DISTRIBUTION AND CONSERVATION OF REDUCED

P METABOLISM OPERONS IN BACTERIA

______

A Thesis

Presented

to the Faculty of

California State University, Chico

______

In Partial Fulfillment

of the Requirements for the Degree

Master’s of Science

in

Biological Sciences

______

by

Betsey Renfro

Fall 2012

ACKNOWLEDGEMENTS

The completion of this thesis concludes a decade long quest for a

Master of Science degree in Biology. I would never have attained this degree

without encouragement and support of numerous faculty. I would like to than Dr.

Ailsie McEnteggart and Dr. Jeff Bell, past and present Chairs of the Biology

Department, for allowing me the release time required from the media lab to

complete the course work for this degree. Than you Dr. Kris Blee, Dr. Larry

Hanne, and Dr. Patricia Edelmann, for your help with experimental design, troubleshooting, data analysis and for your encouraging words. Special thanks to

Dr. Jeff Bell, who was so generous with his time and helped me with this project

in more ways than I can enumerate. The biggest thanks however, must go to my

advisor, co-worker and dear friend Dr. Andrea White. I have learned so much under your guidance. You were the perfect advisor for me, and I appreciate your

support more than you will ever know. Finally, I would like to thank my family,

especially my husband James and my children, Zach, Lauren and Michael. You

guys always believed in me, and I love you so much. A huge thanks you to my

parents, Craig and Susie Hawes, for all of your help with the kids and your

willingness to act as a taxi service while I was busy pursuing my dream. This

work was funded by the Office of Research and Sponsored Programs at

California State University, Chico.

iii TABLE OF CONTENTS

PAGE

Acknowledgements ...... iii

List of Tables ...... vi

List of Figures...... vii

Nomenclature ...... ix

Abstract ...... x

CHAPTER

I. Introduction ...... 1

Questions...... 23

II. Methods ...... 26

Pseudomonas stutzeri WM88 Chromosomal Library Construction...... 26 Selection of Hpt+ and Pt+ Library Clones ...... 27 Restriction Analysis of Cosmid Clones...... 28 Database Mining for Hypophosphite, Phosphite and Phosphonate Oxidation Operons...... 28

III. Results ...... 31

Reduced P Oxidation Pathways in Pseudomonas putida...... 31 Distribution and Conservation of Hypophosphite Oxidation Pathways ...... 36 Distribution of Phosphite Oxidation Pathways...... 44 Conservation of Phosphite Oxidation Pathways...... 47 Distribution of C-P Lyase Operons...... 52 Conservation of C-P Lyase Operons...... 55

iv CHAPTER PAGE

IV. Discussion...... 65

Overview ...... 24

References ...... 77

Appendix

A. Reduced Oxidizing Bacteria Identified in this Study...... 85

v LIST OF TABLES

TABLE PAGE

1. Commercial Products Containing Phosphate that are Marketed as Fungicides and Fertilizers ...... 9

2. Substrate Ranges Cosmid Clones in Glucose Mops minimal media +100 ug/ml Carbenicillin + 0.5mM Phosphorus source after 36 Hours of growth...... 32

3. Primers and expected product size for amplified htxA and ptxD products ...... 35

4. Function of Pseudomonas stutzeri WM88 Phn and Htx Orthologues of the C-P Lyase Operons...... 56

5. Reduced P Oxidation Genes in bacteria with htx Encoded C-P Lyase Operons

vi LIST OF FIGURES

FIGURE PAGE

1. Diagram Depicting the Traditional P Cycle...... 3

2. Chemical Structure and Oxidation State of Common Organic and Inorganic Phosphorus Compounds ...... 6

3. Pathways for the Microbial Metabolism of Phosphonates...... 11

4. Model for the Degradation of Methylphosphonate Via the C-P Lyase Pathway ...... 12

5. Biochemical Pathway for the Oxidation of Hypophosphite and Phosphite ...... 17

6. Arrangement of Genes Involved In Catalysis of Hypophosphite, Phosphite and Phosphonates in Diverse Bacterial Species ...... 19

7. Pseudomonas Putida AW2 Phosphite Oxidation Pathway ...... 33

8. Growth of wild type P. putida AW2, E. coli Epi T100 +pBR20 and wild type E ...... 34

9. Phylogenetic Tree of the HtxA Hypophosphite-2-Oxoglutarate Dioxygenase Catalytic Protein...... 38

10. Gene Organization and Protein Similarity of Phosphite Oxidation Pathways Indicate Recent Horizontal Gene Transfer...... 39

11. Comparison of the htx and phn Encoded C-P Lyase Pathways in Pseudomonas stutzeri WM88 with the htx Encoded C-P Lyase Pathway in Pseudomonas aeruginosa PADK-CF510 ...... 41

12. Structure of Two Potential Hypophosphite Oxidation Pathways in Bradyrhizobium BTAi1 and Their Similarity to Hypophophite Oxidation Clusters in Xanthobacter flavis and Alcaligenes faecalis ...... 43

13. Bacteria with Phosphite Oxidation Enzymes are Found in Chemically and Physically Diverse Environments ...... 45 vii FIGURE PAGE

14. Schematic of Common Arrangements of the ptx Operon and Surrounding Genes in Bacteria...... 48

15. Phylogenetic Tree of the NAD-Dependent Phosphite Dehydrogenase Enzyme PtxD ...... 51

16. Maximum Likelihood Tree of Catalytic C-P Lyase Protein PhnJ and HtxH with 100 Bootstrap Replicates ...... 58

17. The distribution of the organisms into two separate clades indicates separate evolution of the Phn and Htx proteins...... 59

18. Maximum Likelihood Tree of Catalytic Proteins PhnM and HtxL with 100 Bootstrap Replicates ...... 60

viii NOMENCLATURE

P Phosphorus or any compound containing phosphorus

Pi Inorganic phosphate. Inorganic reduced phosphorus compound (+5 oxidation state)

Hpt Hypophosphite. Inorganic reduced phosphorus compound (+1 oxidation state)

Pt Phosphite Inorganic reduced phosphorus compound (+3 oxidation state)

AePn Aminoethylphosphonate. Organic reduced phosphorus compound (+3 oxidation state)

PH3 Phosphine gas. (-3 oxidation state) htxA Gene encoding 2-oxoglutarate-dependent hypophosphite dioxygenase, which is the enzyme that catalyzes the oxidation of hypophosphite to phosphite. ptxD Gene encoding a NAD-dependent phosphite dehydrogenase, which is the enzyme that catalyzes the oxidation of phosphite to phosphate.

HGT Horizontal gene transfer.PET—photosynthetic electron transport

ix ABSTRACT

DISTRIBUTION AND CONSERVATION OF REDUCED

P METABOLISM OPERONS IN BACTERIA

by

Betsey Renfro

Master of Science in Biological Sciences

California State University, Chico

Fall 2012

P has long been considered a biologically inert yet essential element to all living organisms. However, our understanding of how P compounds are converted and made available for growth in the environment is greatly lacking.

This deficit in our knowledge of P metabolism in an environmental context is highlighted by recent studies demonstrating that common soil bacteria are capable of oxidizing and reducing P compounds, thus altering P bioavailability in the environment. Understanding the interactions between these reduced P compounds and microbial populations is crucial to our understanding of P nutrient availability and management in the environment. These deficits in our knowledge led to our desire to identify novel reduce P oxidation pathways.

Towards this end, DNA sequencing and analysis of the phosphite oxidation pathway in Pseudomonas putida AW2 were completed. The similarity of this

x pathway to previously characterized ptx operons suggested recent horizontal gene transfer. The industrial use of hypophosphite and phosphite is likely leading to increased concentrations of these compounds in the environment. Database mining was used to look for further evidence of horizontal gene transfer of these operons, which would suggest that bacteria are adapting to these environmental changes. Sixty-four organisms were identified that harbor genes allowing the oxidation of hypophosphite, phosphite or both compounds. Recent horizontal gene transfer was evident in both of these pathways. HtxA was 100 percent conserved in four of the five bacteria identified as having HtxA. Seven examples of recent cross genus horizontal gene transfer of PtxD were identified. ptxD was found in association with heavy metal detoxification genes in several organisms, suggesting that it may play a role in the detoxification of phosphite in the environment. Finally, the divergent evolution of two distinct lineages C-P lyase operon, designated phn and htx were demonstrated. These findings indicate that reduced P compounds have been, and are currently important sources of P in the environment, and that diverse bacterial species play an essential role in the bioavailability of P.

xi CHAPTER I

INTRODUCTION

P has long been considered a biologically inert yet essential element to

all living organisms. However, our understanding of how P compounds are

converted and made available for growth in the environment is greatly lacking.

This deficit in our knowledge of P metabolism in an environmental context is

highlighted by recent studies demonstrating that common soil bacteria are

capable of oxidizing and reducing P compounds, thus altering P bioavailability in the environment. Yet we know very little about which bacteria can do this, how common they are, how they do it and how important these conversions are in changing P flux. As a result, our ability to effectively restore and manage ecosystems, to develop effective and efficient agricultural practices, which rely heavily on P supplementation, and to take advantage of bacterial mediated P cycling, is not possible. Furthermore, more recent industrial and agricultural use of reduced P compounds has undoubtedly resulted in their increased concentrations in the environment. These human activities have resulted in profound impacts on the environment, yet we understand very little of how this has altered P flux and bioavailability in diverse ecosystems. This is in part due to our very limited understanding of how reduced P compounds are altered by environmental microorganisms, and how native populations of microorganisms

1 2

are altered due to the presence of these compounds. It is clear that bacteria have

evolved mechanisms for adapting to environmental changes, one of which is the

ability to transfer genetic traits to other bacteria via horizontal gene transfer.

Evidence for recent horizontal gene transfer of reduced P oxidation genes among

bacteria strongly suggests that the P profile in the environment may indeed be

changing, likely as a result of human activity. Understanding the interactions

between these reduced P compounds and microbial populations is crucial to our

understanding of P nutrient availability and management in the environment. In this project the distribution of reduced P compound oxidation pathways among bacteria is explored, as is the spread of these pathways among diverse microbes due to increased concentrations of environmental reduced P compounds.

Phosphorus is an essential nutrient required for a diverse set of cellular processes. It is a structural component of nucleic acids and cell membranes; it is

part of the primary molecules utilized in energy transfer within cells, such as ATP

and GTP; and it is used to regulate the activation state of numerous enzymes via phosphorylation. The primary form of P utilized by cells is inorganic phosphate,

Pi (+5 oxidation state), and the biological cycling of P is believed to be done by the inter-conversion of phosphate to phosphate esters and anhydrides (+5 oxidation state), during which no change in oxidation state occurs (Fig. 1). While

these reactions are critical to all organisms, Pi is often a limiting nutrient in the

environment, and it has long been accepted that P does not undergo

biogeochemical redox cycling like other essential nutrients such as C, N and S

(2).

Incorporated into Animals Plant tissue

Rock weathering

Fungal and bacterial decomposition (Phosphate and Phosphate-esters, P oxidation = +5)

Inorganic phosphates in soil and solution

Precipitated phosphates

FIG. 1. Diagram depicting the traditional P cycle. In the traditional P cycle, the role of bacteria is limited to decomposition of organic matter, while the inter-conversion of P is between inorganic P and P esters, resulting in no change in oxidation state. 3

4

Despite this belief, abundant evidence exists which supports the existence of microbial redox cycling of P, including both the production and oxidation of reduced P compounds (compounds in which P is in a lower oxidation state than that found in Pi) by microbes and eukaryotes. Studies have shown that numerous reduced P compounds are found in the environment. For example, a wide variety of invertebrates synthesize natural organic reduced P compounds in the form of phosphonates (+3) and phosphinates (+1). These compounds are characterized by a direct carbon-phosphorus (C-P) bond that is resistant to chemical and enzymatic hydrolysis, in contrast to the more common C-O-P bond of phosphate esters (67, 75)

Aminoethylphosphonate (AEPn) and phosphonoalanine are examples of biologically important phosphonates that serve as structural molecules in certain invertebrates. Both AEPn and phosphoalanine can be found as side groups in glycoproteins and polysaccharides, or as the head group of phosphonolipids in cell membranes (17). In some invertebrates, phosphonates can account for approximately 50% of the total cellular P (55, 56, 70). The marine diazotroph, Tetrahymena, may have up to 30% of its membrane lipids in the form of phosphonolipis, and it has recently been demonstrated that phosphonates comprise approximately 10% of the total P in the marine cyanobacterium

Trichodesmium erythareum IMS101 (9, 28). Furthermore, phosphonates have been shown to represent up to 25% of the dissolved organic phosphorus in all investigated marine environments and are preferentially removed from sinking

5

particles relative to phosphate esters, suggesting that phosphonates are a

preferred form of P for some organisms (5, 31).

Many other naturally occurring phosphonates and phosphinates are

produced by common soil microbes (48). A wide range of compounds, the

majority of which possess antibiotic properties, are produced by Actinobacteria.

For example, members of the genus Streptomyces produce a plethora of

phosphonate and phosphinate compounds including phosphonothrixin tripeptide,

phosphonthrixin, and fosfomycin, all of which have clinical and commercial

applications.

In addition to these natural sources, numerous synthetic organic

reduced P compounds are manufactured and introduced into the environment

each year. Two examples are the herbicides glyphosate and Round Up (active

ingredient is glyphosate) which are used extensively both agriculturally to

improve crop yields and by home and garden and garden consumers. In 2007 it

was estimated that between 95 to125 million pounds of the herbicide Round Up

were applied. Currently, there are over 750 products for sale in the United States

that contain glyphosate (69).

Inorganic P compounds, including phosphine (-3), hypophosphite (+1)

and phosphite (+3), whose structures are depicted in Fig. 2, also occur naturally.

Phosphine is a toxic gas that has been detected in the atmosphere and in nearly

every anaerobic environment, including marine sediments, anaerobic sewage digestion tanks and even in the head space of anaerobic bacterial

6

FIG. 2. Chemical structure and oxidation state of common organic and inorganic phosphorus compounds. Source: Reprinted by permission from Andrea White, Department of Biological Sciences. Assistant Professor at California State University, Chico, California.

7

cultures (10, 13, 25, 50, 51, 60). In sewage treatment plants, significant P loss

between ingoing and outgoing waste was demonstrated to be up to 45%. It was

suggested that this loss might be due to the production of volatile phosphine gas

(7). Phosphine production has also been demonstrated in the gastrointestinal

tract of mammals, where it is thought to play a role in the development of

stomach cancers (13). Additional studies have shown the reduction of phosphate

in wetland soils, common soils and during metal corrosion under anaerobic

conditions (23, 68, 73). Together, these reports suggest that P reduction occurs

in nature, and it is suspected that microorganisms play a major role, albeit an

unclear one, in these processes.

Phosphine is important commercially as it is used extensively as a

chemical fumigant in grain storage vessels. The treatment of these vessels

involves filling them with phosphine gas, then venting it directly into the

atmosphere. This process likely results in large quantities of phosphine being

introduced into areas of the environment where it would not normally occur.

Phosphine is spontaneously oxidized to phosphate when exposed to oxygen,

presumably through hypophosphite and phosphite intermediates, although this

has not been definitively demonstrated. However, two studies support that this is

indeed occurring. The first study found Hpt and Pt were products of phosphine

oxidation (59) and the second demonstrated that 40 days after phosphine

treatment 70% of the phosphine had oxidized to Pi, while the remaining 30% is presumably present in the environment as Hpt and/or Pt (18). As a result, these

8 inorganic reduced P compounds are present in areas where phosphine is being produced or used commercially. Additional sources of environmental hypophosphite arise from its use in metal plating applications, and the black market usage of hypophosphite as a methamphetamine precursor.

Phosphite is more abundant in the environment than Hpt due to broader commercial usage. Phosphite is used extensively as an alternative P source in fertilizers and as an anti-fungal agent (Table 1) (36). It is also the only accepted treatment for Sudden Oak Death, which is caused by the fungal pathogen, Phytophthora ramorum, and has decimated oak groves throughout

Northern California. The treatment of this disease involves spraying phosphite directly onto the trunks of shrubs and trees until the point of runoff, resulting in significant amounts of phosphite being added to the environment (30).

While there is indirect evidence of reduced P compounds in the environment, the actual concentrations in complex environments such as soil have not been measured. However, ion chromatography has been used to detect hypophosphite and phosphite in simulated geothermal waters (39), and more recently, phosphite has been detected in naturally occurring geothermal pools at a concentration of ~0.06 μM using suppressed-ion chromatography coupled with tandem conductivity and electrospray mass spectrometry (53).

Given that reduced P compounds occur naturally in the environment and are introduced through human activities, it is not surprising that many bacteria possess the ability to metabolize these compounds. Microbial

TABLE 1. Commercial products containing phosphate that are marketed as fungicides and fertilizers Product Company Active Ingredient Marketed as Fosetyl-Al (Aluminum Aliette Bayer Cropscience phosphite) Fungicide Nutri-Phite Biagro Western Sales Phosphites & Organic acids Fertilizer Ele-Max Helena Chemical Phosphorus acid Fertilizer ProPhyt Luxembourg-pamol Monopotassium Phosphite Fungicide Nutrol Lidochem Potassium phosphite Fungicide and Fertilizer Phostrol NuFarm America Phosphorus acid Pesticide Agrifos Liquid Fert Pty (Agrichem) Monopotassium Phosphite Fungicide Foli-r-fos 400 UiM Agrochemicals Monopotassium Phosphite Fungicide Fosphite Jh Biotech Monopotassium Phosphite Fungicide Lexx-a-phos Foliar Nutrients Inc Monopotassium Phosphite Fungicide Trafos line Tradecorp Potassium phosphite Fertilizer & defense stimulator Phytos'K Valagro Potassium phosphite Biostiumulant Phosfik line Biolchim Phosphorus acid Fertilizer Fosfisan, Vigorsan Agrofill Potassium phosphite Fertilizer & defense stimulator Geros-K L-Gobbi Potassium phosphite Fertilizer Kalium Plus Lebosol Potassium phosphite Fertilizer Frutogard Spiess Urania Potassium phosphite Fertilizer Foliaphos Plantin Potassium phosphite Fertilizer

Source: Courtesy of Leymonie, Jean-Pierre. 2007. Phosphites and phoshates: When distributors and growers alike get get confused!! UK Representative Office. The New Ag International Sarl. September edition. 9

10 catabolism of reduced organic P compounds for use as a P and/or C source has been the most extensively studied and appears to be quite common among environmental bacteria. Four well-characterized pathways for phosphophonate catabolism have been described: A) C-P lyase, B) phosphonopyruvate hydrolase, C) phosphonoacetate hydrolase, and D) phosphonoacetaldehyde hydrolase (phosphonatase) (Fig. 3).

The C-P lyase pathway encodes proteins that cleave the direct C-P bond, yielding Pi and a corresponding hydrocarbon. In E. coli, the C-P lyase pathway is encoded by a fourteen-gene operon designated phnCDEFGHIJKLMNOP, and exhibits broad substrate specificity, allowing oxidation of compounds such as phenylphosphonate, methylphosphonate and aminoethyl phosphonate. In E. coli, it also allows oxidation of phosphite.

Although the enzymatic mechanism of the C-P lyase pathway has not been fully characterized, (26) in vitro reproduction of activity and identification of reaction intermediates of some of the enzymatic subunits in E. coli have been reported

(27). It is believed that phnCDE encode ABC type transporters, phnF encodes a repressor and phnNOP encode proteins with regulatory or accessory function

(20, 21, 46, 72) and the role of phnK is unknown (27). The catalytic subunits are encoded by phnGHIJKLM. It has recently been demonstrated that PhnJ catalyzes the core reaction, the S-adenosyl-L-methionine-dependent radical cleavage of 5-phosphoribosyl-1-phosphate yielding 5-phosphoribosyl-1,2-cyclic phosphate and the corresponding alkane (Fig. 4) (20, 26, 27). Several

11

FIG. 3. Pathways for the microbial metabolism of phosphonates: A) C-P lyase pathways (3), B) 2-AEP catabolism by 2-AEP transaminase (4) and phosphonoacetaldehyde hydrolase (5), C) Phosphonoacetate catabolism by phosphonoacetate hydrolase (6), D) 2-AEP catabolism by 2-AEP transaminase (4), phosphonoacetaldehyde dehydrogenase (7) and phosphonoacetate hydrolase (6). Source: Adapted from Villarreal-Chiu J. F., J. P. Quinn, and J. W. McGrath. 2012. The genes and enzymes of phosphonate metabolism by bacteria, and their distribution in the marine environment. Front. Microbiol. 3:19.

FIG. 4. Model for the degradation of methylphosphonate via the C-P lyase pathway. Proteins PhnI, PhnG, PhnH, PhnL, PhnM and PhnJ are required. PhnJ catalyzes the core reaction, the S-adenosyl-L methionine- dependent radical cleavage of 5-phosphoribosyl-1-phosphate yielding 5-phosphoribosyl-1,2-cyclic phosphate and methane. Source: Reprinted by permission from Macmillan Publishers Ltd: [NATURE], Kamat S. S., H. J. Williams, and F. M. Raushel. Intermediates in the transformation of phosphonates to phosphate by bacteria. Nature 480:570–573. 2011. doi:10.1038/nature10622

12

13 variations of this operon with different substrate ranges have been described in numerous environmental bacteria (22, 77).

All C-P lyase pathways described to date, including those of E. coli,

Pseudomonas stutzeri, and T. erythreaum, are regulated as part of the Pho regulon in response to phosphorus starvation and are therefore known as phosphate starvation inducible (psi) genes (45, 57, 71, 76). In E. coli, psi genes are regulated by the two component regulatory system PhoBR. PhoR is a sensor histidine kinase and PhoB is a response regulator that becomes activated under

Pi limiting conditions. When inorganic phosphate levels are high, phosphate is transported into bacterial cells via low affinity inorganic phosphate transporters.

Once environmental phosphate becomes limiting, phosphate specific transporters, which consist of a high affinity periplasmic phosphate binding protein, two transmembrane transporter subunits and an ATPase, collectively known as PST-SCAB, are activated. Upon activation of the transporters, PhoU, a putative repressor protein dissociates from the PST-SCAB transporter complex.

This signal induces autophosphorylation of PhoR using ATP. PhoR then transfers its phosphoryl group to PhoB, activating it. PhoB-P binds the promoter regions of multiple genes, resulting in a global change in gene expression. P starvation induces the synthesis of proteins involved in Pi scavenging and utilization of alternative P sources up to 1500 fold, indicating the importance of these processes to bacterial cell survival.

14

Two other C-P degrading enzymes, phosphonopyruvate hydrolase and phosphonoacetate hydrolase are activated by the presence of their substrates, rather than by limiting phosphate, which suggests that the physiological role of these enzymes is to provide carbon, not phosphate. Phosphonopyruvate hydrolase cleaves the direct C-P bond of this compound to yield Pi and pyruvate

((66, 69) while phophonoacetate hydrolase (41, 70), yields Pi and acetate.

The regulation of phosphonoacetaldehyde hydrolase is organism specific: in some cases, it is activated by the presence of its substrate, and in others it is regulated via the Pho regulon. The end products of the phosphonoacetaldehyde hydrolase reaction are acetaldehyde and Pi , although this reaction occurs in two steps (8, 33, 70). First, phosphonoacetaldehyde hydrolase, encoded by phnX, catalyzes the transamination of aminoethylphosphonate using pyruvate as an amino acceptor yielding 2- phosphonoacetaldehyde and alanine. Next, the phnW gene product, phosphonatase, hydrolyzes 2-phosphonoacetaldehyde to acetaldehyde and Pi.

Recently, phnA, which encodes phosphonoacetate hydrolase, has been found in an operon with phnW, which encodes a 2-AEP:pyruvate aminotransferase, and a gene encoding a novel NAD-dependent phosphonoacetaldehyde dehydrogenase, designated PhnY. Together these enzymes degrade phosphonates to phosphonoacetate (3, 29). Thus, this pathway comprises a biogenic route for phosphonoacetate production (6, 70).

15

In addition to the four well-characterized pathways described above, several novel pathways allowing C-P bond cleavage have been recently described: two proteins, a novel 2-oxoglutarate dioxygenase designated PhnY*

(it is a different protein then the PhnY described above) and a phosphonohydrolase designated PhnZ, isolated from a genomic fragment of the marine cyanobacteria Proclorococcus marinus were reported to confer AEPn utilization to E. coli via heterologous expression (37, 38), a Sinorhizobium haukuii isolate that can utilize the phosphonate antibiotic fosfomycin as a sole C and P source (40, 42, 43), Mendez, et al. (44), and Ford, et al. (11) report Pi independent phenylphosphonate degradation in Campylobacter and Helicobacter sp., while Gomez-Garcia, et al. (15) have reported previously uncharacterized Pn catabolism by Synechooccus sp. The existence of several distinct pathways that allow phosphonate utilization by bacteria, indicates the importance of phosphonate compounds to bacteria. The recent discovery of several novel pathways suggests that there may be additional pathways that are yet to be discovered, and that our knowledge of reduced P metabolism remains incomplete.

Several pathways allowing utilization of inorganic reduced P compounds such as Hpt and Pt, have also been described. A hypophosphite oxidase that requires NAD and a respiratory chain component for activity was identified in Bacillus caldolyticus (16), and another Bacillus strain that is able to grow anaerobically using Hpt as a sole P source (12) has been described.

16

However, the mechanism allowing these activities was not determined. The first fully characterized enzyme that confers utilization of Hpt as a sole P source is a hypophosphite-2-oxoglutarate dioxygenase, encoded by htxA. This enzyme catalyzes the oxidation of hypophosphite to phosphite concomitant with the decarboxylation of 2-oxoglutarate yielding succinate and CO2, in a ferrous ion

and oxygen dependent manner as described in Fig. 5. HtxA was first identified in

Pseudomonas stutzeri WM88 and was shown to be a member of the Pho regulon

(47, 76, 77). A putative hypophosphite dehydrogenase, encoded by htxXY, which

is homologous to soluble NAD-dependent formate dehydrogenases was

identified in Xanthobacter flavus WM2814, but attempts to fully characterize the

enzymes were unsuccessful (79).

The two known mechanisms for oxidizing Pt to Pi are carried out by the

enzymes bacterial alkaline phosphatase (BAP) encoded by phoA and a NAD

dependent phosphite oxidoreductase encoded by ptxD. Although BAP has only

been shown to oxidize Pt in E.coli, (80) PtxD mediated Pt oxidation has been

demonstrated in a variety of organisms including P. stutzeri, A. faecalis, X.

flavus, Desulftignum phosphitoxidans and Prochlorococcus marinus 9301 (38,

61, 75, 79, 80).

In Pseudomonas stutzeri, hypophosphite is oxidized to phosphate

through a phosphite intermediate and the genes encoding these functions are

found in two discreet loci designated htx (for hypophosphite oxidation), and ptx,

(for phosphite oxidation). The htx locus is comprised of genes htxA-N, which form

FIG. 5. Biochemical pathway for the oxidation of hypophosphite and phosphite by the enzymes hypophosphite 2-oxoglutarate dioxygenase (HtxA) and the NAD-dependent phosphite oxidoreductase (PtxD) in Pseudomonas stutzeri WM88. Source: Reprinted by permission from Andrea White, Department of Biological Sciences. Assistant Professor at California State University, Chico, California.

17

18 a single transcriptional unit (47, 77). As described previously, htxA encodes a hypophosphite 2-oxoglutarate dioxygenase that catalyzes the oxidation of hypophosphite to phosphite. The genes htxB-E encode an ABC transporter that is believed to function as a transporter of both hypophosphite and phosphonates.

The genes htxF-L encode catalytic proteins for the metabolism of phosphonates via the C-P lyase pathway, and htxMN encode proteins with unknown function

(47, 77). Therefore, in this organism, the htx operon encodes pathways for the oxidation of both hypophosphite to phosphite (catalyzed by HtxA) and phosphonates to phosphate (catalyzed by C-P lyase, encoded by htxF-L).

Pseudomonas stutzeri also has a second complete chromosomal copy of a C-P lyase operon similar to the phn operon in E. coli that confers the ability to oxidize phosphonates, but not hypophosphite (77).

The phosphite oxidation pathway in Pseudomonas stutzeri consists of a five-gene operon designated ptxABCDE (47, 77). The genes ptxABC encode an ABC-type phosphite transporter, ptxD encodes a phosphite dehydrogenase, and ptxE encodes a putative LysR type regulatory protein (47, 77).

Since the discovery and characterization of Hpt oxidation in P. stutzeri

WM88, the genetic pathways for Hpt and Pt oxidation in several other bacterial species with this ability have been identified, and these arrangements are depicted in Fig. 6. Alcaligenes faecalis possesses one operon that encodes genes similar to those of P. stutzeri, designated htxABCDptxDE, which allows for the transport and oxidation of hypophosphite to phosphate (80). In Xanthobacter

19

FIG. 6. Arrangement of genes involved in catalysis of hypophosphite, phosphite and phosphonates in diverse bacterial species. Source: Reprinted by permission from Andrea White, Department of Biological Sciences. Assistant Professor at California State University, Chico, California. flavus, the hypophosphite and phosphite oxidation genes are separated on the chromosome and are divergently transcribed (79). The phosphite oxidation pathway in Proclorococcus marinus MIT9301 consists of the genes ptxABCD but the putative transcriptional regulator ptxE is absent (38). Finally, in the strictly anaerobic marine organism Desulfotignum phosphitoxidans, phosphite oxidation

20 genes ptxED, which are orthologs to those previously described in P. stutzeri

WM88, are found in conjunction with genes designated ptdFCDHI. The ptd locus encodes genes believed to be involved in anaerobic respiration using phosphite as an electron donor and sulfate as a terminal electron acceptor (63). The fact that in this organism Pt plays a role in energy metabolism as well as P acquisition implies that phosphite is abundant in its natural environment and likely composes a major fraction of P available in anaerobic marine environments.

Until recently, the abundance of bacteria capable of utilizing reduced P compounds in natural environments had not been investigated. Stone and White

(65) used Most Probable Number analysis to quantify the number of reduced phosphorus oxidizing bacteria in twelve common aquatic and terrestrial environments. Each site was sampled and bacteria were cultured with Pi, Hpt, Pt or AEpn as a sole P source. This study demonstrated that reduced P oxidizing bacteria are common and easily isolated from natural environments. Bacteria capable of utilizing Pi and AEpn as a sole P source were equally abundant

(1x106 per gram of sample) while the concentrations of Hpt and Pt oxidizers were

lower (1x105 per gram of sample), but still significant (65).

Previously it was observed that the hypophosphite oxidation genes

htxABCD of A. faecalis WM2072 and P. stutzeri WM88 share 99.5% identity, with

only 22 nucleotide changes in a 4.2 kbp region (80). This high nucleotide identity

strongly suggests horizontal gene transfer of these genes. Horizontal gene

transfer (HGT), which is the exchange of genes between bacterial species, as

21 opposed to the vertical inheritance of genetic material, is a primary process driving bacterial evolution.

HGT results in the rapid transfer of genes, allowing bacteria to exploit new ecological niches. Three distinct processes are necessary for successful horizontal gene transfer. DNA must first be transferred into the cytoplasm of the recipient bacterium through either conjugation, mediated by a plasmid, transduction by a bacteriophage or transformation, which involves uptake of exogenous DNA from the environment. Once the DNA is in the cytoplasm, it must be either be integrated into the host chromosome or be on a replicative plasmid in order to be maintained. Integration into the host genome can occur through homologous recombination, but is more likely mediated by transposases, integrases, or site-specific recombinases. Finally, following integration into the genome, there must be a selective pressure for maintaining the newly acquired genes (35).

Numerous studies have shown that mutational bias leads to a reduction in genome size that increases fitness and that within bacterial species the size of the genome is limited (4, 32, 78). Therefore, it follows that genes acquired through horizontal gene transfer will be quickly lost, if they do not confer an advantage to the host. An example of genes encoding a metabolic pathway that has been spread via horizontal gene transfer are the genes of the C-P lyase pathway.

22

Previous studies have demonstrated that the C-P lyase operon has a long evolutionary history encompassing both vertical and horizontal gene transfer

(22, 72). The dissemination and maintenance of this operon among bacterial species strongly suggests that the ability to metabolize phosphonates confers a selective advantage to bacteria in the natural environment. Evidence of recent horizontal gene transfer of other reduced P oxidation operons would suggest that the importance of these compounds as a source of P to bacteria is increasing, possibly in response to increased amounts of these compounds in the environment as a result of human activities.

The diversity of pathways so far characterized in only a handful of organisms, coupled with high concentrations of bacteria capable of utilizing reduced P in natural environments, suggests that oxidation of reduced P compounds is not a unique ability limited to relatively few organisms. Additionally, the abundance of reduced P compounds that occur naturally and the introduction of these compounds to the environment via human activities indicate that reduced P compounds may be an important source of P in the environment.

Furthermore, the regulation of reduced P oxidation pathways via phoBR in response to Pi starvation, indicates that possessing these pathways would confer a competitive advantage to environmental bacteria when Pi is limiting. Therefore, understanding the mechanisms of bacterial mediated redox cycling of P in the environment may elucidate novel mechanism of P flux, which could have profound agricultural and ecological implications. This is particularly important for

23

Hpt and Pt utilization, which only a handful of bacteria have been shown to have the ability to utilize.

In order to fully understand the mechanisms of environmental P flux, it is crucial to identify the mechanisms by which P is transformed and moved through the environment by microorganisms. This requires a thorough understanding of the roles that both reduced P compounds and the bacteria that oxidize them play in the environment. To this end, it is essential to elucidate the distribution, conservation and genetic transfer of reduced oxidation pathways among bacteria and throughout diverse environments. To determine all possible

P conversion pathways, the P oxidation pathways of more organisms need to be studied. Although the evolution of phosphonate degradation operons and their distribution in the environment have been investigated, there have been no studies that have addressed the evolution of inorganic reduced P metabolism operons or their prevalence in diverse environments. These deficits led to the questions addressed in this study.

Questions

This study will address the following questions:

1. What are the hypophosphite and phosphite oxidation pathways utilized by the bacterium Pseudomonas putida?

A bacterial isolate from the local sewage treatment plant identified as

Pseudomonas putida was chosen for study due to its robust growth on both Hpt and Pt. Sequenced P. putida strains found in public databases did not have any

24 of the previously characterized genes for Hpt and Pt oxidation, suggesting that this organism might possess a unique pathway. Identification and characterization of this pathway would further add to our understanding of bacterial metabolism of reduced P compounds.

2. What is the distribution and conservation of reduced P oxidation pathways in environmental metagenomic samples and sequenced organisms?

The abundance of Hpt and Pt oxidizers, as represented in the public sequence databases, has not been investigated. Mining sequence databases for reduced P oxidation genes could provide a wealth of information regarding the distribution and diversity of these pathways among organisms and across environments, which could not be obtained with culture-based approaches.

Determining the distribution and conservation of reduced P metabolism genes in bacteria and across diverse environments may provide significant insights into the importance of these processes in bacterial metabolism and therefore to higher organisms, and of the prevalence of reduced P compounds in the environment.

3. Is there evidence of recent horizontal gene transfer of reduced P oxidation pathways?

Evidence of horizontal gene transfer and subsequent gene maintenance provides strong support for the importance of particular genes to the organisms in which they are found. Horizontal gene transfer of the htx and ptx pathways has been suggested by the similarities in gene arrangement and

25 identity among the three bacterial species that have been characterized. Mining the sequence databases for additional, highly similar pathways may provide crucial insights into the evolution and transfer of these genes among bacteria, thus providing a greater understanding of their evolutionary history and current importance in the environment. Evidence of horizontal gene transfer would also demonstrate bacterial adaptation to environmental changes caused by the recent addition of reduced P compounds in the environment.

CHAPTER II

METHODS

Pseudomonas stutzeri WM88 Chromosomal Library Construction

Pseudomonas putida genomic DNA was isolated using standard DNA isolation and manipulation techniques described in the Stratagene SuperCos 1

Cosmid Vector Kit. The library was constructed using Epicentre pWEB-TNCTM

Cosmid Cloning Kit following manufacturer’s recommendations with the following modifications: 1) DNA was precipitated following gel purification and resuspended in 25ul TE, and this concentrated DNA was used in the ligation reaction; 2) the packaging reaction was not diluted in phage buffer prior to mixing with E. coli EPI100-T1R host cells for transduction.

The Poisson distribution was used to determine the number of clones

needed to be 99% certain that the entire P. putida genome was represented in

our library. The Poisson distribution formula is as follows: N = ln(1-P)/ln(1-F)

where P is the desired probability, f is the proportion of the genome contained in

a single clone, and N is the desired number of cosmid clones. The P. putida

genome is 6.18 x 106 bases, and each cosmid clone should have an insert of 3.8

x 104 bases, so 746 clones were required in the primary library to be 99% certain that the entire P. putida genome is represented.

26 27

E. coli EPI100 –T1R clones harboring P. putida insert DNA were

selected on LB + 50 ug/ml Carbenicillin (Agilent Technologies, Stratagene

Product Division, 2008). Wild Type P. putida, which is naturally resistant to

Carbenicillin and wild type E. coli EPI100 –T1R , which is Carbenicillin sensitive,

were also plated on LB + 50 ug/ml Carbenicillin as positive and negative controls, respectively. The primary library was pooled in 1X “M” buffer (40mM 3-(N-

morpholino)propanesulfonic (MOPS) based) and vortexed. Aliquots of library

suspensions were frozen in 50% glycerol and stored at -80C. One aliquot was

left unfrozen and 10 fold dilutions from 10-3 to 10-9 were plated on 0.2% Glucose

MOPS minimal media supplemented with 100 ug/ml leucine , 10 ug/ml thiamine,

50 ug/ml Carbenicillin with 1mM Pi to determine the optimal dilution to use for

future screening on reduced P compounds.

Selection of Hpt+ and Pt+ Library Clones

To isolate clones harboring genes involved in reduced P oxidation, 10

fold dilutions of the library were plated on MOPS minimal media with 50 ug/ml

Carbenicillin and with 1mM Pi, Hpt, Pt or AEPn as a sole P source, and

incubated for 7 days. Colonies of the E. coli host harboring library clones which grew on Hpt, Pt or AEPn were purified, and the substrate range for each was determined by inoculating each clone into MOPS Carbenicillin broth containing

Pi, Hpt, Pt or AEPn. Pi free broth was used as a negative control. Growth in reduced P media was scored at 24, 48 and 36 hours after incubation and was compared to the level of growth for each clone grown in Pi broth.

28

Restriction Analysis of Cosmid Clones

Cosmid DNA was isolated from each reduced P oxidizing clone and digested with the restriction enzymes BamH1 and EcoRV. The banding pattern attained after digestion allowed the determination of the number of unique clones isolated. Fisherbrand 1KB ExactGene Ladder was used as a marker for determining the size of insert DNA. Cosmid DNA from clone pBR20, which was positive for both hpt and pt oxidation, was isolated and submitted to San Diego

State Micro Core Chemical Facility for sequencing. Sequencing was initiated using standard M13 Forward and T7 Reverse Promoter primers. The remainder of the insert was sequenced via internal primers designed from subsequent sequences. Contiguous DNA sequences were assembled using Serial Cloner

2.1, by F.Perez/Serial Basics (54). Genes involved in phosphite oxidation were identified using BlastN algorithm (1).

Database Mining for Hypophosphite, Phosphite and Phosphonate Oxidation Operons

The following methods were used to identify sequenced organisms harboring genes for the oxidation of hypophosphite, phosphite and phosphonates to phosphate: 1) The nucleotide sequence of previously identified genes, htxA, htxX, htxY, ptxD and phnJ, were used to query the Comprehensive Microbial

Resource (http://www.cmr.jcvi.org/) and NCBI (http://www.ncbi.nlm.nih.gov/)

(Nucleotide Collection (nr/nt), and whole-genome shotgun reads (wgs)).

Metagenomic sequences were identified using the same nucleotide sequences to

29 search the NCBI database (Metagenomic sequences (env_nr)); 2) The protein sequence corresponding to the genes referenced above were used to probe the

CMR and NCBI protein databases (Non-redundant protein sequences (nr)).

Once similar genes from sequenced organisms were identified, the corresponding genomic region was examined to determine if the catalytic genes were associated with genes normally found in Reduced P operons, such as transporters and regulatory elements. If an entire putative operon was present, the protein sequences corresponding to the operon genes were collected and used to construct operon maps.

Protein alignments were initially done using ClustalW (34).

Phylogenetic trees were constructed using MEGA5 (66). The MUSCLE algorithm in MEGA5 was used to align the protein sequences. Hyper variable N and C termini were manually trimmed when necessary, so only relatively conserved regions of the proteins were analyzed. Pairwise amino acid identity analysis using a substitution model was used to calculate the p-distance of the alignment and verify its validity, with a p-distance of <0.8 indicating a valid alignment.

Rooted phylogenetic trees were constructed using the Maximum Likelihood method based on the Whelan and Goldman model (74). The bootstrap consensus tree inferred from 100 replicates is taken to represent the evolutionary history of the taxa analyzed (66). Branches corresponding to partitions reproduced in less than 50% bootstrap replicates are collapsed. The percentage

30 of replicate trees in which the associated taxa clustered together in the bootstrap test (100 replicates) is shown next to the branches (66).

CHAPTER III

RESULTS

Reduced P Oxidation Pathways in Pseudomonas putida

A bacterial isolate from the Chico municipal wastewater treatment plant, identified as Pseudomonas putida, was chosen for study due to its robust growth on both Hpt and Pt. No P. putida reduced P oxidizing strains had been identified in public databases, suggesting that this organism might possess a unique pathway.

To determine its genetic pathway, a chromosomal library of

Pseudomonas putida DNA was constructed and expressed in a non-reduced P oxidizing strain of E.coli. The primary genomic library of Pseudomonas putida consisted of ~2200 E. coli clones harboring ~ 36 KB inserts of Pseudomonas putida chromosomal DNA. Nineteen cosmid clones that conferred the ability to grow on reduced P compounds as a sole P source in E. coli were isolated.

Twelve conferred growth on phosphite, one on hypophosphite and six on aminoethylphosphonate, as described in Table2. Restriction digest analysis of the cosmid DNA was performed and the resulting fragment pattern confirmed that 10 of the clones isolated were unique. Cosmid clone pBR20 was selected for further analysis due to the robust growth conferred by it on both Pt and Hpt.

31 32 TABLE 2. Substrate Ranges Cosmid Clones in Glucose Mops minimal media +100 ug/ml Carbenicillin + 0.5mM Phosphorus source after 36 Hours of growth

Clone Hpt Pt AePn BR1b - + - BR3b - + - BR6 - +/- - BR11b - + - BR13 - - + BR14 - - +/- BR15 - - + BR17 - - + BR18 - - + BR20 + + - WT P. putida + + + WT E. coli Epi - - - 100-T1R a A (+) indicates turbidity when grown in reduced P compound is equal to growth in Pi. A (+/-) indicates turbidity was less than Pi and a (-) indicates no turbidity. b Indicates that multiple clones with the same restriction pattern were recovered. Only unique clones were reported.

Interestingly, although the average insert size of the clone library is 35 to 40 KB,

pBR20 has only a 13 KB insert. Sequencing of the pBR20 insert revealed the

presence of a complete ptx operon that is 98% identical at the nucleotide level to the Pseudomonas stutzeri ptx operon. The ptx operon in pBR20 is followed by a transposase, but no known genes capable of conferring Hpt oxidation are

contained in the insert DNA, shown in Fig. 7.

To determine if cosmid pBR20 DNA was sufficient to confer both the

Hpt and Pt oxidation phenotypes observed, pBR20 was transformed into two

different Pt- Hpt- strains of E. coli. In both cases, the transformed E. coli strains gained the ability to oxidize Pt, but not Hpt, although the original E. coli clone harboring pBR20 continued to exhibit robust growth on both Pt and Hpt (Fig. 8).

33

FIG. 7. Pseudomonas putida AW2 phosphite oxidation pathway. Phosphite oxidation genes encoded on cosmid pBR20 are 98% similar to the previously characterized phosphite oxidation pathway in Pseudomonas stutzeri WM88. Yellow arrows represent ABC type phosphite transporters, green arrow represents the catalytic subunit, the blue arrow represents a gene with accessory function, and the pink arrow represents a transposase.

Given the similarity of the ptx operon in P. putida to that of P. stutzeri, we

hypothesized that the gene allowing utilization of Hpt as a sole P source might in

fact be htxA, as found in P stutzeri also. However, no Hpt oxidation genes were

found to be present on pBR20, making it difficult to explain how the original E.

coli host became both Hpt+ and Pt+. One possible explanation is perhaps that

the genes encoding Hpt oxidation in P. putida, likely htxA, had somehow become

incorporated into the E. coli host chromosome. This type of chromosomal

insertion could potentially occur via homologous recombination or transposition.

To determine if the Hpt oxidation gene from P. putida, htxA, had become

integrated into the E. coli host chromosome, BR20 E. coli chromosomal DNA was isolated and primers designed to amplify htxA (Table 3) were used to screen for the presence of the htxA gene by PCR. A DNA fragment of 1 KB in size was produced indicating that the htxA gene is present in the BR20 genome, and not on the cosmid. htxA was also shown to be absent from the chromosome of the non-transduced E.coli host chromosome, thus it appears that the chromosomally

encoded htxA allows Hpt to be oxidized to Pt, while the cosmid encoded ptx

P. Putida AW2 E. coli Epi T100 +pBR20

E. coli Epi T100 Uninoculated control

FIG. 8. Growth of wild type P. putida AW2, E. coli Epi T100 +pBR20 and wild type E. coli EpiT100 on 0.2% glucose Mops + Cb50 +1mM Hpt. Both P. putida (naturally Cb resistant) and E. coli harboring pBR20 can grow on Hpt as sole P source. Sequence analysis shows pBR20 does not harbor Hpt oxidation genes, suggesting that these genes were transferred by an unknown mechanism to the E. coli host. 34

35

TABLE 3. Primers and expected product size for amplified htxA and ptxD products

Expected Product Primer Primer Sequence (5’-3’) Size (nt) htxA Spe1 AAGCTTACTAGTTGATCGAATCAGCATGCC 936 htxA Xba1 GTTTCTAGATCAGTAGTACTTTTGAGTCAAAGC ptxD CCGAGTACACGATGAGATCC 953 GGTTCGCAGCGTTGATTGGG

operon allows oxidation of Pt to Pi, explaining the ability of this clone to grow on both substrates.

By some unknown mechanism, the htxA gene from P. putida became integrated into the E.coli host chromosome. This event most likely took place after the ~40 kb insert was cloned, and the library clone was transduced into the

E.coli host. Because only 35-40kb fragments were used to construct the cosmid library, and the pBR20 clone was only 13kb in size, we hypothesize that a non- replicative transposition event between pBR20 and the E.coli host chromosome occurred, resulting in the transfer of the htxA encoding segment from the cosmid to the chromosome. This is further supported by the presence of a transposase associated with the ptx operon located on the pBR20 cosmid. The observation that such an event likely occurred under standard laboratory conditions suggests that these genes may also be actively undergoing transposition or homologous recombination mediated horizontal gene transfer in the environment. This observation led to the bioinformatics portion of this project, where public databases containing microbial genome sequences were mined to determine the

36

distribution and conservation of reduced P operons and to look for evidence of

recent horizontal gene transfer of reduced P oxidation pathways.

Distribution and Conservation of Hypophosphite Oxidation Pathways

All bacteria identified to date that are oxidizers of inorganic reduced P

compounds belong to the phylogenetic groups Proteobacteria or Cyanobacteria.

To determine whether the genes allowing oxidation of inorganic reduced P

compounds are truly limited to this subset of bacteria, or whether this is an

artifact of the culturing methods used to identify these genes, public sequence

data was mined to determine the distribution and conservation of the

hypophosphite and phosphite oxidation pathways in bacteria. As hypophosphite

and phosphite oxidation genes have been found in association with genes of the

C-P lyase operon, the distribution and conservation of that operon was

investigated as well.

Despite the dearth of Hpt oxidizers in the databases, two different

catalytic pathways have been genetically characterized, one catalyzed by HtxA

and the other by HtxXY. (47, 77, 79, 80). Mining of the public databases revealed

only six bacteria harboring Hpt oxidation genes (Appendix A, Table 1-A), three of

which have been described previously which are P. stutzeri WM88 (HtxA), A.

faecalis WM2072 (HtxA) and X. flavus WM2814 (HtxXY). I identified two additional bacteria with HtxA, Pusillimonas sp. T7-7 and Pseudomonas

aeruginosa PADK CF510. In all of these organisms, HtxA is 100% conserved

37

suggesting that this gene has been recently acquired via horizontal gene transfer, as shown in Fig. 9. One additional organism, Bradyrhizobium sp. BTAi1,

has a distantly related HtxA-like protein as well as a partial htxXY operon.

Interestingly, no htxA or htxXY homologs were found in the metagenomic

databases. Finally, although all six organisms identified are Proteobacteria, they

are distributed evenly among the α, β and γ phylogenetic groups.

Pusillimonas sp. T7-7 encodes a hybrid hypophosphite/phosphite

oxidation pathway that is nearly identical to that of A. faecalis, as shown in Fig.

10. The arrangement of the genes is identical in these two organisms, and the six

proteins in the pathway share between 97 and 100 percent identity, although

Pusillimonas has a short hypothetical protein located in the operon that is not

present in A. faecalis. Interestingly, given the similarity of the operons in these

two organisms, which strongly suggests recent horizontal gene transfer, A.

faecalis is a mesophilic bacterium isolated from a pig lagoon in Illinois while

Pusillimonas sp. T7-7 is an oil-degrading cold-tolerant bacterium isolated from a

petroleum contaminated site in Bohai Sea, China. The differences in these

organism’s natural habitats coupled with distances between the two isolation

sites makes horizontal gene transfer between these two organisms unlikely, as

physical contact is required for bacterial gene exchange. It is therefore likely that

there are numerous intermediate organisms involved in the horizontal gene

transfer of this operon.

Γ-Proteobacteria

β-Proteobacteria

Α-Proteobacteria

FiG. 9. Phylogenetic tree of the HtxA hypophosphite-2-oxoglutarate dioxygenase catalytic protein. Evolutionary history was inferred using Maximum Likelihood analysis with 100 Bootstrap replicates. Bracket indicates horizontal gene transfer. A protein from the 2-oxoglutarate superfamily from Marinobacter sp. was included as an outgroup.

38

39

A P. aeruginosa PADK-CF510 ptx Operon

A BDCE

100 100 100 100 100

A BDC E

P. stutzeri ptx Operon

B

A.faecalis htx/ptx operon

HtxA HtxBHtxC HtxD PtxD PtxE

100 97 99 99 100 100

HtxA HtxBHtxC HtxD PtxD PtxE

Pusillimonas sp. T7-7 htx/ptx operon

FIG. 10. Gene organization and protein similarity of phosphite oxidation pathways indicate recent horizontal gene transfer. Panel A shows the hypophosphite oxidation pathway in Pseudomonas stutzeri and Pseudomonas aeruginosa PADK-CF510 share 100% amino acid identity. Panel B shows the arrangement of genes and protein identities of the htx/ptx encoded hypophophite /phosphite oxidation pathway in Alcaligenes faecalis and Pusillimonas sp. T7-7 is highly conserved. Red arrows indicate htx encoded proteins and green arrows represent ptx encoded proteins. The numbers between the operons indicate percent amino acid identity the proteins share.

40

If so, then hypophosphite oxidation by bacteria is much more common than is currently represented by the small number of identified organisms with these genes, and these genes are more widely distributed and abundant in the environment than their presence in the databases would suggest.

Finally, Pseudomonas aeruginosa PADK-CF510, which was isolated from a cystic fibrosis patient in Finland, was found to have a hybrid hypophosphite/C-P lyase pathway that is almost identical to the pathway in

Pseudomonas stutzeri WM88 (Fig. 11). Ten of the fourteen proteins found in this putative operon share 100 percent identity, while the other proteins are between

70 and 95 percent identical. In P. aeruginosa PADK-CF510 the htxE gene is missing, although in P. stutzeri, htxE encodes an extra and unnecessary transport protein that is not required for utilization of hypophosphite or phosphonates as P sources. Thus, it is not surprising that this gene was not maintained in Pseudomonas aeruginosa PADK-510, and suggests that this operon is likely functional. Although this organism was isolated from the lungs of a cystic fibrosis patient, Pseudomonas aeruginosa is a common soil organism, and likely acquired the phosphite oxidation pathways in its natural environment.

The one organism harboring a different variation of HtxA is

Bradyrhizobium sp. BTAi1. Bradyrhizobium sp. BTAi1 is a photosynthetic, nitrogen fixing bacterium that is a symbiont of the plant Aeschynomene indica and was isolated from that organism. Bradyrhizobium has a gene that encodes a protein that is 44% identical to the functionally characterized HtxA proteins at the

Pseudomonas stutzeri phn encoded C-P Lyase pathway

CDEFGH IJKLMN P

37 16 33 2324 42 53 51 42 36 43 50

Pseudomonas aeruginosa htx encoded hypophosphite oxidation and C-P lyase pathway A BGHIJKLMNCD F

100 100 100 91100 100 100100 70 100 95 100 100

Pseudomonas stutzeri htx encoded hypophosphite oxidation and C-P lyase pathway A BGHIJKLMNCDE F

FIG. 11. Comparison of the htx and phn encoded C-P Lyase pathways in Pseudomonas stutzeri WM88 with the htx encoded C-P lyase pathway in Pseudomonas aeruginosa PADK-CF510. Homologous proteins are indicated by color, and the percent amino acid identity is listed between the operons being compared. The presence of the htxA encoded hypophosphite-2-oxoglutarate dioxygenase protein associated with a phosphonate metabolism operon has previously been described only in Pseudomonas stutzer WM88i. The arrangement of the genes in the Pseudomonas aeruginosa PADK-CF510 htx pathway along with the high amino acid identity shared with the Pseudomonas stutzeri WM88 htx pathway strongly suggests recent horizontal gene transfer. 41

42

amino acid level, but an alignment of the two genes shows that no significant

homology at the nucleotide level exists (Fig. 12). However, the gene encoding the

HtxA-like protein is associated with genes encoding ABC type transporter proteins that share 37 to 45 percent identity to the hypophosphite ABC transporter proteins in

A. faecalis. Furthermore, Bradyrhizobium possess a second locus that is similar to the Hpt oxidation locus in X. flavus. This genomic region consists of genes encoding hypophosphite ABC transporters that share 64 to 79 percent identity to the hypophosphite transporters in X. flavus, and a gene encoding a catalytic subunit that is 58% identical to the HtxY protein. However, there is no gene encoding a protein analogous to the HtxX catalytic subunit that was required for hypophosphite oxidation in X. flavus. These two putative Hpt oxidation operons are separated on the chromosome by six genes, two of which are transposases, and the htxY gene is flanked by an integrase. The presence of the transposases and integrase, whose function in cells is to mobilize DNA creating genetic variation, suggests a mode for horizontal gene transfer of these genes. It is also important to note that the two sets of hypophosphite transporter proteins share only 39 to 43 percent identity to one another, and thus are not a result of a chromosomal duplication. Together, these data suggest that Bradyrhizobium may have acquired these genes through horizontal gene transfer, quite possibly through two different gene transfer events, as these two putative hypophosphite oxidation operons have never before been observed in a single organism. Despite the presence of these putative operons, their divergence from the genes encoding proteins that have been demonstrated to

Bradyrhizobium BTAi1 – Two possible hypophosphite oxidation gene clusters

Y D C B D C B A //

58 64 69 79 45 40 37 40

Y X D C B E D D C B A

Xanthobacter flavus htx operon Alcaligenes faecalis htx/ptx operon

FIG.12. Structure of two potential hypophosphite oxidation pathways in Bradyrhizobium BTAi1 and their similarity to hypophophite oxidation clusters in Xanthobacter flavis and Alcaligenes faecalis. Bradyrhizobium BTAi1 encodes two potential hypophosphite oxidation gene clusters that are separated on the chromosome by ??KB. One gene cluster consists of hypophosphite ABC transporters showing significant similarity to the hypophosphite transporters in X. flavus, as well as a dehydrogenase showing 58% similarity to the X. flavus’ HtxY catalytic subunit. The other potential hypophosphite oxidation cluster consists of an Htx-A like gene, that encodes a protein that is 40% identical to HtxA. This protein is associated with transporters that share between 37 to 45 percent similarity to the hypophosphite ABC transporters in Alcaligenes faecalis. These regions also contain mobile genetic elements such as transposases and an integrase. . Iinterestingly, Bradyrhizobium BTAi1, does not encode any genes that exhibit significant homology with PtxD, however, it does encode a C-P lyase operon, which can confer phosphite oxidation in some organisms. Burgundy arrows represent hypophosphite oxidation genes, green arrows represent phosphite oxidation genes, buff arrows indicate hypothetical genes, blue arrows represent transposases and pink arrows represent integrases.

43

44 catalyze the oxidation of hypophosphite suggests that they may have a different function in Bradyrhizobium.

Distribution of Phosphite Oxidation Pathways

Mining of public databases revealed 61 sequenced bacteria, twelve metagenomic samples and one tree, the black cottonwood Populus trichocarpa, harboring Pt oxidation genes, (See Appendix, Table 2-A). The majority of bacteria belong to the taxonomic groups α, β or γ Proteobacteria, although a ptxD gene sharing only 39 percent identity with the ptxD of Pseudomonas stutzeri was found in one member of the δ Proteobacterium, Desulfotignum phosphitoxidans. In addition, several Cyanobacteria, including marine bacteria belonging to the genus Prochlorococcus, Nodularia, Cyanothece, and

Trichodesmium, contain a PtxD ortholog. Finally, there was one representative from the Actinobacteria, Dietzia cinnamea that was found to posses an enzyme sharing 50% identity with the PtxD from Pseudomonas stutzeri WM88.

Bacteria harboring Pt oxidation genes were isolated from a variety of different environments that varied dramatically in their physical and chemical characteristics as shown in Fig. 13. Many of these bacteria were isolated from humans, oceans, freshwater and soil environments. Interestingly, the environmental sites were frequently described as being contaminated with petroleum products or heavy metals such as arsenic, lead, mercury, copper or iron. For instance, Dietzia cinnamea, the sole Gram-positive bacteria identified to

45

Plant tissue 1% Pig lagoon 3% Unknown Industrial Freshwater 8% 3% 8%

Wastewater 8%

Soil 7% Oceans 21%

Human 24% Oceans (Metagenomic) 17%

FIG. 13. Bacteria with phosphite oxidation enzymes are found in chemically and physically diverse environments. The isolation sites of phosphite oxidizers vary greatly, but the two most common isolation sites were oceans (38%, 27 organisms) and humans (24%, 17 organisms).

date with phosphite oxidation genes, was isolated from a sample of oil- contaminated soil from a tropical forest. In fact, when considering sequenced

46 organisms with known isolation sites that are not of human origin, 41% of the bacteria identified were from these contaminated sites. Wastewater treatment plants were also common isolation sites.

Humans were the second most common isolation sites. Several strains of the human pathogen, Klebsiella pneumoniae, and the opportunistic pathogen

Pseudomonas aeruginosa, were isolated either from patients with pneumonia, or from human feces. In several of the K. pneumoniae strains, the Pt oxidation genes were plasmid encoded and carried antibiotic resistance genes and heavy metal resistance genes in addition to the Pt oxidation clusters.

The variety of environments that harbor phosphite oxidizing bacteria suggest that phosphite oxidation by bacteria is an important activity across diverse environments. It is clear that organisms harboring these genes benefit from their ability to utilize an alternative P source. It may also be possible that phosphite oxidation serves a protective mechanism for the organisms, as studies have shown that high phosphite concentrations are toxic. The large number of bacteria harboring metal resistance genes, or that were isolated from contaminated sites, that are also phosphite oxidizers suggests that in these organisms, phosphite oxidation could be a part of their genetic arsenal protecting them from environmental pollutants. It is also possible that expression of ptxD in these organisms could be regulated via the presence of phosphite, rather than by

Pi starvation, as it was in Pseudomonas stutzeri WM88.

47

One tree, Populus trichocarpa, was identified in the databases as having PtxD, which would allow phosphite oxidation. However, it is unlikely that this tree has acquired ptxD from bacteria via horizontal gene transfer, as the transfer of bacterial genes to higher eukaryotes is not normally observed.

Furthermore, the PtxD identified in Populus trichocarpa is identical to the PtxD proteins found in the bacteria C. metallidurans and D. acidovorans. Therefore, it is more likely that the DNA isolated from Populus trichocarpa that was submitted for sequencing was contaminated with bacterial DNA, resulting in the erroneous identification of a tree harboring PtxD.

Conservation of Phosphite Oxidation Pathways

The arrangements of the Pt transport genes, ptxABC, and the catalytic gene, ptxD, are conserved in all organisms except Desulfotignum phosphitoxidans, as depicted in Fig. 14. However, the position of the gene ptxE, which is a member of the LysR family of transcriptional regulators, was highly variable. In some organisms, ptxE appeared to form part of the ptx operon, in others it is divergently transcribed, and in some it was missing altogether. For example, in Dietzia cinemea, ptxABCD is associated with a phnF encoded Gnt R family regulator, and ptxE is absent. Although phylogenetic analysis suggests that ptxE has an ancient origin and is highly conserved, no function has been assigned to the gene in characterized organisms. It is possible that the bacteria

Nostoc punctiforme Cyanothece sp. Cyanobacteria

Alicycliphilus denitrificans Β-Proteobacteria Nodularia punctiformes Cyanobacteria Methylobacterium extorquens, p2 Α-Proteobacteria

Pseudomonas putida AW1 γ-Proteobacteria

Acidovorax ebreus β-Proteobacteria

Burkholderia vietnamiensis β-Proteobacteria

Dietzia cinnemea Actinobacteria

Klebsiella pneumoniae, pKPN3 γ-Proteobacteria

FIG. 14. Schematic of common arrangements of the ptx Operon and surrounding genes in bacteria. The arrangement of ptxA-ptxD, indicated by red arrows, is conserved in all species. There is considerable variation in arrangement of accessory genes. Blue arrows indicate ptxE, fuschia arrows indicate transposases, light pink arrow indicates an integrase and the yellow arrow indicates a Gnt R type regulator similar to phnF. 48

49 identified that lack the ptxE gene have eliminated it, as it is no longer required for the operon to be functional.

One organism, Marinobacter aqueoli contains three separate Pt oxidation operons, which were mis-identified as phosphonate metabolism operons in a recent publication (64). In M. aqeaeoli, two of the operons are encoded on the chromosome, and one is plasmid encoded. The proteins that result from these genes are between 99 and 100 percent identical to one another, which suggests recent integration of the genes into the chromosome from the plasmid, or a recent chromosomal duplication and transfer to the plasmid. All three operons are associated with TN3 type transposases, which suggest a mode for the transfer and duplication of these genes. Furthermore, another species of Marinobacter, Marinobacter hydrocarboclasticus, has a ptx operon whose protein products are between 98 to 100 percent identical to those of M. aquaeoli. That these organisms have nearly identical Ptx proteins suggests very recent horizontal gene transfer and that phosphite may be an important P source in the world’s oceans.

Although M. aquaeoli is the only organism identified to date with multiple complete phosphite oxidation operons, Pseudomonas aeruginosa

PADK-CF510, which is one of the organisms identified to have htxA as part of a

C-P lyase operon, has one complete ptx operon and a nearly identical operon that include the ptxABC genes and a truncated ptxD. Although the truncated ptx operon is likely the result of a chromosomal duplication, multiple operons for the

50 utilization of reduced P compounds indicate that these compounds are plentiful in the environment where this bacterium resides.

The location and origin of the ptx genes vary among the organisms identified. In some, such as Shewanella putrefaciens, the Pt oxidation genes are chromosomally encoded, while in others, such as Burkholderia vietnamiensis and

Commamonas testosterioni, they are plasmid encoded. In other organisms, such as Pseudomonas aeruginosa PAGI 9, the chromosomally encoded genes were identified as being part of a genomic island. Furthermore, ptx genes are also frequently associated with transposases, integrases, insertion sequences and other mobile genetic elements.

Phylogenetic analysis of the ptxD gene, which encodes phosphite oxidoreductase, the enzyme responsible for conferring growth on phosphite, illustrates the long evolutionary history of this pathway, as shown in Fig. 15. In general PtxD shows between 43 and 100 percent identity among organisms with this pathway. However, it also shows multiple examples of recent horizontal gene transfer between different bacterial genera. For example, Methylophaga aminisulfidivorans and Shewanella putrefaciens have identical PtxD proteins as do Herminiimonas arsenicoxydans and Janthinobacterium sp. Marseille. The movement of these genes between bacterial species, once again suggest that they are important to their hosts and confer a competitive advantage to those organisms in their natural habitat.

51

Γ-Proteobacteria

β-Proteobacteria

α-Proteobacteria

Cyanobacteria

Δ-Proteobacteria

FIG. 15. Phylogenetic tree of the NAD-dependent phosphite dehydrogenase enzyme PtxD. The evolutionary history was inferred using Maximum Likelihood analysis. Bootstrap consensus tree was inferred from 100 replicates. Boot strap percentages greater than 50 are shown next to the branches. Arrows indicate recent horizontal gene transfer. The NAD-dependent phosphoglycerate dehydrogenase from E. coli was used as an out group.

52

The ptxD gene of Desulfotignum phosphitidoxidans encodes a functional phosphite oxidoreductase, yet diverges significantly from the ptxD genes of other characterized organisms. The PtxD protein in D. phosphitidoxidans is the least conserved of all PtxD proteins, and shares only 39 percent identity to PtxD in Pseudomonas stutzeri. Furthermore, the physiological function of the enzyme in this organism is vastly different than in other characterized bacteria. In D. phosphitidoxidans phosphite oxidation appears to be involved in energy production more than P acquisiton. In fact, so much phosphate is produced during the metabolism of phosphite that D. phosphitidoxidans actually excretes excess phosphate into the media where Pi crystals can be visually observed (personal communication with Andrea White).

Furthermore, phylogenetic analysis of PtxD proteins (Fig. 15) consistently places

D. phosphitidoxidans in a clade that is distinct from all other PtxD proteins.

Together, these data suggest that the ptx genes of D. phosphitidoxidans may have an evolutionary origin that is distinct from the other ptx genes. Furthermore, that D. phosphitidoxidans is a marine bacterium that utilizes Pt as an energy source strongly suggests that Pt is abundant in that environment.

Distribution of C-P Lyase Operons

The C-P lyase operon is widely distributed among bacterial taxa. One hundred and seventy two microorganisms harboring C-P lyase genes were identified in this study. Bacteria with a C-P lyase operon are primarily members of proteobacteria and are distributed as follows; 52 are α-proteobacteria, 29 are

53

β-protebacteria, 54 are γ-proteobacteria, and 6 are δ-proteobacteria. The remaining bacteria are distributed among 5 other bacterial taxa; 9 are

Actinobacteria, 2 are Chloroflexi, 6 are Cyanobacteria, 1 belongs to Deinococus thermus, and 11 are Firmicutes. Finally, 2 members of archaea were identified that harbor C-P lyase genes (See Appendix, Table 3-A). The distribution of organisms harboring these genes, indicate a long evolutionary history with both vertical and horizontal gene transfer, which accounts for the presence of these genes in diverse taxonomic groups.

The organisms harboring C-P lyase metabolic genes occupy habitats that vary greatly in their physical and chemical properties. For example, bacteria capable of metabolizing phosphonates have been isolated from soil, in association with plants, from both freshwater and marine environments, from areas contaminated from petroleum products or heavy metals, from extreme environments such as a 39% salinity crystallizer pond, and from hydrothermal vents, among others. The diversity of these habitats coupled with the numbers of bacteria harboring these genes suggests that phosphonates are abundant in nearly every environment and are readily available as a P source to bacteria.

Numerous bacteria were isolated from human sources including feces, sputum, vagina, (Roseomonas cervicalis ATCC 49957) and wounds. Citrobacter freundii, Clostridium difficile, Eggerthella sp., Enterobacter cancerogenus,

Shigella dysenteriae and Yersenia enterocolitica are just a few examples of organisms isolated from the gastrointestinal tract or feces of humans. One

54 hypothesis that would account for numerous enteric organisms possessing the

C-P lyase genes is that Pi is limiting in this environment and that Pn comprises a major fraction of the bioavailable P in the GI tract. This seems possible, as ptxD, the gene that confers the ability to oxidize phosphite, was also found in many enteric bacteria. However, given the complexity of the human diet, it is difficult to believe that Pi would be limiting in the gut. Therefore, it is equally likely that enteric organisms are maintaining these genes because the ability to utilize various P sources creates a competitive advantage when the enteric bacteria ultimately re-enter the natural environment.

Marine environments are another common isolation source of bacteria with the C-P lyase pathway. Bacteria with the C-P lyase genes were isolated at varying ocean depths, ranging from surface waters to depths of 1050 meters.

One organism, Thiomicrospira crungena XCL-2, was isolated from a deep sea hydrothermal vent, while Halorhabdus tiamatea SARL4B, which belongs to

Archaea, was isolated from deep-sea brines from Shaban Deep. Another bacterium that is adapted to an extreme marine environment that harbors C-P lyase degradation genes is Psychromonas ingrahamii. This bacterium was isolated from arctic polar sea ice in point barrow Alaska, and grows exponentially at -12 degrees C, with a generation time of 240 hours (58). The fact that bacteria that are adapted to environments as diverse as deep-sea hydrothermal vents and extremely cold environments harbor C-P lyase metabolic genes, suggests

55 that these compounds have been present in the environment for long periods of time, and further highlights the importance of these compounds to bacteria.

Conservation of C-P Lyase Operons

The number and arrangement of genes in the C-P lyase operon vary greatly among the various organisms possessing these genes, although the arrangement of the core catalytic genes remains largely conserved. The presence or absence of both putative regulatory and accessory genes, and the placement of genes encoding proteins with transport functions are places where variation is routinely observed. An additional source of variation is whether the operon is also associated with htxA, the gene that encodes the protein that catalyzes the oxidation of hypophosphite to phosphite.

Previously, White and Metcalf discovered that the Pseudomonas stutzeri WM88 genome contained two distinct C-P lyase operons at discreet loci.

In P. stutzeri WM88, the phn locus consists of 13 genes, which is similar to the E. coli C-P lyase operon. The second P. stutzeri WM88 C-P lyase operon, designated htx, varies significantly from the well-described phn operons. The proteins that arise from the htx encoded pathway share low identity with the proteins that result from the phn pathway (Htx and Phn homologues and their functions are described in Table 4). This observation led to the hypothesis that the two C-P lyase operons in P. stutzeri WM88 may have distinct evolutionary origins. To test this hypothesis, protein sequences from organisms harboring htx- like or phn-like C-P lyase operons were collected and analyzed. Three separate

TABLE 4. Function of Pseudomonas stutzeri WM88 Phn and Htx orthologues of the C-P lyase operons Phn Protein Htx Protein Function of Phn and Htx Proteins

D B Phosphonate binding –ABC transporter E C/E Phosphonate transport permease C D Phosphonate binding protein – F ABC transporter G F Transcriptional regulator H G Catalytic I H Catalytic J I Catalytic K J Catalytic L K Unknown M L Catalytic N M Catalytic P N Accessory protein

56

57 catalytic proteins that are required for phosphonate metabolism, PhnI, PhnJ and

PhnM, were investigated to ensure that any trends observed were consistent along the operon. The resulting maximum likelihood trees shown in Fig. 16, Fig.

17, and Fig. 18 support the hypothesis that these two distinct lineages of operons that confer the ability to metabolize phosphonates, have evolved separately. In each phylogenetic tree, two distinct clades are formed, and the P. stutzeri WM88 htx and phn analogues fall into separate clades in 100 of 100 bootstrap replicates. Analysis of the percentage of conserved amino acids in each of the three proteins further supports divergent evolution of these genes. For example, when examining the conservation of PhnJ in the entire group of organisms analyzed, we find that only 33% of the amino acid residues are conserved.

However, the conservation of amino acid residues increases to 51.5% when comparing only the htx-like PhnJ proteins, and 56% amino acid conservation when comparing only the phn subgroup. Similar trends are seen in both the PhnI and PhnM protein populations. Only 22% of the amino acids are conserved when the entire population of PhnI proteins is investigated, but increases to 43% and

36% in the htx-like and phn subgroups, respectively. Likewise, the group of

PhnM proteins shares only 15% amino acid conservation, but this number increases to 26% and 34% when considering the subpopulations separately.

Together, these data support the hypothesis that these two rather large and complex operons share an ancient evolutionary ancestor, but the genes in these operons followed divergent evolutionary paths. Despite this, both lineages of

Γ-Proteobacteria β-Proteobacteria

α-Proteobacteria

Cyanobacteria

Htx

Phn

FIG. 16. Maximum likelihood tree of catalytic C-P lyase protein PhnJ and HtxH with 100 bootstrap replicates. The distribution of the organisms into two separate clades indicates separate evolution of the Phn and Htx proteins. 58

Γ-Proteobacteria

β-Proteobacteria

α-Proteobacteria

Cyanobacteria

Htx

Phn

FIG. 17. Maximum likelihood tree of catalytic C-P lyase protein PhnI and HtxG with 100 bootstrap replicates. Distribution of organisms into two separate clades supports divergent evolution of the Phn and Htx proteins. 59

Γ-Proteobacteria β-Proteobacteria Cyanobacteria Phn

Htx

FIG. 18. Maximum likelihood tree of catalytic proteins PhnM and HtxL with 100 bootstrap replicates. Distribution of organisms into two separate clades supports divergent evolution of the Phn and Htx proteins. 60

61 operons have been shown to be functional, although in Pseudomonas stutzeri

WM88, the phn encoded operon conferred better growth on phosphonates than the htx encoded operon. That two distinct lineages of C-P lyase operons have evolved and have been maintained in bacterial populations, strongly suggests that biogenic production of phosphonates has been occurring in the environment on evolutionary timescales, and that these reduced P compounds have been an available source of P to bacteria for eons.

In the public databases, the phn encoded C-P lyase operons are much more widely distributed then htx type. Only 13 bacterial species have been identified to date that have complete htx encoded C-P Lyase operons (Table 5), whereas well over 100 species of bacteria have been shown to have the phn encoded C-P lyase. There are two possible explanations for the small number of bacteria with the htx genes. One is that the proteins resulting from the htx C-P lyase operon are less functional than the proteins encoded by the phn operon at metabolizing phosphonates, so these genes are being phased out of bacterial populations. Another explanation is that the bacteria harboring htx genes are normally found in extreme environments, such as hydrothermal vents, or the environments where these bacteria normally reside has not yet been identified and investigated.

The observation that only a handful of bacteria have htx genes, led to the question of what these organisms might have in common that would explain the distribution and presence of the two distinct phylogenetic lineages observed.

62

TABLE 5. Reduced P Oxidation Genes in bacteria with htx encoded C-P lyase operons Organism HtxA PtxD Gallinoella capsiferriformans ES2 No Yes Pseudomonas aeruginosa PADK2_CF510 Yes Yes Thiomicrospira crunogena XCL-2 No No Psychromonas ingrahamii 37 No No Burkholderia sp. H160 No No Thiobacillus denitricans No No Marinobacter aquaeolei VT8 No Yes Trichodesmium erythraeum IMS101 No Yes Cyanothece sp. PCC8802 No No Cyanothece sp. PCC8801 No No Cyanothece CCY00110 No Yes Methylibium petroleiphilum PM1 No No Limnobacter sp. MED105 No No

The htx encoded C-P lyase was found in β and γ proteobacteria as well as

cyanobacteria. Five of these bacteria, also harbor the ptx operon that encodes

the phosphite oxidation pathway, but the other eight do not.

Bacteria harboring htx encoded C-P lyase operons were also isolated

from diverse sites ranging from the lungs of a cystic fibrosis patient to petroleum-

contaminated environments to varying depths of seawater. One organism

harboring these genes, Burkholderia sp., is a rhizosphere colonizing bacterium

and is the only organism with the htx genes that is found in association with

plants. Interestingly, Psychromonas ingrahamii, the psychrophilic bacterium that grows exponentially at -12C, and Thiomicrospira crunogena, which was isolated from a deep sea hydrothermal vent, consistently group together when performing

63 phylogenetic analysis of their phosphonate metabolism proteins. This gene distribution is particularly interesting given that the organisms are adapted to essentially opposite habitats.

Recent horizontal gene transfer of C-P lyase operons appears limited, which is consistent with the conclusion that phosphonates have long been available to bacteria, although significant intra-species HGT in enteric organisms such as E. coli was observed. In addition, four bacteria that may have recently acquired their C-P lyase operons, Methylibium petroleiphilum, Marinobacter aquaeoli, Pseudomonas aeruginosa PADK2-CF510 and Pseudomonas stutzeri

WM88, have been identified. Interestingly, each of these bacteria possess a C-P lyase operon of the htx lineage. Methylibium petroleiphilum has two identical plasmid encoded C-P lyase operons, suggesting either recent acquisition or duplication of these genes. Marinobacter aquaeoli VT8 has four C-P lyase operons. In this organism, two copies are chromosomally encoded and two copies are found on separate mega plasmids. Interestingly, there are two variations of the operon in this organism that appear in duplicate. In other words, the organization of the genes in the variant operons are distinct. However, these genes appear to have recently integrated into the genome from the plasmids, or moved from the chromosome to the plasmids. Pseudomonas aeruginosa

PADK2-510 and P. stutzeri WM88 have nearly identical operons that are clearly the result of recent horizontal gene transfer. However, in these organisms, the C-

P lyase operons are found in conjunction with htxA, the gene that allows

64 utilization of hypophosphite as a sole P source. It is therefore possible, that in these organisms, it is the presence of htxA that is conferring an advantage in the environment, resulting in the entire operon being maintained by the recipient bacteria.

The results discussed above show that phosphonates are important sources of P in the environment. This conclusion is supported by the number of bacteria that can utilize phosphonates, the variety of environments in which these organisms are found and the separate evolution of two C-P lyase operons in bacteria.

CHAPTER IV

DISCUSSION

Overview

In this study, we wished to expand on the limited amount of information regarding the prevalence, distribution, and importance of reduced P oxidation in the environment. Public databases were mined to identify organisms and metagenomic environmental samples with reduced P oxidation pathways. As the sequences submitted to NCBI are from bacteria isolated from all over the world, we felt that this comprehensive study would provide insight into the global importance of reduced P oxidation to bacteria, that limited culture based techniques could never accomplish.

This in silico investigation revealed hundreds of organisms that are capable of utilizing Hpt, Pt or Pn as sole P sources. Organisms with C-P lyase operons were the most abundant and widely distributed in the environment, which is consistent with the demonstrated presence of phosphonates in the environment. In addition, 64 sequenced bacteria were identified that harbor genes for either Hpt or Pt oxidation. Five of the bacteria have pathways for the oxidation of both compounds. The bacteria are primarily members of

Proteobacteria and Cyanobacteria, and the bacteria harboring these genes were found in diverse environments all over the globe. They were isolated from

65 66 humans, wastewater treatment facilities, seawater, fresh water and sites contaminated with petroleum and heavy metals, among others. Together these data suggest that bacterial oxidation of inorganic reduced P compounds, especially Pt, is fairly common and not an unusual activity that is restricted to a handful of organisms in highly unique environments.

One of the major questions addressed in this study is whether the artificial introduction of reduced P compounds into the environment by human activities is altering the genomic composition of bacterial populations by creating a selective pressure to maintain Reduced P oxidation operons. The results of this study indicate that this is indeed occurring. Phylogenetic analysis of PtxD demonstrates that this gene has an ancient origin. However, recent HGT of ptx operons would suggest that an environmental change has occurred, which is creating a selective bias for the maintenance of these genes. In support of this, I identified 7 different examples of recent cross genus HGT of the ptx operon, which correlates with possible increased concentrations of Pt in the environment due to the commercial use of Pt as a fungicide and fertilizer.

While phylogenetic analysis demonstrates recent HGT of the ptx operon, the association of the ptx operons with genes involved in DNA mobilization, offer a mechanism for the transfer of these genes. A recent investigation into the insertion sequences of Cupriavidus metallidurans CH34 and

Delftia acidovorans revealed that in these organisms, the ptx operons are identical and are associated with transposases. C. metallidurans is a β-

67 proteobacterium isolated from sediments contaminated with heavy metals, while

D. acidovorans can be found in association with soil, water, activated sludge, crude oil and occasionally in clinical specimens. D. acidovorans has been researched extensively due to its role in degrading linear alkylbenzenesulfonates

(LAS), the major synthetic surfactant used worldwide in producing detergents

(62). Genomic analysis of C. metallidurans CH34 revealed the presence of an insertion sequence, ISRme17, that is 100 percent conserved in D. acidovorans

(62). In both of these organisms ISRme17 is found in conjunction with genes encoding proteins for both methionine biosynthesis and phosphite oxidation (19,

49). Furthermore, in D. acidovorans, a Tn3 related transposase and a resolvase were found adjacent to the phosphite oxidation gene cluster.

Herminiimonas arsenicoxydans and Janthinobacterium sp. Marseille both have ptx operons that are flanked by two insertion sequences of the IS30 family, suggesting a possible composite transposon (19). Interestingly the phosphite oxidation operons in these bacteria are found adjacent to heavy metal resistance genes. This genomic arrangement was also observed in C. metallidurans CH34. This observation led Van Houdt, et al. to consider that the oxidation of phosphite to phosphate may be involved in heavy metal resistance through the precipitation of metal-phosphates (19). However, microarray data demonstrated that in C. metallidurans CH34, heavy metal challenge did not increase expression of phosphite oxidation genes, suggesting that these genes do not play a role in heavy metal detoxification (19). This arrangement of co-

68 localization of phosphite and metal resistance genes was also observed in

Klebsiella pneumonaie, where the ptx genes are found on a plasmid that also carries genes associated with heavy metal and antibiotic resistance. Although, Pt oxidation may not play a role in heavy metal resistance, it is possible that the physiologic role of these genes is to detoxify Pt, as it has been demonstrated that

Pt is toxic at concentrations higher than are required for growth.

The selective pressure driving the distribution and maintenance of the ptx operon may be related to environmental changes that are the result of human activities. For instance, it was observed that nearly all of the organisms identified as having recently acquired phosphite oxidation genes are from anthropogenic sites. Several bacterial strains were isolated from sewage treatment plants or petroleum or heavy metal contaminated sites. Commamonas testosteronii is a gram-negative aerobic bacterium that was isolated from a sewer treatment plant.

C. testosteronii can degrade both testosterone and 4-chloronitrobenzene, and is also involved in degrading LAS with D. acidovorans. Acidovorax ebreus TPSY, which can oxidize both iron and uranium, was isolated from ground water at US,

Department of Energy Integrated Research Challenge field station, where nitrate, metals, radionuclides such as uranium and technetium, and other chemicals were disposed of in four unlined ponds from the 1950s until 1983. Pusilimonas sp. T7-7 is a petroleum degrader isolated from diesel contaminated benthal mud, and Shewanella putrefaciens 200 was isolated from a Canadian oil pipeline and is capable of performing reductive de-halogenation of the industrial pollutant

69 tetrachloromethane. Thioalkovibrio sulfidophilus HL-EbGr7, whose PtxD is 98 and 99 percent similar to Pseudomonas stutzeri and K. pneumoniae respectively, was isolated from a bioreactor in the Netherlands where it oxidizes toxic hydrogen sulfide to elemental sulfur (24, 52).

Bacterial genomes are constantly in flux, with the genomic composition responding to environmental changes. The recent acquisition of phosphite oxidation gene clusters in numerous bacteria that play roles in bioremediation suggests that environmental changes resulting from human activities may be driving the maintenance of these genes. This would allow bacteria to utilize environments that would otherwise be uninhabitable. The presence of ptx genes in these newly created anthropogenic sites suggests that phosphite concentrations are also increasing. Whether this increase in Pt is allowing bacteria to utilize it as a P source, or whether the ptx operons are playing a role in detoxification, an environmental change is influencing the distribution of this pathway in bacteria.

The origin and evolutionary history of htxA cannot be determined at this time, as there are no sequences in the databases similar enough to htxA to lend insight into the evolution of this gene. The htxA gene is 100 percent conserved in all organisms identified. (Note: Although Bradyrhizobium sp. BTAi1 was identified as having a HtxA-like protein, the Bradyrhizobium sp. BTAi1 htxA- like gene shared no significant identity with the functionally characterized htxA gene, so It is not included in this discussion). This suggests EXTREMELY recent

70

HGT, as no mutations of any kind have accumulated in these genes. The small number of bacteria identified harboring htxA, coupled with the high conservation of the gene and the complete absence of related genes in the databases is highly unusual. The evolution of genes is a slow process where the accumulation of mutations over time can eventually lead to a gene that encodes a protein with a new function. Therefore, the lack of ancestral sequences raises the question of where htxA originated. Although there is not an easy explanation for this, I believe the most likely explanation is that htxA has been maintained in low numbers in bacteria residing in cryptic environments, such as highly reducing or acidic environments, as it is in these environments that hypophosphite is most stable. The recent use of phosphine as a chemical fumigant, and hypophosphite in metal plating applications has led to an increase in environmental Hpt, which is creating a selective pressure for the distribution and maintenance of this gene.

This would explain why so few organisms have been identified that harbor this gene, and why htxA is 100% conserved. At first glance, this hypothesis seems to be in conflict with the MPN work of Stone and White, which indicates that there is no correlation between anthropogenic sites and the presence of Hpt oxidizing bacteria (65). However, the environments they sampled were common soil and aquatic environments, which are not indicative of the types of environments where htxA is likely maintained. Additionally, the databases are skewed towards pathogenic and environmentally relevant organisms, so it is likely that the environments where htxA has been maintained have yet to be explored.

71

Inorganic reduced P compounds have likely always been present in the environment and are increasing. If this is the case, one would expect that the majority of bacteria would possess operons for the oxidation and detoxification of these compounds. However, the bacteria identified to date that harbor inorganic reduced P metabolism operons are limited to Cyanobacteria and Proteobacteria

(Gram negative), with one exception (Dietzia cinnamea). This apparent biased distribution toward Gram negative bacteria suggests that Gram positive bacteria possess as yet unidentified genes that allow the oxidation of reduced P compounds. It also indicates that high efficiency HGT between these groups has not been occurring likely due to structural differences between Gram positive and

Gram negative bacteria.

Although extensive work has already been done on the distribution and conservation of C-P lyase operons, to my knowledge, this is the first study that identifies two distinct evolutionary lineages of C-P lyase operons. The htx encoded C-P lyase has only been found in approximately a dozen organisms, several of which are from extreme environments. Despite the limited distribution of these genes, there is evidence of recent horizontal gene transfer as evidenced by nearly identical duplicate operons in Marinobacter aquaeoli VT8, and the htx and phn encoded C-P lyase operons in P. stutzeri WM88 Furthermore the htx encoded C-P lyase operon has been found in conjunction with htxA in two different organisms. Above I suggested that htxA has been maintained in cryptic

72 habitats and is just now undergoing HGT in response to environmental changes.

I believe that this may be case for the htx encoded C-P lyase operon as well.

When the htx encoded C-P lyase operon was first identified in

Pseudomonas stutzeri WM88, it was demonstrated to be functional at conferring growth on AePn. However, P. stutzeri strains with the htx operon deleted grow better on media containing AePn as a sole P source then either wild type P. stutzeri or phn deletion mutants (77). This data indicates that the phn encoded C-

P lyase confers better growth on phosphonates then the htx-encoded operon under standard laboratory conditions. This immediately raises the question of why this operon is undergoing horizontal gene transfer, or even being maintained. It is possible that the limited distribution of the htx encoded C-P lyase operon indicates that this operon is being phased out of bacterial genomes due to the evolution of the more functional phn encoded C-P lyase. However, an alternative explanation does exist. Consider the organisms that have been isolated that have an htx-encoded C-P lyase, such as Thiomicrospira crunogena or Psychromonas ingrahamii. Both were isolated from, and adapted to, extreme environments. While T. crunogena was isolated from a deep-sea hydrothermal vent and is adapted to extremely high temperatures, P. ingrahamii grows exponentially at -12C, and is adapted to an extremely cold environment. Neither would presumably grow well at 37C under laboratory conditions. These observations suggest that the htx encoded C-P lyase operon may have evolved in extreme environments such as the ones described above. Therefore, it is

73 possible that this C-P lyase may actually be functional in more extreme environments.

The apparent conundrum of why this operon is being maintained and transferred by horizontal gene transfer can be reconciled by the presence of htxA. If hypophosphite concentrations are increasing in the environment as has been suggested, it may be that it is htxA that is driving the distribution and maintenance of this operon. Furthermore, as noted earlier, some environments in which htx encoded C-P lyase operons are found are extreme environments that have not been thoroughly investigated. Therefore, the presence of this pathway would not be equally represented in the public sequence databases. Togther these observations suggest a possible explanation for the separate evolutionary origins of the phn and htx C-P lyase operons, as well as the limited distribution of the htx operon, while also accounting for its recent HGT.

The identification of bacteria that both produce reduced P compounds and that can utilize these compounds as P and carbon sources suggest a bacterial mediated P redox cycle. This putative cycle has not been thoroughly investigated or definitively demonstrated. Both the biogenesis and degradation of organic reduced P compounds by bacteria has been clearly established.

However, the role bacteria play in the oxidation of inorganic reduced P compounds is a relatively new area of investigation. This is surprising, given the necessity of P for all organisms and the extensive investigation of other nutrient cycles, such as carbon, nitrogen and sulfur. Currently three areas need

74 substantial investigation in order to conclusively demonstrate a P redox cycle.

These areas are 1) Identify the mechanism of P transfer between aquatic and terrestrial environments given the instability of phosphine gas in aerobic conditions; 2) Demonstrate biotic reduction of hypophosphite to phosphine, and

3) Develop techniques for measuring reduced P compounds in complex environments such as soil.

It has been suggested that the instability of phosphine gas in aerobic conditions precludes a closed P cycle (2). For instance, in aerobic conditions the reduction of hypophosphite to phosphine gas would be fruitless, as the phosphine would immediately oxidize to phosphate. The gaseous form of other essential nutrients, such as nitrogen gas or carbon dioxide which are stable under aerobic conditions, play a critical role in nutrient cycling, as it is in this form that the nutrients are transferred between aquatic and terrestrial environments.

Therefore, if phosphine is involved in completing the P cycle, it is necessarily through a different mechanism that allows anaerobic transfer of phosphine between terrestrial and aquatic environments, perhaps through a mechanism such as geothermal vents. This is supported by the fact that phosphine is known to be ubiquitous in anaerobic environments, although the biotic production of phosphine has not been adequately demonstrated. The full elucidation of the bacterial mediated redox cycle is also dependent on technological improvements that will allow the quantification of reduced P compounds in complex environments such as soil. Such quantification would establish the presence of

75 these compounds in common environments and whether they are present at biologically relevant concentrations. Until this occurs, evidence of these compounds in the environment and their importance to bacteria remains anecdotal.

It has recently been suggested that the usable stores of apatite will be depleted within a century. Apatite, also known as phosphate rock, is the progenitor of inorganic phosphate, and the weathering of this rock releases Pi that can be utilized in biological systems. Apatite is mined extensively world wide for use in fertilizers, in order to increase agricultural yields. As much of the world’s apatite stores are found in the oceans, mining of these environments could have devastating ecological consequences. However, the depletion of apatite, and therefore P, could dramatically effect the world’s food supply, thus sending the world into a “phosphorus crisis” (14). It is therefore crucial that alternative sources of Pi be investigated. Understanding the flux of P, in all of its forms and the role that bacteria play in the conversion of P, could alleviate the dependence on apatite mining for industrial uses.

This study contributed to the field of P redox cycling by demonstrating that bacterial oxidation of inorganic reduced P compounds is much more common than previously believed. It demonstrated that oxidation of these compounds is occurring in diverse environments with distinct chemical and physical characteristics. It also revealed that environmental changes resulting from human activities are driving the distribution and maintenance of inorganic

76 reduced P oxidation genes in bacteria. Ultimately, whether or not there is a closed P cycle that is on par with the other nutrient cycles is less important than understanding the mechanisms for the conversion and flux of P in our environment. Therefore, further investigation into the metabolic pathways responsible for converting P, the abundance of reduced P in the environment and the effect of increasing reduced inorganic P on microbial communities are required.

REFERENCES

REFERENCES

1. Altschul, S. F., W. Gish, W. Miller, E. W. Myers, and D. J. Lipman. 1990. Basic local alignment search tool. J. Mol. Biol. 215:403–410. 2. Ayres, R. U. 1997. Integrated assessment of the grand nutrient cycles. Environ. Model. Assess. 2:107–128. 3. Borisova, S., H. Christman, M. Metcalf, N. Zulkepli, J. Zhang, W. van der Donk, and W. W. Metcalf. 2011. Genetic and biochemical characterization of a pathway for the degradation of 2- aminoethylphosphonate in Sinorhizobium meliloti 1021. J. Biol. Chem. 286:22283–22290. 4. Boto, L. 2009. Horizontal gene transfer in evolution: Facts and challenges. Proc. R. Soc. B. 277:819–827. 5. Clark, L., E. Ingall, and R. Benner. 1998. Marine phosphorus is selectively remineralized. Nature. 393:426. 6. Cooley, N., A. Kulakova, J. Villarreal-Chiu, J. Gilbert, J. McGrath, and J. Quinn. 2011. Phosphonoacetate biosynthesis: In vitro detection of a novel NADP+ dependent phosphonoacetaldehyde-oxidizing activity in cell free extracts of a marine Roseobacter. Microbiology. 80:335–340. 7. Devai, I., L. Felfoldy, I. Wittner, and S. Plosz. 1988. Detection of phosphine: New aspects of the phosphorus cycle in the hydrosphere. Nature. 333:343–345. 8. Dumora, C., A. Lacoste, and A. Cassaigne. 1989. Phosphonoacetate hydrolase from Pseudomonas aeruginosa - purification, properties and comparison with Bacillus cereus enzyme. Biochimica et Biophysica Acta. 997:193–198. 9. Dyhrma, S. T. Dyhrman, C. R. Benitez-nelson, E. D. Orchard, S. T. Haley, and P. J. Pellechia. 2009. A microbial source of phosphonates in oligotrophic marine systems. Nature Geosci. 2:696–699. 10. Eismann, F. , Glindemann A., Bergmannt, A. , Kuschk P. 1997. Soils as Source and Sink of Phosphine. Chemosphere. 35:523–533. 11. Ford, J. L., N. O. Kaakoush, and G. L. Mendz. 2010. Phosphonate metabolism in Helicobacter pylori. Antonie van Leeuwenhoek. 97:51–60. 12. Foster, T., L. Winans Jr., and S. Helms. 1978. Anaerobic utilization of phosphite and hypophosphite by Bacillus sp. Appl. Environ. Microbiol. 35:937–944.

78 79

13. Gassman, G., and D. Glindemann. 1993. Phosphane (PH3) in the biosphere. Angewandte Chemie International Edition in English. 32:61–63. 14. Gilbert, N. 2009. Environment: The disappearing nutrient. Nature. 461:716–718. 15. Gomez-Garcia, M. R., M. Davison, M. Blain-Hartnung, A. R. Grossman, and D. Bhaya. 2011. Alternative pathways for phosphonate metabolism in thermophilic cyanobacteria from microbial mats. SME J. 5:141–9. 16. Heinan, W., and A. Lauwers. 1974. Hypophosphite oxidase from Bacillus caldolyticus. Arch. Microbiol. 95:267–274. 17. Hildebrand, R. L. 1993. The Role of Phosphonates in Living Systems. CRC Press Inc., Boca Raton, FL. 18. Hilton, H., and W. Robison. 1972. Fate of Zinc Phosphide and Phosphine in the Soil-Water Environment. J. Agr. Food Chem. 20:1209–1213. 19. Houdt, R. Van, S. Monchy, N. Leys, and M. Mergeay. 2009. New mobile genetic elements in Cupriavidus metallidurans CH34, their possible roles and occurrence in other bacteria. Antonie van Leeuwenhoek. 96:205–26. 20. Hove-Jensen, B., F. R. McSorley, and D. L. Zechel. 2011. Physiological role of phnP-specified phosphoribosyl cyclic phosphodiesterase in catabolism of organophosphonic acids by the carbon-phosphorus lyase pathway. J. Am. Chem. Soc. 133:3617–24. 21. Hove-Jensen, B., T. J. Rosenkrantz, D. L. Zechel, and M. Willemoës. 2010. Accumulation of intermediates of the carbon-phosphorus lyase pathway for phosphonate degradation in phn mutants of Escherichia coli. J. Bacteriol. 192:370–4. 22. Huang, J., Z. Su, and Y. Xu. 2005. The evolution of microbial phosphonate degradative pathways. J. Mol. Evol. 61:682–90. 23. Iverson, W. 1968. Corrosion of iron and formation of iron phosphide by Desulfovibrio desulfuricans. Nature. 217 1265–1267. 24. Janssen, A. J. H., P. N. L. Lens, A. J. M. Stams, C. M. Plugge, D. Y. Sorokin, G. Muyzer, H. Dijkman, E. Van Zessen, P. Luimes, and C. J. N. Buisman. 2009. Application of bacteria involved in the biological sulfur cycle for paper mill effluent purification. Sci. Total Environ. 407:1333–43. 25. Jenkins, R. O., T. a Morris, P. J. Craig, A. W. Ritchie, and N. Ostah. 2000. Phosphine generation by mixed- and monoseptic-cultures of anaerobic bacteria. Sci. Total Environ. 250:73–81. 26. Jochimsen, B., S. Lolle, F. R. McSorley, M. Nabi, J. Stougaard, D. L. Zechel, and B. Hove-Jensen. 2011. Five phosphonate operon gene products as components of a multi-subunit complex of the carbon- phosphorus lyase pathway. Proc. Nat. Acad. Sci. USA. 108:11393–8.

80

27. Kamat, S. S., H. J. Williams, and F. M. Raushel. 2011. Intermediates in the transformation of phosphonates to phosphate by bacteria. Nature. 480:570–573. doi:10.1038/nature10622 28. Kennedy, K., and G. Thompson. 1970. Phosphonolipids: Localization in surface membranes of Tetrahymena. Science. 168:989–991. 29. Kim, A., M. M. Benning, S. OkLee, J. Quinn, B. M. Martin, H. M. Holden, and D. Dunaway-Mariano. 2011. Divergence of chemical function in the alkaline phosphatase superfamily: Structure and mechanism of the P-C bond cleaving enzyme phosphonoacetate hydrolase. Biochemistry. 50:3481–94. 30. Kliejunas, J. 2010. Sudden oak death and Phytophthora ramorum: A summary of the literature. USDA Forest Service General Technical Report PSW-GTR-234. Albany, CA. 31. Kolowith, L. C., E. D. Ingall, R. Benner, and S. Carolina. 2001. Composition and cycling of marine organic phosphorus. Limnol. Oceanogr. 46:309–320. 32. Koskiniemi, S., S. Sun, O. Berg, and D. Andersson. 2012. Selection- Driven Gene Loss in Bacteria. PLoS Genet. 8:1002787. 33. LaNauze, J., J. Coggins, and H. Dixon. 1977. Aldolase-like imine formation in mechanism of action of phosphonoacetaldeyde hydrolase. Biochem. J. 165:409–411. 34. Larkin, M., G. Blackshields, N. Brown, R. Chenna, P. McGettigan, H. McWilliam, I. Wallace, A. Wilm, R. Lopez, J. Thompson, T. Gibson, and D. Higgins. 2007. ClustalW and Clustalx version 2. Bioinformatics. 23:2947–2948. 35. Lawrence, J. 2002. The Dynamic of Bacterial Genomes, p. . In M. Syvanen, and C. Kado (eds.), Horizontal Gene Transfer Second Edition. Academic Press, London. 36. Leymonie, Jean-Pierre. 2007. Phosphites and Phoshates: When distributors and growers alike get get confused!! The New Ag International. September edition. 37. Martinez, A., G. W. Tyson, and E. F. Delong. 2010. Widespread known and novel phosphonate utilization pathways in marine bacteria revealed by functional screening and metagenomic analyses. Environ. Microbiol. 12:222–38. 38. Martínez, A., M. S. Osburne, A. K. Sharma, E. F. Delong, and S. W. Chisholm. 2012. Phosphite utilization by the marine picocyanobacterium Prochlorococcus MIT9301. Environ. Microbiol. 14:1363–77.

81

39. McDowell, M. M., M. M. Ivey, M. E. Lee, V. V. V. . Firpo, T. M. Salmassi, C. S. Khachikian, and K. L. Foster. 2004. Detection of hypophosphite, phosphite, and orthophosphate in natural geothermal water by ion chromatography. J. Chromatogr. A 1039:105–111. 40. McGrath, J. W., F. Hammerschmidt, and J. P. Quinn. 1998. Biodegradation of phosphonomycin by Rhizobium huakuii PMY1. Appl. Environ. Microbiol. 64:356–8. 41. McGrath, J. W., G. B. Wisdom, G. McMullan, M. J. Larkin, and J. P. Quinn. 1995. The purification and properties of phosphonoacetate hydrolase, a novel carbon-phosphorus bond-cleavage enzyme from Pseudomonas fluorescens 23F. Eur. J. Biochem. 234:225–30. 42. McGrath, J. W., F. Hammerschmidt, H. Kählig, F. Wuggenig, G. Lamprecht, and J. P. Quinn. 2011. Studies on the biodegradation of fosfomycin: Synthesis of 13C-labeled intermediates, feeding experiments with Rhizobium huakuii PMY1, and isolation of labeled amino acids from cell mass by HPLC. Chem. Euro. J. 17:13341–8. 43. McGrath, J., F. Hammerschmidt, W. Preusser, and A. Schweifer. 2009. Studies on the biodegradation of fosfomycin: Growth of Rhizobium hauakuii PMY1 on possible intermediates synthesized chemically. Org. Biolmol. Chem. 7:1944–1953. 44. Mendz, G., F. Megraud, and V. Korolik. 2005. Phosphonate catabolism by Campylobacter spp. Arch. Microbiol. 183:113–120. 45. Metcalf, W. W., and B. L. Wanner. 1991. Involvement of the Escherichia coli phn (psiD) gene cluster in assimilation of phosphorus in the form of phosphonates, phosphite, Pi esters, and Pi. J. Bacteriol. 173:587–600. 46. Metcalf W. W., and B. L. Wanner. 1993. Mutational analysis of an Escherichia coli fourteen-gene operon for phosphonate degradation, using TnphoA’ elements. J. Bacteriol. 175:3430–42. 47. Metcalf W. W., and R. S. Wolfe. 1998. Molecular genetic analysis of phosphite and hypophosphite oxidation by Pseudomonas stutzeri WM88. J. Bacteriol. 180:5547–58. 48. Metcalf W. W., and W. a van der Donk. 2009. Biosynthesis of phosphonic and phosphinic acid natural products. Annu. Rev. Biochem. 78:65–94. 49. Mijnendonckx K., A. Provoost, P. Monsieurs, N. Leys, M. Mergeay, J. Mahillon, and R. Van Houdt. 2011. Insertion sequence elements in Cupriavidus metallidurans CH34: Distribution and role in adaptation. Plasmid. 65:193–203. 50. Morton S., D. Glindemann, and M. Edwards. 2003. Phosphates, phosphites and phosphides in samples of enviromental interest. Environ. Sci. Technol. 37:1169–74.

82

51. Morton S., D. Glindemann, X. Wang, X. Niu, and M. Edwards. 2005. Analysis of reduced phosphorus in samples of environmental interest. Environ. Sci. Technol. 39:4369–76. 52. Muyzer, G., D. Y. Sorokin, K. Mavromatis, A. Lapidus, A. Clum, N. Ivanova, A. Pati, P. d’Haeseleer, T. Woyke, and N. C. Kyrpides. 2011. Complete genome sequence of “Thioalkalivibrio sulfidophilus” HL-EbGr7. Standards in Genomic Sciences. 4:23–35. 53. Pech, H., A. Henry, C. S. Khachikian, T. M. Salmassi, G. Hanrahan, and K. L. Foster. 2009. Detection of geothermal phosphite using high- performance liquid chromatography. Environ. Sci. Technol. 43:7671–5. 54. Perez, F. Serial Cloner 2.1 [software]. SerialBasics. 55. Quin, L. D. 2000. A Guide to Organophosphorus Chemistry. New York. 56. Quin, L. D. 1965. The presences of compounds with a carbon- phosphorus bond in some marine invertebrates. Biochemistry. 4(2):324–330. 57. Quinn, J., A. Kulakova, N. Cooley, and J. McGrath. 2007. New ways to break an old bond: The bacterial carbon–phosphorus hydrolases and their role in biogeochemical phosphorus cycling. Environ. Microbiol. 9:2392– 2400. 58. Riley M., J. T. Staley, A. Danchin, T. Z. Wang, T. S. Brettin, L. J. Hauser, M. L. Land, and L. S. Thompson. 2008. Genomics of an extreme psychrophile, Psychromonas ingrahamii. BMC Genomics. 9:210. 59. Robinson, J., and E. Bond. 1970. The toxic action of phosphine: Studies with 32PH3; Terminal residues in biological materials. J. Stored Prod. Res. 6. 60. Rutishauser, B. V, and R. Bachofen. 1999. Phosphine Formation from Sewage Sludge Cultures. Anaerobe. 5:525–531. 61. Schink, B., V. Thiemann, H. Laue, and M. W. Friedrich. 2002. Desulfotignum phosphitoxidans sp. nov., a new marine sulfate reducer that oxidizes phosphite to phosphate. Arch. Microbiol. 177:381–91. 62. Schleheck, D., T. P. Knepper, K. Fischer, and A. M. Cook. 2004. Mineralization of Individual Congeners of Linear Alkylbenzenesulfonate by Defined Pairs of Heterotrophic Bacteria Mineralization of Individual Congeners of Linear Alkylbenzenesulfonate by Defined Pairs of Heterotrophic Bacteria. Appl. Environ. Microbiol. 70:4053–4063. 63. Simeonova, D. D., M. M. Wilson, W. W. Metcalf, and B. Schink. 2010. Identification and heterologous expression of genes involved in anaerobic dissimilatory phosphite oxidation by Desulfotignum phosphitoxidans. J. Bacteriol. 192:5237–44.

83

64. Singer, E., E. a Webb, W. C. Nelson, J. F. Heidelberg, N. Ivanova, A. Pati, and K. J. Edwards. 2011. Genomic potential of Marinobacter aquaeolei, a biogeochemical “opportunitroph”. Appl. Environ. Microbiol. 77:2763–71. 65. Stone, B., and A. K. White. 2012. Most probable number quantification of hypophosphite and phosphite in natural aquatic and terrestial environments. Arch. Microbiol. 194:223–228. 66. Tamura, K., D. Peterson, G. Stecher, M. Nei, and S. Kumar. 2011. MEGA5: Moleculare Evolutionary Genetics Analysis using Maximum Likelihood, Evolutionary Distance, and Maximum Parsimony Methods. Mol Biol Evol. 10:2731-2739 67. Ternan, N. G., J. W. M. Grath, G. M. Mullan, and J. P. Quinn. 1998. Review: Organophosphonates: Occurrence, synthesis and biodegradation by microorganisms. World J. Microbiol. Biotechnol. 14:635–647. 68. Tsubota, G. 1959. Phosphate reduction in the paddy field. Soil and Plant Food. 5:10–15. 69. USEPA. 2007. U. S. Enviornmental Protection Agency 2006-2007 pesticide market estimates. 70. Villarreal-Chiu, J. F., J. P. Quinn, and J. W. McGrath. 2012. The genes and enzymes of phosphonate metabolism by bacteria, and their distribution in the marine environment. Front. Microbiol. 3:19. 71. Wanner, B. L. 1993. Gene regulation by phosphate in enteric bacteria. J. Cell. Biochem. 51:47–54. 72. Wanner, B. L., and W. W. Metcalf. 1992. Molecular genetic studies of a 10.9-kb operon in Escherichia coli for phosphonate uptake and biodegradation. FEMS Microbiol. Lett. 79:133–9. 73. Weimer, P., M. Van Kavelaar, C. Miller, and T. N. G. 1998. Effect of phosphate on the corrosion of carbon steel and on the composition of corrosion products in two stage continuous cultures of Desulfovibrio desulfuricans. Appl. Environ. Microbiol. 54:386–397. 74. Whelan, S., and N. Goldman. 2001. A general empirical model of protein evolution derived from multiple protein families using a maximum-likelihood approach. Molecular Biology and Evolution. 18:691–699. 75. White, A. K., and W. W. Metcalf. 2007. Microbial metabolism of reduced phosphorus compounds. Annu. Rev. Microbiol. 61:379–400. 76. White, A. K., and W. W. Metcalf. 2004. The htx and ptx Operons of Pseudomonas stutzeri WM88 Are New Members of the Pho Regulon. J. Bacteriol. 186:5876–5882.

84

77. White, A. K., and W. W. Metcalf. 2004. Two COP Lyase Operons in Pseudomonas stutzeri and Their Roles in the Oxidation of Phosphonates, Phosphite, and Hypophosphite. J. Bacteriol. 186:5876–5882. 78. Wiedenbeck, J., and F. Cohan. 2011. Origins of bacterial diverstiy through horizontal genetic transfer and adaptation to new ecological niches. FEMS Microbiol. Rev. 35:957–976. 79. Wilson, M. M. 2006. Characterization of reduced phosphorus metabolism in Alcaligenes faecalis WM2072 and Xanthobacter flavis WM2814. Ph.D. Thesis. University of Illinois at Urbana-Champaign, IL. 80. Wilson, M. M., and W. W. Metcalf. 2005. Genetic Diversity and Horizontal Transfer of Genes Involved in Oxidation of Reduced Phosphorus Compounds by Alcaligenes faecalis WM2072. Appl. Environ. Microbiol. 71:290–296. 81. Yang K., and W. W. Metcalf. 2004. A new activity for an old enzyme: Escherichia coli bacterial alkaline phosphatase is a phosphite-dependent hydrogenase. Proc. Nat. Acad. Sci. USA 101:7919–24.

APPENDIX A

REDUCED P OXIDIZING BACTGERIA

IDENTIFIED IN THIS STUDY

TABLE 1-A. Organisms harboring hypophosphite oxidation proteins

Name Accession Number Taxa Comments Alcaigenes faecalis AAT12775.1 B-proteobacteria

Bradyrhizobium sp. BTAi1 YP_001242190.1 A-proteobacteria Ithaca, NY from YP_001242176.1 Aeschynomene indica Pseudomonas stutzeri AAC1711.1 G-proteobacteria

Psuillimonas sp. T7-7 YP_004417990.1 B-proteobacteria Benthal mud of a petroleum-contaminated site in Bohai Sea, China. Pseudomonas aeruginosa EIE42690.1 G-proteobacteria PADK2_CF510

86

87

Table 2-A. Organisms harboring PtxD catalytic protein for estoster oxidation

Organism Accession number Taxa Comments Acidovorax ebreus TPSY YP_002552880.1 B-proteobacteria Ground water, US DOE Integrated Research Challenge, Oakridge Tennessee

Acidovorax sp. NO-1 ZP_09327546.1 B-proteobacteria Gold mine soil, Daye, Hubai Province, China

Acinetobacter radioresistens ACIRA0001_3212 G-proteobacteria Human skin SK82

Alcaligenes faecalis AAT12779.1 B-proteobacteria Crystal Lake, Illinois

Alicycliphilus denitrificans K601 YP_004387877.1 B-proteobacteria Anaerobic sewer sludge, Germany

Acinetobacter sp. SH024 ZP_06692247.1 G-proteobacteria Human skin

Agrobacterium tumefaciens F2 EGP54370.1 A-proteobacteria Harbin, China plasmid p1

Burkholderia vietnamiensis G4, ABO60092.1 B-proteobacteria plasmid

Commamonas testosterioni KF-1 ZP_03543711.1 B-proteobacteria Isolated from activated sludge

Comamonas estosterone pPT1 YP_001687763.1 B-proteobacteria

Cupriavidus_metallidurans_CH34 YP_585134.1 B-proteobacteria Cupriavidus metallidurans CH34. This strain was first identified in the heavy metal-contaminated sludge of a settling tank in Belgium in the late 1970s

Cyanothece sp. ATCC 51142 YP_001803974.1 Cyanobacteria isolated from intertidal sands from the Gulf of Mexico in Texas

Cyanothece sp. ATCC 51472 ZP_08972951.1 Cyanobacteria Seawater, Port Aransas, TX

Cyanothece sp. CYY0010 ZP_01730688.1 Cyanobacteria Seawater off coast of Zanzibar

Delftia acidovorans SPH-1 YP_001563696.1 B-proteobacteria Sewage treatment plant, Germany

Dietzia cinnamea P4 ZP_08025323.1 Actinobacteria Microcosms containing oil-contaminated soil collected from an environmentally protected area of a tropical Atlantic forest.

88

Table 2-A. (Continued)

Organism Accession number Taxa Comments Desulftigum phosphitoxidans ABU54325.1 D-proteobacteria

Gallionella capsiferriformans ES- YP_003848684.1 B-proteobacteria Iron contaminated groundwater in Michigan. Iron oxidizer s

Halomonas sp. HAL1 ZP_08960489.1 G-proteobacteria Isolated from soil of a gold mine in Hubei Province, China. Arsenic resistance

Herminiimonas arsenicoxydans CAL63322.1 B-proteobacteria Heavy metal contaminated sludge from an industrial water treatment plant. Arsenic resistance genes Janthinobacterium sp. Marseille ABR91484.1 B-proteobacteria isolated from a solution used in kidney dialysis. Heavy meta resistance – cadmium, cobalt, zinc, mercury, chromate, copper Klebsiella sp. OBRC7 ZP_10892515 G-proteobacteria Homosapien

Klebsiella sp. MS 92-3 ZP_08302804 G-proteobacteria Gastrointestinal tract, homosapien

Klebsiella pneumoniae G-proteobacteria Isolate from a hospital outbreak in Rotterdam. Multiple antibiotic resistance strain. 1191100241

Klebsiella pneumoniae ABR80271.1 G-proteobacteria Male patient in 1994 pneumoniae MGH78578, pKPN3

K. Pneumoniae pUUH 239.2 AET17078.1 G-proteobacteria Uppsala University Hospital (UUH), Uppsala, Sweden, 2005. Copper, silver, arsenic an multiple drug resistance. Klebsiella pneumoniae strain AEV55093.1 G-proteobacteria Copper, silver, arsenic, and multiple drug resistance. ST258 plasmid pKPN-IT

Klebsiella pneumoniae subsp. EJJ32033.1 G-proteobacteria Skin lesion/groin Pneumoniae KPNIH1

89

Table 2-A. (Continued)

Organism Accession number Taxa Comments Klebsiella pneumoniae subsp. CCI63884.1 G-proteobacteria Hospital Pneumoniae ST512-K30BO

Marine Metagenome ECH27739.1 unknown Global Ocean Sampling project

Marine Metagenome ECZ38707.1 unknown Global Ocean Sampling project

Marine Metagenome EBN27557.1 unknown Global Ocean Sampling project

Marine Metagenome EDD68249.1 unknown Global Ocean Sampling project

Marine Metagenome ECY67400.1 unknown Global Ocean Sampling project

Marine Metagenome EDG18834.1 unknown Global Ocean Sampling project

Marine Metagenome ECV06755.1 unknown Global Ocean Sampling project

Marine Metagenome EBZ33955.1 unknown Global Ocean Sampling project

Marine Metagenome ECX76239.1 unknown Global Ocean Sampling project

Marine Metagenome EBT72201.1 unknown Global Ocean Sampling project

Marine Metagenome ECM35186.1 unknown Global Ocean Sampling project

Marine metagenome ABEF01009771.1 unknown 4000 M depth, Pacific (Hawaii ALOHA)

Marinobacter algicola DG893 ZP_01892375.1 G-proteobacteria Yellow Sea in Korea, surface of the laboratory cultured dinoflagellate Gymnodinium catenatum Marinobacter aquaeoli, 3 YP_957180.1 G-proteobacteria Head of an oil producing well at offshore oil platform in southern Vietnam near separate operons YP_958558.1 Vung Tau Motility. YP_960497.1 Marinobacter YP_005429823.1 G-proteobacteria hydrocarbonclasticus

90

Table 2-A. (Continued)

Organism Accession number Taxa Comments Marinobacter manganoxydans EHJ02880.1 G-proteobacteria Heavy-metal-rich sediment sample collected from a deep-sea hydrothermal MnI7-9 vent in the Indian Ocean. Copper, chromate, mercury, arsenic, zinc, cobalt and cadmium resistance. Degrade aliphatic and polycyclic aromatic hydrocarbons. Methylophaga aminisulfidivorans ZP_08536782.1 G-proteobacteria Seawater at Mokpo, South Korea. Grows MP

Methylobacterium extorquens YP_002966565.1 A-proteobacteria This strain can grow on methylamine or methanol, but not methane. It is an AM1, Meta2p extensively studied laboratory strain.

Methylobacterium extorquens YP_002967326.1 A-proteobacteria This strain can grow on methylamine or methanol, but not methane. It is an AM1 extensively studied laboratory strain. Methylobacterium extorquens YP_003066078.1 A-proteobacteria Soil contaminated with halogenated (chlorine-containing) hydrocarbons. Can DM4 usethe compound dichloromethane, which is both toxic and carcinogenic, as a sole C and energy source. Methylobacterium extorquens EHP95074.1 A-proteobacteria Pine (Pinus sylvestris) tissue cultures from meristems of trees, northern part of DSM 13060 Finland

Methylogphaga sp. JAM1 YP_006297136.1 G-proteobacteria

Nodularia spumigena CCY9414 ZP_01632392.1 Cyanobacteria Surface waters of the Baltic Sea. Nitrogen fixer, bloom forming, toxic.

Nostoc punctiforme PCC 73102 YP_001866684.1 Cyanobacteria Isolated from a symbiotic association with the gymnosperm cycad Macrozamia sp. No ptxE. It typically grows in freshwater habitats.Carbon dioxide fixation, Nitrogen fixation Nostoc sp. PCC 7120 Plasmid BAB77417.1 Cyanobacteria pCC7120 gamma

Oxalobacter formigenes HOxBLS ZP_04577609.1 B-proteobacteria Mixed culture from feces from an adult male. Oxalic acid degrader. (aka OXCC13)

Populus trichocarpa Eukaryote Black Cottonwood Tree

Prochlorococcus marinus str. MIT YP_001091477.1 Cyanobacteria Sargasso Sea at a depth of 90m. Photosynthetic. It can grow only in a narrow 9301 range of light intensities. This strain belongs to the ‘low light-adapted’ ecotype.

91

Table 2-A. (Continued)

Organism Accession number Taxa Comments Prochlorococcus marinus str. MIT YP_001017141.1 Cyanobacteria Sargasso Sea at a depth of 100 m. Photosynthetic. It can grow only in a narrow 9303 range of light intensities. This strain belongs to the ‘low light-adapted’ ecotype. Pseudomonas aeruginosa ATCC EKA40693.1 Biofilm from an industrial water system 700888

Pseudomonas aeruginosa ATCC EKA30527.1 G-proteobacteria Air from a glass-crusher air plate 25324

Pseudomonas aeruginosa EIE42701.1 G-proteobacteria Cystic fibrosis patient – Denmark PADK2_CF510

Pseudomonas aeruginosa 2192 ZP_04934509.1 G-proteobacteria Cystic fibrosis patient

Pseudomonas aeruginosa, ABR13521.1 G-proteobacteria Originally cultured from patients with ventilator-associated pneumonia PSE9, PAGI-7 genomic island

Pseudomonas stutzeri WM88 AAC71709.1 G-proteobacteria University of Illinois, Pig Lagoon

Pseudomonas stutzeri YP_006457277.1 G-proteobacteria Sediments of the West Mediterranean Sea CCUG29243

Pseudomonas extremaustralis ZP_10434936.1 G-proteobacteria Temporary pool in Antarctica

Pseudomonas sp. K ADZ52866.1 G-proteobacteria Soil

Psuillimonas sp. T7-7 Ptx D YP_004417995 B-proteobacteria Isolated from the benthal mud of a petroleum-contaminated site in Bohai Sea, HtxA YP_004417990.1 China. Diesel oil-degrading cold-tolerant bacterium.

Ramlibacter tataouinensis YP_004620153.1 B-proteobacteria Sand particles coated on a meteorite fragment buried in a sandy soil of a semi- TTB310 arid region of South Tunisia

Ralstonia sp. 5_2_56FAA ZP_08894371.1 B-proteobacteria Human fecal sample; Emma Allen-Vercoe, University of Guelph

Ralstonia sp. 5_7_47FAA ZP_07675768.1 B-proteobacteria Inflamed biopsy tissue from a 25 year old female patient with Crohn’s disease

92

Table 2-A. (Continued)

Organism Accession number Taxa Comments Shewanella putrefaciens 200 ADV55674.1 G-proteobacteria Isolated from a Canadian oil pipeline

Thioalkalivibrio sulfidophilus HL- ACL72000.1 G-proteobacteria Isolated from a sulfide-oxidizing bioreactor in the Netherlands. HL-EbGr7 is an EbGr7 obligately chemolithoautotrophic, haloalkaliphilic sulfur-oxidizing bacterium that can oxidize sulfide, thiosulfate, elemental sulfur, sulfite and polythionates.

Trichodesmium erythraeum ABG49837.1 Cyanobacteria Isolated from the North Carolina coast in 1992 and grows in straight filaments IMS101

Xanthobacter flavus AAZ57333.1 A-proteobacteria Pig lagoon

93

Table 3-A. Bacteria harboring Phn J Catalytic Protein of the C-P Lyase Operon Organism Accession # Taxonomy Comments Achromobacter arsenitoxydans Isolated from arsenic-contaminated soil of a pig farm. Can oxidize arsenite to SY8 ZP_09300490.1 B-Proteobacteria arsenate.

Acetivibrio cellulolyticus CD2 ZP_09464682 Firmicutes Sewage sludge; Canada Acetobacteraceae bacterium AT- Leg wound from a 17 year old male, wound was secondary to being stepped ZP_09395608 5844 A-Proteobacteria on by a bull Achromobacter piechaudii ATCC ZP_06689438 43553 B-Proteobacteria Isolated from a nose wound, France Achromobacter xylosoxidans EGP47856 AXX-A B-Proteobacteria Human, Cystic Fibrosis, Opportunistic infection

Acidiphilium cryptum JF-5 YP_001236023 A-Proteobacteria Coal mine lake sediment

Acidithiobacillus ferrooxidans ATCC 53993 YP_002220356.1 G-Proteobacteria Derived from the type strain DSM 2705 Acidithiobacillus thiooxidans ZP_09996293 ATCC 19377 G-Proteobacteria Kimmeridge clay United Kingdom Isolated from groundwater collected from the U.S. Department of Energy Acidovorax ebreus TPSY Integrated Field Research Challenge site at Oak Ridge, TN. Anaerobic NC_0119922 YP_002554355.1 B-Proteobacteria nitrate-dependent Fe(II) oxidizer. Acidovorax sp. NO-1 ZP_09327474 B-Proteobacteria Arsenic-contaminated soil of a gold mine in Daye, Hubei Province, China. Bulk soil of a temperate orchard in sub-tropical Himalayas, India. Thiosulfate- Advenella kashmirensis WT001 YP_006378341 B-Proteobacteria and tetrathionate-oxidizing facultative chemoautotroph Commercial strain used to control crown gall caused by Agrobacterium Agrobacterium radiobacter K84 YP_002542939 A-Proteobacteria tumefaciens

Agrobacterium tumefaciens F2 EGP58529 A-Proteobacteria Soil Agrobacterium vitis S4 YP_002548179 A-Proteobacteria Aerial gall that developed on a two-year-old woody grapevine cane Alkaliphilus metalliredigens QYMF YP_00139025.1 Firmicutes Borax leachate ponds. Halophile, sproulating, metal reducer. alpha proteobacterium BAL199 ZP_02189537 A-Proteobacteria 3m depth of Baltic proper, Sweden. Part of Marine Microbial Initiative. Azorhizobium caulinodans ORS YP_001526311 571 A-Proteobacteria Sesbania rostrata,stem nodules Bilophila sp. 4_1_30 ZP_08840607 D-Proteobacteria Isolated from Aeschynomene indica at the Boyce Thompson Institute for Plant Bradyrhizobium sp. BTAi1 YP_001241694 A-Proteobacteria Research in Ithaca, NY

Bradyrhizobium sp. ORS 375 ZP_09424858 A-Proteobacteria Soil. Nitrogen fixer

94

Table 3-A. (Continued) Organism Accession # Taxonomy Comments Isolated from bird by K Rauss in 1961 for the Institute of Microbiology Pecs, Burkholderia mallei NCTC 10229 YP_001027165 B-Proteobacteria Hungary

Burkholderia phymatum STM815 YP_001859953 B-Proteobacteria Root nodule of Machaerium lunatum in French Guiana Burkholderia phytofirmans PsJN YP_001889649 B-Proteobacteria Surface-sterilized onion roots, Austria. Nitrogen fixer.

Burkholderia pseudomallei 112 ZP_02499519 B-Proteobacteria Clinical isolate from Thailand

Burkholderia sp. H160 ctg00397, NZ_ABYL01000051.1 ZP_03267412.1 B-Proteobacteria Habitat: Host, Rhizosphere, Rhizosphere-colonizing Burkholderia thailandensis ZP_0246466 MSMB43 A-Proteobacteria Drilling bore water

Burkholderia xenovorans LB400 YP_553154 B-Proteobacteria PCB-containing landfill, Moreau, upper New York Candidatus Pelagibacter sp. ZP_05069621 HTCC7211 A-Proteobacteria BATS Bermuda-Atlantic-Time-Series study site

Carnobacterium sp. 17-4 YP_004374227.1 Firmicutes 1999, isolation source: seawater, country: Norway: Isfjord, Spitsberge Chromobacterium violaceum NP_901513 ATCC 12472 B-Proteobacteria Freshwater, Malaysia Citreicella sp. 357 ZP_10021556 A-Proteobacteria Spain Citrobacter freundii Patient with Crohn's disease, female, 25 years old, Emma Allen-Vercoe, 4_7_47CFAA ZP_09332543.1 G-Proteobacteria University of Guelph Citrobacter koseri ATCC BAA- YP_001455284 895 G-Proteobacteria Human infant Citrobacter youngae ATCC 29220 ZP_06356348.1 G-Proteobacteria Normal human gut microbiota.

Clavibacter michiganensis subsp. michiganensis NCPPB 382 YP_001221117.1 Actinobacteria Isolated from Lycopersicon esculentum. Plant pathogen. Clostridium difficile 050-P50- EHJ26972 Firmicutes 2011 Gastrointestinal tract

Collinsella tanakaei YIT 12063 ZP_08853020 Actinobacteria Human feces

Cupriavidus basilensis OR16 ZP_09629724 B-Proteobacteria Obligate anaerobe

95

Table 3-A. (Continued) Organism Accession # Taxonomy Comments

Cupriavidus metallidurans CH34 YP_582918 (aka Ralstonia) B-Proteobacteria Sedimentation pond in a zinc factory, Belgium

Cupriavidus necator N-1 YP_004681452 B-Proteobacteria Soil, University Park, PA Cupriavidus taiwanensis LMG YP_002007847 19424 B-Proteobacteria No information.

Cyanothece sp. CCY0110 ZP_01730757.1 Cyanobacteria Seawater off coast of Zanzibar Cylindrospermopsis raciborskii ZP_06308581 CS-505 Cyanobacteria Australia Desulfomicrobium baculatum YP_003157350 DSM 4028 D-Proteobacteria Manganese ore Desulfosporosinus acidiphilus YP_006466050 SJ4 Firmicutes Acid mining effluent decantation pond; France, Chessy les Mines. Desulfosporosinus youngiae DSM 17734 Firmicutes Constructed wetland sediment, South Carolina Desulfovibrio aespoeensis Aspo- YP_004120927 2 D-Proteobacteria Granitic rock aquifer at 600 m depth; Sweden, Dspv Island

Desulfovibrio alaskensis G20 YP_389820 D-Proteobacteria Isolated from an oil well corrosion site Desulfovibrio desulfuricans YP_005168249 ND132 D-Proteobacteria Mesohaline Chesapeake Bay sediments

Desulfovibrio piger ATCC 29098 ZP_03311345 D-Proteobacteria Human feces

Dickeya dadantii Ech586 YP_003334147 G-Proteobacteria Plant pathogen. Soft rot.

Dickeya zeae Ech1591 YP_003004998.1 G-Proteobacteria Causal agent of onion soft rot

Eggerthella lenta DSM 2243 YP_003180612 Actinobacteria Rectal tumor 1938

Eggerthella sp. 1_3_56FAA ZP_07947962 Actinobacteria Human gastrointestinal tract Enterobacter aerogenes KCTC YP_004591943 2190 G-Proteobacteria Human pathogen, airways

Enterobacter cancerogenus ATCC 35316 ZP_05969302.1 G-Proteobacteria Gastrointestinal tract

Enterobacter cloacae EcWSU1 YP_004950182.1 G-Proteobacteria Onion bulbs that were exhibiting symptoms of rot (Allium cepa = host)

96

Table 3-A. (Continued) Organism Accession # Taxonomy Comments

Enterobacter hormaechei ATCC 49162 ZP_08497854.1 G-Proteobacteria Dputum, San Francisco, CA

Erwinia billingiae Eb661 YP_003742131.1 G-Proteobacteria Trees Erysipelotrichaceae bacterium ZP_07670917 3_1_53 Firmicutes Human feces

Escherichia coli BW2952 E2348_C_4427 G-Proteobacteria Frankia sp. CN3 ZP_09169066 Actinobacteria Soil samples with coriaria nepalensis seeds from Muree, Northern Pakistan

Gallionella capsiferriformans ES- 2 YP_003848507.1 B-Proteobacteria Iron contaminated groundwater in Michigan Gordonibacter pamelaeae 7-10- Sigmoid colon biopsy from University-Hospital Schleswig-Holstein, Kiel, CBL04706 1-b Actinobacteria Germany

Grimontia hollisae CIP 101886 ZP_06052000 G-Proteobacteria Human feces, Maryland

Hafnia alvei ATCC 51873 ZP_09378186.1 G-Proteobacteria Human feces collected in Holland, Netherlands Haloquadratum walsbyi DSM Alicante, Spain. 39% total salinity crystallizer pond; Spain, Brac del Port, 16790 YP_658320.1 Archaea Alicante

Halorhabdus tiamatea SARL4B ZP_08559291 Archaea Isolated from deep-sea brines (2, 3), specifically, from Shaban Deep

Klebsiella oxytoca 10-5242 EHS92055.1 G-Proteobacteria Human Klebsiella pneumoniae subsp. YP_001338118 pneumoniae MGH 78578 G-Proteobacteria Human

Klebsiella variicola At-22 YP_003441654 G-Proteobacteria Atta cephalotes fungus garden Ktedonobacter racemifer DSM ZP_06966694 44963 Chloroflexi Soil from a black locust wood collected in Gerenzano Italy From ponds in the solfatara of San Federigo, a geothermal area near Lago, Kyrpidia tusciae DSM 2912 YP_003590856.1 Firmicutes Tuscany, Italy Labrenzia aggregata IAM 12614 ZP_01549826 )aka Stappia) A-Proteobacteria Damariscotta River in Maine

Labrenzia alexandrii DFL-11 ZP_05116610 A-Proteobacteria Toxic dinoflagellates Alexandrium ostenfeldii and Prorocentrum lima, Germany Laribacter hongkongensis YP_002795579 Blood and thoracic empyema of an alcoholic liver cirrhosis patient in Hong HLHK9 B-Proteobacteria Kong

97

Table 3-A. (Continued) Organism Accession # Taxonomy Comments

Limnobacter sp. MED105 ZP_01914373.1 B-Proteobacteria Surface waters from Eeast Mediterranean Sea (32.81N, 34.69E)

Loktanella vestfoldensis SKA53 ZP_01004208 A-Proteobacteria Seawater taken at a depth of 2-5m from the North Atlantic Ocean

Lyngbya sp. PCC 8106 ZP_01623834 Cyanobacteria Collected in an intertidal zone in Mellum, Germany Magnetospirillum CAM77788 Water and muddy upper layers of sediment from the eutrophic river in gryphiswaldense MSR-1 A-Proteobacteria Germany Head of an oil producing well at offshore oil platform in southern Vietnam near Marinobacter aqueoli VT8 YP_957228.1 G-Proteobacteria Vung Tau Motility Head of an oil producing well at offshore oil platform in southern Vietnam near Marinobacter aqueoli VT8 YP_959556.1 G-Proteobacteria Vung Tau Motility Head of an oil producing well at offshore oil platform in southern Vietnam near Marinobacter aqueoli VT8 YP_956914.1 G-Proteobacteria Vung Tau Motility Head of an oil producing well at offshore oil platform in southern Vietnam near Marinobacter aqueoli VT8 YP_957513.1 G-Proteobacteria Vung Tau Motility

Marinobacterium stanieri S30 ZP_09507874 G-Proteobacteria Coastal lagoon of Chuuk state in Micronesia Maritimibacter alkaliphilus Collected in the Sargasso Sea at the BATS (Bermuda Atlantic Time-Series ZP_01013037 HTCC2654 A-Proteobacteria study) station at a depth of 10 meters. Mesorhizobium australicum ZP_08990586 WSM2073 A-Proteobacteria Northam, Western Australia

Mesorhizobium loti MAFF303099 NP_104470 A-Proteobacteria Japanese bird's-foot trefoil, Tochigi, Japan Mesorhizobium opportunistum YP_004610295 WSM2075 A-Proteobacteria Antonio's farm, Antonio Rd, Northam, Western Australia Isolated in 1998 from the biofilter of a treatment plant in an oil refinery in Los Methylibium petroleiphilum PM1 YP_001023437.1 B-Proteobacteria Angeles, California Isolated in 1998 from the biofilter of a treatment plant in an oil refinery in Los Methylibium petroleiphilum PM1 YP_001023471.1 B-Proteobacteria Angeles, California Methylobacterium nodulans ORS YP_002499389 2060 A-Proteobacteria Root nodules from the legume Crotalaria, Senegal Methylobacterium radiotolerans YP_001756512 JCM 2831 A-Proteobacteria Unpolished rice, Japan

Microvirga sp. WSM3557 ZP_10181447 A-Proteobacteria Root Nodulating Bacteria Mycobacterium thermoresistibile ZP_09080971 ATCC 19527 Actinobacteria Soil

98

Table 3-A. (Continued) Organism Accession # Taxonomy Comments Mycobacterium vanbaalenii YP_956641 PYR-1 Actinobacteria Oil-contaminated sediment in Redfish Bay, TX, USA Nitratireductor aquibiodomus ZP_10237509 RA22 A-Proteobacteria No information.

Oceanibulbus indolifex HEL-45 ZP_02151522 A-Proteobacteria 10m depth at 3 km off the coast of Helgoland in the North Sea, Germany Oceanicola batsensis Seawater collected from a depth of 10m at the Bermuda Atlantic Time Series ZP_00997656 HTCC2597 A-Proteobacteria station in the Sargasso Sea Oceanobacillus iheyensis Deep sea mud at 1050m depth from the Iheya ridge near Okinawa Japan in HTE831 NP_691892.1 Firmicutes 1998 Oceanobacillus iheyensis Deep sea mud at 1050m depth from the Iheya ridge near Okinawa Japan in NP_691892 HTE831 Firmicutes 1998 Ochrobactrum anthropi ATCC YP_001370738 49188 A-Proteobacteria Arsenical cattle-dipping fluid, Queensland, Australia Ochrobactrum intermedium LMG ZP_04680206 330 A-Proteobacteria Human blood

Octadecabacter antarcticus 238 ZP_05065433 A-Proteobacteria 350km offshore off Deadhors, Alaska

Octadecabacter antarcticus 307 ZP_05051097 A-Proteobacteria McMurdo Sound Antarctica O. trichoides subsp. DG-6 was isolated from microbial mats of warm hydrogen Oscillochloris trichoides DG6 ZP_07686103.1 Chloroflexi sulfide springs in the Caucasus region of southeast Europe

Pantoea agglomerans IG1 ZP_10223559 G-Proteobacteria Plant symbiont. Isolated from an outbreak of Eucalyptus blight and dieback in South Africa, Pantoea ananatis LMG 20103 YP_003520690.1 G-Proteobacteria causing major economic losses of this important forestry crop Pantoea vagans C9-1 YP_003931482 G-Proteobacteria Apple Paracoccus denitrificans Habitat is soil and sewage treatment plants. Stores polyhydroxybutyrate, YP_918536 PD1222 A-Proteobacteria Hydrogen oxidizer Paracoccus sp. TRP ZP_08665391 A-Proteobacteria Activated sludge of HuaYang pesticide plant in Shandong, China Pectobacterium atrosepticum YP_048611 SCRI1043 G-Proteobacteria Virulent blackleg isolate, from potato stem, Scotland

Pectobacterium carotovorum subsp. carotovorum PC1 G-Proteobacteria Plant pathogen. Causes soft rot. Pectobacterium wasabiae YP_003258013 WPP163 G-Proteobacteria Plant pathogen. Causes soft rot. Pelagibaca bermudensis ZP_0144529 HTCC2601 A-Proteobacteria Depth of 10m at the Bermuda Atlantic Time Series station in the Sargasso Sea

99

Table 3-A. (Continued) Organism Accession # Taxonomy Comments Phaeobacter gallaeciensis Seawater from larval cultures of the scallop Pecten maximus, in A Coruna, ZP_02146410 BS107 A-Proteobacteria Galicia, Spain Photobacterium angustum S14 ZP_01236242 (aka Vibrio angustum S14) G-Proteobacteria Botany Bay near Sydney Australia from surface waters Photobacterium profundum ZP_01219491 3TCK G-Proteobacteria San Diego Bay Planococcus antarcticus DSM ZP_10206793 14505 Firmicutes Isolated from a cyanobacterial mat sample collected in McMurdo, Antarctica.

Pseudomonas aeruginosa PAO1 NP_252067 G-Proteobacteria Cystic fibrosis patient Pseudomonas fluorescens YP_002871420 SBW25 G-Proteobacteria Leaf surfaces of a sugar beet plant

Pseudomonas mendonica ymp YP_001188370 G-Proteobacteria Sediment, surface holding pond, Nevada Test Site, NV Pseudomonas stutzeri CCUG YP_006455791 29243 G-Proteobacteria No information.

Pseudomonas stutzeri wm88 AAR91738.1 G-Proteobacteria Pig Lagoon, Univeristy of Illinois

Pseudomonas stutzeri, HtxI AAC71719 G-Proteobacteria Pig Lagoon, Univeristy of Illinois Pseudomonas syringae pv. EGH90453 tabaci str. ATCC 11528 G-Proteobacteria Plant pathogen causes soft rot

Pseudovibrio sp. FO-BEG1 YP_005083376 A-Proteobacteria Black band diseased coral

Psychromona ingrahamii 37 YP_944965.1| G-Proteobacteria Arctic polar sea ice; USA, Alaska, Point Barrow, Elson Lagoon

Rahnella aquatilis CIP 78.6 YP_005198610.1 G-Proteobacteria Drinking water, France Ramlibacter tataouinensis Sand particles coated on a meteorite fragment buried in a sandy soil of a semi- YP_004619361 TTB310 B-Proteobacteria arid region of South Tunisia Oxygen Requirement Aerobe Isolated from a mixed plankton sample collected in 1996 from the Billings Raphidiopsis brookii D9 ZP_06305151 Cyanobacteria freshwater reservoir near Sao Paulo, Brazil Isolated from plant host Phaseolus vulgaris. Symbiotic root nodule associated Rhizobium etli GR56 ZP_03521892 A-Proteobacteria nitrogen fixing organsim. Rhizobium leguminosarum bv. YP_002978212 trifolii WSM1325 A-Proteobacteria Livadi beach, Serifos, Cyclades, Greece Rhodobacter capsulatus SB YP_003577361 1003 A-Proteobacteria Soil

100

Table 3-A. (Continued) Organism Accession # Taxonomy Comments

Rhodobacterales bacterium Y4I ZP_05080168 A-Proteobacteria Coastal seawater near St Mary's Georgia Rhodococcus pyridinivorans AK37 ZP_09309098.1 Actinobacteria Crude oil-contaminated site in Hungary

Rhodoferax ferrireducens T118 YP_521433 B-Proteobacteria Aquifer sediment collected at a depth of 18 feet, Oyster Bay, VA, USA Rhodomicrobium vannielii ATCC YP_004011872 17100 A-Proteobacteria Isolated by C B van Niel -- H C Douglas in 1949. Photoheterotrophic N fixer. Rhodopseudomonas palustris BisA53 YP_782024.1 A-Proteobacteria Freshwater sediment samples from De Biesbosch and Haren, the Netherlands Roseobacter denitrificans OCh YP_682647 114 A-Proteobacteria Seaweed, Enteromorpha linza

Roseobacter litoralis Och 149 YP_004690636 A-Proteobacteria Seaweed

Roseobacter sp. SK209-2-6 ZP_01752628 A-Proteobacteria 2500m depth in the Arabian Sea Roseomonas cervicalis ATCC ZP_06897675 49957 A-Proteobacteria Vaginal

Roseovarius nubinhibens ISM ZP_00959410 A-Proteobacteria Surface waters of the Caribbean Sea

Ruegeria pomeroyi DSS-3 YP_165734 A-Proteobacteria Isolated off of the coast of Georgia in 1998Collection Date Salmonella enterica subsp. arizonae serovar 62:z4,z23:-- YP_001572351 str.RSK2980 G-Proteobacteria Cornsnake in 1986 in Oregon

Serratia odorifera DSM 4582 ZP_06637434 G-Proteobacteria Sputum, Bordeaux, France

Serratia proteamaculans 568 YP_001476754.1 G-Proteobacteria Root endophyte from Populus trichocarpa Shigella boydii Sb227 YP_410381.1 G-Proteobacteria Isolate from an epidemic that took place in China in the 1950s

Shigella dysenteriae Sd197 YP_405519 G-Proteobacteria Epidemic in China in the 1950s Shigella flexneri K-272 EGK30494 G-Proteobacteria Shigella sonnei Ss046 YP_313004.1 G-Proteobacteria Isolate from an epidemic in China in the 1950s

Silicibacter sp. TrichCH4B ZP_05739344 A-Proteobacteria Trichodesmium colonies collected in the Caribbean Sea

Sinorhizobium fredii HH103 YP_005191729.1 A-Proteobacteria Isolated from Chinese soil from Hubei Province

Starkeya novella DSM 506 YP_003694419 A-Proteobacteria Soil before 1934

Sulfitobacter sp. EE-36 ZP_00956801 A-Proteobacteria Surface waters of coastal Georgia

101

Table 3-A. (Continued) Organism Accession # Taxonomy Comments

Synechococcus sp. PCC 7335 ZP_05038223 Cyanobacteria Snail shell, intertidal zone, Puerto Penasco, Mexico Deinococcus- Thermus thermophilus HB8 BAL42537.1 Thermus Mine hot spring, Shizuoka, Japan

Thiobacillus denitrificans ATCC 25259 YP_316051.1 B-Proteobacteria Isolated by Beijerinck over a century ago

Thiomicrospira crunogena XCL-2 YP_392348.1 G-Proteobacteria Deep-sea hydrothermal vent

Tistrella mobilis KA081020-065 YP_006371521 A-Proteobacteria No information. Trichodesmium erythraeum IMS101 YP_724387.1 Cyanobacteria Isolated from the North Carolina coast in 1992 and grows in straight filaments Variovorax paradoxus S110 is able to grow autotrophically using hydrogen gas Variovorax paradoxus S110 YP_002947925 and carbon dioxide for energy and carbon. It is also frequently enriched in B-Proteobacteria biodegradative enrichments from heavily contaminated sites. Verminephrobacter aporrectodeae subsp. ZP_08874319 tuberculatae At4 B-Proteobacteria Isolated in Denmark Verminephrobacter eiseniae YP_997713 EF01-2 B-Proteobacteria Kidney of the earthworm Eisenia foetida, Seattle, USA Isolated from Bivalve larvae (Nodipecten nodosus) for Culture of Marine Vibrio brasiliensis LMG 20546 ZP_08099616 G-Proteobacteria Molluscs Florianopolis Brazil Vibrio nigripulchritudo ATCC ZP_08731570 27043 G-Proteobacteria Seawater, chitin enrichment Vibrio shilonii AK1 ZP_01866174 G-Proteobacteria 3m depth at Bleached coral Mediterreanean

Xanthobacter autotrophicus Py2 YP_001416219 A-Proteobacteria Isolated with propene as a sole carbon and energy source

Yersinia bercovieri ATCC 43970 ZP_04627511 G-Proteobacteria Human feces in France

Yersinia enterocolitica subsp. palearctica 105.5R(r) YP_004296691.1 G-Proteobacteria Chinese patient This strain is a Medievalis subtype (biovar) that is widely used in research and Yersinia pestis KIM10+ NP_668063 G-Proteobacteria is well characterized. Human pathogen causes bubonic plague

Yersinia ruckeri ATCC 29473 ZP_04616522 G-Proteobacteria Rainbow trout, Onchorhynchus mykiss with enteric red mouth disease

Yokenella regensburgei ATCC 43003 ZP_09386711.1 G-Proteobacteria Human feces collected in NJ