View of the Proteins Encoded by the MV Genome and Their Functions Are Summarized Below

Development and Use of Recombinant Oncolytic Measles Viruses for the Treatment of Medulloblastoma

Dissertation

Presented in Partial Fulfillment of the Requirements for the Degree Doctor of Philosophy in the Graduate School of The Ohio State University

Brian John Hutzen, B.A.

Graduate Program in Molecular, Cellular and Developmental Biology

The Ohio State University

2012

Dissertation Committee:

Corey Raffel, Advisor

Balveen Kaur

Stefan Niewiesk

Christopher Pierson

Brian John Hutzen

2012

Abstract

Medulloblastoma is the most common malignant brain tumor of early childhood. Our understanding of this disease, its etiology, and treatment has improved considerably over the past several years and is reflected in 5-year survival rates that now exceed 70%. Despite these advancements, numerous challenges in the effective treatment of medulloblastoma remain.

Conventional therapy, which consists of surgical resection and craniospinal irradiation with or without chemotherapy, is associated with significant neurocognitive morbidity. In addition, a sizable subset of medulloblastoma patients will effectively remain incurable because of medulloblastoma’s propensity to disseminate along the spinal canal within the cerebrospinal fluid. Alternative treatment modalities for medulloblastoma are thus clearly needed. One promising approach is the development and use of recombinant oncolytic measles viruses.

These viruses, which are based on the attenuated Edmonston vaccine strain virus, display a natural tropism for malignant cells and induce their fusion and subsequent death via apoptosis following infection. We have demonstrated that medulloblastoma tumor cells are highly susceptible to measles virus-induced oncolysis, and measles virus treatment can significantly prolong survival in mouse xenograft models of localized and disseminated disease. We have also utilized recombinant viruses expressing transgenes for the thyroidal sodium iodide symporter and the angiogenesis inhibitors endostatin and angiostatin to further augment the efficacy of measles virotherapy. Our initial results are encouraging and suggest that measles virus-based therapies may be of clinical utility in the treatment of medulloblastoma. ii

Dedicated to my loving parents, Christina, and all the friends I met along the way.

iii

Acknowledgments

I would first and foremost like to thank my advisor, Corey Raffel, for his guidance, friendship and all the opportunities he provided me over the last few years. It was a pleasure serving in your lab. I would also like to extend my sincerest gratitude to Adam Studebaker, who took me under his wing and helped me become a better scientist. Your advice and your friendship were truly appreciated. I would also like thank the members of my graduate advisory committee, Balveen

Kaur, Stefan Niewiesk and Chris Pierson for their insights and guidance in developing my research career.

There are also many friends I need to thank, in particular my fellow classmates Tom Bebee and

Kevin Bosse. You both helped me in ways you are probably not even aware of, and your friendship meant the world to me. I would also like to thank my former lab mates in the Lin lab, whose companionship got me through some crazy and hectic times. I wish you all nothing but success and happiness down the road.

Finally, I must thank my two wonderful parents, Harold and Diane, my sister, Kristin, and my beautiful fiancée Christina. Your love and support carried me through the darkest of days, and when my confidence in myself wavered, yours stood all the more firm. No amount of words on my part can ever truly express my gratitude and love for you all. Thank you so much.

Vita

November 19, 1980 ……………………………………………….. Born in Youngstown, Ohio

1999 ……………………………………………………………………….. Graduated from Poland Seminary

High School

2003 ………………………………………………………………………. Bachelor of Arts, Biology, Washington and

Jefferson College

2005 – present ………………………………………………………. Graduate Research Associate, Molecular,

Cellular and Developmental Biology

2008 ………………………………………………………………………. Graduate Teaching Associate, Center for

Life Sciences Education, Biology 113

2011 – present ………………………………………………………. Pelotonia Graduate Fellow

Publications

1. Studebaker AW, Hutzen B, Pierson CR, Russell SJ, Galanis E, et al. (2012) Oncolytic measles virus prolongs survival in a murine model of cerebral spinal fluid-disseminated medulloblastoma. Neuro Oncol 14(4): 459-470.

2. Lin L, Hutzen B, Li PK, Ball S, Zuo M, et al. (2010) A novel small molecule, LLL12, inhibits STAT3 phosphorylation and activities and exhibits potent growth-suppressive activity in human cancer cells. Neoplasia 12: 39-50. v

3. Lin L, Hutzen B, Zuo M, Ball S, Deangelis S, et al. (2010) Novel STAT3 phosphorylation inhibitors exhibit potent growth-suppressive activity in pancreatic and breast cancer cells.

Cancer Res 70: 2445-2454.

4. Canner JA, Sobo M, Ball S, Hutzen B, DeAngelis S, et al. (2009) MI-63: a novel small-molecule inhibitor targets MDM2 and induces apoptosis in embryonal and alveolar rhabdomyosarcoma cells with wild-type p53. Br J Cancer 101: 774-781.

5. Cen L, Hutzen B, Ball S, DeAngelis S, Chen CL, et al. (2009) New structural analogues of curcumin exhibit potent growth suppressive activity in human colorectal carcinoma cells. BMC

Cancer 9: 99.

6. Fuh B, Sobo M, Cen L, Josiah D, Hutzen B, et al. (2009) LLL-3 inhibits STAT3 activity, suppresses glioblastoma cell growth and prolongs survival in a mouse glioblastoma model. Br J Cancer 100:

106-112.

7. Hutzen B, Friedman L, Sobo M, Lin L, Cen L, et al. (2009) Curcumin analogue GO-Y030 inhibits

STAT3 activity and cell growth in breast and pancreatic carcinomas. Int J Oncol 35: 867-872.

8. Lin L, Hutzen B, Ball S, Foust E, Sobo M, et al. (2009) New curcumin analogues exhibit enhanced growth-suppressive activity and inhibit AKT and signal transducer and activator of transcription 3 phosphorylation in breast and prostate cancer cells. Cancer Sci 100: 1719-1727.

9. Hutzen B, Willis W, Jones S, Cen L, Deangelis S, et al. (2009) Dietary agent, benzyl isothiocyanate inhibits signal transducer and activator of transcription 3 phosphorylation and collaborates with sulforaphane in the growth suppression of PANC-1 cancer cells. Cancer Cell Int

9: 24.

10. Chen CL, Cen L, Kohout J, Hutzen B, Chan C, et al. (2008) Signal transducer and activator of transcription 3 activation is associated with bladder cancer cell growth and survival. Mol Cancer

7: 78.

11. Lieblein JC, Ball S, Hutzen B, Sasser AK, Lin HJ, et al. (2008) STAT3 can be activated through paracrine signaling in breast epithelial cells. BMC Cancer 8: 302.

Fields of Study

Major Field: Molecular, Cellular and Developmental Biology

iii

Table of Contents

Abstract ...... ii Acknowledgments...... iv Vita ...... v Publications ...... v Fields of Study ...... iii List of Tables ...... ii List of Figures ...... iii List of Abbreviations ...... iv Chapter 1: Background ...... 1 Medulloblastoma ...... 1 Diagnosis and treatment ...... 4 Sequelae ...... 6 The Measles Virus ...... 10 Basic Biology ...... 12 Oncolytic virotherapy and rationale for measles virus-based therapies...... 19 Oncolytic measles viruses...... 22 Considerations for measles virotherapy...... 28 Treatment of medulloblastoma with oncolytic MV ...... 30 Chapter 2: Oncolytic measles virus prolongs survival in a murine model of cerebral spinal fluid- disseminated medulloblastoma ...... 35 Introduction ...... 35 Material and Methods ...... 37 Results ...... 42 Discussion ...... 56 Acknowledgements ...... 60 Chapter 3: Treatment of medulloblastoma using an oncolytic measles virus encoding the thyroidal sodium iodide symporter shows enhanced efficacy with radioiodine ...... 61

Introduction ...... 61 Materials and Methods ...... 63 Results ...... 68 Discussion ...... 77 Acknowledgements ...... 82 Chapter 4: Treatment of medulloblastoma with oncolytic measles viruses expressing the angiogenesis inhibitors endostatin and angiostatin ...... 84 Introduction ...... 84 Materials and Methods ...... 87 Results ...... 96 Discussion ...... 105 Ongoing experiments and future directions ...... 109 Acknowledgements ...... 111 Chapter 5: Future directions and concluding remarks ...... 112 References ...... 118

iii

List of Tables

Table 1.1 Medulloblastoma subtypes according to histopathology and molecular profile...... 4

Table 5.1 Comparison of oncolytic viruses in preclinical testing for medulloblastoma treatment...... 114

List of Figures

Figure 1.1 The measles virus...... 13

Figure 1.2 Schematic representation of the measles virus life cycle……………………………………………………..….19

Figure 1.3 Potential modifications to MV-Edm through genetic engineering...... 22

Figure 1.4 Medulloblastomas express CD46...... 31

Figure 1.5 MV-GFP treatment reduces tumor burden in nude mice...... 33

Figure 2.1 In vivo evaluation of medulloblastoma dissemination and disease progression...... 43

Figure 2.2 Histological examination (H&E stain) of the mouse brain following injection of medulloblastoma cells into the right lateral ventricle of the mouse brain...... 46, 47

Figure 2.3 Evaluation of MV efficacy against disseminated medulloblastoma...... 49

Figure 2.4 MV treatment prolongs survival of mice with disseminated medulloblastoma...... 51

Figure 2.5 Immunohistochemical detection of measles virus...... 54

Figure 2.6 Immunohistochemical staining for apoptosis and cell proliferation...... 55

Figure 3.1 MV-NIS induces syncytia formation and cell death in medulloblastoma cell lines...... 70

Figure 3.2 MV-NIS promotes radioiodine uptake in infected medulloblastoma cells...... 71

Figure 3.3 MV-NIS with and without 131I prolongs survival in mouse models of medulloblastoma...... 74

Figure 3.4 Histology of control and MV-NIS plus 131I treated mice...... 76

Figure 4.1 Construction of MV-E:A viruses and evaluation of their cytopathic activity...... 97

Figure 4.2 MV-hE:A and MV-mE:A infection results in the secretion of active endostatin:angiostatin...... 100

Figure 4.3 MV-hE:A and MV-mE:A conditioned media inhibit angiogenic processes...... 102

Figure 4.4 MV-E:A infection downregulates multiple angiogenic factors in D283med-luc xenografts...... 103

Figure 4.5 MV-E:A viruses prolong survival in mouse xenograft models of medulloblastoma...... 105

iii

List of Abbreviations

CD46 Membrane cofactor protein with cluster of differentiation number 46

CEA Carcinoembryonic antigen

CMS Cerebellar mutism syndrome

CNS Central nervous system

CSI Craniospinal irradiation

CSF Cerebrospinal fluid

CT Computed tomography dceMRI Dynamic contrast-enhanced magnetic resonance imaging

DI Defective interfering

ECM Extracellular matrix

EGF Epidermal growth factor

EGFR Epidermal growth factor receptor

FACS Fluorescence-activated cell sorting

FGF Fibroblast growth factor

GFP Green fluorescent protein

HUVEC Human umbilical vein endothelial cells

IFN Interferon

IHC Immunohistochemistry

IGFBP Insulin-like growth factor-binding protein

MEC Mouse endothelial cells

MeP-dR 6-methylpurine-2'-deoxyriboside

MOI Multiplicity of infection

MRI Magnetic resonance imaging mTOR Mammalian target of rapamycin

MV Measles virus

MV-hE:A MV encoding Endostatin:Angiostatin (human)

MV-mE:A MV encoding Endostatin:Angiostatin (mouse)

MV-Edm Edmonston vaccine strain MV

MV-GFP MV encoding green fluorescent protein

MV-mGM-CSF MV encoding mouse granulocyte macrophage colony-stimulating factor

MV-NAP MV encoding Helicobacter pylori neutrophil-activating protein

MV-NIS MV encoding sodium iodide symporter

MV-PNP MV encoding Escherichia coli purine nucleoside phosphorylase

NIS Sodium iodide symporter

NPR3 Natriuretic peptide receptor 3

ORF Open reading frame p/s/cm2/sr Photons per second per centimeter2 per steradian

PDGF Platelet derived growth factor

PET Positron emission tomography

PI3K Phosphatidylinositol-3-kinase

PlGF Placental growth factor

ScFV Single-chain variable fragment (single-chain antibody)

SHH Sonic hedgehog

SLAM Signaling lymphocyte activation molecule

SPECT Single photon emission computed tomography ii

TBST Tris-buffered saline solution with Tween 20

TCID50 Tissue culture infectious dose 50

TGF Transforming growth factor uPA Urokinase plasminogen activator

iii

Chapter 1: Background

Medulloblastoma

Medulloblastoma is the most common malignant brain tumor in children [1]. The term medulloblastoma was first coined by neurosurgeons Harvey Cushing and Percival Bailey in 1925 to describe “a very cellular tumor of a peculiar kind” that had developed in the cerebellar vermis of 29 pre-adolescent patients under their care [2]. Believing these tumors represented a subtype of glioma, Cushing and Bailey initially termed them “spongioblastoma cerebelli.” They hypothesized that the origin of these tumors was a hypothetical progenitor cell that was known as the “medulloblast,” and spongioblastoma cerebelli eventually came to be known simply as medulloblastoma [3]. Despite an ongoing lack of evidence for the existence of the medulloblast some 80 years later, the term medulloblastoma has persisted and gained world-wide acceptance as the designation for this unique class of central nervous system (CNS) tumor.

Medulloblastomas account for 20% of all pediatric CNS tumors and 40% of all posterior fossa tumors, representing approximately 540 new cases in the United States each year [4-6].

Although persons of any age can develop medulloblastoma, the peak age of occurrence is around four years of age [7]. These tumors most commonly arise in the midline vermis within the vicinity of the fourth ventricle. Ventricular occlusion is common, and involvement of the brainstem can occur if the tumor invades the floor of the ventricle. Medulloblastomas are also

known for their propensity to disseminate through the subarachnoid space within the cerebrospinal fluid (CSF), allowing them to metastasize to distant sites around the brain and along the spinal canal [8].

A great deal of heterogeneity exists across medulloblastomas, and the World Health

Organization currently recognizes five subgroups of the disease based upon prognosis and histopathology. These subgroups, ranging in degree from least to most severe, are designated as desmoplastic/nodular, classic, anaplastic, and large cell anaplastic [9, 10]. Classic medulloblastomas are identified as small cells with high nuclear-to-cytoplasmic ratios layered in sheets. The desmoplastic/nodular subtype is comprised of pleomorphic desmoplastic cells that are interspersed with nodules of slower-growing, differentiated neurocytic cells.

Medulloblastomas of the anaplastic subtype feature rapidly dividing polymorphic cells and relatively high rates of apoptosis, whereas the large-cell anaplastic subtype of medulloblastoma is identified by large uniform cells with vesicular nuclei and a single nucleolus [10].

Extensive transcriptional profiling of human medulloblastomas has recently yielded a second and more precise classification system that stratifies medulloblastomas according to their mRNA expression profiles [11-13]. Four subgroups with distinct mRNA signatures have been identified, and are presently categorized as WNT, Sonic hedgehog (SHH), Group 3 and Group 4 [12].

Medulloblastomas in the WNT subgroup feature genetic alterations that affect members of the

Wnt signaling pathway, which are linked to the processes of embryogenesis and oncogenesis

[11, 14]. Mutations of the β-catenin gene and monosomy 6 are among the more common genetic events that define this subgroup, and the incidence rate among males and females is approximately equal. WNT subgroup medulloblastomas tend to affect older children and are rare in adults. Among the different subgroups, WNT tumors have the best prognosis and clinical 2

outcomes [11]. The SHH subgroup is characterized by upregulation of members of the SHH signaling family. Common genetic events exclusive to this subgroup are mutations in the genes for PTCH, the receptor of SHH, and SUFU, a negative regulator of the SHH signaling pathway

[11]. SHH tumors are the most common subgroup of medulloblastoma found in infants and adults, and they carry an intermediate prognosis. Like the WNT subgroup, the incidence of SHH tumors is equal for males and females. Group 3 tumors are characterized by over-amplification of MYC and genes related to the processes of phototransduction and glutamate signaling. These tumors are also known for their high frequency of metastasis and have the worst prognosis of any medulloblastoma subtype. Group 3 tumors are extremely rare in adults, and are more prevalent in males than females. The last subgroup, currently known as Group 4, is characterized by upregulation of genes related to neuronal or glutameminergic signaling.

Although these tumors are common across all age groups, comparatively little is known about them [12]. Like Group 3, Group 4 tumors are more prevalent in males and have a high tendency to metastasize. Their prognosis is considered intermediate.

A summary of the histopathological and molecular subtypes of medulloblastoma is shown in

Table 1.1. Overlap between the two classification systems is incomplete, however, and medulloblastomas stratified by molecular subtype may fall into multiple subtypes when classified histologically and vice versa [15]. Despite these incongruences, the disease stratification systems available for medulloblastoma are useful prognostic tools and can help guide critical decisions in patient care.

Table 1.1 - Medulloblastoma subtypes according to histopathology and molecular profile. Table adapted from Gilbertson 2008 and Northcott 2010.

Diagnosis and treatment

Because medulloblastomas arise in the cerebellum, patients accordingly present with symptoms of cerebellar dysfunction. Some common symptoms include headaches, irritability, vomiting, ataxia, and trouble maintaining balance, which are consequences of increased intracranial pressure from obstructive hydrocephalus [4, 16]. The severity of these symptoms can vary with the patient’s age and the extent of the disease. Seizures and symptoms of cord compression may also be evident in instances where the tumor has disseminated into the cerebral hemispheres and spinal cord, respectively [4]. The initial diagnosis of medulloblastoma is typically made on a computed tomography (CT) scan, where the tumor appears as a solid, homogeneous mass in the posterior fossa. Magnetic resonance imaging (MRI) of the brain and spine is then performed for further confirmation and to assess if spinal dissemination of the

tumor has occurred. In the absence of hydrocephalus, a lumbar puncture may also be recommended to assay for the presence of circulating tumor cells in the CSF [4].

Treatment strategies for medulloblastoma are based on a system of risk stratification, which takes into account the patient’s age, whether there is postoperative residual disease, and the extent of any tumor dissemination if present [8]. Patients that fall into the category of standard risk are those three years of age or older with no evidence of spinal metastasis on presentation

[5]. Surgical resection of the tumor with the goal of gross total resection is the standard of care in these patients, and is usually followed with craniospinal irradiation (CSI) of 23.4 Gy plus a localized boost to the posterior fossa totaling up to 55.8 Gy [5]. Adjuvant chemotherapy, including alkylating agents and platinum derivatives such as vincristine, lomustine, cyclophosphamide and cisplatin, may also be administered over the following year [7]. Whereas medulloblastoma was an invariably fatal disease at the time of Bailey and Cushing, the 5-year overall survival rate for patients with average risk disease is currently on the order of 80% or higher [17].

High risk medulloblastoma patients are those greater than three years of age with subtotal resection and/or evidence of disseminated disease. These are well-established indicators of poor clinical outcome, and the intensity of the treatment varies accordingly [1, 18]. Surgical resection remains the mainstay of treatment for these patients, but the following dose of CSI is increased to 36 Gy plus a similarly high boost to the posterior fossa. A more aggressive regimen of adjuvant chemotherapy may also be recommended in high risk treatment protocols [5].

Despite these added measures , the current survival rate for high risk medulloblastoma patients is dismal, ranging from only 34 to 40% across studies [19].

A third medulloblastoma risk category is comprised of very young children (i.e. children under the age of three). Medulloblastomas in the very young have been reported to be more vascular, behave more aggressively and have a higher incidence of metastasis than those found in older patients [20, 21]. As such, disease management in this category is particularly challenging and is exacerbated by the increased susceptibility of the developing brain to the toxicities associated with conventional therapy [22]. Radiation therapy in particular is known to be especially damaging to the pediatric brain, and has been associated with a broad spectrum of neurocognitive and endocrine impairments (see section on sequelae below) [23, 24]. Optimal treatment protocols for the treatment of medulloblastoma in the very young have yet to be formally established, but a common aim is to delay or obviate radiation therapy by using different chemotherapy regimens [7]. Patients in this risk group fare consistently worse than their older counterparts, both in terms of overall survival and in treatment-related impairments

[4].

Sequelae

Although recent advancements in the diagnosis and treatment of medulloblastoma have led to increased survival rates across risk categories, these statistics belie the devastating toll of the disease. Contemporary treatment strategies, while seemingly effective, are not without risks and associated morbidities. One common complication following surgical resection of the tumor is the development of cerebellar mutism syndrome (CMS), which is also known as posterior fossa syndrome [7]. CMS is a condition that arises one to two days following surgery and may persist for weeks to months afterwards. The syndrome, which is estimated to occur in 8 – 31% of patients, is marked by severely diminished or absent speech, hypotonia, ataxia, disinhibition 6

and emotional instability [25]. Symptoms of brainstem dysfunction can also occur, and include facial muscle weakness, dysphagia, and abducens paralysis [7]. The spatial distribution and location of the tumor can also factor in to the extent and severity of CMS; right-sided cerebellar tumors are associated with problems of auditory sequential memory and language processing and left-sided tumors are more likely to lead to deficits in spatial and visual memory [26].

Recent studies suggest that more severe forms of CMS may also be associated with permanent residual neurological and cognitive impairments [27].

The devastating impact of CSI on the pediatric brain has also been well established. Potential side effects of radiation therapy include loss of hearing [28], endocrine system abnormalities

[29], the occurrence of secondary malignancies [30], and significant declines in cognitive abilities

[31]. Younger patients are particularly susceptible to neurocognitive morbidity, and a dose- response relationship exists between the amount of radiation administered and the degree of impairment observed [32]. Many of the deficits associated with CSI can be permanent, and greatly impact the quality of the patient’s life. A 1997 study conducted by Kiltie et al. examined the late term effects of CSI in adult survivors of early childhood medulloblastoma [33]. Sixteen patients who had survived more than 10 years without relapse were followed in this study.

Fifteen of these patients had required learning assistance during school, six to a degree that necessitated their placement in schools that specifically cater to those with learning and/or physical disabilities. The early onset of puberty was documented in four patients, two of which would also develop clinical hypothyroidism. Of the nine patients who met working eligibility requirements at the time of study, only one was able to successfully hold down a job. None of the patients had married. In addition, four of the patients had developed secondary

malignancies, one patient required a back brace for severe kyphosis and another had developed cataracts [33].

A more formal analysis of the long-term neurocognitive, functional and physical outcomes of medulloblastoma patients was recently completed by Edelstein and colleagues [34]. This study followed 20 adults ages 18-47 that were treated for childhood medulloblastoma with surgery and adjuvant CSI. A comprehensive neuropsychological assessment was made for each patient.

As a whole, the former medulloblastoma patients had below average Wechsler Abbreviated

Scale of Intelligence IQ scores relative to population norms. Several other neurocognitive domain scores were likewise deficient; scores assigned to working memory, speed, memory, executive function, academic achievement, and motor dexterity were all statistically lower than age-matched population norms. The authors also noted a clear association between younger age at diagnosis and poorer IQ and academic achievement scores. The level of impairment was also exacerbated over time regardless of the patient’s age at diagnosis. In terms of physical outcomes, the findings of Edelstein et al. closely mirror those presented in the Kiltie study [33].

Incidences of hearing loss, secondary malignancies and endocrine abnormalities including hypothyroidism were all observed. Functional and social outcomes were similarly deficient.

Ninety percent of the former patients had required learning assistance during their school years.

All but one patient eventually finished high school, but none went on to complete any level of college education. Eighty-five percent of these patients still lived at home and were supported by their parents, 25% of which could be considered fully dependent on parental or professional care. None of the patients had married, and only 55% were employed in some capacity. In contrast, the vast majority of their age-matched peers were married, employed, and had at least some post-secondary education [34].

The prevalence and severity of such sequelae in medulloblastoma patients underscores the need to develop new and more effective modalities for the treating the disease. An ideal therapy would be minimally invasive, selective for the tumor cells to minimize unintended toxicity, affordable, and easily administered. As our knowledge of medulloblastoma and its molecular underpinnings continue to expand, so too will our ability to identify and develop novel therapies to combat it. One potential strategy that is currently being investigated in our lab centers on what was until fairly recently one of the worst scourges of mankind – the measles virus.

The Measles Virus

Measles virus (MV) is a member of the genus Morbillivirus in the Paramyxoviridae family.

Measles, the disease caused by MV infection, is historically one of the most devastating infectious diseases of mankind and was responsible for millions of deaths per year prior to the introduction of measles vaccines [35]. MV is a close relative of the recently eradicated rinderpest virus, a cattle pathogen it is believed to have diverged from following zoonotic transmission sometime in the 11th or 12th century [36]. MV is one of the most highly contagious pathogens, spreading readily from infected carriers to susceptible hosts through respiratory transmission. Initial infection is now thought to occur in the macrophages and dendritic cells of the airways [37]. These infected cells then migrate to involve the epithelial cells of the upper respiratory tract, where viral replication occurs and spreads into local lymphatic tissues [35].

Viremia and further dissemination of the virus soon follow as MV continues to replicate in lymphocytes, monocytes and epithelial cells of distant organs such as the skin, liver, kidneys and gastrointestinal tract [38]. Symptoms of measles, which manifest as fever, cough, conjunctivitis and the appearance of a characteristic maculopapular rash, are due to a strong measles-specific immune response [39]. In an immunocompetent host, the involvement of the innate and adaptive systems of immunity is usually sufficient to control spread and promote viral clearance, leading to lifelong immunity from future MV infections. Initial exposure to MV is concomitant with a generalized dampening of the host immune response, however, which can persist for several weeks following acute infection [40]. Although MV itself can cause severe and sometimes lethal complications, the majority of fatalities associated with the disease are due to secondary, opportunistic infections such as bronchitis and pneumonia that arise during this period of immune suppression [40, 41].

The earliest known attempt of developing a measles vaccine dates back to 1749 and is attributed to the Scottish physician Francis Home [42]. Following the principles of variolation,

Home inoculated individuals with blood taken from measles patients at the early onset of the disease. He hypothesized that this route of transfer would lessen the impact of measles on the patients’ lungs [43]. Home’s findings were discouraging however, as his methods merely led to the full transmission of the disease [44]. Later attempts in the 1920s and 1940s to attenuate MV by culturing it in chick embryos produced similar outcomes [44, 45]. The breakthrough that would eventually lead to the development of a measles vaccine occurred in 1954, with the isolation of MV in tissue culture by John Enders and Thomas Peebles [46]. This strain of virus, originally isolated from the throat culture of a young boy named David Edmonston, came to be known as the Edmonston strain (MV-Edm). Serial passaging of MV-Edm in human and monkey kidney cells resulted in a loss of the virus’s pathogenicity, paving the way for the development of both inactivated and live attenuated MV vaccines in the early 1960s [44]. Inactivated vaccines soon proved to be ineffective, however, and were discontinued shortly after their introduction

[47]. The first live attenuated vaccine based on MV-Edm was released in 1963. Although the vaccine was effective in promoting measles immunity, it was also found to be reactogenic and caused the development of fever and rash in several measles-naïve children [48]. Subsequent passaging of MV-Edm in other cells, such as chick embryo fibroblasts, led to further attenuation of the virus and the development of safer vaccine strains such as the Schwarz and Moraten vaccines, which are still in extensive use today [44]. The advent of safe and effective vaccines has led to a drastic reduction in the number of measles-related mortalities, with the World

Health Organization estimating 164,000 deaths attributable to measles-related causes for the year 2008, the vast majority confined to regions of the developing world [49]. Despite significant

advancements in disease control, measles remains a considerable public-health concern and recent outbreaks in even the most industrialized of nations highlight the challenges in sustaining measles elimination [35, 50, 51]. A long-standing goal to achieve the complete eradication of measles has led to significant advancements in our understanding of the disease and the virus responsible for it. These insights have not only made measles elimination a distinct possibility in the future, but have also led to the development of a potentially useful tool in the treatment of human cancers.

Basic Biology

MV is a spherical, enveloped virus that ranges in size from 300-1000nm (Figure 1.1A) [52]. Like all members of the Paramyxoviridae family, MV features a non-segmented, single-stranded, negative-sense RNA genome that acts as a template for the production of viral genes and the synthesis of full-length anti-genomic RNA [53, 54]. The MV genome is comprised of approximately 16,000 nucleotides and encompasses six genes that translate into eight viral proteins. These include three proteins involved in viral genome transcription and replication known as the nucleocapsid protein (N), the phosphoprotein (P), and the large protein/polymerase (L); two envelope glycoproteins that mediate cell entry known as the hemagglutinin (H) and fusion (F) proteins; and two virulence factors referred to as the C and V proteins (Figure 1.1B) [55, 56]. Each gene is separated by a tri-nucleotide intergenic sequence and 3’ and 5’ terminal sequences that contain genomic and anti-genomic promoters respectively

[57]. The viral polymerase transcribes each gene in sequence, starting from the 3’ end of the genome [58]. Failure of the polymerase to reinitiate transcription at the junctions separating each gene produces a gradient of viral transcripts, with genes closer to the 3’ end of the genome 12

being produced in greater abundance (Figure 1.1C) [57]. A brief overview of the proteins encoded by the MV genome and their functions are summarized below.

Figure 1.1 - The measles virus. A. A cartoon showing the basic components and structure of a measles virus particle. B. A schematic of the MV genome. The C and V genes are the products of an alternative open reading frame and co-transcriptional editing respectively. C. Relative transcription levels of six MV genes. The failure of the MV polymerase to properly reinitiate transcription at the next promoter creates a gradient of viral transcripts with the 3’ proximal genes being more highly expressed. Figure adapted from Moss and Griffin 2012 and Billeter 2009.

The N protein is the most abundant of the viral proteins. N is synthesized on free ribosomes in the cytosol, where it proceeds to tightly bind and organize viral RNA into a helical nucleocapsid

[59, 60]. Each nucleoprotein monomer interacts precisely with six ribonucleotides, necessitating that the MV genome be of polyhexameric length in order to be efficiently synthesized and

packaged. This strict requirement of MV and the other Paramyxoviridae has appropriately been dubbed the “rule of six” [61-63]. In addition to structural support, the N protein has been shown to make numerous interactions with various cellular and viral proteins via its C-terminal domain, which are believed to be critical for viral transcription and replication [59].

The P protein is a component of the functional viral polymerase (described in detail below) [58].

P acts as a cofactor to tether the polymerase to the nucleocapsid, forming the ribonucleoprotein core of the virus. The ribonucleoprotein is the basic unit of MV infectivity and is responsible for coordinating all viral transcription and replication [64, 65]. The P protein has also been implicated to play a role in the downregulation of the host immune response following MV infection by suppressing interferon (IFN) α/β activity through a variety of different mechanisms

[66, 67]. The gene that encodes P carries the distinction of being the only MV gene to be transcribed in a polycistronic fashion, as its sequence also encodes the genes for the C and V proteins.

The C and V proteins are nonstructural proteins that function as virulence factors and contribute to efficient viral proliferation through modulation of host cell events [68, 69]. The C protein is translated from an alternative open reading frame (ORF) in the P gene, and thus has a unique amino acid sequence [64]. C protein has been shown to inhibit apoptosis of MV-infected cells by suppressing the activity of PKR, a protein kinase that acts to counter viral infections by phosphorylating the translation initiation factor eIF2α and shutting down protein synthesis in the infected cell [70]. There are also reports that C protein plays a direct role in host immune suppression through the downregulation of IFN β [71, 72]. The V protein is transcribed from the same ORF as the P gene, but the co-transcriptional insertion of a nontemplate guanosine at P mRNA position 751 produces a truncated variant of the P protein (299 amino acids versus 507) 14

with a unique c-terminus [73]. The V protein is a potent inhibitor of IFN-inducible gene expression [74], which it accomplishes in part by interfering with the interaction between the kinase Jak1 and the signal transducer and activator of transcription STAT1 [75]. The IFN- antagonistic activity of the C and V proteins is notably absent in the MV-Edm strain due to amino acid substitutions Y110H and C272R in the P gene, which contribute to the attenuated nature of this strain [76, 77].

Immediately downstream of the P gene is the M gene, which encodes the M protein that is synthesized in the cytoplasm of the host cell following MV infection [78]. Binding sites on the M protein allow it to interact with the viral ribonucleoprotein, the F and H envelope glycoproteins, and the lipid bilayer of the host cell membrane [58, 78]. These associations are believed to be the driving force for initiating the assembly and budding of new progeny virions [58, 79]. A role in the modulation of viral mRNA synthesis has also been ascribed to the M protein, as its removal from the ribonucleoprotein results in increased levels of transcription [80]. Mutations in the M gene can dramatically alter the assembly of MV, and have been implicated in the development of subacute sclerosing panencephalitis, a chronic and potentially fatal neurological disorder associated with defective MV genomes [79, 81].

The F gene encodes the F or fusion protein, one of the two surface glycoproteins that stud the surface of the MV virion. As its name suggests, the F protein is responsible for mediating the fusion of the MV envelope with the plasma membrane of the host cell [82]. F proteins are initially synthesized as inactive precursors that trimerize in the endoplasmic reticulum [83]. The nascent F protein trimer is subsequently cleaved by the host-cell protease furin, forming a metastable F protein comprised of two subunits termed F1 and F2 [84, 85]. The F1 subunit contains a transmembrane domain that anchors the F protein to the plasma membrane and a 15

stretch of hydrophobic amino acids at its N-terminus that serve as the fusion peptide, which is inserted into the target cell membrane during infection [82]. The F2 subunit is covalently linked to F1 by a disulfide bond, and contains three N-linked carbohydrate chains that are necessary for proper proteolytic cleavage of the F protein and its transport to the cell surface [86]. Activation of the F protein by an adjacent H protein dimer results in the insertion of the fusion peptide into the host cell membrane. This event is coupled with irreversible conformational changes to the F protein trimer that bring the MV and host cell membranes into closer proximity, allowing the subsequent formation of a fusion pore through which the MV ribonucleoprotein can enter the cell [82]. Infection of susceptible cells typically results in mass cell-cell fusion, producing giant, multinuclear aggregates known as syncytia that function as robust factories of MV production before ultimately dying due to apoptosis [87].

The H protein is a type II transmembrane glycoprotein comprised of an N-terminal cytoplasmic tail, a membrane-spanning domain, and an extracellular stalk connected to a large C-terminal globular head [88]. The head domain of H protein contains binding sites that allow MV to recognize and bind susceptible cells [89]. To date, three receptors that permit MV entry in human cells have been identified: signaling lymphocyte activation molecule (SLAM), membrane cofactor protein (CD46), and nectin-4 [90]. SLAM, also known as CD150, is the preferred cellular receptor of wildtype MV. SLAM is expressed by thymocytes, activated lymphocytes, dendritic cells, platelets and macrophages [91]. Depletion of these cell populations during MV infection provides a partial explanation for the immunosuppression that accompanies the disease [92].

CD46 is a regulator of complement activation that is expressed on all human nucleated cells

[93]. Despite its more widespread distribution, wildtype MV strains generally do not interact with CD46 [94, 95]. Instead, CD46 is the preferred receptor for all laboratory strains of MV-Edm,

a tropism that was acquired due to a single amino acid substitution at position 481, changing an asparagine to a tyrosine [96-98]. Nectin-4 is an adherens junction protein that serves as the MV receptor in epithelial cells. The existence of such a receptor has been known for some time, but its identity was only recently elucidated [90]. Nectin-4 is found on the basolateral surface of human airway epithelial sheets, and is believed to be an entry point for the eventual shedding of

MV into the airway lumen. Regardless of the virus and the receptor being utilized, binding of the H protein results in a series of conformational changes that ultimately bring an associated F protein into a position where the fusion peptide can contact the host plasma membrane and initiate the fusion process [99].

The L gene is the most 5’ gene in the MV genome, and as such, the L protein it encodes is the least abundant of the of the MV structural proteins [100]. An L protein forms a complex with 5-

10 P proteins to produce a transcriptionally competent viral polymerase that can produce 5'- capped and polyadenylated mRNAs and full length copies of genomic and antigenomic RNA during replication [58]. As an RNA polymerase, the MV polymerase lacks proof-reading capability and is thus inherently error-prone [101]. Mutation frequencies for MV typically range from 10-3 - 10-6 per site per replication [102]. Consequently, any given population of MV is not clonal, but rather a large number of genetic microvariants referred to as a quasispecies [102].

Another consequence of the error-prone nature of the MV polymerase is the production of defective interfering (DI) genomes. DI genomes, also referred to as "copy backs," occur when the MV polymerase leaves an antigenomic template and then rejoins, creating an inverted terminal repeat of its 3' end [58]. As their name suggests, DI genomes can interfere with their unaltered counterparts and reduce the yield of fully infectious virions, leading to persistent infections in tissue culture and virus attenuation in vivo [103].

Following this brief synopsis of the MV genes and their functions, it is perhaps now appropriate to discuss their roles in the overall context of the MV lifecycle. Following adsorption of the MV to its cellular receptor, the viral envelope fuses with the plasma membrane as mediated by the activities of the H and F proteins. As a consequence of this event, the MV nucleocapsid and multiple copies of the viral polymerase (P and L proteins) are released into the host cell cytoplasm [58]. RNA synthesis begins almost immediately, using endogenous ribonucleotide triphosphates as substrates [59]. The MV polymerase enters the 3’ end of the genome to generate the plus leader RNA and capped and polyadenlyated mRNAs, starting and stopping at the junctions that separate each viral gene. Once these transcripts have produced a sufficient level of MV proteins, the unassembled N proteins begin to assemble a nascent nucleocapsid leader chain. This act causes the viral polyermase to ignore the junctions separating the MV genes, and full-length antigenomic nucleocapsids are synthesized. These antigenomic ribonucleoproteins contain no ORFs of any consequence, and no mRNAs are transcribed from them [58]. Instead, they are thought to function as intermediaries in the process of genome replication. A strong promoter at the 3’ end of each antigenome directs the viral polymerase to produce an abundance of ribonucleoproteins containing genomic RNA, which are destined for packaging into progeny virions [57]. Assembly of the prospective MV envelope occurs at the cell surface, where newly synthesized and glycosylated H and F proteins have been transported following processing in the endoplasmic reticulum and Golgi network. The precise mechanisms by which the virus particle is assembled at the plasma membrane are unknown, but viral M proteins are believed to play a critical role in organizing the process. Newly formed MV particles bud from the cell surface, where they are free to disseminate and begin the process anew in

other susceptible host cells. An overview of the MV life cycle is shown schematically in Figure

1.2.

Figure 1.2 - Schematic representation of the MV life cycle. H = hemagglutinin, F = fusion protein, N = nucleoprotein, P = phosphoprotein, L = large protein (polymerase), and M = matrix protein. Figure adapted from Lamb et al. 1996.

Oncolytic virotherapy and rationale for measles virus-based therapies

Clinical observations made over the last century have revealed that many viruses, including MV, possess the innate ability to kill tumor cells [104-110]. These so-called oncolytic viruses selectively infect and kill neoplastic tissue, spreading from cancer cell to cancer cell as they

replicate and lyse their hosts [111]. Interest in viruses as antitumor agents prompted several early clinical trials in the 1950s and 1960s, where various human and animal viruses were administered to cancer patients in the hopes of achieving tumor regression [112, 113]. In most cases, these viruses were rapidly neutralized by the host’s immune response and any effects that they may have had on the tumor were unclear due to improper oversight and questionable experimental design [114, 115]. Tumor regression was found to occur only in a small subset of immunosuppressed patients, but the accompanying morbidity and risk of disease transmission was deemed unacceptable [114]. The initial enthusiasm for virotherapy as a therapeutic approach soon diminished in favor of newly emerging chemotherapy approaches [116]. Despite significant advancements in the treatment of cancer over the decades that followed, many malignancies still remain incurable and the need for novel therapies to combat them persists.

The field of oncolytic virus research has undergone a renaissance over the last two decades, driven by the development of new molecular biology techniques and our expanding knowledge of the viruses and their mechanisms of cytotoxicity [113]. These insights have allowed researchers to engineer safer and more efficacious oncolytic viruses, which now carry the potential to be effective anti-cancer agents in the clinic [117, 118].

In order to minimize risk to the patient and the population, an ideal oncolytic virus should selectively infect tumor cells while being nonpathogenic to normal host tissue. In addition, such a virus should be nonpersistent, nontransmissible, remain genetically stable, and be derived from a virus to which the general public is already immune [114, 119]. The MV-Edm strain and its various derivatives meet these criteria. Tumor selectivity is conferred by MV-Edm’s acquired tropism for CD46 [96]. Overexpression of CD46 is frequently seen in human cancer cells, where it most likely serves as a survival mechanism to protect the transformed cells from complement

mediated lysis [114, 120, 121]. CD46 overexpression has been documented in several cancers including brain, breast, cervical, colorectal, endometrial, gastrointestinal, hepatocellular, lung, renal and ovarian carcinomas, and has also been reported in hematopoietic malignancies such as leukemia and multiple myeloma [122-132]. Although CD46 is ubiquitously expressed and can be found on every nucleated cell in the human body, MV-Edm requires a certain threshold of

CD46 density in order to initiate infection and fusion [133]. At the low CD46 densities typical of normal cells, MV-Edm infection is uncommon and any subsequent intercellular fusion is negligible [114]. In contrast, the high levels of CD46 found on tumor cells make them readily susceptible to MV-Edm infection, leading to extensive intercellular fusion and syncytia formation concomitant with cell death [133]. This reliance on receptor density allows oncolytic viruses derived from MV-Edm to functionally discriminate between normal and transformed cells. In regard to patient safety, MV-Edm has a remarkable track record that spans more than

50 years and over a billion recipients worldwide [35]. The reversion of MV-Edm to pathogenic

MV has never been documented, which is a testament to its stability in vivo. Compared to viruses such as influenza, which require new vaccines every year, MV has essentially been controlled by the same vaccine for decades [35, 44, 114]. The risk of unintended transmission is also exceedingly low, thanks in part to successful childhood vaccination programs that have made an estimated 80% of the world’s population immune to measles [134]. In addition to its demonstrated selectivity for tumor cells and overall safety, MV-Edm is benefited by a relatively simple genome amenable to genetic manipulation and an established rescue system allowing for robust production of virus for laboratory and clinical testing [114, 135]. Taken together, these properties make MV-Edm an attractive platform for the development of oncolytic virotherapies.

Oncolytic measles viruses

The development of a reverse genetic system for MV rescue by Radecke and colleagues in 1996 allowed recombinant MV to be generated from cDNA, ushering in the current era of measles- based virotherapies [114, 135]. Genetic manipulation of viral cDNA makes it possible to create novel MV with new attributes and functions that build upon the already considerable strengths of MV-Edm. Efforts to date have focused on the creation of oncolytic MV that produce detectable markers to monitor viral spread, express transgenes that confer enhanced oncolytic activity, and/or feature modifications that increase their selectivity for neoplastic tissue (Figure

1.3) [114]. Examples of these viruses are described below.

Figure 1.3 - Potential modifications to MV-Edm through genetic engineering. GFP = green fluorescent protein, CEA = carcinoembryonic antigen, wt P = wildtype phosphoprotein, NIS = sodium iodide symporter, NAP = neutrophil activating protein, PNP = purine nucleoside phosphorylase, GM-CSF =

Granulocyte macrophage colony-stimulating factor, and ScFV = single-chain antibody. Descriptions of these viruses can be found in the text.

Monitoring of MV infection and spread has been facilitated by the development of MV-GFP and

MV-CEA, two MV-Edm derivatives that encode green fluorescent protein (GFP) and carcinoembryonic antigen (CEA) respectively [136, 137]. Additional transcription units for GFP and CEA were inserted into the 3’ end of MV genome before the N gene where their transcripts would be produced in high abundance, thereby increasing the sensitivity of virus detection [57,

138]. MV-GFP has been widely used to monitor the in vitro spread of MV, where fluorescence microscopy techniques can be used to detect MV infection prior to or in the absence of any obvious cytopathic effect, such as the formation of syncytia [136, 138]. MV-CEA was similarly designed to enable in vivo monitoring of MV replication and spread where direct observation of a cytopathic effect is not possible. MV-CEA infection of tumor cells results in their secretion of

CEA, a nonimmunogenic soluble peptide with no biological function of its own and a constant circulation half-life [137]. Assessment of CEA levels in the patient’s serum can therefore provide useful information on the kinetics of MV infection. Parameters such as how quickly the virus is eliminated, how its replication is compromised by host immunity, and any potential dose- limiting toxicities can all be evaluated, making it possible to tailor treatment regimens specific to individual patient needs [137]. The therapeutic potential of MV-CEA has already been demonstrated in a wide variety of solid tumors and hematological malignancies, and it is currently being tested in phase I clinical trials for the treatment of glioblastoma multiforme and ovarian cancer [116, 139, 140].

Another MV designed to facilitate monitoring is MV-NIS, which encodes the thyroidal sodium iodide symporter (NIS) gene [141]. NIS is a transmembrane ion channel expressed on the basolateral surface of thyroid follicular cells, where it actively transports two sodium cations for each iodide anion into the cells [142]. Concentration of iodide is a necessary first step for the

production of the thyroid hormones triiodothyronine and thyroxine and proper thyroid function

[142]. Thyroidal expression of NIS has been exploited for several decades in clinical practice, where the administration of radioactive iodine can be used for imaging or ablation of the thyroid depending on the dose and isotope utilized [143]. MV-NIS infected tumors similarly acquire the ability to concentrate radioiodine from the bloodstream [141]. This can provide anatomical information about the location of the tumor and allow the status of infection to be monitored with single photon emission computed tomography (SPECT) or positron emission tomography (PET) imaging techniques using 123I and 124I as tracers, respectively [144, 145]. MV-

NIS virotherapy can also be combined with the β--emitting radioiodine isotope 131I, enhancing the therapeutic potency of the virus (See Chapter 3) [114]. The efficacy of MV-NIS treatment has been evaluated in preclinical models of multiple myeloma [141], ovarian cancer [146], pancreatic cancer [147], mesothelioma [148], prostate cancer [149], malignant gliomas [150], and cancers of the head and neck [151]. Phase I clinical trials investigating the use of MV-NIS to treat recurrent or refractory multiple myeloma, malignant pleural mesothelioma and ovarian epithelial cancer are presently underway [140, 152, 153].

Increasing the oncolytic activity of a recombinant MV can be accomplished by various means, such as the introduction of a transgene that can elicit an antitumor response. An example is MV-

PNP, which encodes the Escherichia coli purine nucleoside phosphorylase (PNP) gene [154]. PNP is a prodrug convertase that catalyzes the conversion of compounds 6-methylpurine-2'- deoxyriboside (MeP-dR) and fludarabine (arabinofuranosyl-2-fluoroadenine monophosphate) to

6-methylpurine and 2-fluoroadenine respectively [155]. These highly diffusible products are metabolized to toxic adenosine triphosphate analogs, which can subsequently arrest DNA, RNA and protein synthesis [155]. The local activation of MeP-dR and fludarabine in MV-PNP infected

tumors can thus result in an increased bystander effect, improving the therapeutic efficacy of the virus. MV-PNP was found to exhibit a synergistic relationship with MeP-dR against murine colon adenocarcinoma cells, and could significantly prolong survival in a subcutaneous allograft model [154]. Complete tumor regression was also observed in nine out of ten animals under study when MV-PNP/MeP-dR was co-administered with the immunosuppressive agent cyclophosphamide [154]. In separate studies, MV-PNP administered with fludarabine showed an enhanced bystander effect and improved efficacy against xenograft models of Burkitt’s lymphoma and pancreatic cancer [156, 157]. Clinical trials with MV-PNP have yet to be formally proposed.

Another strategy for improving the oncolytic potential of MV-Edm is by encoding a transgene that modulates the host’s response against the tumor or alters the tumor microenvironment

[158-160]. MV-mGM-CSF is an MV-Edm derivative that includes the mouse gene for granulocyte macrophage colony-stimulating factor (GM-CSF) as an additional transcription unit [161]. GM-

CSF is an immunostimulatory cytokine that potentiates many neutrophil functions including stimulation of phagocytosis, lysozyme release, oxidative metabolism and recruitment of complement [162]. Treatment of a mouse xenograft model of Burkitt’s lymphoma with MV- mGM-CSF coincided with a pronounced infiltration of activated neutrophils and a delayed, but potent, antitumor response that was otherwise absent in the controls [161]. More recently, a

MV-Edm encoding a secreted form of the Helicobacter pylori neutrophil-activating protein (NAP) was developed and evaluated for its efficacy against metastatic breast cancer [163]. NAP is a virulence factor involved in the pathogenesis of H. pylori infection and a potent modulator of proinflammatory cytokines [164]. Treatment of xenograft models of lung and intrapleural metastatic breast cancer with MV-NAP led to a significant prolongation of survival compared to

other MV-Edm strains, mediated in part by the induction of a nonspecific inflammatory reaction in the tumor microenvironment [163].

Another method of increasing the efficacy of MV-Edm against tumor cells is by substituting its P gene for that of the wildtype virus [165]. As discussed above, mutations in the MV-Edm P gene have resulted in its P, C and V proteins being unable to efficiently suppress the host IFN response [76, 77]. Consequently, tumor cells infected with MV-Edm produce substantially more

IFN than those infected with a wildtype MV, which can compromise viral gene expression [165].

Based on these observations, Haralambieva and colleagues created a chimeric MV-GFP virus armed with the wildtype P gene and evaluated its antitumor activity in vitro and in vivo [165].

The chimeric virus was better able to suppress IFN production in infected cells than standard

MV-GFP and was also found to display greater oncolytic potency against human myeloma xenografts. Despite its improved efficacy, clinical testing of this chimeric MV-Edm has not been pursued due to concerns that the wildtype P gene could potentially make the virus pathogenic

[114]. MV virulence and pathogenicity do not solely depend on the P,V,C proteins however, and there may still be a compelling argument to use such a virus in instances where its perceived benefits may outweigh its risks [141].

In addition to modifications that facilitate monitoring and enhance tumor-killing capacity, it is also possible to redirect the tropism of MV-Edm through genetic engineering [166, 167]. As previously described, sequence determinants in the C-terminus of the H gene are responsible for the H protein’s ability to interact with SLAM, CD46 and nectin-4 [89, 90]. Ablation of MV’s tropism for its natural receptors is thus a simple matter of introducing mutations at critical amino acid residues [168, 169]. Retargeting of an MV-Edm can then be accomplished by placing

a ligand or single-chain antibody (ScFV) at or near the C-terminus of the H gene without disrupting its ability to be incorporated into virus particles or provide fusion support [114].

A host of retargeted MV-Edm have been developed within the last few years, including MV specific for the epidermal growth factor receptor (EGFR) and the EGFR mutant vIII found on gliomas [170-172], the myeloma markers CD38 and CD138 [173, 174], the alpha-folate receptor expressed in ovarian cancers [175], and the prostate stem cell antigen expressed by prostatic and pancreatic cancers [156, 176]. In each case, retargeting of the MV successfully restricted viral infection and replication to only the cells expressing the appropriate marker. Moreover, no off-target effects were observed in a CD46 transgenic mouse model of MV toxicity following administration of these retargeted viruses, in contrast to the lethal encephalitis that invariably develops with standard MV-Edm [177]. Although the ability to redirect MV tropism to make seemingly more tumor-selective viruses is appealing, the actual utility of this approach remains unproven. The impetus to reengineer MV tropism was based on the assumption that the ubiquitous expression of CD46 would be problematic for MV-based virotherapies [114]. This assumption turned out to be incorrect, however, as MV-Edm can efficiently discriminate between normal and transformed cells on the basis of receptor density [133]. In addition, no substantial toxicities have been observed in the phase I clinical trials with the CD46-tropic MV-

CEA and MV-NIS viruses that would warrant using an MV with altered tropism [116, 152].

Although it may be unnecessary to alter the tropism of a MV at present, the ability to do so may have important implications in the future. It is distinctly possible that a retargeted MV may be more effective against a particular tumor type that does not express adequate levels of CD46. In addition, an MV targeted to the luminal surface of the vascular endothelial cells comprising a

tumor’s blood vessels could theoretically lead to enhancement of virus uptake at the sites of tumor growth [114, 178].

The genetic modifications possible with MV-Edm and the examples provided above likely represent only the beginning of a promising experimental approach to the treatment of cancer.

The results of ongoing clinical trials with recombinant MV-Edm will be crucial for the further development of MV-based virotherapies, providing necessary information in regards to the safety and efficacy of this approach [116]. Knowing and understanding these parameters will help guide future development strategies, and presumably lead to a new generation of safer and more effective oncolytic MV.

Considerations for measles virotherapy

MV-CEA and MV-NIS are currently being evaluated in phase I clinical trials for the treatment of multiple myeloma, ovarian cancer, glioblastoma and mesothelioma [139, 140, 152, 153]. While data from these trials are still forthcoming, they are proceeding satisfactorily and have provided valuable insight to some of the challenges and considerations that will need to be addressed before further advancing this therapeutic approach in human subjects [179]. The most pressing of these issues is the fact that the vast majority of cancer patients will have pre-existing immunity to MV on account of a previous vaccination or natural infection [114, 134, 180].

Circulating anti-MV antibodies and T lymphocytes can rapidly neutralize an oncolytic MV. The titers of these antibodies also increase progressively with each successive exposure to the virus, greatly diminishing its therapeutic potential [181]. One possible solution for this problem may be the judicious use of immunosuppressive agents such as cyclophosphamide in conjunction with the MV [114]. Experiments with oncolytic strains of herpes virus have shown that

cyclophosphamide can decrease the innate immune response, enhance oncolytic activity, and prolong viral gene expression in tumors [182-184]. A pre-clinical toxicology study with MV-NIS reported similar findings, as consistently higher levels of viral RNA could be isolated from the buccal swabs of immunocompetent squirrel monkeys (Saimiri sciureus) given cyclophosphamide than those given MV-NIS alone [185]. Importantly, no significant toxicity was reported in these animals at doses of 31 mg/kg cyclophosphamide (corresponding to a proposed human dose of

10mg/kg) when given two days prior to intravenous MV-NIS administration [185]. These observations have provided justification to administer cyclophosphamide to future participants in the MV-NIS clinical trial prior to their treatment with the virus [114].

Another issue facing measles-based virotherapies involves the route in which the MV is administered. Disseminated and hematopoietic malignancies will necessitate systemic administration of the MV through the blood, where the virions can become sequestered and phagocytosed by macrophages in the lung, liver and spleen, irrespective of the presence of circulating anti-viral antibodies [186, 187]. The efficacy of an intravenously delivered MV is thus contingent upon the small fraction of virus particles that are able escape this fate. One promising strategy to circumvent this issue is the use of infected cell carriers. MV administered in this fashion is not delivered as naked virions, but is instead sheltered in pre-infected carriers such as monocytoid cell lines or mesenchymal stem cells [188, 189]. In addition to limiting unwanted sequestration of the virus, these infected cell carriers have been shown to efficiently deliver MV to tumor cells even in the presence of neutralizing titers of anti-MV and also display some capacity to “home in” to sites of tumor lesions [188, 189].

Considerable optimization of these approaches will likely be necessary moving forward with oncolytic MV clinical trials. There are many reasons to be optimistic about the future of

oncolytic measles virotherapy however, and these current challenges will likely be mitigated by the rational design of improved viruses and treatment strategies as guided by forthcoming clinical data.

Treatment of medulloblastoma with oncolytic MV

Despite the proven efficacy of oncolytic MV against a host of tumor types, its potential as a novel therapy for medulloblastoma was only just recently investigated by Studebaker and colleagues [190]. Prior to any assessment of efficacy in an in vivo system, it was necessary to establish that medulloblastoma cell lines and clinical specimens expressed adequate levels of

CD46 to promote MV infection. This assessment was initially made by performing fluorescence- activated cell sorting (FACS) of five available medulloblastoma cell lines and immunohistochemistry (IHC) on 12 medulloblastoma specimens obtained during surgical resection. High levels of CD46 expression were confirmed in every cell line evaluated, and intense staining of the cell membranes could be observed in 11 of 12 clinical specimens (Figure

1.4).

Figure 1.4 - Medulloblastomas express CD46. A. FACS analysis of five medulloblastoma cell lines stained with CD46 (blue histograms) or an isotype control (green histograms). B. Representative IHC of a clinical medulloblastoma specimen stained with an anti-CD46 antibody (brown color). Images are reprinted with permission from Studebaker et al. 2010 [190].

Subsequent in vitro studies utilizing an MV-Edm virus engineered to express GFP (MV-GFP) revealed that the medulloblastoma cell lines were extremely susceptible to MV oncolysis, and even fairly low multiplicities of infection (MOI) could infect and kill an entire monolayer of cells within 72-96 hours. Cell killing was accompanied by the appearance of syncytia, the tell-tale cytopathic effect of MV infection in cultured cells. Viable MV could also be collected from these cells, demonstrating their suitability as hosts for viral replication. A series of mouse xenograft experiments was then proposed to gauge the in vivo efficacy of MV treatment against localized medulloblastoma tumors. Of the five medulloblastoma cell lines available for implantation, the

D283med cell line was ultimately chosen to carry out this set of experiments. D283med was originally derived from the peritoneal implant and ascitic fluid of a child with disseminated medulloblastoma and could be serially passaged in athymic mice as intracranial tumors [191].

Based on information obtained in the aforementioned in vitro studies, D283med was found to

express lower levels of CD46 than the other cell lines and also be more resistant to MV- mediated cell death. Therefore, it could be reasonably assumed that a successful treatment response observed in the D283med tumors would also extend to tumors derived from the other medulloblastoma cell lines.

Prior to implantation, the D283med line was stably transduced with firefly luciferase to allow the resultant tumors to be visualized over time through bioluminescent imaging techniques. This new cell line, designated D283med-luc, was then stereotactically implanted into the caudate nuclei of athymic nude mice and given seven days to grow and establish tumors. At this point, the mice were randomly divided into groups scheduled to receive intratumoral injections of MV-

GFP, MV-GFP that was inactivated by ultraviolet light (UV MV-GFP), or a vehicle control consisting of optiMEM (Invitrogen, Carlsbad, CA). Treatment regimens consisted of five

5 intratumoral injections of 2x10 tissue culture infective dose 50 (TCID50) virus or an equivalent volume of optiMEM medium and were administered every other day. Tumor growth and treatment response were then monitored by bioluminescent imaging over the next several weeks. During the course of these imaging studies, it was readily apparent that the animals treated with MV-GFP displayed significant decreases in tumor burden compared to the UV MV-

GFP and vehicle control-treated mice as measured in total flux (Figure 1.5A and 1.5B). The efficacy of MV-GFP treatment in this model was further reflected in the Kaplan-Meier survival analysis, which revealed that the MV-GFP treated mice exhibited a highly significant prolongation of overall survival compared to the UV MV-GFP and vehicle controls (p < 0.001)

(Figure 1.5C).

Figure 1.5 - MV-GFP treatment reduces tumor burden in nude mice. A. Bioluminescent imaging of nude mice bearing D283med-luc tumors treated with MV-GFP or an optiMEM vehicle control over time. Day 0 marks the first day of treatment (i.e. seven days after tumor implantation). Treatment was administered every other day for a total of five times at the same stereotactic coordinates as tumor implantation. Mice treated with MV-GFP show a marked decrease in tumor burden. Mice treated with UV MV-GFP (not shown) showed comparable bioluminescent signal intensities to the vehicle controls. B. MV-GFP treatment leads to significant reductions in tumor burden as quantified by total flux. C. Kaplan-Meier survival curve of mice treated with MV-GFP or UV MV-GFP. Images are reprinted with permission from

Studebaker et al. 2010 [190].

Histopathological examination of the animals’ brains was also performed. No evidence of tumor could be found at the injection site of eight of 11 mice treated with MV-GFP, but tumor cells that had presumably managed to escape MV-mediated oncolysis and invade the subarachnoid space could be detected. In contrast, the brains of mice treated with UV MV-GFP or the vehicle control all displayed large, destructive tumors with mass effect that in some cases were accompanied by leptomeningeal spread.

These initial findings showed that medulloblastomas are susceptible to MV oncolysis and suggest that MV virotherapy may have therapeutic potential against localized disease.

Moreover, the creation and use of the D283med-luc cell line provides a noninvasive means to monitor tumor growth and treatment response through bioluminescent imaging techniques.

With this basic framework available, additional questions about the utility of MV virotherapy against medulloblastoma could now be further explored.

Chapter 2: Oncolytic measles virus prolongs survival in a murine model of cerebral spinal fluid- disseminated medulloblastoma

Introduction

Medulloblastoma is the most common malignant brain tumor of childhood, accounting for 15% to 20% of all pediatric brain tumors [6]. Approximately 350–500 new cases are diagnosed annually in the United States [4, 5, 192]. Using current multimodality treatment consisting of surgery, craniospinal radiotherapy, and multiple drug chemotherapy, the 5-year survival rate is now 60-80% [17, 193, 194]. Many children receiving this therapy will experience long-term treatment-related morbidity, however, which greatly affects their quality of life [33, 34, 195-

198]. Although a number of prognostic factors influence survival, dissemination of tumor into the CSF pathways, present in approximately 20% of patients at initial diagnosis and in 75% of patients at recurrence, is an especially grave negative prognostic factor [8, 199, 200]. Fewer than 20% of children presenting with CSF dissemination live more than five years [201]. Clearly, more effective therapy for medulloblastoma and, in particular, for disseminated medulloblastoma is needed.

Medulloblastomas predominantly arise in the fourth ventricle between the cerebellar vermis and brainstem, often leading to occlusion of the ventricle and subsequent hydrocephalus [202].

Because of the aggressive nature of medulloblastoma and its close proximity to the CSF, patients

may present with disseminated disease in the ventricles, basal cisterns, and/or spinal subarachnoid space [8, 199, 200]. Previous studies have demonstrated dissemination of human medulloblastoma cell lines in murine orthotopic models when tumor cells were injected either into the subarachnoid space of the cisterna magna [203] or cerebellum [204, 205]. In both models, pathological review revealed tumor involvement in the ventricular system and the spinal cord.

We recently reported on the therapeutic efficacy of a recombinant MV-Edm against a panel of human medulloblastoma cell lines in vitro and in a mouse orthotopic model of medulloblastoma

[190]. In these studies, both irradiated SCID and athymic nude mice implanted with human medulloblastoma cell lines in the caudate nucleus demonstrated significantly increased survival when treated with a recombinant MV, compared to mice treated with a UV-inactivated form of the virus. In the current study, we sought to develop a mouse model that recapitulated the dissemination pattern exhibited by children with medulloblastoma and thus determine whether a similar therapeutic approach using recombinant MV would increase animal survival.

In this study, we demonstrate a pattern of human medulloblastoma dissemination in a murine model that is similar to the dissemination pattern exhibited by children with the disease. Unlike the previous studies which required necropsy to demonstrate CSF-disseminated disease [203-

205], our model was capable of using intravital bioluminescent imaging to evaluate dissemination. Subsequent necropsy revealed extensive intraventricular and subarachnoid disease involving both the extra-cerebral and spinal subarachnoid spaces, thus confirming our imaging data. In many cases, these animals also exhibited hydrocephalus resulting from blockage of CSF flow. More importantly, we found that the animals treated with a modified MV exhibited morphologic and immunohistochemical evidence of viral infection of tumor cells 36

throughout the CSF and statistically increased survival times relative to controls. We have demonstrated effective treatment of disseminated medulloblastoma with MV in a new murine model of CSF dissemination. Ongoing experiments in our laboratory to determine optimal dosing of virus in preparation for a phase I trial are under way.

Material and Methods

Cell culture

The Vero (African green monkey) and D283med human medulloblastoma cell lines were obtained from the American Type Culture Collection. The D425med human medulloblastoma cell line was obtained from Darrell Bigner (Duke University, Durham, NC). Vero and medulloblastoma cells were grown in DMEM supplemented with 10% or 20% fetal bovine serum, respectively, at 37°C in a humidified incubator set at 5% CO2. The D283med- and

D425med-Luciferase cell lines were generated using a method previously described [190].

Luciferase bioluminescence emitted per cell line was quantified by plating 5x104 D283med- luciferase (D283med-luc) and D425med-luciferase (D425med-luc) cells in replicates of 6 in a white 96-well plate. Twenty-four hours later, Bright-Glo reagent (Promega) was added to each well. A Victor2 Wallac plate reader (Perkin Elmer) was used to measure light emissions in counts per second over a 10 second period. Data were quantified as counts per second per cell.

Production of measles virus

The MV-GFP virus was rescued as described elsewhere [136] and propagated in Vero cells by infecting them at an MOI of 0.01 for 2 hours at 37°C in a minimal volume of OptiMEM

(Invitrogen). After incubation, the medium containing unabsorbed virus was replaced with

DMEM supplemented with 10% fetal bovine serum. Cells were incubated for 48 hours at 37°C and then transferred to 32°C for 24 hours. The presence of GFP-positive cells was verified by fluorescence microscopy. Medium was gently aspirated, and cells were collected in OptiMEM.

Virus was harvested by 2 cycles of freezing and thawing. The titer of the virus was determined by TCID50 titration on Vero cells [206].

In vivo disseminated tumor model

D283med-luc (1×106 cells) or D425med-luc (5×105 cells) were injected into the right lateral ventricle of 5-week-old Hsd:Athymic Nude-Foxn1nu mice (Harlan Laboratories) using the small animal stereotactic frame (David Kopf Instruments). The injection coordinates were 1 mm to the right and 0.5 mm posterior to the bregma and 2.2 mm below the skull surface. The mice were kept under isoflurane gas anesthesia while cells in phosphate-buffered saline were injected over a course of 3 min using a 26-guage Hamilton syringe. These mice were randomly divided into groups for treatment with MV-GFP or inactivated UV-MV-GFP. Treatment regimens were initiated either 3 or 14 days after tumor implantation, with each mouse receiving an injection of

5 2×10 TCID50 of MV-GFP or UV-MV-GFP at the same stereotactic coordinates used for implantation. Treatments were repeated every other day for a total of 5 doses (1×106 total

TCID50). The animals were euthanized if they developed neurologic deficits, such as hemiparesis

or lethargy. All animal experiments were approved by the Nationwide Children's Hospital

Institutional Animal Care and Use Committee.

Histopathological evaluation

At the time of necropsy, brains and spinal columns were collected, fixed overnight with 10% formalin, paraffin embedded, cut into 4-µm tissue sections, and stained with hematoxylin and eosin. The spinal cords were placed in decal solution (Formical-2000; Decal Chemical) overnight following formalin fixation and prior to paraffin embedding. The D283med-luc tumor focus isolated in the spinal cord of the animal 3 days following tumor implantation was visualized using a Zeiss Axioskop 2 Plus microscope and photographed using a Zeiss AxioCam MRc 5 camera. Individual cells in the focus were counted, and the radius of individual cells and the entire focus were determined using the AxioVs40 V 4.6.3.0 morphometry. The radius value of 10 independent cells was calculated to determine the average radius. Four radius measurements were taken of the entire tumor focus to determine an average radius. From these values, the volume of the individual cells and the entire focus was determined. These values allowed us to approximate the number of cells in the tumor focus.

IHC of medulloblastoma tumor xenografts

To confirm intratumor MV infection, measles nucleoprotein was detected by immunohistochemistry of paraffin-embedded tissue sections obtained from D283med-luc and

D425med-luc xenografts. Following tumor cell implantation, a single MV treatment was

administered 7 days following tumor implantation using the same stereotaxic techniques previously described. Tissues were collected 48 hours following MV treatment and prepared as described above. Formalin-fixed paraffin-embedded samples were sectioned with a microtome

(Finesse; Thermo Scientific) at 4 µm, placed on charged slides, oven dried, deparaffinized, and hydrated with distilled water. Heat-induced epitope retrieval was performed by immersing the slide in antigen retrieval solution (sodium citrate buffer; pH, 6.0) and placed in a decloaking chamber for 30 min at 120°C. Slides were cooled and then rinsed with distilled water. To block endogenous peroxidase activity, slides were incubated in 3% hydrogen peroxide for 15 minutes.

After rinsing with distilled water, slides were washed with Tris-buffered saline solution with

Tween 20 (TBST). To reduce nonspecific background, slides were incubated in super block

(ScyTek Laboratories) for 10 min and then washed with TBST. The slides were then incubated in the primary antibody, anti-measles nucleoprotein antibody (NB100–1856; Novus Biologicals), at a 1:300 dilution for 1 hour and then rinsed with TBST. Next, slides were incubated in UltraTek

Anti-Polyvalent Biotinylated Antibody (ScyTek Laboratories) for 10 minutes. After washing in

TBST, the slides were incubated in UltraTek HRP (ScyTek Laboratories) for 10 minutes. Slides were then washed in TBST, incubated in substrate (AEC Chromagen, ScyTek Laboratories) for 3.5 minutes, counter stained with hematoxylin (Shandon Gill; Thermo Scientific), and blued using ammonia water. From distilled water, the sections were coated with crystal mounting media, heated at 58°C, and cover slipped with Permount mounting media. For comparison, additional sections were cut from samples positive for intratumor MV infection and tested with the same immunostaining procedure, with the exception of the primary antibody. Modified versions of the immunohistochemical protocol described above were used to evaluate xenograft tissue for cell proliferation and apoptosis. Slides prepared as described above were either incubated in the

primary antibody Ki-67 (VP-K451; Vector Laboratories) at a 1:1000 dilution for 1 hour to detect proliferation or in the primary antibody cleaved caspase-3 (Asp175; 96661; Cell Signaling) at a

1:200 dilution for 1 hour to detect apoptosis. After the slides were rinsed with TBST, the Ki-67 slides were incubated in 4+ Biotinylated Universal Goat Link (Biocare Medical) for 10 minutes, washed with TBST, and incubated in 4+ Streptavidin HRP (Biocare Medical) for 10 minutes. The cleaved caspase-3 slides were incubated in UltraTek Anti-Polyvalent Biotinylated Antibody for 10 minutes. After washing in TBST, the slides were incubated in UltraTek HRP (ScyTek Laboratories) for 10 minutes. Slides were then washed in TBST, incubated in substrate (DAB, Vector

Laboratories) for 30 seconds, counter stained with hematoxylin (Shandon Gill; Thermo

Scientific), and blued using ammonia water.

In vivo bioluminescence imaging

For the studies characterizing tumor dissemination and growth, bioluminescence imaging was conducted on days 3, 7, 14, and 21 for D283med-luc and days 3 and 10 for D425med-luc following tumor implantation. In studies evaluating the efficacy of MV therapy, bioluminescence imaging was performed prior to each MV injection, then weekly thereafter. Bioluminescence imaging was conducted using the Xenogen IVIS Spectrum (Caliper Life Sciences). Animals received an intraperitoneal injection of 4.5 µg Xenolight Rediject D-Luciferin (Caliper Life

Sciences) and were continuously maintained under isoflurane gas anesthesia. Images were obtained 20 minutes after luciferin administration. The bioluminescence intensity was quantified in units of photons per second using Living Image Software (version 4.1; Caliper Life

Sciences). The lower threshold of detection was set at 1250 photons per second per centimeter2 per steradian (p/s/cm2/sr).

Statistical analysis

Survival curves were generated using the Kaplan-Meier method and GraphPad Prism 5 software

(GraphPad Software). Statistical significance (p < .05) between the groups was determined using the log-rank test. All other statistical analysis was performed using Microsoft Office Excel

(v.11.6560.6568 SP2) in Data Analysis using Regression or Student's t test: paired 2-sample for means. Probabilities for the Student's t test are listed as “p(T ≤ t) 2-tail” with an α of 0.05.

Results

Medulloblastoma cell line dissemination and growth at distant sites can be detected by intravital bioluminescence

In order to evaluate whether MV therapy would be effective at treating disseminated medulloblastoma, it was first necessary to establish a model of CSF dissemination. We previously demonstrated that we could follow localized tumor growth and treatment efficacy in vivo using bioluminescent imaging techniques [190] and wanted to determine whether this imaging modality would also be suitable for visualizing disseminated disease. Using stereotaxic guidance, we initially injected D283med cells stably expressing firefly luciferase (D283med-luc) into the lateral ventricles of athymic nude mice, where the cells would have direct access to the

CSF. Successful implantation of D283med-luc cells and their subsequent dissemination were

confirmed with bioluminescent imaging prior to initiating MV treatment (Figure 2.1A and B). An animal with a bioluminescent signal >1250 p/s/cm2/sr in its spinal cord was determined to have successful dissemination (Figure 2.1B). This setting was chosen because it is substantially higher than the documented background auto-luminescence of a nude mouse (1000 p/s/cm2/sr) [207].

Using this technique to evaluate dissemination, we determined our success rate to be 83.4%

(126 of 151 animals), with an average spinal cord signal intensity of 1.47 × 104 p/s/cm2/sr.

Figure 2.1 - In vivo evaluation of medulloblastoma dissemination and disease progression.

Bioluminescence images from mice containing D283med-luc tumors. Animals were implanted with

D283med-luc cells in the right lateral ventricle. Bioluminescence imaging was conducted 3, 7, 14, and 21 days following tumor implantation. Bioluminescent signals in the brain and spinal cord are visible as early as 3 days following tumor implantation. Tumor burden in the brain and spinal cord, as determined by total flux (photons/s), increased steadily over time. Animals not displaying a bioluminescent signal in their spinal cord at day 3 failed to exhibit a signal throughout the course of the study and were excluded from the study (data not shown).

Animals displaying disseminated tumor on day 3 were additionally imaged on days 7, 14, and 21 after tumor implantation. As shown in Figure 2.1A and 2.1B, the bioluminescent signal in both the brain and the spinal cord increases over time, as evaluated by total flux of the bioluminescent signal. Of interest, those animals implanted with D283med-luc and not displaying a bioluminescent signal in their spinal cords 3 days following tumor implantation never developed a signal throughout the course of evaluation (21 days). For this reason, animals not showing signal in the spine prior to treatment were not used in subsequent studies.

The murine model of disseminated medulloblastoma closely mimics the pattern observed in children

To confirm the dissemination pattern of D283med-luc in animals following introduction of tumor cells into the lateral ventricle, animals were euthanized at each timepoint following bioluminescent imaging. Histopathological review of the entire brain and spinal cord confirmed an animal’s corresponding imaging data. Animals that displayed a bioluminescent signal in their spinal cord also were found to have tumor in their spinal cord following microscopic review

(Figure 2.2). Furthermore, animals exhibiting disseminated disease revealed extensive intraventricular and intracranial subarachnoid disease (Figure 2.2A). By examining serial sections from the spinal cord of the animal displaying a positive bioluminescent signal 3 days following tumor implantation (Figure 2.2; inset), we were able to determine that there were approximately 3000 D283med-luc cells within the tumor focus. As expected, tumor burden in the brains and spines of animals increased progressively over time. Animals euthanized 14 days post tumor implantation and later had increased tumor burden and severity of dissemination,

including tumor foci located around the cerebellum and brain stem (Figure 2.2A). Animals in the terminal stages of the disease were sacrificed approximately 40 days following tumor implantation. Conversely, animals that failed to display a bioluminescent signal in their spinal cord were found to have no histopathologic evidence of disease in their spinal cord, intraventricular space, or subarachnoid space. Instead, these animals had a singular tumor mass in the caudate putamen, indicating that the tumor cells may not have been properly implanted into the lateral ventricle (data not shown).

continued

Figure 2.2 - Histological examination (H&E stain) of the mouse brain following injection of medulloblastoma cells into the right lateral ventricle of the mouse brain. A. The presence of a D283med- luc-derived tumor in the ventricle, posterior fossa, and spinal cord is demonstrated as early as 3 days following tumor implantation and increases steadily over time. Tumor is present in the intraventricular and intracranial subarachnoid spaces, especially the cerebellum and brain stem. Tumor is also evident in the sacral region of the spinal cord. Evaluation of an animal following terminal disease revealed extensive intraventricular and intracranial subarachnoid space involvement. The ventricles appear occluded by tumor, and the cerebellum has extensive disease. Tumor has invaded the dorsal root ganglia as well as the spinal cord. All insets were originally taken at 400X. B. Similar observations are found in disseminated tumors of the D425luc-derived cell line.

Figure 2.2 continued

Administration of measles virus directly into the CSF increases survival of mice exhibiting disseminated medulloblastoma tumors

To determine the efficacy of MV treatment in our model of disseminated disease, we established D283med-luc xenografts in athymic nude mice. Fourteen days following tumor implantation, we began a treatment regimen by injecting MV into the right lateral ventricle every other day for 10 days. The animals were then monitored to assess survival. There was a small but significant increase in survival of animals treated with MV-GFP, compared with animals treated with UV-MV-GFP (p < .002). The median survival for MV-GFP treated animals was 49 days (range 47–49 days), compared to 40 days (range 37–42 days) for UV-MV-GFP treated animals. There were no long-term survivors in the MV-GFP treatment group.

Pathological review determined that all 5 UV-MV-GFP treated animals had extensive intraventricular, intracranial subarachnoid space, and spinal cord involvement. Likewise, all 5

MV-GFP treated animals displayed ventricular and subarachnoid disease, but we were unable to detect tumor in the spinal cords of 2 animals. We noted from our histopathological review that the tumor burden in the CSF was already quite large by 14 days after injection (Figure 2.2A). On the basis of this finding and the survival results, we were concerned that the large burden of tumor in the subarachnoid space at 14 days after tumor injection was preventing the injected virus from moving through the subarachnoid space to access the entire tumor. To address this concern, we modified the experiment described above by beginning treatment 3 days after intraventricular injection of tumor cells. As before, the animals received a dose of MV-GFP or

UV-MV-GFP every other day for a total of 5 injections of MV. Animals were followed up with serial imaging (Figure 2.3A) and monitored to assess survival. Quantification of photons released by D283med-luc implanted tumors demonstrated that tumors either stabilized or shrank in the

treated animals compared to UV-MV-GFP treated animals (Figure 2.3B). Two of 8 treated animals appeared to have been cured of disseminated disease, as determined by bioluminescent imaging (Figure 2.3).

Figure 2.3 – Evaluation of MV efficacy against disseminated medulloblastoma. Bioluminescent images from mice containing D283med-luc tumors. Animals were implanted with D283med-luc cells in the right lateral ventricle 3 days prior to treatment. MV treatment was administered on days 0, 2, 4, 6, and 8. A bioluminescent signal in the lower vertebral region is indicative of tumor dissemination. A. One MV-GFP treated animal exhibits complete tumor abolition, as determined by the lack of bioluminescent signal in the spinal cord (day 60). The other MV-GFP treated animal exhibits a delayed increase in tumor burden compared to the UV-MV-GFP animal, which displays a significant temporal increase in tumor burden. B.

MV-GFP treated animals display a delayed progression of tumor burden compared to untreated animals when using total flux (photons/second) as an indicator of tumor burden.

Like the animals treated 14 days post tumor implantation (Figure 2.4A), the mice treated with

MV-GFP exhibited a statistically significant prolongation of survival compared with to their UV-

MV-GFP treated counterparts (p < 0.0005) (Figure 2.4B). The UV-MV-GFP treated animals had a median survival of 37 days (range 35–39 days), whereas the MV-treated animals had a median survival of 82 days (range 64–110 days). A second independent study was performed and also demonstrated a significant increase in survival (p < 0.0009; data not shown). In this study, the median survival of MV-GFP treated mice was 83.5 days (range 66–104 days) compared with 38.5 days (range 35–42 days) for mice treated with UV-MV-GFP. Necropsy revealed extensive intraventricular, intracranial subarachnoid, and spinal subarachnoid disease in both treated and untreated animals. The 2 animals devoid of any bioluminescent signal in the first study were free of disease upon pathological evaluation of their brains and spinal cords (data not shown).

Two additional animals in the second study were also devoid of tumor upon pathological examination (data not shown).

Dissemination and treatment of D425med tumor xenografts

Because of the heterogeneous nature of medulloblastoma [11], we constructed a second medulloblastoma luciferase-expressing cell line, D425med-luc, to evaluate its dissemination pattern when delivered directly into the CSF and to determine whether MV therapy would be efficacious against another cell line. In contrast to D283med-luc, the bioluminescent signal in the spinal cord of animals implanted with D425luc was delayed, occasionally taking as long as 10 days to visualize. In vitro evaluation of the 2 cell lines revealed that D283med-luc cells emitted

10-fold more counts/second/cell than did D425med-luc cells (350–400 counts/s/cell vs. 35–40

counts/s/cell). Of interest, the average spinal cord signal intensity in D425med-luc xenografts when first detected was 1.47 × 103 (1.33–1.97 × 103) p/s/cm2/sr, which is 10-fold lower than the initial intensity observed with D283luc xenografts.

Figure 2.4 – MV treatment prolongs survival of mice with disseminated medulloblastoma. D283med-luc medulloblastoma cells were injected into the right lateral ventricle of female athymic nude mice and treated A. fourteen days or B. 3 days post tumor implantation. Mice treated with MV-GFP had significantly longer survival than mice given UV-MV-GFP (p < 0.002 (A); p < 0.0005 (B). C. A similar experiment also demonstrated significant (p < 0.0001) survival of mice treated with MV-GFP 3 days following D425med-luc implantation compared to mice that received UV-MV-GFP.

Although some animals implanted with D425med-luc failed to display a bioluminescent signal in their spinal cord until day 10, histopathological review was still performed on days 3 and 14 following tumor implantation. Similar to what was observed with D283med-luc, animals either displayed progressive intraventricular and intracranial subarachnoid disease characteristic of disseminated disease or a primary tumor in the caudate putamen indicating a failed implantation. Using histopathological evaluation, we determined that 81.3% (39 of 48 animals) had disseminated tumor, a similar percentage to our efficiency with D283med-luc. Animals implanted with D425med-luc appear to have greater tumor burden than the day-matched

D283med-luc animals, including more widespread spinal cord distribution and ventricle occlusion, consistent with the more rapid growth rate of this cell line in vitro.

A similar treatment approach was performed in mice with established D425med-luc xenografts.

An initial study evaluating MV-GFP efficacy initiated 14 days after tumor implantation could not be completed on account of the animals succumbing to the disease prior to completing the treatment regimen. As with the second generation D283med-luc xenograft study, efficacy of

MV-GFP treatment against disseminated D425med-luc was evaluated with treatment commencing 3 days after tumor implantation. Animals received either a dose of MV-GFP or a dose of UV-MV-GFP every other day for a total of 5 doses. Animals treated with MV-GFP had a significantly longer survival than did animals treated with the UV-MV-GFP (p < 0.0001) (Figure

2.4C). UV-MV-GFP treated animals had a median survival of 16 days (range 15–18 days), whereas MV-treated animals had a median survival of 37.5 days (range 32–80 days). One animal that displayed disseminated disease prior to initiating MV treatment was determined by bioluminescent imaging to be tumor free when euthanized on day 80. Histopathological evaluation of this animal failed to detect any tumor. In contrast, all other animals revealed

extensive intraventricular, intracranial, and spinal subarachnoid disease (Figure 2.2B). Because bioluminescent imaging evaluation prior to initiating treatment was shown to be unreliable with

D425luc, animals that displayed a large primary parenchymal tumor indicative of a failed lateral ventricle injection were excluded from the final survival comparison.

Immunohistochemistry was performed on the brains and spinal cords of MV-GFP treated animals to definitively demonstrate MV dissemination and infection of D425med-luc tumor cells located throughout the CSF. Positive MV infection of medulloblastoma cells was located in the ventricles (Figure 2.5A and B), posterior fossa (Figure 2.5C and D), and the spinal cord (Figure

2.5E and F), demonstrating MV infection of tumor cells distant from the site of inoculation. MV infection is associated with syncytia that were immunoreactive. The majority of the virus is located in the cytoplasm of infected cells. Untreated animals showed no immunoreactivity for

MV (Figure 2.5G–L) and negative controls performed by omitting the primary antibody revealed no staining (data not shown). Similar results were observed in MV-GFP treated D283med-luc xenografts (data not shown). Subsequent staining demonstrated that the syncytia immunoreactive for MV in both the brain and the spinal cord also stained positive for cleaved caspase-3, a marker for apoptosis (Figure 2.6A and B). Although there was a low level of apoptosis in the untreated samples (Figure 2.6C and D), there was increased apoptosis in the

MV-GFP treated samples (Figure 2.6A and B). Evaluation of the tumors from MV-GFP infected and uninfected animals revealed a similar proliferation index, as assessed by Ki-67 staining

(Figure 2.6E–H). Review of MV-GFP infected samples indicated that syncytia positive for MV and apoptosis immunoreactivity were negative for Ki-67 staining (Figure 2.6E and F).

Figure 2.5 - Immunohistochemical detection of measles virus. Paraffin-embedded tissue sections derived from D425med-luc xenografts were stained with a rabbit polyclonal MV nucleoprotein antibody.

Nucleoprotein immunoreactivity was detected in the cytoplasm of individual cells and multi-nucleated syncytia. Positive MV infection of medulloblastoma cells was located in the ventricles (A and B), posterior fossa (C and D), and spinal cord (E and F) of MV-GFP treated animals, but was absent in the untreated control animals (G–L).

Figure 2.6 - Immunohistochemical staining for apoptosis and cell proliferation. Paraffin-embedded tissue sections derived from D425med-luc xenografts were stained with either a rabbit polyclonal cleaved caspase-3 antibody, to detect apoptosis or a rabbit polyclonal Ki-67 to detect cell proliferation. Syncytia in both the A. brain and B. spinal cord stained positive for cleaved caspase-3. Low levels of apoptosis could also be found in the untreated samples (C and D). Tumors from MV-GFP infected and non-infected animals revealed a similar proliferation index on basis of Ki-67 staining (E–H). Review of MV-GFP infected samples indicated that syncytia positive for MV and apoptosis staining were negative for Ki-67 staining (E and F).

Discussion

Although advances in treatment modalities have increased the survival of children who receive a diagnosis of medulloblastoma, approximately 20% of these patients will present with disseminated disease and face a much worse prognosis. Because of the limitations and significant drawbacks associated with conventional therapy, alternative means for treating all variants of medulloblastoma are sorely needed. The decision to investigate the use of a modified MV-Edm to treat disseminated medulloblastomas was motivated by several key observations. First, the oncolytic activity of the MV-Edm has already been demonstrated across multiple tumor types, where it has displayed remarkable specificity for targeting and destroying transformed cells, leaving the normal surrounding tissue intact [206, 208-210]. Second, the general safety of MV-Edm has been thoroughly vetted over several decades of clinical use, having been safely administered to over one billion recipients worldwide. Although a routine vaccination is certainly far removed from using a virus to treat a brain tumor, it should be noted that extensive studies with the latter route of administration have already been conducted in nonhuman primates. In the early 1970s, Albrecht et al. found no clinical signs of encephalitis in rhesus monkeys following intracerebral injection with low passage MV-Edm virus [211]. In addition, no histological evidence of active measles infection, such as intranuclear inclusions or syncytia, could be found in any of the animals. Similarly, injection of MV-Edm into the thalamus or CSF via cisternal injection of grivet monkeys or cynomologuous monkeys produced no clinical toxicity [212]. Lastly, prior to initiating clinical trials for patients with glioblastoma multiforme, measles neurotoxicty studies were performed in previously immunized rhesus macaques [213].

Similar to previous safety studies, there was no evidence of toxicity in the animals, thereby demonstrating the safety of measles virus therapy.

We recently reported on the efficacy of MV therapy in increasing the survival of mouse xenografts of human medulloblastoma [190]. In that study, we were able to show that MV was effective in treating localized tumors in the caudate nucleus. Animals treated with recombinant

MV showed drastic reductions in tumor size and increased overall survival compared to animals given a UV-inactivated form of the virus. In addition, we demonstrated that bioluminescent imaging was a very effective and accurate method to evaluate tumor response to MV virotherapy. Although MV efficacy was performed on medulloblastoma cell lines, immunohistochemical evaluation of multiple primary medulloblastoma resection specimens demonstrated that they express CD46, thus indicating that MV virotherapy may be useful clinically [190].

To determine whether MV treatment efficacy would extrapolate to disseminated disease, we developed a mouse model that recapitulated the dissemination pattern of human medulloblastoma. The use of luciferase-expressing cells allowed us to use intravital biolumniscent imaging to monitor tumor growth and response to treatment. In this study, we demonstrated that implantation of human medulloblastoma cells directly into the CSF via the lateral ventricle generated bioluminescent signals in the head and spine of animals (Figure 2.1).

Subsequent histopathological evaluation revealed tumor deposits in the intraventricular space, intracranial subarachnoid space, and spinal subarachnoid space (Figure 2.2), thus confirming our bioluminescent images. Although we were able to accurately determine dissemination and follow tumor response to MV treatment using bioluminescent imaging, comparison of

D283med-luc and D425med-luc cells reveal some of the limitations associated with intravital imaging, such as a definitive lower limit of sensitivity. In vitro analysis and in vivo imaging revealed that D283med-luc cells emit 10-fold more photons per second per cell. This was clearly

demonstrated by the average spinal cord signal intensities initially observed in D283med-luc and

D425med-luc xenografts (1.47 × 104 and 1.47 × 103 p/s/cm2/sr, respectively) and the time it took to observe a signal in the spinal cords following tumor implantation. Attempts are currently being made to construct a D425med-luc cell line that emits increased luminescence.

We were able to show that MV-GFP, when administered either 3 or 14 days following D283med- luc tumor implantation, significantly enhanced survival of animals with disseminated medulloblastoma (Figure 2.4A and B). We were also able to demonstrate a significant increase in survival of animals implanted with D425med-luc, when MV treatment was initiated 3 days following tumor implantation but not at the later timepoint of 14 days (Figure 2.4C).

Pathological comparison of tumor burden at days 3 and 14 revealed increased tumor burden in the ventricles and concomitant enhanced dilation of the ventricles, including the fourth ventricle. The presence of hydrocephalus suggests that the tumor was impeding the flow of CSF from the ventricle to the subarachnoid space, therefore diminishing the access of MV-GFP to disseminated tumor sites. Our findings from initiating treatment 3 days following tumor implantation and 14 days following tumor implantation indicate that there may be a window for optimal MV treatment efficacy. Although we believe that tumor burden, especially in the ventricles, affected efficacy in our animal models, we do not believe this will be an issue when treating children. Although children with medulloblastoma often present with hydrocephalus, this is almost always caused by the tumor in the fourth ventricle, which is removed surgically prior to the institution of therapy.

Aside from leading to increases in overall survival, we were able to verify that the administration of MV-GFP via the lateral ventricle led to MV infection in multiple tumor deposits throughout the subarachnoid space, including the spinal cord (Figure 2.5). We observed large, multi- 58

nucleated syncytia in the treated tumors that stained positive for MV nucleoprotein when examined immunohistochemically. Further investigation determined that the syncytia associated with MV infection stained positive for cleaved caspase-3, a marker of apoptosis

(Figure 2.6A and 2.6B). The formation of syncytia and subsequent apoptosis has been well documented for MV-mediated oncolysis [87, 210]. In addition, both MV-GFP treated and untreated animals displayed similar cell proliferation profiles as determined by Ki-67 staining

(Figure 2.6 E–H). Evidence of MV-GFP infection confirmed our interpretation of the bioluminescent imaging data, which showed a decrease in signal intensity in the treated animals. As bioluminescent signal intensity was used as a surrogate marker of tumor burden, immunohistochemistry strongly suggests that MV-GFP was responsible for the decrease in tumor burden. The ability to use the CSF to deliver therapeutic MV to disseminated disease and to demonstrate infection at these distant sites is critical to treating mice and, ultimately, children presenting with disseminated disease.

Although other studies have been successful in generating disseminated disease in mouse models of medulloblastoma, either by metastasis from a primary tumor [204, 205] or by direct injection into the subarachnoid space [203], they required histological examination to verify dissemination. The model that we present here has the advantage of using bioluminescent medulloblastoma cells, whose location and growth can be serially monitored without the need to sacrifice the animal. Moreover, this ensures consistency by eliminating from the study any animals that do not demonstrate dissemination prior to treatment. An additional advantage to this model is the ability to follow our treatment response. We are able to follow tumor growth, regression, and even dissemination from the brain to the spinal cord, allowing us to evaluate our

MV efficacy in more detail and to know exactly when an animal is tumor free. As such, our

model allows for more dynamic treatment regimens to be implemented. Animals can conceivably be treated as needed, receiving as little or as much MV as necessitated, depending on how they respond to treatment.

In summary, we demonstrated that inoculation of MV-GFP directly into the CSF via the lateral ventricle significantly increased the survival of animals presenting with disseminated medulloblastoma. Intravital bioluminescent imaging provided a means by which disseminated medulloblastoma could be evaluated and a method to monitor tumor response to MV therapy.

Evidence of MV infection at tumor deposits distant from the site of MV inoculation, concomitant with an increase in animal survival, demonstrated that modified MV has therapeutic potential for disseminated medulloblastoma. Additional studies, including evaluating the toxicity of MV injection directly into the CSF of previously immunized, immunocompetent, nonhuman primates will need to be completed prior to using the virus in a clinical trial for the treatment of disseminated medulloblastoma. Furthermore, the broad tropism toward varying malignancies, as evidenced by the ongoing clinical trials [139, 152, 179], suggest that MV may be a viable therapeutic strategy toward other pediatric tumors (i.e., ependymomas and diffuse intrinsic pontine gliomas). Studies are currently being performed to evaluate this treatment approach.

Acknowledgements

We thank the Core Morphology Laboratory and the Small Animal Imaging Facility of The

Research Institute at Nationwide Children's Hospital for technical support.

Chapter 3: Treatment of medulloblastoma using an oncolytic measles virus encoding the thyroidal sodium iodide symporter shows enhanced efficacy with radioiodine

Introduction

Medulloblastoma is the most common malignant brain tumor of childhood [5]. Our understanding of this disease, its etiology, and treatment has improved considerably over the past several years and is reflected in 5-year survival rates that now exceed 70% [1]. Despite these advancements, numerous challenges in the effective treatment of medulloblastoma remain. Conventional therapy, consisting of surgical resection and craniospinal irradiation with or without chemotherapy, is frequently associated with neurocognitive morbidity. Patients treated for medulloblastoma often display impaired intelligence and deficits in processing speed, memory ability, and attention, which significantly impact their quality of life [23, 24]. In addition, a sizable subset of medulloblastoma patients will effectively remain incurable, owing to medulloblastoma’s propensity to disseminate in cerebrospinal fluid (CSF) spaces, including the ventricles, intracranial subarachnoid space, and spinal subarachnoid space [199, 200]. Fewer than 20% of children who present with disseminated medulloblastoma will survive more than five years [201]. Alternative treatment modalities for medulloblastoma are clearly needed.

One promising approach is the development and use of oncolytic measles viruses (MV). As derivatives of the Edmonston vaccine strain, these viruses display a natural tropism for the

CD46 membrane protein, an inhibitory complement regulator strongly over-expressed by many types of tumor relative to normal tissue [94, 114]. MV preferentially infects tumor cells and induces their death via syncytia formation and apoptosis, causing minimal damage to the normal surrounding tissue [208, 210]. In a recently published study, we reported that the majority of medulloblastomas over-express CD46 and were consequently susceptible to MV oncolysis [190]. We also demonstrated that MV virotherapy was effective against orthotopic mouse xenograft models of localized and disseminated medulloblastoma [190, 214]. In these studies, multiple intratumoral injections of MV were found to significantly reduce tumor burden and extend survival in treated animals. Further studies aimed at scaling back the number of intratumoral MV injections revealed a marked decrease in the efficacy of the treatment

(unpublished data), prompting us to explore the use of genetically modified MV that offer enhanced killing of tumor cells.

The insertion of specific transgenes into the MV genome can be used to confer increased specificity, augment MV killing of infected tumor cells, or provide markers to assess virus delivery and tumor response [114]. MV-NIS, an oncolytic MV engineered to express the human thyroidal sodium iodide symporter (NIS), was developed to provide a noninvasive means of imaging tumors and to potentially enhance the efficacy of MV against radiosensitive malignancies by concentrating radioiodine in virus-infected cells [141]. MV-NIS was shown to exhibit a profound synergy with the β- particle emitting radioiodine isotope 131I in a multiple myeloma xenograft model, wherein the administration of 37 MBq 131I at peak infection resulted in complete tumor regression in all the animals under study [141]. More recently, the combination of MV-NIS and 131I was found to have significant antitumor activity against an orthotopic model of glioblastoma multiforme, an invasive and radiosensitive primary brain

tumor [150]. Because medulloblastomas are also known to be extremely radiosensitive [1], we hypothesized that MV-NIS virotherapy in combination with 131I administration may promote enhanced tumor regression and survival in our orthotopic models of localized and disseminated disease. In the current study, we show that MV-NIS is highly effective against medulloblastoma and can promote radioiodine concentration in vitro and in vivo. We also evaluate the efficacy of

MV-NIS against localized and disseminated xenograft models of medulloblastoma both when given alone and in combination with 131I administered at varying timepoints after MV treatment.

MV-NIS treatment followed with 131I at 24 or 48 hours significantly prolonged overall survival in the localized medulloblastoma model. Proper timing of the 131I administration was apparently critical, as the survival benefit was lost at later timepoints. The addition of 131I to MV-NIS in the treatment of disseminated medulloblastoma showed a trend towards increased survival, but was found to be statistically insignificant. Taken together, our data suggest that MV-NIS radiovirotherapy may be a promising therapeutic alternative to conventional therapy.

Materials and Methods

Cell culture

The Vero, D283med and UW426 cell lines were obtained from the American Type Culture

Collection. The D283med-Luc cell line was generated as described previously [190]. All cell lines were maintained in DMEM supplemented with 10-20% FBS, 1% penicillin/streptomycin and

2mM L-glutamine and cultured at 37°C in a humidified incubator set at 5% CO2.

MV-NIS production and titration

The MV-NIS virus was the kind gift of Stephen J. Russell at the Mayo Clinic in Rochester,

Minnesota. MV-NIS stocks were propagated by infecting Vero cells at an MOI of 0.01 in a minimal volume of Opti-MEM (Invitrogen, Carlsbad, CA) for 2 hours. Unbound virus was then removed and replaced with DMEM with 10% FBS and the cells were incubated an additional 48-

72 hours at 37°C. When the majority of the Vero cells had fused into syncytia, the media was removed and the cells were scraped into a small volume of Opti-MEM. MV-NIS was harvested by two cycles of freezing in liquid nitrogen and thawing, followed by centrifugation at 10,000xg to pellet and remove cellular debris. Aliquoted virus was stored at -80°C. Viral titers were determined by 50% tissue culture infective dose (TCID50) titration on Vero cells [206].

In vitro infection assays

D283med and UW426 cells were seeded in six-well plates at a density of 2.5x105 cells/well. After

24 hours of incubation, when the cells had reached approximately 70-80% confluency, they were infected with MV-NIS at MOIs of 0.01, 0.1 and 1 in 200µl of OptiMEM. The virus was removed 2 hours later and replaced with 3 ml of DMEM. Cells were monitored under a microscope for the appearance of syncytia over the next 72 hours and photographed with a

Spot RT KE/SE digital camera (Diagnostic Instruments Inc., Sterling Heights, MI). In vitro kill curves were constructed by determining the number of viable cells at each time point and MOI by trypan blue exclusion. The percentage of surviving cells was calculated by dividing the number of viable cells in an infected well by the number of viable cells in the uninfected well

corresponding to the same time point. Sample and control wells were seeded and counted in triplicate.

In vitro MV-NIS-mediated 125I uptake and retention assays

UW426 and D283med cells were seeded in 6-well plates at a density of 1.5x105 cells/well and

5x105 cells/well respectively. The cells were infected 24 hours later with MOI 0.1 MV-NIS or MV-

GFP in 250 µl OptiMEM and allowed to incubate for an additional 2 hours. Following infection, the media was aspirated and replaced with DMEM until the time of the uptake assay. At each time point, the cells were washed once with warm Hanks’ Balanced Salt Solution (HBSS) and

125 then placed in 900 µl HBSS+10mM HEPES, with or without 100 µM KClO4. One-hundred µl of I

(1x105 cpm total) was then added and the cells were incubated for 45 minutes at 37°C. The plates were then washed with cold HBSS+10mM HEPES, aspirated, and 1 ml of 1M NaOH was added to each well. After shaking for 15 minutes, the NaOH solution was removed and its radioactivity was quantified with a Cobra II gamma counter. Samples were set up and quantified in triplicate. Data is presented as counts per minute per 104 cells.

Radioiodine retention was measured using a slight modification of the above protocol. Following the 45 minute exposure of 125I, the media covering the cells was instead collected and replaced with fresh HBSS+10mM HEPES every 3 minutes for a total of 30 minutes. Cells were then lysed and collected in 1M NaOH at the last timepoint. Total radioactivity at the beginning of efflux was calculated by adding the cpm of each supernatant to that of the lysed cells. Each sample was run in quadruplicate.

In vivo xenograft studies

Localized and disseminated models of medulloblastoma were constructed as described previously [190, 214]. In brief, 1x106 D283med-Luc cells suspended in 7 µl PBS were implanted into the caudate nucleus (localized model) or right lateral ventricle (disseminated model) of 5- week-old Hsd:Athymic Nude-Foxn1nu mice (Harlan Laboratories, Indianapolis, IN).

Bioluminescent imaging was conducted prior to initiating treatment in order to ensure that tumor burdens were roughly equivalent. Treatment with MV-NIS (2x105 pfu/dose) or an equivalent volume of an OptiMEM vehicle control was initiated seven days post tumor implantation for the localized medulloblastoma mice or three days for the disseminated model mice. The mice placed into 131I treatment groups were switched to low-iodine diets and given daily IP injections of 5µg L-thyroxine one week prior to the administration of 131I. A single 37

MBq dose of 131I (Cardinal Radiopharmacy, Columbus, OH) was delivered by IP injection 24-72 hours post MV-NIS treatment. The animals were observed over the following weeks and euthanized if they became lethargic, displayed cachexia or exhibited hemiparesis or other motor impairment. All studies involving animals were approved by the Institutional Animal Care and

Use Committee at The Research Institute at Nationwide Childrens’ Hospital (protocol number:

AR08-00019).

Bioluminescent imaging of tumor and 131I uptake

Bioluminescent imaging was conducted using the Xenogen Ivis Spectrum (Caliper Life Sciences,

Hopkinton, MA). Animals were given an IP injection of 4.5 µg Xenolight Rediject D-Luciferin

(Caliper Life Sciences) and kept under general anesthesia with isoflurane in O2 delivered by a

veterinary vaporizer. Images were obtained 20 minutes after luciferin administration. Uptake of

131I was visualized as Cerenkov luminescence on the same system [215]. Imaging of 131I uptake was performed 24 hours after tumor bioluminescent images were acquired to allow for complete clearance of the luciferin. Image acquisition time was set for a 5 minute exposure. Flux is displayed as average radiance (photons/second/cm2/steradian).

Histopathological evaluation

At the time of necropsy, brains and decalcified spinal columns were fixed overnight in 10% buffered formalin phosphate. They were then paraffin embedded, cut into 4 µm tissue sections, and stained with hematoxylin and eosin (H&E). Individual sections were visualized under a Zeiss

Axioskop 2 Plus microscope and photographed with a Zeiss AxioCam MRc camera (Carl Zeiss

MicroImaging, LLC., Thornwood, NY).

Immunohostochemistry

IHC of tissue slides with anti-Measles Nucleoprotein antibody (NB100-1856; Novus Biologicals,

Littleton, CO) was carried out as described previously [214].

Statistical analysis

Survival curves were generated using the Kaplan-Meier method and GraphPad Prism version

5.01 software (GraphPad Software, Inc.).Comparisons of survival were done via the log-rank test. Differences were considered statistically significant if p ≤ 0.05.

Results

MV-NIS infects medulloblastoma cells and promotes the uptake of radioiodine

We initially tested the efficacy of the MV-NIS virus in vitro against two established medulloblastoma cell lines, UW426 and D283med (Figure 3.1). These cell lines were previously shown to express abundant levels of the measles virus receptor CD46 and were susceptible to infection with an attenuated Edmonston-strain MV [190]. The addition of the NIS gene had no discernible impact on measles virus’ cytotoxic activity, and the formation of syncytia was readily observed in both UW426 and D283med infected at MOIs as low as 0.01 within 48 hours (Figure

3.1A). At higher MOIs of 0.1 and 1, levels of cell death exceeded 90% by 72 hours (Figure 3.1B-

C). We confirmed the expression of functional NIS by performing radionuclide uptake assays at

24, 48 and 72 hours post MV-NIS infection. Increased uptake of 125I was observed in UW426 and

D283med cells infected with MV-NIS, peaking at 48 hours post infection (Figure 3.2A and B).

Extensive cell-death prevented measurement of 125I uptake after 72 hours of infection. The addition of KClO4, a competitive substrate for NIS, resulted in the near complete elimination of

125I uptake. As an additional control, we repeated the experiment substituting an MV encoding green fluorescent protein (MV-GFP) for MV-NIS. The failure of MV-GFP infected cells to incorporate 125I demonstrates that NIS expression is responsible for the observed increases in

125I uptake. Radioiodine retention studies were similarly performed in both medulloblastoma cell lines by collecting and replacing the media on MV-NIS infected cells at 3 minute intervals.

125 The efflux of I was rapid but comparable for each cell line, displaying a t1/2 retention time of approximately 4.5 minutes (Figure 3.2C)

In order to determine whether MV-NIS infection could also promote radioiodine uptake in our in vivo model of localized medulloblastoma, we treated mice bearing D283med-Luc tumors with

5 131 MV-NIS (2 x 10 TCID50) and gave them IP injections of I (37 MBq) 48 hours later. The mice were imaged the following day with a Xenogen Ivis Spectrum imaging system. As a β- particle emitter, 131I generates Cerenkov radiation as it decays, producing visible light detectable with ultra-sensitive charge-coupled device cameras [216, 217]. Figure 3.2C shows representative bioluminescent images of an MV-NIS treated mouse side by side with a vehicle control. The MV-

NIS mouse shows an increased bioluminescent signal originating from the tumor where 131I has accumulated. Strong bioluminescent signals were also noted in the stomach and bladder regions of some of the mice.

We conducted similar studies with mice implanted with D283med-Luc in their lateral ventricles.

In this particular model, the tumor disseminates along the spinal canal with the CSF and closely recapitulates human disseminated medulloblastoma [214]. Despite repeated efforts, we were unable to detect 131I accumulation in the spinal tumors of these mice (data not shown).

Figure 3.1 - MV-NIS induces syncytia formation and cell death in medulloblastoma cell lines. A. UW426 and D283med medulloblastoma cell lines were infected with MV-NIS at MOIs of 0.01, 0.1 and 1 and then monitored for the appearance of syncytia formation over the next three days. The photographs shown here were taken at 100X magnification after 48 hours of infection. B. In vitro kill curves for UW426 and

D283med infected with MV-NIS and MV-GFP. Viability was determined by trypan blue exclusion, and each sample was run in triplicate. The number of viable cells were averaged and expressed as a percentage of an uninfected control for each corresponding timepoint. Error bars represent one standard deviation.

Figure 3.2 - MV-NIS promotes radioiodine uptake in infected medulloblastoma cells. Radionuclide uptake assays were performed with A. UW426 and B. D283med. Each cell line was infected with MV-NIS or MV-

GFP (MOI of 0.1) and then exposed to 1x105 cpm of 125I at 24, 48 or 72 hours post infection. Due to excessive cell death at 72 hours, only data from the 24 and 48 hour timepoints are shown. The addition of

125 KClO4 to the cells effectively blocked incorporation of I. Each sample was run in triplicate, with error bars representing one standard deviation. +/- denotes the presence or absence of KClO4 respectively. C.

Radioiodine kinetics in UW426, D283med and the rat thyroid cell line FRTL-5. 48 hours after MV-NIS

125 infection. Efflux of I is rapid, with a t1/2 retention time of approximately 4.5 minutes for each cell line.

Data points are the average of four independent samples. D. Medulloblastoma xenografts incorporate 131I

5 following MV-NIS infection. The mouse in the left panels received a 2 x 10 TCID50 intratumoral injection of MV-NIS three days following tumor implantation whereas the mouse in the right panels was given an equal volume of OptiMEM to serve as a vehicle control. Tumor bioluminescence was visualized 48 hours later, and the mice subsequently given an IP injection of 37 MBq 131I. Cerenkov luminescence from the irradiated tumors was then visualized the following day. 71

MV-NIS treatment with and without 131I prolongs survival in mouse xenografts

We next sought to determine whether MV-NIS virotherapy in combination with 131I conferred any survival advantage over MV-NIS alone in mice bearing intracranial medulloblastoma tumors.

A total of 48 mice were implanted with D283med-luc cells in their caudate nuclei, and the tumors were given seven days to establish prior to treatment. Bioluminescent imaging revealed that the animals had comparable tumor burdens on the basis of total emitted flux, however four of the mice had developed spinal metastases and were thus excluded from further study. The 44 remaining mice were randomly assigned into the following groups: MV-NIS only (5 mice); MV-

NIS + 131I at 24 hours (10 mice); MV-NIS + 131I at 48 hours (10 mice); MV-NIS + 131I at 72 hours (6 mice); 131I only (5 mice); and vehicle control (8 mice). Mice in the treated groups were given a

5 single intratumoral injection of MV-NIS (2 x 10 TCID50), followed by an IP injection of 37 MBq

131I at the appropriate timepoint. All MV-NIS treated groups exhibited significant increases in survival time compared to the vehicle and 131I controls (p < 0.0001) (Figure 3.3A-C). Mice that received 131I at 24 or 48 hours after MV-NIS treatment, however, displayed statistically significant prolongation of survival compared to those given MV-NIS alone (p = 0.01 and 0.009 respectively). One of the mice in the 24 hour group and one in the 48 hour group survived symptom-free until the experiment endpoint at 100 days post tumor implantation. In contrast, the mice given 131I after 72 hours exhibited similar survival times to those given MV-NIS alone (p

= 0.3). The administration of 131I by itself without prior MV-NIS treatment was found to produce no survival benefit over the vehicle controls (p = 0.3).

A similar series of survival studies was conducted in 35 mice with disseminated D283med-luc tumors (Figure 3.3D). In contrast to the localized medulloblastoma model, the mice in this set of experiments were treated 3 days after tumor implantation as opposed to 7 days. This 72

discrepancy in timing was necessary as rapid occlusion of the ventricles by growing tumor cells can prevent efficient spread of the virus to distant sites [214]. Twenty mice were treated with

MV-NIS, and half of these were subsequently given a 37 MBq dose of 131I delivered by IP at 48 hours post treatment. The remaining 15 mice served as vehicle and 131I controls (n of 10 and 5 respectively). MV-NIS treatment had a profound impact on overall survival (p < 0.0001), nearly doubling median survival times. The addition of 131I to MV-NIS only produced a trend towards increased survival over the virus alone however, and did not quite reach statistical significance

(p = 0.06). Two mice from the MV-NIS + 131I group survived symptom-free until the experiment endpoint at 100 days post tumor implantation, whereas the entirety of the MV-NIS only group succumbed within 84 days.

Histology of MV-NIS treated tumors

The presence of MV in treated tumors was determined by immunohistochemistry (IHC) using an antibody specific for the MV nucleoprotein (Figure 3.4A). Histological examination of the mice in the localized medulloblastoma model survival studies revealed substantial tumor masses in the caudate nuclei of the control and 131I-only mice (Figure 3.4B). Deposits of tumor cells were also frequently detected around the cerebellum, around the base of the brainstem, and packing the lateral and third ventricles. Brains from all groups of MV-NIS treated mice showed large areas of tumor clearance surrounding the injection site, but small foci of tumor that had escaped MV oncolysis could be detected at distant sites of the cerebellum and brainstem. The animals that survived free of visible symptoms until the experiment endpoint were also found to be free of

Figure 3.3 - MV-NIS treatment with and without 131I prolongs survival in mouse models of medulloblastoma. Kaplan-Meier survival analysis of mice with localized medulloblastoma tumors treated

5 131 with 2 x 10 TCID50 MV-NIS. The mice received a 37 MBq dose of I at A. 24 hours, B. 48 hours or C. 72 hours after MV-NIS treatment. The 131I-only mice were given radioiodine five days following tumor implantation. The mice denoted as controls were treated with OptiMEM. D. Survival analysis of mice with disseminated tumors.

viable tumors (Figure 3.4C). During the course of this examination, we noted that several additional treated animals that had succumbed prior to the experiment endpoint were also determined to be tumor-free. These included two additional animals in the MV-NIS with 131I at

24 hours group (three of 10 animals tumor-free), four animals from the MV-NIS + 131I at 48 hours group (five of 10 animals tumor-free), and three animals from the MV-NIS + 131I at 72 hours group (three of six animals tumor-free). Prior to death, these animals had exhibited significant

wasting, lethargy and a kyphotic posture, which are consistent with reported symptoms of 131I- induced gastrointestinal toxicity in mice [218]. Many of these symptoms have also been reported as consequences of MV-induced encephalitis in immunocompromised mice [219]. To investigate this possibility, we performed IHC on brain sections from the seemingly tumor-free mice to assess the extent of any residual MV infection (Figure 3.4D). Although off-target infection of cortical neurons was evident in some of these sections, these events were generally rare and unaccompanied by any overt indications of an inflammatory response indicative of encephalitis.

Histological examination of the brains and spinal cords from mice in the disseminated medulloblastoma model survival studies showed tumor deposits in the ventricles and extensive involvement of the cerebellum, brainstem, and cranial and spinal subarachnoid spaces of control and 131I-only mice (Figure 3.4E). While there was some evidence of tumor clearance in the MV-NIS treated groups (Figure 3.4F), their histological profiles closely mirrored those of the controls. Two of the six mice in the MV-NIS group and five of the six mice from the MV-NIS + 131I had no evidence of spinal metastases, despite the presence of these tumors being confirmed via bioluminescent imaging at the outset of the experiment.

Figure 3.4 - Histology of control and MV-NIS plus 131I treated mice. A. Representative IHC of a mouse brain with anti-MV nucleoprotein antibody. The mouse shown here was sacrificed 24 hours after intratumoral injection of MV-NIS. B.H&E staining of a moribund mouse’s brain that had been previously treated with

OptiMEM following D283med-Luc implantation. The bulk of the cerebral hemisphere has been replaced with tumor. C. H&E staining of the mouse from the MV-NIS + 131I at 48 hours group that survived to the experiment endpoint. A small group of non-viable cells (inset) is the only remaining evidence of the tumor’s presence. Several additional animals from the MV-NIS + 131I groups were likewise devoid of tumor. D. IHC of tumor-free mouse brain with anti-MV nucleoprotein antibody, showing sparse off-target infection of cortical neurons. E. A section of spinal cord from a control mouse showing extensive tumor infiltration. F. A section of spinal cord from a mouse treated with MV-NIS supplemented with 131I at 48 hours post treatment. No evidence of tumor could be found in the spines of five of the six animals in this treatment group.

Discussion

Although current treatment strategies for medulloblastoma are effective, they carry inherent risks and are associated with significant morbidity [27, 220, 221]. Radiation therapy, in particular, is known to produce a broad spectrum of cognitive and endocrine impairments in surviving patients [34, 222]. With these issues in mind, the focus of many labs has shifted towards identifying therapies that are both effective against and highly specific for transformed cells, hopefully mitigating the need for more conventional therapy. In this study, we evaluated the oncolytic activity of MV-NIS used in conjunction with 131I against two xenograft models of medulloblastoma, seeking to combine measles virotherapy with targeted radiotherapy. As a derivative of the attenuated Edmonston vaccine strain, MV-NIS is able to efficiently enter cells through the CD46 receptor and promote mass cell-cell fusion and death via apoptosis [94, 114].

Successful infection and viral propagation is dependent upon high expression of CD46 on the target cell membrane, and this reliance on receptor abundance allows MV-NIS to functionally discriminate between normal and tumor cells [147, 223]. The CD46 receptor is highly expressed in medulloblastoma, making this cancer a suitable target for MV virotherapy [190].

MV-NIS has shown impressive oncolytic activity in multiple preclinical tumor models [141, 146,

147, 149, 224], and its ability to promote iodide uptake in infected tumor cells has made targeted radiotherapy feasible for cancers of various origins. Targeted radiotherapy differs from conventional external beam radiotherapy in that it delivers low doses of radiation over prolonged periods of time and tends to promote non-necrotic mechanisms of cell death through localized, but potent, bystander effects that minimize unintended damage to the normal surrounding tissue [225]. Additional cell killing by radiological cross-fire is also predicted to occur with radionuclides like 131I, whose decay produces β- particles that travel long distances

(up to 0.36 mm) and introduce single-strand DNA breaks in the cells they traverse before dissipating [226]. Since medulloblastomas are highly susceptible to MV oncolysis and known to be radiosensitive [1, 227], we hypothesized that a targeted radiovirotherapy approach using

MV-NIS with 131I would be more effective than MV virotherapy alone.

We were able to confirm that a single intratumoral injection of MV-NIS was capable of promoting 131I uptake in the cranial tumors of treated mice using an emerging imaging modality known as Cerenkov luminescent imaging (CLI). Cerenkov radiation is a phenomenon where charged particles move faster than the speed of light through the medium in which they travel, emitting optical photons in the process [215, 228]. These particles, which are produced during the decay of β--emitting radionuclides, can be subsequently detected by a sensitive charge- coupled device camera like the Xenogen Ivis Spectrum used in the experiments detailed above.

Although the utility of CLI as an imaging modality is currently limited to small-animal molecular imaging, it can provide a means to semi-quantitatively determine signal intensity and spatial distribution of radionuclides like 131I where conventional imaging modalities such as positron emission tomography (PET) or single-photon emission computed tomography (SPECT) are unavailable or cost prohibitive [228].

Kaplan-Meier analysis of our localized medulloblastoma survival studies suggests that the animals did benefit from the inclusion of 131I to their MV-NIS treatment, provided that the 131I was administered within a 24-48 hour window after infection. These time points most likely encompass the period of peak MV-NIS infection in our medulloblastoma model where infected tumor cells have begun expressing NIS but have yet to fully undergo lysis. The addition of 131I at

72 hours post infection, the last time point we evaluated, had no impact on overall survival. The importance of timing the 131I administration following MV-NIS was recently expounded upon in a 78

study by Penheiter et al., who evaluated MV-NIS-mediated radiotherapy in a mouse xenograft model of pancreatic cancer [224]. In this study, mice bearing subcutaneous human pancreatic xenografts were given intratumoral injections of MV-NIS followed by an intraperitoneal dose of

131I six days later. Although SPECT/CT analysis revealed increased radioiodine uptake by the tumors, there was ultimately no benefit to using 131I radiovirotherapy over MV-NIS virotherapy alone. The authors postulated that this lack of synergy may have been due in part to improper timing of 131I administration, and a subsequently performed serial imaging study revealed that peak intratumoral iodide uptake varied between day 3 and day 6 post MV-NIS infection. The tumors that displayed peak iodide uptake on day 3 may have undergone significant cell killing by the virus itself prior to 131I administration, and any added therapeutic benefit gained by its inclusion would be diminished as a result.

In our disseminated medulloblastoma survival studies, the addition of 131I to MV-NIS treated animals produced a moderate increase in survival over MV-NIS only treated animals that approached the threshold of statistical significance (p = 0.06). Disseminated disease is an especially grave prognostic factor, and has proven difficult to effectively treat in both human beings and mouse models [214]. Despite an overt lack of synergy with 131I, MV-NIS was still nevertheless effective as an oncolytic agent. Median survival times of the treated mice were nearly double that of their respective vehicle controls (Figure 3.3D). It is also important to note that we were unable to find spinal tumors in five of the six animals given MV-NIS + 131I at time of autopsy, suggesting that these animals may have died due to residual tumors around their brainstems and cerebella. Future experiments aimed at optimizing virus delivery and 131I dosing may eventually yield enhanced efficacy in this model.

During the course of the localized medulloblastoma survival studies, a substantial number of treated and otherwise tumor-free mice succumbed prior to the experiment endpoint. Although it is difficult to draw definitive conclusions, we believe that these animals died from the effects of gastrointestinal toxicity following 131I administration. Although NIS is primarily expressed by and associated with thyroid follicular cells, it is also abundant in the gastric mucosa of mice

[229]. Uptake of 131I leads to the death of these gastric cells, which eventually culminates in animal malnutrition over the long term [150, 229]. The mice in our studies that were determined to be tumor-free all came from treatment groups that received an IP dose of 131I, making gastrointestinal toxicity the likely cause of their premature deaths. A recently published paper by Opyrchal and colleagues examined the efficacy of MV-NIS radiovirotherapy in an orthotopic model of malignant glioma and arrived at similar conclusions [150]. An alternative explanation may be that our mice developed an adverse reaction to the measles virus on account of their severely immunocompromised state. In mice, resistance and susceptibility to

MV-induced encephalitis is governed by their major histocompatibility complex haplotype [230].

Nude mice, characterized by their thymic aplasia, are unable to produce functional CD4+ and

CD8+ T lymphocytes, which play important roles in clearing MV from the central nervous system

[231]. Neurologic disease has been shown to occur in these animals following intracerebral inoculation with Edmonston strain MV, albeit after long incubation periods (49 to 140 days after

104 pfu virus) [232]. For comparison, the seemingly cured mice from our studies died between days 45 and 87 following MV-NIS treatment. While MV toxicity was not considered a potential contributing cause of death in the Opyrchal paper, it should be noted that their survival studies were terminated within 30-40 days of MV-NIS treatment. Although none of the mice in our survival studies displayed any outward neurological symptoms suggestive of encephalitis in the

days leading up to their deaths, IHC with an anti-MV nucleoprotein antibody did reveal a low grade infection in some of the animals’ brains (Figure 3.4D). These infected neurons were sparse and unaccompanied by the presence of activated microglia which would be indicative of an inflammatory response.

Whether the cause of premature death in these animals was due to 131I or the virus itself, the toxicity observed here should not extend to immunocompetent human beings. The side effects for 131I-based therapies in humans are generally mild when administered in reasonable doses

[233, 234] and the safety of MV-NIS has been vetted in preclinical toxicity studies and phase I clinical trials [140, 152, 185]. MV-NIS is a derivative of the Edmonston vaccine strain, a highly attenuated strain of measles virus that has a remarkable safety record spanning over a billion recipients worldwide [96]. With close to five decades of use, its reversion to pathogenicity has never been reported [35]. Extensive studies have also shown no clinical evidence of toxicity in non-human primates following intracerebral injection of Edmonston strain MV [211, 213]. In addition, phase I clinical trials with oncolytic MV are presently underway for treatment of multiple myeloma[152], recurrent glioblastoma multiforme [139], and ovarian cancer [140].

While data from these trials is still forthcoming, no dose-limiting toxicity has been observed

9 7 following delivery of MV up to 10 TCID50 by IP or IV administration and up to 10 TCID50 for MV delivered through the central nervous system [111]. We have recently proposed a Phase 1 clinical trial investigating the use of oncolytic MV to treat recurrent medulloblastoma. While we foresee no complications with MV-associated toxicity, additional measures to further restrict

MV replication to tumor cells are available should they be deemed necessary [167, 235].

In conclusion, the data presented here show that MV-NIS virotherapy is an effective means of treating medulloblastoma in mouse xenografts, and that its oncolytic activity against localized 81

tumors can be further enhanced by the subsequent IP administration of 37 MBq of 131I at 24 or

48 hours of viral delivery. Proper timing of 131I administration treatment appears to be critical in this tumor model, as this survival benefit was lost when 131I was given 72 hours after MV-NIS treatment. Significant questions remain to be addressed however. Despite its utility in determining whether 131I has been concentrated by the tumor, CLI currently lacks the resolution to provide tomographic detail about and quantification of radioactivity uptake. Understanding these parameters will be necessary before extrapolating the potential of MV-NIS-based therapies to human medulloblastoma patients, as effective radionuclide therapy is dependent upon total isotope uptake and retention in order to deposit therapeutically relevant levels of energy in the tumor [236]. Our in vitro 125I efflux experiments suggest that radioiodine retention in medulloblastoma cells is fleeting (Figure 3.2C), so additional measures to improve iodide organification or slow its release may be necessary in order to achieve clinical benefit. Future studies using MV-NIS to treat medulloblastoma should also be aimed at ascertaining optimal viral and 131I dosing rates and expanded to include non-invasive monitoring of viral propagation and distribution. Our initial results are encouraging, however, and suggest that MV-NIS mediated radiovirotherapy may have clinical utility in the treatment of medulloblastoma.

Acknowledgements

These studies were funded by a Nationwide Children’s Hospital start-up grant awarded to Corey

Raffel.

This work was supported by the Pelotonia Fellowship Program. Any opinions, findings, and conclusions expressed in this material are those of the author(s) and do not necessarily reflect those of the Pelotonia Fellowship Program.

Chapter 4: Treatment of medulloblastoma with oncolytic measles viruses expressing the angiogenesis inhibitors endostatin and angiostatin

Introduction

Medulloblastoma is the most common malignant brain tumor in children, accounting for 20% of all pediatric tumors of the central nervous system [1, 5]. Treatment strategies are based on a system of risk stratification, and typically include surgical resection followed by craniospinal irradiation and adjuvant chemotherapy [1]. Despite significant increases in overall survival, approximately one-third of medulloblastoma patients will remain refractory to current treatments [17]. Moreover, the majority of survivors will suffer severe and often permanent side-effects such as neurological and cognitive impairment, endocrine abnormalities, and physical disabilities [29, 31]. As such, there is a great need for safer and more effective therapies to treat medulloblastoma.

Oncolytic virotherapy may represent such an approach. An oncolytic virus is one that selectively infects and kills neoplastic tissue, leaving the normal surrounding tissue unharmed as it continues to replicate in and lyse transformed cells [111]. We have recently reported on the potential of a recombinant oncolytic measles virus (MV) against medulloblastoma, demonstrating its efficacy in orthotopic mouse models of localized and disseminated disease

[190, 214]. In each study, intratumoral administration of MV led to tumor stabilization or remission and effectively doubled the median survival times of treated mice compared to their

untreated controls. The oncolytic MVs utilized in our studies were based on the highly attenuated Edmonston vaccine strain, which has been in clinical use for nearly five decades without report of incidence [35]. Genetically modified derivatives of Edmonston MV are currently being tested in phase I clinical trials for the treatment of both solid tumors and cancers of the blood and have thus far proven to be safe and reasonably effective [139, 140, 152].

Although data from these trials is still forthcoming, efforts to develop a new class of oncolytic

MVs with enhanced antitumor properties continue to be made and tested in various preclinical models of cancer [157, 163].

Angiogenesis is the dynamic and highly regulated process in which new blood vessels arise from the pre-existing vasculature. It has long been recognized that abnormal angiogenesis is a critical component of tumor maintenance and progression, and the disruption of this event has grown to become one of the most intensely investigated areas of cancer research [237, 238]. Malignant brain tumors, including medulloblastoma, are among the most angiogenic of all human solid tumors [239, 240]. A wide range of angiogenic factors are produced by medulloblastomas that, alone or in concert, play a direct role in tumor growth and survival [241]. Anti-angiogenic therapies could thus be a useful component in the treatment of this disease.

Endostatin and angiostatin are two endogenous inhibitors of angiogenesis that were identified in the laboratory of the late Judah Folkman [242, 243]. Endostatin, a naturally occurring fragment of collagen XVIII, has a broad spectrum of anti-angiogenic activities and is known to target angiogenesis regulatory genes on more than 12% of the human genome [244]. Despite such wide-ranging effects, endostatin exhibits virtually no toxicity and there are no reports of tumors developing endostatin resistance [245]. Angiostatin is a proteolytic cleavage product of plasminogen, and is capable of inhibiting endothelial cell migration and proliferation by 85

interacting with endothelial cell surface proteins such as ATP synthase and angiomotin [246].

Although there is still considerable uncertainty regarding its mechanisms of action, angiostatin has no associated toxicities and has been shown to act synergistically with endostatin when the two agents are used in combination [247]. Clinical success has largely eluded endostatin and angiostatin-based therapies however, due to issues such as manufacturing difficulties and short serum half-lives [248, 249]. One potential solution to address these shortcomings is the use of gene transfer strategies to systemically deliver a continuous source of endostatin and angiostatin to tumor [250]. To investigate this possibility within the context of oncolytic measles virotherapy, we have developed recombinant MVs that express endostatin:angiostatin (E:A) fusion proteins. Because Edmonston strain MVs are inherently tumor-selective and retain their ability to replicate, an E:A armed MV could potentially result in the targeted inhibition of angiogenesis within the local tumor environment, curtailing the delivery of vital oxygen and nutrients to regions of the tumor not directly lysed by the virus itself. In this report, we demonstrate that oncolytic MVs armed with E:A can induce infected medulloblastoma tumor cells to secrete endostatin and angiostatin without attenuating the oncolytic activity of the MV itself. In addition, the E:A secreted by these infected tumor cells is biologically active and is capable of inhibiting multiple regulators of angiogenesis in vitro and in vivo.

Materials and Methods

Cell culture

The 293T, Vero, D283med, human umbilical vein endothelial cells (HUVEC) and bEnd.3 cell lines were obtained from the American Type Culture Collection. The D425med cell line was obtained from Darrell Bigner (Duke University, Durham, NC). The D283med-luc and D425med-luc cell lines were generated as described previously [190, 214]. The 293T, Vero, D283med, D425med and bEnd.3cell lines were maintained in DMEM supplemented with 10-20% FBS, 1% penicillin/streptomycin and 2mM L-glutamine and cultured at 37°C in a humidified incubator set at 5% CO2. Low passage HUVEC cells were maintained in endothelial cell growth medium M200

(Invitrogen) in high glucose supplemented medium with 10% FBS, endothelial cell growth supplements (Cascade Biologics Inc., Portland Oregon), and 2 mM L-glutamine at 37°C with 5%

CO2.

Measles virus plasmid construction and rescue

Plasmids pBLAST-hEndo:Angio and pBLAST-mEndo:Angio were obtained from InvivoGen (San

Diego, CA). Amplicons of plasmid DNA encompassing the human Interleukin-2 signaling peptide and the full length endostatin:angiostatin fusion genes were generated using Easy-A high-fidelity

PCR cloning enzyme (Agilent Technologies, Wilmington, DE) and the following sets of PCR primers: hE:A forward - 5’CAGCCCATCAACGCGTTAATGTACAGGATGCAACTCCTGTC 3’, hE:A reverse- 5’TAGTATCATCGCGAGACGTCCATGTCATACAACACTCGCTTCTGTTC 3’ and mE:A forward

– 5’TAACGCGTACCATGTACAGGATGCAACTC 3’, mE:A reverse –

5’TAGACGTCCTAACTCCCTCCTGTCTC 3’. These PCR products were then cloned into a previously

mluI/AatII digested MV-NIS backbone (obtained from Stephen Russell, Mayo Clinic, Rochester,

MN) using the InFusion HD cloning system (Clontech, Mountain View, CA) to create plasmids pMV-hEndo:Angio and pMV-mEndo:Angio. The pMV-GFP plasmid and corresponding virus was created by PCR amplifying eGFP from the p(+)MVeGFP plasmid [136] using the following primers: GFP2 forward: 5’CAGCCCATCAACGCGTACGCCACCATGGTGAGCAAG 3’ and GFP2 reverse: 5’TAGTATCATCGCGAGACGTCCAGTCTACTTGTACAGCTCGTCC 3’. The resulting PCR product was cloned into TOPO-pCR 2.1 using the TOPO TA cloning kit (Invitrogen, Carlsbad, CA).

The eGFP gene was excised from this plasmid by restriction digestion with mluI and AatII, gel purified, and then ligated into an mluI/AatII opened pMV-hEndo:Angio plasmid to create pMV-

GFP2.

Four µg of these pMV plasmids were transfected into 60% confluent 293T cells alongside the MV accessory plasmids pCA-MVN, pCA-MVP, pCA-MV-L and the T7 polymerase encoding pCA-T7pol

(kind gifts of Urs Schneider, University of Freiburg, Freiburg, Germany) [251] using the calcium phosphate method. The media on the transfected cells was changed with fresh DMEM after 24 hours. After an additional 24-48 hours, the transfected 293T were scraped into their media and overlaid onto 70% confluent Vero cells in 10cm plates. These cells were then incubated at 37°C over the next several days and monitored periodically for the appearance of syncytia. Once identified, these cells were split and evenly distributed on new plates of 70% confluent Vero cells. After 48-72 hours, the media was removed and the cells were scraped into a minimal volume of OptiMEM (Invitrogen, Carlsbad, CA). The collected cells were then subjected to two cycles of freeze-thawing, followed by centrifugation at 10,000xg to pellet and remove cellular debris. These initial MV products were stored at -80°C and titered the following day as described below.

MV propagation and titering

MV stocks were propagated by infecting Vero cells at an MOI of 0.01 in a minimal volume of

OptiMEM for 2 hours. Unbound virus was then removed and replaced with DMEM with 10% FBS and the cells were incubated an additional 48-72 hours at 37°C. When the majority of the Vero cells had fused into syncytia, the media was removed and the cells were scraped into a small volume of OptiMEM. MV was harvested by two cycles of freezing in liquid nitrogen and thawing, followed by centrifugation at 10,000xG to pellet and remove cellular debris. Aliquoted virus was stored at -80°C. Viral titers were determined by 50% tissue culture infective dose (TCID50) titration on Vero cells [206].

In vitro kill curves

D283med and D425med cells were seeded in 96-well plates at a density of 3x104 cells/well in a volume of 75 µl DMEM. The cells were infected with MOI 0.1 MV after 24 hours of incubation, when they had reached approximately 70-80% confluency. Cell viability was determined using the MTT assay (ATCC, Manassas, VA). Absorbance at 570nm was measured for each well using a

SpectraMax M2 microplate reader (Molecular Devices, Sunnyvale, CA) and compared to an uninfected control at each corresponding timepoint. Each sample and control was run in quintuplicate. The average absorbance for each sample is presented as a percentage of the uninfected controls. Error bars represent +/- one standard deviation.

In vitro virus production assays

D283med (7.5x105 cells/well) and D425med cells (1x106 cells/well) were seeded in 6-well plates and infected the following day with MOI 0.1 MV in 500µl OptiMEM. Unabsorbed virus was removed after two hours and replaced with 3ml fresh DMEM. The cells were scraped into 125 µl

OptiMEM at 24, 48 or 72 hours after infection, freeze-thawed twice, and centrifuged. The collected MV was then titered on Vero cells using the TCID50 method. Samples were assayed in triplicate.

ELISA and Western blotting

An enzyme-linked immunosorbent assay (ELISA) for human endostatin was performed with the

Quantikine human endostatin immunoassay per the manufacturer’s protocol (R&D Systems,

Minneapolis, MN). Conditioned media for the assay was obtained by seeding 5x105 D283med or

7.5x105 D425med cells in 6-well plates and infecting them the following day with MOI 0.1 MV- hEndo:Angio in a total volume of 500 µl OptiMEM. Unabsorbed virus was removed after two hours and the cells were incubated in 700 µl DMEM for an additional 48 hours. Infected cell supernates were collected, centrifuged briefly, and then subjected to UV light exposure for 10 minutes to inactivate any residual virus. Samples were diluted 1:30 in assay diluent and run in triplicate. Data are presented as ng endostatin per ml per 104 cells. Error bars represent +/- one standard deviation.

For Western blotting, 25 µl of the same D283med and D425med supernates were resolved on a

10% SDS-PAGE gel and transferred to a PVDF membrane. After blocking, the membrane was probed with a 1:1000 dilution of anti-angiostatin antibody (BAF226, R&D Systems) overnight 90

and developed the following day with Pierce ECL Western Blotting Substrate (Thermo Fisher

Scientific). Western blotting was performed with at least two independent samples, with three minute exposures carried out for each blot.

Production of conditioned media

Conditioned media for the HUVEC and bEnd.3 mouse endothelial cell studies was obtained by infecting semi-confluent 15cm plates of Vero cells with MV-GFP, MV-hEndo:Angio, or MV- mEndo:Angio at an MOI of 0.01 in 5ml total volume OptiMEM. After two hours, the OptiMEM containing virus was removed and replaced with 15ml of DMEM + 10% FBS and the infected

Vero cells were incubated at 37°C for an additional 48 hours. The media covering these cells was collected, centrifuged, aliquoted and stored at -80°C. Total protein concentration in the conditioned media was determined by Bradford assay (Bio-Rad, Hercules, CA). Residual virus was inactivated by exposure to UV light for 10 minutes prior to use.

Endothelial cell tube formation and viability assays

Endothelial tube formation was evaluated with the Endothelial Tube Formation Assay (CBA200,

Cell Biolabs Inc., San Diego, CA, USA). The supplied extracellular matrix (ECM) gel was thawed at

4°C and mixed to homogeneity using cooled pipette tips. A thin layer of ECM was then pipetted into the wells of a 96-well plate (50µl/well) and allowed to polymerize at 37°C for 60 minutes.

Two-3x104 HUVECs or bEnd.3 stimulated with VEGF (10ng/ml human VEGF or 20ng/ml mouse

VEGF) in 150 µl medium were added to each well on the solidified ECM gel. Culture medium was

then added to each well in the presence or absence of MV-infected Vero conditioned media

(10µg/ml total protein concentration). The plates were incubated at 37°C for 18 hours and the endothelial tubes were observed using a fluorescent microscope after staining with Calcein AM.

Three microscope fields were selected at random and photographed. Tube forming ability was quantified by counting the total number of cell clusters and branches under a 4X objective and four different fields per well. The results are expressed as mean fold change of branching compared with the control groups.

For viability/proliferation assays, HUVEC and bEnd.3 cells were seeded on 6-well plates at a density of approximately 1×105 cells/well in M200 medium. Cells were treated with 10µg/ml of

MV-conditioned media one day after seeding. After two days, Alamar Blue reagent (Invitrogen) was added directly into culture media at a final concentration of 10% and the plates were incubated at 37°C. Optical density was measured spectrophotometrically at 540 and 630 nm three hours later. As a negative control, Alamar Blue was added to medium without cells. Each experiment was performed a minimum of three times using endothelial cells between passages three and eight.

Migration assays

HUVEC and bEnd.3 migration was monitored using the wound-healing assay described by

Thaloor et al. [252]. In brief, 3×104 cells/well/ml were seeded in 24-well plates in M200 medium supplemented with low serum growth supplement (Cascade Biologics Inc.). After the cells had attached and formed a complete monolayer, a wound was made by scraping the surface of each well with a pipet tip. The cells were subsequently washed with PBS and incubated with the

medium containing VEGF (10ng/ml for HUVEC and 20ng/ml for bEnd.3) with or without MV conditioned media (10µg/ml). The width of the scraped area was photographed at different time intervals (0 and 18 hours) with a microscopic camera system (Leitz Diavert microscope,

Leica, Bensheim; AxioCam, Carl Zeiss, Gottingen, Germany) at 40X magnification.

For quantitative analysis, HUVEC and bEnd.3 were grown in M200 containing low serum growth supplements until 40–50% confluent. Cells were washed with PBS, trypsinized, collected with

0.2% FBS and centrifuged at 300xG for 5 min. Cells were then resuspended with 0.2% FBS and counted using a Beckman Coulter Z2. A volume of 400 µl of this mix containing 5×105 cells was placed on to Boyden Chambers (8 µm pore) inserts with and without MV conditioned media

(10µg/ml) in 24 well plates with 500 µl of M200. Human or mouse VEGF in 1% BSA was added to a final concentration of 10 or 20 ng/ml in the lower chambers as a chemo-attractant. The cells were then incubated at 37°C for 18–24 hrs. The Boyden chamber porous membranes were then blotted and fixed with 3.7% formaldehyde containing 0.05% crystal violet for 30 min. After repeated washes with distilled water, the membranes were air-dried. The migrated cells on the bottom side of the membranes were collected by scraping the bottom of the chamber with a Q- tip, which was subsequently placed into a 1.5 ml eppendorf tube and incubated in 80% methanol to extract the dye. The cells that remained on top of the membrane and within the

Boyden chamber were separately incubated in 80% methanol, shaken at 500 rpm for 30 min, and the extracted dye measured at 570 nm. Migration was quantified using the ratio of the migrated cells over the total cells (migrated plus remaining cells) to determine the fraction of migrating cells in each individual experiment. Experiments were performed in duplicate.

In vivo xenograft studies

The establishment of localized medulloblastoma tumors was conducted as previously described

[190]. In brief, 5x105 D283med-luc or 2.5x105 D425med-luc cells suspended in 2 µl PBS were implanted into the caudate nuclei of 5-6 week-old Hsd:Athymic Nude-Foxn1nu mice (Harlan

Laboratories, Indianapolis, IN). Bioluminescent imaging was conducted using the Xenogen Ivis

Spectrum (Caliper Life Sciences, Hopkinton, MA) to ensure that the animals had roughly equivalent tumor burdens prior to being separated into treatment groups. These mice were subsequently treated with an intratumoral injection of the specified MV (2x105 pfu/dose) or an equivalent volume of an OptiMEM vehicle control at the times outlined in the text. The animals were observed over the following weeks and euthanized if they became lethargic, displayed cachexia or exhibited hemiparesis or other motor impairment. All studies involving animals were approved by the Institutional Animal Care and Use Committee at The Research Institute at

Nationwide Childrens’ Hospital.

At the time of necropsy, the brains were removed and fixed overnight in 10% buffered formalin phosphate. They were then paraffin embedded, cut into 4 µm tissue sections, and stained with hematoxylin and eosin (H&E). Individual sections were visualized under a Zeiss Axioskop 2 Plus microscope and photographed with a Zeiss AxioCam MRc camera (Carl Zeiss MicroImaging, LLC.,

Thornwood, NY).

Human angiogenesis protein array

Proteome Profiler Human Angiogenesis Array Kits (R&D Systems, Minneapolis, MN) were used per the manufacturer’s instructions to detect the relative expression levels of 55 angiogenesis- 94

related proteins in conditioned media-treated HUVECs and MV-treated mice bearing intracranial

D283med-luc tumors. For HUVEC studies, whole cell lysate was made from HUVEC cells treated with 100µg/ml MV-GFP or MV-hE:A conditioned media for 24 hours. After blocking the membranes, 300 µg of protein from the samples were added and incubated overnight at 4°C.

The membranes were washed the next day and streptavidin-HRP was added or 30 minutes.

Immunoreactive signals were visualized using Super Signal Chemiluminiscence substrate (Pierce) and Biomax MR and XAR film (Eastman Kodak Co.). Array data on developed X-ray film was quantified by scanning the film using Biorad Molecular Image Gel Doc™ XR+ and analyzed using

Image Lab™ software. Arrays for the in vivo studies were conducted in a similar fashion, using

300 µg lysate derived from excised D283med-luc tumors three days following MV treatment.

Two tumors were analyzed for each treatment group.

Statistical analysis

Survival curves were generated using the Kaplan-Meier method and GraphPad Prism version

5.01 software (GraphPad Software, Inc.). Comparisons of survival were done via the log-rank test. Differences were considered statistically significant if p ≤ 0.05. All other statistical analysis was performed using Microsoft Office Excel 2010 in Data Analysis using Regression or Student's t test: paired 2-sample for means. Probabilities for the Student's t test are listed as “P(T ≤ t) 2-tail” with an α of 0.05.

Results

Construction and oncolytic activity of measles viruses expressing endostatin:angiostatin fusion proteins

Human and mouse variants of an E:A fusion protein appended to the human Interleukin-2 signal peptide were cloned into the mluI/AatII restriction site of the parental MV-NIS virus (Figure

4.1A). The resulting viruses, designated MV-hE:A and MV-mE:A, were subsequently rescued as described elsewhere [251]. Since the insertion and location of an additional transcription unit in the MV genome can affect virus production [57], an MV encoding GFP at this position (MV-GFP) was also designed and rescued to serve as a control. We compared the oncolytic activity of these viruses in vitro by infecting the D283med and D425med medulloblastoma cell lines at MOI

0.1 and found the efficacy of the viruses to be roughly equivalent (Figure 4.1B-C). In vitro virus replication assays also showed that MV-hE:A, MV-mE:A and MV-GFP had similar growth kinetics

(Figure 4.1D-E).

Figure 4.1 – Construction of MV-E:A viruses and evaluation of their cytopathic activity. A. Human/mouse

E:A or enhanced GFP were cloned into the mluI/AatII restriction site of MV-NIS to create the MV-hE:A,

MV-mE:A and MV-GFP viruses. The human IL-2 signaling peptide (hIL-2) appended to the E:A proteins results in their secretion from the infected cells. The oncolytic activity of these new viruses was compared by infecting B. D283med and C. D425med cells at an MOI of 0.1 and measuring their viability over the next three days by MTT assay. Viral production assays were similarly conducted by infecting D. D283med and E. D425med at MOI 0.1 and analyzing cell lysates collected at the listed timepoints. Viral titers were determined by the TCID50 method.

Verification of endostatin:angiostatin production and biological activity

In order to determine if MV-hE:A infection induced medulloblastoma cells to secrete E:A, we performed ELISA and immunoblot analysis with D283med and D425med cell culture supernates.

Only the cells infected with MV-hE:A produced detectable quantities of endostatin, which increased steadily over 24-72 hours following infection as quantified by ELISA (Figure 4.2A).

Angiostatin production, which should be equal to endostatin as the two are secreted as a fusion protein, was nonetheless confirmed by an immunoblot with an anti-angiostatin antibody (Figure

4.2B). Supernates from MV-mE:A infected cells were similarly evaluated, but the human-specific antibodies used in these experiments were unable to detect mouse E:A (data not shown).

We then performed a series of experiments to determine whether the E:A being produced by the MV infected cells was physiologically active. Tube formation assays were conducted by stimulating HUVECs with 10 ng/ml recombinant human VEGF in the presence or absence of MV-

GFP, MV-hE:A and MV-mE:A conditioned media (10µg/ml total protein). This conditioned media had previously been subjected to UV light in order to inactivate any residual viral activity. The addition of VEGF precipitated HUVEC tube formation in the control PBS and MV-GFP treated samples within 24 hours, but this process was inhibited in the samples treated with MV-hE:A and MV-mE:A conditioned media (Figure 4.2C). Quantification of branch numbers revealed that both MV-hE:A and MV-mE:A had a significant impact on tube formation compared to MV-GFP (p

< 0.001 and p < 0.05 respectively), and that MV-hE:A had a greater effect in this regard over MV- mE:A (p < 0.05) (Figure 4.2D). We then evaluated the effect the virus conditioned media had on endothelial cell migration, one of the hallmarks of angiogenesis. Scratch assays were performed in monolayers of HUVEC cells treated with MV-GFP, MV-hE:A or MV-mE:A conditioned media and were photographed immediately thereafter and at 18 hours later. Cells had migrated to 98

completely fill the void left in the MV-GFP samples, but evidence of the scratches was visible in the samples treated with MV-hE:A and MV-mE:A (Figure 4.2E). A quantitative migration assay using the crystal violet method and 10ng/ml human VEGF as a chemoattractant produced similar results. Conditioned media from MV-hE:A and MV-mE:A inhibited endothelial cell migration whereas MV-GFP had no effect over the control PBS samples (Figure 4.2F).

Since the majority of new blood vessels formed in our xenograft models of medulloblastoma would ostensibly be of murine origin, we also examined the effects of MV conditioned media on bEnd.3 mouse endothelial cells (MEC). We observed a significant decrease in VEGF-mediated

MEC tube formation in samples treated with 10µg/ml of MV-hE:A or MV-mE:A conditioned media relative to MV-GFP and PBS treated samples (Figure 4.3A). In contrast to the HUVEC tube formation assay where MV-hE:A was more effective in inhibiting tube formation (Figure 4.2D),

MV-mE:A was significantly more effective at inhibiting MEC tube formation (p < 0.05). We next conducted viability assays with HUVEC and MEC cells stimulated by VEGF (10ng/ml human VEGF and 20ng/ml mouse VEGF respectively) and treated with 10µg/ml of MV conditioned media or an equal volume of PBS. While the addition of VEGF led to increased cell proliferation irrespective of other treatment, MV-hE:A and MV-mE:A conditioned media were able to impede this process to some degree, each demonstrating superior activity against the endothelial cells of their native species (Figure 4.3B). We performed a similar series of experiments with the

D283med and D425med medulloblastoma cell lines to determine if the MV conditioned media had a direct effect on their viability as well. For this set of experiments, we evaluated several different concentrations of conditioned media up to 500µg/ml, but observed no significant deviations in viability amongst them (data not shown).

Figure 4.2 - MV-hE:A and MV-mE:A infection results in the secretion of active endostatin:angiostatin. A.

Human endostatin production in infected D283med and D425med cells as quantified by ELISA. Endostatin concentration is expressed in ng/ml per 104 cells. B. Western blot analysis of media taken from infected

D283med and D425med probed with an anti-angiostatin antibody. C-D. Conditioned media from MV-hE:A and MV-mE:A infected Vero cells (10µg/ml total protein) inhibits VEGF-mediated tube formation in

HUVEC cells (*p ≤ 0.05, ** p ≤ 0.001). E. To examine the effect of MV-E:A conditioned media on migration, scratch assays were performed in HUVECs by allowing the cells to move to the scraped region for 18 hours using VEGF (10 ng/ml) as a positive control in the presence and absence of MV conditioned media

(original magnification ×40). F. A crystal violet assay was also performed as described in Materials and

Methods section to quantify the effect of MV conditioned media on migration (*p ≤ 0.05).

100

Endostatin:Angiostatin inhibits multiple angiogenic factors in vitro and in vivo

In order to investigate whether the E:A produced by MV infected cells could inhibit angiogenic factors beyond VEGF, we examined the levels of 55 proteins related to angiogenesis using a commercially available protein array (R&D Systems). Since the antibodies employed by this array were human-specific, we limited our focus to HUVEC treated with MV-hE:A and MV-GFP conditioned media. Relative to MV-GFP, MV-hE:A treatment resulted in decreased expression of angiogenic proteins such as angiopoietin-2, coagulation factor III, epidermal growth factor (EGF), endothelin-1, fibroblast growth factor (FGF), heparin-binding EGF-like growth factor (HB-EGF), insulin-like growth factor-binding protein 2 (IGFBP-2), transforming growth factor (TGF)-β1, platelet-derived growth factor (PDGF), placental growth factor (PlGF), and urokinase plasminogen activator (uPA) (Figure 4.3C).

To examine whether MV-hE:A and MV-mE:A infection could similarly inhibit critical angiogenic factors in medulloblastoma tumors, we implanted 5x105 D283med-luc cells into the caudate

5 nuclei of athymic nude mice and treated them 30 days afterwards with a 2x10 TCID50 dose of

5 5 MV-GFP or a combined dose of 1x10 TCID50 MV-hE:A and 1x10 TCID50 MV-mE:A. The rationale for this combined MV-E:A approach was based on recent observations made in a xenograft model of glioblastoma, wherein a significant portion of the vascular epithelium was found to be of neoplastic and thus human origin [253]. The animals were sacrificed three days after treatment and the tumors were carefully excised. Analysis of these tumor lysates revealed that the combined MV-EA treatment resulted in significant down-regulation of several angiogenic factors compared to the tumors treated with MV-GFP (Figure 4.4).

101

Figure 4.3 – MV-hE:A and MV-mE:A conditioned media inhibit angiogenic processes. A. Conditioned media (10µg/ml total protein) from the MV-E:A viruses, but not MV-GFP inhibits tube formation in bEnd.3 mouse endothelial cells stimulated with 20ng/ml recombinant mouse VEGF (*p ≤ 0.05, ** p ≤ 0.001). B.

MV-E:A conditioned media suppresses VEGF enhancement of cell viability in HUVEC and bEnd.3 cells (*p ≤

0.05). C. An angiogenesis protein array reveals that MV-hE:A conditioned media (100µg/ml total protein) downregulates multiple angiogenic proteins in HUVECs compared to MV-GFP. Changes in protein expression are quantified in the accompanying bar graph.

102

Figure 4.4 – MV-E:A infection downregulates multiple angiogenic factors in D283med-luc xenografts.

Changes in angiogenic protein expression were monitored using a Proteome profiler antibody array as described in the Materials and Methods section.

103

MV-E:A viruses prolong survival in mouse models of localized medulloblastoma

A mouse xenograft model of localized medulloblastoma was utilized to assess the efficacy of the

MV-E:A viruses in prolonging survival [190]. Using stereotactic guidance, we implanted a total of

80 mice with 1x106 D283med-luc cells. Bioluminescent imaging was performed 14 days later in order to verify that the tumors had properly established and were of roughly equivalent size on the basis of total emitted flux; animals displaying tumor dissemination or bioluminescent signals that fell outside of a standard deviation were excluded from further analysis. The remaining animals were placed into the following treatment groups: MV-GFP (n=11); MV-hE:A (n=8); MV- mE:A (n=11), a combination of the MV-E:A viruses (n=11), and a vehicle control (n=8). We then

5 treated the animals with a 2x10 TCID50 intratumoral dose of their respective virus (combined

5 MV-E:A animals received a 1x10 TCID50 dose of both MV-hE:A and MV-mE:A) or an equivalent volume of optiMEM. The animals in the treated groups all displayed a significant prolongation in survival over the vehicle controls (p ≤ 0.0001), however the MV-hE:A and MV-mE:A viruses showed no benefit compared MV-GFP (Figure 4.5A). The combined MV-E:A treated animals showed a slight trend towards increased survival over MV-GFP (median survival times of 90 days versus 78 days), but this difference was not statistically significant.

We performed a similar survival study with the D425med-luc line. Because D425med-luc in our experience grows more rapidly and generates more aggressive tumors, only 2.5x105 cells were implanted in these mice. The treatment groups were as follows: MV-GFP (n=9); the combined

MV-E:A viruses (n=9); and a vehicle control (n=9). MV treatment of these tumors led to prolonged survival in the treated groups (p ≤ 0.0001), but there was again no significant benefit

104

in using the combined MV-E:A viruses over MV-GFP (median survival times of 29 days versus 25 days) (Figure 4.5B).

Figure 4.5 – MV-E:A viruses prolong survival in mouse xenograft models of medulloblastoma. Kaplan-

Meier survival anaysis of mice implanted with A. D283med-luc and B. D425med-luc and treated 14 days

5 later with a single intratumoral injection of the listed MVs (2x10 TCID50).

Discussion

Although there are more than 100 subcategories of brain tumors with different biological characteristics, each is reliant on the generation of new blood vessels for survival and growth, providing a powerful rationale for the inclusion of anti-angiogenic agents in their treatment

[239]. The use of such therapies in the treatment of medulloblastoma has thus far been surprisingly limited, but recent case studies have demonstrated improved progression-free survival in patients treated with the anti-VEGF monoclonal antibody Bevacizumab in combination with other chemotherapeutics [254, 255]. Aside from VEGF, medulloblastomas have been shown to produce several factors that contribute to angiogenesis including basic FGF,

105

angiopoetin-1 and -2, TGF-α, and PDGF-A [241]. As such, prospective anti-angiogenesis therapeutic strategies that target only a single angiogenic factor or pathway could ultimately prove to be inadequate.

Endostatin and angiostatin are two endogenous and broad-spectrum inhibitors of angiogenesis.

While numerous studies have demonstrated impressive anti-angiogenic and antitumor activities with these agents in rodent models, similar findings have not materialized in phase I/II trials with human patients [256-259]. Several factors have hindered the advancement of endostatin- and angiostatin-based therapies, such as short serum half-lives, manufacturing difficulties, and issues pertaining to their solubility and stability [248, 249, 260]. Endostatin and angiostatin are also not directly cytotoxic to the tumor cells in and of themselves. Instead, their continued presence within the local tumor microenvironment is necessary in order to inhibit angiogenesis and deprive the tumor of further oxygen and nutrients [261]. In this study, we developed oncolytic MVs that encode human or mouse variants of E:A fusion proteins, which display enhanced anti-angiogenic activity and prolonged half-lives compared to endostatin and angiostatin expressed individually [262]. Moreover, their incorporation into the genome of a replication competent oncolytic virus assures their continued expression as long as the virus is able to infect and replicate in susceptible cells.

The MV-hE:A and MV-mE:A viruses are derivatives of MV-Edm, a highly attenuated vaccine strain with an excellent safety profile that extends more than 50 years and encompasses over a billion recipients worldwide [35]. In contrast to wild-type MV, which primarily uses the signaling lymphocyte activation molecule expressed by various lymphocytes as an entry receptor, MV-

Edm has adapted to use the more ubiquitous membrane cofactor protein, also known as CD46

[90]. As a negative regulator of the complement system, CD46 is expressed by all nucleated cells 106

in the human body. Despite such widespread distribution, CD46 expression levels on normal cells are generally low and fall under the threshold of receptor density required to initiate and sustain an MV-Edm infection [133]. Most tumors express elevated levels of CD46 however, and are consequently highly susceptible to MV-Edm oncolysis [122, 125, 126, 132, 190]. The reliance of MV-Edm on CD46 receptor density allows the virus and its derivatives to discriminate between tumor and normal cells, infecting and lysing the former while sparing the latter. Phase I clinical trials have demonstrated the safety of these viruses for the treatment of ovarian cancer and glioblastoma, where no dose-limiting toxicity has been observed following administration of

9 7 the MV at doses up to 10 TCID50 delivered intraperiotoneally and 10 TCID50 for MV delivered through the central nervous system respectively [111, 179].

We reasoned that a recombinant MV-Edm would be an optimal vector to deliver anti-angiogenic agents because of its oncolytic activity, overall safety, and specificity for infecting and replicating in tumor cells. The addition of E:A fusion genes to the MV-Edm genome did not attenuate the viruses’ cytotoxicity or replication in the D283med or D425med medulloblastoma cell lines.

Moreover, we were able to verify that the E:A being expressed by the infected cells was physiologically active. Conditioned media derived from MV-E:A infected cells inhibited viability in activated endothelial cells and impeded their migration and formation into tube-like structures. In vivo, a single low-dose injection of MV-E:A delivered intratumorally was also found to result in the downregulation of multiple angiogenic modulators within three days. Despite these initially promising observations, the MV-E:A viruses ultimately failed to significantly prolong survival in the mouse xenograft models of medulloblastoma over MV-GFP. Although we can surmise that E:A is being expressed by the infected tumors through our angiogenesis protein array data (Figure 4.4), we did not directly assess or follow the temporal production of E:A in

107

the days and weeks after treatment. It is very likely that the anti-angiogenic effect we witnessed early on dissipated over time, perhaps as pockets of tumor cells that escaped MV oncolysis continued to grow and initiate the processes of neovascularization without E:A to impede them.

If this is indeed the case, increasing the amount of virus administered and/or fractionating the dosing regimen to aid the spread of the virus could prove to be beneficial. Another possible reason for the lack of synergy may simply be due to inadequate production of the E:A transgenes. It is well established that the location of a transgene within the MV genome dictates its relative abundance, with genes closer to the 3’ end of the genome being transcribed and translated in greater quantity [57]. In the case of the MV-hE:A and MV-mE:A viruses, the E:A transgenes have been inserted between the measles H and L genes, near the 5’ end of the genome (Figure 4.1A). Cloning these genes into a site further upstream would result in higher expression of E:A, albeit at the expense of reduced virus titers. Further experimentation would be required to determine if this is an acceptable tradeoff.

Aside from the MV-E:A viruses described here, other oncolytic viruses armed with E:A fusion proteins have also recently been described in the literature. Yang and colleagues reported enhanced efficacy using the attenuated herpes simplex virus-1 mutant, G207, armed with human E:A for the treatment of lung cancer [263]. Xenograft flank tumors treated with 1x107 pfu of the E:A armed virus were found to be consistently smaller than those treated with the parental G207 virus up to day 13 post treatment. The effects of this virus on overall survival, however, were not investigated. Tysome and colleagues have also reported enhanced efficacy and survival in mouse xenograft models of pancreatic cancer following treatment with a modified Lister strain of vaccinia virus [261]. Decreased microvessel density counts and reduced tumor burdens were also observed in the mice treated with the E:A expressing virus relative to

108

the parental vaccinia strain. These results were achieved with two intratumoral dosing regimens: a low dose consisting of three separate injections of 1x107 pfu virus and a high dose consisting of six injections of 5x107 pfu virus. An intravenous delivery method was also examined, but it was terminated due to excessive toxicity before any efficacy could be observed.

It is difficult to make direct comparisons between these reports and our own because of the vast biological differences of the viruses and tumors under study. It appears that the inclusion of E:A in oncolytic virotherapy can have the potential to be beneficial in some circumstances, but there is still considerable room for further optimization and improvement. Further modifications with the MV-E:A viruses, such as their dosing regimen and even their genetic make-up, will hopefully lead to superior oncolytic measles virotherapy for the treatment of medulloblastoma.

Ongoing experiments and future directions

A series of immunohistochemical studies was unfortunately unable to be completed at the time of this writing. In addition to the mice used for Kaplan-Meier survival analysis, a separate group of D283med-luc implants was processed in an identical fashion for timed sacrifice and histological examination. The purpose of these studies is twofold. The first objective is to quantify and compare microvessel densities in MV-treated and control tumors over time, which will hopefully allow us to capture a functional difference between the MV-E:A viruses and MV-

GFP. The other objective is to determine the origin of the endothelial cells that comprise the tumor vasculature. This can be accomplished by using antibodies specific for mouse and human endothelial cell markers, such as CD31, CD34 and Von Willebrand factor. While it is expected that most, if not all, of the neovasculature will be derived from the host, there is also the possibility that some of these new blood vessels will originate from the tumor itself [253]. If this 109

is indeed the case with our medulloblastoma xenografts, it might provide a partial explanation for why the combined MV-E:A treated mice showed a trend for increased survival (Figure 4.5). A lack of reliable, species-specific antibodies has hindered the progression of these studies, but we have recently obtained mouse-specific CD34 and human-specific CD31 antibodies that show some reactivity with our tissue slides. We are currently in the process of optimizing their associated staining protocols and investigating alternative means to identify and quantify the blood vessels should they become necessary.

Another study that is currently underway centers of the use of dynamic contrast-enhanced magnetic resonance imaging (dceMRI) to assess perfusion in our medulloblastoma xenografts following treatment with the MV-E:A viruses. Dynamic contrast-enhanced MRI is an imaging technique that can measure the density, integrity and leakiness of the vasculature in a given tissue [264]. The method is based on measurements and mathematical models that describe how a contrast-enhancing agent (e.g. a gadolinium-based compound) perfuses through the blood vessels. In contrast to the vasculature of the normal brain, the blood vessels of a brain tumor are highly disorganized, tortuous, and typically feature excessive branching and shunting

[240]. They also display a high degree of permeability on account of large endothelial cell gaps, incomplete basement membrane, and a lack of smooth muscle layers [265]. By observing the changes in perfusion over time with dceMRI, it is possible to assess longitudinal changes within tumor itself, particularly in how it responds to treatment [264].

We presently have several D283med-luc xenografts available for these perfusion studies, which will be conducted over the following weeks and months. Tumor perfusion will be observed in

5 animals treated with an optiMEM vehicle control or 2x10 TCID50 doses of either MV-GFP or the combined MV-E:A viruses over several timepoints. These data should provide valuable 110

information on the efficacy of the MV-E:A viruses in disrupting angiogenesis and help us determine the next steps for their successful implementation in preclinical survival studies.

Acknowledgements

We would like to thank Dr. Kimerly Powell and Anna Bratasz of the Ohio State University Small

Animal Imaging Shared Resource for the Comprehensive Cancer Center and Davis Heart and

Lung Institute for their assistance with the small animal MRI studies.

All studies performed in the preceding manuscript were funded by a Nationwide Children’s

Hospital start-up grant awarded to Corey Raffel.

111

Chapter 5: Future directions and concluding remarks

The field of oncolytic virotherapy continues to expand as currently available viruses are further modified and improved upon and novel viral species with antitumor properties are identified.

Beyond our present work with MV, several other groups have also investigated the possibility of using onclolytic virotherapy as a means to treat medulloblastoma. These efforts have focused on viruses such as reovirus [205], adenovirus [266], myxoma virus [204], and most recently the

Seneca Valley virus [267]. Despite widely varying mechanisms of infection and propagation, each virus could selectively target and kill medulloblastoma tumor cells in vitro and in vivo. A brief comparison of these oncolytic viruses, including some of their strengths and limitations, can be found in Table 5.1. While it is unlikely that any of these viruses acting alone will represent a

“magic bullet” for medulloblastoma therapy, their potential as part of a multi-modality treatment approach holds considerable promise. Combinatorial oncolytic virotherapy, as put forth by Ottolino-Perry and colleagues, centers upon three basic strategies [268]. The first is to combine an oncolytic virus with a current standard of care therapy. While this approach is potentially the quickest route to achieving clinical relevance, it may require considerable optimization as some chemotherapeutic and radiation modalities can have a negative impact on viral replication [269]. The second strategy is to identify any obstacles that may interfere with the activity of the oncolytic virus and then select therapies to help overcome them. One example that pertains to MV virotherapy is the use of cyclophosphamide to help suppress the

112

host antiviral response, as mentioned previously. The third strategy is to combine multiple oncolytic viruses. The appeal of this approach is that it conceivably allows the therapeutic benefit of oncolytic virotherapy to continue after the host immune system renders one virus ineffective by substituting in another. Implementing such an approach will likely prove to be extremely challenging however, as it will be difficult to obtain regulatory approval for two (or more) separate experimental modalities.

Taking full advantage of any of these approaches will require careful consideration of the intended oncolytic virus’s mechanisms of action, the complexity and extent of its interactions within the host, and the unique properties of the tumor it is to be used against. Our initial studies with MV lead us to believe that the virus is a promising platform for the development of novel medulloblastoma therapies that warrants further attention. The following sections provide details on some of the future directions our lab is interested in pursuing to further assess and improve oncolytic measles virotherapy for the treatment of medulloblastoma.

113

Virus Genome Strengths Limitations Ref.

Reovirus dsRNA • Wildtype virus causes mild or no • Viral gene translation [205, disease dependent on activated Ras or 270] • Systemic delivery possible Ras pathway effectors (30-40% of human tumors)

Adenovirus DNA • Able to infect wide variety of tumors • Variable expression of [266, • Nonessential genes can be replaced adenovirus receptors in human 271, by large amounts of foreign DNA to cancers 272] enhance cytotoxicity • Systemic delivery may be limited by preexisting immunity and hepatic adsorption • Possible toxicity

Myxoma DNA • Does not cause human disease • Short-lived ( ≤ 72 hours) [273] virus • Selective for cancer cells with altered replication in vivo Akt signaling • Can accommodate large amounts of foreign DNA

Measles ssRNA • Able to infect wide variety of tumors • Systemic delivery may be [114, virus • Safely administered limited by preexisting immunity 190, • Can be armed with foreign genes to and hepatic adsorption 214] enhance cytotoxicity • Genome accommodates • Easily retargeted relatively small amounts of foreign DNA

Seneca ssRNA • Systemic delivery possible • Unclear mechanism of infection [274] Valley virus • Can cross blood brain barrier • Presently unable to arm with • Does not cause human disease foreign genes

Table 5.1. Comparison of oncolytic viruses in preclinical testing for medulloblastoma treatment. Table adapted from Friedman et al. [275]

Considerable advancements have been made in medulloblastoma research over the past few years. The recent delineation of medulloblastoma into distinct and readily identifiable molecular subtypes undoubtedly marks an epochal moment for the field [12]. In the immediate future, the ability to classify medulloblastoma into specific subtypes in an unbiased and reliable manner should allow for more accurate diagnoses to be made. Treatment regimens can thus be better suited to individual patient needs, lowering the risk and unintended side-effects of potentially unnecessary therapy. Over the long term, unique targeted therapies that exploit the distinct molecular profiles that define each medulloblastoma subtype can be devised and implemented.

114

Such strategies can be adapted to incorporate oncolytic MV, perhaps by modifying the virus to deliver a therapeutically relevant genetic element or by administering the virus as a synergistic agent alongside a small molecule inhibitor. A new class of MV can also be developed with expanded if not entirely redirected tropism for each subtype of medulloblastoma based on the unique cell surface markers they express [11]. Single-chain antibodies or ligands specific for these markers can potentially be used to increase MV selectivity for the tumor. As a proof of this concept, we have recently begun to develop oncolytic MVs retargeted to natriuretic peptide receptor 3 (NPR3), the cell surface marker that identifies the highly aggressive Group 3 medulloblastoma subtype. Work on this virus is in extremely preliminary stages, and it still remains to be seen whether Group 3 tumors as a whole express high enough levels of NPR3 to justify using a retargeted MV over one that utilizes CD46. If this strategy does prove to be successful however, it can be adapted to develop retargeted MV for the other subtypes of medulloblastoma.

Another area of research our lab is interested in pursuing is whether oncolytic MV treatment can synergize with currently available small molecule inhibitors, particularly those designed to inhibit the phosphatidylinositol-3-kinase/Akt/mammalian target of rapamycin (PI3K/Akt/mTOR) signaling pathway. The PI3K/Akt/mTOR pathway modulates cell growth, proliferation, survival and angiogenesis, and is crucial to sustain medulloblastoma pathophysiology [276, 277]. Many

DNA and RNA viruses are known to phosphorylate and activate Akt after infection to increase levels of viral replication [278, 279]. MV is an exception, however, and acts to decrease the expression of activated Akt, presumably as a means to help downregulate the host immune system [280-282]. As such, the co-administration of an Akt inhibitor may be less detrimental to

MV functionality than it would be to other oncolytic viruses. We recently performed an in vitro

115

pilot study to examine if the MV-hE:A virus acted in an additive, synergistic or antagonistic fashion with MK-2206, a potent allosteric inhibitor of Akt [283]. Although further validation will be required, Chou-Talalay analysis of our initial data provided a combinatorial index of 0.72, which suggests that the two agents are moderately synergistic (data not shown) [284]. Future experiments in this line of studies will likely focus on Akt inhibitors other than MK-2206. The initial determination of lethal dose 50% concentrations in our medulloblastoma cell lines were somewhat high (6µM and 13.5µM for D283med and D425med respectively), and are likely to be unobtainable in a physiological setting. Furthermore, despite impressive efficacy in various preclinical models, phase I and II clinical trials with MK-2206 have not met with similar success, prompting at least one clinical trial to be withdrawn prior to completing enrollment [285]. An alternative Akt inhibitor we plan to evaluate in the near future is perifosine, a novel phospholipid analog of alkylphosphocholine that has been previously shown to induce cell cycle arrest and apoptosis in medulloblastoma [286]. Perifosine is currently being tested in several phase I/II clinical trials, both alone and in combination with other cytotoxic agents, and has displayed encouraging activity thus far [287]. If perifosine is found to be synergistic with MV, we will optimize the dosing regimens for comparison in our localized and disseminated models of medulloblastoma and assess the efficacy and any related toxicity of this combined treatment approach. Additional PI3K/Akt/mTOR inhibitors will also be evaluated if warranted.

Finally, the favorable MV treatment responses observed in our orthotopic model of the medulloblastoma have led to the proposal of a phase I clinical trial. The primary aims of this trial will be to explore the efficacy and maximum tolerated dose of MV-CEA when administered to the tumor bed of resected, recurrent medulloblastoma. Such patients are classified as high risk, and thus stand to benefit the most from experimental therapeutic strategies. Assessment of any

116

toxicity, viremia and viral shedding/persistence will be made, and levels of CEA in patient blood will serve as an indirect means of monitoring viral reproduction. This proposed clinical trial initially seeks to recruit 12 patients, ages 2-21, with recurrent medulloblastoma and no evidence of tumor dissemination into the CSF pathways. These patients will be subgrouped into cohorts of four, allowing for a dose-escalation study to be implemented. The initial cohort will be

6 treated with 1x10 TCID50 MV-CEA, and the antitumor activity of this dose of virus will be defined by the time elapsed before the tumor resumes progression. If no toxicity is observed,

6 7 successive cohorts will be treated with 5x10 and 1x10 TCID50 MV-CEA. Should toxicity become

5 an issue, future dosages of the virus will be scaled back to 5x10 TCID50. The use of immunosuppressive drugs such as cyclophosphamide in conjunction with MV-CEA may also be investigated if pre-existing immunity to MV becomes problematic. The successful implementation of a phase I clinical trial investigating MV-CEA treatment of glioblastoma [139] gives us hope that this approach will also be successful for medulloblastoma.

We have demonstrated that oncolytic MV is a potentially useful therapeutic modality that may mitigate the neurocognitive and functional morbidities associated with conventional medulloblastoma therapy. Several questions remain to be addressed, and additional studies will need to be conducted in order to fully validate the merits of this approach. There is reason to be optimistic about the future however, and further advances in our understanding of the virus- cell and virus-host interactions should allow for the rational development of new and more effective oncolytic MVs. It is our earnest hope that such agents will one day be a useful component of successful medulloblastoma treatment.

117

References

1. Gilbertson, R.J., Medulloblastoma: signalling a change in treatment. Lancet Oncol, 2004. 5(4): p. 209-18.

2. Bailey, P. and H. Cushing, A common type of midcerebellar glioma of childhood. Arch Neurol Psychiatr, 1925. 14: p. 192-224.

3. Rutka, J.T. and H.J. Hoffman, Medulloblastoma: a historical perspective and overview. J Neurooncol, 1996. 29(1): p. 1-7.

4. Dhall, G., Medulloblastoma. J Child Neurol, 2009. 24(11): p. 1418-30.

5. Polkinghorn, W.R. and N.J. Tarbell, Medulloblastoma: tumorigenesis, current clinical paradigm, and efforts to improve risk stratification. Nat Clin Pract Oncol, 2007. 4(5): p. 295-304.

6. Humphreys, R., Posterior cranial fossa brain tumors in children, in Neurological Surgery, J. Youmans, Editor. 1982, WB Saunders: Philadelphia. p. 2733-2752.

7. Mueller, S. and S. Chang, Pediatric brain tumors: current treatment strategies and future therapeutic approaches. Neurotherapeutics, 2009. 6(3): p. 570-86.

8. Zeltzer, P.M., et al., Metastasis stage, adjuvant treatment, and residual tumor are prognostic factors for medulloblastoma in children: conclusions from the Children's Cancer Group 921 randomized phase III study. J Clin Oncol, 1999. 17(3): p. 832-45.

9. Louis, D.N., et al., The 2007 WHO classification of tumours of the central nervous system. Acta Neuropathol, 2007. 114(2): p. 97-109.

10. Gilbertson, R.J. and D.W. Ellison, The origins of medulloblastoma subtypes. Annu Rev Pathol, 2008. 3: p. 341-65.

11. Northcott, P.A., et al., Medulloblastoma Comprises Four Distinct Molecular Variants. J Clin Oncol, 2010.

12. Ramaswamy, V., P.A. Northcott, and M.D. Taylor, FISH and chips: the recipe for improved prognostication and outcomes for children with medulloblastoma. Cancer Genet, 2011. 204(11): p. 577-88. 118

13. Kool, M., et al., Integrated genomics identifies five medulloblastoma subtypes with distinct genetic profiles, pathway signatures and clinicopathological features. PLoS One, 2008. 3(8): p. e3088.

14. Klaus, A. and W. Birchmeier, Wnt signalling and its impact on development and cancer. Nat Rev Cancer, 2008. 8(5): p. 387-98.

15. Hatten, M.E. and M.F. Roussel, Development and cancer of the cerebellum. Trends Neurosci, 2011. 34(3): p. 134-42.

16. Raffel, C., Medulloblastoma: molecular genetics and animal models. Neoplasia, 2004. 6(4): p. 310-22.

17. Packer, R.J., et al., Phase III study of craniospinal radiation therapy followed by adjuvant chemotherapy for newly diagnosed average-risk medulloblastoma. J Clin Oncol, 2006. 24(25): p. 4202-8.

18. Jenkin, D., et al., Prognostic factors for medulloblastoma. Int J Radiat Oncol Biol Phys, 2000. 47(3): p. 573-84.

19. Taylor, R.E., et al., Outcome for patients with metastatic (M2-3) medulloblastoma treated with SIOP/UKCCSG PNET-3 chemotherapy. Eur J Cancer, 2005. 41(5): p. 727-34.

20. Evans, A.E., et al., The treatment of medulloblastoma. Results of a prospective randomized trial of radiation therapy with and without CCNU, vincristine, and prednisone. J Neurosurg, 1990. 72(4): p. 572-82.

21. Rutkowski, S., et al., Treatment of early childhood medulloblastoma by postoperative chemotherapy alone. N Engl J Med, 2005. 352(10): p. 978-86.

22. Packer, R.J., et al., A prospective study of cognitive function in children receiving whole- brain radiotherapy and chemotherapy: 2-year results. J Neurosurg, 1989. 70(5): p. 707- 13.

23. Mulhern, R.K., et al., Neurocognitive consequences of risk-adapted therapy for childhood medulloblastoma. J Clin Oncol, 2005. 23(24): p. 5511-9.

24. Saury, J.M. and I. Emanuelson, Cognitive consequences of the treatment of medulloblastoma among children. Pediatr Neurol, 2011. 44(1): p. 21-30.

25. Pollack, I.F., et al., Mutism and pseudobulbar symptoms after resection of posterior fossa tumors in children: incidence and pathophysiology. Neurosurgery, 1995. 37(5): p. 885- 93.

119

26. Riva, D. and C. Giorgi, The cerebellum contributes to higher functions during development: evidence from a series of children surgically treated for posterior fossa tumours. Brain, 2000. 123 ( Pt 5): p. 1051-61.

27. Robertson, P.L., et al., Incidence and severity of postoperative cerebellar mutism syndrome in children with medulloblastoma: a prospective study by the Children's Oncology Group. J Neurosurg, 2006. 105(6 Suppl): p. 444-51.

28. Grau, C. and J. Overgaard, Postirradiation sensorineural hearing loss: a common but ignored late radiation complication. Int J Radiat Oncol Biol Phys, 1996. 36(2): p. 515-7.

29. Heikens, J., et al., Long-term neuro-endocrine sequelae after treatment for childhood medulloblastoma. Eur J Cancer, 1998. 34(10): p. 1592-7.

30. Neglia, J.P., et al., New primary neoplasms of the central nervous system in survivors of childhood cancer: a report from the Childhood Cancer Survivor Study. J Natl Cancer Inst, 2006. 98(21): p. 1528-37.

31. Merchant, T.E., et al., Modeling radiation dosimetry to predict cognitive outcomes in pediatric patients with CNS embryonal tumors including medulloblastoma. Int J Radiat Oncol Biol Phys, 2006. 65(1): p. 210-21.

32. Duffner, P.K., et al., The long-term effects of cranial irradiation on the central nervous system. Cancer, 1985. 56(7 Suppl): p. 1841-6.

33. Kiltie, A.E., L.S. Lashford, and H.R. Gattamaneni, Survival and late effects in medulloblastoma patients treated with craniospinal irradiation under three years old. Med Pediatr Oncol, 1997. 28(5): p. 348-54.

34. Edelstein, K., et al., Early aging in adult survivors of childhood medulloblastoma: long- term neurocognitive, functional, and physical outcomes. Neuro Oncol, 2011. 13(5): p. 536-45.

35. Moss, W.J. and D.E. Griffin, Measles. Lancet, 2012. 379(9811): p. 153-64.

36. Furuse, Y., A. Suzuki, and H. Oshitani, Origin of measles virus: divergence from rinderpest virus between the 11th and 12th centuries. Virol J, 2010. 7: p. 52.

37. Ferreira, C.S., et al., Measles virus infection of alveolar macrophages and dendritic cells precedes spread to lymphatic organs in transgenic mice expressing human signaling lymphocytic activation molecule (SLAM, CD150). J Virol, 2010. 84(6): p. 3033-42.

38. Griffin, D.E., Measles virus-induced suppression of immune responses. Immunol Rev, 2010. 236: p. 176-89.

120

39. Naniche, D., Human immunology of measles virus infection. Curr Top Microbiol Immunol, 2009. 330: p. 151-71.

40. Schneider-Schaulies, S. and J. Schneider-Schaulies, Measles virus-induced immunosuppression. Curr Top Microbiol Immunol, 2009. 330: p. 243-69.

41. Katz, M., Clinical spectrum of measles. Curr Top Microbiol Immunol, 1995. 191: p. 1-12.

42. Enders, J.F., Vaccination against measles: Francis Home redivivus. Yale J Biol Med, 1961. 34: p. 239-60.

43. Home, F., Medical facts and experiments. 1759, London: Miller.

44. Griffin, D.E. and C.H. Pan, Measles: old vaccines, new vaccines. Curr Top Microbiol Immunol, 2009. 330: p. 191-212.

45. Maris, E.P., S.S. Gellis, and et al., Vaccination of children with various chorioallantoic passages of measles virus; a follow-up study. Pediatrics, 1949. 4(1): p. 1-8.

46. Enders, J.F. and T.C. Peebles, Propagation in tissue cultures of cytopathogenic agents from patients with measles. Proc Soc Exp Biol Med, 1954. 86(2): p. 277-86.

47. Rauh, L.W. and R. Schmidt, Measles Immunization with Killed Virus Vaccine. Serum Antibody Titers and Experience with Exposure to Measles Epidemic. Am J Dis Child, 1965. 109: p. 232-7.

48. Katz, S.L., Immunization with Live Attenuated Measles Virus Vaccines: Five Years' Experience. Arch Gesamte Virusforsch, 1965. 16: p. 222-30.

49. Global reductions in measles mortality 2000-2008 and the risk of measles resurgence. Wkly Epidemiol Rec, 2009. 84(49): p. 509-16.

50. Outbreak news. Measles outbreaks in Europe. Wkly Epidemiol Rec, 2011. 86(18): p. 173- 4.

51. Measles: United States, January--May 20, 2011. MMWR Morb Mortal Wkly Rep, 2011. 60(20): p. 666-8.

52. Lund, G.A., et al., The molecular length of measles virus RNA and the structural organization of measles nucleocapsids. J Gen Virol, 1984. 65 ( Pt 9): p. 1535-42.

53. Castaneda, S.J. and T.C. Wong, Leader sequence distinguishes between translatable and encapsidated measles virus RNAs. J Virol, 1990. 64(1): p. 222-30.

121

54. Billeter, M.A., H.Y. Naim, and S.A. Udem, Reverse genetics of measles virus and resulting multivalent recombinant vaccines: applications of recombinant measles viruses. Curr Top Microbiol Immunol, 2009. 329: p. 129-62.

55. Dowling, P.C., et al., Transcriptional map of the measles virus genome. J Gen Virol, 1986. 67 ( Pt 9): p. 1987-92.

56. Rima, B.K., et al., Characterization of clones for the sixth (L) gene and a transcriptional map for morbilliviruses. J Gen Virol, 1986. 67 ( Pt 9): p. 1971-8.

57. Rima, B.K. and W.P. Duprex, The measles virus replication cycle. Curr Top Microbiol Immunol, 2009. 329: p. 77-102.

58. Lamb, R. and D. Kolakofsky, Paramyxoviridae: the viruses and their replication, in Fundamental Virology, B. Fields, D. Knipe, and H. P, Editors. 1996, Lippincroft-Raven Publishers: Philadelphia. p. 577-604.

59. Longhi, S., Nucleocapsid structure and function. Curr Top Microbiol Immunol, 2009. 329: p. 103-28.

60. Curran, J. and D. Kolakofsky, Replication of paramyxoviruses. Adv Virus Res, 1999. 54: p. 403-22.

61. Hausmann, S., J.P. Jacques, and D. Kolakofsky, Paramyxovirus RNA editing and the requirement for hexamer genome length. RNA, 1996. 2(10): p. 1033-45.

62. Calain, P. and L. Roux, The rule of six, a basic feature for efficient replication of Sendai virus defective interfering RNA. J Virol, 1993. 67(8): p. 4822-30.

63. Kolakofsky, D., et al., Paramyxovirus RNA synthesis and the requirement for hexamer genome length: the rule of six revisited. J Virol, 1998. 72(2): p. 891-9.

64. Bellini, W.J., et al., Measles virus P gene codes for two proteins. J Virol, 1985. 53(3): p. 908-19.

65. Harty, R.N. and P. Palese, Measles virus phosphoprotein (P) requires the NH2- and COOH-terminal domains for interactions with the nucleoprotein (N) but only the COOH terminus for interactions with itself. J Gen Virol, 1995. 76 ( Pt 11): p. 2863-7.

66. Gerlier, D. and H. Valentin, Measles virus interaction with host cells and impact on innate immunity. Curr Top Microbiol Immunol, 2009. 329: p. 163-91.

67. Yokota, S., et al., Measles virus P protein suppresses Toll-like receptor signal through upregulation of ubiquitin-modifying enzyme A20. FASEB J, 2008. 22(1): p. 74-83.

122

68. Valsamakis, A., et al., Recombinant measles viruses with mutations in the C, V, or F gene have altered growth phenotypes in vivo. J Virol, 1998. 72(10): p. 7754-61.

69. Patterson, J.B., et al., V and C proteins of measles virus function as virulence factors in vivo. Virology, 2000. 267(1): p. 80-9.

70. Toth, A.M., et al., Protein kinase PKR mediates the apoptosis induction and growth restriction phenotypes of C protein-deficient measles virus. J Virol, 2009. 83(2): p. 961-8.

71. Nakatsu, Y., et al., Measles virus circumvents the host interferon response by different actions of the C and V proteins. J Virol, 2008. 82(17): p. 8296-306.

72. McAllister, C.S., et al., Mechanisms of protein kinase PKR-mediated amplification of beta interferon induction by C protein-deficient measles virus. J Virol, 2010. 84(1): p. 380-6.

73. Cattaneo, R., et al., Measles virus editing provides an additional cysteine-rich protein. Cell, 1989. 56(5): p. 759-64.

74. Fontana, J.M., et al., Regulation of interferon signaling by the C and V proteins from attenuated and wild-type strains of measles virus. Virology, 2008. 374(1): p. 71-81.

75. Caignard, G., et al., Measles virus V protein blocks Jak1-mediated phosphorylation of STAT1 to escape IFN-alpha/beta signaling. Virology, 2007. 368(2): p. 351-62.

76. Yanagi, Y., M. Takeda, and S. Ohno, Measles virus: cellular receptors, tropism and pathogenesis. J Gen Virol, 2006. 87(Pt 10): p. 2767-79.

77. Ohno, S., et al., Dissection of measles virus V protein in relation to its ability to block alpha/beta interferon signal transduction. J Gen Virol, 2004. 85(Pt 10): p. 2991-9.

78. Riedl, P., et al., Measles virus matrix protein is not cotransported with the viral glycoproteins but requires virus infection for efficient surface targeting. Virus Res, 2002. 83(1-2): p. 1-12.

79. Naim, H.Y., E. Ehler, and M.A. Billeter, Measles virus matrix protein specifies apical virus release and glycoprotein sorting in epithelial cells. EMBO J, 2000. 19(14): p. 3576-85.

80. Suryanarayana, K., et al., Transcription inhibition and other properties of matrix proteins expressed by M genes cloned from measles viruses and diseased human brain tissue. J Virol, 1994. 68(3): p. 1532-43.

81. Billeter, M.A., et al., Generation and properties of measles virus mutations typically associated with subacute sclerosing panencephalitis. Ann N Y Acad Sci, 1994. 724: p. 367-77.

123

82. Navaratnarajah, C.K., V.H. Leonard, and R. Cattaneo, Measles virus glycoprotein complex assembly, receptor attachment, and cell entry. Curr Top Microbiol Immunol, 2009. 329: p. 59-76.

83. Plemper, R.K., A.L. Hammond, and R. Cattaneo, Measles virus envelope glycoproteins hetero-oligomerize in the endoplasmic reticulum. J Biol Chem, 2001. 276(47): p. 44239- 46.

84. Lamb, R.A., Paramyxovirus fusion: a hypothesis for changes. Virology, 1993. 197(1): p. 1- 11.

85. Bolt, G. and I.R. Pedersen, The role of subtilisin-like proprotein convertases for cleavage of the measles virus fusion glycoprotein in different cell types. Virology, 1998. 252(2): p. 387-98.

86. Hu, A., et al., Influence of N-linked oligosaccharide chains on the processing, cell surface expression and function of the measles virus fusion protein. J Gen Virol, 1995. 76 ( Pt 3): p. 705-10.

87. Esolen, L.M., et al., Apoptosis as a cause of death in measles virus-infected cells. J Virol, 1995. 69(6): p. 3955-8.

88. Alkhatib, G. and D.J. Briedis, The predicted primary structure of the measles virus hemagglutinin. Virology, 1986. 150(2): p. 479-90.

89. Hashiguchi, T., et al., Crystal structure of measles virus hemagglutinin provides insight into effective vaccines. Proc Natl Acad Sci U S A, 2007. 104(49): p. 19535-40.

90. Muhlebach, M.D., et al., Adherens junction protein nectin-4 is the epithelial receptor for measles virus. Nature, 2011. 480(7378): p. 530-3.

91. Yanagi, Y., et al., Measles virus receptors. Curr Top Microbiol Immunol, 2009. 329: p. 13- 30.

92. Hsu, E.C., et al., CDw150(SLAM) is a receptor for a lymphotropic strain of measles virus and may account for the immunosuppressive properties of this virus. Virology, 2001. 279(1): p. 9-21.

93. Seya, T., et al., Distribution of membrane cofactor protein of complement on human peripheral blood cells. An altered form is found on granulocytes. Eur J Immunol, 1988. 18(8): p. 1289-94.

94. Dhiman, N., R.M. Jacobson, and G.A. Poland, Measles virus receptors: SLAM and CD46. Rev Med Virol, 2004. 14(4): p. 217-29.

124

95. Buckland, R. and T.F. Wild, Is CD46 the cellular receptor for measles virus? Virus Res, 1997. 48(1): p. 1-9.

96. Naniche, D., et al., Human membrane cofactor protein (CD46) acts as a cellular receptor for measles virus. J Virol, 1993. 67(10): p. 6025-32.

97. Dorig, R.E., et al., The human CD46 molecule is a receptor for measles virus (Edmonston strain). Cell, 1993. 75(2): p. 295-305.

98. Nielsen, L., et al., Adaptation of wild-type measles virus to CD46 receptor usage. Arch Virol, 2001. 146(2): p. 197-208.

99. Buchholz, C.J., et al., Cell entry by measles virus: long hybrid receptors uncouple binding from membrane fusion. J Virol, 1996. 70(6): p. 3716-23.

100. Blumberg, B.M., et al., Measles virus L protein evidences elements of ancestral RNA polymerase. Virology, 1988. 164(2): p. 487-97.

101. Schrag, S.J., P.A. Rota, and W.J. Bellini, Spontaneous mutation rate of measles virus: direct estimation based on mutations conferring monoclonal antibody resistance. J Virol, 1999. 73(1): p. 51-4.

102. Holland, J.J., J.C. De La Torre, and D.A. Steinhauer, RNA virus populations as quasispecies. Curr Top Microbiol Immunol, 1992. 176: p. 1-20.

103. Calain, P. and L. Roux, Generation of measles virus defective interfering particles and their presence in a preparation of attenuated live-virus vaccine. J Virol, 1988. 62(8): p. 2859-66.

104. Dock, G., Influence of complicating diseases upon leukemia. AM J Med Sci, 1904. 127: p. 563-592.

105. Bierman, H.R., et al., Remissions in leukemia of childhood following acute infectious disease: staphylococcus and streptococcus, varicella, and feline panleukopenia. Cancer, 1953. 6(3): p. 591-605.

106. Csatary, L.K., Viruses in the treatment of cancer. Lancet, 1971. 2(7728): p. 825.

107. Hansen, R.M. and J.A. Libnoch, Remission of chronic lymphocytic leukemia after smallpox vaccination. Arch Intern Med, 1978. 138(7): p. 1137-8.

108. Bluming, A.Z. and J.L. Ziegler, Regression of Burkitt's lymphoma in association with measles infection. Lancet, 1971. 2(7715): p. 105-6.

109. Pasquinucci, G., Possible effect of measles on leukaemia. Lancet, 1971. 1(7690): p. 136.

125

110. Taqi, A.M., et al., Regression of Hodgkin's disease after measles. Lancet, 1981. 1(8229): p. 1112.

111. Galanis, E., Therapeutic potential of oncolytic measles virus: promises and challenges. Clin Pharmacol Ther, 2010. 88(5): p. 620-5.

112. Kelly, E. and S.J. Russell, History of oncolytic viruses: genesis to genetic engineering. Mol Ther, 2007. 15(4): p. 651-9.

113. Chiocca, E.A., Oncolytic viruses. Nat Rev Cancer, 2002. 2(12): p. 938-50.

114. Russell, S.J. and K.W. Peng, Measles virus for cancer therapy. Curr Top Microbiol Immunol, 2009. 330: p. 213-41.

115. Hammill, A.M., J. Conner, and T.P. Cripe, Oncolytic virotherapy reaches adolescence. Pediatr Blood Cancer, 2010. 55(7): p. 1253-63.

116. Msaouel, P., A. Dispenzieri, and E. Galanis, Clinical testing of engineered oncolytic measles virus strains in the treatment of cancer: an overview. Curr Opin Mol Ther, 2009. 11(1): p. 43-53.

117. Aghi, M. and R.L. Martuza, Oncolytic viral therapies - the clinical experience. Oncogene, 2005. 24(52): p. 7802-16.

118. Rowan, K., Oncolytic viruses move forward in clinical trials. J Natl Cancer Inst, 2010. 102(9): p. 590-5.

119. Russell, S.J., Replicating vectors for cancer therapy: a question of strategy. Semin Cancer Biol, 1994. 5(6): p. 437-43.

120. Fishelson, Z., et al., Obstacles to cancer immunotherapy: expression of membrane complement regulatory proteins (mCRPs) in tumors. Mol Immunol, 2003. 40(2-4): p. 109- 23.

121. Hara, T., et al., High expression of membrane cofactor protein of complement (CD46) in human leukaemia cell lines: implication of an alternatively spliced form containing the STA domain in CD46 up-regulation. Scand J Immunol, 1995. 42(6): p. 581-90.

122. Ulasov, I.V., et al., CD46 represents a target for adenoviral gene therapy of malignant glioma. Hum Gene Ther, 2006. 17(5): p. 556-64.

123. Thorsteinsson, L., et al., The complement regulatory proteins CD46 and CD59, but not CD55, are highly expressed by glandular epithelium of human breast and colorectal tumour tissues. APMIS, 1998. 106(9): p. 869-78.

126

124. Simpson, K.L., et al., Expression of the complement regulatory proteins decay accelerating factor (DAF, CD55), membrane cofactor protein (MCP, CD46) and CD59 in the normal human uterine cervix and in premalignant and malignant cervical disease. Am J Pathol, 1997. 151(5): p. 1455-67.

125. Murray, K.P., et al., Expression of complement regulatory proteins-CD 35, CD 46, CD 55, and CD 59-in benign and malignant endometrial tissue. Gynecol Oncol, 2000. 76(2): p. 176-82.

126. Juhl, H., et al., Frequent expression of complement resistance factors CD46, CD55, and CD59 on gastrointestinal cancer cells limits the therapeutic potential of monoclonal antibody 17-1A. J Surg Oncol, 1997. 64(3): p. 222-30.

127. Kinugasa, N., et al., Expression of membrane cofactor protein (MCP, CD46) in human liver diseases. Br J Cancer, 1999. 80(11): p. 1820-5.

128. Varsano, S., et al., Human lung cancer cell lines express cell membrane complement inhibitory proteins and are extremely resistant to complement-mediated lysis; a comparison with normal human respiratory epithelium in vitro, and an insight into mechanism(s) of resistance. Clin Exp Immunol, 1998. 113(2): p. 173-82.

129. Blok, V.T., et al., A possible role of CD46 for the protection in vivo of human renal tumor cells from complement-mediated damage. Lab Invest, 2000. 80(3): p. 335-44.

130. Seya, T., et al., Quantitative analysis of membrane cofactor protein (MCP) of complement. High expression of MCP on human leukemia cell lines, which is down- regulated during cell differentiation. J Immunol, 1990. 145(1): p. 238-45.

131. Bjorge, L., et al., Complement-regulatory proteins in ovarian malignancies. Int J Cancer, 1997. 70(1): p. 14-25.

132. Ong, H.T., et al., Oncolytic measles virus targets high CD46 expression on multiple myeloma cells. Exp Hematol, 2006. 34(6): p. 713-20.

133. Anderson, B.D., et al., High CD46 receptor density determines preferential killing of tumor cells by oncolytic measles virus. Cancer Res, 2004. 64(14): p. 4919-26.

134. McQuillan, G.M., et al., Seroprevalence of measles antibody in the US population, 1999- 2004. J Infect Dis, 2007. 196(10): p. 1459-64.

135. Radecke, F., et al., Rescue of measles viruses from cloned DNA. EMBO J, 1995. 14(23): p. 5773-84.

136. Duprex, W.P., et al., Observation of measles virus cell-to-cell spread in astrocytoma cells by using a green fluorescent protein-expressing recombinant virus. J Virol, 1999. 73(11): p. 9568-75.

127

137. Peng, K.W., et al., Non-invasive in vivo monitoring of trackable viruses expressing soluble marker peptides. Nat Med, 2002. 8(5): p. 527-31.

138. Duprex, W.P. and B.K. Rima, Using green fluorescent protein to monitor measles virus cell-to-cell spread by time-lapse confocal microscopy. Methods Mol Biol, 2002. 183: p. 297-307.

139. NCT00390299. Viral Therapy in Treating Patients with Recurrent Glioblastoma. 2008; Available from: http://www.clinicaltrials.gov/ct2/show/NCT00390299.

140. NCT00408590. Recombinant Measles Virus Vaccine Therapy and Oncolytic Virus Therapy in Treating Patients With Progressive, Recurrent, or Refractory Ovarian Epithelial Cancer or Primary Peritoneal Cancer. 2006; Available from: http://clinicaltrials.gov/ct2/show/NCT00408590.

141. Dingli, D., et al., Image-guided radiovirotherapy for multiple myeloma using a recombinant measles virus expressing the thyroidal sodium iodide symporter. Blood, 2004. 103(5): p. 1641-6.

142. Dohan, O., et al., The sodium/iodide Symporter (NIS): characterization, regulation, and medical significance. Endocr Rev, 2003. 24(1): p. 48-77.

143. Riesco-Eizaguirre, G. and P. Santisteban, A perspective view of sodium iodide symporter research and its clinical implications. Eur J Endocrinol, 2006. 155(4): p. 495-512.

144. Dingli, D., et al., Combined I-124 positron emission tomography/computed tomography imaging of NIS gene expression in animal models of stably transfected and intravenously transfected tumor. Mol Imaging Biol, 2006. 8(1): p. 16-23.

145. Carlson, S.K., et al., In vivo quantitation of intratumoral radioisotope uptake using micro- single photon emission computed tomography/computed tomography. Mol Imaging Biol, 2006. 8(6): p. 324-32.

146. Hasegawa, K., et al., Dual therapy of ovarian cancer using measles viruses expressing carcinoembryonic antigen and sodium iodide symporter. Clin Cancer Res, 2006. 12(6): p. 1868-75.

147. Carlson, S.K., et al., Quantitative molecular imaging of viral therapy for pancreatic cancer using an engineered measles virus expressing the sodium-iodide symporter reporter gene. AJR Am J Roentgenol, 2009. 192(1): p. 279-87.

148. Li, H., et al., Oncolytic measles viruses encoding interferon beta and the thyroidal sodium iodide symporter gene for mesothelioma virotherapy. Cancer Gene Ther, 2010. 17(8): p. 550-8.

128

149. Msaouel, P., et al., Noninvasive imaging and radiovirotherapy of prostate cancer using an oncolytic measles virus expressing the sodium iodide symporter. Mol Ther, 2009. 17(12): p. 2041-8.

150. Opyrchal, M., et al., Effective Radiovirotherapy for Malignant Gliomas by using Oncolytic Measles Virus Strains Encoding the Sodium Iodine Symporter (MV-NIS). Hum Gene Ther, 2011.

151. Li, H., K.W. Peng, and S.J. Russell, Oncolytic Measles Virus Encoding Thyroidal Sodium Iodide Symporter for Squamous Cell Cancer of the Head and Neck Radiovirotherapy. Hum Gene Ther, 2012.

152. NCT00450814. Vaccine Therapy with or without Cyclophosphamide in Treating Patients with Recurrent or Refractory Multiple Myeloma. 2008; Available from: http://www.clinicaltrials.gov.ct2/show/NCT00450814.

153. NCT01503177. Intrapleural Measles Virus Therapy in Patients With Malignant Pleural Mesothelioma. 2011; Available from: http://clinicaltrials.gov/ct2/show/NCT01503177.

154. Ungerechts, G., et al., An immunocompetent murine model for oncolysis with an armed and targeted measles virus. Mol Ther, 2007. 15(11): p. 1991-7.

155. Parker, W.B., et al., Metabolism and metabolic actions of 6-methylpurine and 2- fluoroadenine in human cells. Biochem Pharmacol, 1998. 55(10): p. 1673-81.

156. Bossow, S., et al., Armed and targeted measles virus for chemovirotherapy of pancreatic cancer. Cancer Gene Ther, 2011. 18(8): p. 598-608.

157. Ungerechts, G., et al., Lymphoma chemovirotherapy: CD20-targeted and convertase- armed measles virus can synergize with fludarabine. Cancer Res, 2007. 67(22): p. 10939- 47.

158. Boisgerault, N., F. Tangy, and M. Gregoire, New perspectives in cancer virotherapy: bringing the immune system into play. Immunotherapy, 2010. 2(2): p. 185-99.

159. Wojton, J. and B. Kaur, Impact of tumor microenvironment on oncolytic viral therapy. Cytokine Growth Factor Rev, 2010. 21(2-3): p. 127-34.

160. De Silva, N., et al., Double trouble for tumours: exploiting the tumour microenvironment to enhance anticancer effect of oncolytic viruses. Cytokine Growth Factor Rev, 2010. 21(2-3): p. 135-41.

161. Grote, D., R. Cattaneo, and A.K. Fielding, Neutrophils contribute to the measles virus- induced antitumor effect: enhancement by granulocyte macrophage colony-stimulating factor expression. Cancer Res, 2003. 63(19): p. 6463-8.

129

162. Quesniaux, V. and T. Jones, Granulocyte-macrophage colony stimulating factor, in The Cytokine Handbook, A. Thomson, Editor. 1998, Academic Press Ltd: Burlington, MA. p. 637-670.

163. Iankov, I.D., et al., Expression of Immunomodulatory Neutrophil-activating Protein of Helicobacter pylori Enhances the Antitumor Activity of Oncolytic Measles Virus. Mol Ther, 2012.

164. D'Elios, M.M., et al., The neutrophil-activating protein of Helicobacter pylori (HP-NAP) as an immune modulating agent. FEMS Immunol Med Microbiol, 2007. 50(2): p. 157-64.

165. Haralambieva, I., et al., Engineering oncolytic measles virus to circumvent the intracellular innate immune response. Mol Ther, 2007. 15(3): p. 588-97.

166. Hadac, E.M., et al., Fluorescein and radiolabeled Function-Spacer-Lipid constructs allow for simple in vitro and in vivo bioimaging of enveloped virions. J Virol Methods, 2011. 176(1-2): p. 78-84.

167. Msaouel, P., et al., Oncolytic measles virus retargeting by ligand display. Methods Mol Biol, 2012. 797: p. 141-62.

168. Xie, M., et al., Amino acid substitutions at position 481 differently affect the ability of the measles virus hemagglutinin to induce cell fusion in monkey and marmoset cells co- expressing the fusion protein. Arch Virol, 1999. 144(9): p. 1689-99.

169. Vongpunsawad, S., et al., Selectively receptor-blind measles viruses: Identification of residues necessary for SLAM- or CD46-induced fusion and their localization on a new hemagglutinin structural model. J Virol, 2004. 78(1): p. 302-13.

170. Nakamura, T., et al., Rescue and propagation of fully retargeted oncolytic measles viruses. Nat Biotechnol, 2005. 23(2): p. 209-14.

171. Paraskevakou, G., et al., Epidermal growth factor receptor (EGFR)-retargeted measles virus strains effectively target EGFR- or EGFRvIII expressing gliomas. Mol Ther, 2007. 15(4): p. 677-86.

172. Allen, C., et al., Retargeted oncolytic measles strains entering via the EGFRvIII receptor maintain significant antitumor activity against gliomas with increased tumor specificity. Cancer Res, 2006. 66(24): p. 11840-50.

173. Peng, K.W., et al., Oncolytic measles viruses displaying a single-chain antibody against CD38, a myeloma cell marker. Blood, 2003. 101(7): p. 2557-62.

174. Hummel, H.D., et al., Genetically engineered attenuated measles virus specifically infects and kills primary multiple myeloma cells. J Gen Virol, 2009. 90(Pt 3): p. 693-701.

130

175. Hasegawa, K., et al., The use of a tropism-modified measles virus in folate receptor- targeted virotherapy of ovarian cancer. Clin Cancer Res, 2006. 12(20 Pt 1): p. 6170-8.

176. Liu, C., et al., Prostate-specific membrane antigen retargeted measles virotherapy for the treatment of prostate cancer. Prostate, 2009. 69(10): p. 1128-41.

177. Mrkic, B., et al., Measles virus spread and pathogenesis in genetically modified mice. J Virol, 1998. 72(9): p. 7420-7.

178. Hallak, L.K., et al., Targeted measles virus vector displaying echistatin infects endothelial cells via alpha(v)beta3 and leads to tumor regression. Cancer Res, 2005. 65(12): p. 5292- 300.

179. Galanis, E., et al., Phase I trial of intraperitoneal administration of an oncolytic measles virus strain engineered to express carcinoembryonic antigen for recurrent ovarian cancer. Cancer Res, 2010. 70(3): p. 875-82.

180. Audet, S., et al., Measles-virus-neutralizing antibodies in intravenous immunoglobulins. J Infect Dis, 2006. 194(6): p. 781-9.

181. Hangartner, L., R.M. Zinkernagel, and H. Hengartner, Antiviral antibody responses: the two extremes of a wide spectrum. Nat Rev Immunol, 2006. 6(3): p. 231-43.

182. Fulci, G., et al., Cyclophosphamide enhances glioma virotherapy by inhibiting innate immune responses. Proc Natl Acad Sci U S A, 2006. 103(34): p. 12873-8.

183. Kambara, H., Y. Saeki, and E.A. Chiocca, Cyclophosphamide allows for in vivo dose reduction of a potent oncolytic virus. Cancer Res, 2005. 65(24): p. 11255-8.

184. Ikeda, K., et al., Oncolytic virus therapy of multiple tumors in the brain requires suppression of innate and elicited antiviral responses. Nat Med, 1999. 5(8): p. 881-7.

185. Myers, R.M., et al., Preclinical pharmacology and toxicology of intravenous MV-NIS, an oncolytic measles virus administered with or without cyclophosphamide. Clin Pharmacol Ther, 2007. 82(6): p. 700-10.

186. Fisher, K., Striking out at disseminated metastases: the systemic delivery of oncolytic viruses. Curr Opin Mol Ther, 2006. 8(4): p. 301-13.

187. Wang, Y. and F. Yuan, Delivery of viral vectors to tumor cells: extracellular transport, systemic distribution, and strategies for improvement. Ann Biomed Eng, 2006. 34(1): p. 114-27.

188. Iankov, I.D., et al., Infected cell carriers: a new strategy for systemic delivery of oncolytic measles viruses in cancer virotherapy. Mol Ther, 2007. 15(1): p. 114-22.

131

189. Mader, E.K., et al., Mesenchymal stem cell carriers protect oncolytic measles viruses from antibody neutralization in an orthotopic ovarian cancer therapy model. Clin Cancer Res, 2009. 15(23): p. 7246-55.

190. Studebaker, A.W., et al., Treatment of medulloblastoma with a modified measles virus. Neuro Oncol, 2010. 12(10): p. 1034-42.

191. Hobart, J.C., et al., How responsive is the Multiple Sclerosis Impact Scale (MSIS-29)? A comparison with some other self report scales. J Neurol Neurosurg Psychiatry, 2005. 76(11): p. 1539-43.

192. Bleyer, W.A., The impact of childhood cancer on the United States and the world. CA Cancer J Clin, 1990. 40(6): p. 355-67.

193. Allen, J.C., et al., Brain tumors in children: current cooperative and institutional chemotherapy trials in newly diagnosed and recurrent disease. Semin Oncol, 1986. 13(1): p. 110-22.

194. Hughes, E.N., et al., Medulloblastoma at the joint center for radiation therapy between 1968 and 1984. The influence of radiation dose on the patterns of failure and survival. Cancer, 1988. 61(10): p. 1992-8.

195. Palmer, S.L., et al., Patterns of intellectual development among survivors of pediatric medulloblastoma: a longitudinal analysis. J Clin Oncol, 2001. 19(8): p. 2302-8.

196. Freeman, C.R., et al., Radiotherapy for medulloblastoma in children: a perspective on current international clinical research efforts. Med Pediatr Oncol, 2002. 39(2): p. 99-108.

197. Gurney, J.G., et al., Endocrine and cardiovascular late effects among adult survivors of childhood brain tumors: Childhood Cancer Survivor Study. Cancer, 2003. 97(3): p. 663-73.

198. Ris, M.D., et al., Intellectual outcome after reduced-dose radiation therapy plus adjuvant chemotherapy for medulloblastoma: a Children's Cancer Group study. J Clin Oncol, 2001. 19(15): p. 3470-6.

199. Inakoshi, H., et al., Multivariate analysis of dissemination relapse of medulloblastoma and estimation of its time parameter for craniospinal irradiation. Radiat Med, 2003. 21(1): p. 37-45.

200. Packer, R.J., Childhood medulloblastoma: progress and future challenges. Brain Dev, 1999. 21(2): p. 75-81.

201. Ellison, D.W., et al., What's new in neuro-oncology? Recent advances in medulloblastoma. Eur J Paediatr Neurol, 2003. 7(2): p. 53-66.

202. Packer, R.J., Brain tumors in children. Arch Neurol, 1999. 56(4): p. 421-5.

132

203. Shimato, S., et al., Human neural stem cells target and deliver therapeutic gene to experimental leptomeningeal medulloblastoma. Gene Ther, 2007. 14(15): p. 1132-42.

204. Lun, X.Q., et al., Targeting human medulloblastoma: oncolytic virotherapy with myxoma virus is enhanced by rapamycin. Cancer Res, 2007. 67(18): p. 8818-27.

205. Yang, W.Q., et al., Reovirus prolongs survival and reduces the frequency of spinal and leptomeningeal metastases from medulloblastoma. Cancer Res, 2003. 63(12): p. 3162- 72.

206. Phuong, L.K., et al., Use of a vaccine strain of measles virus genetically engineered to produce carcinoembryonic antigen as a novel therapeutic agent against glioblastoma multiforme. Cancer Res, 2003. 63(10): p. 2462-9.

207. Troy, T., et al., Quantitative comparison of the sensitivity of detection of fluorescent and bioluminescent reporters in animal models. Mol Imaging, 2004. 3(1): p. 9-23.

208. Grote, D., et al., Live attenuated measles virus induces regression of human lymphoma xenografts in immunodeficient mice. Blood, 2001. 97(12): p. 3746-54.

209. Peng, K.W., et al., Systemic therapy of myeloma xenografts by an attenuated measles virus. Blood, 2001. 98(7): p. 2002-7.

210. Peng, K.W., et al., Intraperitoneal therapy of ovarian cancer using an engineered measles virus. Cancer Res, 2002. 62(16): p. 4656-62.

211. Albrecht, P., et al., Experimental measles encephalitis in normal and cyclophosphamide- treated rhesus monkeys. J Infect Dis, 1972. 126(2): p. 154-61.

212. Buynak EB, P.H., Creamer VMD, Goldner H, and Hilleman MR Differentiation of virulent from avirulent measles strains. American Journal of Diseases of Children, 1962. 103: p. 460-473.

213. Myers, R., et al., Toxicology study of repeat intracerebral administration of a measles virus derivative producing carcinoembryonic antigen in rhesus macaques in support of a phase I/II clinical trial for patients with recurrent gliomas. Hum Gene Ther, 2008. 19(7): p. 690-8.

214. Studebaker, A.W., et al., Oncolytic measles virus prolongs survival in a murine model of cerebral spinal fluid-disseminated medulloblastoma. Neuro Oncol, 2012.

215. Ruggiero, A., et al., Cerenkov luminescence imaging of medical isotopes. J Nucl Med, 2010. 51(7): p. 1123-30.

216. Robertson, R., et al., Optical imaging of Cerenkov light generation from positron- emitting radiotracers. Phys Med Biol, 2009. 54(16): p. N355-65.

133

217. Liu, H., et al., Molecular optical imaging with radioactive probes. PLoS One, 2010. 5(3): p. e9470.

218. Halperin, S.A., A.C. Nestruck, and B.J. Eastwood, Safety and immunogenicity of a new influenza vaccine grown in mammalian cell culture. Vaccine, 1998. 16(13): p. 1331-5.

219. Lauring, A.S., J.O. Jones, and R. Andino, Rationalizing the development of live attenuated virus vaccines. Nat Biotechnol, 2010. 28(6): p. 573-9.

220. Roussel, M.F. and G. Robinson, Medulloblastoma: advances and challenges. F1000 Biol Rep, 2011. 3: p. 5.

221. Gajjar, A., et al., Risk-adapted craniospinal radiotherapy followed by high-dose chemotherapy and stem-cell rescue in children with newly diagnosed medulloblastoma (St Jude Medulloblastoma-96): long-term results from a prospective, multicentre trial. Lancet Oncol, 2006. 7(10): p. 813-20.

222. Palmer, S.L., W.E. Reddick, and A. Gajjar, Understanding the cognitive impact on children who are treated for medulloblastoma. J Pediatr Psychol, 2007. 32(9): p. 1040-9.

223. Villano, J.L., et al., Malignant pineal germ-cell tumors: an analysis of cases from three tumor registries. Neuro Oncol, 2008. 10(2): p. 121-30.

224. Penheiter, A.R., et al., Sodium iodide symporter (NIS)-mediated radiovirotherapy for pancreatic cancer. AJR Am J Roentgenol, 2010. 195(2): p. 341-9.

225. Stigbrand, T., J. Carlsson, and G.P. Adams, Targeted radionuclide tumor therapy biological aspects, 2008, Springer: Dordrecht. p. xiii, 402 p.

226. Boswell, C.A. and M.W. Brechbiel, Development of radioimmunotherapeutic and diagnostic antibodies: an inside-out view. Nucl Med Biol, 2007. 34(7): p. 757-78.

227. Powell, S.N., T.J. McMillan, and G.G. Steel, In vitro radiosensitivity of human medulloblastoma cell lines. J Neurooncol, 1993. 15(1): p. 91-2.

228. Hoorn, E.J., et al., Acute hyponatremia related to intravenous fluid administration in hospitalized children: an observational study. Pediatrics, 2004. 113(5): p. 1279-84.

229. Josefsson, M., et al., Sodium/iodide-symporter: distribution in different mammals and role in entero-thyroid circulation of iodide. Acta Physiol Scand, 2002. 175(2): p. 129-37.

230. Weidinger, G., Measles virus-specific T-cell immunity in rodent models. Viral Immunol, 2002. 15(3): p. 429-34.

231. Weidinger, G., et al., Role of CD4(+) and CD8(+) T cells in the prevention of measles virus- induced encephalitis in mice. J Gen Virol, 2000. 81(Pt 11): p. 2707-13.

134

232. Ohuchi, R., M. Ohuchi, and K. Mifune, Slow development of measles virus (Edmonston strain) infection in the brain of nude mice. Microbiol Immunol, 1984. 28(7): p. 757-64.

233. Parthasarathy, K.L. and E.S. Crawford, Treatment of thyroid carcinoma: emphasis on high-dose 131I outpatient therapy. J Nucl Med Technol, 2002. 30(4): p. 165-71; quiz 172- 3.

234. Alexander, C., et al., Intermediate and long-term side effects of high-dose radioiodine therapy for thyroid carcinoma. J Nucl Med, 1998. 39(9): p. 1551-4.

235. Leber, M.F., et al., MicroRNA-sensitive oncolytic measles viruses for cancer-specific vector tropism. Mol Ther, 2011. 19(6): p. 1097-106.

236. Dingli, D., et al., Dynamic iodide trapping by tumor cells expressing the thyroidal sodium iodide symporter. Biochem Biophys Res Commun, 2004. 325(1): p. 157-66.

237. Folkman, J., Tumor angiogenesis: therapeutic implications. N Engl J Med, 1971. 285(21): p. 1182-6.

238. Shojaei, F., Anti-angiogenesis therapy in cancer: current challenges and future perspectives. Cancer Lett, 2012. 320(2): p. 130-7.

239. Jain, R.K., et al., Angiogenesis in brain tumours. Nat Rev Neurosci, 2007. 8(8): p. 610-22.

240. Grizzi, F., C. Weber, and A. Di Ieva, Antiangiogenic strategies in medulloblastoma: reality or mystery. Pediatr Res, 2008. 63(5): p. 584-90.

241. Huber, H., et al., Angiogenic profile of childhood primitive neuroectodermal brain tumours/medulloblastomas. Eur J Cancer, 2001. 37(16): p. 2064-72.

242. O'Reilly, M.S., et al., Endostatin: an endogenous inhibitor of angiogenesis and tumor growth. Cell, 1997. 88(2): p. 277-85.

243. O'Reilly, M.S., et al., Angiostatin: a circulating endothelial cell inhibitor that suppresses angiogenesis and tumor growth. Cold Spring Harb Symp Quant Biol, 1994. 59: p. 471-82.

244. Abdollahi, A., et al., Endostatin's antiangiogenic signaling network. Mol Cell, 2004. 13(5): p. 649-63.

245. Folkman, J., Antiangiogenesis in cancer therapy--endostatin and its mechanisms of action. Exp Cell Res, 2006. 312(5): p. 594-607.

246. Troyanovsky, B., et al., Angiomotin: an angiostatin binding protein that regulates endothelial cell migration and tube formation. J Cell Biol, 2001. 152(6): p. 1247-54.

135

247. Yokoyama, Y., et al., Synergy between angiostatin and endostatin: inhibition of ovarian cancer growth. Cancer Res, 2000. 60(8): p. 2190-6.

248. Marshall, E., Cancer therapy. Setbacks for endostatin. Science, 2002. 295(5563): p. 2198- 9.

249. MacDonald, N.J., et al., The tumor-suppressing activity of angiostatin protein resides within kringles 1 to 3. Biochem Biophys Res Commun, 1999. 264(2): p. 469-77.

250. Indraccolo, S., et al., Differential effects of angiostatin, endostatin and interferon- alpha(1) gene transfer on in vivo growth of human breast cancer cells. Gene Ther, 2002. 9(13): p. 867-78.

251. Martin, A., P. Staeheli, and U. Schneider, RNA polymerase II-controlled expression of antigenomic RNA enhances the rescue efficacies of two different members of the Mononegavirales independently of the site of viral genome replication. J Virol, 2006. 80(12): p. 5708-15.

252. Thaloor, D., et al., Inhibition of angiogenic differentiation of human umbilical vein endothelial cells by curcumin. Cell Growth Differ, 1998. 9(4): p. 305-12.

253. Ricci-Vitiani, L., et al., Tumour vascularization via endothelial differentiation of glioblastoma stem-like cells. Nature, 2010. 468(7325): p. 824-8.

254. Aguilera, D.G., S. Goldman, and J. Fangusaro, Bevacizumab and irinotecan in the treatment of children with recurrent/refractory medulloblastoma. Pediatr Blood Cancer, 2011. 56(3): p. 491-4.

255. Peyrl, A., et al., Antiangiogenic metronomic therapy for children with recurrent embryonal brain tumors. Pediatr Blood Cancer, 2011.

256. Eder, J.P., Jr., et al., Phase I clinical trial of recombinant human endostatin administered as a short intravenous infusion repeated daily. J Clin Oncol, 2002. 20(18): p. 3772-84.

257. Thomas, J.P., et al., Phase I pharmacokinetic and pharmacodynamic study of recombinant human endostatin in patients with advanced solid tumors. J Clin Oncol, 2003. 21(2): p. 223-31.

258. Kulke, M.H., et al., Phase II study of recombinant human endostatin in patients with advanced neuroendocrine tumors. J Clin Oncol, 2006. 24(22): p. 3555-61.

259. Beerepoot, L.V., et al., Recombinant human angiostatin by twice-daily subcutaneous injection in advanced cancer: a pharmacokinetic and long-term safety study. Clin Cancer Res, 2003. 9(11): p. 4025-33.

136

260. Shin, S.U., et al., Targeted delivery of an antibody-mutant human endostatin fusion protein results in enhanced antitumor efficacy. Mol Cancer Ther, 2011. 10(4): p. 603-14.

261. Tysome, J.R., et al., Lister strain of vaccinia virus armed with endostatin-angiostatin fusion gene as a novel therapeutic agent for human pancreatic cancer. Gene Ther, 2009. 16(10): p. 1223-33.

262. Li, X., et al., Prostate-restricted replicative adenovirus expressing human endostatin- angiostatin fusion gene exhibiting dramatic antitumor efficacy. Clin Cancer Res, 2008. 14(1): p. 291-9.

263. Yang, C.T., et al., Oncolytic herpesvirus with secretable angiostatic proteins in the treatment of human lung cancer cells. Anticancer Res, 2005. 25(3B): p. 2049-54.

264. Yankeelov, T.E. and J.C. Gore, Dynamic Contrast Enhanced Magnetic Resonance Imaging in Oncology: Theory, Data Acquisition, Analysis, and Examples. Curr Med Imaging Rev, 2009. 3(2): p. 91-107.

265. Provenzale, J.M., et al., Comparison of permeability in high-grade and low-grade brain tumors using dynamic susceptibility contrast MR imaging. AJR Am J Roentgenol, 2002. 178(3): p. 711-6.

266. Stolarek, R., et al., Robust infectivity and replication of Delta-24 adenovirus induce cell death in human medulloblastoma. Cancer Gene Ther, 2004. 11(11): p. 713-20.

267. Yu, L., et al., A single intravenous injection of oncolytic picornavirus SVV-001 eliminates medulloblastomas in primary tumor-based orthotopic xenograft mouse models. Neuro Oncol, 2011. 13(1): p. 14-27.

268. Ottolino-Perry, K., et al., Intelligent design: combination therapy with oncolytic viruses. Mol Ther, 2010. 18(2): p. 251-63.

269. Dingli, D., et al., Interaction of measles virus vectors with Auger electron emitting radioisotopes. Biochem Biophys Res Commun, 2005. 337(1): p. 22-9.

270. Downward, J., Targeting RAS signalling pathways in cancer therapy. Nat Rev Cancer, 2003. 3(1): p. 11-22.

271. Short, J.J. and D.T. Curiel, Oncolytic adenoviruses targeted to cancer stem cells. Mol Cancer Ther, 2009. 8(8): p. 2096-102.

272. Ribacka, C. and A. Hemminki, Virotherapy as an approach against cancer stem cells. Curr Gene Ther, 2008. 8(2): p. 88-96.

137

273. Lun, X., et al., Myxoma virus virotherapy for glioma in immunocompetent animal models: optimizing administration routes and synergy with rapamycin. Cancer Res, 2010. 70(2): p. 598-608.

274. Reddy, P.S., et al., Seneca Valley virus, a systemically deliverable oncolytic picornavirus, and the treatment of neuroendocrine cancers. J Natl Cancer Inst, 2007. 99(21): p. 1623- 33.

275. Friedman, G.K., et al., Targeting pediatric cancer stem cells with oncolytic virotherapy. Pediatr Res, 2012. 71(4 Pt 2): p. 500-10.

276. Baryawno, N., et al., Small-molecule inhibitors of phosphatidylinositol 3-kinase/Akt signaling inhibit Wnt/beta-catenin pathway cross-talk and suppress medulloblastoma growth. Cancer Res, 2010. 70(1): p. 266-76.

277. Hartmann, W., et al., Phosphatidylinositol 3'-kinase/AKT signaling is activated in medulloblastoma cell proliferation and is associated with reduced expression of PTEN. Clin Cancer Res, 2006. 12(10): p. 3019-27.

278. Buchkovich, N.J., et al., The TORrid affairs of viruses: effects of mammalian DNA viruses on the PI3K-Akt-mTOR signalling pathway. Nat Rev Microbiol, 2008. 6(4): p. 266-75.

279. Ji, W.T. and H.J. Liu, PI3K-Akt signaling and viral infection. Recent Pat Biotechnol, 2008. 2(3): p. 218-26.

280. Avota, E., et al., Disruption of Akt kinase activation is important for immunosuppression induced by measles virus. Nat Med, 2001. 7(6): p. 725-31.

281. Niewiesk, S., et al., Measles virus-induced immune suppression in the cotton rat (Sigmodon hispidus) model depends on viral glycoproteins. J Virol, 1997. 71(10): p. 7214- 9.

282. Carsillo, M., D. Kim, and S. Niewiesk, Role of AKT kinase in measles virus replication. J Virol, 2010. 84(4): p. 2180-3.

283. Hirai, H., et al., MK-2206, an allosteric Akt inhibitor, enhances antitumor efficacy by standard chemotherapeutic agents or molecular targeted drugs in vitro and in vivo. Mol Cancer Ther, 2010. 9(7): p. 1956-67.

284. Chou, T.C., Drug combination studies and their synergy quantification using the Chou- Talalay method. Cancer Res, 2010. 70(2): p. 440-6.

285. NCT01249105. A Phase II Study of MK-2206 for Recurrent Malignant Glioma. 2011; Available from: http://clinicaltrials.gov/ct2/show/NCT01249105.

138

286. Kumar, A., et al., The alkylphospholipid perifosine induces apoptosis and p21-mediated cell cycle arrest in medulloblastoma. Mol Cancer Res, 2009. 7(11): p. 1813-21.

287. Pal, S.K., et al., Akt inhibitors in clinical development for the treatment of cancer. Expert Opin Investig Drugs, 2010. 19(11): p. 1355-66.

139