Phylogenetics of L.(-Swertiinae) and Molecular Differentiation of Swertia Species in Nepalese Medicinal Herbs Kunjani Joshi* and † and Jianhua Li† * Tribhuvan University, Botany Department, Kathmandu, Nepal. † Arnold Arboretum and Harvard University Herbaria, 22 Divinity Avenue, Cambridge, MA 02138

Swertia chirayita Swertia multicaulis Swertia angustifolia Swertia nervosa Swertia lurida Swertia racemosa Swertia dilatata Swertia paniculata Swertia pedicellata Swertia macrosperma 2 fimbriate gland 1 fimbriate gland 1 fimbriate gland 1 fimbriate gland 2 non-fimbriate gland 1 fimbriate gland 1 non-fimbriate gland 1 non-fimbriate gland 1 non-fimbriate gland 2 fimbriate gland

Background Materials and Methods Phylogeny • Results from nrDNA ITS (Fig. 3a) are generally congruent with those • Swertia L. (Gentianaceae) is a morphologically diverse genus especially in • 92 samples representing the major sections of Swertia and closely related genera were of the chloroplast trnL-F sequences (Fig. 3b) floral merosity and petal gland shape and form (see photos). included in the study • Obolaria and Gentiana are the closest genera to Swertia, which is • Nepalese species were collected from both wild habitats and local herbal markets paraphyletic including Halenia, Comastoma, Gentianella, and • Diversity: 150 species worldwide. 30 species in Nepal with one endemic S. Lomatogonium. There are a few well-supported clades (Fig. 3b) : acaulis (see Fig. 1). • Standard molecular techniques (PCR and DNA Sequencing) were used to obtain data from Clade 1: S. multicaulis, S. chirayita, and S. lurida; Clade 2: S. ciliata, • Distribution: Cosmopolitan with its center of species diversity in the Sino- both nuclear ribosomal internal transcribed spacer (ITS) and chloroplast (trnL-F) regions S. dilatata, S. paniculata, S. pedicellata, and S. racemosa; Clade 3: Himalayan region. Swertia species predominantly occur in the mountainous • Additional ITS and trnL-F sequence data was obtained from Genbank Swertia cuneata and S. engleri; Clade 4: Gentianopsis and regions of the 54 districts in Nepal. • Distance, parsimony, and Bayesian analyses were used to reconstruct phylogenetic trees in Pterygocalyx; Clade 5: Halenia and Swertia tetraptera; Clade 6: S. PAUP* or MrBayes kilimandscharica, S. angustifolia and S.nervosa; Clade 7: Swertia Distribution of Swertia in Nepal petiolata, S. perennis, and S.Calycina • Clades 1, 2, and 3 form a clade with Comastoma, Gentianella, Lomatogonium, Swertia hispidicalyx, and S. macrosperma. However, relationships among them are not resolved • There is one well-supported discrepancy between the two genomes. In the ITS tree, S. ciliata is positioned in the clade containing S. chirayita and S. lurida, while in the trnL-F tree, it is in the clade of S. dilatata, S. paniculata, S. pedicellata, and S. racemosa. This suggests that S. ciliata may have evolved from a hybridization event with S. dilatata, S. paniculata, S. pedicellata, or S. racemosa serving as the possible maternal donor • Both ITS and trnL-F data support the close relationship of S. lurida with S. chirayita Highest swertia • We find support for the paraphyly of Swertia relative to other genera species diversity of Swertiinae, highlighting the need for a re-evaluation of the sections. Ophelia is highly polyphyletic, while section Kingdon-Wardia may be derived from within the polyphyletic section Platynema (Fig. 4) Results Study Area in Nepal • Both the floral merosity and petal glands are homoplasious in Swertia Fig. 4. Majority Bayesian Consensus (ITS data) Key: Flower 4 or 5 merous / Number nectaries or corrolas / Types of nectaries (F = Molecular Differentiation fimbriate, N = non-fimbriate / Infragenetic sections • nrDNA ITS sequences are useful in differentiating Nepalese species commonly Fig. 1. Geographical distribution of Swertia Section abbreviations: Oph - Ophalia; Het - Heteranthus; S. acaulis used in herbal medicine (Fig. 2). Mon - Montana; Rug - Rugosa; Kin - Kingdom-wardia; Endemic to Nepal Pla - Platynema; Swe - Swertia; Mac - Macranthos Swertia species in the 11111111111111111111111111111112222222233333444444 12334445556677889999900000111223444555667778888889990012222355666011111 Taxon/Node 120690290491457390367812367245029067689120353456782354670347269589513578 •Many Swertia species in Nepal are used for medicinal purposes. Among them S. ------Nepalese herbal market S angustifolia 1 TATTA-AGCCTCGCGCACCCAA-AATTTCGCAGGCGACAGAGCTACGCTCTCCCGGGTGGA-----GCGCCT Bootstrap S angustifolia57 TATTA-AGCCTCGCGCACCCAAAACTTTCGCAGGCGACAGAGCTACGCTCTCCCGGGTGGAGGACTGCACCT 52 Bartonia virginica S chirayta 13925 TGCTCCGGCCCGACGTGCCCGAATATCGCGCTTTCGACAGAGCGACGCTCTCCTGGATGTAGGACCGCACCC chirayita holds the greatest medicinal value. Swertia tashiroi S chirayta 15149 TGCTCCGGCCC-GCGTGCCCGAATATCGCGCTTTCGACAGAGCGACGCTCTCCTGGATGTA-----GAACCC Bootstrap S chirayta5711 TGCTCCGGCCCGGCGTGTCCGAATATCGCGCTTTCGACAGAGCGACGCTCTCCTGGATGTAGGACCGCACCC Comastoma traillianum Bartonia virginica • The evolutionary relationships among the species within the genus has been S chirayta5733 TGCTCCGGCCCGGCGTGCCCGAATATCGCGCTTTCGACAGAGCGACGCTCTCCTGGATGTAGGACCGCACCC Gentianella germanica S ciliata 151500 TGCTCCGGCCC-GCGTGCCCGAATATCGCGCTTTCGACAGAGCGACGCTCTCCTGGATGTA-----GCACTT 97 Comastoma traillianum 52 Gentianella umbellata S ciliata5712 TGCTACGGTACGGCTCGCCCGGTTATCGCTTCAT---ATAGGTGCCCATCTCCCGAACCGCGGACCGTACCC 92 Gentianella germanica S ciliata5739 TGCTACGGTACGGCTCGCCCGGTTATCGCTTCATCGACAGAGTGCCCATCTCCCGAACCGCGGACCGTACCC Swertia binchuanensis debated (Chassot, 2000; Gilg,1895; Ho & Liu, 1990; Ho et al, 1994; Shah,1990, Gentianella umbellata S dilata5715 TGCTACGGCACAGCTCGCCCGGATACCGCGCCATCGACAGATTGCCCATCTCCCGGATGGAGGACCGTACCC 100 Gentianopsis ciliata S dilata5730 TGCTACGGCACAGCTCGCCCGGATACCGCGCCATCGACAGACTGCCCATGTCCCGGATGGAGGACCGTACCC Lomatogonium macranthum Pterygocalyx volubilis 1992; Struwe et al. 2002; von Hagen and Kadereit, 2001; Yuan and Kupfer 1995). S lurida5709 TGCTCCGGCCC-GCGTGCCCGAATATCGCGCTTTCGACAGAGCGACGCTCTCCTGGATGTAAGACCGAACCC 73 Swertia aff S macrosperma 15 TGCGAAAACCCAGCGCACCTGAATATCGCGACATTGACAGATTGACGCTCTCCCGGATGGA-----GCAACC 100 Halenia brevicornis Swertia multicaulis 5713 S macrosperma571 ---TAAAACCCAGCGCACCTGAATATCGCGACATTGACAGATTGACGCTCTCCCGGATGGAGGACCGCACCC Swertia tetraptera 99 • The major questions that are yet to be resolved include: species delimitation, S macrosperma572 TGCTAAAACCCAGCGCACCTGAATATCGCGACATTGACAGATTGACGCTCTCCCGGATGGAGGACCGCACCC 51 Swertia chirayita 5711 S macrosperma572 TGCTAAAACCCAGCGCACCTGAATATCGCGACATTGACAGATTGACGCTCTCCCGGATGGAGGACCGCACCC Latouchea fokienensis 78 Swertia lurida 5709 1 S multicaulis 18 TGCTACGGCCCAGMGCGCCCGAATATCGCGCCATCGACAGAGYGACGCTCTCCCGGATGGA-----GCACCC Lomatogonium macranthum Swertia chirayita 5733 section delimitation, Swertia’s relation with allied genera, and the domestication of S multicaulis571 TGCTACGGCCCAGAGCGCGCGAATATCGCGCCATCCACAGAGTGACGCTCTCGCGGATGGAGCACCCCACCC Megacodon stylophorus S nervosa5708 TATTA-AGCCTCGCGCACCCGAAACTCTTGCCGGCGACAGAGCTACGCTCTCCCGGGTGGAGGAATGCACCC Swertia binchuanensis Obolaria virginica Swertia ciliata 5712 S nervosa5732 TATTA-AGCCTCGCGCACCCGAAACTCTTGCCGGCGACAGAGCTACGCTCTCCCGGGTGGAGGAATGCACCC 73 economically important Swertia species S paniculata5727 TGCTACGACACAGCTCGCCCGGATATCGCGCCATCGACAAAGTGCCCATCTCCCGGATGGAGGTCCGTACCC Swertia aff 64 Swertia ciliata S pedicelata5714 TGCTACGGTACGGCTCGCCCGGTTATCGCTTCATCGACAGAGTGCCCATCTCCCGAACCGCGGACCGTACCC Swertia angustifolia 5707 Swertia dilatata 5730 S pedicelata5729 TGCTACGGTACGGCTCGCCCGGTTATCGCTTCATCGACAGAGTGCCCATCTCCCGAACCGCGGACCGTACCC 100 Swertia nervosa 5732 S petiolata 8479 TGCTAAGGCCTTGCGCACCCGAAACTCTCGGCATCGGCAGGGCTATGCGCACCCGGGTGGA-----GCACCC 94 93 100 Swertia dilatata 5715 S racemosa 13235 CGCTACGGCACAGCTCGCCCGGATATCGCGCCATCGACAGAGTGCCCATCTTCCAGATGGA-----GTACCC Swertia nervosa 5708 Swertia paniculata 5727 S racemosa5710 CGCTACGGCACAGCTCGCCCGGATATCGCGCCATCGACAGAGTGCCCATCTTCCAGATGGAGGACCGTACCC Swertia kilimandscharica Swertia pedicellata 5729 2 S racemosa5731 CGCTACGGCACAGCTCGCCCGGATATCGCGCCATCGACAGAGTGCCCATCTTCCAGATGGAGGACCGTACCC 85 Swertia calycina Swertia pedicellata 5714 100 69 96 Swertia racemosa 5731 60 44444444444444444444444455555555555555555555556666666666 Swertia petiolata Swertia cuneata 100 3 12223333334444555777789900112334556677788888890000011111 60 Swertia chirayita 5711 Swertia engleri Taxon/Node 92591235782467168257823509043689795745634567910167912367 Swertia ciliata 5712 Swertia hispidicalyx ------96 S angustifolia 1 -GTCCGTCGGTTTGCTTCGCGCGCCCAGATCGGATCTAATCTCCACAACACCAACC Swertia chirayita 5733 99 Swertia macrosperma 5728 62 S angustifolia57 -GTCCGTCGGTTTGCTTCGCGCGCCCAGATCGGATCTAATCTCCACAACACCAACC Swertia lurida 5709 Swertia macrosperma 5716 S chirayta 13925 -GTCCGTCGGCTAGGACTGCGCGCCCGGATCGGGCCTGATCCCTACATTGCCGACT Swertia ciliata 100 Gentianopsis ciliata S chirayta 15149 -GTCCGTCGGCTAGGACT-CGCGTCCGGATCGGGCCTGATCCCTACATTGCCGACT 4 Objectives S chirayta5711 -GTCCGTCGGCTAGGACTGCGCGCCCGGATCGGGCCTGATCCCTACATTGCCGACT 78 Swertia cuneata Pterygocalyx volubilis S chirayta5733 -GTCCGTCGGCTAGGACTGCGCGCCCGGATCGGGCCTGATCCCTACATTGCCGACT Swertia engleri 84 Halenia brevicornis S ciliata 151500 -GGCCGCTGGTAAAGACTGCGCACCCAGAATGGGCTTGACGCCCACACCTACGGAT Swertia tetraptera 71 Swertia dilatata 5730 5 S ciliata5712 TATCCGC-AGTTAGGACTGCGTACCCGGAATGGGCCTGGTCTCCACACCGCCGAAT 100 Latouchea fokienensis S ciliata5739 TATCCC-AGTTAGGACTGCGTACCCGGAATGGGCCTGGTCTCCACACCGCCGAAT Swertia dilatata 5715 100 S dilata5715 TATCCGC-GGTTAGGACTGCGCACCCGGAATGGGCCTGGTCCCCACACCGCCGAAT 89 Swertia paniculata 5727 Megacodon stylophorus S dilata5730 TATCCCC-GGTCAGGACTGCGCACCCGGAATGGGCTTGGACCCCACACCGCCGAAT Swertia angustifolia 5707 • To study the morphological variation and distribution pattern of the S lurida5709 -GTCCGTCGGCTAGGACT-CGCGTCCGGATCGGGCCTGATCCCTACATTGCCGACT 100 100 Swertia pedicellata 5729 100 87 Swertia nervosa 5732 S macrosperma 15 CGTCCGTCGGCTAGGATTCCGCGCCTGGATTGAGTCTAATCCCCACTCCGCTGACT Swertia pedicellata 5714 76 Swertia nervosa 5708 6 S macrosperma571 -GTCCGTCGGCTAGGATTCCGTGCCTGAATTGAGTCTGATCCCCACTCCGCTGACT Swertia racemosa 5731 species within Swertia S macrosperma572 -GTCCGTCGGCTAGGATTCCGTGCCTGAATTGAGTCTGATCCCCTCTCCGCTGACT Swertia kilimandscharica Swertia hispidicalyx S macrosperma572 -GTCCGTCGGCTAGGATTCCGTGCCTGAATTGAGTCTGATCCCCACTCCGCTGACT 100 72 Swertia calycina S multicaulis 18 -GTCTGTCGGCTA-GACTGCGCGCTCGGAATGGGCCTGATCCCCACACCGCCGACT Swertia macrosperma 5728 • To test the monophyly of Swertia and its sections 100 87 Swertia perennis S multicaulis571 -GTCCGTCGGCTA-GACTGCGCGCTCGGAATGGGCCTGATCCCCACACCGCCGACT Swertia macrosperma 5716 7 S nervosa5708 -GTCCGTCGGTTTGCTTTGCGCGCCCAGATCGGATCTAATCTCCATAACACCGACC Swertia petiolata Swertia multicaulis 5713 • To use DNA barcoding to identify the Swertia species used in Nepalese S nervosa5732 -GTCCGTCGGTTTGCTTTGCGCGCCCAGATCGGATCTAATCTCCATAACACCGACC Swertia tashiroi S paniculata5727 TATCCGC-GGTTAAGACTGCGCACCCGGAATGGGCCTTGTCCACACATCGCCGAAT Veratrilla baillonii Veratrilla baillonii S pedicelata5714 TATCCGC-AGTTAGGACTGCGTACCCGAAATGGGCCTGGTCTCCACACCGCCGAAT Gentiana angustifolia S pedicelata5729 TATCCGC-AGTTAGGACTGCGTACCCGGAATGGGCCTGGTCTCCACACCGCCGAAT Obolaria virginica herbal medicine S petiolata 8479 -GTACGTCGACTTGGAATGTGCGCCCGGATCGGGCCCGATACCCACATCGGCGACC Tripterospermum filicaule Gentiana angustifolia S racemosa 13235 CATCCGT-GGTTAGGACTGCACACCCGGTATAGGCCTGGTCCCCGCACCGCTGAAT Crawfurdia speciosa Tripterospermum filicaule S racemosa5710 TATCCGT-GGTTAGGACTGCACACCCGGTAT------S racemosa5731 CATCCGT-GGTTAGGACTGCACACCCGGTATAGGCCTGGTCCCCGCACCGCTGAAT Crawfurdia speciosa Fig. 3a. Strict consensus of 12 trees (Consistency Fig. 3b. Strict consensus of 10,000 trees reconstructed from Fig. 2. Sites in color showing species-specific nucleotides. index=0.57) from ITS data. Branches with less than 50% trnL-F sequence data. Numbers on branches represent bootstrap support were collapsed. bootstrap support of 100 replicates. References Chassot, P. et al, 2001. High paraphyly of Swertia L. (Gentianaceae) in the Gentianella-lineage as Revealed by Nuclear and Chloroplast DNA Sequence Variation. Syst Evol 229: 1-21. Acknowledgements Gilg, E., 1895. Gentianaceae, In: Engler, A. and Prantl, K. (eds). Die Naturlichen Pflanzenfamilien, Wilhelm Engelman, Leipzig 4 (2): 50-108. Li Lab: Margaret Frank, Zhihua Jiao, Zhihong Zhang, and Qingyan Li Ho, T-N. and Liu, S-W., 1990. The Infrageneric Classification of Gentiana (Gentianaceae). Bull Br Mus (Nat.Hist) Bot. 20: 169-192. HUH: Dr.Kanchi Gandhi, Henry Kesner, Melinda Peters, Stephanie Zabel, and Carolyn Beans Ho, T-N et al, 1994. The Origin Dispersal and Formation of the Distribution Patterns of Swertia L. (Gentianaceae). Acta Phytotax Sin. 32(6): 525-537. Dr.A.R. Joshi Shah, J., 1990 & 1992. Taxonomic Studies in the Genus Swertia L. (Gentianaceae): Monograph, Part 1 & 2. Scientific Khyber. Struwe, et al., 2002 . Gentianaceae- Systematics and Natural History. Cambridge University Press. Cambridge, UK. Funding Von Hagen, K.B. and Kadereit, J.W., 2001. The phylogeny of Gentianella (Gentianaceae) and Colonization of the Southern Hemisphere as Revealed by Nuclear and Chloroplast DNA Sequence Variation. Org Divers Evol 1: 61-79. Fulbright Commission Nepal & CIES USA Yuan YM, Kupfer P., 1995. Molecular Phylogenetics of the Subtribe Gentianinae (Gentianaceae) Inferred from the Sequences of Internal Transcribed Spacers (ITS) of Nuclear Ribosomal DNA. Pl Syst Evol 196: 207-226.