US 20170002359A1 (19) United States (12) Patent Application Publication (10) Pub. No.: US 2017/0002359 A1 Freier et al. (43) Pub. Date: Jan.5, 2017

(54) MODULATION OF PREKALLIKREIN (PKK) Publication Classification EXPRESSION (51) Int. Cl. CI2N IS/II3 (2006.01) (71) Applicant: IONIS PHARMACEUTICALS, INC., A638/36 (2006.01) Carlsbad, CA (US) A63L/7088 (2006.01) (72) Inventors: Susan M. Freier, San Diego, CA (US); (52) U.S. Cl. Huynh-Hoa Bui, San Diego, CA (US) CPC ...... CI2N 15/1137 (2013.01); A61 K3I/7088 (2013.01); A61K 38/36 (2013.01); C12N 2310/3231 (2013.01); C12N 23.10/341 (73) Assignee: Ionis Pharmaceuticals, Inc., Carlsbad, (2013.01); C12N 2310/III (2013.01); C12N CA (US) 23.10/323 (2013.01); C12N 23.10/351 (2013.01); C12N 23.10/321 (2013.01); C12N (21) Appl. No.: 14/915,039 2310/322 (2013.01); C12N 23.10/3341 (2013.01); C12N 23.10/315 (2013.01); C12N (22) PCT Fed: Aug. 28, 2014 2310/317 (2013.01); C12N 23.10/3525 (2013.01); C12N 2320/35 (2013.01); C12N (86) PCT No.: PCT/US1.4/S3266 2320/31 (2013.01) S 371 (c)(1), (2) Date: Feb. 26, 2016 (57) ABSTRACT Disclosed herein are antisense compounds and methods for decreasing PKK mRNA and protein expression. Such meth Related U.S. Application Data ods, compounds, and compositions are useful to treat, pre (60) Provisional application No. 61/871,175, filed on Aug. vent, or ameliorate PKK-associated diseases, disorders, and 28, 2013. conditions. Patent Application Publication Jan. 5, 2017. Sheet 1 of 2 US 2017/0002359 A1

+Captopril -

n O 9 S 9 9 V 3 a. a. | PKK

fXII

C1 inhibitor

HMWK

HMWK cleaved Patent Application Publication Jan. 5, 2017. Sheet 2 of 2 US 2017/0002359 A1

KLKB1 ASO mpk/week

fXII

PKK

Kallikrein HC or

HMWK

HMWK cleaved US 2017/0002359 A1 Jan. 5, 2017

MODULATION OF PREKALLIKREIN (PKK) 0007 Such diseases, disorders, and conditions can have EXPRESSION one or more risk factors, causes, or outcomes in common. 0008 Certain risk factors and causes for development of SEQUENCE LISTING an inflammatory disease include genetic predisposition to an inflammatory disease and environmental factors. In certain 0001. The present application is being filed along with a embodiments, the Subject has a mutated complement 1 Sequence Listing in electronic format. The Sequence Listing esterase inhibitor (C1-INH) gene or mutated Factor 12 gene. is provided as a file entitled BIOLO172WOSEQ ST25.txt In certain embodiments, the Subject has taken or is on created Aug. 15, 2014, which is approximately 632 KB in angiotensin-converting enzyme inhibitors (ACE inhibitors) size. The information in the electronic format of the or angiotensin II receptor blockers (ARBs). In certain sequence listing is incorporated herein by reference in its embodiments, the Subject has had an allergic reaction lead entirety. ing to angioedema. In certain embodiments, the Subject has type I HAE. In certain embodiments, the subject has type II FIELD HAE. In certain embodiments, the subject has type III HAE. 0002 Provided are compounds, compositions, and meth 0009 Certain outcomes associated with development of ods for reducing expression of human plasma prekallikrein an inflammatory disease include edema/swelling in various (PKK) mRNA and protein in an animal. Such compositions body parts including the extremities (i.e., hands, feet, arms, and methods are useful to treat, prevent, or ameliorate legs), the intestines (abdomen), the face, the genitals, the inflammatory and thromboembolic conditions. larynx (i.e., voice box); vascular permeability; vascular leakage; generalized inflammation; abdominal pain; bloat BACKGROUND ing; vomiting; diarrhea; itchy skin; respiratory (asthmatic) reactions; rhinitis; anaphylaxis; bronchoconstriction; 0003 Plasma prekallikrein (PKK) is the precursor of hypotension; coma; and death. plasma kallikrein (PK), which is encoded by the KLKB1 0010 Certain risk factors and causes for development of gene. PKK is a glycoprotein that participates in the Surface a thromboembolic disease include genetic predisposition to dependent activation of blood coagulation, fibrinolysis, a thromboembolic disease, immobility, Surgery (particularly kinin generation, and inflammation. PKK is converted to PK orthopedic Surgery), malignancy, pregnancy, older age, use by Factor XIIa by the cleavage of an internal Arg-Ile peptide of oral contraceptives, atrial fibrillation, previous thrombo bond. PK liberates kinins from kininogens and also gener embolic condition, chronic inflammatory disease, and inher ates plasmin from plasminogen. PK is a member of the ited or acquired prothrombotic clotting disorders. Certain kinin-kallikrein pathway, which consists of several proteins outcomes associated with development of a thromboembolic that play a role in inflammation, blood pressure control, condition include decreased blood flow through an affected coagulation, and pain. vessel, death of tissue, and death. 0011. In certain embodiments, methods of treatment SUMMARY include administering a PKK antisense compound to an 0004 Provided herein are compounds, compositions, and individual in need thereof. In certain embodiments, methods methods for modulating expression of PKK mRNA and of treatment include administering a PKK antisense oligo protein. In certain embodiments, compounds useful for nucleotide to an individual in need thereof. modulating expression of PKK mRNA and protein are antisense compounds. In certain embodiments, the antisense LISTING OF FIGURES compounds are antisense oligonucleotides. (0012 FIG. 1 is a Western blot quantification of HMWK 0005. In certain embodiments, modulation can occur in a from blood samples as described in Example 11. cell or tissue. In certain embodiments, the cell or tissue is in (0013 FIG. 2 is a Western blot quantification of HMWK an animal. In certain embodiments, the animal is a human. from blood samples as described in Example 14. In certain embodiments, PKK mRNA levels are reduced. In certain embodiments, PKK protein levels are reduced. Such DETAILED DESCRIPTION reduction can occur in a time-dependent manner or in a dose-dependent manner. 0014. It is to be understood that both the foregoing 0006. Also provided are compounds, compositions, and general description and the following detailed description methods useful for preventing, treating, and ameliorating are exemplary and explanatory only and are not restrictive of diseases, disorders, and conditions associated with PKK. In the invention, as claimed. Herein, the use of the singular certain embodiments, such PKK associated diseases, disor includes the plural unless specifically stated otherwise. As ders, and conditions are inflammatory diseases. In certain used herein, the use of “or” means “and/or unless stated embodiments, the inflammatory disease may be an acute or otherwise. Furthermore, the use of the term “including as chronic inflammatory disease. In certain embodiments, such well as other forms, such as “includes” and “included, is inflammatory diseases may include hereditary angioedema not limiting. Also, terms such as “element” or “component' (HAE), edema, angioedema, Swelling, angioedema of the encompass both elements and components comprising one lids, ocular edema, macular edema, and cerebral edema. In unit and elements and components that comprise more than certain embodiments, such PKK associated diseases, disor one subunit, unless specifically stated otherwise. ders, and conditions are thromboembolic diseases. In certain 0015 The section headings used herein are for organiza embodiments, such thromboembolic diseases may include tional purposes only and are not to be construed as limiting thrombosis, embolism, thromboembolism, deep vein throm the subject matter described. All documents, or portions of bosis, pulmonary embolism, myocardial infarction, stroke, documents, cited in this application, including, but not and infarct. limited to, patents, patent applications, articles, books, and US 2017/0002359 A1 Jan. 5, 2017 treatises, are hereby expressly incorporated by reference for 0028 “Amelioration” refers to a lessening, slowing, stop the portions of the document discussed herein, as well as in ping, or reversing of at least one indicator of the severity of their entirety. a condition or disease. The severity of indicators may be determined by subjective or objective measures, which are DEFINITIONS known to those skilled in the art. 0016. Unless specific definitions are provided, the 0029) “Animal' refers to a human or non-human animal, nomenclature utilized in connection with, and the proce including, but not limited to, mice, rats, rabbits, dogs, cats, dures and techniques of analytical chemistry, synthetic pigs, and non-human primates, including, but not limited to, organic chemistry, and medicinal and pharmaceutical chem monkeys and chimpanzees. istry described herein are those well known and commonly 0030) “Antisense activity” means any detectable or mea used in the art. Standard techniques may be used for Surable activity attributable to the hybridization of an anti chemical synthesis, and chemical analysis. Where permitted, sense compound to its target nucleic acid. In certain embodi all patents, applications, published applications and other ments, antisense activity is a decrease in the amount or publications, GENBANK Accession Numbers and associ expression of a target nucleic acid or protein encoded by ated sequence information obtainable through databases Such target nucleic acid. “Antisense compound' means an such as National Center for Biotechnology Information oligomeric compound that is capable of undergoing hybrid (NCBI) and other data referred to throughout in the disclo ization to a target nucleic acid through hydrogen bonding. sure herein are incorporated by reference for the portions of Examples of antisense compounds include single-stranded the document discussed herein, as well as in their entirety. and double-stranded compounds, Such as, antisense oligo 0017. Unless otherwise indicated, the following terms nucleotides, siRNAs, shRNAs, ssRNAs, and occupancy have the following meanings: based compounds. 0018 “2'-O-methoxyethyl (also 2'-MOE and 0031 “Antisense compound' means an oligomeric com 2'-OCHCH OCH and MOE) refers to an O-methoxy pound that is capable of undergoing hybridization to a target ethyl modification of the 2' position of a furanose ring. A nucleic acid through hydrogen bonding. Examples of anti 2'-O-methoxyethyl modified Sugar is a modified Sugar. sense compounds include single-stranded and double 0019 “2'-O-methoxyethyl modified nucleoside' (also Stranded compounds, such as, antisense oligonucleotides, “2'-MOE nucleoside') means a nucleoside comprising a siRNAs, shRNAs, ssRNAs, and occupancy-based com 2'-MOE modified sugar moiety. pounds. 0020 “2'-substituted nucleoside' means a nucleoside 0032 “Antisense inhibition” means reduction of target comprising a Substituent at the 2'-position of the furanose nucleic acid levels in the presence of an antisense compound ring other than H or OH. In certain embodiments, 2 sub complementary to a target nucleic acid compared to target stituted nucleosides include nucleosides with bicyclic Sugar nucleic acid levels or in the absence of the antisense com modifications. pound. “Antisense mechanisms are all those mechanisms 0021 ''2'-deoxynucleoside' means a nucleoside compris involving hybridization of a compound with target nucleic ing a hydrogen at the 2' position of the Sugar portion of the acid, wherein the outcome or effect of the hybridization is nucleoside. either target degradation or target occupancy with concomi 0022 "3" target site' refers to the nucleotide of a target tant stalling of the cellular machinery involving, for nucleic acid which is complementary to the 3'-most nucleo example, transcription or splicing. tide of a particular antisense compound. 0033 “Antisense mechanisms are all those mechanisms 0023 “5” target site' refers to the nucleotide of a target involving hybridization of a compound with a target nucleic nucleic acid which is complementary to the 5'-most nucleo acid, wherein the outcome or effect of the hybridization is tide of a particular antisense compound. either target degradation or target occupancy with concomi 0024 “5-methylcytosine” means a cytosine modified tant stalling of the cellular machinery involving, for with a methyl group attached to the 5 position. A 5-meth example, transcription or splicing. ylcytosine is a modified nucleobase. 0034) “Antisense oligonucleotide' means a single 0025 “About means within +7% of a value. For Stranded oligonucleotide having a nucleobase sequence that example, if it is stated, “the compounds affected at least permits hybridization to a corresponding segment of a target about 70% inhibition of PKK”, it is implied that the PKK nucleic acid. “Base complementarity” refers to the capacity levels are inhibited within a range of 63% and 77%. for the precise base pairing of nucleobases of an antisense 0026 “Administered concomitantly refers to the co oligonucleotide with corresponding nucleobases in a target administration of two pharmaceutical agents in any manner nucleic acid (i.e., hybridization), and is mediated by Watson in which the pharmacological effects of both are manifest in Crick, Hoogsteen or reversed Hoogsteen hydrogen binding the patient at the same time. Concomitant administration between corresponding nucleobases. does not require that both pharmaceutical agents be admin 0035 “Base complementarity” refers to the capacity for istered in a single pharmaceutical composition, in the same the precise base pairing of nucleobases of an antisense dosage form, or by the same route of administration. The oligonucleotide with corresponding nucleobases in a target effects of both pharmaceutical agents need not manifest nucleic acid (i.e., hybridization), and is mediated by Watson themselves at the same time. The effects need only be Crick, Hoogsteen or reversed Hoogsteen hydrogen binding overlapping for a period of time and need not be coexten between corresponding nucleobases. S1V. 0036) “Bicyclic sugar means a furanose ring modified 0027 “Administering means providing a pharmaceuti by the bridging of two atoms. A bicyclic Sugar is a modified cal agent to an animal, and includes, but is not limited to Sugar. administering by a medical professional and self-adminis 0037 "Bicyclic nucleoside' (also bicyclic nucleic acid or tering. BNA) means a nucleoside having a Sugar moiety comprising US 2017/0002359 A1 Jan. 5, 2017 a bridge connecting two carbon atoms of the Sugar ring, administration of that amount of pharmaceutical agent to a thereby forming a bicyclic ring system. In certain embodi Subject in need of Such modulation, treatment, or prophy ments, the bridge connects the 4-carbon and the 2-carbon of laxis, either in a single dose or as part of a series, that is the Sugar ring. effective for modulation of that effect, or for treatment or 0038 “Cap structure' or “terminal cap moiety' means prophylaxis or improvement of that condition. The effective chemical modifications, which have been incorporated at amount may vary among individuals depending on the either terminus of an antisense compound. health and physical condition of the individual to be treated, 0039) “cEt” or “constrained ethyl means a bicyclic the taxonomic group of the individuals to be treated, the nucleoside having a Sugar moiety comprising a bridge formulation of the composition, assessment of the individu connecting the 4'-carbon and the 2-carbon, wherein the als medical condition, and other relevant factors. bridge has the formula: 4'-CH(CH)—O-2'. 0.052 “Efficacy’ means the ability to produce a desired 0040 “cEt modified nucleoside' (also “constrained ethyl effect. nucleoside') means a nucleoside comprising a bicyclic Sugar 0053 “Expression' includes all the functions by which a moiety comprising a 4'-CH(CH)—O-2' bridge. gene's coded information is converted into structures pres 0041. “Chemically distinct region” refers to a region of ent and operating in a cell. Such structures include, but are an antisense compound that is in Some way chemically not limited to the products of transcription and translation. different than another region of the same antisense com 0054 “Fully complementary” or “100% complementary” pound. For example, a region having 2'-O-methoxyethyl means each nucleobase of a first nucleic acid has a comple nucleosides is chemically distinct from a region having mentary nucleobase in a second nucleic acid. In certain nucleosides without 2'-O-methoxyethyl modifications. embodiments, a first nucleic acid is an antisense compound 0042 “Chimeric antisense compound means an anti and a target nucleic acid is a second nucleic acid. sense compound that has at least two chemically distinct 0055 “Gapmer means a chimeric antisense compound regions, each position having a plurality of Subunits. in which an internal region having a plurality of nucleosides 0.043 “Co-administration” means administration of two that support RNase H cleavage is positioned between exter or more pharmaceutical agents to an individual. The two or nal regions having one or more nucleosides, wherein the more pharmaceutical agents may be in a single pharmaceu nucleosides comprising the internal region are chemically tical composition, or may be in separate pharmaceutical distinct from the nucleoside or nucleosides comprising the compositions. Each of the two or more pharmaceutical external regions. The internal region may be referred to as a agents may be administered through the same or different 'gap' and the external regions may be referred to as the routes of administration. Co-administration encompasses “wings.” parallel or sequential administration. 0056 “Hybridization” means the annealing of comple 0044) “Complementarity” means the capacity for pairing mentary nucleic acid molecules. In certain embodiments, between nucleobases of a first nucleic acid and a second complementary nucleic acid molecules include, but are not nucleic acid. limited to, an antisense compound and a target nucleic acid. 0045 “Comprise.” “comprises.” and “comprising will In certain embodiments, complementary nucleic acid mol be understood to imply the inclusion of a stated Step or ecules include, but are not limited to, an antisense oligo element or group of steps or elements but not the exclusion nucleotide and a nucleic acid target. of any other step or element or group of steps or elements. 0057. “Identifying an animal having an inflammatory 0046 “Contiguous nucleobases’ means nucleobases disease' means identifying an animal having been diagnosed immediately adjacent to each other. with an inflammatory disease or predisposed to develop an 0047. “Designing or “Designed to refer to the process inflammatory disease. Individuals predisposed to develop an of creating an oligomeric compound that specifically hybrid inflammatory disease include those having one or more risk izes with a selected nucleic acid molecule. factors for developing an inflammatory disease including 0048 “Diluent’ means an ingredient in a composition environmental factors, having a personal or family history, that lacks pharmacological activity, but is pharmaceutically or genetic predisposition to one or more inflammatory necessary or desirable. For example, in drugs that are disease. Such identification may be accomplished by any injected, the diluent may be a liquid, e.g. saline solution. method including evaluating an individual’s medical history 0049) “Dose” means a specified quantity of a pharma and standard clinical tests or assessments, such as genetic ceutical agent provided in a single administration, or in a testing. specified time period. In certain embodiments, a dose may 0.058 “Identifying an animal having a PKK associated be administered in one, two, or more boluses, tablets, or disease' means identifying an animal having been diagnosed injections. For example, in certain embodiments where with a PKK associated disease or predisposed to develop a Subcutaneous administration is desired, the desired dose PKK associated disease. Individuals predisposed to develop requires a volume not easily accommodated by a single a PKK associated disease include those having one or more injection, therefore, two or more injections may be used to risk factors for developing a PKK associated disease includ achieve the desired dose. In certain embodiments, the phar ing having a personal or family history, or genetic predis maceutical agent is administered by infusion over an position of one or more PKK associated diseases. Such extended period of time or continuously. Doses may be identification may be accomplished by any method includ stated as the amount of pharmaceutical agent per hour, day, ing evaluating an individual’s medical history and standard week, or month. clinical tests or assessments, such as genetic testing. 0050 “Downstream refers to the relative direction 0059) “Identifying an animal having a thromboembolic toward the 3' end or C-terminal end of a nucleic acid. disease' means identifying an animal having been diagnosed 0051. “Effective amount” in the context of modulating an with a thromboembolic disease or predisposed to develop a activity or of treating or preventing a condition means the thromboembolic disease. Individuals predisposed to develop US 2017/0002359 A1 Jan. 5, 2017

a thromboembolic disease include those having one or more -continued risk factors for developing a thromboembolic disease includ (C) ing having a personal or family history, or genetic predis position of one or more thromboembolic diseases, immo O Bx bility, Surgery (particularly orthopedic Surgery), malignancy, pregnancy, older age, use of oral contraceptives, atrial fibrillation, previous thromboembolic condition, chronic inflammatory disease, and inherited or acquired prothrom - O botic clotting disorders. Such identification may be accom plished by any method including evaluating an individuals (D) medical history and standard clinical tests or assessments, Such as genetic testing. O Bx 0060 “Immediately adjacent’ means there are no inter vening elements between the immediately adjacent ele ments. “Individual” means a human or non-human animal O selected for treatment or therapy. N N V 0061 “Individual' means a human or non-human animal R selected for treatment or therapy. (E) 0062 “Inhibiting PKK means reducing the level or expression of a PKK mRNA and/or protein. In certain O Bx embodiments, PKK mRNA and/or protein levels are inhib ited in the presence of an antisense compound targeting PKK, including an antisense oligonucleotide targeting PKK, as compared to expression of PKK mRNA and/or protein levels in the absence of a PKK antisense compound. Such as 3. an antisense oligonucleotide. 0063 “Inhibiting the expression or activity” refers to a 0067. As used herein, LNA compounds include, but are reduction or blockade of the expression or activity and does not limited to, compounds having at least one bridge not necessarily indicate a total elimination of expression or between the 4' and the 2' position of the sugar wherein each activity. of the bridges independently comprises 1 or from 2 to 4 0064 “Internucleoside linkage” refers to the chemical linked groups independently selected from —C(R)(R) bond between nucleosides. — —C(R)=C(R)— —C(R)=N-, —C(=NR)—, C(=O) s C(=S) —O—, Si(R) s S(=O) 0065 “Linked nucleosides' means adjacent nucleosides — and —N(R)—, wherein: X is 0, 1, or 2; n is 1, 2, 3, or linked together by an internucleoside linkage. 4; each R and R is, independently, H, a protecting group, 0066 “Locked nucleic acid' or “LNA or “LNA nucleo hydroxyl, C-C alkyl, Substituted C-C alkyl, C-C2 sides' means nucleic acid monomers having a bridge con alkenyl, Substituted C-C alkenyl, C-C alkynyl, Substi necting two carbon atoms between the 4' and 2' position of tuted C-C alkynyl, Cs-Caryl, Substituted Cs-Co aryl, a the nucleoside Sugar unit, thereby forming a bicyclic Sugar. heterocycle radical, a substituted heterocycle radical, het Examples of Such bicyclic Sugar include, but are not limited eroaryl, substituted heteroaryl, Cs-C, alicyclic radical, Sub to A) C-L-Methyleneoxy (4'-CH O-2) LNA, (B) f-D- stituted Cs-C, alicyclic radical, halogen, OJ, NJJ, S.J., N. Methyleneoxy (4-CH O-2) LNA, (C) Ethyleneoxy (4'- COOJ, acyl (C(=O)—H), substituted acyl, CN, sulfonyl (CH), O-2) LNA, (D) Aminooxy (4-CH O N(R)-2) (S(=O)-J), or Sulfoxyl (S(=O)-J); and each J and J is, LNA and (E) Oxyamino (4'-CH N(R)—O-2) LNA, as independently, H, C-C alkyl, Substituted C-C alkyl, depicted below. C-C alkenyl, Substituted C-C alkenyl, C-C alkynyl, Substituted C-C alkynyl, Cs-Co aryl. Substituted Cs-Co aryl, acyl (C(=O)—H), substituted acyl, a heterocycle (A) radical, a Substituted heterocycle radical, C-C amino alkyl, Substituted C-C aminoalkyl or a protecting group. O p Bx 0068 Examples of 4'-2' bridging groups encompassed within the definition of LNA include, but are not limited to one of formulae: —C(R)(R), , —C(R)(R), O—, C(RR) N(R)—O O C(RR)—O N(R) Furthermore, other bridging groups encompassed with the definition of LNA are 4'-CH-2',4'-(CH)-2',4'-(CH2)-2', (B) 4'-CH O-2',4'-(CH), O-2',4'-CH O N(R)-2' and 4'-CH N(R)—O-2'-bridges, wherein each R and R is, O Bx independently, H, a protecting group or C-C alkyl. 0069. Also included within the definition of LNA accord ing to the invention are LNAs in which the 2'-hydroxyl group of the ribosyl Sugar ring is connected to the 4' carbon Nd atom of the Sugar ring, thereby forming a methyleneoxy (4'-CH2—O-2) bridge to form the bicyclic sugar moiety. US 2017/0002359 A1 Jan. 5, 2017

The bridge can also be a methylene (—CH2—) group position of a target nucleic acid, then the position of hydro connecting the 2' oxygen atom and the 4' carbon atom, for gen bonding between the oligonucleotide and the target which the term methyleneoxy (4'-CH O-2) LNA is used. nucleic acid is considered to be complementary at that Furthermore; in the case of the bicyclic Sugar moiety having nucleobase pair. an ethylene bridging group in this position, the term ethyl I0085 "Nucleobase sequence” means the order of con eneoxy (4'-CHCH O-2) LNA is used. C-L-methylene tiguous nucleobases independent of any Sugar, linkage, oxy (4'-CH O-2), an isomer of methyleneoxy (4'-CH2— and/or nucleobase modification. O-2) LNA is also encompassed within the definition of LNA, as used herein. 0086 "Nucleoside' means a nucleobase linked to a Sugar. 0070 "Mismatch' or “non-complementary nucleobase' 0087. “Nucleoside mimetic” includes those structures refers to the case when a nucleobase of a first nucleic acid used to replace the Sugar or the Sugar and the base and not is not capable of pairing with the corresponding nucleobase necessarily the linkage at one or more positions of an of a second or target nucleic acid. oligomeric compound Such as for example nucleoside 0071 "Modified internucleoside linkage” refers to a sub mimetics having morpholino, cyclohexenyl, cyclohexyl, tet stitution or any change from a naturally occurring inter rahydropyranyl, bicyclo, or tricyclo Sugar mimetics, e.g., nucleoside bond (i.e. a phosphodiester internucleoside non furanose Sugar units. Nucleotide mimetic includes those bond). structures used to replace the nucleoside and the linkage at 0072 “Modified nucleobase' means any nucleobase one or more positions of an oligomeric compound Such as other than adenine, cytosine, guanine, thymidine (also for example peptide nucleic acids or morpholinos (mor known as 5-methyluracil), or uracil. An “unmodified nucle pholinos linked by —N(H)—C(=O)—O— or other non obase' means the purine bases adenine (A) and guanine (G), phosphodiester linkage). Sugar Surrogate overlaps with the and the pyrimidine bases thymine (T), cytosine (C), and slightly broader term nucleoside mimetic but is intended to uracil (U). indicate replacement of the Sugar unit (furanose ring) only. 0073. “Modified nucleoside' means a nucleoside having, The tetrahydropyranyl rings provided herein are illustrative independently, a modified Sugar moiety and/or modified of an example of a Sugar Surrogate wherein the furanose nucleobase. Sugar group has been replaced with a tetrahydropyranyl ring 0074 “Modified nucleotide' means a nucleotide having, system. “Mimetic” refers to groups that are substituted for a independently, a modified Sugar moiety, modified inter Sugar, a nucleobase, and/or internucleoside linkage. Gener nucleoside linkage, and/or modified nucleobase. ally, a mimetic is used in place of the Sugar or Sugar 0075 "Modified oligonucleotide' means an oligonucle internucleoside linkage combination, and the nucleobase is otide comprising at least one modified internucleoside link maintained for hybridization to a selected target. age, modified Sugar, and/or modified nucleobase. I0088 "Nucleotide' means a nucleoside having a phos 0076 “Modified sugar means substitution and/or any phate group covalently linked to the Sugar portion of the change from a natural Sugar moiety. nucleoside. 0077. “Monomer means a single unit of an oligomer. I0089 “Off-target effect” refers to an unwanted or delete Monomers include, but are not limited to, nucleosides and rious biological effect associated with modulation of RNA or nucleotides, whether naturally occurring or modified. protein expression of a gene other than the intended target 0078 “Motif' means the pattern of unmodified and modi nucleic acid. fied nucleosides in an antisense compound. 0090 “Oligomeric compound' or "oligomer means a 0079. “Natural sugar moiety” means a sugar moiety polymer of linked monomeric subunits which is capable of found in DNA (2'-H) or RNA (2'-OH). hybridizing to at least a region of a nucleic acid molecule. 0080 “Naturally occurring internucleoside linkage' 0091 “Oligonucleotide' means a polymer of linked means a 3' to 5' phosphodiester linkage. nucleosides each of which can be modified or unmodified, 0081. “Non-complementary nucleobase' refers to a pair independent one from another. of nucleobases that do not form hydrogen bonds with one 0092 “Parenteral administration” means administration another or otherwise support hybridization. through injection (e.g., bolus injection) or infusion. Paren 0082 “Nucleic acid refers to molecules composed of teral administration includes Subcutaneous administration, monomeric nucleotides. A nucleic acid includes, but is not intravenous administration, intramuscular administration, limited to, ribonucleic acids (RNA), deoxyribonucleic acids intraarterial administration, intraperitoneal administration, (DNA), single-stranded nucleic acids, double-stranded or intracranial administration, e.g., intrathecal or intracere nucleic acids, Small interfering ribonucleic acids (siRNA), broventricular administration. and microRNAs (miRNA). 0083 "Nucleobase' means a heterocyclic moiety capable 0093. “Peptide' means a molecule formed by linking at of pairing with a base of another nucleic acid. least two amino acids by amide bonds. Without limitation, as 0084 “Nucleobase complementarity” refers to a nucle used herein, peptide refers to polypeptides and proteins. obase that is capable of base pairing with another nucle 0094 "Pharmaceutical agent’ means a substance that obase. For example, in DNA, adenine (A) is complementary provides a therapeutic benefit when administered to an to thymine (T). For example, in RNA, adenine (A) is individual. For example, in certain embodiments, an anti complementary to uracil (U). In certain embodiments, sense oligonucleotide targeted to PKK is a pharmaceutical complementary nucleobase refers to a nucleobase of an agent. antisense compound that is capable of base pairing with a 0.095 “Pharmaceutical composition” means a mixture of nucleobase of its target nucleic acid. For example, if a Substances Suitable for administering to a subject. For nucleobase at a certain position of an antisense compound is example, a pharmaceutical composition may comprise an capable of hydrogen bonding with a nucleobase at a certain antisense oligonucleotide and a sterile aqueous solution. US 2017/0002359 A1 Jan. 5, 2017

0096 “Pharmaceutically acceptable derivative' encom 0112 "Side effects' means physiological responses passes pharmaceutically acceptable salts, conjugates, prod attributable to a treatment other than desired effects. In rugs or isomers of the compounds described herein. certain embodiments, side effects include, without limita 0097. “Pharmaceutically acceptable salts' means physi tion, injection site reactions, liver function test abnormali ologically and pharmaceutically acceptable salts of anti ties, renal function abnormalities, liver toxicity, renal tox sense compounds, i.e., salts that retain the desired biological icity, central nervous system abnormalities, and myopathies. activity of the parent oligonucleotide and do not impart 0113 "Single-stranded oligonucleotide' means an oligo undesired toxicological effects thereto. nucleotide which is not hybridized to a complementary 0098 “Phosphorothioate linkage” means a linkage Strand. between nucleosides where the phosphodiester bond is 0114 “Sites, as used herein, are defined as unique modified by replacing one of the non-bridging oxygenatoms nucleobase positions within a target nucleic acid. with a Sulfur atom. A phosphorothioate linkage is a modified 0115 “Specifically hybridizable' or “specifically hybrid internucleoside linkage. izes' refers to an antisense compound having a Sufficient 0099. “PKK” means mammalian plasma prekallikrein, degree of complementarity between an antisense oligonucle including human plasma prekallikrein. Plasma prekallikrein otide and a target nucleic acid to induce a desired effect, (PKK) is the precursor of plasma kallikrein (PK), which is while exhibiting minimal or no effects on non-target nucleic encoded by the KLKB1 gene. acids under conditions in which specific binding is desired, 0100 "PKK associated disease” means any disease asso i.e., under physiological conditions in the case of in vivo ciated with any PKK nucleic acid or expression product assays and therapeutic treatments. thereof. Such diseases may include an inflammatory disease 0116 “Stringent hybridization conditions” or “stringent or a thromboembolic disease. Such diseases may include conditions' refer to conditions under which an oligomeric hereditary angioedema (HAE). compound will hybridize to its target sequence, but to a 0101 "PKK mRNA' means any messenger RNA expres minimal number of other sequences. sion product of a DNA sequence encoding PKK. 0117 “Subject’ means a human or non-human animal 0102 "PKK nucleic acid means any nucleic acid encod selected for treatment or therapy. ing PKK. For example, in certain embodiments, a PKK 0118 “Target” refers to a protein, the modulation of nucleic acid includes a DNA sequence encoding PKK, an which is desired. RNA sequence transcribed from DNA encoding PKK (in 0119) “Target gene' refers to a gene encoding a target. cluding genomic DNA comprising introns and exons), and I0120 “Targeting” or “targeted” means the process of an mRNA sequence encoding PKK. "PKK mRNA' means design and selection of an antisense compound that will an mRNA encoding a PKK protein. specifically hybridize to a target nucleic acid and induce a 0103 “PKK protein’ means the polypeptide expression desired effect. product of a PKK nucleic acid. I0121 “Target nucleic acid,” “target RNA, and “target 0104 “Portion' means a defined number of contiguous RNA transcript' and “nucleic acid target all mean a nucleic (i.e., linked) nucleobases of a nucleic acid. In certain acid capable of being targeted by antisense compounds. embodiments, a portion is a defined number of contiguous 0.122 "Target region' means a portion of a target nucleic nucleobases of a target nucleic acid. In certain embodiments, acid to which one or more antisense compounds is targeted. a portion is a defined number of contiguous nucleobases of I0123 “Target segment’ means the sequence of nucleo an antisense compound. tides of a target nucleic acid to which an antisense com 0105 “Prevent” or “preventing” refers to delaying or pound is targeted. “5” target site' refers to the 5'-most forestalling the onset or development of a disease, disorder, nucleotide of a target segment. "3" target site' refers to the or condition for a period of time from minutes to days, 3'-most nucleotide of a target segment. weeks to months, or indefinitely. 0.124 “Therapeutically effective amount’ means an 0106 “Prodrug” means a therapeutic agent that is pre amount of a pharmaceutical agent that provides a therapeutic pared in an inactive form that is converted to an active form benefit to an individual. (i.e., drug) within the body or cells thereof by the action of (0.125 “Treat” or “treating” or “treatment” refers to endogenous enzymes or other chemicals and/or conditions. administering a composition to effect an improvement of the 0107 “Prophylactically effective amount” refers to an disease or condition. amount of a pharmaceutical agent that provides a prophy 0.126 "Unmodified nucleobases' mean the purine bases lactic or preventative benefit to an animal. adenine (A) and guanine (G), and the pyrimidine bases 0108 “Region' is defined as a portion of the target thymine (T), cytosine (C) and uracil (U). nucleic acid having at least one identifiable structure, func 0127 "Unmodified nucleotide' means a nucleotide com tion, or characteristic. posed of naturally occurring nucleobases, Sugar moieties, 0109 “Ribonucleotide' means a nucleotide having a and internucleoside linkages. In certain embodiments, an hydroxy at the 2' position of the sugar portion of the unmodified nucleotide is an RNA nucleotide (i.e. B-D- nucleotide. Ribonucleotides may be modified with any of a ribonucleosides) or a DNA nucleotide (i.e. B-D-deoxyribo variety of substituents. nucleoside). 0110 “Salts' mean a physiologically and pharmaceuti I012.8 “Upstream” refers to the relative direction toward cally acceptable salts of antisense compounds, i.e., salts that the 5' end or N-terminal end of a nucleic acid. retain the desired biological activity of the parent oligo I0129. “Wing segment’ means a plurality of nucleosides nucleotide and do not impart undesired toxicological effects modified to impart to an oligonucleotide properties such as thereto. enhanced inhibitory activity, increased binding affinity for a 0111 "Segments' are defined as smaller or sub-portions target nucleic acid, or resistance to degradation by in vivo of regions within a target nucleic acid. nucleases. US 2017/0002359 A1 Jan. 5, 2017

Certain Embodiments prising at least 8, at least 9, at least 10, at least 11, at least 0130 Certain embodiments provide compounds, compo 12, at least 13, at least 14, at least 15, or at least 16 sitions, and methods for inhibiting plasma prekallikrein consecutive nucleobases of the nucleobase sequence of SEQ (PKK) mRNA and protein expression. Certain embodiments ID NO: 1666. provide compounds, compositions, and methods for 10136 Certain embodiments provide compounds, com decreasing PKK mRNA and protein levels. prising a modified oligonucleotide consisting of 20 linked 0131 Certain embodiments provide antisense com nucleosides and having the nucleobase sequence of SEQ ID pounds targeted to a plasma prekallikrein (PKK) nucleic NO: 570. acid. In certain embodiments, the PKK nucleic acid is the I0137 Certain embodiments provide compounds, com sequence set forth in GENBANK Accession No. prising a modified oligonucleotide consisting of 20 linked NM 000892.3 (incorporated herein as SEQ ID NO: 1), nucleosides and having the nucleobase sequence of SEQ ID GENBANK Accession No. DC412984.1 (incorporated NO: 705. herein as SEQ ID NO: 2), GENBANK Accession No. I0138 Certain embodiments provide compounds, com CN265612.1 (incorporated herein as SEQID NO:3), GEN prising a modified oligonucleotide consisting of 16 linked BANK Accession No. AK297672.1 (incorporated herein as nucleosides and having the nucleobase sequence of SEQID SEQ ID NO: 4), GENBANK Accession No. DC4.13312.1 NO: 1666. (incorporated herein as SEQID NO. 5), GENBANKAcces I0139 Certain embodiments provide compounds, com sion No. AV688858.2 (incorporated herein as SEQ ID NO: prising a modified oligonucleotide consisting of 12 to 30 6), GENBANK Accession No. CD652077.1 (incorporated linked nucleosides and having a nucleobase sequence com herein as SEQ ID NO: 7), GENBANK Accession No. prising at least 8, at least 9, at least 10, at least 11, at least BC1439.11.1 (incorporated herein as SEQID NO: 8), GEN 12, at least 13, at least 14, at least 15, or at least 16 BANK Accession No. CB162532.1 (incorporated herein as consecutive nucleobases of any of the nucleobase sequences SEQID NO: 9), GENBANKAccession No. NT 016354.19 of SEQID NOs: 62, 72, 103, 213, 312,334-339, 344, 345, truncated from nucleobases 111693001 to Ser. No. 11/730, 346,348, 349, 351,369,373,381, 382,383,385, 387-391, 000 (incorporated herein as SEQ ID NO: 10), GENBANK 399, 411, 412, 414, 416, 444, 446-449, 452, 453, 454, 459, Accession No. NM_008455.2 (incorporated herein as SEQ 460, 462-472, 473, 476, 477, 479, 480, 481, 484, 489-495, ID NO: 11), GENBANKAccession No. BB598673.1 (incor 497, 500, 504,506, 522,526, 535, 558,559, 560, 564,566, porated herein as SEQ ID NO: 12), GENBANK Accession 568-571, 573, 576,577, 578,587, 595,597-604, 607, 608, No. NT 03.9460.7 truncated from nucleobases 61.14001 to 610, 613, 615, 618, 619, 622, 623, 624, 633, 635, 636,638, U.S. Pat. No. 6,144,000 (incorporated herein as SEQID NO: 639, 640, 642, 643, 645, 652, 655-658, 660, 661, 670, 13), GENBANK Accession No. NM 012725.2 (incorpo 674-679, 684, 685, 698, 704, 705, 707, 708, 713, 716, 717, rated herein as SEQID NO: 14), GENBANKAccession No. 728, 734, 736, 767, 768, 776, 797, 798, 800, 802, 810, 815, NW 047473.1 truncated from nucleobases 10952001 to Ser. 876, 880, 882, 883, 886, 891, 901-905, 908-911, 922, 923, No. 10/982,000 (incorporated herein as SEQ ID NO: 15), 924,931, 942, 950-957, 972,974,978,979, 980, 987-991, GENBANKAccession No. XM 002804276.1 (incorporated 1005, 1017-1021, 1025, 1026, 1029, 1030, 1032, 1034, herein as SEQID NO: 17), and GENBANK Accession No. 1035, 1037, 1040, 1041, 1045, 1046, 1051, 1054, 1059, NW 001118167.1 truncated from nucleobases 2358000 to 1060, 1061, 1064, 1065, 1066, 1075, 1076, 1087, 1089, U.S. Pat. No. 2,391,000 (incorporated herein as SEQID NO: 1111, 1114, 1116, 1117, 1125, 1133, 1153, 1169, 1177, 1181, 18). 1182, 1187, 1196, 1200, 1214, 1222, 1267, 1276, 1277, (0132) Certain embodiments provide compounds, com 1285, 1286, 1289, 1290, 1291, 1303, 1367, 1389, 1393, prising a modified oligonucleotide consisting of 12 to 30 1398-1401, 1406, 1407, 1408, 1411, 1419-1422, 1426, linked nucleosides and having a nucleobase sequence com 1430, 1431, 1432, 1434-1437, 1439, 1440, 1443, 1444, prising at least 8, at least 9, at least 10, at least 11, at least 1451, 1452, 1471, 1516, 1527, 1535, 1537, 1538, 1539, 12, at least 13, at least 14, at least 15, at least 16, at least 17, 1540, 1541, 1563, 1564, 1567, 1568, 1616, 1617, 1623, at least 18, at least 19, or at least 20 consecutive nucleobases 1629, 1664, 1665, 1666, 1679, 1687, 1734, 1804, 1876, of any of the nucleobase sequences of SEQ ID NOs: 1886, 1915, 2008, 2018, 2100, 2101, 2115, and 2116. In 30-2226. certain embodiments, the modified oligonucleotide achieves 0133) Certain embodiments provide compounds, com at least 80% mRNA inhibition of PKK. prising a modified oligonucleotide consisting of 12 to 30 0140) Certain embodiments provide compounds, com linked nucleosides and having a nucleobase sequence com prising a modified oligonucleotide consisting of 12 to 30 prising at least 8, at least 9, at least 10, at least 11, at least linked nucleosides and having a nucleobase sequence com 12, at least 13, at least 14, at least 15, at least 16, at least 17, prising at least 8, at least 9, at least 10, at least 11, at least at least 18, at least 19, or at least 20 consecutive nucleobases 12, at least 13, at least 14, at least 15, or at least 16 of the nucleobase sequence of SEQ ID NO: 570. consecutive nucleobases of any of the nucleobase sequences I0134) Certain embodiments provide compounds, com of SEQID NOs: 62, 72, 103, 213,334-339, 344, 346,348, prising a modified oligonucleotide consisting of 12 to 30 349, 351,381, 382,383,385, 389, 390, 391, 446, 448, 452, linked nucleosides and having a nucleobase sequence com 453, 454, 466-473, 476, 481, 484, 491, 492, 494, 495, 497, prising at least 8, at least 9, at least 10, at least 11, at least 504,526, 558,559, 566,568-571, 576,578,587,595,597, 12, at least 13, at least 14, at least 15, at least 16, at least 17, 598,600-604, 607, 610, 613, 618, 619, 624, 635, 638, 639, at least 18, at least 19, or at least 20 consecutive nucleobases 645, 652, 656, 657, 658, 660, 674, 675, 676, 684, 698,704, of the nucleobase sequence of SEQ ID NO: 705. 705, 707, 713, 716, 768,876, 880, 901-905, 908-911, 922, I0135 Certain embodiments provide compounds, com 923,924, 931, 942,951, 954-957,972,974, 978,979,987, prising a modified oligonucleotide consisting of 12 to 30 988, 990, 1005, 1019, 1020, 1021, 1025, 1032, 1037, 1040, linked nucleosides and having a nucleobase sequence com 1041, 1045, 1054, 1059, 1060, 1061, 1064, 1065, 1066, US 2017/0002359 A1 Jan. 5, 2017

1075, 1111, 1116, 1117, 1125, 1133, 1153, 1169, 1177, 1200, 2116. In certain embodiments, the modified oligonucleotide 1222, 1267, 1285, 1290, 1291, 1303, 1367, 1398, 1399, achieves an ICs (uM) of 0.3 or less. 1401, 1406, 1408, 1411, 1419, 1420, 1421, 1426, 1430, 0145 Certain embodiments provide compounds, com 1431, 1432, 1434-1437, 1440, 1443, 1444, 1451, 1537 prising a modified oligonucleotide consisting of 12 to 30 1540, 1563, 1616, 1679, 1687, 1804, 2008, 2101, 2115, and linked nucleosides and having a nucleobase sequence com 2116. In certain embodiments, the modified oligonucleotide prising at least 8, at least 9, at least 10, at least 11, at least achieves at least 85% mRNA inhibition of PKK. 12, at least 13, at least 14, at least 15, or at least 16 0141 Certain embodiments provide compounds, com consecutive nucleobases of any of the nucleobase sequences prising a modified oligonucleotide consisting of 12 to 30 of SEQ ID NOs: 334, 346, 382, 453, 495, 526, 570, 587, linked nucleosides and having a nucleobase sequence com 598,635, 901,904, 931,955, 1020, 1111, 1349, 1352, 1389, prising at least 8, at least 9, at least 10, at least 11, at least 1426, 1516, 1535, 1544, 1548, 1564, 1569, 1598, 1616, 12, at least 13, at least 14, at least 15, or at least 16 1617, 1665, 1666, 1804, 1876, 1881, 2019, 2044, 2101, and consecutive nucleobases of any of the nucleobase sequences 2116. In certain embodiments, the modified oligonucleotide of SEQ ID NOs: 334, 346, 351, 382, 390, 391, 446, 448, achieves an ICso (LM) of 0.2 or less. 452, 453, 468, 469, 470, 471, 472, 476, 481,491, 495, 504, 0146 Certain embodiments provide compounds, com 558,566,568, 570,571, 578,587, 597, 598,600, 604,613, prising a modified oligonucleotide consisting of 12 to 30 635, 638, 645, 656, 658, 660, 674, 675, 684, 704, 705, 880, linked nucleosides and having a nucleobase sequence com 901-905, 909, 922, 931, 951, 954, 956, 990, 1005, 1020, prising at least 8, at least 9, at least 10, at least 11, at least 1032, 1037, 1040, 1041, 1045, 1054, 1075, 1111, 1125, 12, at least 13, at least 14, at least 15, or at least 16 1133, 1153, 1200, 1267, 1291, 1303, 1398, 1399, 1401, consecutive nucleobases of any of the nucleobase sequences 1406, 1420, 1426, 1430, 1431, 1434, 1435, 1436, 1440, of SEQID NOs: 334,495, 587, 598,635, 1349, 1352, 1389, 1443, 1451, 1537-1540, 2115, and 2116. In certain embodi 1516, 1544, 1548, 1569, 1598, 1617, 1665, 1666, 1804, ments, the modified oligonucleotide achieves at least 90% 1881, and 2019. In certain embodiments, the modified mRNA inhibition of PKK. oligonucleotide achieves an ICs (LLM) of less than 0.2. 0142. Certain embodiments provide compounds, com 0147 Certain embodiments provide compounds, com prising a modified oligonucleotide consisting of 12 to 30 prising a modified oligonucleotide consisting of 12 to 30 linked nucleosides and having a nucleobase sequence com linked nucleosides and comprising a nucleobase sequence prising at least 8, at least 9, at least 10, at least 11, at least comprising at least 8, at least 9, at least 10, at least 11, at 12, at least 13, at least 14, at least 15, or at least 16 least 12, at least 13, at least 14, at least 15, at least 16, at least consecutive nucleobases of any of the nucleobase sequences 17, at least 18, at least 19, or at least 20 consecutive of SEQ ID NOs: 334, 391, 448, 468, 469, 568, 570, 598, nucleobases complementary to an equal length portion of 635, 658, 674, 684, 705, 901, 903, 904, 922, 990, 1267, nucleobases 27427-27466 of SEQ ID NO: 10. 1291, 1420, 1430, 1431, 1434, 1435, 1436, 1537, 1538, and 0148 Certain embodiments provide compounds, com 1540. In certain embodiments, the modified oligonucleotide prising a modified oligonucleotide consisting of 12 to 30 achieves at least 95% mRNA inhibition of PKK. linked nucleosides and comprising a nucleobase sequence 0143 Certain embodiments provide compounds, com comprising at least 8, at least 9, at least 10, at least 11, at prising a modified oligonucleotide consisting of 12 to 30 least 12, at least 13, at least 14, at least 15, at least 16, at least linked nucleosides and having a nucleobase sequence com 17, at least 18, at least 19, or at least 20 consecutive prising at least 8, at least 9, at least 10, at least 11, at least nucleobases complementary to an equal length portion of 12, at least 13, at least 14, at least 15, or at least 16 nucleobases 33183-33242 of SEQ ID NO: 10. consecutive nucleobases of any of the nucleobase sequences 0149 Certain embodiments provide compounds, com of SEQ ID NOs: 334, 338, 346, 349, 382, 383, 390, 448, prising a modified oligonucleotide consisting of 12 to 30 452, 453, 454,495,526, 559,570,587, 598,635, 660, 705, linked nucleosides and comprising a nucleobase sequence 901, 903, 904, 908, 923, 931, 955, 974, 988, 990, 1020, comprising at least 8, at least 9, at least 10, at least 11, at 1039, 1040, 1111, 1117, 1267, 1291, 1349, 1352, 1367, least 12, at least 13, at least 14, at least 15, at least 16, at least 1389, 1393, 1399, 1401, 1408, 1411, 1426, 1499, 1516, 17, at least 18, at least 19, or at least 20 consecutive 1535, 1544, 1548, 1563, 1564, 1568, 1569, 1598, 1616, nucleobases complementary to an equal length portion of 1617, 1623, 1624, 1643, 1661, 1665, 1666, 1673, 1679, nucleobases 30570-30610 of SEQ ID NO: 10. 1695, 1720, 1804, 1817, 1876, 1881, 1886, 1940, 1947, 0150 Certain embodiments provide compounds, com 2008, 2018, 2019, 2031, 2044, 2100, 2101, 2115, and 2116. prising a modified oligonucleotide consisting of 12 to 30 In certain embodiments, the modified oligonucleotide linked nucleosides and comprising a nucleobase sequence achieves an ICso (LM) of 0.4 or less. comprising at least 8, at least 9, at least 10, at least 11, at 0144. Certain embodiments provide compounds, com least 12, at least 13, at least 14, at least 15, at least 16, at least prising a modified oligonucleotide consisting of 12 to 30 17, at least 18, at least 19, or at least 20 consecutive linked nucleosides and having a nucleobase sequence com nucleobases complementary to an equal length portion of prising at least 8, at least 9, at least 10, at least 11, at least nucleobases 27427-27520 of SEQ ID NO: 10. 12, at least 13, at least 14, at least 15, or at least 16 0151 Certain embodiments provide compounds, com consecutive nucleobases of any of the nucleobase sequences prising a modified oligonucleotide consisting of 12 to 30 of SEQ ID NOs: 334, 346, 349, 382, 453, 454, 495, 526, linked nucleosides and comprising a nucleobase sequence 570,587, 598,635, 660,901, 903, 904, 931,955,990, 1020, comprising at least 8, at least 9, at least 10, at least 11, at 1111, 1267, 1349, 1352, 1367, 1389, 1399, 1408, 1411, least 12, at least 13, at least 14, at least 15, at least 16, at least 1426, 1516, 1535, 1544, 1548, 1563, 1564, 1568, 1569, 17, at least 18, at least 19, or at least 20 consecutive 1598, 1616, 1617, 1623, 1643, 1661, 1665, 1666, 1673, nucleobases complementary to an equal length portion of 1695, 1804, 1876, 1881, 2019, 2044, 2100, 2101, 2115, and nucleobases 33085-33247 of SEQ ID NO: 10. US 2017/0002359 A1 Jan. 5, 2017

0152 Certain embodiments provide compounds, com 0166 In certain embodiments, the modified sugar is any prising a modified oligonucleotide consisting of 12 to 30 of a 2'-O-methoxyethyl. 2'-O-methyl, a constrained ethyl, a linked nucleosides and comprising a nucleobase sequence LNA, or a 3'-fluoro-HNA. comprising at least 8, at least 9, at least 10, at least 11, at 0167. In certain embodiments, the compound comprises least 12, at least 13, at least 14, at least 15, at least 16, at least at least one 2'-O-methoxyethyl nucleoside, 2'-O-methyl 17, at least 18, at least 19, or at least 20 consecutive nucleoside, constrained ethyl nucleoside, LNA nucleoside, nucleobases complementary to an equal length portion of or 3'-fluoro-HNA nucleoside. nucleobases 30475-30639 of SEQID NO: 10. 0153. Certain embodiments provide compounds, com 0.168. In certain embodiments, the modified oligonucle prising a modified oligonucleotide consisting of 12 to 30 otide comprises: linked nucleosides and comprising a nucleobase sequence 0169 a gap segment consisting of 10 linked deoxy comprising at least 8, at least 9, at least 10, at least 11, at nucleosides; least 12, at least 13, at least 14, at least 15, at least 16, at least 0170 a 5' wing segment consisting of 5 linked nucleo 17, at least 18, at least 19, or at least 20 consecutive sides; and nucleobases complementary to an equal length portion of 0171 a 3' wing segment consisting of 5 linked nucleo nucleobases 27362-27524 of SEQ ID NO: 10. sides; 0154 Certain embodiments provide compounds, com 0172 wherein the gap segment is positioned between the prising a modified oligonucleotide consisting of 12 to 30 5' wing segment and the 3' wing segment and wherein each linked nucleosides and comprising a nucleobase sequence nucleoside of each wing segment comprises a modified comprising at least 8, at least 9, at least 10, at least 11, at Sugar. least 12, at least 13, at least 14, at least 15, at least 16, at least 0173. In certain embodiments, the modified oligonucle 17, at least 18, at least 19, or at least 20 consecutive nucleobases complementary to an equal length portion of otide consists of 20 linked nucleosides. nucleobases 33101-33240 of SEQ ID NO: 10. 0.174. In certain embodiments, the modified oligonucle 0155 Certain embodiments provide compounds, com otide consists of 19 linked nucleosides. prising a modified oligonucleotide consisting of 12 to 30 0.175. In certain embodiments, the modified oligonucle linked nucleosides and comprising a nucleobase sequence otide consists of 18 linked nucleosides. comprising at least 8, at least 9, at least 10, at least 11, at 0176 Certain embodiments provide compounds consist least 12, at least 13, at least 14, at least 15, at least 16, at least ing of a modified oligonucleotide according to the following 17, at least 18, at least 19, or at least 20 consecutive formula: Tes. Ges. mCes Aes Aes Gds Tods mCds Tods mGds nucleobases complementary to an equal length portion of Tds Tods Gds Gds mCds Aes Aes Aes mGes Ae; wherein, nucleobases 30463-30638 of SEQ ID NO: 10. 0177 A=an adenine, 0156 Certain embodiments provide compounds, com (0178 mC—a 5'-methylcytosine prising a modified oligonucleotide consisting of 12 to 30 (0179 G=a guanine, linked nucleosides and comprising a nucleobase sequence comprising at least 8, at least 9, at least 10, at least 11, at 0180. T=a thymine, least 12, at least 13, at least 14, at least 15, at least 16, at least 0181 e—a 2'-O-methoxyethyl modified nucleoside, 17, at least 18, at least 19, or at least 20 consecutive 0182 d=a 2'-deoxynucleoside, and nucleobases complementary to an equal length portion of 0183 s—a phosphorothioate internucleoside linkage. exon 9, exon 12, or exon 14 of a PKK nucleic acid. 0.184 Certain embodiments provide compounds consist 0157. In certain embodiments the nucleobase sequence of ing of a modified oligonucleotide according to the following the modified oligonucleotide is at least 80%, at least 81%, at formula: mGes. mCes mCes mCes mCes Tods Tods mCds Tods least 82%, at least 83%, at least 84%, at least 85%, at least Tds Tods Ads Tods Ads Gds mCes mCes Aes Ges. mCe: 86%, at least 87%, at least 88%, at least 89%, at least 90%, wherein, at least 91%, at least 92%, at least 93%, at least 94%, at least 0185. A=an adenine, 95%, at least 96%, at least 97%, at least 98%, at least 99%, 0186 mC=a 5'-methylcytosine; or 100% complementary to SEQ ID NO: 10. 0158. In certain embodiments, the compound consists of 0187 G-a guanine, a single-stranded modified oligonucleotide. 0188 T=a thymine, 0159. In certain embodiments, at least one internucleo 0189 e—a 2'-O-methoxyethyl modified nucleoside, side linkage of the modified oligonucleotide is a modified 0.190 d=a 2'-deoxynucleoside, and internucleoside linkage. 0191 s—a phosphorothioate internucleoside linkage. 0160. In certain embodiments, at least one modified 0.192 Certain embodiments provide compounds consist internucleoside linkage of the modified oligonucleotide is a ing of a modified oligonucleotide according to the following phosphorothioate internucleoside linkage. formula: mGes Ges Aks Tods Ads Tods mCds Ads Tods Gds 0161. In certain embodiments, each internucleoside link Ads Tods Tods mCks mCks mCe; wherein, age of the modified oligonucleotide is a phosphorothioate 0193 A=an adenine, linkage. 0194 mC=a 5'-methylcytosine; 0162. In certain embodiments, at least one nucleoside of the modified oligonucleotide comprises a modified nucle (0195 G=a guanine, obase. (0196. T=a thymine, 0163. In certain embodiments, the modified nucleobase is 0.197 e—a 2'-O-methoxyethyl modified nucleoside, a 5-methylcytosine. 0198 k—a ct modified nucleoside, 0164. In certain embodiments, the modified oligonucle 0199 d=a 2'-deoxynucleoside, and otide comprises at least one modified Sugar. 0200 s—a phosphorothioate internucleoside linkage. 0.165. In certain embodiments, the modified sugar is a 2" 0201 Certain embodiments provide compounds accord modified sugar, a BNA, or a THP. ing to the following formula: US 2017/0002359 A1 Jan. 5, 2017 10

{{OWOHO

US 2017/0002359 A1 Jan. 5, 2017 11

0202 Certain embodiments provide compounds accord ing to the following formula: US 2017/0002359 A1 Jan. 5, 2017 12

{{OWOHO

US 2017/0002359 A1 Jan. 5, 2017 14

0203 Certain embodiments provide compounds accord ing to the following formula:

NH2 S-PO nN. so O

OH OMOE

0204 Certain embodiments provide compositions com bosis, embolism, thromboembolism, deep vein thrombosis, prising the compound of any preceding claim or salt thereof pulmonary embolism, myocardial infarction, stroke, or and at least one of a pharmaceutically acceptable carrier or infarct. diluent. 0209 Certain embodiments provide use of the compound 0205 Certain embodiments provide methods comprising or composition of any preceding claim for the manufacture administering to an animal the compound or composition of of a medicament for treating an inflammatory disease or a any preceding claim. thromboembolic disease. 0206 In certain embodiments, the animal is a human. Antisense Compounds 0207. In certain embodiments, administering the com 0210 Oligomeric compounds include, but are not limited pound prevents, treats, or ameliorates a PKK associated to, oligonucleotides, oligonucleosides, oligonucleotide ana disease, disorder or condition. logs, oligonucleotide mimetics, antisense compounds, anti 0208. In certain embodiments, the PKK associated dis sense oligonucleotides, and siRNAs. An oligomeric com ease, disorder or condition is a hereditary angioedema pound may be “antisense' to a target nucleic acid, meaning (HAE), edema, angioedema, Swelling, angioedema of the that is capable of undergoing hybridization to a target lids, ocular edema, macular edema, cerebral edema, throm nucleic acid through hydrogen bonding. US 2017/0002359 A1 Jan. 5, 2017

0211. In certain embodiments, an antisense compound 57, 58, 59, 60, 61, 62, 63, 64, 65, 66, 67, 68, 69, 70, 71, 72, has a nucleobase sequence that, when written in the 5' to 3' 73, 74, 75, 76, 77, 78,79, or 80 linked subunits in length, or direction, comprises the reverse complement of the target a range defined by any two of the above values. In certain segment of a target nucleic acid to which it is targeted. In embodiments the antisense compound is an antisense oli certain such embodiments, an antisense oligonucleotide has gonucleotide, and the linked subunits are nucleosides. a nucleobase sequence that, when written in the 5' to 3' 0214. In certain embodiments antisense oligonucleotides direction, comprises the reverse complement of the target targeted to a PKK nucleic acid may be shortened or trun segment of a target nucleic acid to which it is targeted. cated. For example, a single subunit may be deleted from the 0212. In certain embodiments, an antisense compound 5' end (5' truncation), or alternatively from the 3' end (3' targeted to a PKK nucleic acid is 12 to 30 subunits in length. truncation). A shortened or truncated antisense compound In certain embodiments, an antisense compound targeted to targeted to a PKK nucleic acid may have two subunits PKK nucleic acid is 12 to 25 subunits in length. In certain deleted from the 5' end, or alternatively may have two embodiments, an antisense compound targeted to PKK subunits deleted from the 3' end, of the antisense compound. nucleic acid is 12 to 22 Subunits in length. In certain Alternatively, the deleted nucleosides may be dispersed embodiments, an antisense compound targeted to PKK throughout the antisense compound, for example, in an nucleic acid is 14 to 20 Subunits in length. In certain antisense compound having one nucleoside deleted from the embodiments, an antisense compound targeted to PKK 5' end and one nucleoside deleted from the 3' end. nucleic acid is 15 to 25 subunits in length. In certain 0215. When a single additional subunit is present in a embodiments, an antisense compound targeted to PKK lengthened antisense compound, the additional Subunit may nucleic acid is 18 to 22 Subunits in length. In certain be located at the 5' or 3' end of the antisense compound. embodiments, an antisense compound targeted to PKK When two or more additional subunits are present, the added nucleic acid is 19 to 21 subunits in length. In certain Subunits may be adjacent to each other, for example, in an embodiments, the antisense compound is 8 to 80, 12 to 50. antisense compound having two subunits added to the 5' end 13 to 30, 13 to 50, 14 to 30, 14 to 50, 15 to 30, 15 to 50, 16 (5' addition), or alternatively to the 3' end (3' addition), of the to 30, 16 to 50, 17 to 30, 17 to 50, 18 to 30, 18 to 50, 19 to antisense compound. Alternatively, the added subunits may 30, 19 to 50, or 20 to 30 linked subunits in length. be dispersed throughout the antisense compound, for example, in an antisense compound having one subunit 0213. In certain embodiments, an antisense compound added to the 5' end and one subunit added to the 3' end. targeted to a PKK nucleic acid is 12 subunits in length. In 0216. It is possible to increase or decrease the length of certain embodiments, an antisense compound targeted to a an antisense compound, such as an antisense oligonucle PKK nucleic acid is 13 subunits in length. In certain otide, and/or introduce mismatch bases without eliminating embodiments, an antisense compound targeted to a PKK activity. For example, in Woolfetal. (Proc. Natl. Acad. Sci. nucleic acid is 14 Subunits in length. In certain embodi USA 89:7305-7309, 1992), a series of antisense oligonucle ments, an antisense compound targeted to a PKK nucleic otides 13-25 nucleobases in length were tested for their acid is 15 subunits in length. In certain embodiments, an ability to induce cleavage of a target RNA in an oocyte antisense compound targeted to a PKK nucleic acid is 16 injection model. Antisense oligonucleotides 25 nucleobases Subunits in length. In certain embodiments, an antisense in length with 8 or 11 mismatch bases near the ends of the compound targeted to a PKK nucleic acid is 17 subunits in antisense oligonucleotides were able to direct specific cleav length. In certain embodiments, an antisense compound age of the target mRNA, albeit to a lesser extent than the targeted to a PKK nucleic acid is 18 subunits in length. In antisense oligonucleotides that contained no mismatches. certain embodiments, an antisense compound targeted to a Similarly, target specific cleavage was achieved using 13 PKK nucleic acid is 19 subunits in length. In certain nucleobase antisense oligonucleotides, including those with embodiments, an antisense compound targeted to a PKK 1 or 3 mismatches. nucleic acid is 20 subunits in length. In certain embodi ments, an antisense compound targeted to a PKK nucleic 0217 Gautschi et al (J. Natl. Cancer Inst. 93:463-471, acid is 21 subunits in length. In certain embodiments, an March 2001) demonstrated the ability of an oligonucleotide antisense compound targeted to a PKK nucleic acid is 22 having 100% complementarity to the bcl-2 mRNA and Subunits in length. In certain embodiments, an antisense having 3 mismatches to the bcl-XL mRNA to reduce the compound targeted to a PKK nucleic acid is 23 subunits in expression of both bcl-2 and bcl-XL in vitro and in vivo. length. In certain embodiments, an antisense compound Furthermore, this oligonucleotide demonstrated potent anti targeted to a PKK nucleic acid is 24 subunits in length. In tumor activity in vivo. certain embodiments, an antisense compound targeted to a 0218 Maher and Dolnick (Nuc. Acid. Res. 16:3341 PKK nucleic acid is 25 subunits in length. In certain 3358, 1988) tested a series of tandem 14 nucleobase anti embodiments, an antisense compound targeted to a PKK sense oligonucleotides, and a 28 and 42 nucleobase anti nucleic acid is 26 subunits in length. In certain embodi sense oligonucleotides comprised of the sequence of two or ments, an antisense compound targeted to a PKK nucleic three of the tandem antisense oligonucleotides, respectively, acid is 27 Subunits in length. In certain embodiments, an for their ability to arrest translation of human DHFR in a antisense compound targeted to a PKK nucleic acid is 28 rabbit reticulocyte assay. Each of the three 14 nucleobase Subunits in length. In certain embodiments, an antisense antisense oligonucleotides alone was able to inhibit trans compound targeted to a PKK nucleic acid is 29 subunits in lation, albeit at a more modest level than the 28 or 42 length. In certain embodiments, an antisense compound nucleobase antisense oligonucleotides. targeted to a PKK nucleic acid is 30 subunits in length. In certain embodiments, the antisense compound targeted to a Antisense Compound Motifs PKK nucleic acid is 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 0219. In certain embodiments, antisense compounds tar 41, 42, 43, 44, 45, 46, 47, 48, 49, 50, 51, 52, 53, 54, 55, 56, geted to a PKK nucleic acid have chemically modified US 2017/0002359 A1 Jan. 5, 2017

Subunits arranged in patterns, or motifs, to confer to the SEQ ID NO:3), GENBANK Accession No. AK297672.1 antisense compounds properties such as enhanced inhibitory (incorporated herein as SEQID NO: 4), GENBANKAcces activity, increased binding affinity for a target nucleic acid, sion No. DC4.13312.1 (incorporated herein as SEQ ID NO: or resistance to degradation by in vivo nucleases. 5), GENBANK Accession No. AV688858.2 (incorporated 0220 Chimericantisense compounds typically contain at herein as SEQ ID NO: 6), GENBANK Accession No. least one region modified so as to confer increased resistance CD652077.1 (incorporated herein as SEQID NO: 7), GEN to nuclease degradation, increased cellular uptake, increased BANK Accession No. BC 1439.11.1 (incorporated herein as binding affinity for the target nucleic acid, and/or increased SEQ ID NO: 8), GENBANK Accession No. CB162532.1 inhibitory activity. A second region of a chimeric antisense (incorporated herein as SEQID NO:9), GENBANKAcces compound may optionally serve as a Substrate for the sion No. NT 016354.19 truncated from nucleobases cellular endonuclease RNase H, which cleaves the RNA 111693001 to Ser. No. 11/730,000 (incorporated herein as strand of an RNA:DNA duplex. SEQID NO: 10), GENBANKAccession No. NM_008455.2 0221) Antisense compounds having a gapmer motif are (incorporated herein as SEQ ID NO: 11), GENBANK considered chimeric antisense compounds. In a gapmer an Accession No. BB598673.1 (incorporated herein as SEQID internal region having a plurality of nucleotides that Sup NO: 12), GENBANK Accession No. NT 0394.60.7 trun ports RNaseH cleavage is positioned between external cated from nucleobases 6114001 to U.S. Pat. No. 6,144,000 regions having a plurality of nucleotides that are chemically (incorporated herein as SEQ ID NO: 13), GENBANK distinct from the nucleosides of the internal region. In the Accession No. NM 012725.2 (incorporated herein as SEQ case of an antisense oligonucleotide having a gapmer motif. ID NO: 14), GENBANK Accession No. NW 047473.1 the gap segment generally serves as the Substrate for endo truncated from nucleobases 10952001 to Ser. No. 10/982, nuclease cleavage, while the wing segments comprise modi 000 (incorporated herein as SEQ ID NO: 15), GENBANK fied nucleosides. In certain embodiments, the regions of a Accession No. XM 002804276.1 (incorporated herein as gapmer are differentiated by the types of Sugar moieties SEQ ID NO: 17), and GENBANK Accession No. comprising each distinct region. The types of Sugar moieties NW 001118167.1 truncated from nucleobases 2358000 to that are used to differentiate the regions of a gapmer may in U.S. Pat. No. 2,391,000 (incorporated hereinas SEQID NO: some embodiments include B-D-ribonucleosides, B-D-de 18). oxyribonucleosides. 2'-modified nucleosides (such 2'-modi 0225. It is understood that the sequence set forth in each fied nucleosides may include 2'-MOE, and 2'-O CH, SEQ ID NO in the Examples contained herein is indepen among others), and bicyclic Sugar modified nucleosides dent of any modification to a Sugar moiety, an internucleo (such bicyclic Sugar modified nucleosides may include those side linkage, or a nucleobase. As such, antisense compounds having a 4'-(CH)n-O-2" bridge, where n=1 or n=2 and defined by a SEQID NO may comprise, independently, one 4'-CH O—CH-2'). In certain embodiments, wings may or more modifications to a Sugar moiety, an internucleoside include several modified Sugar moieties, including, for linkage, or a nucleobase. Antisense compounds described by example 2'-MOE. In certain embodiments, wings may Isis Number (Isis No) indicate a combination of nucleobase include several modified and unmodified Sugar moieties. In sequence and motif. certain embodiments, wings may include various combina 0226. In certain embodiments, a target region is a struc tions of 2'-MOE nucleosides and 2'-deoxynucleosides. turally defined region of the target nucleic acid. For 0222 Each distinct region may comprise uniform Sugar example, a target region may encompass a 3' UTR, a 5' UTR, moieties, variant, or alternating Sugar moieties. The wing an exon, an intron, an exon/intronjunction, a coding region, gap-wing motif is frequently described as “X-Y-Z’, where a translation initiation region, translation termination region, “X” represents the length of the 5' wing, “Y” represents the or other defined nucleic acid region. The structurally defined length of the gap, and “Z” represents the length of the 3' regions for PKK can be obtained by accession number from wing. “X” and “Z” may comprise uniform, variant, or sequence databases such as NCBI and Such information is alternating Sugar moieties. In certain embodiments, “X” and incorporated herein by reference. In certain embodiments, a “Y” may include one or more 2'-deoxynucleosides. “Y” may target region may encompass the sequence from a 5' target comprise 2'-deoxynucleosides. As used herein, a gapmer site of one target segment within the target region to a 3' described as "X-Y-Z’ has a configuration such that the gap target site of another target segment within the same target is positioned immediately adjacent to each of the 5' wing and region. the 3' wing. Thus, no intervening nucleotides exist between 0227 Targeting includes determination of at least one the 5' wing and gap, or the gap and the 3' wing. Any of the target segment to which an antisense compound hybridizes, antisense compounds described herein can have a gapmer such that a desired effect occurs. In certain embodiments, the motif. In certain embodiments, “X” and “Z” are the same; in desired effect is a reduction in mRNA target nucleic acid other embodiments they are different. levels. In certain embodiments, the desired effect is reduc 0223) In certain embodiments, gapmers provided herein tion of levels of protein encoded by the target nucleic acid include, for example 20-mers having a motif of 5-10-5. or a phenotypic change associated with the target nucleic acid. Target Nucleic Acids, Target Regions and Nucleotide 0228. A target region may contain one or more target Sequences segments. Multiple target segments within a target region 0224 Nucleotide sequences that encode human plasma may be overlapping. Alternatively, they may be non-over prekallikrein (PKK) include, without limitation, the follow lapping. In certain embodiments, target segments within a ing: GENBANK Accession No. NM 000892.3 (incorpo target region are separated by no more than about 300 rated herein as SEQID NO: 1), GENBANK Accession No. nucleotides. In certain embodiments, target segments within DC412984.1 (incorporated herein as SEQID NO: 2), GEN a target region are separated by a number of nucleotides that BANK Accession No. CN265612.1 (incorporated herein as is, is about, is no more than, is no more than about, 250, 200, US 2017/0002359 A1 Jan. 5, 2017

150, 100, 90, 80, 70, 60, 50, 40, 30, 20, or 10 nucleotides on Complementarity the target nucleic acid, or is a range defined by any two of 0235 An antisense compound and a target nucleic acid the preceeding values. In certain embodiments, target seg are complementary to each other when a sufficient number ments within a target region are separated by no more than, of nucleobases of the antisense compound can hydrogen or no more than about, 5 nucleotides on the target nucleic bond with the corresponding nucleobases of the target acid. In certain embodiments, target segments are contigu nucleic acid, such that a desired effect will occur (e.g., ous. Contemplated are target regions defined by a range antisense inhibition of a target nucleic acid, such as a PKK having a starting nucleic acid that is any of the 5' target sites nucleic acid). or 3' target sites listed herein. 0236 Non-complementary nucleobases between an anti 0229 Suitable target segments may be found within a 5' sense compound and a PKK nucleic acid may be tolerated UTR, a coding region, a 3' UTR, an intron, an exon, or an provided that the antisense compound remains able to spe exon/intron junction. Target segments containing a start cifically hybridize to a target nucleic acid. Moreover, an codon or a stop codon are also suitable target segments. A antisense compound may hybridize over one or more seg Suitable target segment may specifically exclude a certain ments of a PKK nucleic acid such that intervening or structurally defined region Such as the start codon or stop adjacent segments are not involved in the hybridization codon. event (e.g., a loop structure, mismatch or hairpin structure). 0230. The determination of suitable target segments may 0237. In certain embodiments, the antisense compounds include a comparison of the sequence of a target nucleic acid provided herein, or a specified portion thereof, are, or are at to other sequences throughout the genome. For example, the least, 70%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, BLAST algorithm may be used to identify regions of simi 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, larity amongst different nucleic acids. This comparison can 98%, 99%, or 100% complementary to an PKK nucleic acid, prevent the selection of antisense compound sequences that a target region, target segment, or specified portion thereof. may hybridize in a non-specific manner to sequences other Percent complementarity of an antisense compound with a than a selected target nucleic acid (i.e., non-target or off target nucleic acid can be determined using routine methods. target sequences). 0238 For example, an antisense compound in which 18 of 20 nucleobases of the antisense compound are comple 0231. There may be variation in activity (e.g., as defined mentary to a target region, and would therefore specifically by percent reduction of target nucleic acid levels) of the hybridize, would represent 90 percent complementarity. In antisense compounds within an active target region. In this example, the remaining noncomplementary nucleobases certain embodiments, reductions in PKK mRNA levels are may be clustered or interspersed with complementary nucle indicative of inhibition of PKK expression. Reductions in obases and need not be contiguous to each other or to levels of a PKK protein are also indicative of inhibition of complementary nucleobases. As such, an antisense com target mRNA expression. Further, phenotypic changes are pound which is 18 nucleobases in length having four non indicative of inhibition of PKK expression. For example, complementary nucleobases which are flanked by two reduced or prevented inflammation can be indicative of regions of complete complementarity with the target nucleic inhibition of PKK expression. In another example, reduced acid would have 77.8% overall complementarity with the or prevented edema/swelling can be indicative of inhibition target nucleic acid and would thus fall within the scope of of PKK expression. In another example, reduced or pre the present invention. Percent complementarity of an anti vented vascular permeability can be indicative of inhibition sense compound with a region of a target nucleic acid can be of PKK expression. In another example, reduced or pre determined routinely using BLAST programs (basic local vented vascular leakage can be indicative of inhibition of alignment search tools) and PowerBLAST programs known PKK expression. In certain embodiments, vascular perme in the art (Altschulet al., J. Mol. Biol., 1990, 215, 403 410; ability is measured by quantification of a dye, such as Evans Zhang and Madden, Genome Res., 1997, 7, 649 656). Blue. Percent homology, sequence identity or complementarity, can be determined by, for example, the Gap program (Wis Hybridization consin Sequence Analysis Package, Version 8 for Unix, Genetics Computer Group, University Research Park, Madi 0232. In some embodiments, hybridization occurs son Wis.), using default settings, which uses the algorithm of between an antisense compound disclosed herein and a Smith and Waterman (Adv. Appl. Math., 1981, 2, 482 489). target nucleic acid. The most common mechanism of hybrid 0239. In certain embodiments, the antisense compounds ization involves hydrogen bonding (e.g., Watson-Crick, provided herein, or specified portions thereof, are fully Hoogsteen or reversed Hoogsteen hydrogen bonding) complementary (i.e. 100% complementary) to a target between complementary nucleobases of the nucleic acid nucleic acid, or specified portion thereof. For example, an molecules. antisense compound may be fully complementary to a plasma prekallikrein nucleic acid, or a target region, or a 0233 Hybridization can occur under varying conditions. target segment or target sequence thereof. As used herein, Stringent conditions are sequence-dependent and are deter “fully complementary' means each nucleobase of an anti mined by the nature and composition of the nucleic acid sense compound is capable of precise base pairing with the molecules to be hybridized. corresponding nucleobases of a target nucleic acid. For 0234 Methods of determining whether a sequence is example, a 20 nucleobase antisense compound is fully specifically hybridizable to a target nucleic acid are well complementary to a target sequence that is 400 nucleobases known in the art. In certain embodiments, the antisense long, so long as there is a corresponding 20 nucleobase compounds provided herein are specifically hybridizable portion of the target nucleic acid that is fully complementary with a target nucleic acid. to the antisense compound. Fully complementary can also US 2017/0002359 A1 Jan. 5, 2017

be used in reference to a specified portion of the first and/or Identity the second nucleic acid. For example, a 20 nucleobase portion of a 30 nucleobase antisense compound can be “fully 0244. The antisense compounds provided herein may complementary' to a target sequence that is 400 nucleobases also have a defined percent identity to a particular nucleotide long. The 20 nucleobase portion of the 30 nucleobase sequence, SEQ ID NO, or compound represented by a oligonucleotide is fully complementary to the target specific Isis number, or portion thereof. As used herein, an sequence if the target sequence has a corresponding 20 antisense compound is identical to the sequence disclosed nucleobase portion wherein each nucleobase is complemen herein if it has the same nucleobase pairing ability. For tary to the 20 nucleobase portion of the antisense compound. example, a RNA which contains uracil in place of thymidine At the same time, the entire 30 nucleobase antisense com in a disclosed DNA sequence would be considered identical pound may or may not be fully complementary to the target to the DNA sequence since both uracil and thymidine pair sequence, depending on whether the remaining 10 nucle with adenine. Shortened and lengthened versions of the obases of the antisense compound are also complementary antisense compounds described herein as well as compounds to the target sequence. having non-identical bases relative to the antisense com 0240. The location of a non-complementary nucleobase pounds provided herein also are contemplated. The non may be at the 5' end or 3' end of the antisense compound. identical bases may be adjacent to each other or dispersed Alternatively, the non-complementary nucleobase or nucle throughout the antisense compound. Percent identity of an obases may be at an internal position of the antisense antisense compound is calculated according to the number compound. When two or more non-complementary nucle of bases that have identical base pairing relative to the obases are present, they may be contiguous (i.e. linked) or sequence to which it is being compared. non-contiguous. In one embodiment, a non-complementary 0245. In certain embodiments, the antisense compounds, nucleobase is located in the wing segment of a gapmer or portions thereof, are at least 70%, 75%, 80%, 85%, 90%, antisense oligonucleotide. 95%, 96%, 97%, 98%, 99% or 100% identical to one or 0241. In certain embodiments, antisense compounds that more of the antisense compounds or SEQ ID NOS, or a are, or are up to 11, 12, 13, 14, 15, 16, 17, 18, 19, or 20 portion thereof, disclosed herein. nucleobases in length comprise no more than 4, no more 0246. In certain embodiments, a portion of the antisense than 3, no more than 2, or no more than 1 non-complemen compound is compared to an equal length portion of the tary nucleobase(s) relative to a target nucleic acid or speci target nucleic acid. In certain embodiments, an 8, 9, 10, 11, fied portion thereof. 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, or 25 0242. In certain embodiments, antisense compounds that nucleobase portion is compared to an equal length portion of are, or are up to 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, the target nucleic acid. 22, 23, 24, 25, 26, 27, 28, 29, or 30 nucleobases in length 0247. In certain embodiments, a portion of the antisense comprise no more than 6, no more than 5, no more than 4. oligonucleotide is compared to an equal length portion of the no more than 3, no more than 2, or no more than 1 target nucleic acid. In certain embodiments, an 8, 9, 10, 11, non-complementary nucleobase(s) relative to a target 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, or 25 nucleic acid or specified portion thereof. nucleobase portion is compared to an equal length portion of 0243 The antisense compounds provided also include the target nucleic acid. those which are complementary to a portion of a target nucleic acid. As used herein, "portion” refers to a defined Modifications number of contiguous (i.e. linked) nucleobases within a region or segment of a target nucleic acid. A "portion' can 0248. A nucleoside is a base-sugar combination. The also refer to a defined number of contiguous nucleobases of nucleobase (also known as base) portion of the nucleoside is an antisense compound. In certain embodiments, the anti normally a heterocyclic base moiety. Nucleotides are sense compounds, are complementary to at least an 8 nucleosides that further include a phosphate group cova nucleobase portion of a target segment. In certain embodi lently linked to the sugar portion of the nucleoside. For those ments, the antisense compounds are complementary to at nucleosides that include a pentofuranosyl Sugar, the phos least a 9 nucleobase portion of a target segment. In certain phate group can be linked to the 2',3' or 5’ hydroxyl moiety embodiments, the antisense compounds are complementary of the Sugar. Oligonucleotides are formed through the cova to at least a 10 nucleobase portion of a target segment. In lent linkage of adjacent nucleosides to one another, to form certain embodiments, the antisense compounds are comple a linear polymeric oligonucleotide. Within the oligonucle mentary to at least an 11 nucleobase portion of a target otide structure, the phosphate groups are commonly referred segment. In certain embodiments, the antisense compounds to as forming the internucleoside linkages of the oligonucle are complementary to at least a 12 nucleobase portion of a otide. target segment. In certain embodiments, the antisense com 0249 Modifications to antisense compounds encompass pounds are complementary to at least a 13 nucleobase Substitutions or changes to internucleoside linkages, Sugar portion of a target segment. In certain embodiments, the moieties, or nucleobases. Modified antisense compounds are antisense compounds are complementary to at least a 14 often preferred over native forms because of desirable nucleobase portion of a target segment. In certain embodi properties such as, for example, enhanced cellular uptake, ments, the antisense compounds are complementary to at enhanced affinity for nucleic acid target, increased Stability least a 15 nucleobase portion of a target segment. Also in the presence of nucleases, or increased inhibitory activity. contemplated are antisense compounds that are complemen 0250 Chemically modified nucleosides may also be tary to at least a 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, employed to increase the binding affinity of a shortened or or more nucleobase portion of a target segment, or a range truncated antisense oligonucleotide for its target nucleic defined by any two of these values. acid. Consequently, comparable results can often be US 2017/0002359 A1 Jan. 5, 2017

obtained with shorter antisense compounds that have Such (R), O—CH2—C(=O) N(R)(R), and O CH C chemically modified nucleosides. (=O)—N(R)-(CH2) N(R)(R), where each R. R. and R is, independently, H or substituted or unsubstituted Modified Internucleoside Linkages C-Co alkyl. 0251. The naturally occurring internucleoside linkage of 0256. As used herein, “bicyclic nucleosides' refer to RNA and DNA is a 3' to 5' phosphodiester linkage. Antisense modified nucleosides comprising a bicyclic Sugar moiety. compounds having one or more modified, i.e. non-naturally Examples of bicyclic nucleosides include without limitation occurring, internucleoside linkages are often selected over nucleosides comprising a bridge between the 4' and the 2 antisense compounds having naturally occurring inter ribosyl ring atoms. In certain embodiments, antisense com nucleoside linkages because of desirable properties such as, pounds provided herein include one or more bicyclic nucleo for example, enhanced cellular uptake, enhanced affinity for sides comprising a 4" to 2' bridge. Examples of Such 4" to 2 target nucleic acids, and increased Stability in the presence of nucleases. bridged bicyclic nucleosides, include but are not limited to 0252 Oligonucleotides having modified internucleoside one of the formulas: 4'-(CH)—O-2 (LNA); 4'-(CH)—S-2: linkages include internucleoside linkages that retain a phos 4'-(CH), O-2 (ENA); 4'-CH(CH) O-2 (also referred phorus atom as well as internucleoside linkages that do not to as constrained ethyl or cRt) and 4'-CH(CHOCH)—O-2 have a phosphorus atom. Representative phosphorus con (and analogs thereof see U.S. Pat. No. 7,399,845, issued on taining internucleoside linkages include, but are not limited Jul. 15, 2008): 4'-C(CH)(CH)—O-2 (and analogs thereof to, phosphodiesters, phosphotriesters, methylphosphonates, see PCT/US2008/068922 published as WO/2009/006478, phosphoramidate, and phosphorothioates. Methods of published Jan. 8, 2009): 4'-CH N(OCH)-2' (and analogs preparation of phosphorous-containing and non-phospho thereof see PCT/US2008/064591 published as WO/2008/ rous-containing linkages are well known. 150729, published Dec. 11, 2008): 4'-CH-O N(CH)-2' 0253) In certain embodiments, antisense compounds tar (see published U.S. Patent Application US2004-0171570, geted to a plasma prekallikrein nucleic acid comprise one or published Sep. 2, 2004); 4'-CH N(R) O-2', wherein R is more modified internucleoside linkages. In certain embodi H, C-C alkyl, or a protecting group (see U.S. Pat. No. ments, the modified internucleoside linkages are phospho 7.427,672, issued on Sep. 23, 2008): 4'-CH C(H)(CH)-2' rothioate linkages. In certain embodiments, each inter (see Chattopadhyaya et al., J. Org. Chem., 2009, 74, 118 nucleoside linkage of an antisense compound is a 134); and 4'-CH C(=CH-)-2' (and analogs thereof see phosphorothioate internucleoside linkage. PCT/US2008/066154 published as WO 2008/154401, pub lished on Dec. 8, 2008). Modified Sugar Moieties 0257. Further reports related to bicyclic nucleosides can 0254 Antisense compounds can optionally contain one also be found in published literature (see for example: or more nucleosides wherein the Sugar group has been Frieden et al., Nucleic Acids Research, 2003, 21, 6365-6372: modified. Such Sugar modified nucleosides may impart Singh et al., Chem. Commun., 1998, 4, 455-456; Koshkin et enhanced nuclease stability, increased binding affinity, or al., Tetrahedron, 1998, 54, 3607-3630; Wahlestedt et al., Some other beneficial biological property to the antisense Proc. Natl. Acad. Sci. U.S.A., 2000, 97, 5633-5638; Kumar compounds. In certain embodiments, nucleosides comprise et al., Bioorg. Med. Chem. Lett., 1998, 8, 2219-2222; Singh chemically modified ribofuranose ring moieties. Examples et al., J. Org. Chem., 1998, 63, 10035-10039; Srivastava et of chemically modified ribofuranose rings include without al., J. Am. Chem. Soc., 2007, 129(26) 8362-8379; Elayadi et limitation, addition of Substitutent groups (including 5' and al., Curr. Opinion Invest. Drugs, 2001, 2, 558-561; Braasch 2' Substituent groups, bridging of non-geminal ring atoms to et al., Chem. Biol., 2001, 8, 1-7; and Orum et al., Curr: form bicyclic nucleic acids (BNA), replacement of the Opinion Mol. Then, 2001, 3, 239-243: U.S. Pat. Nos. 6,268, ribosyl ring oxygen atom with S. N(R), or C(R)(R) (R. R. 490; 6,525, 191; 6,670,461; 6,770,748; 6,794,499; 7,034, and R2 are each independently H, C-C alkyl or a protect 133; 7,053,207; 7,399,845; 7,547,684; and 7,696.345; U.S. ing group) and combinations thereof. Examples of chemi Patent Publication No. US2008-0039618: US2009 cally modified sugars include 2'-F-5'-methyl substituted 0.012281; US2007-0287831; US2004-0171570; U.S. patent nucleoside (see PCT International Application WO 2008/ application Ser. Nos. 12/129,154; 60/989,574: 61/026,995: 101157 Published on Aug. 21, 2008 for other disclosed 61/026,998: 61/056,564: 61/086,231: 61/097,787; and 5'2'-bis substituted nucleosides) or replacement of the ribo 61/099,844; Published PCT International applications WO syl ring oxygen atom with S with further substitution at the 1994/014226; WO 2004/106356; WO 2005/021570; WO 2'-position (see published U.S. Patent Application US2005 2007/134181; WO 2008/150729; WO 2008/154401; and 0130923, published on Jun. 16, 2005) or alternatively WO 2009/006478. Each of the foregoing bicyclic nucleo 5'-substitution of a BNA (see PCT International Application sides can be prepared having one or more stereochemical WO 2007/134181 Published on Nov. 22, 2007 wherein LNA Sugar configurations including for example C-L-ribofura is substituted with for example a 5'-methyl or a 5'-vinyl nose and B-D-ribofuranose (see PCT international applica group). tion PCT/DK98/00393, published on Mar. 25, 1999 as WO 0255 Examples of nucleosides having modified sugar 99/14226). moieties include without limitation nucleosides comprising 0258. In certain embodiments, bicyclic sugar moieties of 5'-vinyl, 5'-methyl (R or 5), 4-S, 2'-F, 2'-OCH, BNA nucleosides include, but are not limited to, compounds 2'-OCHCH, 2'-OCHCHF and 2'-O(CH)OCH sub having at least one bridge between the 4' and the 2' position stituent groups. The Substituent at the 2' position can also be of the pentofuranosyl Sugar moiety wherein such bridges selected from allyl, amino, azido, thio, O-allyl, O—C-Co independently comprise 1 or from 2 to 4 linked groups alkyl, OCF, OCHF, O(CH2)SCH, O(CH), O N(R) independently selected from —C(R)(R), , —C(R) US 2017/0002359 A1 Jan. 5, 2017

(C)

0261 n is 1, 2, 3, or 4: 0262 each R, and R is, independently, H, a protecting group, hydroxyl, C-C alkyl, Substituted C-C alkyl, - C-C alkenyl, Substituted C-C alkenyl, C-C alkynyl, O Substituted C-C alkynyl, Cs-Co aryl, Substituted Cs-Co aryl, heterocycle radical, Substituted heterocycle radical, heteroaryl, Substituted heteroaryl, Cs-C, alicyclic radical, (D) Substituted C-C, alicyclic radical, halogen, OJ, NJ.J., SJ, N. COOJ, acyl (C(=O)—H), substituted acyl, CN, sul fonyl (S(=O)-J), or sulfoxyl (S(=O)-J); and 0263 each J and J is, independently, H. C-C alkyl, Substituted C-C alkyl, C-C alkenyl, Substituted C-C2 alkenyl, C-C alkynyl, Substituted C-C alkynyl, Cs-Co aryl, Substituted Cs-Co aryl, acyl (C(=O)—H), Substituted acyl, a heterocycle radical, a Substituted heterocycle radical, C-C aminoalkyl, Substituted C-C aminoalkyl or a pro (E) tecting group. 0264. In certain embodiments, the bridge of a bicyclic Sugar moiety is —C(R)(R), , —C(R)(R), O—, C(RR) N(R)—O— or —C(RR) O N(R)—. In certain embodiments, the bridge is 4'-CH-2',4'-(CH)-2', 4'-(CH)-2',4'-CH, O-2',4'-(CH), O-2',4'-CH O— N(R)-2' and 4'-CH N(R)—O-2'- wherein each R is, inde pendently, H, a protecting group or C-C alkyl. 0265. In certain embodiments, bicyclic nucleosides are further defined by isomeric configuration. For example, a (F) nucleoside comprising a 4'-2' methylene-oxy bridge, may be in the C-L configuration or in the B-D configuration. Previ- O ously, C-L-methyleneoxy (4'-CH, O-2) BNA’s have been Bx incorporated into antisense oligonucleotides that showed antisense activity (Frieden et al., Nucleic Acids Research, H3C 2003, 21, 6365-6372). N 0266. In certain embodiments, bicyclic nucleosides include, but are not limited to, (A) C-L-methyleneoxy (4'- CH-O-2) BNA, (B) f-D-methyleneoxy (4'-CH2—O-2) (G) BNA, (C) ethyleneoxy (4'-(CH), O-2) BNA, (D) ami nooxy (4-CH2—O N(R)-2') BNA, (E) oxyamino (4'- O CH N(R)—O-2) BNA, and (F) methyl(methyleneoxy) Bx (4'-CH(CH) O-2) BNA, (G) methylene-thio (4'-CH S

2) BNA, (H) methylene-amino (4'-CH N(R)-2') BNA, (I) methyl carbocyclic (4'-CH CH(CH)-2') BNA, (J) pro pylene carbocyclic (4-(CH)-2') BNA and (K) vinyl BNA as depicted below: (H)

(A) O O Bx

(I) (B)

O Bx O Bx

N US 2017/0002359 A1 Jan. 5, 2017

-continued 0276 Z is C-C alkyl, C-C alkenyl, C-C alkynyl, (J) Substituted C-C alkyl, Substituted C-C alkenyl, Substi tuted C-C alkynyl, acyl, Substituted acyl, Substituted amide, thiol or substituted thio. O Bx 0277. In one embodiment, each of the substituted groups is, independently, mono or poly Substituted with Substituent groups independently selected from halogen, oxo, hydroxyl, OJ, NJ.J. S.J., N, OC(=X).J. and NJC(=X)NJ.J. wherein each J. J. and J is, independently, H. C-C alkyl, (K) or substituted C-C alkyl and X is O or NJ. 0278. In certain embodiments, bicyclic nucleosides are provided having Formula III: O Bx

III

CH2

0267 wherein Bx is the base moiety and R is indepen dently H, a protecting group, C-C alkyl or C-C alkoxy. 0268. In certain embodiments, bicyclic nucleosides are provided having Formula I:

T-O Bx wherein: 0279. Bx is a heterocyclic base moiety; 0280 T and T, are each, independently H, a hydroxyl X, protecting group, a conjugate group, a reactive phosphorus QONo1 Qe group, a phosphorus moiety or a covalent attachment to a Ti, Support medium; 0281 Z, is C-C alkyl, C-C alkenyl, C-C alkynyl, Substituted C-C alkyl, Substituted C-C alkenyl, Substi wherein: tuted C-C alkynyl or substituted acyl (C(=O)—). 0269. Bx is a heterocyclic base moiety; 0282. In certain embodiments, bicyclic nucleosides are provided having Formula IV:

0271 R is C-C alkyl or an amino protecting group; IV and 0272 T, and T are each, independently H, a hydroxyl protecting group, a conjugate group, a reactive phosphorus group, a phosphorus moiety or a covalent attachment to a Support medium. 0273. In certain embodiments, bicyclic nucleosides are provided having Formula II:

II wherein: 0283 Bx is a heterocyclic base moiety; 0284. T and T, are each, independently H, a hydroxyl protecting group, a conjugate group, a reactive phosphorus group, a phosphorus moiety or a covalent attachment to a Support medium; 0285 R. is C-C alkyl, substituted C-C alkyl, C-C, alkenyl, Substituted C-C alkenyl, C-C alkynyl or Substi tuted C-C alkynyl: wherein: 0286 each q, q, q, and q is, independently, H., halogen, 0274 Bx is a heterocyclic base moiety; C-C alkyl, Substituted C-C alkyl, C-C alkenyl, substi 0275 T and T, are each, independently H, a hydroxyl tuted C-C alkenyl, C-C alkynyl or Substituted C-C, protecting group, a conjugate group, a reactive phosphorus alkynyl, C-C alkoxyl. Substituted C-C alkoxyl, acyl, group, a phosphorus moiety or a covalent attachment to a Substituted acyl, C-C aminoalkyl or Substituted C-C, Support medium; aminoalkyl; US 2017/0002359 A1 Jan. 5, 2017 22

0287. In certain embodiments, bicyclic nucleosides are 10298 each q, q, q and q, is, independently, H, halogen, provided having Formula V: C-C alkyl, Substituted C-C alkyl, C-C alkenyl, Sub stituted C-C alkenyl, C-C alkynyl. Substituted C-C2 V Ca alkynyl, C-C alkoxyl, substituted C-C alkoxyl, OJ, Cb S.J., SOJ, SOJ, NJ.J., N, CN, C(=O)CJ, C(=O)NJ.J. T-O O Bx C(=O), O C(=O)NJ.J., N(H)C(=NH)NJ.J., N(H)C O-Ti, (=O)NJ.J. or N(H)C(=S)NJ.J.; and Ce 10299 q, and q, or q, and q together are =C(q)(q). wherein q and q, are each, independently, H, halogen, Clf O C-C alkyl or Substituted C-C alkyl. 0300. One carbocyclic bicyclic nucleoside having a 4'- wherein: (CH)-2' bridge and the alkenyl analog bridge 0288 Bx is a heterocyclic base moiety; 4'-CH=CH-CH-2 have been described (Freier et al., 0289 T, and T, are each, independently H, a hydroxyl Nucleic Acids Research, 1997, 25(22), 4429-4443 and protecting group, a conjugate group, a reactive phosphorus Albaek et al., J. Org. Chem., 2006, 71, 7731-7740). The group, a phosphorus moiety or a covalent attachment to a synthesis and preparation of carbocyclic bicyclic nucleo Support medium; sides along with their oligomerization and biochemical 0290 q q., q and q are each, independently, hydrogen, studies have also been described (Srivastava et al., J. Am. halogen, C-C alkyl, Substituted C-C alkyl, C-C2 Chem. Soc., 2007, 129(26), 8362-8379). alkenyl, Substituted C-C alkenyl, C-C alkynyl, Substi (0301 As used herein, “4'-2' bicyclic nucleoside' or “4” to tuted C-C alkynyl, C-C alkoxy, Substituted C-C2 2' bicyclic nucleoside' refers to a bicyclic nucleoside com alkoxy, OJ, SJ, SOJ, SOJ, NJ.J., N, CN, C(=O)CJ, prising a furanose ring comprising a bridge connecting two C(=O)NJ.J., C(=O).J. O. C(=O)NJ.J., N(H)C(=NH) carbon atoms of the furanose ring connects the 2 carbon NJ.J., N(H)C(=O)NJ.J. or N(H)C(=S)NJ.J.; atom and the 4' carbon atom of the Sugar ring. (0291 or q and q, together are =C(q)(q): 0302 As used herein, "monocyclic nucleosides’ refer to 0292 q and q, are each, independently, H, halogen, nucleosides comprising modified Sugar moieties that are not C-C alkyl or Substituted C-C alkyl. bicyclic Sugar moieties. In certain embodiments, the Sugar 0293. The synthesis and preparation of the methyleneoxy moiety, or Sugar moiety analogue, of a nucleoside may be (4'-CH2—O-2) BNA monomers adenine, cytosine, guanine, modified or substituted at any position. 5-methyl-cytosine, thymine and uracil, along with their 0303 As used herein, “2'-modified sugar means a fura oligomerization, and nucleic acid recognition properties nosyl Sugar modified at the 2' position. In certain embodi have been described (Koshkin et al., Tetrahedron, 1998, 54. ments, such modifications include Substituents selected 3607-3630). BNAS and preparation thereof are also from: a halide, including, but not limited to substituted and described in WO 98/39352 and WO 99714226. unsubstituted alkoxy, substituted and unsubstituted thio 0294 Analogs of methyleneoxy (4'-CH-O-2) BNA alkyl, substituted and unsubstituted amino alkyl, substituted and 2'-thio-BNAs, have also been prepared (Kumar et al., and unsubstituted alkyl, substituted and unsubstituted allyl, Bioorg. Med. Chem. Lett., 1998, 8, 2219-2222). Preparation and Substituted and unsubstituted alkynyl. In certain of locked nucleoside analogs comprising oligodeoxyribo embodiments, 2" modifications are selected from substitu nucleotide duplexes as Substrates for nucleic acid poly ents including, but not limited to: O(CH), OCH, merases has also been described (Wengel et al., WO O(CH), NH, O(CH), CH, O(CH),F, O(CH), ONH, 99/14226). Furthermore, synthesis of 2'-amino-BNA, a OCHC(=O)N(H)CH, and O(CH)ON(CH2)CH), novel conformationally restricted high-affinity oligonucle where n and m are from 1 to about 10. Other 2'-substituent otide analog has been described in the art (Singh et al., J. groups can also be selected from: C-C alkyl, Substituted Org. Chem., 1998, 63, 1.0035-10039). In addition, 2-amino alkyl, alkenyl, alkynyl, alkaryl, aralkyl, O-alkaryl or and 2'-methylamino-BNA’s have been prepared and the O-aralkyl, SH, SCH, OCN, Cl, Br, CN, F, CF. OCF, thermal stability of their duplexes with complementary RNA SOCH, SOCH, ONO, NO, N, NH, heterocycloalkyl, and DNA strands has been previously reported. heterocycloalkaryl, aminoalkylamino, polyalkylamino, Sub 0295. In certain embodiments, bicyclic nucleosides are stituted silyl, an RNA cleaving group, a reporter group, an provided having Formula VI: intercalator, a group for improving pharmacokinetic prop erties, or a group for improving the pharmacodynamic VI properties of an antisense compound, and other Substituents having similar properties. In certain embodiments, modified nucleosides comprise a 2-MOE side chain (Baker et al., J. Biol. Chem., 1997, 272, 11944-12000). Such 2'-MOE sub stitution have been described as having improved binding affinity compared to unmodified nucleosides and to other modified nucleosides, such as 2'-O-methyl, O-propyl, and O-aminopropyl. Oligonucleotides having the 2'-MOE sub wherein: stituent also have been shown to be antisense inhibitors of 0296 Bx is a heterocyclic base moiety; gene expression with promising features for in vivo use 0297 T, and T, are each, independently H, a hydroxyl (Martin, Helv. Chim. Acta, 1995, 78, 486-504; Altmann et protecting group, a conjugate group, a reactive phosphorus al., Chimia, 1996, 50, 168-176: Altmann et al., Biochem. group, a phosphorus moiety or a covalent attachment to a Soc. Trans., 1996, 24, 630-637; and Altmann et al., Nucleo Support medium; sides Nucleotides, 1997, 16, 917-926). US 2017/0002359 A1 Jan. 5, 2017

0304. As used herein, a “modified tetrahydropyran 0310. In certain embodiments, Sugar Surrogates comprise nucleoside' or “modified THP nucleoside” means a nucleo rings having more than 5 atoms and more than one heteroa side having a six-membered tetrahydropyran “Sugar Sub tom. For example nucleosides comprising morpholino Sugar stituted in for the pentofuranosyl residue in normal nucleo moieties and their use in oligomeric compounds has been sides (a sugar surrogate). Modified THP nucleosides include, reported (see for example: Braasch et al., Biochemistry, but are not limited to, what is referred to in the art as hexitol 2002, 41, 4503-4510; and U.S. Pat. Nos. 5,698,685; 5,166, nucleic acid (HNA), anitol nucleic acid (ANA), manitol 315; 5,185,444; and 5,034.506). As used here, the term nucleic acid (MNA) (see Leumann, Bioorg. Med. Chem., “morpholino” means a Sugar Surrogate having the following 2002, 10, 841-1954) or fluoro HNA (F-HNA) having a formula: tetrahydropyran ring system as illustrated below:

Bx

HO O

0311. In certain embodiments, morpholinos may be HO Bx modified, for example by adding or altering various Sub stituent groups from the above morpholino structure. Such 0305. In certain embodiments, sugar surrogates are Sugar Surrogates are referred to herein as "modified mor selected having Formula VII: pholinos.” 0312 Combinations of modifications are also provided without limitation, such as 2'-F-5'-methyl substituted

VII nucleosides (see PCT International Application WO 2008/ 101157 published on Aug. 21, 2008 for other disclosed 5', 2'-bis substituted nucleosides) and replacement of the ribo Syl ring oxygen atom with S and further Substitution at the 2'-position (see published U.S. Patent Application US2005 0130923, published on Jun. 16, 2005) or alternatively 5'-substitution of a bicyclic nucleic acid (see PCT Interna tional Application WO 2007/134181, published on Nov. 22, 2007 wherein a 4-CH O-2' bicyclic nucleoside is further substituted at the 5' position with a 5'-methyl or a 5'-vinyl wherein independently for each of said at least one tetrahy group). The synthesis and preparation of carbocyclic bicy dropyran nucleoside analog of Formula VII: clic nucleosides along with their oligomerization and bio 0306 Bx is a heterocyclic base moiety; chemical studies have also been described (see, e.g., Sriv 0307 T, and T are each, independently, an internucleo astava et al., J. Am. Chem. Soc. 2007, 129(26), 8362-8379). side linking group linking the tetrahydropyran nucleoside 0313. In certain embodiments, antisense compounds analog to the antisense compound or one of T and T, is an comprise one or more modified cyclohexenyl nucleosides, internucleoside linking group linking the tetrahydropyran which is a nucleoside having a six-membered cyclohexenyl nucleoside analog to the antisense compound and the other in place of the pentofuranosyl residue in naturally occurring of T, and T, is H, a hydroxyl protecting group, a linked nucleosides. Modified cyclohexenyl nucleosides include, conjugate group or a 5' or 3'-terminal group; but are not limited to those described in the art (see for 0308 q, q, q, q, qs, q and q, are each independently, example commonly owned, published PCT Application WO H. C-C alkyl, Substituted C-C alkyl, C-C alkenyl, 2010/036696, published on Apr. 10, 2010, Robeyns et al., J. Substituted C-C alkenyl, C-C alkynyl or Substituted Am. Chem. Soc., 2008, 130(6), 1979-1984; Horvath et al., C-C alkynyl; and each of R and R is selected from Tetrahedron Letters, 2007, 48, 3621-3623; Nauwelaerts et hydrogen, hydroxyl, halogen, Substituted or unsubstituted al., J. Am. Chem. Soc., 2007, 129(30), 9340-9348; Gu et al., alkoxy, NJ.J., S.J., N, OC(=X).J., OC(=X)NJJ, NJC Nucleosides, Nucleotides & Nucleic Acids, 2005, 24(5-7), (—X)NJJ and CN, wherein X is O. S or NJ and each J, 993-998: Nauwelaerts et al., Nucleic Acids Research, 2005, J and J is, independently, H or C-C alkyl. 33(8), 2452-2463; Robeyns et al., Acta Crystallographica, 0309. In certain embodiments, the modified THP nucleo Section F. Structural Biology and Crystallization Commu sides of Formula VII are provided wherein q1, q2, q, q, qs. nications, 2005, F61(6), 585-586; Gu et al., Tetrahedron, q and q, are each H. In certain embodiments, at least one of 2004, 60(9), 2111-2123; Gu et al., Oligonucleotides, 2003, q1, q2, qs, q1, qs, q6 and q.7 is other than H. In certain 13(6), 479-489; Wang et al., J. Org. Chem., 2003, 68, embodiments, at least one of q1, q2, qs, q1, qs, q and q, is 4499-4505; Verbeure et al., Nucleic Acids Research, 2001, methyl. In certain embodiments, THP nucleosides of For 29(24), 4941-4947; Wang et al., J. Org. Chem., 2001, 66, mula VII are provided wherein one of R and R is fluoro. 8478-82; Wang et al., Nucleosides, Nucleotides & Nucleic In certain embodiments, R is fluoro and R is H; R is Acids, 2001, 20(4-7), 785-788; Wang et al., J. Am. Chem., methoxy and R is H. and R is methoxyethoxy and R is H. 2000, 122, 8595-8602: Published PCT application, WO US 2017/0002359 A1 Jan. 5, 2017 24

06/047842; and Published PCT Application WO 01/049687; used to modify nucleosides for incorporation into antisense the text of each is incorporated by reference herein, in their compounds as provided herein (see for example review entirety). Certain modified cyclohexenyl nucleosides have article: Leumann, Bioorg. Med. Chem., 2002, 10,841-1954). Formula X. Such ring systems can undergo various additional Substitu tions to enhance activity. 0325 Methods for the preparations of modified sugars X are well known to those skilled in the art. Some represen C 92 qs tative U.S. patents that teach the preparation of such modi T-O fied sugars include without limitation, U.S. Pat. Nos. 4,981, C4 957; 5,118,800; 5,319,080; 5,359,044: 5,393,878; 5,446, C9 137; 5,466,786; 5,514,785: 5,519,134: 5,567,811: 5,576, C8 Bx 427: 5,591,722; 5,597,909; 5,610,300; 5,627,053: 5,639, /O C5 873; 5,646,265; 5,670,633; 5,700,920; 5,792,847 and 6,600, T4 C7 C6 032 and International Application PCT/US2005/019219, filed Jun. 2, 2005 and published as WO 2005/121371 on Dec. 22, 2005, and each of which is herein incorporated by 0314 wherein independently for each of said at least one reference in its entirety. cyclohexenyl nucleoside analog of Formula X: 0326 In nucleotides having modified sugar moieties, the 0315 Bx is a heterocyclic base moiety; nucleobase moieties (natural, modified or a combination 0316 T and T are each, independently, an internucleo thereof) are maintained for hybridization with an appropriate side linking group linking the cyclohexenyl nucleoside nucleic acid target. analog to an antisense compound or one of T and T is an 0327. In certain embodiments, antisense compounds internucleoside linking group linking the tetrahydropyran comprise one or more nucleosides having modified Sugar nucleoside analog to an antisense compound and the other of moieties. In certain embodiments, the modified Sugar moiety T and T is H, a hydroxyl protecting group, a linked is 2'-MOE. In certain embodiments, the 2'-MOE modified conjugate group, or a 5'- or 3'-terminal group; and nucleosides are arranged in a gapmer motif. In certain 0317 q1, q2, qs, d4, ds, do. 97, ds and do are each, embodiments, the modified Sugar moiety is a bicyclic independently, H. C-C alkyl, Substituted C-C alkyl, nucleoside having a (4'-CH(CH)—O-2) bridging group. In C-C alkenyl, Substituted C-C alkenyl, C-C alkynyl, certain embodiments, the (4'-CH(CH)—O-2) modified Substituted C-C alkynyl or other sugar substituent group. nucleosides are arranged throughout the wings of a gapmer 0318. As used herein, “2'-modified’ or “2'-substituted motif. refers to a nucleoside comprising a Sugar comprising a substituent at the 2' position other than H or OH. 2'-modified Conjugated Antisense Compounds nucleosides, include, but are not limited to, bicyclic nucleo sides wherein the bridge connecting two carbon atoms of the 0328 Antisense compounds may be covalently linked to Sugar ring connects the 2" carbon and another carbon of the one or more moieties or conjugates which enhance the Sugar ring; and nucleosides with non-bridging 2 substitu activity, cellular distribution or cellular uptake of the result ents, such as allyl, amino, azido, thio, O-allyl, O—C-Co ing antisense oligonucleotides. Typical conjugate groups alkyl, —OCF, O (CH), O CH, 2'-O(CH2)SCH, include cholesterol moieties and lipid moieties. Additional O—(CH), O N(R)(R), or O CH C(=O)—N conjugate groups include carbohydrates, phospholipids, bio (R)(R), where each R, and R, is, independently, H or tin, phenazine, folate, phenanthridine, anthraquinone, acri substituted or unsubstituted C-C alkyl. 2'-modified dine, fluoresceins, rhodamines, coumarins, and dyes. nucleosides may further comprise other modifications, for 0329 Antisense compounds can also be modified to have example at other positions of the Sugar and/or at the nucle one or more stabilizing groups that are generally attached to obase. one or both termini of antisense compounds to enhance 0319. As used herein, “2'-F refers to a nucleoside com properties such as, for example, nuclease stability. Included prising a Sugar comprising a fluoro group at the 2' position in stabilizing groups are cap structures. These terminal of the Sugar ring. modifications protect the antisense compound having termi 0320. As used herein, “2'-OMe” or “2'-OCH or “2'-O- nal nucleic acid from exonuclease degradation, and can help methyl each refers to a nucleoside comprising a Sugar in delivery and/or localization within a cell. The cap can be comprising an —OCH group at the 2' position of the Sugar present at the 5'-terminus (5'-cap), or at the 3'-terminus ring. (3'-cap), or can be present on both termini. Cap structures are 0321. As used herein, “MOE” or “2'-MOE” or “2'- well known in the art and include, for example, inverted OCHCHOCH or “2'-O-methoxyethyl each refers to a deoxy abasic caps. Further 3' and 5'-stabilizing groups that nucleoside comprising a Sugar comprising a can be used to cap one or both ends of an antisense —OCH2CH2OCH group at the 2' position of the Sugar ring. compound to impart nuclease stability include those dis 0322. As used herein, “oligonucleotide' refers to a com closed in WO 03/004602 published on Jan. 16, 2003. pound comprising a plurality of linked nucleosides. 0323. In certain embodiments, one or more of the plu Cell Culture and Antisense Compounds Treatment rality of nucleosides is modified. In certain embodiments, an 0330. The effects of antisense compounds on the level, oligonucleotide comprises one or more ribonucleosides activity, or expression of PKK nucleic acids can be tested in (RNA) and/or deoxyribonucleosides (DNA). vitro in a variety of cell types. Cell types used for such 0324 Many other monocyclo, bicyclo and tricyclo sugar analyses are available from commercial vendors (e.g., Surrogate ring systems are also known in the art that can be American Type Culture Collection, Manassas, Va.; Zen-Bio, US 2017/0002359 A1 Jan. 5, 2017

Inc., Research Triangle Park, N.C.: Clonetics Corporation, Analysis of Inhibition of Target Levels or Expression Walkersville, Md.) and are cultured according to the ven dors instructions using commercially available reagents 0340. Inhibition of levels or expression of a PKK nucleic (e.g., Life Technologies, Carlsbad, Calif.). Illustrative cell acid can be assayed in a variety of ways known in the art. types include, but are not limited to, HepaRGTMT cells and For example, target nucleic acid levels can be quantitated by, mouse primary hepatocytes. e.g., Northern blot analysis, competitive polymerase chain reaction (PCR), or quantitative real-time PCR. RNA analysis can be performed on total cellular RNA or poly(A)-- mRNA. In Vitro Testing of Antisense Oligonucleotides Methods of RNA isolation are well known in the art. 0331 Described herein are methods for treatment of cells Northern blot analysis is also routine in the art. Quantitative with antisense oligonucleotides, which can be modified real-time PCR can be conveniently accomplished using the appropriately for treatment with other antisense compounds. commercially available ABI PRISM 7600, 7700, or 7900 0332 Cells may be treated with antisense oligonucle Sequence Detection System, available from PE-Applied otides when the cells reach approximately 60-80% conflu Biosystems, Foster City, Calif. and used according to manu ency in culture. facturers instructions. 0333) One reagent commonly used to introduce antisense Quantitative Real-Time PCR Analysis of Target RNA Levels oligonucleotides into cultured cells includes the cationic lipid transfection reagent LIPOFECTIN (Life Technologies, 0341 Quantitation of target RNA levels may be accom Carlsbad, Calif.). Antisense oligonucleotides may be mixed plished by quantitative real-time PCR using the ABIPRISM with LIPOFECTIN in OPTI-MEM 1 (Life Technologies, 7600, 7700, or 7900 Sequence Detection System (PE Carlsbad, Calif.) to achieve the desired final concentration of Applied BioSystems, Foster City, Calif.) according to manu antisense oligonucleotide and a LIPOFECTIN concentration facturers instructions. Methods of quantitative real-time that may range from 2 to 12 ug/mL per 100 nM antisense PCR are well known in the art. oligonucleotide. 0342. Prior to real-time PCR, the isolated RNA is sub 0334] Another reagent used to introduce antisense oligo jected to a reverse transcriptase (RT) reaction, which pro nucleotides into cultured cells includes LIPOFECTAMINE duces complementary DNA (cDNA) that is then used as the (Life Technologies, Carlsbad, Calif.). Antisense oligonucle substrate for the real-time PCR amplification. The RT and otide is mixed with LIPOFECTAMINE in OPTI-MEM 1 real-time PCR reactions are performed sequentially in the reduced serum medium (Life Technologies, Carlsbad, same sample well. RT and real-time PCR reagents may be Calif.) to achieve the desired concentration of antisense obtained from Life Technologies (Carlsbad, Calif.). RT oligonucleotide and a LIPOFECTAMINE concentration that real-time-PCR reactions are carried out by methods well may range from 2 to 12 ug/mL per 100 nM antisense known to those skilled in the art. oligonucleotide. 0343 Gene (or RNA) target quantities obtained by real 0335 Another technique used to introduce antisense oli time PCR are normalized using either the expression level of gonucleotides into cultured cells includes electroporation. a gene whose expression is constant, such as cyclophilin A, or by quantifying total RNA using RIBOGREEN (Life 0336 Yet another technique used to introduce antisense Technologies, Inc. Carlsbad, Calif.). Cyclophilin A expres oligonucleotides into cultured cells includes free uptake of sion is quantified by real time PCR, by being run simulta the oligonucleotides by the cells. neously with the target, multiplexing, or separately. Total 0337 Cells are treated with antisense oligonucleotides by RNA is quantified using RIBOGREEN RNA quantification routine methods. Cells may be harvested 16-24 hours after reagent (Invetrogen, Inc. Eugene, Oreg.). Methods of RNA antisense oligonucleotide treatment, at which time RNA or quantification by RIBOGREEN are taught in Jones, L.J., et protein levels of target nucleic acids are measured by al, (Analytical Biochemistry, 1998,265,368-374). ACYTO methods known in the art and described herein. In general, FLUOR 4000 instrument (PE Applied Biosystems) is used when treatments are performed in multiple replicates, the to measure RIBOGREEN fluorescence. data are presented as the average of the replicate treatments. 0344) Probes and primers are designed to hybridize to a 0338. The concentration of antisense oligonucleotide PKK nucleic acid. Methods for designing real-time PCR used varies from cell line to cell line. Methods to determine probes and primers are well known in the art, and may the optimal antisense oligonucleotide concentration for a include the use of Software such as PRIMER EXPRESS particular cell line are well known in the art. Antisense Software (Applied Biosystems, Foster City, Calif.). oligonucleotides are typically used at concentrations ranging from 1 nM to 300 nM when transfected with LIPO Analysis of Protein Levels FECTAMINE. Antisense oligonucleotides are used at higher concentrations ranging from 625 to 20,000 nM when trans (0345 Antisense inhibition of PKK nucleic acids can be fected using electroporation. assessed by measuring PKK protein levels. Protein levels of PKK can be evaluated or quantitated in a variety of ways RNA Isolation well known in the art, such as immunoprecipitation, Western blot analysis (immunoblotting), enzyme-linked immunosor 0339 RNA analysis can be performed on total cellular bent assay (ELISA), quantitative protein assays, protein RNA or poly(A)-- mRNA. Methods of RNA isolation are activity assays (for example, caspase activity assays), immu well known in the art. RNA is prepared using methods well nohistochemistry, immunocytochemistry or fluorescence known in the art, for example, using the TRIZOL Reagent activated cell sorting (FACS). Antibodies directed to a target (Life Technologies, Carlsbad, Calif.) according to the manu can be identified and obtained from a variety of sources, facturer's recommended protocols. such as the MSRS catalog of antibodies (Aerie Corporation, US 2017/0002359 A1 Jan. 5, 2017 26

Birmingham, Mich.), or can be prepared via conventional with an acquired problem, disease, or disorder that leads to monoclonal or polyclonal antibody generation methods well a risk of thrombosis, for example, Surgery, cancer, immo known in the art. bility, sepsis, atherosclerosis atrial fibrillation, as well as genetic predisposition, for example, antiphospholipid syn In Vivo Testing of Antisense Compounds drome and the autosomal dominant condition, Factor V 0346 Antisense compounds, for example, antisense oli Leiden. In certain embodiments, the individual has been gonucleotides, are tested in animals to assess their ability to identified as in need of anticoagulation therapy. Examples of inhibit expression of PKK and produce phenotypic changes. such individuals include, but are not limited to, those 0347 In certain embodiments, such phenotypic changes undergoing major orthopedic Surgery (e.g., hip/knee include those associated with an inflammatory disease. Such replacement or hip fracture Surgery) and patients in need of as, reduced inflammation, edema/swelling, vascular perme chronic treatment, such as those Suffering from arterial ability, and vascular leakage. In certain embodiments, fibrillation to prevent stroke. inflammation is measured by measuring the increase or 0353. In certain embodiments the invention provides decrease of edema, temperature, pain, color of tissue, and methods for prophylactically reducing PKK expression in an abdominal function in the animal. individual. Certain embodiments include treating an indi 0348. In certain embodiments, such phenotypic changes vidual in need thereof by administering to an individual a include those associated with a thromboembolic disease, therapeutically effective amount of an antisense compound Such as, prolonged aPTT, prolonged aPTT time in conjunc targeted to a PKK nucleic acid. tion with a normal PT, decreased quantity of Platelet Factor 0354. In one embodiment, administration of a therapeu 4 (PF-4), and reduced formation of thrombus or increased tically effective amount of an antisense compound targeted time for thrombus formation. to a PKK nucleic acid is accompanied by monitoring of PKK 0349 Testing may be performed in normal animals, or in levels in the serum of an individual, to determine an indi experimental disease models. For administration to animals, antisense oligonucleotides are formulated in a pharmaceu viduals response to administration of the antisense com tically acceptable diluent, such as phosphate-buffered saline. pound. An individual’s response to administration of the Administration includes parenteral routes of administration, antisense compound is used by a physician to determine the Such as intraperitoneal, intravenous, and Subcutaneous. Cal amount and duration of therapeutic intervention. culation of antisense oligonucleotide dosage and dosing 0355. In certain embodiments, administration of an anti frequency is within the abilities of those skilled in the art, sense compound targeted to a PKK nucleic acid results in and depends upon factors such as route of administration reduction of PKK expression by at least 15, 20, 25, 30, 35, and animal body weight. Following a period of treatment 40, 45, 50, 51, 52, 53, 54, 55, 56, 57, 58, 59, 60, 61, 62, 63, with antisense oligonucleotides, RNA is isolated from liver 64, 65, 66, 67,68, 69, 70, 71, 72, 73, 74, 75, 76, 77,78, 79, tissue and changes in PKK nucleic acid expression are 80, 81, 82, 83, 84, 85, 86, 87, 88, 89,90,91, 92,93, 94, 95, measured. 96.97, 98, or 99%, or a range defined by any two of these values. In certain embodiments, pharmaceutical composi Certain Indications tions comprising an antisense compound targeted to PKK 0350. In certain embodiments, the invention provides are used for the preparation of a medicament for treating a methods of treating an individual comprising administering patient Suffering or Susceptible to an inflammatory disease or one or more pharmaceutical compositions as described thromboembolic disease. herein. 0351. In certain embodiments, the individual has an Certain Compositions inflammatory disease. In certain embodiments, the indi vidual is at risk for developing an inflammatory condition, 1. ISIS 546254 including, but not limited to hereditary angioedema (HAE), 0356. In certain embodiments, ISIS 546254 is character edema, angioedema, Swelling, angioedema of the lids, ocu ized as a 5-10-5 MOE gapmer, having a sequence of (from lar edema, macular edema, and cerebral edema. This 5' to 3') TGCAAGTCTCTTGGCAAACA (incorporated includes individuals with an acquired problem, disease, or herein as SEQ ID NO: 570), wherein each internucleoside disorder that leads to a risk of inflammation, for example, linkage is a phosphorothioate linkage, each cytosine is a genetic predisposition to an inflammatory condition, envi 5'-methylcytosine, each of nucleosides 1-5 and 16-20 are ronmental factors, and exposure to certain medications, 2'-O-methoxyethyl modified nucleosides, and each of including, for example, ACE inhibitors and ARBs. In certain nucleosides 6-15 are 2'-deoxynucleosides. embodiments, the individual has been identified as in need 0357. In certain embodiments, ISIS 546254 is described of anti-inflammation therapy. Examples of Such individuals by the following chemical notation: Tes. Ges. mCes Aes Aes include, but are not limited to those having a mutation in the Gds Tods mCds Tods mCds Tods Tods Gds Gds mCds Aes Aes genetic code for complement 1 esterase inhibitor (i.e., Aes mCes Ae; wherein, C1-INH) or Factor 12. In certain embodiments, an abnormal code can lead to a deficiency in C1-INH (i.e., type I HAE), 0358 A=an adenine, an inability of existing C1-INH to function properly (type II 0359 mC—a 5'-methylcytosine HAE), or hyperfunctional Factor 12 (i.e., type III HAE). 0360 G=a guanine, 0352. In certain embodiments, the individual has a 0361 T=a thymine, thromboembolic disease. In certain embodiments, the indi 0362 e—a 2'-O-methoxyethyl modified nucleoside, vidual is at risk for a blood clotting disorder, including, but 0363 d=a 2'-deoxynucleoside, and not limited to, infarct, thrombosis, embolism, thromboem 0364 s—a phosphorothioate internucleoside linkage. bolism Such as deep vein thrombosis, pulmonary embolism, 0365. In certain embodiments, ISIS 546254 is described myocardial infarction, and stroke. This includes individuals by the following chemical structure: US 2017/0002359 A1 Jan. 5, 2017 27

{{OWOHO

US 2017/0002359 A1 Jan. 5, 2017 28

Structure 1. ISIS 546254 0369. In certain embodiments, as provided in Example 8 0366. In certain embodiments, as provided in Example 2 (hereinbelow), ISISI 546254 is effective for inhibiting PKK (hereinbelow), ISIS 546254 achieved 95% inhibition of mRNA and protein expression and is tolerable in primates. human PKK mRNA in cultured HepaRGTM cells (density of 20,000 cells per well) when transfected using electropora 2. ISIS 546343 tion with 5,000 nM antisense oligonucleotide after a treat 0370. In certain embodiments, ISIS 546343 is character ment period of 24 hours and measured by quantitative ized as a 5-10-5 MOE gapmer, having a sequence of (from real-time PCR using human primer probe set RTS3454 and 5' to 3') CCCCCTTCTTTATAGCCAGC (incorporated adjusted according to total RNA content, as measured by herein as SEQ ID NO: 705), wherein each internucleoside RIBOGREENCR). linkage is a phosphorothioate linkage, each cytosine is a 0367. In certain embodiments, as provided in Example 5 5'-methylcytosine, each of nucleosides 1-5 and 16-20 are (see Tables 34 and 41 hereinbelow), ISIS 546254 achieved 2'-O-methoxyethyl modified nucleosides, and each of an ICs of 0.2 uM and 0.3 uM in a 4 point dose response nucleosides 6-15 are 2'-deoxynucleosides. curve (0.19 uM, 0.56 uM, 1.67 uM, and 5.0 uM) in cultured 0371. In certain embodiments, ISIS 546343 is described HepaRGTM cells (density of 20,000 cells per well) when by the following chemical notation: mCes mGes mGes. mCes transfected using electroporation after a treatment period of mCes Tods Tods mCds Tods Tods Tods Ads Tods Ads Gds mCes 16 and measured by quantitative real-time PCR using human mCes Aes Ges. mCe; wherein, primer probe set RTS3454 and adjusted according to total 0372 A=an adenine, RNA content, as measured by RIBOGREENR). 0373 mC—a 5'-methylcytosine: 0368. In certain embodiments, as provided in Example 7 (hereinbelow), ISIS 546254 achieved 31%, 55%, 84%, and 0374 G-a guanine, 83% human PKK mRNA inhibition and 0%, 36%, 51%, and 0375. T=a thymine, 76% human PKK protein inhibition in transgenic mice 0376 e—a 2'-O-methoxyethyl modified nucleoside, harboring the human PKK gene sequence when injected 0377 d=a 2'-deoxynucleoside, and subcutaneously twice a week for 3 weeks with 2.5 mg/kg/ 0378 s—a phosphorothioate internucleoside linkage. week, 5.0 mg/kg/week, 10 mg/kg/week or 20 mg/kg/week 0379. In certain embodiments, ISIS 546343 is described with ISIS 546254. by the following chemical structure: US 2017/0002359 A1 Jan. 5, 2017 29

{{OWOHO

US 2017/0002359 A1 Jan. 5, 2017 30

Structure 2. ISIS 546343 3. ISIS 548048 0380. In certain embodiments, as provided in Example 2 0384. In certain embodiments, ISIS 548048 is character (see Tables 9 and 10 hereinbelow), ISIS 546343 achieved ized as a modified antisense oligonucleotide having the 97% and 91% human PKK mRNA inhibition in cultured nucleobase sequence (from 5' to 3') CGATATCATGAT HepaRGTM cells (density of 20,000 cells per well) when TCCC (incorporated herein as SEQ ID NO: 1666), consist transfected using electroporation with 5,000 nM antisense ing of a combination of sixteen 2'-deoxynucleosides. 2'-O- oligonucleotide after a treatment period of 24 hours and methoxyethyl modified nucleosides, and cEt modified measured by quantitative real-time PCR using human primer nucleosides, wherein each of nucleosides 1, 2, and 16 are probe set RTS3454 and adjusted according to total RNA 2'-O-methoxyethyl modified nucleosides, wherein each of content, as measured by RIBOGREENR). nucleosides 3, 14, and 15 are cFt modified nucleosides, 0381. In certain embodiments, as provided twice in wherein each of nucleosides 4-13 are 2'-deoxynucleosides, Example 5 (see Tables 34 and 41 hereinbelow), ISIS 546343 wherein each internucleoside linkage is a phosphorothioate achieved an ICso of 0.4LM in a 4 point dose response curve internucleoside linkage, and wherein each cytosine is a (0.19 uM, 0.56 uM, 1.67 uM, and 5.0 uM) in cultured 5'-methylcytosine. HepaRGTM cells (density of 20,000 cells per well) when transfected using electroporation after a treatment period of 0385. In certain embodiments, ISIS 548048 is described 16 and measured by quantitative real-time PCR using human by the following chemical notation: mGes Ges Aks Tods Ads primer probe set RTS3454 and adjusted according to total Tds mCds Ads Tods Gds Ads Tods Tods mCks mCks mCe: RNA content, as measured by RIBOGREENR). wherein, 0382. In certain embodiments, as provided in Example 7 0386 A=an adenine, (hereinbelow), ISIS 546343 achieved 46%. 66%, and 86% (0387 mC—a 5'-methylcytosine: human PKK mRNA inhibition and 0%, 38%, and 79% 0388 G-a guanine, human PKK protein inhibition in transgenic mice harboring (0389. T=a thymine, the human PKK gene sequence when injected Subcutane 0390 e—a 2'-O-methoxyethyl modified nucleoside, ously twice a week for 3 weeks with 2.5 mg/kg/week, 5.0 mg/kg/week, 10 mg/kg/week or 20 mg/kg/week with ISIS 0391 ka cBt modified nucleoside, 546343. 0392 d=a 2'-deoxynucleoside, and 0383. In certain embodiments, as provided in Example 8 0393 s—a phosphorothioate internucleoside linkage. (hereinbelow), ISISI 546343 is effective for inhibiting PKK 0394. In certain embodiments, ISIS 548048 is described mRNA and protein expression and is tolerable in primates. by the following chemical structure:

O NH Nso

O Nso

7 NH

O Nso

sixo NH2

isionO Nso

OHOMOE US 2017/0002359 A1 Jan. 5, 2017

Structure 3. ISIS 548048 0402. In certain embodiments, antisense oligonucleotides targeting nucleobases 27427-27466 of SEQ ID NO: 10 0395. In certain embodiments, as provided in Example 3 achieve at least 30%, at least 31%, at least 32%, at least 33%, (hereinbelow), ISIS 548048 achieved 84% mRNA inhibition at least 34%, at least 35%, at least 36%, at least 37%, at least in cultured HepaRGTM cells (density of 20,000 cells per 38%, at least 39%, at least 40%, at least 41%, at least 42%, well) when transfected using electroporation with 1,000 nM at least 43%, at least 44%, at least 45%, at least 46%, at least antisense oligonucleotide after a treatment period of 24 47%, at least 48%, at least 49%, at least 50%, at least 51%, hours and measured by quantitative real-time PCR using at least 52%, at least 53%, at least 54%, at least 55%, at least human primer probe set RTS3454 and adjusted according to 56%, at least 57%, at least 58%, at least 59%, at least 60%, total RNA content, as measured by RIBOGREENR). at least 61%, at least 62%, at least 63%, at least 64%, at least 0396. In certain embodiments, as provided in Example 6 65%, at least 66%, at least 67%, at least 68%, at least 69%, (hereinbelow), ISIS 548048 achieved an ICs of 0.1 uM in at least 70%, at least 71%, at least 72%, at least 73%, at least a 4 point dose response curve (0.11 uM, 0.33 uM, 1.00 uM, 74%, at least 75%, at least 76%, at least 77%, at least 78%, and 3.00 uM) in cultured HepaRGTM cells (density of 20,000 at least 79%, at least 80%, at least 81%, at least 82%, at least cells per well) when transfected using electroporation after 83%, at least 84%, at least 85%, at least 86%, at least 87%, a treatment period of 16 and measured by quantitative at least 88%, at least 89%, at least 90%, at least 91%, at least real-time PCR using human primer probe set RTS3454 and 92%, at least 93%, at least 94%, at least 95%, at least 96%, adjusted according to total RNA content, as measured by at least 97%, at least 98%, or at least 99% reduction of PKK RIBOGREENCR). and/or protein levels in vitro and/or in vivo. 0397. In certain embodiments, as provided in Example 7 (hereinbelow), ISIS 548048 achieved 7%, 77%, 72% and 2. Nucleobases 33183-33242 of SEQ ID NO: 10 80% human PKK mRNA inhibition and 23%, 70%, 89%, 0403. In certain embodiments, antisense oligonucleotides and 98% human PKK protein inhibition in transgenic mice are designed to target nucleobases 33 183-33242 of SEQ ID harboring the human PKK gene sequence when injected NO: 10 (GENBANK Accession No. NT 016354.19 trun subcutaneously twice a week for 3 weeks with 2.5 mg/kg/ cated from nucleobases 111693001 to Ser. No. 11/730,000). week, 5.0 mg/kg/week, 10 mg/kg/week or 20 mg/kg/week In certain embodiments, nucleobases 33 183-33242 of SEQ with ISIS 548048. ID NO: 10 are a hotspot region. In certain embodiments, 0398. In certain embodiments, as provided in Example 8 nucleobases 33183-33242 of SEQID NO: 10 are targeted by (hereinbelow), ISISI 548048 is effective for inhibiting PKK antisense oligonucleotides. In certain embodiments, the anti mRNA and protein expression and is tolerable in primates. sense oligonucleotides are 15, 16, 17, 18, 19, or 20 nucle obases in length. In certain embodiments, the antisense Certain Hotspot Regions oligonucleotides are gapmers. In certain embodiments, the gapmers are 5-10-5 MOE gapmers, 4-9-4 MOE gapmers, 1. Nucleobases 27427-27466 of SEQ ID NO: 10 4-10-4 MOE gapmers, 4-10-3 MOE gapmers, 3-10-4 MOE gapmers, or 3-10-3 MOE gapmers. In certain embodiments, 0399. In certain embodiments, antisense oligonucleotides the gapmers are 5-10-5 MOE and cEt gapmers, 4-9-4 MOE are designed to target nucleobases 27427-27466 of SEQ ID and cEt gapmers, 4-10-4 MOE and cEt gapmers, 4-10-3 NO: 10 (GENBANK Accession No. NT 016354.19 trun MOE and cEt gapmers, 3-10-4 MOE and cEt gapmers, or cated from nucleobases 111693.001 to Ser. No. 11/730,000). 3-10-3 MOE and cEt gapmers. In certain embodiments, the In certain embodiments, nucleobases 27427-27466 of SEQ nucleosides of the antisense oligonucleotides are linked by ID NO: 10 are a hotspot region. In certain embodiments, phosphorothioate internucleoside linkages. nucleobases 27427-27466 of SEQID NO: 10 are targeted by 0404 In certain embodiments, nucleobases 33183-33242 antisense oligonucleotides. In certain embodiments, the anti of SEQ ID NO: 10 are targeted by the following ISIS sense oligonucleotides are 15, 16, 17, 18, 19, or 20 nucle numbers: 531052, 531053, 531054, 531055, 531056, obases in length. In certain embodiments, the antisense 531057,531158,546343,546345,547480,547481,547482, oligonucleotides are gapmers. In certain embodiments, the and 547483. gapmers are 5-10-5 MOE gapmers, 4-9-4 MOE gapmers, 0405. In certain embodiments, nucleobases 33 183-33242 4-10-4 MOE gapmers, 4-10-3 MOE gapmers, 3-10-4 MOE of SEQ ID NO: 10 are targeted by the following SEQ ID gapmers, or 3-10-3 MOE gapmers. In certain embodiments, NOs: 155, 156, 157, 158, 159, 160,261, 702, 703,704, 705, the gapmers are 5-10-5 MOE and cEt gapmers, 4-9-4 MOE 706, and 707. and cEt gapmers, 4-10-4 MOE and cEt gapmers, 4-10-3 0406. In certain embodiments, antisense oligonucleotides MOE and cEt gapmers, 3-10-4 MOE and cEt gapmers, or targeting nucleobases 33183-33242 of SEQ ID NO: 10 3-10-3 MOE and cEt gapmers. In certain embodiments, the achieve at least 30%, at least 31%, at least 32%, at least 33%, nucleosides of the antisense oligonucleotides are linked by at least 34%, at least 35%, at least 36%, at least 37%, at least phosphorothioate internucleoside linkages. 38%, at least 39%, at least 40%, at least 41%, at least 42%, 0400. In certain embodiments, nucleobases 27427-274.66 at least 43%, at least 44%, at least 45%, at least 46%, at least of SEQ ID NO: 10 are targeted by the following ISIS 47%, at least 48%, at least 49%, at least 50%, at least 51%, numbers: 530993, 530994, 530995, 546251, 546252, at least 52%, at least 53%, at least 54%, at least 55%, at least 546253, 546254,546255,546256, 547410,5474 11,547978, 56%, at least 57%, at least 58%, at least 59%, at least 60%, 547979, 547980, and 547981. at least 61%, at least 62%, at least 63%, at least 64%, at least 04.01. In certain embodiments, nucleobases 27427-274.66 65%, at least 66%, at least 67%, at least 68%, at least 69%, of SEQ ID NO: 10 are targeted by the following SEQ ID at least 70%, at least 71%, at least 72%, at least 73%, at least NOs: 94, 95, 96, 566, 567, 568, 569, 570, 571, 572, 573, 74%, at least 75%, at least 76%, at least 77%, at least 78%, 1597, 1598, 1599, and 1600. at least 79%, at least 80%, at least 81%, at least 82%, at least US 2017/0002359 A1 Jan. 5, 2017 32

83%, at least 84%, at least 85%, at least 86%, at least 87%, nucleobases 27427-27520 of SEQID NO: 10 are targeted by at least 88%, at least 89%, at least 90%, at least 91%, at least antisense oligonucleotides. In certain embodiments, the anti 92%, at least 93%, at least 94%, at least 95%, at least 96%, sense oligonucleotides are 15, 16, 17, 18, 19, or 20 nucle at least 97%, at least 98%, or at least 99% reduction of PKK obases in length. In certain embodiments, the antisense mRNA and/or protein levels in vitro and/or in vivo. oligonucleotides are gapmers. In certain embodiments, the gapmers are 5-10-5 MOE gapmers, 4-9-4 MOE gapmers, 3. Nucleobases 30570-30610 of SEQ ID NO: 10 4-10-4 MOE gapmers, 4-10-3 MOE gapmers, 3-10-4 MOE gapmers, or 3-10-3 MOE gapmers. In certain embodiments, 0407. In certain embodiments, antisense oligonucleotides the gapmers are 5-10-5 MOE and cEt gapmers, 4-9-4 MOE are designed to target nucleobases 30570-30610 of SEQ ID and cEt gapmers, 4-10-4 MOE and cEt gapmers, 4-10-3 NO: 10 (GENBANK Accession No. NT 016354.19 trun MOE and cEt gapmers, 3-10-4 MOE and cEt gapmers, or cated from nucleobases 111693.001 to Ser. No. 11/730,000). 3-10-3 MOE and cEt gapmers. In certain embodiments, the In certain embodiments, nucleobases 30570-30610 of SEQ nucleosides of the antisense oligonucleotides are linked by ID NO: 10 are a hotspot region. In certain embodiments, phosphorothioate internucleoside linkages. nucleobases 30570-30610 of SEQID NO: 10 are targeted by antisense oligonucleotides. In certain embodiments, the anti 0412. In certain embodiments, nucleobases 27427-27520 sense oligonucleotides are 15, 16, 17, 18, 19, or 20 nucle of SEQ ID NO: 10 are targeted by the following ISIS obases in length. In certain embodiments, the antisense numbers: 530993-530999, 546251-546256, 546258 oligonucleotides are gapmers. In certain embodiments, the 546260, 546263, 546265-546268, 5474 10-547417, and gapmers are 5-10-5 MOE gapmers, 4-9-4 MOE gapmers, 547978-547992. 4-10-4 MOE gapmers, 4-10-3 MOE gapmers, 3-10-4 MOE 0413. In certain embodiments, nucleobases 27427-27520 gapmers, or 3-10-3 MOE gapmers. In certain embodiments, of SEQ ID NO: 10 are targeted by the following SEQ ID the gapmers are 5-10-5 MOE and cEt gapmers, 4-9-4 MOE NOs: 94-100, 566-587, and 1597-1611. and cEt gapmers, 4-10-4 MOE and cEt gapmers, 4-10-3 0414. In certain embodiments, antisense oligonucleotides MOE and cEt gapmers, 3-10-4 MOE and cEt gapmers, or targeting nucleobases 27427-27520 of SEQ ID NO: 10 3-10-3 MOE and cEt gapmers. In certain embodiments, the achieve at least 30%, at least 31%, at least 32%, at least 33%, nucleosides of the antisense oligonucleotides are linked by at least 34%, at least 35%, at least 36%, at least 37%, at least phosphorothioate internucleoside linkages. 38%, at least 39%, at least 40%, at least 41%, at least 42%, 0408. In certain embodiments, nucleobases 30570-30610 at least 43%, at least 44%, at least 45%, at least 46%, at least of SEQ ID NO: 10 are targeted by the following ISIS 47%, at least 48%, at least 49%, at least 50%, at least 51%, numbers: 531026, 546309, 546310, 546311, 546313, at least 52%, at least 53%, at least 54%, at least 55%, at least 547453, 547454,547455,547456,547457, 547458,548046, 56%, at least 57%, at least 58%, at least 59%, at least 60%, 548047, 548048, 548049, and 548050. at least 61%, at least 62%, at least 63%, at least 64%, at least 04.09. In certain embodiments, nucleobases 30570-30610 65%, at least 66%, at least 67%, at least 68%, at least 69%, of SEQ ID NO: 10 are targeted by the following SEQ ID at least 70%, at least 71%, at least 72%, at least 73%, at least NOs: 129, 652, 653, 654, 655, 656, 657, 658, 659, 660, 661, 74%, at least 75%, at least 76%, at least 77%, at least 78%, 1664, 1665, 1666, 1667, and 1668. at least 79%, at least 80%, at least 81%, at least 82%, at least 0410. In certain embodiments, antisense oligonucleotides 83%, at least 84%, at least 85%, at least 86%, at least 87%, targeting nucleobases 30570-30610 of SEQ ID NO: 10 at least 88%, at least 89%, at least 90%, at least 91%, at least achieve at least 30%, at least 31%, at least 32%, at least 33%, 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 34%, at least 35%, at least 36%, at least 37%, at least at least 97%, at least 98%, or at least 99% reduction of PKK 38%, at least 39%, at least 40%, at least 41%, at least 42%, and/or protein levels in vitro and/or in vivo. at least 43%, at least 44%, at least 45%, at least 46%, at least 47%, at least 48%, at least 49%, at least 50%, at least 51%, 5. Nucleobases 33085-33247 of SEQ ID NO: 10 at least 52%, at least 53%, at least 54%, at least 55%, at least 56%, at least 57%, at least 58%, at least 59%, at least 60%, 0415. In certain embodiments, antisense oligonucleotides at least 61%, at least 62%, at least 63%, at least 64%, at least are designed to target nucleobases 33085-33247 of SEQ ID 65%, at least 66%, at least 67%, at least 68%, at least 69%, NO: 10 (GENBANK Accession No. NT 016354.19 trun at least 70%, at least 71%, at least 72%, at least 73%, at least cated from nucleobases 111693001 to Ser. No. 11/730,000). 74%, at least 75%, at least 76%, at least 77%, at least 78%, In certain embodiments, nucleobases 33085-33247 of SEQ at least 79%, at least 80%, at least 81%, at least 82%, at least ID NO: 10 are a hotspot region. In certain embodiments, 83%, at least 84%, at least 85%, at least 86%, at least 87%, nucleobases 33085-33247 of SEQID NO: 10 are targeted by at least 88%, at least 89%, at least 90%, at least 91%, at least antisense oligonucleotides. In certain embodiments, the anti 92%, at least 93%, at least 94%, at least 95%, at least 96%, sense oligonucleotides are 15, 16, 17, 18, 19, or 20 nucle at least 97%, at least 98%, or at least 99% reduction of PKK obases in length. In certain embodiments, the antisense mRNA and/or protein levels in vitro and/or in vivo. oligonucleotides are gapmers. In certain embodiments, the gapmers are 5-10-5 MOE gapmers, 4-9-4 MOE gapmers, 4-10-4 MOE gapmers, 4-10-3 MOE gapmers, 3-10-4 MOE 4. Nucleobases 27427-27520 of SEQ ID NO: 10 gapmers, or 3-10-3 MOE gapmers. In certain embodiments, 0411. In certain embodiments, antisense oligonucleotides the gapmers are 5-10-5 MOE and cEt gapmers, 4-9-4 MOE are designed to target nucleobases 27427-27520 of SEQ ID and cEt gapmers, 4-10-4 MOE and cEt gapmers, 4-10-3 NO: 10 (GENBANK Accession No. NT 016354.19 trun MOE and cEt gapmers, 3-10-4 MOE and cEt gapmers, or cated from nucleobases 111693.001 to Ser. No. 11/730,000). 3-10-3 MOE and cEt gapmers. In certain embodiments, the In certain embodiments, nucleobases 27427-27520 of SEQ nucleosides of the antisense oligonucleotides are linked by ID NO: 10 are a hotspot region. In certain embodiments, phosphorothioate internucleoside linkages. US 2017/0002359 A1 Jan. 5, 2017

0416. In certain embodiments, nucleobases 33085-33247 47%, at least 48%, at least 49%, at least 50%, at least 51%, of SEQ ID NO: 10 are targeted by the following ISIS at least 52%, at least 53%, at least 54%, at least 55%, at least numbers: 531041-531158, 546336, 546339, 546340, 56%, at least 57%, at least 58%, at least 59%, at least 60%, 546343, 546345, 547474-547483,547778,548077-548082, at least 61%, at least 62%, at least 63%, at least 64%, at least and 548677-548678. 65%, at least 66%, at least 67%, at least 68%, at least 69%, 0417. In certain embodiments, nucleobases 33085-33247 at least 70%, at least 71%, at least 72%, at least 73%, at least of SEQ ID NO: 10 are targeted by the following SEQ ID 74%, at least 75%, at least 76%, at least 77%, at least 78%, NOs: 144-160, 261, 693-707, 1256, 1320-1325, 2214, and at least 79%, at least 80%, at least 81%, at least 82%, at least 2215. 83%, at least 84%, at least 85%, at least 86%, at least 87%, 0418. In certain embodiments, antisense oligonucleotides at least 88%, at least 89%, at least 90%, at least 91%, at least targeting nucleobases 33085-33247 of SEQ ID NO: 10 92%, at least 93%, at least 94%, at least 95%, at least 96%, achieve at least 30%, at least 31%, at least 32%, at least 33%, at least 97%, at least 98%, or at least 99% reduction of PKK at least 34%, at least 35%, at least 36%, at least 37%, at least and/or protein levels in vitro and/or in vivo. 38%, at least 39%, at least 40%, at least 41%, at least 42%, at least 43%, at least 44%, at least 45%, at least 46%, at least 7. Nucleobases 27362-27524 of SEQ ID NO: 10 47%, at least 48%, at least 49%, at least 50%, at least 51%, 0423. In certain embodiments, antisense oligonucleotides at least 52%, at least 53%, at least 54%, at least 55%, at least are designed to target nucleobases 27362-27524 of SEQ ID 56%, at least 57%, at least 58%, at least 59%, at least 60%, NO: 10 (GENBANK Accession No. NT 016354.19 trun at least 61%, at least 62%, at least 63%, at least 64%, at least cated from nucleobases 111693001 to Ser. No. 11/730,000). 65%, at least 66%, at least 67%, at least 68%, at least 69%, In certain embodiments, nucleobases 27362-27524 corre at least 70%, at least 71%, at least 72%, at least 73%, at least spond to exon 9 of PKK (GENBANK Accession No. 74%, at least 75%, at least 76%, at least 77%, at least 78%, NT 016354.19 truncated from nucleobases 111693.001 to at least 79%, at least 80%, at least 81%, at least 82%, at least Ser. No. 11/730,000). In certain embodiments, nucleobases 83%, at least 84%, at least 85%, at least 86%, at least 87%, 27362-27524 of SEQ ID NO: 10 are a hotspot region. In at least 88%, at least 89%, at least 90%, at least 91%, at least certain embodiments, nucleobases 27362-27524 of SEQ ID 92%, at least 93%, at least 94%, at least 95%, at least 96%, NO: 10 are targeted by antisense oligonucleotides. In certain at least 97%, at least 98%, or at least 99% reduction of PKK embodiments, the antisense oligonucleotides are 15, 16, 17. and/or protein levels in vitro and/or in vivo. 18, 19, or 20 nucleobases in length. In certain embodiments, the antisense oligonucleotides are gapmers. In certain 6. Nucleobases 30475-30639 of SEQ ID NO: 10 embodiments, the gapmers are 5-10-5 MOE gapmers, 4-9-4 0419. In certain embodiments, antisense oligonucleotides MOE gapmers, 4-10-4 MOE gapmers, 4-10-3 MOE gap are designed to target nucleobases 30475-30639 of SEQ ID mers, 3-10-4 MOE gapmers, or 3-10-3 MOE gapmers. In NO: 10 (GENBANK Accession No. NT 016354.19 trun certain embodiments, the gapmers are 5-10-5 MOE and cEt cated from nucleobases 111693.001 to Ser. No. 11/730,000). gapmers, 4-9-4 MOE and cEtgapmers, 4-10-4 MOE and cEt In certain embodiments, nucleobases 30475-30639 of SEQ gapmers, 4-10-3 MOE and cEt gapmers, 3-10-4 MOE and ID NO: 10 are a hotspot region. In certain embodiments, cEt gapmers, or 3-10-3 MOE and cEt gapmers. In certain nucleobases 30475-30639 of SEQID NO: 10 are targeted by embodiments, the nucleosides of the antisense oligonucle antisense oligonucleotides. In certain embodiments, the anti otides are linked by phosphorothioate internucleoside link sense oligonucleotides are 15, 16, 17, 18, 19, or 20 nucle ageS. obases in length. In certain embodiments, the antisense 0424. In certain embodiments, nucleobases 27361-27524 oligonucleotides are gapmers. In certain embodiments, the of SEQ ID NO: 10 are targeted by the following ISIS gapmers are 5-10-5 MOE gapmers, 4-9-4 MOE gapmers, numbers: 530985-530999, 546244, 54.6247-546256, 4-10-4 MOE gapmers, 4-10-3 MOE gapmers, 3-10-4 MOE 546258-546260,546263,546265-546268,547403-547417, gapmers, or 3-10-3 MOE gapmers. In certain embodiments, 547723, 547968-547970, and 547972-547992. the gapmers are 5-10-5 MOE and cEt gapmers, 4-9-4 MOE 0425. In certain embodiments, nucleobases 27361-27524 and cEt gapmers, 4-10-4 MOE and cEt gapmers, 4-10-3 of SEQ ID NO: 10 are targeted by the following SEQ ID MOE and cEt gapmers, 3-10-4 MOE and cEt gapmers, or NOs: 86-100, 554-587, 1217, and 1588-1611. 3-10-3 MOE and cEt gapmers. In certain embodiments, the 0426 In certain embodiments, antisense oligonucleotides nucleosides of the antisense oligonucleotides are linked by targeting nucleobases 27362-27524 of SEQ ID NO: 10 phosphorothioate internucleoside linkages. achieve at least 30%, at least 31%, at least 32%, at least 33%, 0420. In certain embodiments, nucleobases 30475-30639 at least 34%, at least 35%, at least 36%, at least 37%, at least of SEQ ID NO: 10 are targeted by the following ISIS 38%, at least 39%, at least 40%, at least 41%, at least 42%, numbers: 531021-531029, 531146, 546297, 546299 at least 43%, at least 44%, at least 45%, at least 46%, at least 546304,546306-546311, 546313, 54.631.6-546319, 547444 47%, at least 48%, at least 49%, at least 50%, at least 51%, 547462, 548031, 548032, and 548034–548056. at least 52%, at least 53%, at least 54%, at least 55%, at least 0421. In certain embodiments, nucleobases 30475-30639 56%, at least 57%, at least 58%, at least 59%, at least 60%, of SEQ ID NO: 10 are targeted by the following SEQ ID at least 61%, at least 62%, at least 63%, at least 64%, at least NOs: 124-132, 249, 633-669, and 1650-1674. 65%, at least 66%, at least 67%, at least 68%, at least 69%, 0422. In certain embodiments, antisense oligonucleotides at least 70%, at least 71%, at least 72%, at least 73%, at least targeting nucleobases 30475-30639 of SEQ ID NO: 10 74%, at least 75%, at least 76%, at least 77%, at least 78%, achieve at least 30%, at least 31%, at least 32%, at least 33%, at least 79%, at least 80%, at least 81%, at least 82%, at least at least 34%, at least 35%, at least 36%, at least 37%, at least 83%, at least 84%, at least 85%, at least 86%, at least 87%, 38%, at least 39%, at least 40%, at least 41%, at least 42%, at least 88%, at least 89%, at least 90%, at least 91%, at least at least 43%, at least 44%, at least 45%, at least 46%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, US 2017/0002359 A1 Jan. 5, 2017 34 at least 97%, at least 98%, or at least 99% reduction of PKK NT 016354.19 truncated from nucleobases 111693.001 to and/or protein levels in vitro and/or in vivo. Ser. No. 11/730,000). In certain embodiments, nucleobases 30463-30638 of SEQ ID NO: 10 are a hotspot region. In 8. Nucleobases 33101-33240 of SEQ ID NO: 10 certain embodiments, nucleobases 30463-30638 of SEQ ID NO: 10 are targeted by antisense oligonucleotides. In certain 0427. In certain embodiments, antisense oligonucleotides embodiments, the antisense oligonucleotides are 15, 16, 17. are designed to target nucleobases 33101-33240 of SEQ ID 18, 19, or 20 nucleobases in length. In certain embodiments, NO: 10 (GENBANK Accession No. NT 016354.19 trun the antisense oligonucleotides are gapmers. In certain cated from nucleobases 111693.001 to Ser. No. 11/730,000). embodiments, the gapmers are 5-10-5 MOE gapmers, 4-9-4 In certain embodiments, nucleobases 33101-33240 corre MOE gapmers, 4-10-4 MOE gapmers, 4-10-3 MOE gap spond to exon 14 of PKK (GENBANK Accession No. mers, 3-10-4 MOE gapmers, or 3-10-3 MOE gapmers. In NT 016354.19 truncated from nucleobases 111693.001 to certain embodiments, the gapmers are 5-10-5 MOE and cEt Ser. No. 11/730,000). In certain embodiments, nucleobases gapmers, 4-9-4 MOE and cEtgapmers, 4-10-4 MOE and cEt 33101-33240 of SEQ ID NO: 10 are a hotspot region. In gapmers, 4-10-3 MOE and cEt gapmers, 3-10-4 MOE and certain embodiments, nucleobases 33101-33240 of SEQ ID cEt gapmers, or 3-10-3 MOE and cEt gapmers. In certain NO: 10 are targeted by antisense oligonucleotides. In certain embodiments, the nucleosides of the antisense oligonucle embodiments, the antisense oligonucleotides are 15, 16, 17. otides are linked by phosphorothioate internucleoside link 18, 19, or 20 nucleobases in length. In certain embodiments, ageS. the antisense oligonucleotides are gapmers. In certain 0432. In certain embodiments, nucleobases 30463-30638 embodiments, the gapmers are 5-10-5 MOE gapmers, 4-9-4 of SEQ ID NO: 10 are targeted by the following ISIS MOE gapmers, 4-10-4 MOE gapmers, 4-10-3 MOE gap numbers: 531021-531029, 531146, 546297, 546299 mers, 3-10-4 MOE gapmers, or 3-10-3 MOE gapmers. In 546304,546306-546311, 546313, 54.631.6-546319, 547444 certain embodiments, the gapmers are 5-10-5 MOE and cEt 547462, 548031, 548032, and 548034–548056. gapmers, 4-9-4 MOE and cEtgapmers, 4-10-4 MOE and cEt 0433. In certain embodiments, nucleobases 30463-30638 gapmers, 4-10-3 MOE and cEt gapmers, 3-10-4 MOE and of SEQ ID NO: 10 are targeted by the following SEQ ID cEt gapmers, or 3-10-3 MOE and cEt gapmers. In certain NOs: 124-132, 249, 633-669, and 1650-1674. embodiments, the nucleosides of the antisense oligonucle 0434 In certain embodiments, antisense oligonucleotides otides are linked by phosphorothioate internucleoside link targeting nucleobases 30463-30638 of SEQ ID NO: 10 ageS. achieve at least 30%, at least 31%, at least 32%, at least 33%, 0428. In certain embodiments, nucleobases 33101-33240 at least 34%, at least 35%, at least 36%, at least 37%, at least of SEQ ID NO: 10 are targeted by the following ISIS 38%, at least 39%, at least 40%, at least 41%, at least 42%, numbers: 531041-531158, 546336, 546339, 546340, at least 43%, at least 44%, at least 45%, at least 46%, at least 546343, 546345, 547474-547483, 548077-548082, and 47%, at least 48%, at least 49%, at least 50%, at least 51%, 548678-548678. at least 52%, at least 53%, at least 54%, at least 55%, at least 0429. In certain embodiments, nucleobases 33101-33240 56%, at least 57%, at least 58%, at least 59%, at least 60%, of SEQ ID NO: 10 are targeted by the following SEQ ID at least 61%, at least 62%, at least 63%, at least 64%, at least NOs: 144-160, 261, 693-707, 1320-1325, and 2215. 65%, at least 66%, at least 67%, at least 68%, at least 69%, 0430. In certain embodiments, antisense oligonucleotides at least 70%, at least 71%, at least 72%, at least 73%, at least targeting nucleobases 33101-33240 of SEQ ID NO: 10 74%, at least 75%, at least 76%, at least 77%, at least 78%, achieve at least 30%, at least 31%, at least 32%, at least 33%, at least 79%, at least 80%, at least 81%, at least 82%, at least at least 34%, at least 35%, at least 36%, at least 37%, at least 83%, at least 84%, at least 85%, at least 86%, at least 87%, 38%, at least 39%, at least 40%, at least 41%, at least 42%, at least 88%, at least 89%, at least 90%, at least 91%, at least at least 43%, at least 44%, at least 45%, at least 46%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, 47%, at least 48%, at least 49%, at least 50%, at least 51%, at least 97%, at least 98%, or at least 99% reduction of PKK at least 52%, at least 53%, at least 54%, at least 55%, at least and/or protein levels in vitro and/or in vivo. 56%, at least 57%, at least 58%, at least 59%, at least 60%, at least 61%, at least 62%, at least 63%, at least 64%, at least EXAMPLES 65%, at least 66%, at least 67%, at least 68%, at least 69%, at least 70%, at least 71%, at least 72%, at least 73%, at least Non-Limiting Disclosure and Incorporation by 74%, at least 75%, at least 76%, at least 77%, at least 78%, Reference at least 79%, at least 80%, at least 81%, at least 82%, at least 0435 While certain compounds, compositions and meth 83%, at least 84%, at least 85%, at least 86%, at least 87%, ods described herein have been described with specificity in at least 88%, at least 89%, at least 90%, at least 91%, at least accordance with certain embodiments, the following 92%, at least 93%, at least 94%, at least 95%, at least 96%, examples serve only to illustrate the compounds described at least 97%, at least 98%, or at least 99% reduction of PKK herein and are not intended to limit the same. Each of the and/or protein levels in vitro and/or in vivo. references recited in the present application is incorporated herein by reference in its entirety. 9. Nucleobases 30463-30638 of SEQ ID NO: 10 Example 1 0431. In certain embodiments, antisense oligonucleotides are designed to target nucleobases 30463-30638 of SEQ ID Antisense Inhibition of Human PKK in NO: 10 (GENBANK Accession No. NT 016354.19 trun HepaRGTM Cells by Antisense Oligonucleotides cated from nucleobases 111693.001 to Ser. No. 11/730,000). with 2'-MOE Sugar Modifications In certain embodiments, nucleobases 30463-30638 corre 0436 Antisense oligonucleotides were designed target spond to exon 12 of PKK (GENBANK Accession No. ing a PKK nucleic acid and were tested for their effects on US 2017/0002359 A1 Jan. 5, 2017 35

PKK mRNA in vitro. HepaRGTM cells, which are terminally 3) or the human PKK genomic sequence, designated herein differentiated hepatic cells derived from a human hepatic as SEQID NO: 10 (GENBANKAccession No. NT 016354. progenitor cell line and retain many characteristics of pri 19 truncated from nucleotides 111693.001 to Ser. No. mary human hepatocytes (Lubberstedt M. et al., J. Pharma 11/730,000). n/a indicates that the antisense oligonucle col. Toxicol. Methods 2011 63: 59-68), were used in the otide does not target that particular gene sequence. SCC. 0438 Cultured HepaRGTM cells at a density of 20,000 0437. The chimeric antisense oligonucleotides in the cells per well were transfected using electroporation with tables below were designed as 5-10-5 MOE gapmers. The 3,000 nMantisense oligonucleotide. After a treatment period gapmers are 20 nucleosides in length, wherein the central of approximately 24 hours, RNA was isolated from the cells gap segment comprises of ten 2'-deoxynucleosides and is and PKK mRNA levels were measured by quantitative flanked by wing segments on the 5' direction and the 3' real-time PCR. Human primer probe set RTS3454 (forward direction comprising five nucleosides each. Each nucleoside sequence CCAAAAAAGGTGCACCAGTAACA, desig in the 5' wing segment and each nucleoside in the 3' wing nated herein as SEQ ID NO. 20; reverse sequence CCTC segment has a 2'-O-methoxyethyl modification. The inter CGGGACTGTACTTTAATAGG, designated herein as SEQ nucleoside linkages throughout each gapmer are phospho ID NO: 21; probe sequence CACGCAAACATTTCA rothioate linkages. All cytosine residues throughout each CAAGGCAGAGTACC, designated herein as SEQ ID NO: gapmer are 5-methylcytosines. “Start site' indicates the 22) was used to measure mRNA levels. PKK mRNA levels 5'-most nucleoside to which the gapmer is targeted in the were adjusted according to total RNA content, as measured human gene sequence. "Stop site' indicates the 3'-most by RIBOGREENR). The antisense oligonucleotides were nucleoside to which the gapmer is targeted in the human tested in a series of experiments that had similar culture gene sequence. Each gapmer listed in the tables below is conditions. The results for each experiment are presented in targeted to either the human PKK mRNA, designated herein separate tables shown below. Results are presented as per as SEQID NO: 1 (GENBANK Accession No. NM 000892. cent inhibition of PKK, relative to untreated control cells. TABLE 1.

SEQ SEQ ID ID SEQ ID SEQ ID NO : 1 NO: 1 NO: 10 NO: 10 SEQ Start Stop 3. Start Stop ID ISIS NO Site Site Sequence inhibition Site Site NO

53 O929 1. 2O AACGGTCTTCAAGCTGTTCT 59 33.93 3412 3O

53 O930 6 25 AAATGAACGGTCTTCAAGCT 17 3398 34.17 31

530931 11 3O CTTAAAAATGAACGGTCTTC 29 34 O3 3422 32

53 O932 16 35 TGTCACTTAAAAATGAACGG 52 34 08 3427 33

53 O933 31 SO TGGAGGTGAGTCTCTTGTCA 76 3423 3442 34

53 O934 36 55 CTTCTTGGAGGTGAGTCTCT 54 3428 3.447 35

53 O935 68 87 GCTTGAATAAAATCATTCTG O n/a n/a 36

53 O936 73 92 TGCTTGCTTGAATAAAATCA 27 4. Of 2 4O91 37

53 O937 78 97 TAAGTTGCTTGCTTGAATAA O 4O77 4096 38

53 O938 88 O7 GGAAATGAAATAAGTTGCTT 11 4 O87 4106 39

53 O939 93 12 AACAAGGAAATGAAATAAGT O 4 O92 4111 4 O

53 094 O 98 17 TAGCAAACAAGGAAATGAAA 7 4 O97 41.16 41

53 0941 O3 22 AACTGTAGCAAACAAGGAAA 22 4102 4121 42

53 0942 O8 27 CAGGAAACTGTAGCAAACAA 22 41. Of 4126 43

53 O943 13 32 ATCCACAGGAAACTGTAGCA 56 n/a n/a 44

53 0944 18 37 CAGACATCCACAGGAAACTG O n/a n/a 45

53 0945 f 76 ATCCCCACCTCTGAAGAAGG O 8O29 8048 46

53 0946 6 O 79 TACATCCCCACCTCTGAAGA O 8O32 8051 47

53 0947 65 84 GAAGCTACATCCCCACCTCT 27 8O37 8056 48

53 0948 70 89 ACATGGAAGCTACATCCCCA 35 8042 8061 49

53 O949 7s 94 GGTGTACATGGAAGCTACAT 31 8047 806.6 SO

US 2017/0002359 A1 Jan. 5, 2017 37

TABLE 1 - continued

SEQ SEQ ID ID SEO ID SEQ ID NO: 1 NO: 1 NO: 1.O NO: 10 SEQ s Start Stop o Start Stop ID ISIS NO Site Site Sequence inhibition Site Site NO

53 O985 941 96.O AAATTTTAGAATGGCAGGGT 32 27363. 27382 86

53 O986 946 965 CGGGTAAATTTTAGAATGGC 62 27368 273.87 87

53 O987 951 97 O ACTCCCGGGTAAATTTTAGA 2737 3 27392 88

53 O988 961 980 TCCAAAGTCAACTCCCGGGT 76 27383 274 O2 89

53 O989 966 98s TCTCCTCCAAAGTCAACTCC 28 27388 274. Of 9 O

53 O990 971. 99 O ATTCTTCTCCTCCAAAGTCA 32 273.93 27412 91

53 O991 976 995 ATTCAATTCTTCTCCTCCAA 43 27398 274.17 92

53 O992 981 OOO GTCACATTCAATTCTTCTCC 70 274 O3 27422 93

53 O993 OOS O24 CAAACATTCACTCCTTTAAC 3 O 27.427 2 74.46 94

53 O994 O29 CTTGGCAAACATTCACTCCT SO 27432 2.745.1 95

53 O995 O15 O34 AGTCTCTTGGCAAACATTCA 49 27437 2 74.56 96

53 O996 O38 Of TGACAGCGAATCATCTTTGT 51 274 6 O 274.79 97

53 O997 O62 AAAACTGACAGCGAATCATC 39 274 65 2.f484 98

53 O998 O67 AGTGAAAAACTGACAGCGAA 27470 27489 99

53 O999 O9 O CAGTCTTCTGGGAGTAAAGA 31 27493 27512 OO

531 OOO O98 117 AAGAAACACTTACACTTCTC n/a n/a O1

531 OO1 108 127 AGATAATCTTAAGAAACACT 44 27629 27648 O2

531 OO2 155 174 GAGCTCCCTTGTGTCCCATA 85 27676. 27695 O3

531 OO3 16 O 179 AACCAGAGCTCCCTTGTGTC 49 27681. 277 OO O4

531 OO4 1.65 184 AGAGTAACCAGAGCTCCCTT 76 27686. 277 OS O5

531 OOS 17O 189 CTCAAAGAGTAACCAGAGCT 76 27691. 27710 O6

531 OO6 216 235 GCTTGTTTTTGTTGTGCAGA 49 27892 27911 O7

TABLE 2

SEQ SEQ ID ID SEQ ID SEQ ID NO: 1 NO: 1 NO : 1 O NO : 10 SEQ s ISIS Start Stop o Start Stop ID NO Site Site Sequence inhibition Site Site NO

48.2586 1608 1627 ACCCAACAGTTGGTATAAAT O 31914 31933 108

486.847 1563 1582 AGGCATATTGGTTTTTGGAA 78 31869 31888 109

531OOf 46 65 AACACAATTGCTTCTTGGAG 51 3438 3457 11O

531008 675 694 TGCTGGAAGATGTTCATGTG 51 26.123 26142 111

1239 1258 TTTGTTCCTCCAACAATGCG 65 2791.5 27934 112

531010 1244 1263 AAGAGTTTGTTCCTCCAACA 52 2792 O 27939 113

531011 1249 1268 CCAAGAAGAGTTTGTTCCTC 27925 27944 114

531O12 1254 1273 TCTCCCCAAGAAGAGTTTGT 48 2793 O 27949 115

US 2017/0002359 A1 Jan. 5, 2017 39

TABLE 2 - continued

SEQ SEQ ID ID SEQ ID SEQ ID NO: 1 NO: 1 NO: 1.O NO: 10 SEQ s I SIS Start Stop o Start Stop ID NO Site Site Sequence inhibition Site Site NO

53 724 743 TTATTTTATAATCTTGATAT 33 168 331.87 152

53 OSO 729 748 TTGGGTTATTTTATAATC TT 18 33173 33.192 153

53 734 73 ATCCGTTGGGTTATTTTATA 51 33178 33.197 154

53 739 78 AGACCATCCGTTGGGTTATT 6 O 33183 33202 155

53 744 763 AGCACAGACCATCCGTTGGG 49 33 188 332 Of 156

53 754 773 CTTTATAGCCAGCACAGACC 48 33 198 332.17 157

53 759 778 CCCTTCTTTATAGCCAGCAC 68 332O3 33222 158

53 764 783 TTTCCCCCTTCTTTATAGCC 45 332O8 332.27 159

53 Of 769 788 CATCTTTTCCCCCTTC TTTA 48 33213 33232 160

53 779 798 CCCTTACAAGCATCTTTTCC 6 O n/a n/a 61

53 n/a n/a ACATTCCATTGTGTTTGCAA 55 33919 33938 162

53 n/a n/a TGGTGATGCCCACCAAACGC 35 3394 O 33959 163

53 872 89 TGCTCCCTGCGGGCACAGCC 52 3397 33990 164

53 g77 896 CAGGTTGCTCCCTGCGGGCA 39 3.3976 33995. 165

53 O 63 882 90 GACACCAGGTTGCTCCCTGC 51 3398 34 OOO 166

53 887 906 GTGTAGACACCAGGTTGCTC 56 33986 34 OOS 167

53 892 91 CTTTGGTGTAGACACCAGGT f 3.399 34 O1O 168

53 897 916 AGCGACTTTGGTGTAGACAC 67 33996 34 O15 169

53 9 O2 92 TACTCAGCGACTTTGGTGTA 31 34 OO 34 O2O 170

53 9. Of 926 CCATGTACTCAGCGACTTTG 59 34 OO6 34 025 171

53 912 93 CCAGTCCATGTACT CAGCGA 56 34 O1 34 O3O 172

53 Of O 930 949 CTGTGTTTTCTCTAAAATCC 68 34 O29 34 O48 173

53 935 954 CTGCTCTGTGTTTTCTCTAA 73 34 O34 34 O53 174

53 2026 2O45 GCTCAGAATTTGACTTGAAC 64 34125. 34144 175

53 2O31 2 OSO CCCAGGCTCAGAATTTGACT 51 3413 O 34149 176

53 2O49 2O68 CTTTGCAGATGAGGACCCCC 67 34148 34167 177

53 Ofs 2O54 2O73 CCATGCTTTGCAGATGAGGA 64 34153 3 4172 178

53 2O59 2O78 ACTCTCCATGCTTTGCAGAT 68 341.58 34.177 179

53 2O64 2O83 ATGCCACTCTCCATGCTTTG 51 3.4163 34.182 18O

53 2111 213 O AGCAGCTCTGAGTGCACTGT 77 3.421 O 34229 181

53 2116 2135 TCCTCAGCAGCTCTGAGTGC 58 3.4215 34234 182

53 21.21 214 O CATTGTCCTCAGCAGCTCTG 55 3.422 O 34239 183

53 n/a n/a TGGTTTTTGGAATTCTGAAA 14 31861. 31880 184

53 n/a n/a ATATTGGTTTTTGGAATTCT 31 31865 31884 185 US 2017/0002359 A1 Jan. 5, 2017 40

TABL E 3

SEQ SEQ ID ID SEQ ID SEQ ID NO: 1 NO: 1 NO: 1.O NO: 10 SEQ s I SIS Start Stop o Start Stop ID NO Site Site Sequence inhibition Site Site NO 53 1083 n/a n/a TGTACTAGTTTCCTATAACT 6 O 14738 4757 186 14.809 4828 1488 O 4899 14939 4958 15071 SO90 15214 5233 15286 53. OS 15.345 5364 1477 5496 15549 5568 15 6O7 5626 15 679 56.98 15809 5828 15881 59 OO 15939 5958

53 n/a n/a ATAGGGACACAACCAAGGAA 25 16296 6315 1.87

53 n/a n/a AGGCACAGAGCCAGCACCCA 16495 6514 188

53 n/a n/a CCTGCCTCCTGGCAGCCTTC 48 16696 6715, 189

53 n/a n/a CCAGGTGTGGACAGCAGCTG 52 16821 684 O 190

53 n/a n/a GGTTTTGTTTGTAAAATTAG 27 1715.9 71.78 191

53 n/a n/a AAAACACCATTAAATCCATT 45 17306 7325 192

53 n/a n/a ACAGAAACCATGATGTTGCT 59 17644 7663. 193

53 n/a n/a TCAGCCCAATGTCCTAACCT 35 17793 78.12 194

53 n/a n/a CCTTCACTGACTCTCTTTTC 24 17922 7941 195

53 n/a n/a TTCTCCTGGCTCAGAAGCTC 6 O 18053 8072 196 233.15. 23334

53 n/a n/a GAATGTCAGGCCTCTGGGCC 48 18181. 82OO 197

53 n/a n/a CTAACAACCCCACAATATCA 1839 O. 84 O9 198

53 n/a n/a CCCAATTCTTAGTCCTTTAA 45 18523 85.42 1.99

53 n/a n/a ACCAAGCTCAGCCTCCAACT 41 18648 8667 2 OO

53 n/a n/a TTATTAGTCAAATCACCCAA 19 18773 8792 201

53 n/a n/a TGGATGGGTAGAGGCCTTTC 64 18898 8917 202

53 OO n/a n/a CCCCC. TCCCTTCCC TACACA 19023 9 O42 2O3

53 n/a n/a ATGTAAGTTACAAGCCACTA 37 1915.3 9172 204

53 O2 n/a n/a TGCCTCTTTAATAAAAACTC 42 19484 95 O3 205

53 n/a n/a ACT CATTGCCTTAACTCAGG 4 O 19636 96.55. 206

53 n/a n/a ACTTGACCTTACTGTTTTAG 19886 99 OS 2. Of

53 OS n/a n/a CTCCTCCCCAGGCTGCTCCT 16 22 O92 2211.1 2 O8

53 n/a n/a AAGATCTAGATAATTCTTGT 31 22332 22351 209

53 n/a n/a TCAACT CACACCTGACCTAA 3 O 22 457 224 f6 210

53 n/a n/a TGAACCCAAAACTCTGGCAC SO 22 771. 2279 O 211

53 n/a n/a AGCCCAAGGAACATCT CACC 52 22959 22978 212

53 1O n/a n/a GCCTGTTTGGTGGTCTCTTC 86 2311 O 23129 213 US 2017/0002359 A1 Jan. 5, 2017 41

TABLE 3 - continued

SEQ SEQ ID ID SEQ ID SEQ ID NO: 1 NO: 1 NO : 1 O NO : 10 SEQ s I S S Start Stop o Start Stop ID NO Site Site Sequence inhibition Site Site NO 53 n/a n/a CTTCTCCTGGCTCAGAAGCT 68 18054 18073 214 23.316 23335

53 n/a n/a ATGTATGATTCTAAGAACTT 14 234.79 23498 215

53 n/a n/a AACAGACACATTATTTATAT 23 604 23 623 216

53 n/a n/a AGAGTCAAGTCCACAGACAT 4 O 24246 24265 217

53 n/a n/a TCCTAAATAGGAACAAAGTA 2437.2 24391 218

53 n/a n/a TTGTTAAGGTTGTAGAGAGA 23 24 688 247 Of 219

53 n/a n/a ACCCAATTATTTTTAATGGC 62 24876 24895 22O

53 n/a n/a GCCTAAATGTAAGAGCTAAA 26 251.57 251.76 221

53 n/a n/a TAAACTCTTACATTTATAGA 25293 25.312 222

53 n/a n/a AAATAAAAGCACTCAGACTG 25418 25437 223

53 21 n/a n/a TTGGTCTACAGATTCAATGC 72 25550 25569 224

53 22 n/a n/a TAACAAAAATGCCTTGTGCC 33 2571. O 25.729 225

53 23 n/a n/a TCCCAGCTCCAGTCACCACC 74 25866 25.885 226

53 24 n/a n/a GTACTAAACATCCTAAGTGA 25992 26 O11 227

53 25 n/a n/a ACTCGCCTTTGTGACTCGAT 23 26.264 26.283 228

53 26 n/a n/a TTTTGAATCTTCATTCAAAG 26551 26570 229

53 27 n/a n/a CAGAGCCTTGATCAGAATAA 12 26 676 26.695 23 O

53 28 n/a n/a AAGTTCCACCTTCTAACTGG 18 26831 26850 231

53 29 n/a n/a AGCAGCTCACACCCAAAAAG 27 OOS 27024 232

53 n/a n/a TTCTGTGTCAATTATAAACA 27344 273.63 233

53 31 n/a n/a TAGAAAGAGTAAGCCTTCAC 27.87 276 O6 234

53 32 n/a n/a AGTGAGGTTACT CACCAGAG 27732 27751 235

53 33 n/a n/a TTTTGTTGTGCAGACTGAAA 19 27886 279 05 236

53 34 n/a n/a TTACCCATCAAAGCAGTGGG 28 045 28O 64 237

53 35 n/a n/a AATGTTGTGAATACCATCCC 16 28174 281.93 238

53 36 n/a n/a TAACATTTCTATGGGCCTGA 2867 O 28689 239

53 37 n/a n/a TGTCTACTATTTGACCAATA 19 28795 28814 24 O

53 38 n/a n/a TTTAAATGTGTCACTTAATC 2.8987 29 OO6 241

53 39 n/a n/a TCACTAAAACAAAAATACTT 291.56 291.75 242

53 4 O n/a n/a TCTTCCAGGCCAACCACCTT 22 29321 2934 O 243

53 41 n/a n/a TGCAAGGCATGTGTGCACAA 47 295.32 295.51 244

53 42 n/a n/a TGTTTAAAATATCTCTATAC 3 OO27 245

53 43 n/a n/a CATGGAAAAATTAAGCTCAT 301.33 3 O152 246

53 44 n/a n/a TGAAGATTCTATTTAACAAA 3 O285 247

53 45 n/a n/a GCCTAGGAGAGAAAAATAAA 248 US 2017/0002359 A1 Jan. 5, 2017 42

TABLE 3 - continued

SEQ SEQ ID ID SEQ ID SEQ ID NO: 1 NO: 1 NO : 1 O NO : 10 SEQ s I S S Start Stop o Start Stop ID NO Site Site Sequence inhibition Site Site NO 53 46 n/a n/a CCAGTGTAATTCAAAGGAGC 4 O 3 O 639 249

53 47 n/a n/a CCATTATTTCCATCACCTGC 18 3O871 3O890 250

53 48 n/a n/a TACCCAAATTATACCTGGAA 31 O15 31,034 251

53 49 n/a n/a AGAGGTAAAGCAACTTGCCC 45 31.429 3.1448 252

53 SO n/a n/a TCCTTAATAGTCATAGCAGG 48 31558 31577 253

53 51 n/a n/a TCACCACCATTTTTCACATG 44 31683 317 O2 254

53 52 n/a n/a GTTATGGATATAGACTTTAA 318O8 3.1827 255

53 53 n/a n/a CTAGAAGCAATATTTAAAGC 31974 3.1993 256

53 54 n/a n/a ATGAAGTAAGATGCTTAAAA 16 32162 321.81 27

53 55 n/a n/a CTTCTTGTCTCAGATTACCA 79 324 64 3.2483 258

53 56 n/a n/a TCTGAAAAGCCCTCCGAGCT 32589 326 O8 259

53 st n/a n/a AAGTGAATCAGAGCAGTGTA 46 32961 3.298O 26 O

53 58 n/a n/a ACCTTACAAGCATCTTTTCC 41 3.3223 33242 261

53 59 n/a n/a ATTTGTTAAAAGTTGCTTAT 333.68 3.3387 262

53 60 n/a n/a TGATATCATCATCCCAATGA 13 33510 33529 263

TABL 4.

SEQ SEQ ID ID SEQ ID SEQ ID NO: 1 NO: 1 NO : 1 O NO : 10 SEQ s ISIS Start Stop o Start Stop ID NO Site Site Sequence inhibition Site Site NO 531083 n/a n/a TGTACTAGTTTCCTATAACT 68 14738 14757 264 14.809 14828 1488 O 14899 14939 14958 15071 15090 15214 15233 15286 153. OS 15.345 15364 1477 15496 15549 15568 15 6O7 15626 15 679 15698 15809 15828 15881 159 OO 15939 15958

531161. n/a n/a CAGACACCTTCTTCACAAGG 4 O 898 917 264

531162 n/a n/a AATTTCCCAGATGTATTAGT 43 1054 1073 265

5311.63 n/a n/a TCAGCAGAAATCATGTAGGC 6 O 1181 12 OO 266

531164. n/a n/a TTAAATATAAAGAGATCCTC 38 1609 1628 267

531165 n/a n/a GTAATAAAAGGAATGATAAA 1825 1844 268

531166 n/a n/a AGACAGTAAACAAAATCAGG 12 2O65 269

53.1167 n/a n/a CAAGAAACCACCAAAGGAAG 37 2176 21.95 27 O

5311.68 n/a n/a ACCCCAACAGACAGCCCACC 55 2314 2333 271 US 2017/0002359 A1 Jan. 5, 2017 43

TABLE 4 - continued

SEQ SEQ ID ID SEQ ID SEQ ID NO: 1 NO: 1 NO: 1.O NO: 10 SEQ s I SIS Start Stop o Start Stop ID NO Site Site Sequence inhibition Site Site NO

53 69 n/a n/a TGGGCTCACCCCAGTGGACC 54 258O 2599 272

53 70 n/a n/a GCCTGGCCCCCAAGACTCTA 54 2743 2762 2.73

53 71. n/a n/a AGGCCTGCCACAGGCCAGAC 4 O 2873 2892 2.74

53 72 n/a n/a TTCAAGCCTGGGCAGCACAG 71. 3OO4 3 O23 2.75

53 73 n/a n/a AAAATAACTTCACTAGAGCT 22 3131. 315 O 276

53 74 n/a n/a TGTTAAGTATATTAACTATT 10 3.256 3.27 277

53 n/a n/a TACTCAGGAAATTAGAATAT 25 35.50 3569 278

53 76 n/a n/a TTATGAAACCTCTTGATTTG 375.3 3772 2.79

53 77 n/a n/a TTCTTGTAAATGTCTGAATT 61 3971 3990 280

53 78 n/a n/a ACCACAGGAAACTGTAGCAA 72 4111 413 O 281

53 79 n/a n/a GATTGGACCCAGACACTATA 45 O6 4525 282

53 n/a n/a CCTCTTAAGTCACCATAGAC 45 4785 4804 283

53 81 n/a n/a GGTTGAGGGACAGACACAGG 36 494. O 4959 284

53 82 n/a n/a ATAATCATGATTTATTTTGC 34 SO99 5118, 285

53 83 n/a n/a CATAAGAATGTGCACACAAA. 39 5.382 54 O1. 286

53 84 n/a n/a ACTCTTATTAGCTGGTAGAA 74 5.538 st 287

53 85 n/a n/a GGACCAAAACTGAGAGGCAG 63 5663 5682 288

53 86 n/a n/a CCATTACTCTCAAGCTCCAC 5890 5909 289

53 87 n/a n/a ATCTATTGGTTCAGGAGCCA 72 6O15 6 O34 290

53 88 n/a n/a GTTAAAACAACTAGAAGCCA 67 6146 6165. 291

53 89 n/a n/a AGGTGTTCTTGCTTATCC TC 63 64.84 65O3 292

53 90 n/a n/a GCAGTCACTCCTCTTCCAGC 59 66.59 6678 293

53 91 n/a n/a AAGTGTATTGCCTAGATTTC 37 6784 68O3 294

53 92 n/a n/a GAGTGCCATCTTCTCTGCAC 61 6968 6987 295

53 93 n/a n/a TTATTCCCAGCTCTAAAATA 23 7274 7293 296

53 94 n/a n/a CTCACAATTCTGTAAGGGAA 64 7596 76.15 297

53 95 n/a n/a ATAAAATATATTAAGGCAAC 61 7846 7865. 298

53 96 n/a n/a TTGAGTCAGACATCCTGTGA 38 7996 8 O15. 299

53 97 n/a n/a TACCTTTTCTCCATGTCATT 42 81.48 8167 3 OO

53 98 n/a n/a GGGATTTTGCTGAAGCTGGT 73 8273 8292 3 O1

53 99 n/a n/a CTTTGAATAGAAAATGACTA 8415 8434 3 O2

53 2 OO n/a n/a CAAAATCACAAGTTCTAGAT 51 86.17 8636 3O3

53 n/a n/a TTTCCAATACTTTTACAAAT 52 876O 87.79 304

53 n/a n/a ATTAATAAGCATCTCTCTGA 31 9109 9 128 305

53 n/a n/a TGACTATCCAATTTCTAGTT 67 9253 92.72 3 O6 US 2017/0002359 A1 Jan. 5, 2017 44

TABLE 4 - continued

SEQ SEQ ID ID SEQ ID SEQ ID NO: 1 NO: 1 NO: 1.O NO: 10 SEQ s I SIS Start Stop o Start Stop ID NO Site Site Sequence inhibition Site Site NO 53 2O4. n/a n/a CTTGTAGTCTGCACTTAATG 6 O 9418 94 37 3. Of

53 2O5 n/a n/a ACATTTTTTAAGTACAGGAA 96O2 9621 3O8

53 n/a n/a GAAATGTCTAGCATTTTCTA 28 97.5 97.74 309

53 n/a n/a CCACTTATTTGATGACCACA 64 9915 9934 310

53 n/a n/a TCCAGAATACTGCCCCATCT 23 1OOSO OO 69 311

53 209 n/a n/a TGGATTCATTTTCTGCAAAT 81 101.75 O194 312

53 n/a n/a AGACATTGTCAAATGTCCCC 6 O 10322 O341. 313

53 n/a n/a TTGATGTCAGCACTGTTGAC 77 10480 O499 314

53 n/a n/a ACATCAGTAGCTTCAGATGT 56 106.18 O637 315

53 n/a n/a CAAAATTAATTGTGCATAAT 13 1082O O839 316

53 n/a n/a TTTTTCT, TTAAATTTTGCTA 37 1112 O 1139 317

53 n/a n/a TAGAGATTTTATGTACTTGG 63 11.245 1264 3.18

53 n/a n/a AAACACAGGAATTTGCAGAC 33 11408 1427 319

53 n/a n/a GTGGAATAAACCATAATCTA 47 11579 1598 32O

53 n/a n/a GATAATTCTTTTCACAGACA 72 12O28 2O47 321

53 n/a n/a CTTCTCTATCTCCCAGTGTT 61 12227 22 4 6 322

53 22O n/a n/a CAATACAGGTAAATTTCACG 56 12374 2393 323

53 221 n/a n/a AAGGGATTTAAAATTTTTAT 125. Of 2526 324

53 222 n/a n/a GGCAAGCTGTACAAGAAAAA 19 12642 2661, 325

53 223 n/a n/a TGTACT CACCGGTACTCTGC 58 1280s 2824. 326

53 224 n/a n/a AAGAGAATGCTCAGAAATGG 25 13435 3454 327

53 225 n/a n/a ACACTTGTACCCCATACATC 45 1356 O 3579 328

53 226 n/a n/a GACAGTAGAGACTGGGAAGG 12 13708 3727 329

53 227 n/a n/a TACCAATTTCTGAAAGGGCA 72 14224 4243 330

53 228 n/a n/a CAGAGTAAACTCCCCATCTC 33 14387 44 O6 331

53 229 n/a n/a CTTCAAAGCCAGCAGTGTAA 69 14514 4533 332

53 23 O n/a n/a CTTACTGGGCTAAAATCAAG 46 14639 4658 .333

53 231 n/a n/a TATCACTGTACTAGTTTCCT 94 14744 4763. 334 14815 4834 14886 4.905 14945 4964 15 OOS 5O24 15 Off SO96 1522 O 5239 15292 5311 15351 37O 15411 543 O. 15483 55 O2 15555 5574 15 613 5632 15 685 5704 15815 5834 15887 59 O6 15945 5964 US 2017/0002359 A1 Jan. 5, 2017 45

TABLE 4 - continued

SEQ SEQ ID ID SEQ ID SEQ ID NO: 1 NO: 1 NO: 1.O NO: 10 SEQ ISIS Start Stop 3. Start Stop ID NO Site Site Sequence inhibition Site Site NO

531232 nAa n/a CTGTACTAGTTTCCTATAAC 85 14739 4758 335 14810 4829 14881 49 OO 1494 O 4959 15 OOO SO19 15072 5091 15215 5234 15287 53 O6 15346 5365 154. O6 54.25 15478 5497 15550 5569 15608 5627 15 68O 56.99 1581. O 5829 15882 59 O1 1594 O 5959

531233 n/a n/a ACTGTACTAGTTTCCTATAA 86 1474. O 4759 336 14811 483 O 14882 4901 14941 496 O

15073 SO92 15216 5235 15288 53. Of 15347 5366 154. Of 5426 15479 5498 15551 sist O 15 609 5628 15 681 st OO 15811 583 O 15883 59 O2 15941 596.O

531234 n/a n/a CACTGTACTAGTTTCCTATA 86 14741 476 O 337 14812 4831 14883 49 O2 14942 4961 15 OO2 5021 15074 SO93 1521.7 5236 15289 53 O8 15348 5367 15408 5427 1548 O 5499 15552 sist1. 15 610 56.29 15 682 57 O1 15812 58.31 15884 59 O3 15942 5961

531235 n/a n/a TCACTGTACTAGTTTCCTAT 86 14742 4761 338 14.813 4832 14884 4903 14943 4962 15 OO3 5022 15075 SO94 15218 5237 1529 O 5309 15349 5368 15409 5428 15481 55 OO 15553 sf2 15 611 563 O 15 683 57 O2 15813 58.32 US 2017/0002359 A1 Jan. 5, 2017 46

TABLE 4 - continued

SEQ SEQ ID ID SEQ ID SEQ ID NO: 1 NO: 1 NO: 1.O NO: 10 SEQ ISIS Start Stop 3. Start Stop ID NO Site Site Sequence inhibition Site Site NO

15885 5904 15943 5962

531236 n/a n/a ATCACTGTACTAGTTTCCTA 87 14743 4762. 339 14814 4833 14885 4904 14944 4963 15 OO4 5O23 15076 SO95 15219 5238 15291 5310 15350 536.9 1541. O 5429 15482 55 O1. 15554 sf3 15 612 5631 15 684 st O3 15814 5833 15886 59 OS 15944 5963

531237 n/a n/a GTGGAATGTCATGGCAATTT 56 16399 6418 34 O

Example 2 2'-deoxynucleosides and is flanked by wing segments on the 5' direction and the 3' direction comprising three and four nucleosides respectively. The 3-10-3 MOE gapmers are 16 Antisense Inhibition of Human PKK in HepaRGTM nucleosides in length, wherein the central gap segment Cells by Antisense Oligonucleotides with 2'-MOE comprises often 2'-deoxynucleosides and is flanked by wing Sugar Modifications segments on the 5' direction and the 3' direction comprising three nucleosides each. Each nucleoside in the 5' wing 0439. Additional antisense oligonucleotides were segment and each nucleoside in the 3' wing segment has a designed targeting a PKK nucleic acid and were tested for 2'-O-methoxyethyl modification. The internucleoside link their effects on PKK mRNA in vitro. ages throughout each gapmer are phosphorothioate linkages. 0440 The chimeric antisense oligonucleotides in the All cytosine residues throughout each gapmer are 5-meth tables below were designed as 5-10-5 MOE gapmers, 4-9-4 ylcytosines. “Start site' indicates the 5'-most nucleoside to MOE gapmers, 4-10-4 MOE gapmers, 4-10-3 MOE gap which the gapmer is targeted in the human gene sequence. mers, 3-10-4 MOE gapmers, or 3-10-3 MOE gapmers. The “Stop site' indicates the 3'-most nucleoside to which the 5-10-5 MOE gapmers are 20 nucleosides in length, wherein gapmer is targeted in the human gene sequence. Each the central gap segment comprises of ten 2'-deoxynucleo gapmer listed in the tables below is targeted to either SEQ sides and is flanked by wing segments on the 5' direction and ID NO: 1 or SEQ ID NO: 10. "n/a" indicates that the the 3' direction comprising five nucleosides each. The 4-9-4 antisense oligonucleotide does not target that particular gene MOE gapmers are 17 nucleosides in length, wherein the Sequence. central gap segment comprises of nine 2'-deoxynucleosides 0441. Cultured HepaRGTM cells at a density of 20,000 and is flanked by wing segments on the 5' direction and the cells per well were transfected using electroporation with 3' direction comprising four nucleosides each. The 4-10-4 5,000 nMantisense oligonucleotide. After a treatment period MOE gapmers are 18 nucleosides in length, wherein the of approximately 24 hours, RNA was isolated from the cells central gap segment comprises often 2'-deoxynucleosides and PKK mRNA levels were measured by quantitative and is flanked by wing segments on the 5' direction and the real-time PCR. Human primer probe set RTS3454 was used 3' direction comprising four nucleosides each. The 4-10-3 to measure mRNA levels. PKK mRNA levels were adjusted MOE gapmers are 17 nucleosides in length, wherein the according to total RNA content, as measured by central gap segment comprises often 2'-deoxynucleosides RIBOGREENR). The antisense oligonucleotides were tested and is flanked by wing segments on the 5' direction and the in a series of experiments that had similar culture conditions. 3' direction comprising four and three nucleosides respec The results for each experiment are presented in separate tively. The 3-10-4 MOE gapmers are 17 nucleosides in tables shown below. Results are presented as percent inhi length, wherein the central gap segment comprises of ten bition of PKK, relative to untreated control cells.

US 2017/0002359 A1 Jan. 5, 2017 48

TABLE 5 - continued

SEQ SEQ SEQ SEQ ID ID ID ID NO : NO: NO: 1 NO: 1 1O 1O SEQ s ISI Start Stop o Start Stop ID NO Site Site Sequence Motif inhibition Site Site NO 54.72 87 2O 39 GTCAGACATCCACAGGAAAC 5-10-5 69 n/a n/a 367

546 46 23 42 TGAGTCAGACATCCACAGGA 5-10-5 72 n/a n/a 368

54.72 88 31 SO CATAGAGTTGAGTCAGACAT 5-10-5 8O 8 OO3 8022 369

546 47 32 51 TCATAGAGTTGAGTCAGACA 5-10-5 76 8004 8O23

54.72 89 33 52 TTCATAGAGTTGAGTCAGAC 5-10-5 74 8 OOS 8024 3.71

546 48 37 56 CGTTTTCATAGAGTTGAGTC 5-10-5 68 8009 8028 372

546 49 55 74 CCCCACCTCTGAAGAAGGCG 5-10-5 83 8 O27 804 6 373

546 SO 58 77 CATCCCCACCTCTGAAGAAG 5-10-5 58 8O3O 8049 374

54.72 90 63 82 AGCTACATCCCCACCTCTGA 5-10-5 76 8O35 8 OS 4

546 51 66 85 GGAAGCTACATCCCCACCTC 5-10-5 76 8O38 8057 376

54.72 91 68 87 ATGGAAGCTACATCCCCACC 5-10-5 74 804 O 8059 377

54.72 92 71. 9 O TACATGGAAGCTACATCCCC 5-10-5 6 O 8043 8062 378

5461 52 72 91 GTACATGGAAGCTACATCCC 5-10-5 73 8044 8 O63 379

5461 53 76 95 GGGTGTACATGGAAGCTACA 5-10-5 76 8048 8067

5461 54 95 214 TGGCAGTATTGGGCATTTGG 5-10-5 85 8067 8O86 381

54.72 93 99 218 CATCTGGCAGTATTGGGCAT 5-10-5 92 8071 809 O 382

54.72 94 2O1 22 O CTCATCTGGCAGTATTGGGC 5-10-5 85 8073 8092 383

5461 55 2O2 221 CCTCATCTGGCAGTATTGGG 5-10-5 47 8074 8093 384

54.72 95 2O3 222 ACCTCATCTGGCAGTATTGG 5-10-5 88 8 Ofs 8094 385

54.72 96 2O6 225 TGCAC CTCATCTGGCAGTAT 5-10-5 72 8078 8097 386

546 56 211 23 O GAATGTGCAC CTCATCTGGC 5-10-5 81 8O83 387

54.72 97 213 232 TGGAATGTGCACCTCATCTG 5-10-5 84 8085 388

546 st 216 235 GGGTGGAATGTGCACCTCAT 5-10-5 85 8088 389

54.72 98 218 237 TTGGGTGGAATGTGCACCTC 5-10-5 9 O 8090 390

546 58 219 238 CTTGGGTGGAATGTGCAC CT 5-10-5 95 8091 391

546 59 229 248 TAGCAAACACCTTGGGTGGA 5-10-5 76 81.01 392

546 60 235 254 ACTGAATAGCAAACACCTTG 5-10-5 78 81.07 393

54.72 99 237 256 AAACTGAATAGCAAACACCT 5-10-5 76 8109 394

546 63 250 269 ACTTGCTGGAAGAAAACTGA 5-10-5 42 81.22 395

S473 OO 252 271 GAACTTGCTGGAAGAAAACT 5-10-5 37 8124 396

546 64 257 276 TGATTGAACTTGCTGGAAGA 5-10-5 33 8129 397

546 65 26 O 279 CATTGATTGAACTTGCTGGA 5-10-5 71. 8132 398

S473 261 28O TCATTGATTGAACTTGCTGG 5-10-5 8O 8133 399

546 66 263 282 TGTCATTGATTGAACTTGCT 5-10-5 8135 4 OO

S473 266 285 CCATGTCATTGATTGAACTT 5-10-5 58 8138 US 2017/0002359 A1 Jan. 5, 2017

TABLE 5 - continued

SEQ SEQ SEQ SEQ ID ID ID ID NO : NO: NO: 1 NO: 1 1O 1O SEQ ISIS Start Stop 3. Start Stop ID NO Site Site Sequence Motif inhibition Site Site NO

54 6167 268 287 CTCCATGTCATTGATTGAAC 5-10-5 73 814 O 8159 402

S473 O3 270 289 TTCTCCATGTCATTGATTGA - 1 O- 72 8142 8161. 403

S473 04 273 292 CTTTTCTCCATGTCATTGAT - 1 O- 71. 81.45 8164. 404

S473 OS 280 299 ACCAAACCTTTTCTCCATGT - 1 O- 47 n/a n/a 405

54 617O 283 3O2 GCAACCAAACCTTTTCTCCA 5-10-5 54 n/a n/a 406

S473 O6 284 3O3 AGCAACCAAACCTTTTCTCC 5-10-5 62 n/a n/a 4O7

S473. Of 286 305 GAAGCAACCAAACCTTTTCT 5-10-5 58 n/a n/a 408

S473 O8 290 309 TCAAGAAGCAACCAAACCTT 5-10-5 66 n/a n/a 409

S473 O9 293 312 CTTTCAAGAAGCAACCAAAC 5-10-5 71. 9827 984 6 410

54731O 295 314 ATCTTTCAAGAAGCAACCAA 5-10-5 81 9 829 98.48 411

54 6171. 297 316 CTATCTTTCAAGAAGCAACC 5-10-5 81 98.31 985 O 412

547311 299 318 CACTATCTTTCAAGAAGCAA 5-10-5 71. 98.33 9852 413

54 61.72 3 O1 320 AACACTATCTTTCAAGAAGC 5-10-5 81 98.35 98.54. 414

S47312 325 344 ATGTACTTTTGGCAGGGTTC 5 - 10-5 46 9859 98F8 415

54 61.73 327 346 CGATGTACTTTTGGCAGGGT 5-10-5 84 9861 988 O 416

547313 330 349 GTTCGATGTACTTTTGGCAG 5-10-5 73 9 864 9883 417

TABLE 6

SEQ SEQ SEQ SEQ ID ID ID ID NO : NO: NO: 1 NO: 1 1O 1O SEQ ISIS Start Stop 3. Start Stop ID NO Site Site Sequence Motif inhibition Site Site NO 531231 n/a n/a TATCACTGTACTAGTTTCCT 5-10-5 86 4744 4763. 334 4815 4834 4886 4.905 49.45 4964 SOOS 5 O24 SO77 5096 522O 5239 5292 5311 5351 37 O 5411 543. O 5483 55O2 5555 55.74 5613 5 632 5685 5704 5815 5834 S887 5906 5945 5964

54 6174 333 352 CCTGTTCGATGTACTTTTGG 5-1O- 74 9867 9886 418

547314 336 355 GCACCTGTTCGATGTACTTT - 1 O- 73 987O 9889 419

54 6175 338 357 CTGCACCTGTTCGATGTACT - 1 O- 78 98.72 9 891 42O

547315 340 359 AACTGCACCTGTTCGATGTA 5-10-5 SO 987.4 98.93 421 US 2017/0002359 A1 Jan. 5, 2017 50

TABLE 6-continued

SEQ SEQ SEQ SEQ ID ID ID ID NO : NO: NO: 1 NO: 1 1O 1O SEQ s ISIS Start Stop o Start Stop ID NO Site Site Sequence Motif inhibition Site Site NO

547316 342 361 GAAACTGCACCTGTTCGATG 5-10-5 9876 9 895 422

547317 344 363 CAGAAACTGCACCTGTTCGA 5-10-5 98.78 9897 423

547318 345 364 CCAGAAACTGCACCTGTTCG 5-10-5 74 98.79 9898 424

546.177 348 367 TGTCCAGAAACTGCACCTGT 5-10-5 9882 99.01 425

547319 351 37 O GAATGTCCAGAAACTGCACC 5-10-5 62 9885 9904 426

353 372 AGGAATGTCCAGAAACTGCA 5-10-5 73 9.887 99.06 427

S47321 356 375 TCAAGGAATGTCCAGAAACT 5-10-5 53 989 O 99.09 428

S47322 358 377 CTTCAAGGAATGTCCAGAAA 5-10-5 65 9892 99.11 429

S47323 361 38O TTGCTTCAAGGAATGTCCAG 5-10-5 56 98.95 9914 43 O

S47324 363 382 CATTGCTTCAAGGAATGTCC 5-10-5 76 9897 9916 431

S473.25 368 387 GACCACATTGCTTCAAGGAA 5-10-5 67 99 O2 992.1 432

54 6181 369 388 TGACCACATTGCTTCAAGGA 5-10-5 99 O3 9922 433

S47326 37O 389 ATGACCACATTGCTTCAAGG 5-10-5 48 9904 9923 434

47327 373 392 TTGATGACCACATTGCTTCA 5-10-5 45 99. Of 9926 435

S473.28 37s 394 ATTTGATGACCACATTGCTT 5-10-5 4 O 99 O9 9928 436

S47329 377 396 TTATTTGATGACCACATTGC 5-10-5 24 99.11 993 O 437

547.33 O 378 397 CTTATTTGATGACCACATTG 5-10-5 6 O 991-2 9931 438

54 61.83 38O 399 CACTTATTTGATGACCACAT 5-10-5 69 9914 993.3 439

S473.31 382 4O1 AGCACTTATTTGATGACCAC 5-10-5 47 n/a 44 O

54 6184. 384 4 O3 CAAGCACTTATTTGATGACC 5-10-5 65 n/a 441

S473.32 390 4O9 CGATGGCAAGCACTTATTTG 5-10-5 44 n/a 442

547.333 395 414 TGTCTCGATGGCAAGCACTT 5-10-5 76 n/a 443

54 61.86 396 415 ATGTCTCGATGGCAAGCACT 5-10-5 84 n/a 444

S47334 397 416 AATGTCTCGATGGCAAGCAC 5-10-5 74 n/a 445

S47335 4 O2 421 TTATAAATGTCTCGATGGCA 5-10-5 93 2658 2677 446

S47336 4 O3 422 TTTATAAATGTCTCGATGGC 5-10-5 81 2659 2678 447

546.188 4. Of 426 CTCCTTTATAAATGTCTCGA 5-10-5 95 2663 2682 4 48

47337 409 428 AACTCCTTTATAAATGTCTC 5-10-5 84 2665 2684. 449

547.338 411 43 O TCAACTCCTTTATAAATGTC 5-10-5 71. 2667 2686 450

S47339 413 432 TATCAACTCCTTTATAAATG 5-10-5 42 2669 2688 451

54 619 O 419 438 CTCTCATATCAACTCCTTTA 5-10-5 92 2675 2694 452

S4734 O 422 441 CTCCTCTCATATCAAC TCCT 5-10-5 93 2678 2697 453

S47341 424 443 GACTCCTCTCATATCAACTC 5-10-5 87 268O 2699 454

54 6192 428 447 AATTGACTCCTCTCATATCA 5-10-5 51 2684. 2703 45.5

S473 42 433 452 ATTAAAATTGACTCCTCTCA 5-10-5 66 2689 2708 456 US 2017/0002359 A1 Jan. 5, 2017 51

TABLE 6-continued

SEQ SEQ SEQ SEQ ID ID ID ID NO : NO: NO: 1 NO: 1 1O 1O SEQ s ISIS Start Stop o Start Stop ID NO Site Site Sequence Motif inhibition Site Site NO

54 6193 434 453 CATTAAAATTGACTCCTCTC 5-10-5 57 2690 2709 457

S47343 436 45.5 CACATTAAAATTGACTCCTC 5-10-5 78 2692 2711 458

S47344 438 457 GACACATTAAAATTGACTCC 5-10-5 8O 2694 2713 459

S47345 439 458 AGACACATTAAAATTGACTC 5-10-5 8O 2695 2714 460

S47346 444 463 ACCTTAGACACATTAAAATT 5-10-5 57 27 OO 2719 461

54 6195 4 48 467 GCTAACCTTAGACACATTAA 5-10-5 83 2704 2723 462

S473 47 451 47 O ACTGCTAACCTTAGACACAT 5-10-5 82 27 O7 2726 463

54 61.96 452 471 CACTGCTAACCTTAGACACA 5-10-5 83 27 O8 2727 464

S47348 453 472 ACACTGCTAACCTTAGACAC 5-10-5 83 2709 2728 465

S47349 458 477 CTTCAACACTGCTAACCTTA 5-10-5 88 2714 2733 466

54 6198 459 478 TCTTCAACACTGCTAACCTT 5-10-5 85 2715 2734 467

S47350 464 483 GGCATTCTTCAACACTGCTA 5-10-5 96 272O 2739 468

54 6199 465 484 TGGCATTCTTCAACACTGCT 5-10-5 97 2721 274 O 469

S47351 467 486 TTTGGCATTCTTCAACACTG 5-10-5 92 2723 2742 470

54 62 OO SOO 519 AAAACTGGCAGCGAATGTTA. 5-10-5 91 2756 2775 471

S47352 541 560 CCGGTACTCTGCCTTGTGAA 5-10-5 94 2797 2816 472

S473.54 547 566 ATTGTTCCGGTACTCTGCCT 5-10-5 89 473

54 62O3 548 567 AATTGTTCCGGTACTCTGCC 5-10-5 76 474

S47355 549 568 CAATTGTTCCGGTACTCTGC 5-10-5 77

54 6204 555 sf4 AATAGGCAATTGTTCCGGTA 5-10-5 91 476

S47356 556 sts TAATAGGCAATTGTTCCGGT 5-10-5 83 477

54.737 559 sf8 CTTTAATAGGCAATTGTTCC 5-10-5 78 1413 O 14149 478

5462O5 562 581 GTACTTTAATAGGCAATTGT 5-10-5 83 14133 141-52 479

S47359 569 588 CGGGACTGTACTTTAATAGG 5-10-5 81 1414 O 14159

605 624 CGTTACT CAGCACCTTTATA 5-10-5 92 14176 14195 481

5462 09 629 648 GCTTCAGTGAGAATCCAGAT 5-10-5 73 142 OO 142.19 482

54 6210 651 670 CCAATTTCTGAAAGGGCACA 5-10-5 79 14222 14241 483

S473 60 653 672 AACCAATTTCTGAAAGGGCA 5-10-5 88 484

S473 61 655 674 GCAACCAATTTCTGAAAGGG 5-10-5 46 485

546211 656 675 GGCAACCAATTTCTGAAAGG 5-10-5 42 486

54 6212 678 697 AGATGCTGGAAGATGTTCAT 5-10-5 48 26.126 261.45 487

S473 62 7 O1 72 O CAACATCCACATCTGAGAAC 5-10-5 47 261.49 26168 488

S473 63 7O3 722 GGCAACATCCACATCTGAGA 5-10-5 84 26151 2617 O 489

546213 707 726 CCCTGGCAACATCCACATCT 5-10-5 82 26155 26174 490 US 2017/0002359 A1 Jan. 5, 2017 52

TABL E

SEQ SEQ SEQ SEQ ID ID ID ID NO : NO: NO: 1 INO : 1O 1O SEQ s ISIS Start Stop o Start Stop ID NO Site Site Sequence Motif inhibition Site Site NO 5.31231 n/a n/a TATCACTGTACTAGTTTCCT - 1 O-5 88 4744 47 63 334 4815 48 34 4886 49 49.45 49 64 SOOS SO 24 SO77 SO 96 522O 52 39 5292 53 11 5351 53 70 5411 54 3 O 5483 55 5555 55 74 5613 56 32 5685 f 5815 58 34 S887 59 5945 59 64

54.7364 71O 729 GAACCCTGGCAACATCCACA 92 26 58 26 77 491

54 6214 712 731 GAGAACCCTGGCAACATCCA 88 26 60 26 79 492

S473 65 713 732 TGAGAACCCTGGCAACATCC 81 26 61 26 493

S473 66 717 736 GGAGTGAGAACCCTGGCAAC 86 26 65 26 84 494

54 6216 719 738 CTGGAGTGAGAACCCTGGCA 93 26 67 26 86 495

54.7367 721 74 O ATCTGGAGTGAGAACCCTGG 76 26 69 26 88 496

S473 6.8 723 742 GCATCTGGAGTGAGAACCCT 89 26 71. 26 9 O 497

54.7369 725 744 AAGCATCTGGAGTGAGAACC 76 26 73 26 92 498

54.737O 728 747 CAAAAGCATCTGGAGTGAGA 73 26 76 26 95 499

54 6217 73 O 749 CACAAAAGCATCTGGAGTGA 83 26 78 26 97 SOO

54 6218 740 79 TGGTCCGACACACAAAAGCA 71. 26 88 262

47371 74.1 760 ATGGTCCGACACACAAAAGC 66 26 89 262

473.72 742 761 GATGGTCCGACACACAAAAG 32 26 90 262 SO3

54.7373 745 764 GCAGATGGTCCGACACACAA 9 O 26 93 262 12 504

54 622O 7so 769 TAGGTGCAGATGGTCCGACA 71. 26 98 262 17 505

54.7374 7s2 771 GATAGGTGCAGATGGTCCGA 81 262OO 262 19 506

54.737 754 773 GTGATAGGTGCAGATGGTCC 72 262O2 262 21

54.6222 756 775 GGGTGATAGGTGCAGATGGT 12 262O4. 262 23 508

54.7376 778 797 GAATGTAAAGAAGAGGCAGT 43 26226 262 45 509

54 6224 78O 799 TAGAATGTAAAGAAGAGGCA 65 26228 262 47 510

54.7377 788 8. Of CATTTGTATAGAATGTAAAG 26236 262 55 511

54.7378 79 O 809 TACATTTGTATAGAATGTAA 26.238 262 512

54 6226 793 812 CCATACATTTGTATAGAATG 37 26241 262 6 O 513

473.79 8O2 821 CTCGATTTTCCATACATTTG 37 26.250 262 69 514

805 824 TGACTCGATTTTCCATACAT 42 26.253 262 72 515

54 6228 806 825 GTGACTCGATTTTCCATACA 6 O 26254 262 73 516 US 2017/0002359 A1 Jan. 5, 2017 53

TABLE 7-continued

SEQ SEQ SEQ SEQ ID ID ID ID NO : NO: NO: 1 NO: 1 1O 1O SEQ s ISIS Start Stop o Start Stop ID NO Site Site Sequence Motif inhibition Site Site NO

S47381 8. Of 826 TGTGACTCGATTTTCCATAC 5-10-5 49 26255 26274 17

547.382 810 829 CTTTGTGACTCGATTTTCCA 5-10-5 62 26258 26.277 518

54.7383 812 831 TTC TTTGTGACTCGATTTTC 5-10-5 37 n/a 519

546229 816 835 ACATTTCTTTGTGACTCGAT 5-10-5 19 n/a

S47384 818 837 AAACATTTCTTTGTGACTCG 5-10-5 SO n/a 521

S47385 847 866 TGTGCCACTTTCAGATGTTT 5-10-5 8O 27 11 522

54 623 O 848 867 GTGTGCCACTTTCAGATGTT 5-10-5 7O 27 12 27 31 523

54 6231 852 871 CTTGGTGTGCCACTTTCAGA 5-10-5 79 27 16 27 35 524

S47386 853 872 ACTTGGTGTGCCACTTTCAG 5-10-5 78 27 17 27 36 525

54 6232 857 876 AGGAACTTGGTGTGCCACTT 5-10-5 86 27 21 27 4 O 526

47387 878 897 TGGTGTTTTCTTGAGGAGTA 5-10-5 73 27 42 27 61 27

54 6233 879 898 ATGGTGTTTTCTTGAGGAGT 5-10-5 69 27 43 27 62 528

547.388 88O 899 TATGGTGTTTTCTTGAGGAG 5-10-5 55 27 44 27 63 529

S47389 884 903 CAGATATGGTGTTTTCTTGA 5-10-5 61 27 48 27 67 53 O

54 6234 885 904 CCAGATATGGTGTTTTCTTG 5-10-5 69 27 49 27 68 531

S47390 887 906 ATCCAGATATGGTGTTTTCT 5-10-5 63 27 51 27 70 532

S47391 889 908 ATATCCAGATATGGTGTTTT 5-10-5 32 27 53 27 72 533

54 62.35 893 912 GGCTATATCCAGATATGGTG 5-10-5 77 27 st 27 76 534

S47392 895 914 AAGGCTATATCCAGATATGG 5-10-5 81 27 59 27 78 535

546236 9 OO 919 GTTAAAAGGCTATATCCAGA 5-10-5 SO 27 64 27 83 536

54 6237 903 922 CAGGTTAAAAGGCTATATCC 5-10-5 64 27 67 27 86 s37

S473.93 905 924 TGCAGGTTAAAAGGCTATAT 5-10-5 73 27 69 27 88 538

54.7394 9. Of 926 TTTGCAGGTTAAAAGGCTAT 5-10-5 29 27 71. 27 9 O 539

54 6238 909 928 CTTTTGCAGGTTAAAAGGCT 5-10-5 63 27 73 27 92 54 O

54 6239 912 931 GTTCTTTTGCAGGTTAAAAG 5-10-5 47 27 76 27 95 541

547.395 914 933 AAGTTCTTTTGCAGGTTAAA 5-10-5 15 27 78 27 97 542

54 624 O 917 936 GTAAAGTTCTTTTGCAGGTT 5-10-5 23 27 81 272 OO 543

54 6241 92O 939 CAGGTAAAGTTCTTTTGCAG 5-10-5 69 27 84 272O3 544

S47396 921 94 O TCAGGTAAAGTTCTTTTGCA 5-10-5 49 n/a n/a 545

47397 923 942 GTTCAGGTAAAGTTCTTTTG 5-10-5 27 n/a 546

54 6242 925 944 GGGTTCAGGTAAAGTTCTTT 5-10-5 8 n/a 547

S47398 927 946 CAGGGTTCAGGTAAAGTTCT 5-10-5 16 n/a 548

547.399 928 947 GCAGGGTTCAGGTAAAGTTC 5-10-5 1 O n/a 549

5474 OO 93 O 949 TGGCAGGGTTCAGGTAAAGT 5-10-5 O n/a 550

5474. O1 933 952 GAATGGCAGGGTTCAGGTAA 5-10-5 22 551 US 2017/0002359 A1 Jan. 5, 2017 54

TABLE 7-continued

SEQ SEQ SEQ SEQ ID ID ID ID NO : NO: NO: 1 NO: 1 1O 1O SEQ s ISIS Start Stop o Start Stop ID NO Site Site Sequence Motif inhibition Site Site NO 54 6243 934 95.3 AGAATGGCAGGGTTCAGGTA 5-10-5 16 n/a 552

5474 O2 937 956 TTTAGAATGGCAGGGTTCAG 5-10-5 59 n/a 553

5474. O3 939 958 ATTTTAGAATGGCAGGGTTC 5-10-5 1 O 273 61 2738 O 554

54 6244 942 961 TAAATTTTAGAATGGCAGGG 5-10-5 27 27364 27383 555

5474. O4 956 97. AGTCAACTCCCGGGTAAATT 5-10-5 64 27378 27397 556

5474 OS 959 978 CAAAGTCAACTCCCGGGTAA 5-10-5 47 273.81 274 OO f

54.6247 96.O 979 CCAAAGTCAACTCCCGGGTA 5-10-5 9 O 27382 274 O1 558

54 6248 963 982 CCTCCAAAGTCAACTCCCGG 5-10-5 86 27385 274 O4 559

5474. O6 965 984 CTCCTCCAAAGTCAACTCCC 5-10-5 81 273.87 274 O6 560

54 62.49 968 987 CTTCTCCTCCAAAGTCAACT 5-10-5 68 27390 274 O9 561

5474. Of 97. 994 TTCAATTCTTCTCCTCCAAA 5-10-5 59 27397 27416 562

54 6250 977 996 CATTCAATTCTTCTCCTCCA 5-10-5 65 27.399 27418 563

5474. O8 98O 999 TCACATTCAATTCTTCTCCT 5-10-5 84 274 O2 27421 564

5474. O9 982 1 OO1 AGTCACATTCAATTCTTCTC 5-10-5 67 27.404 27423 565

546251 10 Of 1026 GGCAAACATTCACTCCTTTA 5-10-5 92 27.429 27448 566

TABL E 8

SEQ SEQ SEQ SEQ ID ID ID ID NO : NO: NO: 1 NO: 1 1O 1O SEQ ISIS Start Stop Start Stop ID NO Site Site Sequence Motif inhibition Site Site NO 5.31231 n/a n/a TATCACTGTACTAGTTTCCT 5-10-5 95 4744 4763 344 4815 4834 4886 4.905 49.45 4964 SOOS 5 O24 SO77 5096 522O 5239 5292 5311 5351 37 O 5411 543. O 5483 55O2 5555 55.74 5613 5 632 5685 5704 5815 5834 S887 5906 5945 5964

54.6252 1011 103 O TCTTGGCAAACATTCACTCC 5-10-5 73 27433 27452 567

54.6253 1O14 1033 GTCTCTTGGCAAACATTCAC 5-10-5 98 27436 2745.5 568

5474 10 101.7 1036 CAAGTCTCTTGGCAAACATT 5-10-5 88 27439 27.458 569

54.6254 101.9 1038 TGCAAGTCTCTTGGCAAACA 5-10-5 95 27441 274 6 O st O

54.6255 1024 1043 CTTTGTGCAAGTCTCTTGGC 5-10-5 92 274 46 27.465 sf1 US 2017/0002359 A1 Jan. 5, 2017 55

TABLE 8- continued

SEQ SEQ SEQ SEQ ID ID ID ID NO : NO: NO: 1 INO : 1. 1O 1O SEQ s ISIS Start Stop o Start Stop ID NO Site Site Sequence Motif inhibition Site Site NO

5474 11. O27 O46 CATCTTTGTGCAAGTCTCTT 5-10-5 79 27449 274 68

546256 O28 O47 TCATCTTTGTGCAAGTCTCT 5-10-5 83 27450 27.469

547412 O29 O48 ATCATCTTTGTGCAAGTCTC 5-10-5 73 2745.1 2747 O

54.6258 O36 O55 ACAGCGAATCATCTTTGTGC 5-10-5 74 27.458 27477 sts

54.6259 O4 O O59 ACTGACAGCGAATCATCTTT 5-10-5 86 274 62 27481 576

546260 O45 O64 GAAAAACTGACAGCGAATCA. 5-10-5 84 274.67 27486 577

547413 O47 O66 GTGAAAAACTGACAGCGAAT 5-10-5 94 27.469 27488

54 6263 O61 O8O GGAGTAAAGAATAAGTGAAA 5-10-5 O 27483 275O2 st 9

547.414 O 63 O82 TGGGAGTAAAGAATAAGTGA 5-10-5 76 27485 27504

547415 O65 O84 TCTGGGAGTAAAGAATAAGT 5-10-5 71. 2.7487 27506 581

54 6265 O69 O88 GTCTTCTGGGAGTAAAGAAT 5-10-5 65 27.491 27510 582

54 62 66 O72 O91 ACAGTCTTCTGGGAGTAAAG 5-10-5 63 2.7494 27513 583

5474 16 Ofs O94 CTTACAGTCTTCTGGGAGTA 5-10-5 79 27497 27516 584

546.267 O76 O95 CCTTACAGTCTTCTGGGAGT 5-10-5 72 27.498 27517 585

547417 O77 O96 TCCTTACAGTCTTCTGGGAG 5-10-5 68 274.99 275.18 586

54 62 68 O79 O98 CTTCCTTACAGTCTTCTGGG 5-10-5 93 275 O1. 2752O 587

547418 O92 11 CACTTACACTTCTCTTCCTT 5-10-5 O n/a 588

54 6270 O93 12 ACACTTACAC TTCTCTTCCT 5-10-5 32 n/a 589

54 6271 O97 16 AGAAACACTTACACTTCTCT 5-10-5 6 O n/a 590

547419 O1 2O CTTAAGAAACACTTACACTT 5-10-5 51 n/a 591

54742O 12 31 CCATAGATAATCTTAAGAAA 5-10-5 8 27633 27652 592

547421 15 34 CATCCATAGATAATCTTAAG 5-10-5 69 2.7636 27655 593

547422 17 36 ACCATCCATAGATAATCTTA 5-10-5 7O 27638 2767 594

54 6275 19 38 GAACCATCCATAGATAATCT 5-10-5 87 2764 O 27659 595

546.276 23 42 TGGAGAACCATCCATAGATA 5-10-5 74 27644 27663 596

546.277 46 65 TGTGTCCCATACGCAATCCT 5-10-5 9 O 27667 276.86 597

5474.23 SO 69 CCCTTGTGTCCCATACGCAA 5-10-5 95 27671 2769 O. 598

54 6279 53 72 GCTCCCTTGTGTCCCATACG 5-10-5 82 27674 27693 5.99

5474.24 56 7s AGAGCTCCCTTGTGTCCCAT 5-10-5 9 O 27677 27696

54.628O 58 77 CCAGAGCTCCCTTGTGTCCC 5-10-5 86 276.79 27698

5474.25 61 8O TAACCAGAGCTCCCTTGTGT 5-10-5 85 27.682 277O1

54.6281 62 81 GTAACCAGAGCTCCCTTGTG 5-10-5 85 27683 277 O2 603

547.426 64 83 GAGTAACCAGAGCTCCCTTG 5-10-5 92 27685 277O4 604

547.427 66 85 AAGAGTAACCAGAGCTCCCT 5-10-5 79 27687 277O6 605

547428 69 88 TCAAAGAGTAACCAGAGCTC 5-10-5 78 27690 27709 606 US 2017/0002359 A1 Jan. 5, 2017 56

TABLE 8- continued

SEQ SEQ SEQ SEQ ID ID ID ID NO : NO: NO: 1 INO : 1. 1O 1O SEQ s ISIS Start Stop o Start Stop ID NO Site Site Sequence Motif inhibition Site Site NO

54.6283 71. 19 O TCT CAAAGAGTAACCAGAGC 5-10-5 88 27692 277.11

547.429 73 192 AATCT CAAAGAGTAACCAGA 5-10-5 81 27694 27713 608

54743 O 74 193 CAATCTCAAAGAGTAACCAG 5-10-5 7O 27695 2771.4 609

54.6284 76 195 CACAATCTCAAAGAGTAACC 5-10-5 89 27697 27716

546285 8O 199 GTTACACAATCT CAAAGAGT 5-10-5 76 277 O1 2772 O

547431 84 2O3 CAGTGTTACACAATCT CAAA 5-10-5 67 277 Os 277 24

547432 86 2O5 CCCAGTGTTACACAATCTCA 5-10-5 9 O 27707 27726

547433 89 2O8 GTCCCCAGTGTTACACAATC 5-10-5 63 2771O 27729

54.6287 92 211 GTTGTCCCCAGTGTTACACA 5-10-5 82 27713 27732

54.6288 24 O 259 GTTTGTTCCTCCAACAATGC 5-10-5 78 27916 27935

547434 243 262 AGAGTTTGTTCCTCCAACAA 5-10-5 54 27919 27.938

547435 248 267 CAAGAAGAGTTTGTTCCTCC 5-10-5 85 27924 27943

54.629O 251 27 O CCCCAAGAAGAGTTTGTTCC 5-10-5 86 27927 27.946

547436 23 272 CTCCCCAAGAAGAGTTTGTT 5-10-5 27929 27948 620

547437 255 274 CTCTCCCCAAGAAGAGTTTG 5-10-5 SO 27931 2795 O 621

547438 261 28O GGGCCACTCTCCCCAAGAAG 5-10-5 82 27937 27956 622

54.6291 263 282 CAGGGCCACTCTCCCCAAGA 5-10-5 81 27939 27958 623

547439 298 317 TCTGAGCTGTCAGCTTCACC 5-10-5 85 27974 27993 624

54.6293 3 O1 32O GCCTCTGAGCTGTCAGCTTC 5-10-5 64 27977 27996 625

54744. O 327 346 TCCTATGAGTGACCCTCCAC 5-10-5 67 28 O22 626

54.6294 328 347 GTCCTATGAGTGACCCTCCA 5-10-5 72 28004 28 O23 627

547441 331 350 GGTGTCCTATGAGTGACCCT 5-10-5 62 280 Of 28 O26 628

5474 42 332 351 TGGTGTCCTATGAGTGACCC 5-10-5 42 28 027 629

547443 336 355 CCACTGGTGTCCTATGAGTG 5-10-5 7O 28O12 28O31 630

546295 337 356 CCCACTGGTGTCCTATGAGT 5-10-5 67 28O13 631

54.6296 37O 389 GAAGCCCATCAAAGCAGTGG 5-10-5 27 632

546.297 397 416 TATAGATGCGCCAAACATCC 5-10-5 82 633

547.444 398 417 CTATAGATGCGCCAAACATC 5-10-5 71. 634

547.445 4 O2 421 GCCACTATAGATGCGCCAAA 5-10-5 97 635

546.299 4O4. 423 ATGCCACTATAGATGCGCCA 5-10-5 84 3O482 636

54 63 OO 424 443 TAATGTCTGACAGATTTAAA 5-10-5 58 3 OsO2 3 O 521 637

54 63 O1 427 446 TTGTAATGTCTGACAGATTT 5-10-5 93 3 OSOS 3 O 524 638

54 63 O2 444 463 TGAGAAAGGTGTATCTTTTG 5-10-5 87 3 O522 30541 639

547446 447 466 TTGTGAGAAAGGTGTATCTT 5-10-5 84 3 OS25 3 O 544 64 O US 2017/0002359 A1 Jan. 5, 2017 57

TABLE 8 - continued

SEQ SEQ SEQ SEQ ID ID ID ID NO : NO: NO: 1 NO: 1 1O 10 SEQ s ISIS Start Stop o Start Stop ID NO Site Site Sequence Motif inhibition Site Site NO

54 63 O3. 1448 1467 TTTGTGAGAAAGGTGTATCT 5-10-5 77 3 O526 30545 641

547447 14:49 1468 ATTTGTGAGAAAGGTGTATC 5-10-5 3 O527 3O546 642

TABL E 9

SEQ SEQ SEQ SEQ ID ID ID ID NO : NO: NO: 1 NO: 1 1O 10 SEQ s ISIS Start Stop o Start Stop ID NO Site Site Sequence Motif inhibition Site Site NO 531231 n/a n/a TATCACTGTACTAGTTTCCT 5-10-5 96 4744 4763. 334 4815 4834 4886 4.905 49.45 4964 SOOS 5 O24 SO77 5096 522O 5239 5292 5311 5351 37 O 5411 543. O 5483 55O2 5555 55.74 5613 5 632 5685 5704 5815 5834 S887 5906 5945 5964

547448 451 47 O TTATTTGTGAGAAAGGTGTA 5-10-5 7s 3O548 643

5474. 49 453 472 TTTTATTTGTGAGAAAGGTG 5-10-5 71. 3 O531 3. OSSO 644

54 63 04 454 473 CTTTTATTTGTGAGAAAGGT 5-10-5 94 3 O551 645

547450 456 47s CTCTTTTATTTGTGAGAAAG 5-10-5 71. 3 O534 3 O553. 646

54745.1 471 490 TTGGTGAATAATAATCTCTT 5-10-5 7s 3 O 568 647

54 63 O6 472 491 TTTGGTGAATAATAATCTCT 5-10-5 65 3 O550 3 O 569 648

547452 474 493 GTTTTGGTGAATAATAATCT 5-10-5 47 3 O552 3.0571 649

54.63 Of 478 497 TATAGT TTGGTGAATAATA 5-10-5 12 3 O556 30575 650

54 63 08 482 5O1 ACTTTA AGTTTTGGTGAAT 5-10-5 57 3 OS 60 30579 651

54.63 O9 492 511 CCCTTC GAGACTTTATAGT 5-10-5 88 3 O570 30589 652

54.631.O 496 515 GATTCCCTTCTGAGACTTTA 5-10-5 78 3 OS 74 30593. 653

54.6311 499 518 CATGAT CCCTTCTGAGACT 5-10-5 79 3 Oslf 3 O 596 654

547453 5 OO 519 TCATGA TCCCTTCTGAGAC 5-10-5 81 3 O578 30597 655

547454. 5 O2 521 TATCATGATTCCCTTCTGAG 5-10-5 92 30599 656

54745.5 503 522 ATATCA GATTCCCTTCTGA 5-10-5 88 3 O 6 OO 657

547456 5 O6 525 GCGATA CATGATTCCCTTC 5-10-5 89 3 OS 84 3 O 6 O3 658

54.631.3 Of 526 GGCGATATCATGATTCCCTT 5-10-5 6 O 3 O585 3 O 6O4 659

54747 509 528 AAGGCGATATCATGATTCCC 5-10-5 89 3 O587 3 O 6 O 6 660 US 2017/0002359 A1 Jan. 5, 2017 58

TABLE 9- continued

SEQ SEQ SEQ SEQ ID ID ID ID NO : NO: NO: 1 NO: 1 1O 1O SEQ s ISIS Start Stop o Start Stop ID NO Site Site Sequence Motif inhibition Site Site NO

547458 513 532 TATCAAGGCGATATCATGAT 5-10-5 84 3 O591 3 O 610 661

547459 519 538 GAGTTTTATCAAGGCGATAT 5-10-5 28 3 O597 3 O 616 662

547.460 522 541 CTGGAGTTTTATCAAGGCGA 5-10-5 72 3 O 6 OO 3 O 619 663

54.6316 524 543 GCCTGGAGTTTTATCAAGGC 5-10-5 51 3 O 6 O2 3 O 621 664

546.317 528 547 AGGAGCCTGGAGTTTTATCA 5-10-5 12 3 O 6 O6 3 O 625 665

54.631.8 534 553 ATTCAAAGGAGCCTGGAGTT 5-10-5 47 30612 3 O 631 666

547461 s37 556 GTAATTCAAAGGAGCCTGGA 5-10-5 49 3 O 615 3 O 634 667

547462 539 558 GTGTAATTCAAAGGAGCCTG 5-10-5 59 3 O617 3 O 636 668

54 6319 541 560 CAGTGTAATTCAAAGGAGCC 5-10-5 SO 30619 3 O 638 669

5474 63 564 583 TAGGCATATTGGTTTTTGGA 5-10-5 74 3.1870 31889 670

54.632O 566 585 GGTAGGCATATTGGTTTTTG 5-10-5 72 31872 31891 671

54 6321 569 588 GAAGGTAGGCATATTGGTTT 5-10-5 53 31,875 31894 672

54.6322 584 603 CTTGTGTCACCTTTGGAAGG 5-10-5 74 31890 31909 673

5474 64 585 6O4 GCTTGTGTCACCTTTGGAAG 5-10-5 95 31891 31910 674

54 6323 587 606 GTGCTTGTGT CACCTTTGGA 5-10-5 94 31893 3.1912 675

547.465 592 611 AAATTGTGCTTGTGTCACCT 5-10-5 88 31898 31917 676

547466 596 615 GTATAAATTGTGCTTGTGTC 5-10-5 82 319 O2 31921 677

54 6324 597 616 GGTATAAATTGTGCTTGTGT 5-10-5 73 31903 31922 678

5474 67 598 617 TGGTATAAATTGTGCTTGTG 5-10-5 8O 31904 31923 6.79

5474 68 6 OO 619 GTTGGTATAAATTGTGCTTG 5-10-5 61 31906 31925

54.6325 6 O2 621 CAGTTGGTATAAATTGTGCT 5-10-5 74 31908 31927 681

54.6326 6. Of 626 CCCAACAGTTGGTATAAATT 5-10-5 62 31913 31932 682

547.469 610 629 TTACCCAACAGTTGGTATAA 5-10-5 67 31916 3.1935 683

54.6327 61.2 631 GGTTACCCAACAGTTGGTAT 5-10-5 95 31918 3.1937 684

54 6328 624 643 GAAGCCCCATCCGGTTACCC 5-10-5 84 31930 31949 685

547470 628 647 TCGAGAAGCCCCATCCGGTT 5-10-5 7O 31934 31953 686

54.6329 631 650 CCTTCGAGAAGCCCCATCCG 5-10-5 18 3.1937 31956 687

54 6330 636 655 TTTCTCCTTCGAGAAGCCCC 5-10-5 55 31.942 31961 688

547471 638 657 CCTTTCTCCTTCGAGAAGCC 5-10-5 58 31944 31963 689

547472 641 660 TCACCTTTCTCCTTCGAGAA 5-10-5 44 n/a 690

54.6331 642 661 TTCACCTTTCTCCTTCGAGA 5-10-5 59 n/a 691

547473 649 668 TTTGGATTTCACCTTTCTCC 5-10-5 n/a 692

547474. 659 678 TGTAGAATATTTTGGATTTC 5-10-5 51 331 O3 33 122 693

54747s 686 7Os TTTGTTACCAAAGGAATATT 5-10-5 44 3313 O 33149 694

547476 688 707 CATTTGTTACCAAAGGAATA 5-10-5 33132 331.51 695 US 2017/0002359 A1 Jan. 5, 2017 59

TABLE 9- continued

SEQ SEQ SEQ SEQ ID ID ID ID NO : NO: NO: 1 NO: 1 1O 1O SEQ s ISIS Start Stop o Start Stop ID NO Site Site Sequence Motif inhibition Site Site NO

54 6336 689 7 OS TCATTTGTTACCAAAGGAAT 5-10-5 66 3.31.33 33 152 696

547477 692 711 TCTTCATTTGTTACCAAAGG 5-10-5 74 33136 33 155 697

547478 695 714. CATTCTTCATTTGTTACCAA 5-10-5 85 33139 33 158 698

54.6339 712 731 CTTGATATCTTTTC TGGCAT 5-10-5 65 3.31.56 33175 699

54634. O 71.6 73 TAATCTTGATATCTTTTCTG 5-10-5 3 O 3.316 O 3.3179 7 OO

547479 718 737 TATAATCTTGATATCTTTTC 5-10-5 48 33.162 33 181

54748O 756 775 TTCTTTATAGCCAGCACAGA 5-10-5 6 O 332 OO 33219

547481 758 777 CCTTCTTTATAGCCAGCACA 5-10-5 71. 332O2 3.3221

547482 760 779 CCCCTTCTTTATAGCCAGCA 5-10-5 9 O 332O4. 3.3223 704

546343 761 78O CCCCCTTCTTTATAGCCAGC 5-10-5 97 332O5 33224

547483 762 781 TCCCCCTTCTTTATAGCCAG 5-10-5 71. 332O6 33225 706

54634.5 773 792 CAAGCATCTTTTCCCCCTTC 5-10-5 86 3.3217 33236 707

546346 796 815 AGGGACCACCTGAATCTCCC 5-10-5 83 33.895 33914 7 OS

547484 799 818 CTAAGGGACCACCTGAATCT 5-10-5 69 33898 33917

54634.7 8 OO 819 ACTAAGGGACCACCTGAATC 5-10-5 28 33899 339.18

547485 8O3 822 CAAACTAAGGGACCACCTGA 5-10-5 49 339 O2 33921. 711

546348 804 823 GCAAACTAAGGGACCACCTG 5-10-5 79 33903 33922 712

547486 805 824 TGCAAACTAAGGGACCACCT 5-10-5 89 33904 33923 713

546349 810 829 GTGTTTGCAAACTAAGGGAC 5-10-5 48 33909 33928 71.4

54.7487 811 83 O TGTGTTTGCAAACTAAGGGA 5-10-5 72 33.910 33929

54 6350 868 887 CCCTGCGGGCACAGCCTTCA 5-10-5 88 33967 33986 71.6

54 6351 873 892 TTGCTCCCTGCGGGCACAGC 5-10-5 82 3.3972 33991 717

54 6352 88O 899 CACCAGGTTGCTCCCTGCGG 5-10-5 3.3979 33998 718

547488 881 9 OO ACACCAGGTTGCTCCCTGCG 5-10-5 71. 3398O 33999 719

TABL E 1 O

SEQ SEQ SEQ SEQ ID ID ID ID NO : NO: NO: 1 NO: 1 1O 1O SEQ s ISIS Start Stop o Start Stop ID NO Site Site Sequence Motif inhibition Site Site NO 5.31231 n/a n/a TATCACTGTACTAGTTTCCT 5-10-5 72 14744 14763 334 14815 14834 14886 14.905 14945 14964 15 OOS 15 O24 15 O77 15096 1522O 15239 15292 15311 15351 1537 O

US 2017/0002359 A1 Jan. 5, 2017 61

TABLE 1 O-continued

SEQ SEQ SEQ SEQ ID ID ID ID NO : NO: NO: 1 NO: 1 1O 1O SEQ ISIS Start Stop 3. Start Stop ID NO Site Site Sequence Motif inhibition Site Site NO

5474 64 585 6O4 GCTTGTGTCACCTTTGGAAG 5-10-5 84 31891 31910 674

54 6323 587 606 GTGCTTGTGTCACCTTTGGA 5-10-5 8O 3.1893 31912 675

547.465 592 611 AAATTGTGCTTGTGTCACCT 5-10-5 85 3.1898 31917 676

547466 596 615 GTATAAATTGTGCTTGTGTC 5 - 10-5 43 319 O2 31921. 677

54 6324 597 616 GGTATAAATTGTGCTTGTGT 5-10-5 82 31903 31922 678

5474 67 598 617 TGGTATAAATTGTGCTTGTG 5-10-5 65 31904 3.1923 679

5474 68 6 OO 619 GTTGGTATAAATTGTGCTTG 5-10-5 46 31906 31925 68O

54.6325 6 O2 621. CAGTTGGTATAAATTGTGCT 5-10-5 79 31908 31927. 681

54.6326 6. Of 626 CCCAACAGTTGGTATAAATT 5-10-5 64 31913 31932 682

547.469 610 629 TTACCCAACAGTTGGTATAA 5-10-5 SO 31916 3.193s 683

54.6327 61.2 631 GGTTACCCAACAGTTGGTAT 5-10-5 84 31918 31937 684

54 6328 624 643 GAAGCCCCATCCGGTTACCC 5-10-5 81 3193 O 31949 685

547470 628 647 TCGAGAAGCCCCATCCGGTT 5-10-5 68 31934 31953 6.86

54.6329 631 650 CCTTCGAGAAGCCCCATCCG 5-10-5 8 3.1937 31956 687

54 6330 636 6ss TTTCTCCTTCGAGAAGCCCC is - 1 O- 67 31942 31961 688

547471 638 67 CCTTTCTCCTTCGAGAAGCC - 1 O- 43 31944, 31963 689

547472 641 66 O TCACCTTTCTCCTTCGAGAA 5-1 O- 42 n/a n/a 690

54.6331 642 661 TTCACCTTTCTCCTTCGAGA 5-1 O- 44 n/a n/a 691

547473 649 668 TTTGGATTTCACCTTTCTCC - 1 O- 26 n/a n/a 692

547474. 659 678 TGTAGAATATTTTGGATTTC 5 - 1 O- 34 331 O3 33122. 693

54747s 686 705 TTTGTTACCAAAGGAATATT 5-10-5 42 3313 O 33149 694

547476 688 707 CATTTGTTACCAAAGGAATA 5-10-5 71. 33132 33151 695

54 6336 689 7 OS, TCA TACCAAAGGAAT 5-10-5 73 33.133 331.52 696

547477 692 711 TCTTCATTTGTTACCAAAGG is - 1 O- 68 33136. 33 155 697

547478 695 714 CATTCTTCATTTGTTACCAA 5-1 O- 55 33139 33 158 698

54.6339 712 731. CTTGATATCTTTTCTGGCAT S-1 O- 64 3.31.56 33175 699

54634. O 71.6 73 is TAA TGATATCTTTTCTG 5-1 O-5 56 33 16O 33179 700

547479 718 737 TA TGATATCTTTTC 5 - 1 O-5 9 331.62 33181 701

54748O 756 77 is TTC AGCCAGCACAGA 5-10-5 49 332 OO 33219 702

547481 758 777 cc TATAGCCAGCACA 5-10-5 77 332O2 33221 703

547482 760 779 CCCCTTCTTTATAGCCAGCA 5-1 O- 65 332O4, 33.223 704

546343 761 78 O. CCCCCTTCTTTATAGCCAGC 5 - 1 O- 91 332 OS 3.3224 705

547483 762 781. TCCCCCTTCTTTATAGCCAG is - 1 O- 77 332O6. 33225 706

54634.5 773 792 CAAGCATCTTTTCCCCCTTC 5 - 1 O- 8O 332.17 33236 707

546346 796 815 AGGGACCACCTGAATCTCCC 5-10-5 7O 33895 33914. 708

US 2017/0002359 A1 Jan. 5, 2017 64

TABLE 11 - continued

SEQ SEQ SEQ SEQ ID ID ID ID NO : NO: NO: 1 NO: 1 1O 1O SEQ s ISIS Start Stop o Start Stop ID NO Site Site Sequence Motif inhibition Site Site NO

547513 2O46 2O65 TGCAGATGAGGACCCCCCAG 5-10-5 72 34 45 3.4164 764

54.6378 2O48 2O67 TTTGCAGATGAGGACCCCCC 5-10-5 79 34 47 3.4166 765

54.6379 2O56 2O75 CTCCATGCTTTGCAGATGAG 5-10-5 69 34 55 34174. 766

54.638O 2O62 2O81 GCCACTCTCCATGCTTTGCA 5-10-5 81 34 61 3 418O 767

5475.14 2O66 2O85 AGATGCCACTCTCCATGCTT 5-10-5 85 34 65 341.84 768

54.6381 2O68 2O87 GAAGATGCCACTCTCCATGC 5-10-5 73 34 67 3 4186 769

5475.15 2O69 2O88 AGAAGATGCCACTCTCCATG 5-10-5 58 34 68 341.87 770

546.382 2O72 2091 CAAAGAAGATGCCACTCTCC 5-10-5 58 34 71. 34190 771

547516 2O76 2095 GATGCAAAGAAGATGCCACT 5-10-5 48 34 34.194 772

54.6383 2O77 2096 GGATGCAAAGAAGATGCCAC 5-10-5 57 34 76 34 195 773

4717 2O79 2098 TAGGATGCAAAGAAGATGCC 5-10-5 57 34 78 341.97 774

5475.18 2O83 21 O2 TCCTTAGGATGCAAAGAAGA 5-10-5 51 34 82 77

54.6384 2O85 2104 CGTCCTTAGGATGCAAAGAA 5-10-5 81 34 84 342O3 776

54.6385 212O 2139 ATTGTCCTCAGCAGCTCTGA 5-10-5 67 342.19 34.238 777

547519 n/a n/a CCAGACATTGTCCTCAGCAG 5-10-5 76 34,225 34244 778

54.6386 n/a n/a AGCCAGACATTGTCCTCAGC 5-10-5 78 3.4227 3424 6 779

54752O n/a n/a TCAGCCAGACATTGTCCTCA 5-10-5 76 34,229 34248

547521 n/a n/a CTTCAGCCAGACATTGTCCT 5-10-5 58 34231 3425 O 781

546.387 n/a n/a AGCGGGCTTCAGCCAGACAT 5-10-5 77 34237 3.4256 782

547522 n/a n/a GAAAGCGGGCTTCAGCCAGA 5-10-5 73 3424 O 3.425.9 783

54.6388 n/a n/a CTGAAAGCGGGCTTCAGCCA 5-10-5 71. 34242 34261 784

54.6389 2147 2166 CGTGCTGAAAGCGGGCTTCA 5-10-5 71. 34246 34265

546,390 21 65 21.84 GTCAGCCCCTGGTTACGGCG 5-10-5 342 64 34.283 786

547523 2167 2186 TTGTCAGCCCCTGGTTACGG 5-10-5 69 342 66 342.85 787

547524 21.69 21.88 CATTGTCAGCCCCTGGTTAC 5-10-5 58 342 68 342.87 788

54 6391 21.70 21.89 GCATTGTCAGCCCCTGGTTA 5-10-5 54 342 69 34288 789

547525 2174 21.93 CCTCGCATTGTCAGCCCCTG 5-10-5 78 34273 3.4292 79 O

546392 2176 21.95 GACCTCGCATTGTCAGCCCC 5-10-5 72 34275 342.94 791

547526 21.78 2197 GCGACCTCGCATTGTCAGCC 5-10-5 59 34.277 3.4296 792

47527 21.85 22O4. CTCAGTTGCGACCTCGCATT 5-10-5 58 34284 793

54 63.93 2186 22O5 TCTCAGTTGCGACCTCGCAT 5-10-5 77 342.85 343O4. 794

54 6394 21.96 2215 GTCATGGAGATCTCAGTTGC 5-10-5 71. 342.95 34.314 795.

547528 22 OO 2219 CACAGTCATGGAGATCTCAG 5-10-5 78 34.299 34318 796

US 2017/0002359 A1 Jan. 5, 2017 66

TABLE 12-continued

SEQ SEQ SEQ SEQ ID ID ID ID NO : NO: NO: 1 NO: 1 1O 1O SEQ s ISIS Start Stop o Start Stop ID NO Site Site Sequence Motif inhibition Site Site NO 546,397 2233 2252 TTTTTTGATCTTTCACCATT 5-10-5 55 n/a 823

546496 n/a n/a ATGCATACTCGCCTTTGTGA 5-10-5 54 26270 26.289 824 263 O1 2632O

546497 n/a n/a CATGCATACTCGCCTTTGTG 5-10-5 56 26.271 2629O 825 263 O2 26321

546498 n/a n/a CCATGCATACTCGCCTTTGT 5-10-5 65 26.272 26291 826 263 O3 26322

547529 22O3 2222 ACACACAGTCATGGAGATCT 5-10-5 49 343 O2 3.4321 827

54.7530 22O6 2225 ACAACACACAGTCATGGAGA 5-10-5 63 34305 34.324 828

54.7531 2213 2232 TTATTTCACAACACACAGTC 5-10-5 69 34.312 3.4331 829

546499 n/a n/a TCCATGCATACTCGCCTTTG 5-10-5 26.273 26292 830

54 65 OO n/a n/a TTCCATGCATAC TCGCCTTT 5-10-5 46 26274 26.293 831

54 65 O1. n/a n/a TTTCCATGCATACTCGCCTT 5-10-5 53 262.75 26294 832

54 65 O2 n/a n/a GATTTTCCATGCATACTCGC 5-10-5 37 26.278 26.297 833

54 65 03 n/a n/a GTGATGCGATTTTCCATGCA 5-10-5 53 26.285 263O4. 834

54 6508 n/a n/a GCAGCAAGTGCTCCCCATGC 5-10-5 43 26.317 26336 835

54 65.11 n/a n/a GTGATGAAAGTACAGCAGCA 5-10-5 SO 26331 2635 O 836

54 6683 n/a n/a TCCTATCCGTGTTCAGCTGT 5-10-5 69 3273 3292 837

54 6684 n/a n/a TACTCTCTACATACTCAGGA 5-10-5 71. 3561 358 O 838

54.6687 n/a n/a TGAGACCTCCAGACTACTGT 5-10-5 76 3847 3866 839

54 6690 n/a n/a CTCTGCTGGTTTTAGACCAC 5-10-5 44 4 O27 4 O46 84 O

54 6695 n/a n/a GGGACAATCTCCACCCCCGA 5-10-5 36 4225 4244 841

54 6698 n/a n/a TGCAGAGTGTCATCTGCGAA 5-10-5 59 4387 44 O6 842

54.67 OO n/a n/a TGGTTCCCTAGCGGTCCAGA 5-10-5 78 45 61 458 O 843

54 6705 n/a n/a CCCCTGTAGTTGGCTGTGGT 5-10-5 66 5046 5 O65 844

54.67. Of n/a n/a GCAAGTCAAAGAGTGTCCAC 5-10-5 73 5283 53 O2 845

54 6710 n/a n/a GAAGCCTGTTAGAGTTGGCC 5-10-5 73 5576 5595 846

546719 n/a n/a CCCCCATGTCCATGGACTTT 5-10-5 55 6329 6348 847

54.7532 n/a n/a CTGCCAACAGTTTCAACTTT 5-10-5 65 332O 3339 848

54.7533 n/a n/a TTTTGCTTGGCTTCAATATT 5-10-5 23 3352 33.71 849

54.7534 n/a n/a ATCTGACTAGTGAATGGCTT 5-10-5 72 2279 2298 850

54.7535 n/a n/a AGACAGCCCACCAACAATCT 5-10-5 28 23 O6 2325 851

54.7536 n/a n/a TGCATAGACCCCAACAGACA 5-10-5 48 2321 234 O 852

54.737 n/a n/a CCTGTGCATAGACCCCAACA 5-10-5 65 2325 2344 853

54.7538 n/a n/a CCAGCAGAAATCCTGTGCAT 5-10-5 77 2336 2355 854

54.7539 n/a n/a AGAACTCCAGCAGAAATCCT 5-10-5 43 2342 2361 855

54754 O n/a n/a TTGTGTGGCCCTCTTAAGTC 5-10-5 44 4794 4813 856

US 2017/0002359 A1 Jan. 5, 2017 71

TABLE 13 - continued

SEQ SEQ SEQ SEQ ID ID ID ID NO : NO: NO: 1 NO: 1 1O 1O SEQ ISIS Start Stop Start Stop ID NO Site Site Sequence Motif inhibition Site Site NO

54.94 551.3 5624 5643 5826 584.5 5956 97s

546835 n/a n/a TAACTCTAACAGTATCACTG 5-10-5 86 4756 4775 911 4827 4846 4898 4917 501.7 SO36 5089 51.08 5232 5251 5304 5323 5423 5442 5495 5514 56.25 5644 5827 5846 95.7 5976

54.6836 n/a n/a ATAACTCTAACAGTATCACT 5-10-5 3 O 4757 4776 912 4828 4847 4899 4918 5.018 O37 SO90 5109 5233 5.252 53. OS 5324 5424 5443 5496 5515 5626 5.645 5828 5847 5958 5977

546837 n/a n/a TATAACTCTAACAGTATCAC 5-10-5 4758 4777 913 4829 4848 49 OO 4919 SO19 5038 5091 511 O 5234 5253 53 O6 5325 54.25 5.444 5497 5516 5627 5 646 5829 5848 5959 978

546838 n/a n/a CTATAACTCTAACAGTATCA 5-10-5 43 475.9 4778 914 483 O 4849 4901 492 O 5O2O 5 O39 SO92 5111 5235 52.54 53. Of 5326 5426 5.445 5498 17 5628 5.647 583 O 5849 596.O 979

54 6839 n/a n/a CCTATAACTCTAACAGTATC 5-10-5 47 476 O 4779 915 4831 485 O 49 O2 4921 5021 5040 SO93 5112 5236 5.255 53 O8 5327 5427 5446 5499 5518 56.29 5648 58.31 585 O 5961 598 O US 2017/0002359 A1 Jan. 5, 2017 72

TABLE 13 - continued

SEQ SEQ SEQ SEQ ID ID ID ID NO : NO: NO: 1 NO: 1 1O 1O SEQ s ISIS Start Stop o Start Stop ID NO Site Site Sequence Motif inhibition Site Site NO 54684 O n/a n/a CTGTCCTATAACTCTAACAG 5-10-5 53 4764 4783 916 4.835 4854

546841 n/a n/a CACTGTCCTATAACTCTAAC 5-10-5 38 4766 4785 917 4837 485 6

546842 n/a n/a TCACTGTCCTATAACTCTAA 5-10-5 54 4767 4786 918 4838 4857

546843 n/a n/a TATCACTGTCCTATAACTCT 5-10-5 52 4769 4788 919 484 O 4859

546844 n/a n/a GTCCTATATCACTGTCCTAT 5-10-5 4775 4794 4846 486.5 518O 51.99 5716 sf3 is

54684.5 n/a n/a TGTCCTATATCACTGTCCTA 5-10-5 4776 4795 921 4847 4866 5181. 52OO 5717 5736

546846 n/a n/a CTGTCCTATATCACTCTCCT 5-10-5 95 4777 4796 922 4848 4867 5182 52O1 5718 5737

546847 n/a n/a ACTGTCCTATATCACTGTCC 5-10-5 88 4778 4797 923 4849 4 868 51.83 52O2 5719 5.738

546848 n/a n/a TCACTGTCCTATATCACTGT 5-10-5 86 478O 4799 924 4851 4870 4976 4995 51.85 52O4. 27 5276 5.382 54 O1 552O 5539 56.50 5669 5721 5740 5852 5871 5982 6 OO1

54.7558 n/a n/a CCCCCAGTTCCCATGCAAGG 5-10-5 52 664 O 6659 925

54.7559 n/a n/a GAGCACAGATCTCTTCAAGT 5-10-5 69 6822 6841 926

54.75 6.O n/a n/a GACGGTCACCCAGCCCTGAC 5-10-5 42 7459 74.78 927

54.75 61 n/a n/a AAGGGAAATTAGAGGCAGGC 5-10-5 57 7583 928

54.75 62 n/a n/a CTTTCTTGAGACAATCCCTT 5-10-5 59 8463 8482 929

547563 n/a n/a GTGGGATCAGAGAATGACTA. 5-10-5 48 9267 92.86 93 O

547564 n/a n/a CCCTCTGTCTTAGATGTCCA 5-10-5 94 939 O. 931

5475.65 n/a n/a CTTATCAGTCCCAGTCATGT 5-10-5 63 10698 1.Of 17 932

54.75 66 n/a n/a AAGAGTTGGGATGCGACTCT 5-10-5 76 11335 11354 933

547567 n/a n/a TCCACTCCTAAGAAGTATGG 5-10-5 6 O 11546 11565 934

547568 n/a n/a GCACCCTTTTCATTGAGATT 5-10-5 12070 12089 935

547569 n/a n/a ACTACCATTTGGGTTGGTAG 5-10-5 12571. 1259 O 936

477O n/a n/a AAGCCCTGTTTGGTTTTTAG 5-10-5 18 129 OO 1291.9 937 US 2017/0002359 A1 Jan. 5, 2017 73

TABLE 13 - continued

SEQ SEQ SEQ SEQ ID ID ID ID NO : NO: NO: 1 NO: 1 1O 1O SEQ s ISIS Start Stop o Start Stop ID NO Site Site Sequence Motif inhibition Site Site NO 4771 n/a n/a AAATGACACCAAAATTGAGT 5-10-5 14 3744 3763 938

47572 n/a n/a AAATGACACCAAAATTCGCT 5-10-5 4 O 384 O 38.59 939

4773 n/a n/a TAAGCAAGGCCTATGTGTGG 5-10-5 2 388O 3899 94 O

47574. n/a n/a ACACGCACAGGTCCCAGGGC 5-10-5 51 4314 4.333 941

4775 n/a n/a GGGAAACTCTTTCCTCGCCC 5-10-5 89 4.583 46O2 942

547576 n/a n/a CTAGTTTCCTATAACTGCTG 5-10-5 29 4734 475.3 943

4777 n/a n/a CTAACAGTATCACTGTACTA 5-10-5 79 475.1 477 O 944 4822 4841 4893 4912 5O12 5031 5.084 5103 5227 5246 5299 5318 5418 5437 5.490 5509 562O 5639 5822 5841 5952 5971

4778 n/a n/a GTCCTATAACTCTAACAGTA 5-10-5 3 O 4762 4781 945 4833 4852

47579 n/a n/a TGTCCTATAACTCTAACAGT 5-10-5 4763 4782 946 4834 4853

54758O n/a n/a ATCACTGTCCTATAACTCTA 5-10-5 61 4768 4787 947 4839 485.8

547581 n/a n/a ATATCACTGTCCTATAACTC 5-10-5 6 O 477O 4789 948 4841 486 O

547582 n/a n/a TATATCACTGTCCTATAACT 5-10-5 22 4771 479 O 949 4842 4861 5176 51.95 5712 5731 6160 6179

547583 n/a n/a CACTGTCCTATATCACTGTC 5-10-5 4779 4798 950 4850 486.9 51.84 52O3 572O sf39

TABL E 14

SEQ SEQ SEQ SEQ ID ID ID ID NO : NO: NO: 1 NO: 1 1O 1O SEQ s ISIS Start Stop o Start Stop ID NO Site Site Sequence Motif inhibition Site Site NO 5.31231 n/a n/a TATCACTGTACTAGTTTCCT 5-10-5 85 14744 14763 334 14815 14834 14886 14.905 14945 14964 15 OOS 15 O24 15 O77 15096 1522O 15239 15292 15311 15351 1537 O 15411 1543 O

US 2017/0002359 A1 Jan. 5, 2017 76

TABLE 14 - continued

SEQ SEQ SEQ SEQ ID ID ID ID NO : NO: NO: 1 NO: 1 1O 1O SEQ ISIS Start Stop Start Stop ID NO Site Site Sequence Motif inhibition Site Site NO

54.6862 nAa n/a AACTATAACAATATCACTGT 5-10-5 4864 4883 964 4923 4942 51.98 5217 5270 5289 5329 5348 5591 561 O 5663 5682 5734 sfs st 93 5812 5865. 5.884 5923 5942 6066 6085 6091 6110 6144 61.63 6239 6258

54.6863 n/a n/a TAACTATAACAATATCACTG 5-10-5 21 486.5 4.884 965 4924 4943 51.99 5218 5271 529 O 5.33 O 5349 5592 5611 5664 5683 sf3 is 5754 5794 5813 5866 5.885 5924 5943 60 67 6086 6092 6111 6145 61.64 624 O 6259

54 6864 n/a n/a ATAACTATAACAATATCACT 5-10-5 4866 4.885 966 4925 4.944 52 OO 5.219 5272 5291 53.31 5350 5593 5 612 56.65 5684 5736 sfss st 95 5814 5867 5886 5925 5944 6O 68 6087 6093 6112 6146 61.65 6241 626 O

54.6865 n/a n/a TATAACTATAACAATATCAC 5-10-5 4867 4886 967 4926 494.5 52O1 522 O 5273 5292 5332 5351 5594 5 613 56.66 5685 5.737 5756 5796 5815 5868 S887 5926 5945 6069 6088 6094 61.13 6147 61.66 6242 6261

54.6866 n/a n/a GTTTCCTATAACTATAACAA 5-10-5 35 4873 4892 968 4932 4.951 52O7 5226 279 5298 5.338 s37 US 2017/0002359 A1 Jan. 5, 2017 77

TABLE 14- Continued

SEQ SEQ SEQ SEQ ID ID ID ID NO : NO: NO: 1 NO: 1 1O 1O SEQ ISIS Start Stop Start Stop ID NO Site Site Sequence Motif inhibition Site Site NO

56 OO 5619 5672 5 691 57.43 5762 58 O2 5821 5874 5893 5932 5951

54.6867 n/a n/a ACCTATAACTCTAACAGTAT 5-10-5 4 O 4903 4922 969 5022 5041 SO94 5113 5237 5.256 5309 5328 5428 5.447 55 OO 5519 563 O 5649 58.32 585.1 5962 5981

54.6868 n/a n/a TAC CTATAACTCTAACAGTA 5-10-5 51 4904 4923 5O23 5 O42 SO95 5114 5238 27 5310 5329 5429 5448 55 O1. 552O 5631 56.50 5833 5852 5963 5982

54.6869 n/a n/a TGTACCTATAACTCTAACAG 5-10-5 53 4906 4925 971. 5025 5044 524 O 52.59 5312 5331 5431 545 O 5503 5522 5633 5652 5.835 5854 5965 5984

54687O n/a n/a CTGTACCTATAACTCTAACA 5-10-5 87 49. Of 4926 972 SO26 SO45 5241 526 O 5.313 5332 5432 5451. 5504 5523 5634 5653 5836 5855 5966 5985

546871 n/a n/a ACTGTACCTATAACTCTAAC 5-10-5 73 4908 4927 973 5O27 5046 5242 5261 5314 5.333 5433 54.52 55 OS 55.24 5635 565.4 5837 5856 596.7 5986

546872 nAa n/a CACTGTACCTATAACTCTAA 5-10-5 87 4909 4928 974. 5O28 5 O47 5243 5262 5315 5334 5434 5453 55 O6 55.25 5636 5655 5838 s857 5968 987 US 2017/0002359 A1 Jan. 5, 2017 78

TABLE 14 - continued

SEQ SEQ SEQ SEQ ID ID ID ID NO : NO: NO: 1 NO: 1 1O 1O SEQ s ISIS Start Stop o Start Stop ID NO Site Site Sequence Motif inhibition Site Site NO

546873 n/a n/a CAATATCACTGTACCTATAA 5-10-5 34 4.915 4934 97. 5321 534 O sf8s 5804

546874 n/a n/a ATAACAATATCACTGTACCT 5-10-5 68 4919 4938 976 53.25 5344 sf89 58O8 6062 6081 614 O 61.59

546875 n/a n/a ACTATAACAATATCACTGTA 5-10-5 33 4922 4.941 977 5328 5347 st 92 5811 6065 6084 6143 6.162

546876 n/a n/a GTCCTATATCACTGTACCTG 5-10-5 87 4971 499 O 978

546877 n/a n/a CACTGTCCTATATCACTGTA 5-10-5 88 4975 4994 979 5256 27s 53.81 54 OO 5519 5.538 56.49 56.68 585.1 5870 5981 6 OOO

546878 n/a n/a CCTATAACAGTATCACTGTC 81 4988 OOf 98O 5394 5413

546879 n/a n/a TTTCCTATAACAGTATCACT 42 4991 5010 981 397 5416

54688O n/a n/a GTTTCCTATAACAGTATCAC 41 4992 5 O11 982 5398 5417

546881 n/a n/a AGTTTCCTATAACAGTATCA 49 4993 5O12 983 5399 5418

546882 n/a n/a TAGTTTCCTATAACAGTATC 24 4994 5 O13 984 54 OO 5419

546883 n/a n/a CTAGTTTCCTATAACAGTAT 19 4995 985 54 O1

546884 n/a n/a ACTAGTTTCCTATAACAGTA 4996 5 O15 986 54 O2 54.21

547584 n/a n/a GTATCACTGTCCTATATCAC 85 4783 48O2 987 49.79 4998 5117 51.36 53.85 54 O4 5523 5542 5985 6 OO4

547585 n/a n/a AACAGTATCACTGTCCTATA 5-10-5 85 4787 4806 988 49.83 5 OO2 51.21 514 O 5389 54 O8 27 5546 5989 6 OO8

547586 n/a n/a TATAACAGTATCACTGTCCT 5-10-5 82 4790 4809 989 4986 5 OOS 5052 5. Of 1 5124 5143 5392 5411 5.458 477 553 O 5549 5.992 US 2017/0002359 A1 Jan. 5, 2017 79

TABLE 14- Continued

SEQ SEQ SEQ SEQ ID ID ID ID NO : NO: NO: 1 NO: 1 1O 1O SEQ s ISIS Start Stop o Start Stop ID NO Site Site Sequence Motif inhibition Site Site NO

547.87 CTATAACAGTATCACTGTCC 5-10-5 96 47.91 4810 990 4987 5 OO6 SO53 5. Of2 S125 5144 5393 5412 5459 5478 5531 5550 5.993 6O12

547588 ACTATAACAGTATCACTGTC 5-10-5 83 4792 481.1 991 SO54 Of3 5126 5.145 546 O 54.79 5.532 5551 5994 6O13

547589 TAACTATAACAGTATCACTG 5-10-5 36 4794 4813 992 5056 Ofs 5128 5147 516.1 518O 54.62 5481 5.534 55.53 5567 5586 5697 5716 5996 6O15

547590 ATAACTATAACAGTATCACT 5-10-5 4795 4814 993 Of 5. Of 6 5129 5148 5162 5181. 54.63 5482 5.535 5554 5568 87 56.98 5717 997 6O16

547591 CCTATAACTATAACAGTATC 5-10-5 23 4798 4817 994 SO 60 Of 9 516.5 51.84 54.66 54.85 5.538 issist sist1. 559 O 57 O1 572 O 5772 5791 6OOO 6019

547592 TCCTATAACTATAACAGTAT 5-10-5 27 4799 4818 995 5061 508 O 516.6 51.85 54.67 54.86 5539 5558 sf2 5591 57 O2 5721 6 OO1 6O20

5475.93 TTCCTATAACTATAACAGTA 5-10-5 29 48 OO 4819 996 SO 62 5081 5468 54.87 554. O 55.59

54.7594 GTTTCCTATAACTATAACAG 5-10-5 19 48O2 4821 997 5064 5083 5470 5489 5542 5561

5475.95 ACTAGTTTCCTATAACTATA 5-10-5 21 4806 482.5 998 4877 4896 4936 495.5 SO 68 5087 US 2017/0002359 A1 Jan. 5, 2017 80

TABLE 14- Continued

SEQ SEQ SEQ SEQ ID ID ID ID NO : NO: NO: 1 NO: 1 1O 1O SEQ ISIS Start Stop Start Stop ID NO Site Site Sequence Motif inhibition Site Site NO

5211 523 O 5283 53 O2 5342 5361 5474 5493 5546 55.65 5604 5 623 5676 5695 st 47 5766 58 O6 5825 5.878 5897 5936 5955

547596 n/a n/a TACTAGTTTCCTATAACTAT 5-10-5 14 48. Of 4826 999 4878 4897 4937 4956 SO 69 5088 5212 5231 5284 53O3 5343 5362 5475 54.94 5547 55.66 5.6 OS 5 624 is 677 56.96 5748 sf67 58 Of 5826 879 5898 937 595 6

547597 n/a n/a CAATATCACTGTCCTATATC 5-10-5 29 4856 4875 1 OOO 519 O 5209 5262 5281 5655 5674 57.26 5745 s857 5876

547598 n/a n/a ACTATAACAATATCACTGTC 5-10-5 59 4863 4.882 1 OO1 51.97 5216 5269 5288 5590 5609 5662 5681 sf33 sfs2 586.4 5883 5922 5941 6090 6109 6238 6257

547599 n/a n/a TTCCTATAACTATAACAATA 5-10-5 4871 489 O 1 OO2 493 O 4949 52O5 5224 5277 5296 53.36 5355 5598 5 617 5670 5689 5741 576. O 58 OO 5819 5872 5891 593 O 5949

5476 OO n/a n/a TTTCCTATAACTATAACAAT 5-10-5 26 4872 4891 1 OO3 4931 495. O 52O6 5225 5278 5297 337 5356 5599 5618 5671 569 O. 5.742 5761 58 O1 582O 5873 5892 5931 5950 US 2017/0002359 A1 Jan. 5, 2017 81

TABLE 14 - continued

SEQ SEQ SEQ SEQ ID ID ID ID NO : NO: NO: 1 INO : 1O 1O SEQ s ISIS Start Stop o Start Stop ID NO Site Site Sequence Motif inhibition Site Site NO n/a n/a GTACCTATAACTCTAACAGT 5-10-5 4.905 4924 5O24 SO43 5239 5258 5311 5.33 O 543 O. 5.449 55 O2 5521 5632 5651 5834 5853 5964 5983

5476 O2 n/a n/a TCACTGTACCTATAACTCTA 5-10-5 93 491O 4929 1 OOS 5O29 SO48 5244 5263 5316 5335 5435 5.454 ss. Of 55.26 5637 5656 58.39 5858 5969 5.988

5476 O3 n/a n/a TATCACTGTACCTATAACTC 5-10-5 41 4912 4931 1 OO6 5246 5265 5318 337 5509 55.28 5639 5658 5841 586 O 5971 5990

n/a n/a ATATCACTGTACCTATAACT 5-10-5 4913 4932 1 OOf 5.247 5266 5319 5.338 551O 5529 564 O 5659 5.783 58O2 5842 5861 972 5.991

5476 OS n/a n/a ACAATATCACTGTACCTATA 5-10-5 43 4916 4935 1008 5322 5341 5786 5805 6137 615 6

5476 O6 n/a n/a AACAATATCACTGTACCTAT 5-10-5 43 4917 4936 1 OO9 5323 5342 sf87 5806 61.38 6157

5476. Of n/a n/a TAACAATATCACTGTACCTA 5-10-5 49 4918 4937 1010 5324 5343 5788 58 Of 6139 6158

5476 O8 n/a n/a TATAACAATATCACTGTACC 5-10-5 35 492O 4939 1011 5326 5.345 st 9 O 5.809 6063 6082 6141 616 O

5476 O9 n/a n/a CTATAACAATATCACTGTAC 5-10-5 23 4921 494. O 1012 5327 5346 5791 5810 6O 64 6083 6142 61.61

547610 n/a n/a TGTAACAGTATCACTGTACT 5-10-5 45 495.3 4972 1013

547611 n/a n/a CTGTAACAGTATCACTGTAC 5-10-5 71. 4954 4973 1014

547612 n/a n/a CCTGTAACAGTATCACTGTA 5-10-5 68 495.5 4974 1 O15 US 2017/0002359 A1 Jan. 5, 2017 82

TABLE 14 - continued

SEQ SEQ SEQ SEQ ID ID ID ID NO : NO: NO: 1 NO: 1 1O 1O SEQ ISIS Start Stop 3. Start Stop ID NO Site Site Sequence Motif inhibition Site Site NO 547613 n/a n/a CTATATCACTGTACCTGTAA 5-1O-5 39 4968 4987 1016

547614 n/a n/a CCTATATCACTGTACCTGTA 5-1O-5 81 49 69 4988 1017 547615 n/a n/a TCCTATATCACTGTACCTGT 5-10-5 84 4970 4989 1018

547616 n/a n/a TGTCCTATATCACTGTACCT 5-10-5 86 4972 4991 1 019 5253 52.72 5378 397 5516 5.535 5646 56.65 5848 5867 978 997

547617 n/a n/a CTGTCCTATATCACTGTACC 5-10-5 91 4973 4992 102O 52.54 5273 53.79 5398 17 5536 5.647 5666 5849 5868 979 5998

547618 n/a n/a ACTGTCCTATATCACTGTAC 5-1O-5 87 4974 4993 1021 5.255 5274 538O 5399 5518 s37 56.48 56.67 5850 5869 598O 5.999

547619 n/a n/a TCCTATAACAGTATCACTGT 5-1O-5 7O 4989 5 OO8 1022 5395 5414

54762O n/a n/a TTCCTATAACAGTATCACTG 5-1O-5 65 4990 5 OO9 1023 5396 5415

547621 nAa n/a TACTAGTTTCCTATAACAGT 5-1O-5 12 4997 5 O16 O24 54 O3 5422

547622 nAa n/a GTCACTGTACCTATAACTCT 5-1O-5 88 SO3O 5 O49 1025 5436 5.455

547623 n/a n/a TGTCACTGTACCTATAACTC 5-1O-5 81 5031 5 OSO 1026 5437 5.456

547624 n/a n/a ATGTCACTGTACCTATAACT 5-1O-5 64 SO32 5 O51 1 O27 5438 54.57

TABLE 1.5

SEQ SEQ SEQ SEQ ID ID ID ID NO : NO: NO : 1 NO: 1 1O 1O ISIS Start Stop 3. Start Stop SEQ ID NO Site Site Sequence inhibition Motif Site Site NO 531231 n/a n/a TATCACTGTACTAGTTTCCT 93 5-10-5 14744. 14763 334 14815 14 834 14886 14905 14945 14964 15 OOS 15 O24 15 Off 15096 1522O 15239 15292 15311 15351. 1537 O 15411 1543 O

US 2017/0002359 A1 Jan. 5, 2017 84

TABLE 1.5 - continued

SEQ SE SEQ SEQ ID ID ID ID NO : NO: NO: 1 NO : 1O 1O s ISIS Start Stop o Start Stop SEQ ID NO Site Site Sequence inhibition Motif Site Site NO

54.69 O3 n/a CCTATATCACTGTACCTATA 91 5-10-5 5250 52 69 1045 s37 53 94 5513 55 32 5643 56 62 584.5 58 64 97. 59 94

5469.04 n/a TCCTATATCACTGTACCTAT 5-10-5 5251 52 70 1046 5376 53 95 5514 55 33 5644 56 63 5846 58 65 5976 59 95

54 6905 n/a n/a TAC CTATAACAGTATCACTG 65 5-10-5 5363 53 82

54.69 O7 n/a n/a ATAACTATAACAGTATCACC 37 5-10-5 5769 88

54 6908 n/a n/a TCACTGTACCTATAACTATA 77 5-10-5 578O f 99 6.252 62 71.

546909 n/a n/a AACAATATCACTGTACCTTT 44 5-10-5 6O 60 6 O 79 OSO

54691. On/a n/a TAACAATATCACTGTACCTT 82 5-10-5 6061 6 O

546911 n/a n/a GTCCTATAACTATAACAATA 52 5-10-5 6O73 6 O 92 6098 61 17 6151 61 70

54.7625 n/a CAGTATCACTGTCCTATGTC 79 5-10-5 SO47 SO 66 5453 54 72

547626 n/a ACAGTATCACTGTCCTATGT 91 5-10-5 SO48 SO 67 5.454 54 73

547627 n/a TCTACCTATAACTCTAACAG 71. 5-10-5 16

547628 n/a CTCTACCTATAACTCTAACA 34 5-10-5 SO98 17

547629 n/a ACTCTACCTATAACTCTAAC 5-10-5 SO99 18 Of

54763 On/a ACTGTCCTATATCACTCTAC 76 5-10-5 31

547631 n/a CACTGTCCTATATCACTCTA 85 5-10-5 32

547632 nAa TCACTGTCCTATATCACTCT 87 5-10-5 33

547633 n/a ATCACTGTCCTATATCACTC 87 5-10-5 34

547634 n/a ATCACTGTACTAGTTTTCTA 72 5-10-5 67

547635 n/a TATCACTGTACTAGTTTTCT 53 5-10-5 68 O 63

54.7636 n/a GTATCACTGTACTAGTTTTC 86 5-10-5 69

547 637 n/a AGTATCACTGTACTAGTTTT 88 5-10-5 70

547638 n/a ATAACAGTATCACTGTACTA 87 5-10-5 5 5358 53 77 55 62 55 81 5692 f 11 5894 59 13

547639 n/a GTCCTATAACTATAACAGTA 72 5-10-5 51 86 1067 55 92 f 22 6 O 21 US 2017/0002359 A1 Jan. 5, 2017 85

TABLE 1.5 - continued

SEQ SEQ SEQ SEQ ID ID ID ID NO : NO: NO: 1 NO : 1O 1O s ISIS Start Stop o Start Stop SEQ ID NO Site Site Sequence inhibition Motif Site Site NO

54764 On/a TGTCCTATAACTATAACAGT 13 5-10-5 51.68 51.87 1O 68 5574 5593 5704 5723 6OO3 6O22

547641 n/a CTGTCCTATAACTATAACAG 43 5-10-5 5169 5.188 1069 sists 5594 st Os 5724 6OO4 6O23

547 642 nAa TCACTGTCCTATAACTATAA 72 5-10-5 5172 5.191 1070 sf8 iss97 5708 572.7 6OOf 6O26 6078 6097 6103 61.22 6156 6175

547643 n/a ATCACTGTCCTATAACTATA 72 5-10-5 5.173 5.192 1071 sfe 5598 st O9 5728 6008 6 O27 6079 6098 6104 61.23 6157 617 6 6176 6195

547644 n/a n/a TATCACTGTCCTATAACTAT 51 5-10-5 5174 51.93 1072 558O 55.99 5710 sf29 6009 6O28 608O 6099 6158 6.177 6.177 61.96 6228 6247

547645 n/a n/a ATATCACTGTCCTATAACTA 6 O 5-10-5 17s 5.194 1073 5581 5 6.OO 5711 sf3 O 6O1O 6O29 6081 61OO 61.59 61.78 61.78 61.97 6229 6248

547646 n/a CTATATCACTGTACCTATAA 23 5-10-5 5249 5268 1074 5374 5393 5512 5531 5.642 5661 58.44 5863 5974 5.993

547647 n/a GTCCTATATCACTGTACCTA 92 5-10-5 5252 5271 1075 5377 5396 5515 5.534 5.645 5664 5847 5866 5977 5996

547648 n/a n/a CCTATAACAGTATCACTGTA 83 5-10-5 5361 538 O 1076

547649 n/a n/a ACCTATAACAGTATCACTGT 73 5-10-5 5362 53.81 1077

54765O n/a n/a GTACCTATAACAGTATCACT 32 5-10-5 5364 5383 1078

547651 n/a n/a TGTACCTATAACAGTATCAC 48 5-10-5 5365 53.84 1079

547652 nAa TCACTGTACCTATAACAGTA 59 5-10-5 536.9 S388 108O US 2017/0002359 A1 Jan. 5, 2017 86

TABLE 1.5 - continued

SEQ SEQ SEQ SEQ ID ID ID ID NO : NO: NO: 1 NO : 1O 1O s ISIS Start Stop o Start Stop SEQ ID NO Site Site Sequence inhibition Motif Site Site NO

547653 n/a ATCACTGTACCTATAACAGT f 5-10-5 37O 5389 1081

547654 n/a TATCACTGTACCTATAACAG 53 5-10-5 53.71 539 O. 1082

547655 n/a AATATCACTGTCCTATAACT 37 5-10-5 5582 56O1 1083 6O11 6 O3 O 6082 6101 6179 61.98 623 O 6249

547656 n/a CAATATCACTGTCCTATAAC 42 5-10-5 5583 56O2 1084 6083 61O2 618O 61.99 6231 625 O

547657 n/a ACAATATCACTGTCCTATAA 43 5-10-5 5584 5603 1085 6084 6103 6181 62OO 6232 6251

547658 n/a CGTACTAGTTTCCTATAACT 68 5-10-5 sts O 5769 O86

547659 n/a ACTATAACAGTATCACCGTA 5-10-5 5766 sf8 is

54766O n/a AACTATAACAGTATCACCG 68 5-10-5 5767 5786 O88

5476 61 n/a TAACTATAACAGTATCACCG 5-10-5 5768 sf87

547662 nAa ACCTATAACTATAACAGTAT 5-10-5 5773 sfe2

547663 n/a TAC CTATAACTATAACAGTA 10 5-10-5 sff 4 sfe3

547664 n/a GTACCTATAACTATAACAGT 5-10-5 sffs 5794

547665 n/a TGTACCTATAACTATAACAG 10 5-10-5 st f6 sfe is

547666 n/a ATCACTGTACCTATAACTAT 71. 5-10-5 5781 58OO 6253 6272

5476.67 n/a TATCACTGTACCTATAACTA 55 5-10-5 57.82

547668 n/a CAACTATAACAGTATCACTG 44 5-10-5 5899 5918 O96

547669 n/a ACAACTATAACAGTATCACT 5-10-5 59 OO 5919

54767O n/a TACAACTATAACAGTATCAC 5-10-5 592 O O98

547671 n/a CTACAACTATAACAGTATCA 5-10-5 5921 O99

547672 n/a CAATATCACTGTCCTACAAC 36 5-10-5 5915 5934 1 OO

547673 n/a GAATATCACTGTCCTATAAC 21 5-10-5

547674 n/a ACAATATCACTGTACCTTTA 53 5-10-5 605.9 6078 1 O2

547675 n/a TGTCCTATAACTATAACAAT 10 5-10-5 6093 103 6099 61.18 6152 6171

547676 n/a CTGTCCTATAACTATAACAA 41 5-10-5 6094 104 61 OO 6119 6153 6172

US 2017/0002359 A1 Jan. 5, 2017 88

TABLE 16- continued

SEQ SEQ SEQ SEQ ID ID ID ID NO : NO: NO: 1 NO : 1O 1O SEQ s ISIS Start Stop o Start Stop D NO Site Site Sequence Motif inhibition Site Site NO 546980 n/a n/a AGCCCTCAATTGTTGCTGGT 5-10-5 79 24 664 24683 31

54 6983 n/a n/a GATGACCTGCAGATGCACAG 5-10-5 74 24978 24997 32

54.6986 n/a n/a CAGGATAGAACTGATGGTCC 5-10-5 91 25318 25.337 33

54.699 O n/a n/a AGAACAGGAGACAATCCACT 5-10-5 49 2568O 25699 34

546994 nAa n/a GTTCATGTGGCAACCTGTGA 5-10-5 58 26 12 26131 35

547677 n/a n/a CATCACTGTCCTATAACTAT 5-10-5 62 OS 612.4 36

547678 n/a n/a TAC CTATATCACTGTAACTA 5-10-5 21 25 614 4 37

547679 n/a n/a TGTACCTATATCACTGTAAC 5-10-5 28 27 6146 38

54768O n/a n/a TATCACTGTACCTATATCAC 5-10-5 41 33 6152 39

547681 n/a n/a AATATCACTGTACCTATATC 5-10-5 35 6154 4 O

547682 nAa n/a CAATATCACTGTACCTATAT 5-10-5 36 6155 41

547683 n/a n/a ACTATATCACTGTCCTATAA 5-10-5 33 62 6181 42

547684 n/a n/a TAACTATATCACTGTCCTAT 5-10-5 43 64 61.83 43

547685 n/a n/a ATAACTATATCACTGTCCTA 5-10-5 35 65 6184. 44

547686 n/a n/a CTGTCCTATAACTATATCAC 5-10-5 36 72 61.91 45

547687 n/a n/a ACTGTCCTATAACTATATCA 5-10-5 41 73 61.92 46

547688 n/a n/a CACTGTCCTATAACTATATC 5-10-5 47 74 61.93 47

547689 n/a n/a GTAACAATATCACTGTCCTA 5-10-5 73 84 48

54769 O n/a n/a CTGTAACAATATCACTGTCC 5-10-5 76 86 62O5 49

547691 n/a n/a ACTGTAACAATATCACTGTC 5-10-5 36 87 SO

547692 nAa n/a CACTGTACCTATAACTGTAA 5-10-5 47 62.19 51

547693 n/a n/a TCACTGTACCTATAACTGTA 5-10-5 61 622 O 52

547694 nAa n/a GTCACTGTACCTATAACTGT 5-10-5 92 6221 53

547695 n/a n/a ACTGTCCTATAACTATTACA 5-10-5 31 6224 6243 54

547696 n/a n/a CACTGTCCTATAACTATTAC 5-10-5 26 6225 6244 55

547697 n/a n/a TCACTGTCCTATAACTATTA 5-10-5 63 6226 6245 56

547698 n/a n/a ACCTATAACTATAACAATAT 5-10-5 6245 6264 st

547699 n/a n/a TAC CTATAACTATAACAATA 5-10-5 1 O 624 6 58

5477 OO n/a n/a GTACCTATAACTATAACAAT 5-10-5 6247 6266 59

5477 O1 n/a n/a CATCACTGTACCTATAACTA 5-10-5 49 6254 6273 60

5477 O2 n/a n/a ACATCACTGTACCTATAACT 5-10-5 44 6255 6274 61

5477 O3 n/a n/a CAACATCACTGTACCTATAA 5-10-5 25 6257 6276 62

5477 O4 n/a n/a ACATCTTGTCATTAACATCC 5-10-5 61 6435 6.454 63

5477 O5 n/a n/a GCACCCAATACAGGGCCAGG 5-10-5 69 6512 6531 64

TGCCTCCTGGCAGCCTTCAA 5-10-5 73 6694 6713 65 US 2017/0002359 A1 Jan. 5, 2017 89

TABLE 16- continued

SEQ SEQ SEQ SEQ ID ID ID ID NO : NO: NO : 1 NO: 1 1O 1O SEQ s ISIS Start Stop o Start Stop NO Site Site Sequence Motif inhibition Site Site NO

5477 O7 n/a n/a TGAAAAGCCACGCCCTTAGC 5-10-5 32 16975 16994 66

5477 O8 n/a n/a GCCAGGAGACAGCCCTACTC 5 - 10-5 67 17055 17 O74 67

5477 O9 n/a n/a AGCCCAATGTCCTAACCTGT 5-10-5 76 17791 1781. O 68

54771O n/a n/a TGCGGTTATATGGGCTGAAG 5-10-5 85 1954 O 19559 69

547711 n/a n/a CCTTTAGCCACTCCTCTTGC 5-10-5 45 2 OO61 2008 O 70

547712 nAa n/a CCCCATGGTACCAAAGCCAT 5-10-5 79 2O528 2O547 71.

547713 n/a n/a CTCAATGCCACCCTTTCCCC - 1 O-5 37 2O899 72

547714 n/a n/a CTGTCTAACTGGCCTGGCTG 5-10-5 19 21326 21345 73

547715 n/a n/a GGTCAGAAGGCCTCTTATTC 5 - 10-5 21 21750 21769 74

547716 n/a n/a CCATCTGTCCCCT CAATCCC - 1 O-5 9 22197 22216

54.7717 n/a n/a ACTCTGGCACTGGTCATGGA 5-10-5 54 22 761 22780 76

547718 n/a n/a ATAAAGTGCGATTAAGCCCC 5-10-5 86 235.15 23534 77

547719 n/a n/a TACCAAGCTTGTAGAAGGGA 5-10-5 69 23.633 23652 78

54772O n/a n/a GAAAGACGGCCAATGGGAAA 5-1O-5 24.177 241.96 79

547721 nAa n/a CTCTATCAAAATCCTGCTGC 5-1O-5 68 255.27 25546

547722 nAa n/a CTCCAGTCACCACCATTGCC - 1 O-5 258 60 25879 81

TABLE 1.7

SEQ SEQ SEQ SEQ ID ID ID ID NO : NO: NO : 1 NO: 1 1O 1O SEQ s ISIS Start Stop o Start Stop ID NO Site Site Sequence Motif inhibition Site Site NO

531231 n/a n/a TATCACTGTACTAGTTTCCT - 1 O-5 91 4744 4763 334 4815 4834 4886 4.905 49.45 4964 SOOS 5 O24 SO77 5096 522O 5239 5292 5311 5351 37 O 5411 543. O 5483 55O2 5555 55.74 5613 5 632 5685 5704 5815 5834 S887 5906 5945 5964

54.6599 n/a n/a AAGAGTAAGCCTTCACAGGG 5-10-5 82 27583 276O2 1182

5466 O6 n/a n/a CTCACCAGAGTTGTCCCCAG 5-10-5 27722 27741 11.83

54.6999 n/a n/a GCAGCTCACACCCAAAAAGC 5 - 10-5 29 27004 27 O23 1184

547 OOO n/a n/a TCTGTTACCTTGAGGATTGT - 1 O-5 63 27.276 27295 1185

US 2017/0002359 A1 Jan. 5, 2017 97

TABLE 1.8- continued

SEQ SEQ SEQ SEQ ID ID ID ID NO : NO: NO : 1 NO: 1 1O 1O ISIS Start Stop 3. Start Stop SEQ NO Site Site Sequence Motif inhibition Site Site ID NO

53.49 5365 54 O9 5.425 5481 5497 5553 5569 5611. 5 627 5683 5699 5813 5829 5.885 5901 5943 5959

548722 nAa n/a ACTGTACTAGTTTCCTA 3-10-4 26 47.43 4759 1275 4814 483 O 4.885 4901 4.944 496 O SOO4 5 O2O 5076 5092 5219 5235 5291 3. Of 5350 5366 5410 5426 5482 5498 5554 sist O 561.2 5628 5684 st OO 5814 583 O 5886 5902 5944 596 O

548.723 n/a n/a CACTGTACTAGTTTCCT 3-10-4 62 4744 476 O. 1276 4815 4831 4886 4902 49.45 4961 SOOS 5 O21 SO77 5093 522O 5236 5292 53O8 5351 5367 5411 5427 5483 5.499 5555 st 1 5613 5629 5685 5701 5815 58.31 S887 5903 5945 5961

548724 n/a n/a TCACTGTACTAGTTTCC 3-10-4 61 4745 4761 1277 4816 4832 4887 4903 4.946 4962 SOO6 5022 5078 SO94 5221 5237 5293 5309 5352 5368 5412 5428 5484 55OO 5556 sf2 5614 563 O 5686 5702 5816 58.32 5888 5904 5946 59.62

548725 n/a n/a ATCACTGTACTAGTTTC 3-10-4 32 4746 4762. 1278 4817 4833 4888 4904 4947 4963 O. Of 5 O23 O79 5095 US 2017/0002359 A1 Jan. 5, 2017 98

TABLE 1.8- continued

SEQ SEQ SEQ SEQ ID ID ID ID NO : NO: NO : 1 NO: 1 1O 1O ISIS Start Stop 3. Start Stop SEQ NO Site Site Sequence Motif inhibition Site Site ID NO

5222 5238 5294 531 O 5353 536.9 5413 5429 54.85 55O1 issist sf3 56.15 5631 56.87 st O3 5817 5833 5889 5905 5947 5963

548726 n/a n/a TATCACTGTACTAGTTT 3-10-4 21 4747 4763. 1279 4818 4834 4889 4.905 4948 4964 SO 08 5 O24 508O 5096 5152 51.68 5223 5239 5295 5311 53.54 37 O 5414 543. O 54.86 55O2 5558 55.74 5616 5 632 5688 5704 5818 5834 5890 5906 5948 5964

548727 n/a n/a ACTAGTTTCCTATAACT 4-10-3 O 4.738 475 4 1270 4809 482.5 488O 4896 4939 495.5 5071 5087 5214 523 O 5286 53 O2 53.45 5361 477 5493 5549 55.65 56. Of 5 623 5679 5695 sts O 5766 5809 5825 5881 5897 5939 5955

548728 n/a n/a TACTAGTTTCCTATAAC 4-10-3 O 4739 4755 1271 4810 4826 4881 4897 494. O 4956 SOOO 5 O16 5072 5088 5215 5231 5287 53O3 5346 5362 54 O6 5422 5478 54.94 5550 55.66 5608 5 624 568O 56.96 sts1 sf67 5810 5826 5882 5898 594 O 595 6

548729 n/a n/a GTACTAGTTTCCTATAA 4-10-3 13 474. O 4756 1272 481.1 4827 4.882 4898