DOCSLIB.ORG

ADCK4 Deficiency Destabilizes the Coenzyme Q Complex, Which Is Rescued by 2,4-Dihydroxybenzoic Acid Treatment”

Total Page：16

File Type：pdf, Size：1020Kb

Download full-text PDF Read full-text
ADCK4 Deficiency Destabilizes the Coenzyme Q Complex, Which Is Rescued by 2,4-Dihydroxybenzoic Acid Treatment” BASIC RESEARCH www.jasn.org ADCK4 Deficiency Destabilizes the Coenzyme Q Complex, Which Is Rescued by 2,4-Dihydroxybenzoic Acid Treatment Eugen Widmeier ,1,2 Seyoung Yu,3,4 Anish Nag,5 Youn Wook Chung ,6 Makiko Nakayama,1 Lucía Fernández-del-Río,5 Hannah Hugo,1 David Schapiro,1 Florian Buerger,1 Won-Il Choi,1 Martin Helmstädter,2 Jae-woo Kim,4,7 Ji-Hwan Ryu ,4,6 Min Goo Lee,3,4 Catherine F. Clarke,5 Friedhelm Hildebrandt,1 and Heon Yung Gee 3,4 Due to the number of contributing authors, the affiliations are listed at the end of this article. ABSTRACT Background Mutations in ADCK4 (aarF domain containing kinase 4) generally manifest as steroid-resistant nephrotic syndrome and induce coenzyme Q10 (CoQ10)deficiency. However, the molecular mechanisms underlying steroid-resistant nephrotic syndrome resulting from ADCK4 mutations are not well under- stood, largely because the function of ADCK4 remains unknown. BASIC RESEARCH Methods To elucidate the ADCK4’s function in podocytes, we generated a podocyte-specific, Adck4-knockout mouse model and a human podocyte cell line featuring knockout of ADCK4. These knockout mice and podo- cytes were then treated with 2,4-dihydroxybenzoic acid (2,4-diHB), a CoQ10 precursor analogue, or with a vehicle only. We also performed proteomic mass spectrometry analysis to further elucidate ADCK4’sfunction. Results Absence of Adck4 in mouse podocytes caused FSGS and albuminuria, recapitulating features of nephrotic syndrome caused by ADCK4 mutations. In vitro studies revealed that ADCK4-knockout podo- cytes had significantly reduced CoQ10 concentration, respiratory chain activity, and mitochondrial poten- tial, and subsequently displayed an increase in the number of dysmorphic mitochondria. However, treatment of 3-month-old knockout mice or ADCK4-knockout cells with 2,4-diHB prevented the develop- ment of renal dysfunction and reversed mitochondrial dysfunction in podocytes. Moreover, ADCK4 inter- acted with mitochondrial proteins such as COQ5, as well as cytoplasmic proteins such as myosin and heat shock proteins. Thus, ADCK4 knockout decreased the COQ complex level, but overexpression of ADCK4 in ADCK4-knockout podocytes transfected with wild-type ADCK4 rescued the COQ5 level. Conclusions Our study shows that ADCK4 is required for CoQ10 biosynthesis and mitochondrial function in podocytes, and suggests that ADCK4 in podocytes stabilizes proteins in complex Q in podocytes. Our study also suggests a potential treatment strategy for nephrotic syndrome resulting from ADCK4 mutations. JASN 31: 1191–1211, 2020. doi: https://doi.org/10.1681/ASN.2019070756 Coenzyme Q (CoQ, ubiquinone)—a lipophilic com- Received July 30, 2019. Accepted February 22, 2020. ponent located in the inner mitochondrial mem- E.W. and S.Y. contributed equally to this work. brane, Golgi apparatus, and cell membranes—plays Published online ahead of print. Publication date available at 1 a pivotal role in oxidative phosphorylation. CoQ www.jasn.org. shuttles electrons from complexes I and II to complex Correspondence: Prof. Heon Yung Gee, Department of Pharma- 2 III in the mitochondrial respiratory chain. It also has cology, Yonsei University College of Medicine, Avison BioMedical a critical function in antioxidant defense because of Research Center Rm#225, 50-1 Yonsei-ro, Seodaemun-gu, Seoul 3 03722, Republic of Korea, or Dr. Friedhelm Hildebrandt, Boston its redox potential. The CoQ biosynthesis pathway Children’s Hospital, EN561, 300 Longwood Avenue, Boston, MA has been extensively studied in Saccharomyces cere- 02115. E-mail: [email protected] or friedhelm.hildebrandt@childrens. visiae.4 A minimum of 12 proteins, encoded by the harvard.edu Coq genes, form a complex that serves to stabilize Copyright © 2020 by the American Society of Nephrology JASN 31: 1191–1211, 2020 ISSN : 1046-6673/3106-1191 1191 BASIC RESEARCH www.jasn.org each other and is involved in coenzyme synthesis.5 Based on Significance Statement protein homology, approximately 15 homologous COQ genes have been identified in humans.1 ADCK4 mutations generally manifest as steroid-resistant nephrotic fi Primary CoQ deficiencies due to mutations in ubiquinone syndrome, and cause coenzyme Q10 (CoQ10)de ciency. However, ’ biosynthetic genes (COQ2, COQ4, COQ6, COQ7, COQ9, ADCK4 s function remains obscure. Using mouse and cell models, the authors demonstrated that podocyte-specific Adck4 deletion in PDSS1, PDSS2, aarF domain containing kinase 3 [ADCK3], mice significantly reduced survival and caused severe FSGS, effects – and ADCK4) have been identified.6 12 Clinical manifestations that were prevented by treatment with 2,4-dihydroxybenzoic acid of CoQ10 deficiency vary depending on the genes involved, (2,4-diHB), a CoQ10 precursor analogue. ADCK4-knockout podo- fi and mutations in the same gene can result in diverse pheno- cytes exhibited a signi cantly reduced CoQ10 level and defects in types depending on the mutated allele.13 COQ2,11 COQ6,10 mitochondrial function that were rescued by 2,4-diHB treatment, thus these phenotypes were attributed to decreased CoQ levels. 9 12 10 PDSS2, and ADCK4 have also been implicated in steroid- The authors also found that ADCK4 interacted with mitochondrial resistant nephrotic syndrome (SRNS). Although no effec- proteins, including COQ5, and that ADCK4 knockout decreased tive therapy has been described for SRNS, supplementation of COQ complex levels. These findings reveal that ADCK4 is required for CoQ biosynthesis and mitochondrial function in podocytes, CoQ10 in cases of SRNS resulting from CoQ deficiency acts to 10 alleviate the associated clinical symptoms.10,12,14 This is par- and suggests a treatment strategy for nephrotic syndrome caused by ADCK4 mutations. tially true for ADCK4-related glomerulopathy and several cases have been reported accordingly.12,14 Recently, 2,4- dihydroxybenzoic acid (2,4-diHB) has been shown to amelio- METHODS rate disparate phenotypes in yeast, mouse, and Caenorhabditis elegans models harboring a mutation in the respective Mouse Breeding and Maintenance COQ7, Mclk1,orclk-1 genes.15–17 In these studies, 2,4- The animal experimental protocols were reviewed and ap- diHB was shown to act as an alternate or “bypass” ring proved by the Institutional Animal Care and Use Committee precursor, able to restore endogenous CoQ biosynthesis. In at the University of Michigan (#08619), Boston Children’s addition, 2,4-diHB prevents renal disease of podocyte- Hospital (#13-01-2283), and Yonsei University College of 2 2 specific Coq6 / mice.18 Medicine (#2015-0179). All mice were handled in accordance ADCK3 (also known as COQ8A) and ADCK4 are two with the Guidelines for the Care and Use of Laboratory Ani- mammalian orthologs of yeast Coq8p/Abc1, which belong mals. Mice were housed under pathogen-free conditions with to the microbial UbiB family; they appear to result from a light period from 7:00 AM to 7:00 PM and had ad libitum access gene duplication in vertebrates.6,19 UbiB and Coq8p are to water and irradiated rodent chow (catalog #0006972; required for CoQ biosynthesis in prokaryotes and yeast, re- LabDiet, St. Louis, MO). Targeted Adck4tm1a(EUCOMM)Hmgu spectively, and are speculated to activate an unknown mono- (Adck4tm1a) embryonic stem cells were obtained from oxygenase in the CoQ biosynthesis pathway.19 Coq8p, EUCOMM and injected into the blastocysts of mice. Chimeric ADCK3, and ADCK4 are present on the matrix side of the mice were bred with C57BL/6J mice to establish germline 1 1 inner mitochondrial membrane.20–22 Coq8p is essential for transmission. Nphs2.Cre (stock #008205) and Pgk1.Flpo the organization of high molecular mass Coq polypeptide (#011065) mice were obtained from Jackson Laboratory. complexes and for phosphorylated forms of the Coq3, Mouse lines were bred onto the C57BL/6J genetic background. Coq5, and Coq7 polypeptides that are involved in methyl- Genotyping was performed by PCR using the following pri- ation and hydroxylation steps in CoQ biosynthesis.21,23 Sim- mers: #1, GGATAGGGGGCTGGAGAGATG; #2, GCCCGC ilarly, it has been shown that ADCK3 interacts with CoQ CTCCCTGTATCTTAG; #3, TCGGAGAGGAAAGGACTG biosynthesis enzymes in a protein complex (complex Q).24 GAG; #4, CCCTTTCCCTTGAGTTCACAGC; and #5, TGG Moreover, ADCK3 lacks protein kinase activity in the trans CCTCAAACTCATGAAAATACTCC. Mice were maintained form; exhibits ATPase activity; and has highly conserved, un- in mixed sex and were randomly assigned to the different ex- orthodox protein kinase–like domains, including the KxGQ perimental groups. For mouse studies, experimental results motif, present in UbiB and eukaryotic COQ8 homologs, in- were validated over multiple litters, across several generations cluding ADCK4.25 of the mouse colony with n.6. Data collection of urine, whole However, it is not clear whether ADCK4 functions in a blood, and plasma analysis data were blinded to genotype so manner similar to that of ADCK3. Mutations in the ADCK4 that the operator did not know the genotype during perform- (also known as COQ8B) gene generally manifest as ing the measurements. Histologic and ultrastructural analysis adolescence-onset SRNS, sometimes accompanied with med- was not blinded to genotype but all samples were processed ullary nephrocalcinosis or extrarenal symptoms, including using the same protocol. seizures.12,26 The molecular mechanisms underlying SRNS resulting from ADCK4 mutations are not well understood, Supplementation of 2,4-diHB to the Mice in Drinking largely because the function of ADCK4 is unclear. Therefore, Water in this study, we investigated the function of ADCK4 using 2,4-diHB at a concentration of 25 mM was administered to mouse and cell models. the mice via drinking water and changed twice a week. 1192 JASN JASN 31: 1191–1211, 2020 www.jasn.org BASIC RESEARCH The treatment was started at 3 months of age and continued eosin, Periodic acid–Schiff, Masson trichrome, SFOG, and up to 18 months of age. Jones silver stain following the standard protocols for histo- logic examination. Urine Analysis Urine was collected by housing the mice overnight (12 hours) Ultrastructural Analysis in metabolic cages. All samples were immediately frozen and The kidney tissues and cells were fixed in 2.5% glutaraldehyde, stored at 280°C.
Load more

Recommended publications
  • Electron Transport Discovery Four Complexes Complex I: Nadhà Coqh2
    BI/CH 422/622 OUTLINE: Pyruvate pyruvate dehydrogenase Krebs’ Cycle How did he figure it out? Overview 8 Steps Citrate Synthase Aconitase Isocitrate dehydrogenase Ketoglutarate dehydrogenase Succinyl-CoA synthetase Succinate dehydrogenase Fumarase Malate dehydrogenase Energetics Regulation Summary Oxidative Phosphorylation Energetics (–0.16 V needed for making ATP) Mitochondria Transport (2.4 kcal/mol needed to transport H+ out) Electron transport Discovery Four Complexes Complex I: NADHà CoQH2 Complex II: Succinateà CoQH2 2+ Complex III: CoQH2à Cytochrome C (Fe ) 2+ Complex IV: Cytochrome C (Fe ) à H2O Electron Transport à O2 Inhibitors of Electron Transport Big Drop! • Inhibitors all stop ET and ATP synthesis: very toxic! Spectral work Big Drop! NADH Cyto-a3 Cyto-c1 Big Drop! Cyto-b Cyto-c Cyto-a Fully reduced Flavin Cyto-c + rotenone + antimycin A 300 350 400 450 500 550 600 650 700 1 Electron Transport Electron-Transport Chain Complexes Contain a Series of Electron Carriers • Better techniques for isolating and handling mitochondria, and isolated various fractions of the inner mitochondrial membrane • Measure E°’ • They corresponded to these large drops, and they contained the redox compounds isolated previously. • When assayed for what reactions they could perform, they could perform certain redox reactions and not others. • When isolated, including isolating the individual redox compounds, and measuring the E°’ for each, it was clear that an electron chain was occurring; like a wire! • Lastly, when certain inhibitors were added, some of the redox reactions could be inhibited and others not. Site of the inhibition could be mapped. Electron Transport Electron-Transport Chain Complexes Contain a Series of Electron Carriers • Better techniques for isolating and handling mitochondria, and isolated various fractions of the inner mitochondrial membrane • Measure E°’ • They corresponded to these large drops, and they contained the redox compounds isolated previously.
    [Show full text]
  • The Landscape of Human Mutually Exclusive Splicing
    bioRxiv preprint doi: https://doi.org/10.1101/133215; this version posted May 2, 2017. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made available under aCC-BY-ND 4.0 International license. The landscape of human mutually exclusive splicing Klas Hatje1,2,#,*, Ramon O. Vidal2,*, Raza-Ur Rahman2, Dominic Simm1,3, Björn Hammesfahr1,$, Orr Shomroni2, Stefan Bonn2§ & Martin Kollmar1§ 1 Group of Systems Biology of Motor Proteins, Department of NMR-based Structural Biology, Max-Planck-Institute for Biophysical Chemistry, Göttingen, Germany 2 Group of Computational Systems Biology, German Center for Neurodegenerative Diseases, Göttingen, Germany 3 Theoretical Computer Science and Algorithmic Methods, Institute of Computer Science, Georg-August-University Göttingen, Germany § Corresponding authors # Current address: Roche Pharmaceutical Research and Early Development, Pharmaceutical Sciences, Roche Innovation Center Basel, F. Hoffmann-La Roche Ltd., Basel, Switzerland $ Current address: Research and Development - Data Management (RD-DM), KWS SAAT SE, Einbeck, Germany * These authors contributed equally E-mail addresses: KH: [email protected], RV: [email protected], RR: [email protected], DS: [email protected], BH: [email protected], OS: [email protected], SB: [email protected], MK: [email protected] - 1 - bioRxiv preprint doi: https://doi.org/10.1101/133215; this version posted May 2, 2017. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity.
    [Show full text]
  • Downloaded from the App Store and Nucleobase, Nucleotide and Nucleic Acid Metabolism 7 Google Play
    Hoytema van Konijnenburg et al. Orphanet J Rare Dis (2021) 16:170 https://doi.org/10.1186/s13023-021-01727-2 REVIEW Open Access Treatable inherited metabolic disorders causing intellectual disability: 2021 review and digital app Eva M. M. Hoytema van Konijnenburg1†, Saskia B. Wortmann2,3,4†, Marina J. Koelewijn2, Laura A. Tseng1,4, Roderick Houben6, Sylvia Stöckler‑Ipsiroglu5, Carlos R. Ferreira7 and Clara D. M. van Karnebeek1,2,4,8* Abstract Background: The Treatable ID App was created in 2012 as digital tool to improve early recognition and intervention for treatable inherited metabolic disorders (IMDs) presenting with global developmental delay and intellectual disabil‑ ity (collectively ‘treatable IDs’). Our aim is to update the 2012 review on treatable IDs and App to capture the advances made in the identifcation of new IMDs along with increased pathophysiological insights catalyzing therapeutic development and implementation. Methods: Two independent reviewers queried PubMed, OMIM and Orphanet databases to reassess all previously included disorders and therapies and to identify all reports on Treatable IDs published between 2012 and 2021. These were included if listed in the International Classifcation of IMDs (ICIMD) and presenting with ID as a major feature, and if published evidence for a therapeutic intervention improving ID primary and/or secondary outcomes is avail‑ able. Data on clinical symptoms, diagnostic testing, treatment strategies, efects on outcomes, and evidence levels were extracted and evaluated by the reviewers and external experts. The generated knowledge was translated into a diagnostic algorithm and updated version of the App with novel features. Results: Our review identifed 116 treatable IDs (139 genes), of which 44 newly identifed, belonging to 17 ICIMD categories.
    [Show full text]
  • Seahorse XF Cell Mito Stress Test Kit User Guide 3 4 Agilent Seahorse XF Cell Mito Stress Test Kit User Guide Agilent Seahorse XF Cell Mito Stress Test Kit User Guide
    Agilent Seahorse XF Cell Mito Stress Test Kit User Guide Kit 103015-100 Agilent Technologies Notices © Agilent Technologies, Inc. 2019 Warranty (June 1987) or DFAR 252.227-7015 (b)(2) (November 1995), as applicable in any No part of this manual may be reproduced The material contained in this docu- technical data. in any form or by any means (including ment is provided “as is,” and is sub- electronic storage and retrieval or transla- ject to being changed, without notice, tion into a foreign language) without prior Safety Notices agreement and written consent from in future editions. Further, to the max- Agilent Technologies, Inc. as governed by imum extent permitted by applicable United States and international copyright law, Agilent disclaims all warranties, CAUTION laws. either express or implied, with regard to this manual and any information A CAUTION notice denotes a contained herein, including but not hazard. It calls attention to an oper- Manual Part Number limited to the implied warranties of ating procedure, practice, or the merchantability and fitness for a par- like that, if not correctly performed 103016-400 ticular purpose. Agilent shall not be or adhered to, could result in liable for errors or for incidental or damage to the product or loss of Kit Part Number consequential damages in connection important data. Do not proceed 103015-100 with the furnishing, use, or perfor- beyond a CAUTION notice until the mance of this document or of any indicated conditions are fully Edition information contained herein. Should understood and met. Agilent and the user have a separate Second edition, May 2019 written agreement with warranty Revision G0 terms covering the material in this WARNING Printed in USA document that conflict with these terms, the warranty terms in the sep- A WARNING notice denotes a Agilent Technologies, Inc.
    [Show full text]
  • ADCK3 Protein Recombinant Human Protein Expressed in Sf9 Cells
    Catalog # Aliquot Size A37-11G-20 20 µg A37-11G-50 50 µg ADCK3 Protein Recombinant human protein expressed in Sf9 cells Catalog # A37-11G Lot # Z1457 -3 Product Description Purity Recombinant human ADCK3 (156-end) was expressed by baculovirus in Sf9 insect cells using an N-terminal GST tag. This gene accession number is NM_020247 . The purity of ADCK3 protein was Gene Aliases determined to be >75% by densitometry. ARCA2; CABC1; COQ10D4; COQ8; SCAR9 Approx. MW 83 kDa . Formulation Recombinant protein stored in 50mM Tris-HCl, pH 7.5, 50mM NaCl, 10mM glutathione, 0.1mM EDTA, 0.25mM DTT, 0.1mM PMSF, 25% glycerol. Storage and Stability Store product at –70 oC. For optimal storage, aliquot target into smaller quantities after centrifugation and store at recommended temperature. For most favorable performance, avoid repeated handling and multiple freeze/thaw cycles. Scientific Background ADCK3 or aarF domain containing kinase 3 is a mitochondrial protein similar to yeast ABC1, which functions in an electron-transferring membrane protein complex in the respiratory chain. ADCK3 is involved in coenzyme Q10 synthesis which is essential for proper functioning of the mitochondrial respiratory chain (1). ADCK3 Protein Expression of ADCK3 is induced by the tumor suppressor Recombinant human protein expressed in Sf9 cells p53 and in response to DNA damage, and inhibiting its expression partially suppresses p53-induced apoptosis (2). Catalog # A37-11G Lot # Z1457-3 References Purity >75% Concentration 0.1 µ g/ µl 1. Lagier-Tourenne, C. et.al: ADCK3, an ancestral kinase, is Stability 1yr at –70 oC from date of shipment mutated in a form of recessive ataxia associated with Storage & Shipping Store product at –70 oC.
    [Show full text]
  • Pregnancy-Associated Plasma Protein-Aa Supports Hair Cell
    RESEARCH ARTICLE Pregnancy-associated plasma protein-aa supports hair cell survival by regulating mitochondrial function Mroj Alassaf1,2, Emily C Daykin1, Jaffna Mathiaparanam1, Marc A Wolman1* 1Department of Integrative Biology, University of Wisconsin, Madison, United States; 2Neuroscience Training Program, University of Wisconsin, Madison, United States Abstract To support cell survival, mitochondria must balance energy production with oxidative stress. Inner ear hair cells are particularly vulnerable to oxidative stress; thus require tight mitochondrial regulation. We identified a novel molecular regulator of the hair cells’ mitochondria and survival: Pregnancy-associated plasma protein-aa (Pappaa). Hair cells in zebrafish pappaa mutants exhibit mitochondrial defects, including elevated mitochondrial calcium, transmembrane potential, and reactive oxygen species (ROS) production and reduced antioxidant expression. In pappaa mutants, hair cell death is enhanced by stimulation of mitochondrial calcium or ROS production and suppressed by a mitochondrial ROS scavenger. As a secreted metalloprotease, Pappaa stimulates extracellular insulin-like growth factor 1 (IGF1) bioavailability. We found that the pappaa mutants’ enhanced hair cell loss can be suppressed by stimulation of IGF1 availability and that Pappaa-IGF1 signaling acts post-developmentally to support hair cell survival. These results reveal Pappaa as an extracellular regulator of hair cell survival and essential mitochondrial function. DOI: https://doi.org/10.7554/eLife.47061.001 Introduction *For correspondence: Without a sufficient regenerative capacity, a nervous system’s form and function critically depends [email protected] on the molecular and cellular mechanisms that support its cells’ longevity. Neural cell survival is Competing interests: The inherently challenged by the nervous system’s high energy demand, which is required to support authors declare that no basic functions, including maintaining membrane potential, propagating electrical signals, and coor- competing interests exist.
    [Show full text]
  • Human Mitochondrial Pathologies of the Respiratory Chain and ATP Synthase: Contributions from Studies of Saccharomyces Cerevisiae
    life Review Human Mitochondrial Pathologies of the Respiratory Chain and ATP Synthase: Contributions from Studies of Saccharomyces cerevisiae Leticia V. R. Franco 1,2,* , Luca Bremner 1 and Mario H. Barros 2 1 Department of Biological Sciences, Columbia University, New York, NY 10027, USA; [email protected] 2 Department of Microbiology,Institute of Biomedical Sciences, Universidade de Sao Paulo, Sao Paulo 05508-900, Brazil; [email protected] * Correspondence: [email protected] Received: 27 October 2020; Accepted: 19 November 2020; Published: 23 November 2020 Abstract: The ease with which the unicellular yeast Saccharomyces cerevisiae can be manipulated genetically and biochemically has established this organism as a good model for the study of human mitochondrial diseases. The combined use of biochemical and molecular genetic tools has been instrumental in elucidating the functions of numerous yeast nuclear gene products with human homologs that affect a large number of metabolic and biological processes, including those housed in mitochondria. These include structural and catalytic subunits of enzymes and protein factors that impinge on the biogenesis of the respiratory chain. This article will review what is currently known about the genetics and clinical phenotypes of mitochondrial diseases of the respiratory chain and ATP synthase, with special emphasis on the contribution of information gained from pet mutants with mutations in nuclear genes that impair mitochondrial respiration. Our intent is to provide the yeast mitochondrial specialist with basic knowledge of human mitochondrial pathologies and the human specialist with information on how genes that directly and indirectly affect respiration were identified and characterized in yeast. Keywords: mitochondrial diseases; respiratory chain; yeast; Saccharomyces cerevisiae; pet mutants 1.
    [Show full text]
  • Mitochondrial Electron Transport Chain Complex III Is Required for Antimycin a to Inhibit Autophagy
    View metadata, citation and similar papers at core.ac.uk brought to you by CORE provided by Elsevier - Publisher Connector Chemistry & Biology Article Mitochondrial Electron Transport Chain Complex III Is Required for Antimycin A to Inhibit Autophagy Xiuquan Ma,1,4 Mingzhi Jin,1,4 Yu Cai,1 Hongguang Xia,1 Kai Long,1 Junli Liu,1 Qiang Yu,2,* and Junying Yuan1,3,* 1State Key Laboratory of Bioorganic and Natural Products Chemistry, Shanghai Institute of Organic Chemistry, Chinese Academy of Sciences, 345 Ling-ling Road, Shanghai 200032, China 2Department of Pharmacology, Shanghai Institute of Materia Medica, Chinese Academy of Sciences, 555 Zuchongzhi Road, Shanghai 201203, China 3Department of Cell Biology, Harvard Medical School, 240 Longwood Avenue, Boston, MA 02115, USA 4These authors contributed equally to this work *Correspondence: [email protected] (Q.Y.), [email protected] (J.Y.) DOI 10.1016/j.chembiol.2011.08.009 SUMMARY starvation conditions (Hailey et al., 2010; McEwan and Dikic, 2010), but the detailed mechanism is unclear. Autophagy is a cellular lysosome-dependent catabolic Antimycin A (AMA) is a chemical compound produced by mechanism mediating the turnover of intracellular Streptomyces kitazawensis (Nakayama et al., 1956). AMA is organelles and long-lived proteins. We show that anti- known to bind to the Qi site of cytochrome c reductase in the mi- mycin A, a known inhibitor of mETC complex III, can tochondrial complex III to inhibit the oxidation of ubiquinol in the inhibit autophagy. A structural and functional study electron transport chain, which blocks the mitochondrial electron b c shows that four close analogs of antimycin A that transfer between cytochrome and (Alexandre and Lehninger, 1984; Campo et al., 1992; Maguire et al., 1992; Pham et al., have no effect on mitochondria inhibition also do not 2000; Xia et al., 1997).
    [Show full text]
  • Autosomal-Recessive Cerebellar Ataxia Caused by a Novel ADCK3
    J Neurol Neurosurg Psychiatry: first published as 10.1136/jnnp-2013-306483 on 11 November 2013. Downloaded from Neurogenetics RESEARCH PAPER Autosomal-recessive cerebellar ataxia caused by a novel ADCK3 mutation that elongates the protein: clinical, genetic and biochemical characterisation Yo-Tsen Liu,1,2,3,4 Joshua Hersheson,2 Vincent Plagnol,5 Katherine Fawcett,2 Kate E C Duberley,2 Elisavet Preza,2 Iain P Hargreaves,6 Annapurna Chalasani,6 Open Access 1,2 2 1,2 1,2 Scan to access more Matilde Laurá, Nick W Wood, Mary M Reilly, Henry Houlden free content ▸ Additional material is ABSTRACT potentially treatable causes of ARCA as the symp- published online only. To view Background The autosomal-recessive cerebellar ataxias toms in many patients improve with CoQ10 sup- please visit the journal online 45 (http://dx.doi.org/10.1136/ (ARCA) are a clinically and genetically heterogeneous plementation. CoQ10 is a lipid-soluble jnnp-2013-306483). group of neurodegenerative disorders. The large number component located in the inner mitochondrial of ARCA genes leads to delay and difficulties obtaining membrane. It plays a pivotal role in the oxidative 1MRC Centre for Neuromuscular Diseases, an exact diagnosis in many patients and families. phosphorylation system (OXPHOS) by shuttling UCL Institute of Neurology Ubiquinone (CoQ10) deficiency is one of the potentially electrons derived from mitochondrial respiratory and National Hospital for treatable causes of ARCAs as some patients respond to chain (MRC) complexes I (NADH ubiquinone Neurology and Neurosurgery, CoQ10 supplementation. The AarF domain containing oxidoreductase) and II (succinate ubiquinone oxi- London, UK 2Department of Molecular kinase 3 gene (ADCK3) is one of several genes doreductase) to complex III (ubiquinol cytochrome Neuroscience, UCL Institute of associated with CoQ10 deficiency.
    [Show full text]
  • Functional Characterization of Human Adck3 and Adck4, Mitochondrial Atypical Kinases
    FUNCTIONAL CHARACTERIZATION OF HUMAN ADCK3 AND ADCK4, MITOCHONDRIAL ATYPICAL KINASES by Brody Wheeler A thesis submitted to the Department of Biomedical and Molecular Sciences In conformity with the requirements for the degree of Master of Science Queen’s University Kingston, Ontario, Canada November, 2015 Copyright © Brody Wheeler, 2015 Abstract AarF domain containing kinases 3 and 4 (ADCK3 and ADCK4, respectively) are paralogous human mitochondrial proteins, co-orthologs of the yeast protein Coq8 and bacterial protein UbiB. These proteins are required in the biosynthesis of coenzyme Q, a lipid-soluble electron carrier well known for its role in energy metabolism, more specifically in the electron transport chain. Patients with mutations in ADCK3 experience an onset of neurological disorders from childhood, including cerebellar ataxia and exercise intolerance. Mutations in ADCK4 cause steroid-resistant nephrotic syndrome, and are also associated with coenzyme Q deficiency. Aside from this minimal characterization at the biochemical level, the precise biological functions of both ADCK3 and ADCK4 remain poorly understood. After extensive screening for soluble recombinant protein expression, N-terminal fusions with maltose-binding protein were found to facilitate the overexpression of human ADCK3 and ADCK4 truncations in Escherichia coli as soluble and biologically active entities. For the first time, our work revealed Mg2+-dependent ATPase activity of ADCK3, providing strong support for the theoretical prediction of these proteins being functional atypical kinases. Subsequent experimentation confirmed protein kinase activity for both ADCK3 and ADCK4. This observed kinase activity was inhibited by the presence of an atypical N-terminal extension – containing an invariant KxGQ motif – found within the kinase domains of these proteins, suggesting an autoinhibitory role for this motif.
    [Show full text]
  • Supplementary Information Contents
    Supplementary Information Contents Supplementary Methods: Additional methods descriptions Supplementary Results: Biology of suicidality-associated loci Supplementary Figures Supplementary Figure 1: Flow chart of UK Biobank participants available for primary analyses (Ordinal GWAS and PRS analysis) Supplementary Figure 2: Flow chart of UK Biobank participants available for secondary analyses. The flow chart of participants is the same as Supplementary Figure 1 up to the highlighted box. Relatedness exclusions were applied for A) the DSH GWAS considering the categories Controls, Contemplated self-harm and Actual self-ham and B) the SIA GWAS considering the categories Controls, Suicidal ideation and attempted suicide. Supplementary Figure 3: Manhattan plot of GWAS of ordinal DSH in UK Biobank (N=100 234). Dashed red line = genome wide significance threshold (p<5x10-5). Inset: QQ plot for genome-wide association with DSH. Red line = theoretical distribution under the null hypothesis of no association. Supplementary Figure 4: Manhattan plot of GWAS of ordinal SIA in UK Biobank (N=108 090). Dashed red line = genome wide significance threshold (p<5x10-5). Inset: QQ plot for genome-wide association with SIA. Red line = theoretical distribution under the null hypothesis of no association. Supplementary Figure 5: Manhattan plot of gene-based GWAS of ordinal suicide in UK Biobank (N=122 935). Dashed red line = genome wide significance threshold (p<5x10-5). Inset: QQ plot for genome-wide association with suicidality in UK Biobank. Red line = theoretical distribution under the null hypothesis of no association. Supplementary Figure 6: Manhattan plot of gene-based GWAS of ordinal DSH in UK Biobank (N=100 234).
    [Show full text]
  • COQ8A Gene Coenzyme Q8A
    COQ8A gene coenzyme Q8A Normal Function The COQ8A gene provides instructions for making a protein that is involved in the production of a molecule called coenzyme Q10, which has several critical functions in cells throughout the body. In cell structures called mitochondria, coenzyme Q10 plays an essential role in a process called oxidative phosphorylation, which converts the energy from food into a form cells can use. Coenzyme Q10 is also involved in producing pyrimidines, which are building blocks of DNA, its chemical cousin RNA, and molecules such as ATP and GTP that serve as energy sources in the cell. In cell membranes, coenzyme Q10 acts as an antioxidant, protecting cells from damage caused by unstable oxygen-containing molecules (free radicals), which are byproducts of energy production. Health Conditions Related to Genetic Changes Primary coenzyme Q10 deficiency At least 36 mutations in the COQ8A gene have been found to cause a disorder known as primary coenzyme Q10 deficiency. This rare disease usually becomes apparent in infancy or early childhood, but it can occur at any age. It can affect many parts of the body, most often the brain, muscles, and kidneys. The COQ8A gene mutations associated with this disorder change the structure of the COQ8A protein or prevent its production, which impairs the normal production of coenzyme Q10. Studies suggest that a shortage (deficiency) of coenzyme Q10 impairs oxidative phosphorylation and increases the vulnerability of cells to damage from free radicals. A deficiency of coenzyme Q10 may also disrupt the production of pyrimidines. These changes can cause cells throughout the body to malfunction, which may help explain the variety of organs and tissues that can be affected by primary coenzyme Q10 deficiency.
    [Show full text]