Transient Expression of Human Antibodies in Mammalian Cells

© 2017 Nature America, Inc., part of Springer Nature. All rights reserved. animal animal models within a 3-week time frame. sequences and strategies that allow the expression and purification of endotoxin-free antibody reagents suitable for testing in media, purified by affinity chromatography and characterized by biolayer interferometry. humanized monoclonals, with constant regions. A of full-length IgG antibodies and antibody-derived constructs (including Fab, Fc-fusions and bispecifics) in mammalian cells. antibody production at a reasonable cost. Here, we provide step-by-step protocols for the design and recombinant expression A expression, including glycosylation required for antibody and functionality markedly reduced levels of endotoxin contamination. R Published online 14 December 2017; Correspondence should be addressed to D.C. ( to be time-consuming and has, for academic purposes, been largely stable cell lines can be generated in both systems 293 (HEK293) and Chinese hamster ovary (CHO) cells kidney embryonic human as suchcells, mammalian in produced ceuticals preclinical research and in the development of human biopharma stantially from those observed in mammals cells insect and yeast in systems expression including developed, been expression systems for the production of antibodies constructs have administration assays cell-based cells immune innate activate endotoxins bacterial with antibodies purified of contamination the in result can and functions) effector immune reduced to (leading glycosylation poor gener ally are (IgG)) G immunoglobulin and bispecifics proteins, (Fc)-fusion crystallizable fragment (Fab), binding antigen ment frag (including constructs antibody larger for yields bacteria, in expressed be can readily (scFvs)) fragments variable single-chain experiments subsequent the biological of quality on effects detrimental with often preparations, antibody quality low- in result can challenges production Such settings. academic in proteins recombinant of expression the for system dominant in bacteria such as constructs such expressing with problems to due largely is This research. academic for required commonly is that scale small-to- medium the in particularly challenges, present can constructs and antibody-derived The recombinantantibodies production of I Business Administration, University San Diego,of San Diego, California, USA. 1 & Daniel Christ Rodrigo Vazquez-Lombardi mammalian cells Transient expression of human antibodies in ticularly ticularly when the production several of candidates is required. superseded by the increased efficiency of transient expression, par Immunology Division, Immunology Institute MedicalGarvan of Research, Sydney, Australia. NTRO ecombinant ecombinant expression of antibody molecules in mammalian cells offers important advantages over traditionally utilized bacterial dvances in transient mammalian expression systems enable high yields ( ntibody ntibody constructs are designed by combining antibody variable domains, generated by phage display or derived from human/ In an effort to address these limitations, a range of eukaryotic eukaryotic of range a limitations, these address to effort an In Although small antibody fragments (such as single-domain and 1 2 . However, glycosylation patterns in these cells differ sub differ cells these in patterns However, glycosylation . D UCT 1 3 4 . Moreover, expression in bacteria results in a lack of of lack a in results bacteria in expression Moreover, . . Such limitations do not apply to recombinant proteins I ON 10,1 9 and result in pyrogenic effects following following and result effects in pyrogenic 1 Escherichia coli Escherichia 1 . , 2 7 . Such contamination has the potential to to potential the has contamination Such . 8 d , complicate the interpretation of of interpretation the complicate , o i : 1 1 , which has historically been the , Damien Nevoltris 0 . 1 © 2017 Macmillan Publishers ofSpringer Limited, part Nature. All rightsreserved. 0 [email protected] 3 8 / n p r 1 o 3 t . , limiting their use in 2 1 0 6 1 , the process tends 7 1, T . 1 2 he he constructs are then expressed from mammalian vectors, secreted into culture . 2 6 1 5 . Although ). 1 , Ansha Luthra in in vivo 4 4– Rady School of Rady Management,School of University California San of Diego, La Jolla, California, USA. 2 St St Vincent’ Clinical School, University Newof South Wales, Sydney, Australia. - - - - - 6

the the detection and removal of endotoxin contaminant are outlined for (IMAC, Finally, 30B). Step methods chromatography ion affinity metal immobilized or 30A) (Step chromatography affinity protein A/G/L using medium into culture secreted reagents body anti recombinant of purification the for steps detailed includes (such as display) phage approaches selection derived from humanized/human monoclonals or generated using ( constructs antibody IgG, bispecific full-length ( and of Fc-fusion 23–29) fragment, (Steps Fab expression transient and ( design the for strategies detailed outlines protocol This Protocol and applications potential overview antibody of usage) pathways. downstream development efficient more (i.e., aspects to likely improve both direct (i.e., and more thereby indirect production) efficient are here outlined protocols The investment). more times, capital expression higher and reagents transfection of cost media, longer expensive expression to (due mammalian culture of bacterial with disadvantage cost perspective the strategic a in narrowing from results cost, in also reduction yields in considerable a increase The setting. academic an in reagents antibody recombinant glycosylated of production tive antibodies report culture mil of of liter per hundreds to ligrams tens from range that yields recombinant improved to leading enhancers, transcriptional utilize and ml) ( densities cell culture high on supporting of rely capable media methods developed Recently groups. research academic to expression available broadly more mammalian becoming now are systems serum-free and suspension-adapted Fig. Fig. upeetr Dt 1 Data Supplementary Although initially limited to biopharmaceutical companies, companies, biopharmaceutical to limited initially Although 1 1 ,

). Sequences for constant antibody domains are provided provided are domains antibody constant for ). Sequences > 2

> , Peter Schofield

100 100 mg/liter) that now allow for effective recombinant

1 g/liter pre-purification yields for specific recombinant recombinant for yields specific 1 pre-purification g/liter 19,2 0 . This substantial increase in yields enables effec enables yields in increase substantial . This T his his article provides detailed protocols, natureprotocols ), with variable domain sequences sequences domain variable with ), 1 , 2 17,1 , Carsten Zimmermann 8 . Notably, a number of studies studies of number a Notably, .

| VOL.13 NO.1VOL.13 2 1 . The protocol also protocol

1 1 × 10 | 2018 3 3 School of School of , Box Box 4 7 cells/

99 1 ) - - -

© 2017 Nature America, Inc., part of Springer Nature. All rights reserved. Figure 1 studies. animal preclinical and determination affinity structural, this protocol include following produced reagents antibody for Steps applications (BLI; Potential 45–57). interferometry biolayer using affinity antibody determination of for instructions provide we and 36–44), (Steps 100 antibody reagents by means of transient expression in mammalian cells. protocol Box 1 in mouse models of disease. The Fcregions of human and mouse IgG differintheir abilitytoengage murine Fc-gamma receptors (Fc from human ormouse domains. Thisisof particular importance ifthe therapeutic activityof the expressed constructs willbeassessed plasmid DNA)are sufficient for performing thisprotocol. generated bygene synthesis using commercial suppliers. Standard preparations of cloning vectorscontaining designed inserts (4 larly usefulfor performing the stepsdescribed above, necessary adjustments should bemade inorder toavoid repetitive DNAsequences (IDT’s codon optimization online toolisparticu forming thisstep,inorder tooptimizeexpression. Following back-translation, constructs should betestedfor sequence complexity and S acid sequences for these domains canbeobtained from publicly availabledatabases (such asUniProt (http://www.uniprot.org); see humanization strategies can beselectedusing arange of selection technologies, including phage displayand the immunization of animals incombination with mediate binding toantigens and their sequences canbederived from antibodies of known specificity. Alternatively, novel specificities terminal signal peptide (allowing for secretion into media), and aC-terminal stopcodon. Human antibody variable domains (V vector (Steps1–16).Key requirements for efficient expression of transgenes include the introduction of a Kozak sequence and aBamHIrestriction siteatthe 3 the multiple cloning siteof the selectedexpression vector. As anexample, wetypically introduce aKpnIrestriction site at the 5 cloning into asuitableexpression vectorshould beincluded inthe design. These sitesmust beabsent inthe insert and present within Several considerations must betaken into account when designing gene constructs for mammalian expression. First,restriction sitesfor purification, willensure thatonlyfullyassembledFabispurified. dine taginthe heavy chain,butnot the light chain,of Fabconstructs ( suited for the determination of binding affinities and for structure determination byX-ray crystallography Fc region and cannot bepurifiedbyprotein Gchromatography. Because of their monovalent nature, Fabfragments are particularly not feasible, and itadds versatilitytothe purification process. Thisisparticularly the case for Fabfragments, which lackthe antibody affinity chromatography (IMAC; Step30B).Thisisparticularly usefulininstances inwhich protein A/G/Laffinitychromatography is Fc undesirable for aspecificapplication, mutations canbeintroduced into mouse IgG2a/c and human IgG1 Fc regions inorder todisrupt humanized mice mice) beused. Alternatively, Fcregions derived from the human IgG1 isotypecanbeusedifexperiments are tobeperformed inFc mouse models, itisrecommended thatFcregions originating from murine IgG2a (for useinBalb/cmice) orIgG2c (for useinC57BL/6 the therapeutic efficacy of antibodies (ADCC) and complement-dependent cytotoxicity (CDC))inmice and consequently displaydifferential levels of Fc-mediated immune effectorfunctions (antibody-dependent cell-mediated cytotoxicity in

upplementary Data1

γ As outlined in Information required for designing the above-described constructs, including example amino acid and DNAsequences, canbefound The introduction of aC-terminal hexahistidine (6×HIS) tagallowsfor the purification of expressed constructs via immobilized metal An important consideration for the design of IgG and Fc-fusions iswhether the Fcregion (i.e., the C | S R binding and/or complement activation ( VOL.13 NO.1VOL.13 upplementary Data1

| Schematic overview of the procedure. Schematic representation of the steps required for the design and production of endotoxin-free recombinant Protein production Construct generation | Designofantibodyconstructsformammalianexpression | 5 2018 7 Figures 2 orinimmunodeficient mice engrafted with human immune cells Transfection andexpression | in mammaliancells and genesynthesis

) and back-translated into DNA.It isrecommended toutilizeappropriate mammalian codon tableswhen per natureprotocols Construct design 34–36,53,5 (Steps 23–29) Days 7–13 – 8 and Box . 1

3 4 , IgG, Faband Fc-fusion formats contain antibody constant domains (C . © 2017 Macmillan Publishers ofSpringer Limited, part Nature. All rightsreserved. ′ 5 end of designed constructs ( 6 . Therefore, ifthe contribution of Fc-mediated effectorfunctions istobefullyappreciated in S upplementary Data1 h t t p : / / Subcloning intoexpression w purification (Steps30–33) Recombinant antibody w 5 5 vector (Steps1–16) w . Importantly, immune effectorfunctions mediated byFccaninfluence .

i Days 13–15 S d Days 1–3 upplementary Data2 t ). d advantages advantages over other comparable aremethods as follows: specifically, More optimization. minimal requires and reagents antibodies in mammalian cells. It relies on commercially available recombinant of expression the for steps provides protocol This Advantages the approach of n a Fig. . c o m 3 / ), transfection of excess light chain,followed byIMAC c o d o 5 8 n . IfFc-mediated immune effectorfunctions are o p t ). Afterthe design isfinalized, constructs are – 8 ) for cloning into the pCEP4expression H Plasmid DNApreparation 2 and C Recombinant antibody L , C 3 characterization . Byincluding ahexahisti (Steps 17and18) (Steps 45–57) H Days 15and16 1, C Days 6and H 3 domains) isderived H 2, C H 7 3). The amino 5 2 , anN- H and V ′ end µ - γ g of - R- - γ R) L )

© 2017 Nature America, Inc., part of Springer Nature. All rights reserved. nioy omt ae rvdd ( provided different of are production formats the antibody for required constructs DNA of Antibodies and antibody-derived molecules. inserts cloned of overexpression drive to human utilized promoter/enhancer intermediate–early (CMV) widely cytomegalovirus the on relies which vector, expression pCEP4 the of use make we protocol, this In vectors. expression suitable into recloned are first constructs antibody lines, cell lian ( online databases from obtained are sequences region constant Antibody described Lee as in display, phage using selected clones high-affinity from derived are regions variable human of Sequences services. 1 Data designed are constructs encoding IgG, Fab, Fc-fusion proteins or bispecific scFv Expression constructs. design Experimental time of period quantities of the desired antibody are required in a relatively short large if utilized be can pools transfection stable from expression considered be should interest expressing of line cell antibody the mammalian stable a of generation the for resources and time of investment the development, further for polyethyleneimine reagent transfection polymer cationic inexpensive the of use ing methods, mak comparable of and optimization implementation the consider should researchers required, is expression transient ( transfections scale from obtained to small- are medium- studies preclinical typically cient amounts of recombinant and for antibody mouse structural suffi experience, our In transfections. large-scale of context the gents rea transfection alternative than expensive more are but ciency effi transfection of levels highest the display compounds These This protocol makes use of cationic lipids as transfection reagents. the approach of Limitations mutants. chain light and chain heavy different of pairings several screening when cal chain transfection ratio optimization heavy-to-light to amenable not are they preparation, DNA mid Although bicistronic chains constructs require less labor in antibody terms of plas both produce simultaneously to peptides relying on internal sites entry ribosomal (IRES) or self-processing vector bicistronic a single from than rather vectors, separate two from chains light and heavy antibody of expression the describe effective more antibody be still desired may domains containing constant vectors into cloning direct mat, for same the of variants antibody of number large a producing when instance for applications, other For protocol. the in errors sis synthe DNA of cost the in decline rapid a technologi driving advances of cal advantage takes outsourced This is companies. and specialized synthesis to gene by out carried is constructs The bivalent full-length IgG antibody format ( format antibody IgG full-length bivalent The First, in our protocol, the production of the designed DNA DNA designed the of production the protocol, our in First, 22,2 3 3 0 , and removes much complexity and a source of potential potential of source a and complexity much removes ,and ) and obtained from companies offering gene synthesis synthesis gene offering companies from obtained and ) . The cost of transfection . reagents can become The apparent in cost transfection of t al. et Supplementary Data 1 Data Supplementary 2 in silico in 1 o fo hmnzdhmn monoclonals humanized/human from or , 3 3 . 3 1

< . Once a lead antibody candidate is selected selected is candidate antibody lead a . Once (

500 ml of cell culture). If a larger scale of of scale larger a If culture). cell of ml 500 Box Box In the first part of the PROCEDURE, gene 1 ; ; Figs. 2 2 Figs. ). For expression in mamma in expression For ). upeetr Dt 1–8 Data Supplementary © 2017 Macmillan Publishers ofSpringer Limited, part Nature. All rightsreserved. 2 9 and and can become impracti 3

7 3 . and and Example sequences 24–2 3 Supplementary Supplementary Supplementary Supplementary 2 . Alternatively, Alternatively, . 6 . Second, we we Second, . 34–3 27,2 ). 6 8 ------. .

constant heavy; C and bispecific scFv formats ( ( Figure 2 Data 2 2 Data yield yield is also possible (100 mg/liter, post-purification Fab known with a of positive-control inclusion The yields. antibody recombinant of maximization for mended recom is formats) Fab and (IgG ratios transfection chain light heavy-to- of expression. Optimization for transient of levels high (Expi293F) line cell HEK293 DNA, we a use suspension-adapted Antibody expression. killing. tumor facilitate to antigen tumor-associated a and subunit receptor T-cell CD3 on receptors two the the of different same cell, and dual targeting a for useful applications therapeutic be of variety can antibodies bispecific Such antigens. ferent dif two of recognition for antibodies two from derived regions ( format tandem) (or scFv bispecific the Finally, 30B(iv)). (Step centrations con imidazole increasing with elutions sequential using IMAC ( Fc ( 6 Data Fc-fusion desired the for coding construct a purpose, this For proteins. Fc-fusion monovalent of production in vivo ( proteins bivalent Fc-fusion of expression the for allows region Fc antibody the to cytokines or proteins small of fusion Genetic 30B). (Step IMAC using purification incorporated efficient for is allow to chain heavy Fab the tag into hexahistidine a Instead, purification. A/G protein to amenable necessarily not are absent molecules is these Fab, in region Fc the As applications. determination affinity and crystallography for complexity reduces which region, body ( format Fab are activity ( antibody discussed to Fc- of functions effector contribution immune the mediated regarding considerations context, this In important mice. in studies preclinical performing for ful a – d ) Schematic representation highlighting IgG ( Supplementary Data 7 Data Supplementary half-life and activity ) is co-transfected with a construct encoding a His-tagged a His-tagged encoding a construct with ) is co-transfected

and | Antibody formats for expression in mammalian cells (overview). c a Box Box 3 ) has a long long a has ) Supplementary Data 4 4 Data Supplementary L upeetr Dt 8 Data Supplementary , constant light; V 1 Fc-fusion and and IgG C H Following large-scale preparation of plasmid upeetr Dt 6 Data Supplementary 1 Supplementary Data 1 Data Supplementary V natureprotocols C C C C d H H H H H ) with individual domains highlighted. C in vivo in 2 3 3 2 Targetin domai 3 C ). This is followed by purification by by purification by followed is This ). 8 L . We also provide for instructions the V H L n , variable heavy; V half-life and is particularly use particularly is and half-life g Supplementary Data 4 Supplementary 3 9 , including neutralization of of neutralization , including and V d b H ) incorporates variable variable incorporates )

| C VOL.13 NO.1VOL.13 a 5 H ), Fab ( 1 Bispecific ) lacks the Fc anti Fc the lacks ) V V scFv H ). The monovalent monovalent The ). L ) with prolonged prolonged with ) Fab L , variable light. V protocol Supplementary Supplementary H C b L ), Fc-fusion ( V L | V 2018 L and H , |

c 101 5 ) ). - - - - -

© 2017 Nature America, Inc., part of Springer Nature. All rights reserved. restriction site; SP, signal peptide; TGA, stop codon. Refer to Figure 3 102 protocol Box 2 • • • even ifthey havebeenautoclaved. includes bottlesusedfor storage of buffersand any materials usedfor dialysis of protein samples. Donot reuse storage containers, • tures. Ifanautomated systemisused, sanitizewith1MNaOH for atleast 1hbefore use. • rial contamination. appearance, lowviability of Expi293Fcellsand presence of rod-shaped particles uponmicroscopic examination are indicative of bacte • mammalian cells. • should betaken: reduced byion exchange chromatography (Steps39–44),measures to minimizeand prevent endotoxin contamination inthe firstplace an endotoxin content upperlimitof 36EU/ml(and, ideally, be assumed for amouse weighing 30g.Therefore, for example, a100- can bebasedonthe threshold pyrogenic human dose of 5EUperkg perh Endotoxin content isanimportant consideration for purifiedantibody samplesintended for usein

| VOL.13 NO.1VOL.13 Filter allbuffers using a0.22- Use aliquots of solutions tomeasure pH.Discard these aliquots aftermeasurement. Prepare elution and storage solutions using ultrapure water(Reagent Setup). Use disposable, sterile, certifiedpyrogen-free containers for the entire mammalian culture, purification and storage process. This Avoid the useof automated protein purification systems, especially ifthe systemisalsousedtopurifyprotein from bacterial cul Monitor the mammalian expression culture for bacterial contamination and discard any contaminated preparations. Unusual culture Use plasmid DNAobtained from low-endotoxin preparation kits(such asthe ZymoPURE Plasmid Maxiprep Kit)for transfection of S

| upplementary Data 2 Design of gene constructs. Schematic representation of the designed gene constructs coding for full-length IgG, Fab, Fc-fusion and bispecific scFv. (G/A) RS Bispecific scF (G/A) RS (G/A) RS Fc-fusion (G/A) RS (G/A) RS Fa (G/A) RS (G/A) RS Full-length IgG | b Endotoxin contaminationinrecombinant antibodypreparations 1 1 1 1 1 1 1 NN NN NN NNA NNA NNA NNA | AT AT AT 2018 TG TG TG TG G G G G G G G G G G SP SP SP SP SP SP SP v ...... |

natureprotocols – 8 for fully annotated example construct DNA sequences. Kozak sequences at positions T argeting domain C H V V V V V 2 H H L H L µ m filterunitand store them at4°C for upto6 months. © 2017 Macmillan Publishers ofSpringer Limited, part Nature. All rightsreserved. Fc region link Shor link Long er t er C C C C C H 1 H L H L 1 3 ...... TGA ...... TGA C H 2 V L Gly-Ser Fc region Gly-Ser

< ...... TGA RS RS

...... TGA 10 EU/ml)for mouse studies. Although endotoxin concentration canbe link Shor C 2 Hi 2 ta His tag H er 2 g s t C Fc region H 3 ...... TGA µ Light chain Light chain RS l daily injection (regardless of protein concentration) results RS 4 2 2 7 V . Forinstance, alimitof 0.15EUperh(i.e., 3.6EU/d)can H Hea C H RS 3 ...... TGA vy chain 2 link Long er IL-2-Fc Fc-His RS 2 in vivo V L Hea

−

3 and models. Guidelines for studies vy chain Gly-Ser

4 are highlighted in red. RS, ...... TGA His tag RS 2 - - © 2017 Macmillan Publishers ofSpringer Limited, part Nature. All rightsreserved. © 2017 Macmillan Publishers ofSpringer Limited, part Nature. All rightsreserved.

© 2017 Nature America, Inc., part of Springer Nature. All rights reserved. • • • • • • • • • • • • • REAGENTS M Bisp., bispecific; HC, heavy chain; LC, light chain; WT, wild type. affinity for HER2 was determined from Fab fragment fits ( 5–100 nM) were fitted using the 1:1 Langmuir model (red lines). Monovalent displaying binding to immobilized HER2 antigen. Binding curves (black lines, interferometry analysis of produced Herceptin IgG and Herceptin Fab, technical triplicates is shown (coefficient of variation using the QCL-1000 colorimetric LAL assay (Lonza). The mean ± s.d. of a ready-to-inject 168 2-Fc fusion protein scFv. ( (HC kDa for Herceptin IgG (HC NuPAGE 4–12% (wt/vol) Bis–Tris gel. Theoretical molecular weights are 146 conditions. Two micrograms of purified protein were analyzed using a analysis of sample purity under nonreducing and reducing (10 mM DTT) Figure 4 • c a kDa 110 160 260 T4 DNA (NEB, ligase cat. no. M0202L) formamide. ! Formamide, (Sigma-Aldrich, for biology molecular cat. no. F9037) Deoxynucleotide (dNTP)solution mix(NEB, cat. no. N0447L) (NEB, enzyme DpnI restriction cat. no. R0176L) (NEB, enzyme restriction BamHI-HF cat. no. R3136L) (NEB, enzyme KpnI-HF restriction cat. no. R3142L) QIAquick PCRPurification Kit or similar(Qiagen, cat. no. 28106) GoTaq DNA (Promega, polymerase cat. no. M3005) DNA (NEB,Phusion high-fidelity polymerase cat. no. M0530S) Data 5 pCEP4 Herceptin chain Fab (optional, construct light Data 4 pCEP4 Herceptin Fab heavy chain (optional, construct V04450) Mammalian expression vector (e.g., pCEP4, Fisher, Thermo cat. no. Custom synthesized oligonucleotides see (IDT); Box delivered incloning vectors such aspUC18, pUC19or pUC57. See Genscript, GeneArt, Biomatik, Twist Biosciences, SGI-DNA), typically Custom synthesized genes coding (e.g., formats antibody for designed IDT, ATER 10 15 20 30 40 50 60 80

CAUT Response (nm)

0.0 0.2 0.4 0.6 0.8 1.0 =

1 24 kDa, LC b k , and 5.65 ) Quantification of endotoxin content in purified recombinant IL- a ; plasmidavailable from theauthors uponrequest) ; plasmidavailable from theauthors uponrequest) I I (M

0 IgG ON | ALS Quality control of purified antibody preparations. ( IgG Nonreduced −1 × Wear gloves, nitrile andalabcoat handling when goggles Supplementary Data1–8 Supplementary s 10 −1 Fab 5 200 ) 9.81 Time (s

k IL-2-Fc 3 d

23 kDa), 84 kDa for IL-2-Fc and 53 kDa for bispecific 8 (s . The endotoxin content (in endotoxin units (EU)) of × µ −1 10 400 Bisp. scFv g/ml IL-2 ) ) –5

1.74 = 100 nM

10 nM 20 nM 50 kDa, LC K

5 nM IgG D 600 Reduced (M × 10

WT Fab ) –10 Fc solution (2.1 EU/ml) was determined IL-2-Fc . Response (nm)

0.0 0.2 0.4 0.6 0.8 1.0 Bisp. scFv

23 kDa), 47 kDa for Herceptin Fab k © 2017 Macmillan Publishers ofSpringer Limited, part Nature. All rightsreserved. 3.98 a (M 0 Fab −1 × 10 s −1 Table ) 5 200 b 6.24 Time (s k EU/ml = 10.0 d Supplementary Supplementary 1 0.0 2.5 5.0 7.5

(s 1.5%). ( Supplementary Supplementary × for details. K 10 −1 D 400 IL-2 ) )

–4

= WT a

1.6 nM). 1.57

) SDS-PAGE Fc K c D 600 ) Biolayer (M) × 10 Table

100 nM –9 10 nM 20 nM

5 nM 1 , purification strategies may be utilized if required if utilized be may protein strategies purification alternative antibody purification, single-step recombinant after pure preparations highly our yields Although IMAC. typically or approach A/G/L protein via reagent antibody recombinant of purification for harvested are supernatants Cell • • • • • • • • • • • • • • • • • tries tries available for capture of a ligand. Alternatively, binding kinet ForteBio). There is also a wide (Pall range surface of biosensor chemis systems Octet and BLItz the as such platforms, several on surface biosensor a on light of between waves patterns interference of measurement the on based is and affinity antibody–antigen testing for approach used widely a is BLI 45–57). (Steps BLI and 31) (Step conditions) reducing procedures for SDS-PAGE and (under both analysis nonreducing describe we protocol, this In methods. of variety large a by ized characterization. Antibody ( preparations protein fusion and antibody high-purity in resulting chromatography, affinity endotoxin see (EU)/ml, 10 units (typically, thresholds endotoxin the exceed that Preparations 36–38). (Steps determined are preparations the of Endotoxin removal. methods to assess binding affinity using the monovalent Fab Fab monovalent format. the antibody using affinity describes binding protocol assess to current methods the Thus, IgG. of nature bivalent the to due kinetics binding 2:1 immo represents an protein target with bilized interacting IgG full-length soluble a gener example, ( which affinity binding effects, of avidity overestimation an to all lead ally of devoid interaction, kinetics an binding of 1:1 the measure to designed are experiments Sciences). Life Healthcare (GE systems Biacore the as such platforms, several on available is SPR (SPR). resonance ics of purified antibodies can be characterized by surface plasmon Tris base(Sigma-Aldrich, cat. no. 154563) Glycine (Sigma-Aldrich, cat. no. 241261) rProtein Lagarose (Acro beads Biosystems, cat. no. ML-0422-01) rProtein Gagarose (Acro beads Biosystems, catno. MG-0422-03) rProtein A agarose (Acro beads Biosystems, cat. no. MA-0422-03) toxic; wear gloves andavoid times atall skin. contact with DMSO, sterile (Sigma-Aldrich, cat. no. D2650) no. 31985062) Fisher, IreducedOpti-MEM medium (Thermo serum cat. ExpiFectamine 293Transfection Fisher, Kit (Thermo cat. no. A14525)  Fisher,Expi293 serum-free medium (Thermo cat. no. A1435101) be routinely authenticated and tested for mycoplasma contamination. Expi293F cells (Thermo Fisher, cat. no. A14527) cat. no. D4201or D4202) ZymoPURE PlasmidMidiprep or Maxiprep Kit or similar(Zymogen, E. coli AHF7114) Ultrapure water Baxter, or similar; (sterile water for irrigation cat. no. 10× DPBSsolution (Gibco, cat. no. 14200-166; Reagent see Setup) Glycerol (Sigma-Aldrich, cat. no. G5516) Ampicillin (Sigma-Aldrich, cat. no. A9518) intestinal alkalinephosphatase (NEB,Calf cat. no. M0290L) Regardless of the platform used, it is important to ensure that that to ensure important is it used, platform the of Regardless

CR I DH5-alpha competent cells (NEB, cat. no. C2987H) T I CAL Protect medium from sources. light Box Box After antibody purification, endotoxin levels natureprotocols 2 ) are further purified by ion-exchange ion-exchange by purified further are ) Purified antibodies can be character Fig. Fig. 4 ). 4 1 . BLI can be performed performed be can BLI .

! | !

VOL.13 NO.1VOL.13 CAUT

CAUT I I ON ON protocol 4 DMSO is highly DMSOishighly

Cell lines should 0 . Fig. 4 Fig. | 2018

c ). For For ).

103 - - - - -

© 2017 Nature America, Inc., part of Springer Nature. All rights reserved. • • • • • • • • • • • • • • • • • • • • • • • • • • EQUIPMENT • • • • • • • • • • • • • • • • • • • • • • • • • • • • 104 DTT (Sigma-Aldrich,DTT cat. no. D9779) Yeast (BDBacto, extract cat. no. 212720) Tryptone (BDBacto, cat. no. 211699) EDTA (Sigma-Aldrich, cat. no. EDS) NaCl (Sigma-Aldrich, cat. no. S7653) Agar (BDDifco, cat. no. 281210) Parafilm M(Sigma-Aldrich, cat. no. BR701605) SYBR Safe DNA gelstain(Invitrogen, cat. no. S33102) Fisher,10× TBEbuffer (Thermo cat. no. B52) Agarose for gelelectrophoresis (Lonza, cat. no. 50004) Streptavidin biosensors for BLI(Pall ForteBio, cat. no. 18-5019) T7456-001) LiteSafe 0.5-mlblack microcentrifuge (Argos tubes Technologies, cat. no. EZ-Link NHS-PEG Lonza, cat. no. 50-647U) Endotoxin detection assay (QCL-1000 chromogenic LAL endpoint assay; InstantBlue protein stain(Expedeon, cat. no. ISB1L) NuPAGE buffer MES-SDSrunning (20×)(Invitrogen, cat. no. NP0002) Novex prestained Sharp protein standard (Invitrogen, cat. no. LC5800) NuPAGE LDSsamplebuffer (4×)(Invitrogen, cat. no. NP0007) cat. no. NP0336) NuPAGE Bis–Tris 4–12%(wt/vol) SDS-PAGE precast gel(Invitrogen, Cobalt chloride hexahydrate (Sigma-Aldrich, cat. no. 202185) MES monohydrate (Sigma-Aldrich, cat. no. M5287) dazole. Avoid skinandinhalation. contact with Wear gloves, nitrile goggles, alabcoat andaface imi handling maskwhen Imidazole (Sigma-Aldrich, cat. no. I2399) TALON resin (Clontech, affinity metal cat. no. 635502) (MerckpH-indicator strips Millipore, cat. no. 1.09535.0001) ! Hydrochloric (Sigma-Aldrich, solution, acid cat. 37%(wt/wt) no. 320331) gloves,wear nitrile andalabcoat. goggles ! hydroxideSodium solution, 10M(Sigma-Aldrich, cat. no. 656054) protocol cat. no. 16534-K) 0.22- (BD) Sterile syringes HiTrap Capto Q1-mlcolumns (GEHealthcare) Amicon Ultra-15 centrifugal filter units, 10 kDa (Millipore,Zeba spin desalting cat. columns, no. 7K MWCO, UFC901024) 2 ml (Thermo Fisher, cat. no.Pierce columns, plastic disposable Fisher cat. 10ml(Thermo no. 89889) 29924) SnakeSkin dialysis tubing (Pierce, cat. no. 68100) 0.22- Screw-cap (Nunc, cryotubes cat. no. 377267) Round-bottom (Corning, 14-mlsterile tubes cat. no. 352059) cat. no. 5100-0001) Cell-freezing container (Mr. Frosty Fisher, Thermo or similar; (Corning, cat. nos. 431143, 431144and431145). 125-ml,with Erlenmeyer 250-mland500-mldisposable flasksvented cap BLI system (ForteBio, BLItz or model similar)(optional) or similar)(optional) Surface plasmon resonance system (GEHealthcare, no. model Biacore T200 HPLC system (GEHealthcare AKTA Purifier or similar)(optional) XCell SureLock electrophoresis system (Invitrogen, cat. no. EI0001) DNA gelelectrophoresis chamber (Bio-Rad Mini-Sub or similar) Electrophoresis power supply (Bio-Rad PowerPac or similar) spectrophotometerUV–visible Milli-Q water system purification (Millipore) (optional) (Heraeus centrifuge Refrigerated Multifuge laboratory ×3or model similar) culture plates) Plate shaker capable of Orbital shaker, 125 r.p.m., for Expi293F cells (Infors Celltronfor Expi293F cells model or similar) Tissue culture incubator, 37°C, 5–8%CO Shaking incubator, 37°C, 250r.p.m., for cyclerThermal (Bio-Rad, no. model C1000Touch or similar) Trypan blue (Sigma-Aldrich, cat. no. T8154) Liquid nitrogen

CAUT CAUT

| VOL.13 NO.1VOL.13 µ µ m syringe-driven filtersm syringe-driven (Millipore, cat. no. SLGV013SL;Sartorius, filterm vacuum units(Corning, cat. no. 431097) I I ON ON Work inafumehood, gloves, wear nitrile andalabcoat. goggles hydroxide Sodium solution iscaustic. Work inafumehood, | 4 2018 -Biotin (Thermo Fisher,-Biotin (Thermo cat. no. 21329) ≥ 1,000r.p.m. (optional, for expression intissue |

CAUT DH5-alpha cells I ON Imidazole istoxic.

900 ml of ultrapure water ultrapure to make900 mlof thePBSbuffer. buffer The stored canbe at Low-endotoxin PBSbuffer for upto 4weeks. stock100 mg/mlampicillin solution. stored medium canbe The at4°C Cool thesolution to room temperature 1mlof (20–25°C)andadd the final volume with deionizedto 1liter water. Autoclave thesolution. NaCl deionized water.5 gof in900mlof Adjust thepHto 7.5andbring medium LB ampicillin before use. stored at4°Cfor upto 4weeks. inflow plates The bench dried shouldbe stockampicillin solution. Pour thesolution into plates. plates The canbe Autoclave thesolution. 100mg/ml Cool thesolution to 1mlof 50°Candadd pH to thefinal 7.5andbring volume with deionizedto 1liter water. deionized water. in900mlof yeast extract and5gof tryptone Adjust the plates agar LB ampicillin concentration ampicillin (final medium LB or agar LB in 1,000-fold diluted freshly be should aliquots 0.22- a through 1-ml aliquots stock of solution. solution Store them at the Filter water. deionized of mg/ml) (100 solution stock Ampicillin REAGENT SETUP • • • goggles andalabcoat 5M HCl. handling when goggles storedtion canbe at 4°Cfor several months. water.using ultrapure Filter thesolution through a0.22- water. Adjust thepH to thevolume 7.6using5MHCl andbring to 200ml Tris-HCl solution (1M) 5MHCl. handling when 4 °Cfor several months. Filter thesolution through a0.22- to thevolume 2.7using5MHCl andbring to 1liter water. usingultrapure glycine and5.8gNaCl water. ultrapure 7.5 gof in900mlof Adjust thepH Glycine–HCl elution buffer (0.1Mglycine, 0.1MNaCl, pH2.7) for several months. the solution through a0.22- 1 MNaOH thevolume andbring water. ultrapure to 500mlwith Filter NaCl water. ultrapure 8.8 gof in450mlof Adjust thepHto 5.0using TALON buffer regeneration Avoid skinandinhalation. contact with gloves,nitrile googles, alabcoat andaface imidazole. handling maskwhen gloves, andalabcoat 5MHCl. handling when goggles solution stored canbe at4°Cfor several months. concentration volume TALON additional to 500mlwith washbuffer (finalimidazole buffer anddissolve TALON elution buffer for several months. Filter the solution through a 0.22- volume to PBS(final additional 1liter with NaCl concentration buffer anddissolve. Adjust thepHto 8.0using1MNaOH thefinal andbring TALON washbuffer a labcoat. water to NaOH; gloves, mixthesolution andwear gently; nitrile and goggles for several months. water. ultrapure solution to 90mlof stored canbe This atroom temperature hydroxideSodium (1M) and alabcoat. water, notwater to gloves, acid; mixthesolution wear gently; nitrile goggles for several months. water. ultrapure (HCl) to 58.6mlof stored canbe This atroom temperature Hydrochloric acid(5M) 4 °Cfor several months. h IDT Codon Tool Optimization (Integrated DNA Technologies, h SnapGene or SnapGene Viewer software (GSLBiotech, Hemocytometer (Sigma-Aldrich, cat. no. Z359629) t t t t p p : : / / / / s w g w . i d w t . d s n n

= a a

p 150mM). Filter thesolution through a0.22- . c g o . e Adjust thepHto 8.0using5MHCl. thefinal Bring ! ! m n

CAUT CAUT e Add 21.2 g of NaClAdd low-endotoxin 21.2gof to 900mlof PBS / . C

Add 5.1 g of imidazole to 450 ml of TALON imidazoleAdd to 450mlof 5.1gof wash o o

! Dissolve 10 g of tryptone, 5 g of yeast extract and yeast extract 5gof tryptone, Dissolve 10gof

d =

Dissolve 24.2 g of TrisDissolve 24.2gof ultrapure base in180mlof Add 41.4 ml of 37% (wt/wt) hydrochloric 37%(wt/wt) Add acid 41.4mlof CAUT Add 10 ml of 10MsodiumhydroxideAdd 10mlof (NaOH) I I Dissolve 15 g of agar,Dissolve 15gof NaCl, 5gof 10gof o

100 ) ON ON µ n

Mix 100 ml of 10× DPBS (Thermo Fisher) with Fisher) with 10×DPBS(Thermo Mix 100mlof m filter.The solution be stored can at4°C O Dissolve 2.1 g of MES monohydrateDissolve 2.1gof and Work infumehood; NaOH add to water, not Work inafumehood, slowly to acid add p I µ ON t ) g/ml). µ µ m filter.The solutionbe can stored at 4 °C m filter.The solution be stored can at Wear gloves, nitrile andalabcoat goggles

Dissolve 1 g of ampicillin in 10 ml ml 10 in ampicillin of g 1 Dissolve

! −

CAUT

20 20 °C for up to 1 year. Thawed !

CAUT I ON !

µ Wear gloves, nitrile

CAUT I ON m filter.The solu µ m filter. Prepare Prepare filter. m Wear nitrile µ I ON m filter.The

Dissolve Wear 500mM).

© 2017 Nature America, Inc., part of Springer Nature. All rights reserved. T ? single band of desired sizeispresent. 4| length. ForPhusion HFpolymerase, use20sperkbof insert. per percentage point of final formamide concentration. Elongation time depends onutilizedDNApolymerase and oninsert ing temperature) calculator supportedbythe polymerase manufacturer. Reduce calculatedannealing temperature by0.6°C  3| pCU57 rev (  or similar)and aprimer pairrecommended for the DNAvectorinwhich the insert isdelivered: 2| such aspUC18,pUC19orpUC57. S 1| S PROCE a Formamide (20% (vol/vol)) GC buffer (5×) Template DNA (100 ng/ Ultrapure water C (Steps (Steps 1–3) Subcloning PCR P 27 2–26 1 C Total Phusion HF polymerase (NEB) Rev primer (10 Fwd primer (10 dNTP mix (10 mM) Colony PCR (Steps 11–13) upplementary Data1 ubcloning andlarge-scale preparation of D

TROU

omponent ycle number urpose b

CR CR le le After thermal cycling, analyze 5 Amplify the designed insert using the following PCRprogram: Prepare the following PCRmixtoamplifythe designed insert, using ahigh-fidelity DNApolymerase (NEBPhusion HF Using ultrapure water, resuspend the designed gene-synthesized constructs (seeExperimental design, I I 1 1 T T D I I B URE | CAL CAL LES

Primer pair sequences for subcloning PCR and colony PCR. T

H able STEP STEP OOT µ µ

M) M) Ifusing adifferent primer pair, determine the optimal annealing temperature using anonline T Foramplification from pUC18,pUC19orpUC57plasmids, weusethe primers pUC57fwdand 1 I N Denature (98° ). G µ l) – 8 10 10 s 30 s ) toafinal concentration of 100 ng/ pUC57, pUC57, pUC19 or pUC18 T emplate plasmid(s) C © 2017 Macmillan Publishers ofSpringer Limited, part Nature. All rightsreserved. pCEP4 ) µ A l of PCRproduct bygel electrophoresis ona1%(wt/vol) agarose gel toensure thata nneal (54° 30 30 s NA A constructs mount ( C P pUC57 pUC57 fwd pCEP4 pCEP4 fwd ) pUC57 pUC57 rev pCEP4 pCEP4 rev rimer pair 100 10 20 58 4 4 2 1 1 E xtend (72° m l) 10 10 min ● 40 40 s µ

l. The constructs are typically delivered incloning vectors T IMI GCTTATAATGGTTACAAATAAAGC C GAGGTCTATATAAGCAGAGC P GGAAACAGCTATGACCATG GTAAAACGACGGCCAGTG N ) rimer sequence5 G 7d ′ natureprotocols –3 ′ A nnealing temp.(°

| VOL.13 NO.1VOL.13 Box 51 54 protocol

1 and m (melt | 2018

C ) | -

105 © 2017 Nature America, Inc., part of Springer Nature. All rights reserved. similar) and aprimer pairrecommended for the mammalian vectorinto which the insert wascloned. 11| overnight at37°C. transformed cellsonLBagarplatescontaining ampicillin (orthe appropriate antibiotic for plasmid selection) and incubate on ice againfor 5min.Add 200 (NEB 5-alphaorsimilar)and mix.Incubate the cellsonice for 30min,heat-shock at42°Cfor 45sand incubate 10| in atotalvolume of 10 Mix 100ng of digested vector, the appropriate amount of digested insert, 1 9|  concentration. the dephosphorylated vectorbyspin-columnpurification (Qiagen QIAquick), eluteinultrapure waterand determine the DNA 8| enzymes and, consequently, insert design may need tobemodified. XhoI and BamHI-HFrestriction enzymes (NEB).For subcloning into alternative expression vectors, the choice of restriction  digest for 2hat37°C. enzyme pair. Thiswillreduce the likelihood of vectorreligation inStep9.Use tenunitsof eachenzyme per (Optional) Digest withanadditional restriction enzyme thathasarestriction sitelocatedbetweenthe sitesof the cloning 7| enzymes (NEB). (  trapure waterand determine DNAconcentration using aUV–visiblespectrophotometer. while digesting the PCRproduct). Purifydigested inserts byspin-columnpurification (e.g., Qiagen QIAquick), eluteinul manufacturers’ instructions). Use tenunitsof each enzyme per double digestion orassequential digestions with eachenzyme, depending ondigestion buffercompatibility(follow 6| Determine the DNAconcentration using aUV–visiblespectrophotometer. GATC sites. PurifyPCRproducts byspin-columnpurification (Qiagen QIAquick orsimilar)withfinal elution inultrapure water. (can alsobeperformed overnight). Thisstepremoves templateDNAvia enzymatic digestion of bacteria-derived methylated 5| 106 S Total GoTaq polymerase (Promega) Rev primer (10 Fwd primer (10 dNTP mix (10 mM) Formamide (20% (vol/vol)) GoTaq buffer (5×) Ultrapure water C protocol

omponent upplementary Data2

PAUSE CR CR

The next day, prepare the following PCRmix(volumes are for asingle PCR)using Taq DNApolymerase (Promega GoTaq or Fortransformation, add 2 | VOL.13 NO.1VOL.13 Ligate the digested insert (Step6)and digested dephosphorylated vector(Step8)ata3:1insert/vector molar ratio. After vectordigestion, add 20unitsof calfintestinal alkaline phosphatase, mixand incubate for 1hat37°C.Purify At the same time, digest 10 Digest 2 Add 10–20unitsof DpnIrestriction enzyme directly tothe amplifiedPCRproduct, mixand incubate at37°C for 1h I I T T I I CAL CAL

I STEP STEP NT µ µ g of purifiedPCRproduct withthe desired restriction enzymes. Thiscanbeperformed asasimultaneous µ | The digested vector and inserts can be stored at M) M) 2018 We typically subclone designed inserts into pCEP4expression vectorsimultaneously digested with KpnI-HF, We typically design antibody constructs witha5 |

natureprotocols µ – l. Incubate the mixture for 2hatroom temperature. 8 ), and perform simultaneous digestion of PCRproducts withKpnI-HFand BamHI-HFrestriction µ l of ligation reaction to 20 µ µ © 2017 Macmillan Publishers ofSpringer Limited, part Nature. All rightsreserved. l of LBmedium tothe transformed cellsand rescue for 1hat37°C,250r.p.m. Platethe g of desired mammalian expression vector, using the same enzyme pairutilizedfor inserts. A mount ( 0.25 29.8 50 10 2 2 1 5 m l) µ l of chemically competent µ g of DNAand digest for 2hat37°C(proceed withStep7

−

20 °C for several years. ′ KpnIrestriction siteand a3 µ l of T4ligase and 1 E. coli DH5-alphacells ′ BamHIrestriction site µ l of 10×T4ligase buffer µ g of DNAand

© 2017 Nature America, Inc., part of Springer Nature. All rights reserved.  E mammalian cells.  ? laminar flow hood byfiltering through a0.22- or similar).Determine the DNAconcentration using aUV–visiblespectrophotometer. Sterilizethe purifiedplasmid DNA ina DNA from the cellpelletsusing aplasmid purification kitthatcontains endotoxin removal steps(e.g., ZymoPURE Maxiprep 18| cultures at37°C,250r.p.m. overnight. 17| tubes at 37 °C for 8 h, 250 r.p.m. tip and transfer the tip to a 14-ml round-bottom tube containing 1 ml of LB medium plasmid DNA purification (Steps 17 and 18). To generate a starter culture, stab the frozen glycerol stock with a sterile pipette  glycerol. Placethe mixture into acryotube, snap-freeze itinliquid nitrogen and store itat 16| at 37°C,250r.p.m. overnight. to inoculate 2-mlcultures of LBmedium containing ampicillin (orthe appropriate antibiotic). Incubate the inoculated tubes 15|  ? PCR amplification). validate the sequence of the insert through Sanger sequencing (youcanusethe same forward orreverse primer utilizedfor the cloned insert. PurifyPCRproducts containing the desired DNAband byspin-columnpurification (Qiagen QIAquick) and 14| length. ForGoTaq DNApolymerase (Promega), use1minperkbof insert. age point of the final formamide concentration. Elongation time depends onthe utilizedDNApolymerase and onthe insert T If youare using aprimer pairother thanpCEP4fwd/pCEP4rev, determine the optimal annealing temperature using anonline 13|  plates withParafilm Mand store at4°C transfer ittothe PCRreaction mixand pipetteupand down. Donot discard the platescontaining transformants. Sealthe 12| high-fidelity DNApolymerases, asthey are readily inhibitedbybacterial celllysates.  rev (  2–36 1 37 m xpression by secretion into mammalian culture medium C

TROU TROU

ycle number calculatorsupportedbythe polymerase manufacturer. Reduce the calculatedannealing temperature by0.6°C perpercent PAUSE PAUSE PAUSE PAUSE CR CR CR Pellet the bacterial cellsbycentrifugation at3,200 Use 150 The following day, make glycerol stocksof selectedclones bymixing 700 Aftervalidation bysequencing, pick colonies containing the correct inserts from stored plates(Step12)and usethem Analyze 5 Runthe following PCRprogram: Mark and number the location of sixtoeight colonies onthe plate. Pick aportion of acolony withasterilepipettetip, T I I I able T T T I I I B B CAL CAL CAL LES LES

PO PO PO PO 1 ). Allstepsinthis section should beperformed inalaminar flow hood, providing asterileenvironment

H H I I I I STEP STEP µ NT NT NT NT OOT OOT l of the remaining culture (orstarterculture) toinoculate 150mlof LBmedium µ The sealed plates can be stored at 4 °C for up to a week. Sterile DNA preparations can be stored at Glycerol stocks can be stored at Depending on the provider, the sequencing results are typically available between 2 and 3 d after submission. l of the colony PCRproducts bygel electrophoresis ona1%(wt/vol)agarose gel toverifythe presence of AlwaysuseaTaq DNApolymerase (Promega GoTaq orsimilar)for colony PCRapplications. Avoid using Foramplification from pCEP4plasmids, weusethe primers pCEP4fwdand pCEP4 Denature (95° I I N N G G 6 6 min 30 30 s C ) © 2017 Macmillan Publishers ofSpringer Limited, part Nature. All rightsreserved. A nneal (51° 30 30 s µ m syringe-driven filter.

−

80 °C for several years and can be used to inoculate starter cultures for C ) g for 25min,4°C.Discard the supernatants and purifythe plasmid

− E

xtend (72° 20 °C indefinitely and thawed before transfection of ●

10 10 min T 2 2 min IMI N G 6 d C ) µ l of culture with300

ampicillin. Incubate the inoculated natureprotocols

−

80 °C.

ampicillin. Incubate the

µ l of 50%(vol/vol)

| VOL.13 NO.1VOL.13 protocol

| 2018 |

107 - © 2017 Nature America, Inc., part of Springer Nature. All rights reserved. T ? for Fc-fusion and His-tagged Fc(seeExperimental design and  required (e.g., antibody light and heavy chains,  medium ina15-mltube. Leavethe mixture atroom temperature until the transfection reagent is ready touse(Step25). 24| are not compromised. to passage 40;however, researchers should monitor high-passage cultures toensure thatdoubling times and viability  amount of cells, media, plasmid DNA,transfection reagent and enhancers proportionately, asdescribed in 125-ml flaskand adjustthe volume to25.5mlusing Expi293 medium. Forcustomtransfection volumes, simplyadjustthe 23| transfection, aminimum of 40×10 22|  at DMSO and store them insterilecryotubes(1×10 21| ? 1–2 passages afterthawing. should reach ~5×10  in fresh prewarmed Expi293medium. trypan blueexclusion. Alternatively, useanautomated cellcounter. Seednew flasksat3×10 20|  shaking (125r.p.m.). 125-ml sterilepolycarbonate Erlenmeyer flask.Culture the cellsat37°C,ina5–8%CO temperature and remove the supernatant. Resuspend the cellsin30mlof Expi293medium and transfer them toa 19| 108 a (r.p.m.) Shaker speed Enhancer II ( Enhancer I ( ( Transfection reagent Opti-MEM I ( Plasmid DNA ( in Expi293 medium No. of Expi293F cells flask Plate or Erlenmeyer volume T protocol

µ TROU TROU ransfection

b PAUSE

CR CR CR CR CR − l)/OptiMEM l)/OptiMEM (

le le Prepare DNAfor transfection bymixing atotalof 30 Onthe day of transfection, count the cellsand determine viability. Fora30-mltransfection, add 75×10 24hbefore transfection, count the cellsand adjustcelldensity to2×10 Forcryopreservation of Expi293Fcells, resuspend low-passage cultures inExpi293medium containing 10%(vol/vol) Passage the cellsevery3–4d. When passaging, count the cellsand determine their viability using ahemocytometer and Thaw1×10 |

VOL.13 NO.1VOL.13 80 °C.The next day, transfer the tubestoaliquid nitrogen tankfor long-term storage. I I I I I 2 2 T T T T T I I I I I B B | CAL CAL CAL CAL CAL LES LES

Recommended transfection and culture conditions for the Expi293 transient mammalian expression system PO µ

µ H H I µ STEP STEP STEP STEP STEP

l) NT µ l) OOT OOT l) µ g)/ | l) Expi293 cells can be stored in liquid nitrogen for several years. 2018 7 Expi293Fcellsin20mlof Expi293 medium prewarmed to37°C.Spinat350 Forexpression of monovalent Fc-fusion proteins, co-transfect Expi293FcellswithDNAconstructs coding The totalamount of transfected DNAshould bekept at30 We recommend transfecting Expi293Fcellsbetweenpassages 3and 15.Cellsmay beusedup Cellviability should typically exceed 95%.The doubling time for Expi293Fcellsis~24h,and cultures Allowthe cellstoreach ~3×10 I I N N G G | 6

1,000 1,000 (plate shaker) 1.75 1.75 × 10 cells/ml4dafterpassaging. Slowergrowth rates and lowercellviability may beobservedinthe first 96-Well (deep well) natureprotocols 0.7 ml 1.9/35 0.7/35 3.5 35 6 in 0.6 ml © 2017 Macmillan Publishers ofSpringer Limited, part Nature. All rightsreserved. 6 totalcellsinculture isrecommended. 2.5 2.5 × 10 Fig. 24-Well 7 2.7/50 1/50 1 ml cells/tube).Placethe tubes into acell-freezing container and freeze 6 190 6 50 cells/mlbefore firstpassage (usually 4–5d). in 0.85 ml 5 5 ). µ g of plasmid(s) from Step18with1.5mlof Opti-MEMIserum-free S upplementary Data6 12.5 12.5 ×10 13.5/250 125 125 ml 5/250 5 ml 125 250 6 25 in 4.25 ml µ 6 g, evenifco-transfection of twoplasmids is cells/mlusing Expi293medium. Fora30-ml 75 75 × 10 and 2 humidified atmosphere with 7 81/1,500 30/1,500 125 125 ml 30 ml 1,500 ). 6 125 150 in 25.5 ml 5 cells/mlbydiluting the cells g for 5minatroom 1 7 T . 250 250 × 10 able 6 cellstoanew 270/5,000 100/5,000 100 ml

500 500 ml 2 5,000 125 500 .

in 85 ml

© 2017 Nature America, Inc., part of Springer Nature. All rights reserved. ( the affinity resin volume according tothe expected protein yield and resin-binding capacity. aim tominimizecontamination withendotoxin. For purification from different volumes of culture supernatant, adjust recommended. The stepsbelowdescribe the purification of recombinant proteins from a30-ml transfection volume and tag (6×HIS) ( after asingle purification step.Ifprotein A/G/Laffinitychromatography is notfeasible, incorporation ofa hexahistidine affinity chromatography (option A)provides astraightforward approach that generally results inhigh levels of purity Fc region and V 30| P recommended. may lead to reduced purification yields due to protein aggregation. Refiltering of stored supernatants after thawing is  ? 4 °Cand filterthe supernatants using a0.22- 29| and havebeenshown toenhance recombinant protein expression yields inmammalian cells propionate deacetylase inhibitorssuch asvalproic acid and sodium  transfected cells. (from the ExpiFectamine 293Transfection Kit)tothe 150 28| humidified atmosphere withshaking (125 r.p.m.). culture flask.Culture the cellsat37°C,ina5–8%CO (from Step23)bydripping the solution whileagitating the 27| followed by20minof incubation atroom temperature. Step 24)withdilutedtransfection reagent (from Step25), 26| ? room temperature. 1.5 mlof Opti-MEMIand incubate the solution for 5minat based transfection reagent (ExpiFectamine 293orsimilar)with 25| A urification urification of antibody reagents

(iii) TROU TROU (iv)

(ii) ) PAUSE CR (i) Purifythe expressed antibody-derived molecules byaffinitychromatography using immobilized protein A(binds to Harvest the Expi293Fsupernatant 6–7daftertransfection. Pellet the cellsbycentrifugation at3,200 The next day, at16–20hposttransfection, add Add all3mlof DNA–lipid complex mixtoExpi293Fcells Prepare DNA–lipid complexes bymixing dilutedDNA(from Inaseparate 15-mltube, mix81 P µ I

urification of antibody reagents by protein l of Enhancer Iand 1.5mlof Enhancer IIsolutions T yields due toprotein aggregation.  above. Stopelution when the OD through into apyrogen-free tubeprefilled with1ml of Tris-HCl solution (pH7.6).Collectadditional fractions as keep them onice orat4 °C before SDS-PAGE analysis (Step31). twice with10CVsof low-endotoxin PBS.Collectthe flow-throughs from both the supernatant and the washes, and PBS buffer. Wash the resin with10columnvolumes (CVs)of ultrapure water, then equilibrate with10CVsof low-endotoxin for future use. PBS, 10CVsof ultrapure waterand 10CVsof 20%(vol/vol) ethanol. Store the resin in20%(vol/vol)ethanol at4°C After elution, subjectthe resin tosequential washes with10CVsof glycine–HCl (pH2.7),10CVsof low-endotoxin For elution of bound recombinant protein, add 4ml of glycine–HCl elution buffer(pH2.7)and collectthe flow- Apply the filtered supernatant from Step29tothe columnand allowittoflowthrough by gravity. Wash the resin Transfer 1mlof Protein G,Protein LorProtein A pure resin toanew disposableplastic gravity flowcolumn. I B B CAL

LES LES

PAUSE PO 4 2

H H I . These compounds promote transcriptional activation STEP NT Box OOT OOT H

The filtered supernatants can be stored at 4 °C for up to 3 d or at 3 domains), protein G(binds toFcregion) orprotein L(binds toV PO Enhancer solutions contain histone 1 I I N N ) for protein purification by means of immobilized metal affinitychromatography (option B)is I NT G G Elution fractions canbe stored at4°Cfor upto3d. This, however, may leadtoreduced purification © 2017 Macmillan Publishers ofSpringer Limited, part Nature. All rightsreserved. ●

µ T IMI 280 nm l of cationic lipid- N G of the fractions iszero (thisisusually afterthree tofivefractions). µ 2 d m filterunit. A

/G/

affinitychromatography

Transfection of the HC construct alone resulted in no secreted product 1:2 and 1:4 HC/LC ratios resulting in 17% and 32% less IgG, respectively. transfection ratio resulted in the highest yield of fully assembled IgG, with Image densitometry analysis (ImageJ, NIH) revealed that the 1:1 HC/LC 19.5 in the pCEP4 mammalian expression vector. Four days after transfection, chain (HC) only, light chain (LC) only or varying ratios of HC/LC DNA, all (IgG format). Expi293F cells (5 ml) were transfected using 5 Figure 5

µ kDa l of culture supernatants were analyzed by nonreducing SDS-PAGE. 110 160 10 15 20 30 40 50 60 80

| Optimization of heavy/light chain DNA transfection ratios only HC

− L

kappa domains) 20 °C for several weeks. This, however, ● natureprotocols only

LC T IMI HC/LC 37,43,4 N 1:1 G 3h HC/LC 4 1:2 . 4 5 . Protein A/G/L HC/LC

1:4 | VOL.13 NO.1VOL.13 g for 20minat protocol µ

Excess LC IgG g of heavy

| 2018

0 | .

109 © 2017 Nature America, Inc., part of Springer Nature. All rights reserved.  the protein concentration afterthawing. 35| analysis tool(e.g., ExPASy ProtParam, its molar extinction coefficient and OD 34| Stop the concentration immediately ifthe antibody solution becomes cloudy, which is indicative of aggregation. 3 mlisreached and/or until aconcentration of 0.5–1mg/ml isachieved (seeANTICIPATED RESULTS for expected yields).  prevent protein aggregation. stability isunknown, werecommend amoderate speedof centrifugation during concentration ( 33| dialysis stepthe following day. at 4°Cusing dialysis tubing (SnakeSkin 10KMWCO, Pierce). Perform anadditional dialysis stepovernight and afinal 32| ? of protein bands. electrophoresis, remove the gel from the cassetteand useaCoomassie-based dye (InstantBlue or similar)for staining Bis-Tris SDS-PAGE precast gel and perform electrophoresis for 35minat200VinMES-SDSrunning buffer. After supernatant flow-through and washes. Loadthe prestained protein standard and samplesinto wells of a4–12%(wt/vol) of ultrapure water(nonreduced sample)or3 31| (B) 110 protocol

(iii) TROU (iv)

(ii) PAUSE (v) CR (i)

Prepare aliquots of the concentrated samplesand freeze them at Filterthe concentrated samplethrough asyringe-driven 0.22- Concentrate the dialyzed protein using acentrifugal concentrator ( Combine the fractions with visibleprotein bands and dialyze against Analyze allfractions bySDS-PAGE. Mix19.5 | P VOL.13 NO.1VOL.13 I

urification of antibody reagents by immobilizedmetalaffinitychromatography T ? Wash the columntwice with10CVsof TALON washbuffer. ? 20 min. TALON resin tothe filtered supernatant and mix gently at room temperature using a rotating mixer at20 r.p.m. for wash step.Resuspend the washed resin in5mlof low-endotoxin PBSbuffer. mix the solution and centrifuge itat300 yields becauseof protein aggregation.  flow-through using Protein Gbeadsas described inStep30A. (one 6×HIS tag)from Fc-Hisdimers (two6×HIS tags).Bivalent Fc-fusion (no 6×HIS tag)canbepurifiedfrom the 5 mMincrements, followed byfinal elution with10ml of TALON elution buffer)toseparate monovalent Fc-fusion TALON resin and elutewithten3mlfractions containing increasing concentrations of imidazole (5mMto50in  fractions). pyrogen-free tube. Repeatthe process until the OD After elution, remove the imidazole from the resin byadding 10CVsof TALON regeneration buffer, followed bywashes Elute the bound recombinant protein byadding 3–5mlof TALON elution bufferand collectthe flow-through into a Transfer the supernatant/resin mixtoanunused disposableplastic gravity flowcolumnand collectthe flow-through. Using apHteststrip,ensure thatthe pHof the filtered supernatant from Step29is Dispense 1mlof TALON metal affinity resin into a15-mlpyrogen-free tube. Top upwithlow-endotoxin PBSbuffer, ethanol. chloride hexahydrate (resin becomes pinkagain).Wash the resin withultrapure waterand store itin20%(vol/vol) white), followed bytwowashes with10CVsof ultrapure water. Recharge the resin with10CVsof 100mMcobalt  ethanol at4°Cfor several months. with 10CVsof ultrapure waterand 10CVsof 20%(vol/vol)ethanol. TALON resin canbestored in20%(vol/vol) I B

CAL TROU TROU LES

PAUSE CR CR PO I

I H I STEP T T NT OOT I B I B

CAL CAL LES LES | The protein aliquots can be stored at

2018 PO

We typically concentrate solutions using sequential 15-mincentrifugation stepsuntil afinal volume of I N

H H I STEP STEP G NT OOT OOT |

natureprotocols Elution fractions canbestored at4°Cfor upto3 d. This, however, may leadtoreduced purification Ifpurifying monovalent Fc-fusion proteins (seeExperimental design), bind the supernatant to To completelyregenerate the resin, stripcobaltions with10CVsof 100mMEDTA (resin turns I I N N G G © 2017 Macmillan Publishers ofSpringer Limited, part Nature. All rightsreserved. h 280 nm t t p

: / reading. The extinction coefficient canbecalculatedusing aprotein sequence / µ w l of 100mMDTT (reduced sample).Alsoprepare nonreduced samplesfor e g b µ for 2minatroom temperature. Discard the supernatant and repeat the . l of eachfraction with7.5 e x p a

− s

80 °C for several years. y . o 280 nm r g / p r of the fractions iszero (thisisusually afterthree tofive o

t p µ a m filterand calculatethe protein concentration using r

− m

≤ 80 °Cfor prolonged storage. Refilterand determine / 10 kDacut-off) prewashed withPBS.Ifthe protein ). ≥ 30 volumes of low-endotoxin PBSbufferfor µ l of 4×LDSsamplebufferand either 3 ●

> T

pH 6.5.Add the resuspended IMI ≤ 1,300 N G 3h g at4°C)inorder to

µ ≥

l 2 h

≥

2 h

© 2017 Nature America, Inc., part of Springer Nature. All rights reserved. 0.2 and 0.7ml. Add the sampletothe PBS-equilibrated desalting columnand centrifuge the columnat1,000 46| Transfer the PBS-equilibrated columntoanew centrifuge tube. column, centrifuge the columnat1,000 similar) ina15-mlcentrifuge tubeat1,000 45| the monovalent Fabformat. between biotinylated target protein coupledtostreptavidin BLIbiosensors and solubleantibody expressed and purifiedin  T  before storage and/or administration toanimals. described inStep32.Filterthe samplethrough asyringe-driven 0.22- 44| anion-exchange columns orwithcolumns thathavebeendepyrogenated with1MNaOH following previous runs. repeated multiple times toachieve anacceptableendotoxin content. Repeatedruns canbeperformed using new 43| purified protein isflowing through the column and notbinding toit. 42| and stopcock. automated systeminwhich the tubing hasbeendepyrogenated with1MNaOH, ormanually withadisposablesyringe Use the flow rate and equilibration volumes recommended bythe manufacturer. Thisprocess canbeperformed using an 41| dialysis stepthe following day. 4 °C,using dialysis tubing (SnakeSkin 10KMWCO, Pierce). Perform anadditional dialysis stepovernight and afinal (e.g., for aprotein withpI 40| h 39| for endotoxin removal. on existing guidelines ( of purifiedprotein for any planned animal studies. Determine ifthisisanacceptableorpotentially pyrogenic dose, based 38| sample toensure thatone of them falls withinthe dynamic range of the assay. Chromogenic LALAssay Kit,Lonza).Foraccurate determination of endotoxin content, measure multiple dilutions of the 37| 36| desired level. In most cases, thisprocess canbeperformed using low-endotoxin PBSbuffer(Reagent Setup)withthe pHadjustedtothe endotoxins retain anoverall negative charge and canberemoved from the sampleusing astrong anion exchange medium. protein butabovethatof the contaminating endotoxins (which typically havealowpI) purified protein falls between5and 9.The method relies onadjusting the pHtoapoint belowthe pI of the expressed  ( esting esting antigen binding by B O t

t ptional) ptional) PAUSE CR CR p Using PBS, dilute the target protein antigen toa concentration ranging from 0.1to2mg/ml inavolume between Once adequate endotoxin removal hasbeenachieved, dialyze the sampleagainst low-endotoxin PBSbufferas Retestthe endotoxin content of the sampleasdescribed inSteps37and 38.The cleaning process may need tobe Applythe sampletothe columnatthe recommended flow rate. If desired, monitor the OD Equilibrate astrong anion exchange column(HiTrap CaptoQ1-mlcolumnorsimilar)withthe same bufferasabove. Adjust the pHof low-endotoxin PBSbuffertoapH thatisbelow, butclosetothe theoretical pIof the purifiedprotein Determine the theoretical pIof the purifiedprotein using asequence analysis tool(e.g., ExPASy ProtParam, Afterendotoxin quantification (inendotoxin units(EU)),calculatethe amount of endotoxin contained ina daily dose Measure the endotoxin content of the purified protein sampleusing a detection kit(such asthe QCL-1000Endpoint Sterilizeand remove allpotential aggregates from the samplebyfiltration through asyringe-driven 0.22- : Biotinylation of targetproteinantigen(Steps45–49). / I I / T T w I I CAL CAL e

PO b . e R The procedure inthissection iseffectivefor determining the binding kinetics of a1:1interaction The protocol belowiseffectivefor removing endotoxin from contaminated samplesinwhich the pIof the I x emoval of endotoxin bycontamination ion-exchange chromatography NT p a The protein can be aliquoted and stored at s y . o r g / p Box r o t p

= 2 a

6.4,adjustthe PBSpHto6.3).Dialyze against ) r L a 4 7 I I m . Ifendotoxin content exceeds the pyrogenic threshold, continue withSteps39–44below ● / © 2017 Macmillan Publishers ofSpringer Limited, part Nature. All rightsreserved. ).

T IMI g N for 2minat4°Cand discard the flow-through. Repeat the PBSwashtwice. G 2 d g for 2minat4°Cand discard the flow-through. Add 1ml of PBStothe Centrifuge a2-ml7KMWCO desalting column(ZebaSpin or

−

80 °C for several years. µ m filterand determine the protein concentration ≥ 30 volumes of pH-adjustedPBSfor natureprotocols ● 4 6

T . Under these conditions, IMI N 280 nm G 2 d toensure thatthe

| VOL.13 NO.1VOL.13 g protocol µ for 2min m filter.

≥

2 hat 2018 ≥

2 h

111

© 2017 Nature America, Inc., part of Springer Nature. All rights reserved. 54| adequate loading isachieved.  subsequent steps. to achieve aloading signal of atleast1nmand aclearloading plateautoensure optimal binding signals for 53|  all other steps. reader and runthe protocol inStep51using the tubecontaining biotinylated protein for the loading step,and PBStubesfor black 0.5-mlmicrocentrifuge tube, aswellfour other blacktubescontaining 250 52| the tube’option, withthe following durations: 51| room temperature. ForteBio) inabiosensor rack witha96-wellplatecontaining 200 50|  protein concentration. biotinylation reagent from the sample. Measure OD reaction mixtothe PBS-equilibrated columnand centrifuge the columnat1,000 49| group. The biotinylation reagent must beusedimmediately once dilutedinPBSand should bediscarded afteruse. months, if handled properly. Avoid any contact with moisture to prevent hydrolysis and inactivation of the NHS-ester reactive  Incubate the mixture atroom temperature for 2h. stock solution. Dilutethe reagent toa1mMworking solution using PBSand add the required volume tothe protein sample. 48| protein sample). must beadded tothe protein sampletoachieve a20-fold molar excess of biotinylation reagent (e.g., 20 20 nmoles of biotinylation reagent willberequired. Determine the volume of a1mMstockof biotinylation reagent that molecular weight. Calculatethe number of moles of biotin required for a20-fold molar excess, e.g., for 1nmole of protein, 47| interfere withthe reaction betweenantibody molecules and biotinylation reagent. of allfree amines from the solution (e.g., traces of Tris-HCl orglycine). Chemicals containing free amine groups will  protein concentration. at 4°C.Collectthe flow-through containing protein, measure the OD 112 subsequent runs. 5 4 3 2 1 S protocol tep

PAUSE CR CR CR CR

Once adequate loading of biotinylated protein inablankrunhasbeenachieved, selectthisrunasareference for all Assess the blankrunfor sufficient loading of biotinylated protein onto the streptavidin biosensor. It ispreferable To perform ablank run,prepare 250 Openanew advanced kinetics protocol inthe Blitz Pro software (Pall ForteBio). As adefault protocol, setallstepsto Equilibrate asecond 2-ml7KMWCOdesalting columninPBSasdescribed inStep45.Add the biotinylation Reconstitute the biotinylation reagent (e.g., EZ-Link NHS-PEG4-Biotin, Thermo Fisher) at100mMinDMSO tomake a Determine the number of moles of target protein antigen present inthe samplebasedonthe volume, concentration and | Assessment of antibody–antigenbindingaffinity(Steps50–57). VOL.13 NO.1VOL.13 I I I I T T T T I I I I CAL CAL CAL CAL

I STEP STEP STEP STEP NT | The biotinylated protein sample in the flow-through can be aliquoted and stored at 2018 Reusethe same biotinylated protein solution for allsubsequent steps. It ispossibletostore aliquots of biotinylation reagent stocksolution inDMSO at The protein antigen isrunthrough adesalting columnequilibrated withPBStoensure the removal The concentration of biotinylated protein and the duration of the loading stepcanbemodified until |

natureprotocols Dissociation Association P Baseline Baseline Loading rogram © 2017 Macmillan Publishers ofSpringer Limited, part Nature. All rightsreserved. µ l of PBScontaining 10 T ime (s) 180 180 120 300 30 280 nm and usethe extinction coefficient to determine biotinylated µ µ g/ml of biotinylated protein antigen (from Step49) ina Rehydrate streptavidin biosensors (Dipand Read, Pall l/well of 1%(wt/vol)BSA inPBSfor atleast10min 280 nm and usethe extinction coefficient to determine g for 2minat4°Ctoremove excess µ l of PBS.Placethe biosensor inaBLItz

− −

80 °C for several years. 20 °Cfor several µ l for a1-nmole

© 2017 Nature America, Inc., part of Springer Nature. All rights reserved. Troubleshooting advice canbefound in ? curve fits.  of binding affinity( rate constant ( 57| mum possiblesignal (Rmax) during association and the lowestconcentration thatyielded adetectable binding signal. 56| concentrations (e.g., 4  for the association stepand PBSonlyfor allother steps. 55| T a 24 20 18 4 and 14 S

TROU

tep(s) b CR CR le le Selectthe globalfitanalysis option onthe BLItz Pro software for the selectedruns toobtain models for association Selectruns for kinetics analysis ranging betweenthe highest Fabconcentration inwhich binding hasreached the maxi Perform subsequent runs withbiotinylated protein solution for the loading step,adilution series of solubleFab(inPBS) I I 3 3 T T I I B | CAL CAL LES

Troubleshooting table.

H STEP STEP OOT k a phoresis DNA electro band(s) after undesired presence of No bands or P are suboptimal fication yields Protein puri not at all expected or slowly than grow more Expi293F cells Maxiprep kit Midiprep or application of DNA after of plasmid Low yields ), dissociation rate constant ( roblem The duration of the association and dissociation stepsmay need tobemodified toobtainoptimal Iflittleisknown aboutthe affinity of the antibody–antigen interaction, selectabroad range of Fab I N K G D

= µ

M inafour-fold dilutions series to244pM). k d - - / k a ). tion of multiple PCR products the insert, leading to the genera share substantial similarity with both of the utilized primers may (ii) In some instances, one or and/or unspecific PCR reactions (i) This is indicative of defective P from actively growing tures have not been inoculated might be because overnight cul If plasmid yields are lower, it for high-copy-number plasmids. (Midiprep) to 1 mg (Maxiprep) purification kits range from 0.2 Typical yields for large-scale DNA ratios is required ( Optimization of co-transfection Expi293 medium to light due to excessive exposure of thawing fresh cells, it could be (ii) If the problem persists after high-passage cells (i) This may occur if culturing ossible reason © 2017 Macmillan Publishers ofSpringer Limited, part Nature. All rightsreserved. T able 3 k d . Fig. Fig. ) and equilibriumdissociation rate constant (

E. E. coli 5 ) cells -

- S chain. chain. An excess of light chain also ensures that purification co-transfection ratios is typically performed with excess light the presence of light chain for secretion recombinant protein yields. As IgG and Fab heavy chains require optimization of co-transfection ratios can be performed to improve may have different transfection and translation efficiencies, point is to transfect at a 1:1 ratio. However, as different plasmids (e.g., heavy and light chains for IgG or Fab), a good starting When co-transfection of two different plasmids is required switched off cold room) and work in tissue culture cabinets with the light medium at 4 °C in the dark at all times (e.g., inside a box in a problem. To prevent this problem from occurring, store Expi293 (ii) A newly purchased bottle of Expi293 medium will solve the (i) Thaw a fresh vial of Expi293F cells to solve the issue the day before inoculated with fresh from glycerol stocks. For best results, overnight cultures can be Inoculate cultures from small starter cultures rather than directly ent part of the vector backbone to fix this problem determine if this is the case. Design new primers targeting a differ insert sequences using an appropriate tool (e.g., ClustalW) to reduces primer T GC-rich regions. Note: Each percentage point of added formamide 1–5%) can improve PCR specificity, especially when amplifying Addition of PCR enhancers such as formamide (final concentration the utilized DNA polymerase using online T annealing temperature for specific primer pairs can be determined perature for the primer pair used can solve this problem. Optimal (i) In most cases, determination of the optimal annealing tem olution m calculator tools supported by the manufacturer of m by 0.6 °C (ref. E. E. coli natureprotocols colonies transformed with plasmid DNA

5 K 1 D ). ). (ii) Align the primer and ), aquantitative measure 5 0 , , optimization of

| VOL.13 NO.1VOL.13 protocol

(continued) | 2018

| le le VOL.13 NO.1VOL.13 3 3 |

Troubleshooting table (continued). | are suboptimal fication yields Protein puri are suboptimal fication yields Protein puri P resin from TALON cobalt ions Chelation of TALON resin binding to of 6×HIS tag Low levels expression Low or no 2018 roblem |

natureprotocols - - requires optimization The protein expression time ratio requires optimization The transfection reagent/DNA P overexpressed His-tagged protein be evidenced by the presence of interaction with TALON resin can Suboptimal levels of 6×HIS tag parameters might be required Optimization of one or more the in flow-through. protein of His-tagged presence and yields purification poor to leading colouration, pink resin’s of the a by loss evidenced be can This ml). ( > 100 natants super of Expi293F volumes large purifying when occur ions may of cobalt Chelation SDS-PAGE) in the flow-through (visible by ossible reason © 2017 Macmillan Publishers ofSpringer Limited, part Nature. All rightsreserved. - small 5-ml transfections (total of 5- (total transfections 5-ml small in ratios chain heavy/light 1:1–1:5 testing recommend we ExpiFectamine, a 2.7:1 ratio is recommended) fection reagent/DNA ratios ranging from 1:1 to 6:1 (e.g., for transfection reagents. Most manufacturers recommend trans There are many commercially available cationic lipid-based directly yields protein quantify to purifications small-scale perform Alternatively, above. as intensity band quantify and blot western by Fab or IgG expressed identify distinguishable, easily not are bands If NIH). ImageJ, (e.g., software analysis image using bands of protein intensity the quantifying by estimated be then can expression Fab of or IgG levels relative The identified. easily be can chain light excess and Fab IgG, overexpressed to corresponding bands cases, most In SDS-PAGE. by supernatants analyze transfection, ( required is ratios of co-transfection optimization If Fab or IgG assembled of completely purification in result Fab) for tag 6×HIS and IgG for (Fc binding chain heavy on rely that strategies S and 30B(iii) Refer to troubleshooting advice above for Steps 24, 25, 29, 30B(ii) medium. culture cell a different to switching before yields pre-purification and rates growth cell compare to recommended is (Lonza) Pro293 as such of peptones, content a reduced with one with for medium Expi293 the replace to is alternative Another re-purify. and agents chelating remove to buffer wash against twice supernatant Dialyze NaOH and repurify If this is the case, adjust flow-through pH to 8.0 with 1 M constructs specific for sion expres protein of peak the determine to analysis blot western or SDS-PAGE Perform °C. 4 at aliquots store and Filter 7. to 3 days from supernatant of aliquots sampling and transfections ml) (5 small-scale performing recommend we 7, and 6 days on expected than lower considerably are yields purification protein If days several after of protein loss overall an to lead can which °C), (37 ture cul cell for required temperatures at accentuated be can effect aggregate to tendency a and stability poor display can ies transfection post d 6–7 at occur expression of protein levels peak cases, most In described above recommend testing a range of ratios in small 5-ml transfections, as If optimization of transfection reagent/DNA ratio is required, we olution

1 7 . However, some proteins and antibod and proteins some However, . ≥ 30 volumes of TALON volumes 30 µ g of DNA). 3–6 d after d after 3–6 g of DNA). Fig. Fig.

(continued)

- 4 ), ),

2 . This This . 9

© 2017 Nature America, Inc., part of Springer Nature. All rights reserved. be optimized. Inourexperience, post-purification yields of upto100 mg/l for IgG, 100 mg/l for Fab, 130 mg/l for Fc-fusions format. Expression and purification conditions are alsoimportant factors that influence recombinant protein yield and must rived molecules varyconsiderably depending onvariable region sequence be usedtodetermine true monovalent affinities (seeExperimental design and respective antigens canbeassessedbyBLI(orSPR) inorder toconfirmfunctionality, and production of Fabfragments can injection were typically belowourestablished 10EU/mlthreshold ( prevention of endotoxin contamination ( after asingle affinitypurification step,as analyzed bySDS-PAGE ( affinity chromatography (IgG and IL-2-Fc)orIMAC (Faband bispecificscFv).A high degree ofsamplepuritywasachieved Typical results for recombinant protein preparations are shown in ANT (Day 16) Steps 50–57, assessment of binding affinity: 8 h (Day 15) Steps 45–49, biotinylation of target protein antigen: 4 h Steps 45–57, testing antigen binding by BLI: 2 d S (Day 15) Steps 36–38, assessment of endotoxin content: 2 h (Days 14 and 15) Steps 34 and 35, removal of endotoxin contamination by ion-exchange chromatography: up to 2 d (Day 14) Steps 32 and 33, dialysis and concentration of antibody preparations: 4 h (Day 13) Steps 31 and 32, analysis of sample purity by SDS-PAGE and dialysis: 4 h (Day 13) Step 30B, purification of antibody reagents by immobilized metal affinity chromatography: 3 h (Day 13) Step 30A, purification of antibody reagents by protein A/G/L affinity chromatography: 3 h P (Day 13) Step 29, harvest of supernatants: 1 h (Day 8) Step 28, addition of enhancers: 0.5 h (Day 7) Steps 23–27, transfection of Expi293F cells: 2 h (Day 7) Steps 19–22, (optional) thawing and culture of Expi293 cells: 14 d E (Day 7) Step 18, purification of plasmid DNA: 4 h (Day 6) Steps 16 and 17, inoculation of cultures for plasmid DNA purification: 1 h (Day 5) Step 15, colony picking: 0.5 h (Day 3) Steps 11–14, colony PCR (5 h) and validation by sequencing (allow 2–3 d) (Day 2) Steps 9 and 10, ligation of inserts and transformation: 4 h (Day 1) Steps 1–8, high-fidelity PCR and insert/vector digestion: 8 h S ● and 35mg/l for bispecificscFvcanbe obtained. 31 S T teps teps 39–44, (optional) removal of endotoxin from protein preparations: 2 d xpression by secretion into mammalian culture medium: 6 d teps 1–18, subcloning and large-scale preparation urification urification of antibody reagents: 2 d a

tep(s) T b IMI I le le C I PATE 3 3 N G |

Troubleshooting table (continued). D RESULTS in in SDS-PAGE protein bands Contaminating P roblem protein degradation unspecific purification and/or tions, this may be indicative of present under reducing condi (ii) If additional bands are still bands (e.g., scFv format) for the presence of additional lar disulfide bonds can account tein dimers through intermolecu Unanticipated formation of pro pressed protein can be present. one predicted for the overex tein bands other than the (i) In some instances, pro P ossible reason © 2017 Macmillan Publishers ofSpringer Limited, part Nature. All rightsreserved. Box 2 ), the purifiedprotein solutions atconcentrations required for

- of D - - NA - - constructs: 7 d tion step using size-exclusion chromatography (ii) In this instance we recommend performing a second purifica order to determine if only expected polypeptide chains are present rations by SDS-PAGE under reducing conditions (10 mM DTT) in (iii) To determine if this is the case, analyze purified protein prepa S olution Figure Fig. 4 Fig. 4 a 4 4 ). When following the recommended stepsfor b 8 . The sampleswere purifiedbyprotein A/G/L , utilizedsignal peptide ). Binding of expressed antibodies totheir Fig. 4 c ). Yields of expressed antibody-de natureprotocols 4 9 and expressed antibody

| VOL.13 NO.1VOL.13 3 in vivo protocol | 2018

| -

115

© 2017 Nature America, Inc., part of Springer Nature. All rights reserved. 13. 12. 11. 10. 9. 8. 7. 6. 5. 4. 3. 2. 1. regard to jurisdictional claims in published maps and institutional affiliations. c at online available is information permissions and Reprints CO supervised the research. and generated figures. D.C. wrote the manuscript, generated figures and AUT and the National Health and Medical Research Council. A o Note: Any Information Supplementary and Source Data files are available in the 116 23. 22. 21. 20. 19. 18. 17. 16. 15. 14. o n protocol cknowle

m l M i

n H / PET

humans. Dis. (2014). cells.dendritic CD1c+ human activate to sufficient are proteinsrecombinant in contaminationsendotoxin endotoxin. of story Methods Immunol. J. coli Escherichia (1983). antibodies.monoclonal on 9 proteins. Fc-fusion and antibodiestherapeutic of bacteria. research. in research. cancer (Oxford University Press, 2016). Press, University (Oxford (2007). display.phage by fragmentsantibody News Biotechnol. (2008). e96–e96 conditions.serum-free undertransfection transient by g/l 1 exceeding titers antibodyrecombinant yield cells 293E HEK of News Biotechnol. 1104 lines. cell mammalian cells. mammalian perspectives. future and status,history, manufacturing:biopharmaceutical for lines 3 proteins. recombinant of analysis and modification antibodies. proteins.recombinant Brooks, S.A. Protein glycosylation in diverse cell systems: implications for implications systems: cell diverse in glycosylation Protein S.A. Brooks, recombinant of ExpressionT. Schirrmann, & M. Hust, A., Frenzel, S. Copeland, man. in endotoxinsbacterial of effects Biological S.M. Wolff, Residual J. Horejs-Hoeck, & A. Duschl, Schmittner,M., H., Schwarz, the roots: its and sensing immune InnateE.T. Rietschel, & B.Beutler, S.J. Wakelin, L.C. Simmons, chains carbohydrate of significance Biological H. Wigzell, & M. Nose, A. Beck, R. Rouet, used antibodiesstandardize Reproducibility: A. Pluckthun, & Bradbury,A. preclinical for standards raise development: Drug L.M. Ellis, & C.G. Begley, Peccoud, J. Peccoud, future. the of factories Living M. Eisenstein, human of Selection D. Christ, & F.Sierro, N., Iorno,C.M.Y., Lee, M.B.Jones, G. Backliwal, C.Y. Liu, H.C. Chiou, from proteins secreted of W.A.Over-expression Barton, & A.C. Dalton, cultivated in therapeutics protein recombinant ofProduction F.M. Wurm, cell Human R. Kshirsagar, & S. Estes, B., Mei, D., Euwart, J., Dumont, e r | OR e

, 482–501 (2008). 482–501 , , 345–359 (2006). 345–359 , VOL.13 NO.1VOL.13 v p I e

N r

r i CONTR 128 s G FI n , 35–55 (2014). 35–55 , i t o dgm s n / , S259–S264 (1973). S259–S264 , NANC

Clin. Diagn. Lab. Immunol. Lab. Diagn. Clin. et al. et i et al. et o Nat. Protoc. Nat. n et al. et f IB d ents

Front. Immunol. Front. t et al. et Synthetic Biology: Fostering the Cyber-Biological Revolution Cyber-Biological the Fostering Biology: Synthetic e et al. et Nature h et al. et UT x et al. et Crit. Rev. Biotechnol. Rev. Crit. et al. et e I Attaining high transient titers in CHO cells. CHO in titers transienthigh Attaining . Trends in glycosylation, glycoanalysis and glycoengineering and glycoanalysis glycosylation, in Trends et al. et : rapid and efficient production of aglycosylated antibodies. aglycosylated production of efficient and rapid : AL

h Expression of high-affinity human antibody fragments in fragments antibody human high-affinity of Expression p I |

This This work was supported by the Australian Research Council ONS a 2018 Nature I m Scalable transient protein expression. proteintransient Scalable 32 35 Mammalian transient transfection system. transfectiontransientMammalian Nat. Biotechnol. Nat. p Acute inflammatory response to endotoxin in mice and mice in endotoxin to response inflammatory Acute NTERESTS

“Dirty little secrets”—endotoxin contamination of contaminationsecrets”—endotoxin little “Dirty Rational vector design and multi-pathway modulation multi-pathway and design vector Rational l e . Publisher’s note: Springer Nature remains neutral with with neutral remains Nature Springer note: Publisher’s . 518 Nat. Rev. Immunol. Rev. Nat. Expression of full-length immunoglobulins in immunoglobulins full-length of Expression , 50–51 (2012). 50–51 , (2015). 34–35 , r

R.V.-L., D.N., A.L., P.S. and C.Z. wrote the manuscript 263 7 Protein Sci. Protein Immunol. Lett. Immunol.

, 364–373 (2012). 364–373 , | , 27–29 (2015). 27–29 , 483

natureprotocols , 133–147 (2002). 133–147 , Proc. Natl. Acad. Sci. USA Sci. Acad. Natl. Proc.

The authors declare no competing financial interests. , 531–533 (2012). 531–533 , 4 , 217 (2013). 217 ,

23 22 36

, 517–525 (2014). 517–525 , , 1393–1398 (2004). 1393–1398 , , 1110–1122 (2016). 1110–1122 , 106 Nat. Protoc. Nat. PLoS ONE PLoS

9 Curr. Pharm. Biotechnol. Pharm. Curr.

, e113840 , 2 Expert Rev. Proteomics Rev. Expert Nucleic Acids Res. Acids Nucleic

, 3001–3008 , 531

80 h , 6632–6636 , Methods Mol. Biol. Mol. Methods , 401–403 (2016). 401–403 , t t p Genetic Eng. Genetic : Genetic Eng. Genetic /

/ J. Infect. J. w w

w . n

t u , r e

34. 33. 32. 31. 30. 29. 28. 27. 26. 25. 24. 50. 49. 48. 47. 46. 41. 40. 39. 38. 37. 36. 35. 45. 44. 43. 42.

antibodies for therapy.for antibodies Prog. Biotechnol. (2013). 579–603 production.protein recombinant for technologies Protocols and Methods in cells. mammalian of transfection Purif. Expr. Purif. Expr. cells. CHO-DG44 and HEK-293E suspension-adapted for processes (2015). cells. CHO in expression antibody monoclonal Prog. Biotechnol. vectors. expressionmultigene from levels expressionTransientgene (2009). cells. B single from genes Ig antibodies.recombinant cells.antibodiesmemorymouseB from secretion of IgG antibodies. antibodies. IgG of secretion ONE PLoS cells. CHO in antibodiestherapeutic of expression level high for peptides USA Sci. resistance.aggregation increased with domains variable research. Biotechnol. T-cells. regulatory of depletion Fc-mediated requires proteins fusion 2015). in cells. mammalian in expression (1991). libraries. display phage using fragmentsantibody mouse. a from those with antibody human a in regionscomplementarity-determining the 259–277 (2015). 259–277 chromatography. affinity L protein by purification their vectors. transfer (2003). acids.butyric propionicand by cells ovary hamsterChinese from VIII factordeleted recombinantB-domain (2013). 13/886,226 No. Application Patent US enhancers. expression medium and transfection and growth density high of pairing unique using Screen. Throughput High characterization. kinetic for interferometry BioLayer using 2012). AB, Bio-SciencesHealthcare (GE Mabs Commun. Riechmann, L., Clark, M., Waldmann, H. & Winter, G. Reshaping human Reshaping Winter,G. & H. Waldmann, M., Clark, L., Riechmann, Ye,J. development line cell mammalian in Advances S.K. Ng, & Y.Yang,T., Lai, Large-scaleF.M. Wurm, & C. Meerschman, Hacker,D.L., L., Baldi, approaches. TGE of years 10 than more on Reflections S. Geisse, Hacker,D.L. J. Chng, D.C. James, & J.R. Birch, Naylor,L.H., C.M., Smales,M.F., Underhill, murine of expression and Cloning Wardemann,H. & C.E. Busse,T.,Tiller, Dodev,T.S. Boehmer,von L. Feige, M.J. M.J. Feige, R. Haryadi, K. Dudgeon, preclinical forformulations in limits Endotoxin M. Singh, P.& Malyala, solutions. protein from removalF.B.Endotoxin Anspach, & D. Petsch, J. Concepcion, GE-Healthcare. antibodies. bispecific with strategiestargeting Dual R.E. Kontermann, R. Vazquez-Lombardi, proteinTransient T.recombinant Schirrmann, & K. Jäger,V.,Büssow, Making Winter, G. & A.D. Griffiths, H.R., Hoogenboom,T., Clackson, Replacing Winter,G. & Neuberger,M.S. P.T.,J., Jones, P.H.,Foote,Dear, Rodrigo, G., Gruvegård, M. & Van Alstine, J.M. Antibody fragments and fragmentsAntibody J.M. Alstine,Van & M. Gruvegård, G., Rodrigo, S. Fan, productionW.G.ofEnhanced Bang, & N. S.Y.,Chung,Park,B.H., Chun, S. Vasu,

4 et al. et , 182–197 (2012). 182–197 , et al. et

et al. et 109

et al. et J. Pharm. Sci. Pharm. J. 8 10

, 15373 (2017). 15373 , 64 92 Rapid protein production using CHO stable transfection pools. transfection stable CHO usingproduction protein Rapid 76 et al. et et al. et et al. et et al. et , e0116878 (2015). e0116878 , et al. et , 10879–10884 (2012). 10879–10884 , Valproic acid enhances gene expression from viral gene viral from expressiongene enhances acidValproic , 99–107 (2009). 99–107 , (2013). 67–76 , , 97–119 (2000). 97–119 , High yield transient expression in mammalian cells cells mammalian in expression transient yield High Cleavage efficient 2A peptides for high level level high for peptides 2A efficient Cleavage Nature Recombinant Protein Purification: Principles and Methods and Principles Purification: Protein Recombinant et al. et

et al. et J. Virol. Methods Virol. J. A tool kit for rapid cloning and expression of expression and cloning rapid for kit tool A Optimization of heavy chain and light chain signal chain light and chain heavy of Optimization An unfolded CH1 domain controls the assembly and and assembly the controls domain CH1 unfolded An 26 23 Polyethyleneimine-based transient gene expressiongene Polyethyleneimine-basedtransient General strategy for the generation of human antibody human ofgeneration the for strategy General , 1431–1437 (2010). 1431–1437 , (2007). 435–443 , Label-free detection of biomolecular interactions interactions biomolecular of detection Label-free

Sequencing and cloning of antigen-specificSequencingcloningofand

et al. et 321 801

Nature 97

Sci. Rep. Sci. 12 , 522–525 (1986). 522–525 , , 13–26 (2012). 13–26 , , 2041–2044 (2008). 2041–2044 , Potent antitumour activity of interleukin-2-Fc of activity antitumourPotent , 791–800 (2009). 791–800 , Mol. Cell Mol. J. Immunol. Methods Immunol. J.

332

4 125 Animal Cell Culture Cell Animal , 323–327 (1988). 323–327 , , 5885 (2014). 5885 , Protein Expression in Mammalian Cells: Mammalian in Expression Protein Biotechnol. Lett. Biotechnol.

, 23–33 (2005). 23–33 , 34 Nat. Protoc.Nat. , 569–579 (2009). 569–579 , mAbs Pharmaceuticals Nature

350 11

27–64 Springer,27–64 7 25 , 1908–1923(2016)., , 403–412 403–412 , , 183–193 , Antibodies , 315–319 ,

Proc. Natl. Acad. Natl. Proc. 352 Comb. Chem. Chem. Comb. , 624–628 ,

Protein Protein

Nat.

(2013). antibodies. specific secretinghybridomas from (1975). specificity. predefined of antibody secreting (1990). 8301–8305 ribosomes. eukaryotic by codons initiator DNA. of stability thermal Fields, C. Fields, cells fused of cultures Continuous C. Milstein, & G. Köhler, of recognition facilitates structure secondary Downstream M. Kozak, the on formamide of Influence K.P. Gopinathan, & S. Dutta, C., Sadhu, et al. et Creation of recombinant antigen-binding molecules derived antigen-bindingmolecules recombinant of Creation J. Biosci. J.

256 , 495–497 495–497 ,

8 , 1125–1148 ,

, 58. 57. 56. 55.

Pathol.: Mech. Dis. Mech. Pathol.: USA Sci. Acad. Natl. Fc human recapitulating (2008). neu–positivemetastatic breastcancer. clinical trastuzumab-basedandefficacy of patientstherapy HER-2/ in with cells. effector Walsh, N.C. Walsh, model J.V.Mouse Ravetch, & F. Li, S., Bournazos, D.J., P.,DiLillo, Smith, Musolino,A. M.B. Overdijk, et al. et et al. et J. Immunol. J. et al. et Humanized mouse models of clinical disease. clinical of models mouse Humanized Immunoglobulinfragmentreceptor polymorphismsGC

Crosstalk between human IgG isotypes and murine and isotypes IgG human between Crosstalk 109 , 187–215 (2017). 187–215 , natureprotocols γ , 6181–6186 (2012). 6181–6186 , receptor structural and functional diversity.functional and structural receptor

189 , 3430–3438 (2012). 3430–3438 , J. Clin. Oncol.Clin.J.

| VOL.13 NO.1VOL.13

26 protocol , 1789–1796, | 2018 Annu. Rev. Annu.

Proc. 117