University of Cincinnati

UNIVERSITY OF CINCINNATI

______, 20 _____

I,______, hereby submit this as part of the requirements for the degree of:

______in: ______It is entitled: ______

Approved by: ______

ASSEMBLY AND SECRETION OF PERTUSSIS TOXIN BY BORDETELLA PERTUSSIS

A dissertation submitted to the

Division of Research and Advanced Studies of the University of Cincinnati

in partial fulfillment of the requirements for the degree of

DOCTORATE OF PHILOSOPHY (Ph.D.)

in the Department of Molecular Genetics, Biochemistry, and Microbiology of the College of Medicine

2003

Amy Alison Rambow-Larsen

B.S., Northern Illinois University, 1997

Committee Chair: Alison Weiss, Ph.D. ABSTRACT

Bordetella pertussis is the causative agent of whooping cough. Pertussis toxin,

one of the major virulence factors of B. pertussis, is an AB5 toxin comprised of protein subunits S1 through S5. The individual subunits are secreted to the periplasm where the toxin is assembled. The Ptl secretion system secretes assembled toxin past the outer membrane. In this study, we examined toxin expression, assembly, and secretion.

Cultures followed a typical bacterial growth cycle. A one-hour lag phase was followed

by logarithmic growth until the cultures entered stationary phase around 24 hours.

Secreted toxin was first observed at 3 hours. Secretion continued throughout logarithmic

growth phase, decreasing as the culture entered stationary phase. Toxin secretion

occurred at a constant rate of 3 molecules/minute/cell from two to eighteen hours. More

toxin subunits were produced than secreted, resulting in periplasmic accumulation.

Periplasmic subunits were detected in both soluble and membrane-associated cellular

fractions, with about half of the periplasmic subunits incorporated into holotoxin.

Secretion component PtlF was present at a low level at time zero, and increased between

2 and 24 hours, from 30 to 1000 molecules per cell. However, the initial amount of PtlF

supported maximal secretion. The accumulation of both periplasmic toxin and secretion

components suggests translation rates exceed the rate of secretion, and that secretion, not

toxin and Ptl-complex assembly is rate limiting.

Peptidoglycan acts as a barrier for transport through the periplasm of large folded molecules. Assembled pertussis toxin, and most secretion component proteins are too large to diffuse through intact peptidoglycan. Therefore, we hypothesized that the Ptl

system would contain a peptidoglycanase. PtlE possessed a sequence match to the active site of glycohydrolases, suggesting this protein might cleave the sugar backbone of peptidoglycan. A polyhistidine tagged PtlE fusion protein possessed peptidoglycanase activity. Fusion proteins with alanine substitutions at one or both of the putative active site residues (D53 and E62) lacked peptidoglycanase activity. B. pertussis strains expressing PtlE alleles with the amino acid substitutions were deficient for pertussis toxin secretion. Based on these results, we conclude that PtlE is a peptidoglycanase responsible for the local removal or re-arrangement of the peptidoglycan layer during Ptl- secretion complex assembly.

ACKNOWLEDGEMENTS

I would like to thank my advisor, Alison Weiss, for her encouragement and

support; and my committee members, Michael Lieberman, Gary Dean, George Deepe,

Carolyn Price, for their insight and guidance.

I would also like to thank the past and present members of the Weiss lab: Michael

Barnes, Christine Weingart, Kathy Craig-Mylius, Trevor Stenson, Paula Mobberly-

Schuman, Shantini Gamage, Lyndsay Schaeffer, Angie Patton, Jim Hanson, Cojean

Wang, and Colleen McGannon, for making the Weiss lab an intellectually stimulating

and entertaining environment in which to work.

I would like to thank my parents, Jo Ann and Paul Rambow for imparting to me

their love of learning.

Finally, my deepest gratitude goes to my husband, Lance Larsen, who encouraged

me to enter into this endeavor, and relocated to Cincinnati with me. His constant love

and support has been more valuable than I can say.

TABLE OF CONTENTS

LIST OF TABLES………………………………………………………… 2

LIST OF FIGURES………………………………………………………… 2

LIST OF ABBREVIATIONS……………………………………………… 4

INTRODUCTION……………………………………………………………. 5 Overview of Bordetella pertussis……………………………………... 5 Pertussis Toxin………………………………………………………... 7 Transcription and Translation of Pertussis Toxin…………………….. 9 Assembly of Pertussis Toxin…………………………………………. 12 Secretion via the Ptl System………………………………………….. 13 Relationship to Other Secretion Systems…………………………….. 14 Type II Secretion Systems……………………………………. 15 Type IV Secretion Systems…………………………………… 15 Agrobacterium tumefaciens VirB System……………………. 18 Overview of the VirB Translocon……………………... 20 The Pilus……………………………………………….. 22 The Membrane Bound Components…………………... 23 The Peptidogylcanase………………………………….. 26 The Cytoplasmic ATPases…………………………….. 27 Studies of Pertussis Toxin Secretion…………………………………. 33

PERTUSSIS TOXIN EXPRESSION AND SECRETION………………… 34 Introduction……………………………………………………………. 34 Materials and Methods………………………………………………… 36 Results…………………………………………………………………. 43 Discussion……………………………………………………………... 57

PEPTIDOGLYCANASE ACTIVITY OF PTLE…………………………... 63 Introduction……………………………………………………………. 63 Materials and Methods………………………………………………… 66 Results…………………………………………………………………. 76 Discussion……………………………………………………………... 91

SUMMARY AND FUTURE DIRECTIONS……………………………….. 93

LITERATURE CITED……………………………………………………… 99

APPENDIX – ADDITIONAL STUDIES

LIST OF TABLES

Table 1. Protein-protein interactions in the VirB translocon………………… 21

Table 2. Bacterial strains used in this study………………………………….. 66

Table 3. Plasmids used in this study………………………………………….. 67

Table 3. Primers used in this study…………………………………………… 72

LIST OF FIGURES

Fig. 1. Pertussis toxin expression and secretion……………………………… 10

Fig. 2. Operon structure of type IV secretion systems Ptl, VirB and Tra…….. 17

Fig. 3. Model of the VirB and Ptl secretion complexes………………………. 19

Fig. 4. Model of the HP0535 protein…………………………………………. 31

Fig. 5. Standard curves for calculation of protein concentrations……………. 39

Fig. 6. Growth curve of B. pertussis BP338………………………………….. 44

Fig. 7. Accumulation of pertussis toxin in supernatant………………………. 45

Fig. 8. Toxin secretion per cell……………………………………………….. 47

Fig. 9. Periplasmic S1 and periplasmic toxin………………………………… 48

Fig. 10. Localization of cellular S1…………………………………………… 50

Fig. 11. Periplasmic S2 and S3 and pertussis toxin…………………………... 51

Fig. 12. Localization of cellular S2 and S3…………………………………… 54

2 LIST OF FIGURES continued

Fig. 13. Expression and localization of PtlF………………………………….. 55

Fig. 14. Accumulation of PtlF………………………………………………... 56

Fig. 15. Model of pertussis toxin assembly and secretion……………………. 58

Fig. 16. Features of the PtlE protein………………………………………….. 77

Fig. 17. Analysis of polyhistidine-tagged PtlE expressed in E. coli BL21…… 79

Fig. 18. Analysis of polyhistidine-tagged PtlE expressed in B. pertussis BP338…………………………………………………………………………. 81

Fig. 19. Cloning of amino acid substitutions into the ptx/ptl operon…………. 83

Fig. 20. Western blot of PtlF expression in wild type and PtlE mutants……. 84

Fig. 21. Toxin expression and secretion in haploid strains (ptx/ptl mutant background)…………………………………………………………………… 87

Fig. 22. Toxin expression and secretion in merodiploid strains (wild-type background)…………………………………………………………………… 88

Fig. 23. Fusion proteins for analysis of peptidoglycanase activity in mutants.. 89

Fig. 24. Activity of polyhistidine-tagged mutant PtlE proteins expressed in E. coli BL21[DE3]……………………………………………………………….. 90

Fig. 25. Determining the location of periplasmic holotoxin………………….. 95

3 ABBREVIATIONS USED IN THIS TEXT

ADP – adenine diphosphate

ATP – adenine triphosphate

BG – Bordet-Gengou cAMP – cyclic adenine monophosphate

C-terminus – carboxyl terminus

CHO Cells – Chinese Hamster Ovary Cells

DNA – deoxyribonucleic acid

FHA – filamentous hemaglutanin

IncN – N incompatibility group

IncQ – Q incompatibility group mRNA – messanger ribonucleic acid

N-terminus – amino terminus

OD – optical density

ORF – open reading frame

PBS – Phosphate Buffered Saline

RNA – ribonucleic acid

Sec – general secretory pathway

SS broth – Stainer-Scholte broth

T-DNA – Transferred DNA

Ti-plasmid – tumor inducing plasmid

INTRODUCTION

Overview of Bordetella pertussis

The Gram-negative bacterium, Bordetella pertussis, is the causative agent of whooping cough. The World Health Organization estimates that there were 296,000 deaths worldwide from whooping cough in the year 2000 (148). The incidence of disease is highest in children under one year of age, and the occurrence of complications such as pneumonia, cardiac and pulmonary hypotension, encephalopathy, and seizures, is highest in infants (28, 124). In the United States, there were 62 deaths from pertussis during the four year period between 1997 and 2000. Fifty-six of these deaths (90%) were of infants under 6 months of age (28).

Disease progression can be divided into three stages: catarrhal, paroxysmal, and convalescent. The catarrhal stage may last for several weeks, with symptoms resembling a cold. The disease is often not diagnosed at this stage. Entry into the paroxysmal stage is marked by increasingly frequent and violent episodes of severe coughing. Between these series of coughs, air is rapidly inhaled, producing the classical “whooping” sound.

The coughing paroxysms often lead to vomiting. Patients may even become cyanotic due to oxygen deprivation (28). Coughing episodes most often occur at night, and leave patients feeling severely exhausted. Other symptoms of the paroxysmal stage include lymphocytosis, hyper-insulinemia, and encephalopathy. These symptoms are believed to be due to the effect of pertussis toxin (103), a toxin secreted by B. pertussis. The

5 leukocytosis common in B. pertussis infections has been correlated with the heavy leukocyte infiltration of the lungs and lung hypotension leading to respiratory and cardiac failure seen in many of the fatal pediatric cases (101, 102). The paroxysmal phase may last from one to four weeks. During the convalescent phase, which can last as long as six months after the infection, coughing episodes may continue to occur sporadically (55).

During the paroxysmal phase, when the clinical symptoms are the worst, it is rarely possible to isolate B. pertussis from the patient. Antibiotic therapies given during the paroxysmal phase do little to minimize the disease progression (12). Anecdotal evidence indicates that the antibiotics commonly administered actually increase the severity of the symptoms. In vitro addition of erythromycin, an antibiotic commonly used to treat pertussis infections, to B. pertussis cultures increased the amount of pertussis toxin released into the supernatant over the following two hours (38).

Pertussis toxin is one of the major virulence factors of B. pertussis, and is believed to cause most of the symptoms of the disease. Pertussis toxin mutant strains of

B. pertussis are avirulent in a mouse model of infection (145). The toxin has profound effects on the cells of the immune system, preventing neutrophils from migrating to the site of infection, and preventing the release of antibacterial agents by neutrophils (15).

Pertussis toxin also causes lymphocytosis, the only symptom of the disease to be statistically correlated with mortality in infants (101, 102). Therapeutics that block pertussis toxin secretion could be of great benefit in the treatment of whooping cough.

This thesis examines the secretion of pertussis toxin from B. pertussis.

6 Pertussis Toxin

Pertussis toxin is an AB5 toxin, and is the most complex bacterial toxin known.

Other AB5 toxins include cholera toxin, the heat-labile toxin of enterotoxigenic E. coli,

and Shiga toxin. The AB5 toxins are composed of an A subunit which is a single

polypeptide, and a B oligomer made of five polypeptides. The A subunit is the

catalytically active part of the toxin, while the B oligomer contains the receptor binding

domains, and mediates entry into the host cell. The A subunit of pertussis toxin is the S1

polypeptide. Unlike the other AB5 toxins, which have a B oligomer composed of five identical polypeptides, the B oligomer of pertussis toxin is composed of four different gene products, S2, S3, S4 and S5, in a ratio of 1:1:2:1 (130). The stoichiometry of pertussis toxin was initially determined by dissociation of the B oligomer into an S2-S4 dimer, an S3-S4 dimer and S5 when treated with 5M urea (130), and was later confirmed when the crystal structure of the toxin was determined (125). The S1 polypeptide, which is the A subunit, interacts with the B oligomer via its C-terminus.

Pertussis toxin binds to N-linked glycoproteins (5) of varying sizes in different cell types (22, 33), and has also been shown to bind glycolipids (137). The S2 and S3 subunits of the B oligomer each bind to N-acetylneuraminic acid (sialic acid), and the crystal structure of pertussis toxin with two bound molecules of sialic acid has been determined (126). Chinese Hamster Ovary (CHO) cell mutants unable to add sialic acid residues to N-linked oligosacharides are resistant to pertussis toxin (151). The variety of cell surface macromolecules that bind pertussis toxin likely explains the ability of pertussis toxin to enter a wide variety of cell types.

7 Pertussis toxin enters the cell via endocytosis, and moves by retrograde transport to the endoplasmic reticulum (ER) where membrane translocation of the A subunit takes place (26, 27, 152). To enter the cytoplasm, the A subunit must be released from the B oligomer. Release of the A subunit requires one molecule of ATP, which inserts into the open center of the B oligomer, destabilizing contacts between the B oligomer and the cytoplasmic tail of the A subunit (60). The S1 protein, which is the A subunit, has one intramolecular disulfide bond. Reduction of the disulfide bond is necessary for the A subunit to have enzymatic activity (91), and requires prior dissociation of the A subunit and B oligomer, since S1 in the holotoxin is highly resistant to reducing agents (91, 92).

The A subunit is then translocated through the membrane, but is thought to remain membrane associated (152).

Once in the cytosol, the A subunit disrupts signal transduction by ADP- ribosylating the alpha subunits of Gi (68) and Go (129) GTP-binding proteins (86, 95).

The Gi and Go regulated pathways respond to numerous hormones, neurotransmitters and chemokines, and transmit signals directly or indirectly to a number of effector molecules

(2, 96). One of the most studied effects of pertussis toxin on a Gi regulated pathway is

the increase in cAMP production by adenylyl cyclase due to ADP-ribosylation of the

inhibitory Gαi subunit (90). ADP-ribosylation inactivates the Gi protein, preventing

inhibition of cAMP production, and allowing the signals promoting cAMP production to

go unchecked. The effect of pertussis toxin on the chemotaxis of neutrophils may be the

most important contribution of pertussis toxin to B. pertussis pathogenesis. Peripheral

blood neutrophils express receptors for chemokines of the α (CXC) family (88).

Pertussis toxin inactivates signaling by these receptors, inhibiting chemokine induced

8 chemotaxis and granule release (15). Thus pertussis toxin prevents neutrophils from

migrating to the site of infection and releasing antibacterial compounds.

Before pertussis toxin can affect host cells, it must be produced and secreted by

the bacterium. Pertussis toxin secretion is a multistep process. Transcription is regulated

by the two-component signal transduction system BvgA/S (87). The subunits are

translocated through the cytoplasmic membrane by the Sec secretion system. The toxin

is assembled in the periplasm, and then secreted through the outer membrane by the Ptl

type IV secretion system (Fig. 1). Each of these steps will be discussed in detail.

Transcription and Translation of Pertussis Toxin

The five genes for the subunits of pertussis toxin are arranged on an operon

controlled by a two-component transcriptional regulatory system composed of proteins

BvgA and BvgS (87). The BvgA/S two-component signal system activates the

transcription of multiple virulence factors, including pertussis toxin (58). The integral

membrane protein, BvgS, senses the environment and under appropriate conditions

generates the active, phosphorylated form of the transcriptional activator, BvgA (138).

The level of activated BvgA controls the timing of expression of the different virulence

factors (120). Initially, dimers of phosphorylated BvgA bind to a primary site consisting

of an imperfect inverted heptad repeat (20, 21). Additional BvgA molecules bind to the

DNA in a sequence independent manner up to the binding region for RNA polymerase.

This allows RNA polymerase to bind and transcription initiates (19, 21).

I I I I Outer Membrane S1 F F PT X peptidoglycan GEG G GEG G D G AB Inner Membrane Sec C H

A tl lB lI Promoter p pt pt s1 s2 s4 s5 s3 ptlC ptlD ptlE ptlF ptlG ptlH

ptx genes ptl genes pertussis toxin pertussis toxin liberation

Fig. 1. Pertussis toxin expression and secretion. The toxin and secretion system genes are located on one operon, and expressed from the same promoter. The individual toxin subunits are translocated through the inner membrane via the general secretory pathway, and the toxin is assembled in the periplasm. Secretion past the outer membrane occurs via the Ptl translocon.

s1-s5, pertussis toxin structural genes ptlA-ptlH, secretion complex genes

Sec, general secretory pathway

A – I, Ptl proteins

PTX, assembled pertussis toxin

, stem-loop structure

10 Different promoters require different amounts of bound BvgA due to variations in the

length of the secondary binding region, and this mechanism allows the bacteria to stagger

gene expression after transition to conditions permissive for Bvg-regulated expression.

The adhesin, filamentous hemagglutinin (FHA), is an early gene and transcription is

initiated almost immediately after transition to the permissive state (119). The FHA promoter has a high affinity primary BvgA binding site and short secondary binding region. In contrast, the pertussis toxin promoter is a late promoter (119), requiring a higher level of phosphorylated BvgA for activation due to a lower affinity primary binding site and longer secondary BvgA binding region (21). In recent studies, mRNA for the early gene, fha, was detected by 30 min. in culture (70), while mRNA for the pertussis toxin genes was detected after 2 hours (71). An analysis of the kinetics of pertussis toxin mRNA expression suggested that transcription of pertussis toxin initiated

at about 1 hour in culture (71).

The toxin genes are arranged in the order S1, S2, S4, S5, S3. They appear to be

followed by a stem-loop terminator structure as shown in Fig. 1 (84, 97). The pertussis

toxin structural proteins each have an N-terminal secretion signal which is absent in the

mature protein. Secretion to the periplasm is likely mediated by the general secretory

pathway (Sec), and occurs immediately after translation, since full-length S1 has only

been detected when it has been over-expressed so as to overwhelm the capacity of the

Sec pathway (49).

11 Assembly of Pertussis Toxin

Pertussis toxin assembly occurs in the periplasm. As part of the folding process, each toxin subunit must form the correct intramolecular disulfide bonds. DsbA, which catalyzes disulfide bond formation, is required for pertussis toxin assembly (127). The

S1 peptide has one intramolecular disulfide bond, S4 and S5 each have two, and S2 and

S3 each have three bonds. Formation of the disulfide bond in the S1 subunit is required for accumulation of wild-type levels of S1, suggesting S1 that fails to form the disulfide bond is degraded (4, 127).

The B-pentamer will self-assemble in the absence of the S1 subunit in vitro

(25). However, it is not known whether the B-pentamer assembles separately from the

S1 subunit in the periplasm. The S1 subunit can associate with the outer membrane

(49) and it has been suggested that membrane-associated S1 may constitute a nucleation site for the assembly of the holotoxin on the periplasmic face of the outer membrane. The C-terminal portion of S1 has been proposed to promote membrane association (49), however the C-terminal portion of S1 also mediates association with the B pentamer (76), suggesting that S1 assembly into holotoxin would require disassociation from the membrane. The holotoxin must be assembled before secretion past the outer membrane since neither the S1 subunit, nor the B oligomer can be exported independently (50). The identification of an S1 point mutant (R57K) that is assembled into catalytically active toxin but not secreted suggests that there is a domain on the S1 subunit that interacts with some component of the secretion system to initiate pertussis toxin secretion (37).

Secretion via the Ptl system

Studies of transposon insertion mutants revealed that a region downstream of the

toxin genes is required for the secretion of pertussis toxin. Eight open reading frames

were initially identified and designated ptl (pertussis toxin liberation) A – H. A ninth ptl gene, ptlI, was identified later (48). The ptlI gene is located between ptlD and ptlE (Figs.

1, 2).

Mutations have been made in ptlA, ptlB, ptlC, ptlD, ptlE, ptlF, ptlG, and ptlH.

These mutations have demonstrated that all eight proteins are required for the secretion of pertussis toxin (39). Active pertussis toxin is still produced and assembled in the periplasm of these mutants, and in a strain which does not express any of the Ptl proteins

(147), demonstrating that the Ptl proteins are not necessary for stabilization or periplasmic assembly of the toxin.

Truncation mutations of PtlC, PtlD, PtlE, PtlF, PtlG, and PtlH exhibited dominant phenotypes in merodiploid strains (39). Transdominant phenotypes may result from the formation of multimeric complexes whose function is impaired by the interaction of the non-functional mutant protein. The dominant negative phenotype observed for the PtlC,

PtlD, PtlE, PtlF, PtlG, and PtlH mutants suggests that these six Ptl proteins participate in multimeric complexes.

Sequence analysis shows that only ptlD, ptlI and ptlF contain predicted secretion signal sequences (48, 147). The ptlI gene encodes a small protein with a predicted molecular weight of 6,294 Daltons. The mature PtlI protein is observed to have an apparent molecular weight of 5,200 Daltons by SDS-PAGE, due to removal of the N-

13 terminal signal sequence. PtlI and PtlF are connected via a disulfide bond, and the

formation of this bond is required for the stablization of PtlF (48, 127), since PtlF is not detected in a ptlI deletion mutant (48), and in a wild-type strain PtlF is not detected on western blots if reducing agents are added to the samples (127).

PtlC and PtlH both contain a Walker A ATP-binding motif. Site directed mutagenesis of these domains has shown that the ATP binding site must be intact for efficient toxin secretion (35, 72).

In one study, antibodies were raised against the PtlE, PtlF and PtlG proteins.

Immunoblots of cell extracts following cellular fractionation showed that PtlE and PtlG

were associated with the inner membrane, while PtlF was associated with the outer

membrane (66).

While only limited studies have been performed on the Ptl system, similar

secretion systems have been studied extensively, and these secretion systems will be

discussed next.

Relationship of Ptl to Other Secretion Mechanisms

The bacterial secretion systems have been divided into different types based on

their general mechanisms. The Ptl system is classified as a type IV secretion system

based on its gene sequence and operon layout. Other actively secreted AB5 toxins are

secreted by type II systems, which will be discussed first.

14 Type II Secretion Systems

Two of the AB5 toxins, cholera toxin and E. coli heat-labile toxin, in addition to

many other virulence proteins, are secreted by type II secretion systems. Substrates

translocated by type II systems have N-terminal secretion signals, pass through the

cytoplasmic membrane via the Sec pathway, are folded in the periplasm, and are then

transported past the outer membrane by the type II secretion system. These systems

generally contain genes homologous only to the last ptl gene, ptlH. These homologs of

ptlH include: pulE, required for pullulanase secretion in Klebsiella oxytoca (104, 105); outE, required for secretion of pectate lyases and cellulases in Erwinia chrysanthemi

(81); xcpR, required for secretion of toxin A, lipases and proteases in Pseudomonas aeruginosa; pilB, for pilin synthesis in P. aeruginosa (8, 98, 135); and xpsE, required for secretion of proteases and cellulases in Xanthomonas campestris (46). These proteins are believed to function as motor proteins in their respective secretion mechanisms.

Type IV Secretion Systems

In addition to B. pertussis, type IV Secretion systems are present in other human

pathogens, such as Brucella, Bartonella, and Helicobacter pylori, and are also present in

E. coli and the plant pathogen, Agrobacterium tumefaciens. The type IV family of

transporters was originally defined as transporting DNA substrates from the cytoplasm of

the bacterium, through the two bacterial membranes and through the membrane of a

recipient cell. However, members of the type IV family are better defined by their

15 genetic similarity, since it has become apparent that translocation of proteins is also an

important function of these systems. The DNA transported by type IV systems is

transported as a DNA/protein complex rather than as naked DNA. It is likely, therefore,

that the transport apparatus is recognizing domains on the DNA-associated proteins

rather than on the DNA. The type IV systems also secrete several effector proteins. The

B. pertussis Ptl system was the first type IV system for which a specific protein substrate was identified, and this system secretes only its protein substrate, pertussis toxin. The A. tumefaciens VirB secretion complex transports the effector protein VirJ from the bacterial periplasm to the host cell in addition to transporting DNA substrates (100). The

Helicobacter pylori Vir type system has been shown to secrete an effector protein, CagA, into gastric epithelial cells (6). It has been suggested that the secretion of proteins that

are folded in the periplasm past the outer membrane may be a more typical feature of

type IV secretion systems than was previously thought (9).

The most well characterized type IV Secretion Systems are those involved in the

transport of DNA. These systems include conjugative plasmid export complexes,

particularly those of the Tra region of the N Incompatibility (IncN) group plasmids, and

the VirB type DNA transport systems (Fig. 2) (150). The prototype of the type IV

transport systems, the Agrobacterium tumefaciens virB transport system, shares high

homology with the ptl operon. The structure of the VirB secretion complex has been

studied extensively, and provides a model for the general structure of a type IV secretion

apparatus.

11 f aG 44 o 3 331 h tr t

virB g

Le 10 86 3 traF 375 rB a. lH

vi 339

nd Tr 94

aO .

a 2

8 8

8 293

4 vi

B B

lG B

E E

E e

B r r

a a a

i i 37 i

7 7

pt 7

r r r

v v v i

t t

37 B B B

N N N r r

r 2

232

ch g

i i i V a a

a ,

v v v

r r

r l

F t t

5 t

6 6

6 5 D D

D 48

B B

ptl

273

a a

a s Pt

r r r

i i

i t t 5 t

v v

v m

x x x 5 5

5 29

346

e e

lE e

I I I B B

e e

e n under ea l l l

r r r

t t

t 5

i i

276 i pt

p p

p 7

v v v C C C

a a

220 a n syste

r r 61 r t t t 37 o

2 i

63 e

s is show r ptlD

residue I 789

virB4

3 3 3 866

traB

B B

B c

r r

i i i

2 2 2 v v

v A A

8 A

Type

ptlC

B B B

a a

824 a

r r r

r r

i i

i t t

t of

v v v

M M M

B B

B e l l l

a a a

1 1 1

t t t

r r r

p p p t t t B B B

A A

A ur

r r r

r r

121 10 r

i i

i t

o o o

v v

v 2 c A A A k k k

l l l

t t

t u

n in amino a 93 97 103 25 p p p r i L 102 104 a 244 tr on st r d prote e p d code n e g. 2. O i mefaciens li F the u o pertussis . t . Ptl B VirB A Tra E. c IncN plasmi

17 Agrobacterium tumefaciens VirB system

Agrobacterium tumefaciens induces neoplastic growth in dicotyledonous plants resulting in the formation of crown gall tumors. This is achieved by the transfer of an oncogenic T-DNA (Transferred DNA) from the bacterium into the plant cells. The T-

DNA is encoded on a Ti (tumor inducing) plasmid that also carries the virB operon, which encodes the eleven VirB proteins, VirB1 through VirB11 (Fig. 2), necessary for the transport of the T-DNA/protein complex (141). Ten of the genes, virB2 through virB11, have been shown to be essential for virulence (18, 142). In addition to exporting the T-DNA, the VirB translocon can mediate the transfer of a conjugative plasmid of the

IncQ family between bacterial cells, but must be expressed in both the donor and recipient cell for efficient transfer (16). Characterization of plasmid transfer by the VirB system has provided insight into the function of specific VirB proteins. Several in-depth reviews of Agrobacterium tumefaciens virulence (149, 156) and the VirB system (30,

157) are available.

The structure of the VirB complex has been much more extensively studied than that of the Ptl complex. While the VirB operon contains 11 genes, virB1 through virB11

(Fig. 2), the ptl operon contains only 9 genes. The virB1 and virB5 genes have no

homologs in the ptl operon (Fig. 2). These two proteins may be involved in the

interaction of the VirB complex with the plant cell, and would be unnecessary in the ptl complex. The components of the assembled VirB secretion complex (Fig. 3) will be described beginning at the outside of the bacterium and moving in toward the cytoplasm.

The transport apparatus contains a pilus, and membrane bound proteins form pores

18 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 Pilus 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 PTX 2 2 2 2 2 2 2 2 2 2 * 2 2 2 1 2 2 2 I I OM 7 9 9 9 7 3 OM F F F 5 8 8 8 1 Pore E E E G 8G G G8 G G EG G GE G IM 10 6 10 IM G D G A B 4 11 H 4 11 11 ATPases CC H H 11 11 11 H H H

A. tumefaciens VirB - B. pertussis Ptl - Secretes Ti plasmid Secretes pertussis toxin and associated proteins

Fig. 3. Models of the VirB and Ptl Secretion Complexes. A. Model of the A. tumefaciens VirB system based on protein interactions shown in Table 1, and known protein functions. B. Analogous model of the B. pertussis Ptl system.

19 through both the outer and inner membrane. These membrane bound components are connected together through the periplasmic space, necessitating the removal or rearrangement of peptidoglycan, and thus a peptidoglycanase must be present. Finally, the system must have access to energy to drive the secretion process, which is supplied by ATPases localized to the cytoplasmic side of the secretion complex.

Overview of the VirB Translocon

Several methods have been employed to elucidate the protein-protein interactions between the VirB proteins that form the membrane-spanning complex. These interactions were determined in the absence of host cells, and many studies looked at the interactions of individual proteins in the absence of the assembled complex. The interactions are therefore likely to be representative only of a closed, inactive complex.

The protein-protein interactions detected, and the methods used to detect each interaction are shown in Table 1.

After partial disruption of the VirB complex, the membrane associated and exocellular VirB proteins were found to migrate in native gels primarily as a high molecular weight aggregate consisting of VirB8, VirB9, and VirB10, and a smaller complex at about 100 kDa which cross-reacted with antibodies to VirB2 and VirB5 (75).

VirB6 was found to migrate in native gels between 140 and 232 kDa. VirB7 did not localize distinctly in the native gels, but major bands were detected at 100 kDa and at the same molecular weight as VirB6, consistent with the comigration of VirB6 and VirB7 in sucrose density gradients and gel chromatography. These studies show that the VirB translocation complex contains subassemblies of VirB proteins. Other protein

20 Table 1. Interactions within the VirB complex.

Ptl A B C D I E F G H VirB 1 2 3 4 5 6 7 8 9 10 11 H 11 Y2H - - Y2H - - - - Y2H - DS, IP

G 10 Y2H - - Y2H - - IP NG, NG, X, AP, X, AP, AP, IP, Y2H, Y2H, Y2H C2H C2H F 9 Y2H - - - - IP IP, IB, NG, Y2H Y2H Y2H

E 8 Y2H - - Y2H - - - Y2H, C2H

I 7 - IP, - - DS, IP IP DS, NG NG D 6 ------5 - DS, - - - NG C 4 - - IB Y2H, IP B 3 - - - A 2 - DS 1 -

Methods used to demonstrate interactions (references):

IP - co-immunoprecipitation (10, 41, 64, 109, 114) AP - affinity-tag pull-down (43) NG - blue native gel electrophoresis (75) X - cross-linking (14, 143) DS - sucrose density gradient fractionation (79, 108, 114) IB - immunoblot (3, 52, 67) C2H - cytological two-hybrid assay (45) Y2H - yeast two-hybrid assay (42, 43, 140)

21 interaction studies, which will be discussed, show how these subassemblies interact with

each other.

The pilus, composed of polymerized VirB2, is associated with VirB7 and VirB5

at the outer membrane. VirB7 forms a disulfide bond with VirB9. VirB7 and VirB9

interact with the inner membrane components VirB8 and VirB10 through the periplasmic

space, probably via a channel in the peptidoglycan layer produced by the

peptidoglycanase activity of VirB1. The ATPases, VirB4 and VirB11, are on the

cytoplasmic side of the complex and interact with each other. Although not depicted in

Fig. 3, VirB11 also interacts with VirB9, and the interactions of VirB11 - VirB9 - VirB2

provide a connection between ATPase activity and pilus biogenesis.

The interactions identified by these studies helped to refine the model of the VirB

secretion complex (Fig. 3A). This model of the VirB complex, along with the known

interactions of the Ptl proteins, was used to develop an analogous model of the Ptl

secretion system (Fig. 3B). The components of the VirB system will be discussed in

detail. The homologs in the Ptl system will be discussed only when they appear to differ

from the homologous VirB protein.

The pilus

The structural protein that forms the pilus is VirB2 (Fig. 3). The VirB2 protein is a member of the pilin family of proteins. VirB2 shares the two typical aspects of the pilin family: it is highly hydrophobic, and contains a pair of cysteine residues. The hydrophobic domain at the N-terminus is believed to anchor the protein to the membrane

22 prior to the polymerization of the pilin subunits into pili. The prepilin protein is

processed by removal of the signal peptide (122). The two cysteine residues form a

disulfide bond, which has been shown to result in a ring-like structure in the VirB2

protein and in other pilin family proteins and is essential for function (47). VirB2 is then

exported and assembles into 10 nm wide, flexuous pili (79). Export of the pilin protein

and assembly of the pilus is dependent on the expression of all ten of the other VirB

proteins (78), suggesting that a functional transport apparatus is required for the export of

the pilin subunits.

The homolog of virB2 in the ptl operon is ptlA. Although ptlA is described as the

pilin homolog due to its position in the ptl operon, it shares very little homolgy with virB2, and does not fall into the pilin gene family based on sequence. Additionally, PtlA

contains only one cysteine; and there is no evidence of a pilus-like structure associated

with pertussis toxin secretion.

The membrane bound components of the VirB system:

The membrane spanning components of the VirB translocon are thought to form a

pore passing through both the inner and outer membranes and through the periplasmic

space. The membrane proteins interact with the pilus at the outer membrane, and with

the ATPases at the inner membrane. Many of the components are found in both the outer

and inner membrane after cellular fractionation (132), indicating that the outer and inner

membrane components are tightly bound together, and that some may span the

periplasmic space to interact with both membranes. However, the studies discussed

23 below suggest that these proteins do associate primarily with either the inner or the outer membrane. Proteins associated with the outer membrane will be discussed first, followed by proteins in the inner membrane.

The pilus is tightly associated with VirB7. VirB2 and VirB7 co-fractionate through successive steps of gel-filtration chromatography and sucrose density gradient centrifugation; and are recovered together by immuno-precipitation from the gel-filtration fraction enriched for pilus using either VirB2 or VirB7 antisera (114). VirB7 is a small protein that is exported via an N-terminal signal sequence, and processed to 4.5 kDa after removal of the signal peptide (79). Processed VirB7 is fatty-acylated near the amino- terminus (51). The N-terminus is anchored to the outer membrane; and the C-terminus is periplasmic. VirB7 has a single cysteine at residue 24, and forms disulfide-bonded homodimers (10). VirB7 also forms disulfide bonded heterodimers with VirB9, which has a single cysteine at residue 262 (3, 10, 52). Yeast two-hybrid studies identified a

VirB7 interaction domain on VirB9 which mapped to residues 173-275 (42), around the cysteine at residue 262. Since proteins in the yeast nucleus do not form disulfide bonds, this study demonstrates that the interaction between VirB7 and VirB9 does not rely exclusively on the formation of the disulfide bond. VirB3 has also been detected in the outer membrane (67, 122), but it has not been found to be associated with the pilus or the other outer membrane components. VirB3 is a 12.7 kDa protein encoded by the gene directly downstream of the pilin gene.

Proteins VirB8 and VirB10 were each demonstrated to localize to the inner membrane using different techniques. VirB8 was shown to localize exclusively to the

24 inner membrane using immunogold electron microscopy (133), and VirB10 was found primarily in the inner membrane after cellular fractionation (143). An interaction between VirB8 and VirB10, and the formation of homomultimers of each protein, were demonstrated by a novel bacterial two-hybrid system (64). The self-association of

VirB10 has also been demonstrated by yeast two-hybrid assay (45), and the formation of high molecular weight VirB10 aggregates (133, 143).

The inner and outer membrane proteins have been shown to interact, and are believed to form the core translocation pore of the secretion apparatus. VirB8, VirB9 and

VirB10 were found in both outer and inner membrane fractions after sucrose density gradient centrifugation (132). Yeast two-hybrid studies have also demonstrated interactions between the outer membrane proteins VirB7 and VirB9, and the inner membrane proteins, VirB8 and VirB10 (140), suggesting that the outer and inner membrane compontents of the VirB translocon are connected through the periplasmic space.

VirB6 is an inner membrane protein with multiple predicted trans-membrane domains which has been shown to form high molecular weight aggregates in native gels

(75). VirB6 expression influences the levels of VirB7-VirB9 heterodimers and VirB7 homodimers (64). In the absence of VirB6, VirB7-VirB9 heterodimers are present at wild-type levels, but VirB7 homodimers are not present. Overexpression of VirB6 resulted in a reduction in the steady-state abundance of VirB7-VirB9 heterodimers, wild-type levels of VirB7 homodimers, and the accumulation of high molecular weight aggregates of VirB9. These results suggest that VirB6 promotes the formation of VirB7

25 homodimers, while inhibiting the formation of the VirB7-VirB9 heterodimers. Deletion

of VirB6 also reduced the steady state levels of VirB5 and VirB3 (59).

Transfer of the IncQ conjugative plasmids by the VirB translocon has provided

insight into the function of different subsets of VirB proteins. While expression of all of

the VirB proteins is required for efficient transfer of the IncQ plasmids from the cell (56), only a subset of these proteins is required for uptake by the recipient cell (82).

Expression of VirB7 through VirB10 was sufficient for uptake, although the frequency of transfer was 3 to 4 logs lower than in cells expressing all of the VirB proteins. Co- expression of VirB1 through VirB4 with VirB7 through VirB10 restored wild-type levels of plasmid uptake. The ability of the VirB7 through VirB10 subset of proteins to permit plasmid uptake supports the idea that these proteins form the core transport channel of the

VirB translocon.

The peptidoglycanase

For the inner and outer membrane components to interact and form a pore through

which the T-DNA passes, a peptidoglycanase must remove or rearrange a section of the

peptidoglycan layer. The VirB1 protein, which has no homolog in the ptl operon, has sequence homology to glycohydrolases at its C-terminus (93). While full-length VirB1 is detected in the periplasm, a shorter VirB1 protein containing the putative glycohydrolase

region has been detected on the exterior of the bacterium (83). Processing and secretion of this VirB1 fragment occurs independently of the other Vir proteins (83). It is believed that VirB1 may have the dual functions of removal of bacterial cell wall and removal of

26 host plant cell wall during assembly of the secretion apparatus and interaction with the

plant cell. The VirB1 protein has been shown to interact with the structural components

VirB8, VirB9, and VirB10, and with the ATPase VirB11 by yeast-two-hybrid assay (140)

as shown in Table 1. Since peptidoglycanase activity has the potential to lyse the

bacterium by destruction of the cell wall, strict control of this enzymatic activity is

necessary. Control of the activity of VirB1 may be accomplished by tethering VirB1 to

the transport complex via associations with the other VirB proteins. Tethering has been

proposed for other peptidoglycanases such as the FlgJ protein, a peptidoglycanase

essential for flagellar rod formation in Salmonella typhimurium (94).

The cytoplasmic ATPases

The VirB4, VirB5, and VirB11 proteins all contain ATP binding motifs. Intact

Walker A ATP-binding motifs in VirB4 and VirB11, homologs of PtlC and PtlH respectively, have been shown to be essential for virulence in plants (17, 128), and purified forms of both proteins have exhibited weak ATPase activity (32, 123). Similar studies have not been done for VirB5, which has no Ptl homolog.

VirB4 is believed to be an integral cytoplasmic membrane protein with two periplasmic domains. VirB4 localized to the inner membrane in cell fractionation studies

(123), and analysis of VirB4::phoA fusions and proteinase K treatment identified the two periplasmic domains (40). VirB4 was found to interact with itself, as well as VirB8,

VirB10, and VirB11 by yeast two-hybrid assay (140) as shown in Table 1. VirB4 has also

27 been shown to interact with itself in a phage immunity assay, and by

immunoprecipitation of GFP-fusions to VirB4 (41). These studies mapped the

interaction domain responsible for the formation of homomultimers to the first 157

residues of the 789 amino acid residue VirB4 protein. Walker A mutants were also found

to interact in the phage immunity assay. Therefore, the self-association of VirB4 occurs

independently of ATP binding.

The ATPase activity of purified VirB4 was weak, with a Km of 15-20 µM.

However, this ATPase activity was quenched by the addition of PtlC antiserum, suggesting that the activity is specific to PtlC (123). Mutations in the ATP binding motif

(K439 and GLT438-440) abolished virulence in plant tumerogenesis assays (17) and prevented formation of the T-pilus, as demonstrated by a lack of extracellular VirB2 and

VirB5 (113). Merodiploid strains expressing the wild-type VirB4 and a Walker A mutant displayed a dominant negative phenotype in plant tumerogenesis assays (41), indicating that complexes containing the mutant were unable to transfer T-DNA to plant cells.

VirB4 is one of the subset of VirB proteins that enhances uptake of the IncQ conjugal plasmid RSF1010 (82). Interestingly, strains expressing the Walker A mutant forms of VirB4 had equivalent frequencies of IncQ plasmid uptake when compared to strains expressing wild-type VirB4 (41). Thus, while the ATPase activity of VirB4 is required for the transfer of T-DNA, the protein plays a structural rather than catalytic role in the formation of the core transport complex required for the uptake of plasmid

RSF1010.

It has been demonstrated that a near-full-length copy of the virB4 gene is required

for the accumulation of VirB3 to wild-type levels. The VirB3 protein is known to be

28 necessary for the formation of the pilus, but not found to be a structural component of the

pilus. In wild-type cells, VirB3 is found primarily in the outer membrane. Mutants

carrying a polar insertion in the virB4 gene accumulate very low levels of VirB3 protein.

The VirB3 protein is localized entirely to the cytoplasmic membrane fraction in these

cells (67). Near wild-type protein levels, and outer membrane localization can be restored by adding back the virB4 gene in trans. Thus, the VirB4 protein appears to be necessary for the translocation of VirB3 into the outer membrane.

The location of VirB5 has not been clearly established. VirB5 cofractionates with the outer membrane components VirB2 and VirB7, although it does not appear to be tightly associated with them (114) and is easily solubilized by Triton, suggesting that it is not tightly bound to the membrane (54). Although VirB5 cofractionates with the extracellular pilin protein after shearing of the pili from the cell surface (114), it is found primarily in the inner membrane and cytoplasmic fractions using more traditional cell fractionation techniques (132). It has not been established whether VirB5 binds ATP, but the presence of the consensus nucleotide binding motif supports the idea that VirB5 is an inner membrane spanning component. The interaction of VirB5 with the pilus may occur via the periplasmic space. There is no homolog of VirB5 in the Ptl system.

VirB11 is thought to be loosely associated with the cytoplasmic face of the inner membrane because it is found in both the soluble and cytoplasmic membrane fractions

(32, 109). VirB11 has been shown to have weak ATPase activity (32). Hydrolysis of

ATP was optimal at a pH of 6.5-7.5 and required the addition of a divalent cation at an

29 optimal concentration of 10-25 mM. Activity was inhibited by K+ or Ca2+, and by the presence of competitor nucleotides ADP, dATP, GTP, CTP and UTP. The ATPase activity of VirB11 had a Km of 550 µM. Purified VirB11 was phosphorylated by incubation with [γ32-P]ATP, suggesting that VirB11 has autophosphorylating activity

(32).

VirB11 interactions with VirB1, VirB4 and VirB9 were detected by yeast two- hybrid assay (140) as shown in Table 1. VirB11 also interacts with itself, and interaction domains have been identified in both the N and C-terminus (108, 109). VirB11 self- association has been detected using the phage immunity assay (109), and by precipitation of wild-type VirB11 with a VirB11-GFP fusion protein. GFP fusions to both the N- terminus and the C-terminus of VirB11 interacted with wild-type VirB11. However, while the N-terminal fusion interacted with a recessive Walker A deletion mutant, the C- terminal fusion did not, suggesting that ATP-binding is required for interactions involving the C-terminal domain. The mutations affecting the Walker A ATP-binding motif in VirB11 also affected the subcellular localization of the protein (108). While wild-type VirB11 protein is present in both the cytoplasmic membrane and soluble fractions, the mutant VirB11 proteins fractionated almost exclusively with the cytoplasmic membrane. This change in the localization indicates that ATP binding and/or hydrolysis regulates the association of VirB11 with the cytoplasmic membrane or membrane bound components of the VirB complex.

The observation of separate self-interaction domains in the N and C termini is supported by crystallographic studies of HP0525, the homolog of VirB11 in the

Helicobacter pylori type IV secretion system. The crystal structure has been determined

30 6 ATP

6 ADP 3+ + 6 PO4

Fig. 4. Model of the VirB11 homolog HP0525. This model is based on the crystal structures determined for apo-, ADP-bound and ATP-bound HP0525 (118, 153). The

C-terminal domains are shown in blue, and the N-terminal domains are shown in green.

for ADP bound (153), ATP-γS bound, and apo- forms of HP0525 (118). The C-terminal domains of six HP0525 molecules interact to form a hexameric structure. In apo-HP0525 the N-terminal domains are rotated by varying degrees away from the C-terminal domains, as shown in Fig. 4. When nucleotide is bound, the N-terminal domains also interact to form a symmetrical hexameric ring. The ATP or ADP-bound HP0525 hexamer forms a dome-like structure, open at the N-terminal end, and closed at the C- terminal end. It has been proposed that the mechanical force generated by the conformational change induced upon ATP binding could be used to drive rearrangements of other components of the secretion system, and open and close the secretion complex.

The crystal structures of HP0525 show that this protein multimerizes to form a hexamer via its C-terminal domains, and the interaction of the N-terminal domains is dependent on ATP binding (118, 153). In contrast, studies of protein interactions using

VirB11-GFP fusions suggest that the interaction of the VirB11 C-terminal domains

31 requires ATP binding, but the interaction of the N-terminal domains does not (109).

Until the crystal structure of VirB11 is determined this apparent contradiction remains unresolved.

Most VirB11 mutations that exhibited dominant negative effects in the presence of wild-type VirB11 were non-functional in a VirB11 deletion background. However, some dominant negative mutants were identified that were functional in virulence assays in the VirB11 deletion background (155). These mutants were characterized for their effect on T-pilus assembly, and transfer of an IncQ plasmid to agrobacterial recipient cells (113). In a VirB11 deletion background, the non-functional VirB11 mutants did not produce detectable levels of T-pili. In contrast, the merodiploid strains expressing a dominant negative VirB11 allele assembled T-pili at near wild-type levels and efficiently transferred the IncQ plasmid, but were unable to transfer T-DNA. Thus, while VirB11 is involved in T-pilus production, this is not the only function of VirB11 in the transfer of

T-DNA. Several of the VirB11 mutants that were able to induce tumor formation in plants accumulated reduced levels of exocellular VirB2 and VirB5, and one mutant did not express any detectable levels of exocellular T-pilus proteins, suggesting that assembly of the T-pilus may not be absolutely required for transfer of the T-DNA into plant cells.

Three VirB11 mutants generated in this study were unable to transfer T-DNA, and did not produce T-pili, but were able to transfer the VirE2 T-DNA binding protein to agrobacterial recipient cells (113), demonstrating that the VirB system is capable of transfering proteins into a recipient cell without transferring T-DNA. These studies demonstrate that while VirB11 functions in the assembly of the T-plius, it also has a function in substrate selection or translocation, and these functions are separable.

32 Interestingly, the residues involved in some of the VirB11 mutations that

abolished T-DNA transfer are conserved in the predicted PtlH protein sequence, and in

other VirB11 homologues (108). These include E25, F154, L155, K175, and GKT174-

176. Two of these mutations are in the Walker A ATP binding motif. Corresponding

mutations at G175 and K176 in the Walker A motif of PtlH, have been shown to abolish

pertussis toxin secretion via the Ptl system (72).

Studies of Pertussis Toxin Secretion

While the structural studies of the conjugative Type IV secretion systems have

progressed rapidly, quantitative studies of DNA transfer between cells are very difficult.

In contrast, B. pertussis secretes pertussis toxin directly into the supernatant during

growth in vitro, and this substrate is easily quantified. Monoclonal antibodies to the toxin

are available, allowing for antigenic determination of protein concentrations. The

concentration of biologically active toxin can also be determined by examining its effect

on susceptible cells. In this study we examined the temporal relationship between

expression of toxin subunits, expression of Ptl proteins, and the secretion of the

assembled holotoxin following initiation of transcription of the ptx/ptl operon as a

function of the bacterial growth cycle.

We were also the first to demonstrate that a peptidoglycanase activity is essential for Type IV secretion systems by demonstrating that PtlE can cleave peptidoglycan, and this activity must be present for pertussis toxin secretion.

33 Temporal Expression of Pertussis Toxin and the Ptl Secretion

Proteins by Bordetella pertussis

INTRODUCTION

Pertussis toxin is an AB5 toxin comprised of the products of five genes: S1

through S5 (84, 97). The A subunit of the toxin is the S1 polypeptide, while the

pentameric B subunit is comprised of S2, S3, S4, and S5, assembled in a ratio of

1:1:2:1 (130). Pertussis toxin is secreted past the outer membrane of B. pertussis by a

type IV secretion system comprised of the products of the nine ptl (pertussis toxin

liberation) genes (36, 39, 146). The ptl genes are located immediately downstream of the pertussis toxin genes (147) and are transcribed from the same promoter (7, 73, 110).

It is not known how many secretion complexes are present in one bacterium during active secretion, nor is the stoichiometry of the proteins in the complex known.

The structure of other type IV systems, such as the Agrobacterium tumefaciens virB system (45, 132, 140), which secretes a tumerogenic T-DNA and effector proteins into host plant cells, and the P-plasmid tra conjugation genes (80), have been more thoroughly studied than the Ptl system. The extensive homology between the ptl genes and other type IV secretion systems suggests that the Ptl proteins also form a large complex spanning both the inner and outer membranes. Nevertheless, the Ptl-secretion system and the DNA transport systems have substantially different substrates and functions. The most intriguing difference is that the same basic machinery transports protein-coated DNA between the cytoplasm of two cells for the conjugation systems, or

34 a periplasmic protein complex across the outer membrane in the case of the Ptl system.

Functionally, the DNA-transport systems need to create a pore in three membranes, while the Ptl system only needs to create a pore in the bacterial outer membrane.

However, comparing the two systems appears to be less problematic due to recent reports that suggest that the DNA-transport systems also have substrates that are secreted from the periplasm past the outer membrane (100).

35 MATERIALS AND METHODS

Bacterial strains and growth conditions. The B. pertussis strains used in the

this study were BP338, a nalidixic acid resistant derivative of Tohama I (146), and

BPRA, a nalidixic acid and streptomycin resistant derivative of Tohama I containing a

deletion of the ptx/ptl promoter and S1 through S5 genes (4). For routine propagation,

the bacteria were grown on Bordet-Gengou (BG) agar (BD, Sparks, MD) containing

nalidixic acid at 30 µg/ml and streptomycin at 100 µg/ml when appropriate.

Growth curve for de novo expression of S1 and PtlF proteins. Modulation,

or suppression of the Bvg-regulated transcription of the ptx/ptl operon (87), was

achieved by growth on BG agar plates containing 40mM MgSO4. Strains were

streaked onto modulating plates, and incubated at 37°C for 72 h, then restreaked onto

modulating plates and incubated at 37°C for 24 h. Suspensions of modulated cells were

made in 7 ml Stainer-Scholte (SS) broth at an OD600 = 0.1 and overlaid onto BG plates

containing appropriate antibiotics as previously described (39). Plates were incubated

at 37°C, and 1ml aliquots were harvested by centrifugation. Supernatant samples (for

determination of secreted toxin) were filter sterilized to remove remaining bacteria.

Cell pellets (for determination of cellular components) were washed in 1 ml PBS (pH

7.4), and suspended to an OD600 = 8 in PBS to normalize the concentration of cells in each sample.

Construction and purification of PtlF fusion protein. To produce a standard to quantify PtlF expression antigenically, the maltose-binding protein portion of the

PtlF fusion used to generate the polyclonal antibody (107) was replaced with a

36 polyhistidine tag. The region of ptlF from amino acids 73 to 205 was amplified by

PCR using primers 5-F80 (GGCTCTAGAGACGGCTGGCAATTCAGCC) and 3-F80

(CAGAAGCTTACCCGGTCTGAACATGAGCC) that introduced an XbaI restriction site at the 5’ end and a HindIII restriction site at the 3’ end (107). The PCR product was cloned into the TA cloning vector pCR2.1 using the TOPO TA cloning kit

(Invitrogen, Carlsbad, CA), cut out of the TA vector with XbaI and HindIII, and ligated into the pRSETB vector (Invitrogen) at the NheI and HindIII sites. The polyhistidine- tagged PtlF fusion protein was overexpressed in BL21[DE3] cells (Novagen, Madison,

WI) and purified using a Ni-NTA Spin Kit (QIAGEN, Valencia, CA). Purification of the fusion protein was verified following SDS-PAGE by Coomassie stain, and by

Western blotting with anti-polyhistidine antibody (Sigma, St. Louis, MO) and with anti-PtlF antibody (107). The concentration of the purified protein was determined by

BCA Protein Assay (Pierce, Rockford, IL).

Western blotting and densitometry. Western blotting was performed essentially as previously described (39). Samples were mixed 1:1 with loading buffer.

The samples were boiled for 10 min. and 20µl was loaded in each well. For non- reducing gels, samples were mixed with loading buffer lacking β-mercaptoethanol.

Purified pertussis toxin (List Biologicals, Inc., Campbell, CA), or purified polyhistidine tagged PtlF fragment (described above) were loaded as standards. A 24 h cell sample from wild type BP338, and a 24 h cell sample from the pertussis toxin mutant BPRA were loaded on each gel as positive and negative controls. Proteins were separated by discontinuous SDS-PAGE on a Mini Protean II gel system (BioRad, Richmond, CA), using 12% acrylamideTris-glycine gels, and transferred onto nitrocellulose membranes

37 using a Trans-Blot Cell wet-blotting apparatus (BioRad, Richmond, CA). The membranes were probed with a monoclonal anti-S1 antibody, either 3CX4 (69) or 1B7

(115), a monoclonal antibody that recognizes both S2 and S3, 11E6 (117), or a rat polyclonal anti-PtlF antibody (107). Samples probed with 11E6 were run in the absence of reducing agents as previously described (116, 117). Signal was detected by chemiluminescence using the Dupont Western blot Renaissance kit (NEN Research

Products, Boston, MA).

Thanks to Trevor Stenson for preparation of supernatants containing the 1B7 and 11E6 monoclonal antibodies, and to Paula Mobberly-Schuman for her technical assistance. The antibodies were purified by the National Cell Culture Center.

To quantify protein expression by Western blot, a dilution series of purified protein was loaded onto each gel. For quantification of S1, purified pertussis toxin

(List Biologicals, Inc.) was used at 50, 25, 10 and 5 ng. For S2 and S3, purified pertussis toxin was used at 75, 50, 25 and 10 ng due to the lower affinity of monoclonal

11E6 antibody. For quantification of PtlF, purified polyhistidine tagged PtlF was used at 75, 50, 25, and 10 ng. The signal strength (Volume in Fig. 1) of the standards was obtained by densitometry using the program Image Quant version 5.1 (Molecular

Dynamics), and these values were graphed against the concentration of the standards.

The best-fit line was calculated using the linear regression function of Microsoft Excel

(Fig. 5), and this equation was used to determine the protein concentration in the unknown samples. If necessary, the sample was diluted so that the amount of protein loaded in the sample well fell within the linear range of the standards. Relative levels

38 -5 -5 600000 -5 6 4E+06 -5 -5 -5 4 S1 3E+06 S2 400000 3 x 10 x 10 4 x 10 x 10 x 10 x 10 e e e 2E+06 e e e 2 m m 200000 m m m m 2 11E+06

0 Volu Volu 0 Volu 0 0 Volu Volu Volu 52520033555500 25 50 75 100 Concentration (ng) Concentration (ng) -5 -5 -5 18 00000 -5 -5 -5 150150000 18 PtlF S3 12 00000 x 10 x 10 1000000 x 10 x 10 x 10 x 10 10 12 e e e e e e m m m m m m 5000500 66 00000

0 Volu Volu 0 Volu Volu Volu Volu 0 0 50 7 5 100 2255 5050 7575 100100 50 75 100 Concentration (ng) Concentration (ng)

Fig. 5. Standard curves for calculation of protein concentrations. Volume (in

pixels) was determined by densitometry of Western blots. S1 standards: 5, 10, 25 and

50 ng purified pertussis toxin, PtlF standards: 25, 50, 75 and 100 ng purified

polyhistidine-tagged PtlF, S2 and S3 standards 25, 50, 75 and 100 ng purified

pertussis toxin. Values from a representative experiment are shown.

39 of protein expression were determined by comparing the unknowns to the 24 h sample

as an internal standard.

To determine the amount of protein on a per cell basis, protein values were

divided by the number of cells corresponding to the optical density of the culture at the

9 time the sample was collected. An OD600=1 corresponds to 3×10 bacteria per ml (139).

8 Bacterial samples containing 10µl of cells at an OD600=8, contain 2.4×10 bacteria. For protein expression and secretion rates, trend lines were plotted using Excel, equations were calculated using linear regression and used to determine rates of change and x- intercept values.

Chinese hamster ovary (CHO) cell assay. CHO cell assays were performed as previously described (39). The amount of secreted toxin was determined from filtered sterilized culture supernatants. The amount of periplasimic pertussis toxin was determined as previously described (39, 147). Briefly, periplasmic toxin was released from the cell suspensions by shock treatment with lysozyme and EDTA, and filter- sterilized for determination of intracellular pertussis toxin. Serial two-fold dilutions of samples were made in Ham’s F-12 medium containing 1% FBS. Samples were added to CHO cell monolayers in 96 well plates and incubated 48 h at 37°C with 5% CO2.

Ham’s F-12 medium containing 1% FBS was added to wells in the negative control

rows. Pertussis toxin causes CHO cells to lose contact inhibition and produce a

“clusters of grapes” morphology (62). Cell morphology in wells containing test

samples was compared to wells containing two-fold dilutions of purified pertussis toxin

(List Biologicals) and control wells with no toxin. Each sample was assayed in

duplicate, with four independent repeats of each experiment. Each plate contained 2

40 samples, a standard, and a negative control, each of which were loaded in duplicate.

Each plate was assigned a number, and the strain names and sample types in each row on each plate were recorded before the 48 h incubation. After incubation, the cells were fixed with ethanol, and stained with Giemsa stain. The plates were then read in a random order, and each well on the plate was scored as positive or negative. The limit of detection for purified pertussis toxin was determined on each plate, and the last positive well of the test samples on that plate was assigned that value in order to calculate the concentration of the sample. In this study, the average limit of detection was 1 ng/ml, and the limit of detection did not vary by more than 1 well from the average on any plate used. After the concentration of toxin in the samples on each plate had been determined, the names of the samples on that plate were looked-up and added to the scoring sheet. The standard error of the mean was graphed and the Student t-test was used to determine statistical significance.

Separation of membrane and soluble proteins. B. pertussis BP338 or BPRA were grown in SS broth on BG plates as described above. Ten ml of a 24 h culture was pelleted by centrifugation, washed two times in 10 ml of 4°C Tris-NaCl [20 mM Tris-

HCl (pH 7.4), 200 mM NaCl, 1 mM EDTA], and suspended in 10 ml Tris-NaCl with

20 µl Sigma protease inhibitor cocktail (product # P 8465). Cells were broken by sonication for 8 min. in a sonicating water bath (Branson Ultrasonics Corp., Dantury,

CT), in 2.5 ml aliquots. Sonicated cultures were centrifuged at 9,000 x g for 10 min. to remove unbroken cells. Samples were then centrifuged at 100,000 x g for 1 h to separate the membrane and soluble fractions. The membranes were suspended in 1 ml

Tris-NaCl by sonicating for 1 min. and divided into 100µl aliquots. The soluble

41 fraction was precipitated with trichloroacetic acid (at 20% saturation for 30 min. on

ice), suspended in 1ml Tris-NaCl and divided into 100 µl aliquots. The 10x

concentrated aliquots of soluble fraction and membrane fraction were stored at -80°C until use. The whole cell, soluble and membrane fractions were examined by western blot for the presence of the membrane protein, pertactin, using the monoclonal antibody

BB05 (29) as a control (data not shown).

Generation of PtlF antibody. Hydropathy and secondary structure predict the region of PtlF from amino acid residues 73 to 205 to have the highest antigenicity index

(65). This region was amplified by PCR using primers 5-F80 and 3-F80. These primers introduced the restriction sites XbaI to the 5’ end and HindIII to the 3’ end. The PCR product was cloned into the TA cloning vector pCR2.1 using the TOPO TA Cloning kit

(Invitrogen, Carlsbad, CA) according to manufacturer’s directions. The PCR product was ligated into the plasmid pMAL-p2x using the XbaI and HindIII sites. A maltose- binding protein fusion to this region of PtlF was generated and purified using the pMALTM Protein Fusion and Purification System (New England BioLabs, Inc.). The

fusion protein was expressed in E. coli UT5600 to increase expression levels and

decrease proteolytic degradation. Rat polyclonal antibodies to the fusion protein were generated at Harlan Bioproducts for Science (Indianapolis, IN). Rats were injected with

200µg of fusion protein with Freund’s adjuvant on day 0, followed by two boosts of

100µg with Freund’s adjuvant on day 28 and day 56. The final bleed was done on day

70.

RESULTS

Bacterial growth and pertussis toxin secretion. Bacterial growth and

pertussis toxin secretion were monitored as B. pertussis was transitioned from modulated conditions in the presence of MgSO4 where virulence factor expression was

suppressed, to conditions that permitted the expression of the bacterial virulence

factors, including pertussis toxin. A lag phase of about one hour was observed,

followed by a period of logarithmic growth, and then a gradual decrease in growth rate,

with entry into stationary phase beginning at about 24 hours (Fig. 6). Pertussis toxin

secretion (Fig. 7), as evidenced by antigenic pertussis toxin subunit S1 (13 ng/ml of

toxin) in the culture supernatant was first observed at 3 hours. The greatest increase in

secreted pertussis toxin was observed between 12 and 24 hours, and secretion tapered

off during stationary phase for a final concentration of 3700 ng/ml at 48 hours. The

amount of biologically active toxin secreted at 24 hours was determined to be 2674 ±

892 ng/ml using the CHO cell assay (Fig. 7). This value is consistent with the amount

of pertussis toxin calculated from the antigenic S1 recovered, 2709 ± 548 ng/ml at 24

hours, suggesting that all of the secreted S1 is incorporated into pertussis toxin

holotoxin.

In Fig. 7, bacterial growth was occurring and a different number of cells

contributed to the pertussis toxin production at each time point. To determine the amount

of S1 produced on a per cell basis, the molar amount of S1 was determined and divided

by the number of bacteria present in the culture for each time point. S1 accumulation in

43 1010 nsity nsity e e

11 Optical D Optical D

0.10.1 00 66 1212 1818 2424 30 3636 4422 4848 1h Time (hours)

Fig. 6. Growth curve of B. pertussis BP338. Optical density is plotted as a function of time in culture. The average of 4 independent repeats plus or minus standard error is plotted. A linear trendline was calculated using the early time- points, and the time at which cultures entered logarithmic growth was determined to be at 1 hour.

44 55000000 4500 Active Toxin 44000000 Antigenic Toxin 3500 33000000 2500 22000000 1500 11000000 500 Concentration (ng/ml) Concentration (ng/ml) 00 0 6 1212 18 2244 30 3636 42 42 4488 Time (hours)

Fig. 7. Accumulation of pertussis toxin in supernatant. The amount of secreted

pertussis toxin as a function of time in culture was determined by assessing the

amount of S1 in filter sterilized culture supernatant by densitometry of Western blots

using monoclonal antibody 3CX4 (Antigenic S1). Samples taken at the 24 h time

point were also assessed by CHO cell activity assay (Toxin). The average of 4

independent repeats plus or minus standard error is plotted.

45 the supernatant was fairly linear (Fig. 8) between 2 and 18 hours. The rate of pertussis toxin secretion over this 16 hour time period was 173 molecules per cell per hour

(R2=0.9902), or about 3 molecules of pertussis toxin secreted per cell per minute.

The presence of extracellular pertussis toxin represents the end of a multi-step process involving transcription, translation, assembly, and secretion. We wanted to examine the accumulation of toxin intermediates and components of the secretion complex to begin to dissect the steps of this complex process.

Characterization of periplasmic S1 and holotoxin. Previous studies have shown that both pertussis toxin subunit S1, and assembled pertussis toxin, accumulate in the bacterial periplasm (39, 147). The pool of intracellular toxin could represent secretion precursors or intracellular toxin could accumulate because secretion of pertussis toxin is rate limiting. Therefore, we examined accumulation of the periplasmic toxin as a function of the growth cycle. As reported previously, a significant amount of cell- associated S1 was detected (Fig. 9). In contrast to secreted S1, which was observed after

3 hours in culture (Fig.8), cell-associated S1 began to accumulate after about 5 to 6 hours in culture, and then increased with time.

The periplasmic pool of antigenic S1 could consist of unassembled S1 subunit or S1 incorporated into pertussis toxin. CHO cell assays were performed to determine the amount of periplasmic S1 incorporated into holotoxin. Very little periplasmic S1 was detected before 6 hours in culture, so samples from 12 and 24 hours were selected for characterization (Fig. 9). The amount of S1 incorporated into pertussis toxin, as detected by CHO cell assay, was about half of the amount of antigenic S1 detected by

46 4500 40004000 3500 30003000 2500 20002000 1500 10001000 S1 (molecules/cell) S1 (molecules/cell) 500 00 0 6 12 18 24 2 h

Fig. 8. Toxin secretion per cell. The amount of secreted S1 expressed on a per

cell basis was determined as a function of time in culture. The average of 4 to 7

independent repeats plus or minus standard error is plotted. The trend line was

plotted by linear regression for time points corresponding to 3 to 18 h in culture

and was found to have a slope of m=173 molecules/cell/hour and an x-intercept of

2 hours.

47 1500 1500 Active Toxin Antigenic S1 10001000

500500 S1 (molecules/cell) S1 (molecules/cell) 0 0 0 6 12 18 24 Time (hours)

Fig. 9. Periplasmic S1 and periplasmic toxin. The amount of periplasmic

antigenic S1 was determined by densitometry using monoclonal antibody 3CX4

and expressed on a per cell basis as a function of time in culture. The amount of S1

assembled into pertussis toxin (Active Toxin) was determined by CHO cell assay.

The average of 4 independent repeats plus or minus standard error is plotted. The

concentration of toxin detected by CHO cell assay at 24 hours was significantly

different from the concentration of S1 detected by densitometry, P<0.0001.

48 densitometry. Active toxin levels were 421 ± 69 molecules per cell at 12 hours and 353

± 124 molecules per cell at 24 hours. These values were not significantly different from each other, but were significantly less than the concentration of antigenic S1 at 24 hours. The accumulation of a pool of periplasmic toxin subunits and assembled toxin after secretion has initiated suggests that pertussis toxin secretion, not assembly, is rate limiting.

Much of the periplasmic S1 has been reported to be associated with the bacterial outer membrane (49). We performed separations of the soluble protein (cytoplasmic and periplasmic) and membrane associated protein (Fig. 10). Equivalent amounts of antigenic S1 were detected in the soluble and membrane fractions at 24 hours (Fig. 10, lane 3 vs. lane 4), as determined by densitometry. About half of the periplasmic S1 had been determined to be assembled into holotoxin by CHO cell assay (Fig. 9), and assembled toxin is recovered from the soluble fraction, suggesting that the S1 detected in the soluble fraction is the S1 that has been assembled into pertussis toxin. The remaining S1 is membrane bound, consistent with the suggestion S1 has a membrane- associated intermediate prior to incorporation into soluble holotoxin (49). Samples were also examined for the presence of the membrane associated protein pertactin (23), as a control. Pertactin was localized entirely to the membrane fraction (data not shown).

Characterization of B-subunit protein expression. Periplasmic A subunit protein (S1) was found in excess of folded toxin in the cells. To determine whether this was also true for proteins in the B oligomer, we quantified expression of S2 and S3 at 24 hours (Fig. 11), using monoclonal antibody 11E6, which recognizes both S2 and S3

49 s l l Ce ranes e b l PTX Purified PTX Who Soluble Mem ∆

12 345

Fig. 10. Localization of cellular S1. The amount of S1 from various cell fractions was examined by Western blot using monoclonal antibody 3CX4.

Lane 1, 50 ng purified pertussis toxin; lane 2, BP338 whole cells; lane 3,

BP338 soluble fraction; lane 4, BP338 membrane fraction; lane 5, BPRA

(pertussis toxin mutant) whole cells were loaded as a negative control.

50 PTX A. WT PTX ∆ Samples ∆ Purified PTX S2 S3

B. 20002000 ll ll e e 15001500

10001000

500500 Molecules/C Molecules/C

0 0 S2S2 S3S3 ToxinToxin S1S1

Fig. 11. Periplasmic S2 and S3 and pertussis toxin. A. Western blot using monoclonal antibody 11E6; lane 1-3, three individual 24 h samples of BP338; lane 4,

24 h sample of pertussis toxin mutant (BPRA); lanes 5-8, purified pertussis toxin standards 75, 50, 25, and 10 ng, respectively. B. Antigenic S2 and S3 per cell compared to active holotoxin and antigenic S1 at 24 h.

51 under non-reducing conditions (116, 117). The levels of these proteins, 1524 +/- 156

molecules per cell for S2, and 1088 +/- 286 molecules per cell for S3 corresponds to

slightly more than a two-fold excess over the amount incorporated into active toxin,

which is similar to the amount of S1 detected under reducing conditions. An initial

examination of S2 and S3 localization detected S2 and S3 in both the membrane and

soluble fractions (Fig. 12).

Expression of PtlF protein. Because the Ptl proteins are expressed from the

same polycistronic message as the toxin structural proteins, we wished to examine the

level of Ptl protein in the cells relative to the toxin levels. To examine PtlF expression, a

PtlF antibody was raised in rat. The antisera detected a 31 kDa band in the wild-type strain, BP338, when samples were run under reducing conditions (Fig. 13A). This band was not present in the ptl mutant strain, BPRA. A non-specific band, which migrated at a slightly larger size than PtlF, was also observed in both strains. PtlF was very unstable under these conditions, as has been previously reported (127). Since the instability was thought to be due to endogenous proteases that recognize the reduced form of PtlF, the samples were brought to boiling before the addition of the sample buffer containing reducing agent. When run under non-reducing conditions, a 36 kDa band was detected

(Fig. 13A), consistent with the previously reported size of PtlF disulfide bonded to PtlI

(48). PtlF was stable under non-reducing conditions, and these conditions were used for all further studies. Cellular fractionation of soluble and membrane association proteins was performed. All of the PtlF-PtlI complex was localized to the membrane fraction

(Fig. 13B).

52 The amount of cell-associated PtlF was determined by Western blot (Fig. 14A).

Cells grown under modulating conditions (time zero) were found to have about 30 molecules of PtlF per cell, and this level had not changed by the 3 hour time point, when secreted pertussis toxin was detected. From 3 to 24 hours, a linear increase in PtlF was observed (R2=0.9697). Accumulation stopped after 24 hours, with 1072 molecules per cell at 24 hours and 1078 molecules per cell at 48 hours. The level of PtlF was less than the total accumulation of S1 (cell-associated and secreted) at all time points, and the ratio of S1 to PtlF was 4:1 at 24h (Fig. 14B). The rate of pertussis toxin secretion on a per cell basis was constant throughout logarithmic phase (Fig. 8) despite a 30-fold increase in PtlF expression, suggesting that the basal level of PtlF protein expression

(30 molecules per cell) is sufficient for maximum pertussis toxin secretion.

mutant) who fraction; lane4,50ngpurifiedPTXpertussi 1, BP338wholecells;lane2,solubl cell fractionswasexam Fig. 12.Localiz S3 S2 l e ce ation ofcellu lls. i n ed byW 1 lar S2andS3. Whole Cells e stern bl 2 3 Soluble ot usingm e fraction;lane3,BP338m s toxin;lane4,BPRA(pertussistoxin The Membranes am 4 ount ofS2andS3from onoclonal antibody11E6;Lane Purified PTX

5 PTX Mutant e mbrane various 54

cultu Whole cellsandsolublem Fig 13.Westernsusingratanti-PtlFantibody. re runu nder non-reducingcond 31 kD 36 kD 36 kD A. B. Reduced Non- e mbrane WT itions.

fractionsfrom Cells ptl mutant

Soluble reduced

A. Reducedvsnon-reduced.

wild-typeBP33824h Membranes WT ptl mutant B.

55 A. 12001200 1000 800800 600 400400 200 Molecules/ Cell Molecules/ Cell 0 0 66 1212 1818 2424 2h Time (hours) B. 4500 PtlF ll ll ll 4000 PtlF e e e 3500 ToTotaltal S1 S1 s/ C s/ C s/ C 3000 le le le u u u 2500 c c c 20002000 le 2000

le 2000 le o o o 1500 M M M 1000 500 00 0 6 121824 Time (hours)

Fig. 14. Accumulation of PtlF. (A.) The amount of PtlF expressed on a per cell basis was determined as a function of time in culture. The average of 4 independent repeats plus or minus the standard error is plotted, with a trend line determined by linear regression for time points corresponding to 3 to 24 h in culture. (B.) Comparison of PtlF and total S1 expressed on a per cell basis as a function of time in culture. Total S1 was calculated as secreted plus periplasmic

S1, and standard error was calculated by error propagation.

56 DISCUSSION

Type IV secretion systems of Gram-negative bacteria mediate the transfer of

complexes of biomolecules across membranes for at least two diverse processes,

conjugation and protein secretion. The assembly and structure of the type IV

conjugation systems has been extensively studied (9, 31, 45, 75, 132), however these

studies have been performed largely in the absence of the target recipient cells, and likely

reflect the inactive, closed secretion complex. The pertussis toxin secretion system of B.

pertussis has nine proteins, PtlA-I, which is fewer than the conjugation systems. Much is

known about the secretion substrate, pertussis toxin, and the dynamics of the secretion

process. The steps in pertussis toxin secretion (Fig. 15) include: transcription and

translation of the ptx/ptl operon, Sec-mediated secretion of the subunits to the periplasm,

proteolytic removal of the signal peptides, intramolecular disulfide bond formation,

periplasmic assembly of the toxin subunits and the secretion apparatus, and finally toxin

secretion. We were able to examine several of these steps in this study.

The ptx/ptl operon (Fig. 15, bottom) is large, about 13 kb. Ribosome binding sites have not been detected for the downstream genes of the ptx/ptl operon, suggesting that translation must initiate at S1 and continue down the mRNA, with PtlH being the final protein to be translated. A predicted stem and loop structure located between the ptx structural and ptl secretion genes has been proposed to act as a translational terminator

(110), and could play a role in differentially regulating levels of the pertussis toxin and the secretion proteins. Our data indicates that both PtlF and pertussis toxin S1 accumulate at a linear rate (Fig. 14B), although PtlF accumulates at a slower rate.

g ne ne t in nd n can can rm d . o e mbra mbra m e e rnata 1) f ste sport mbrane a y r M r M (S n e a Supe r ptlH m on s ion peptidogly peptidogly r i e t t Inne Inne r Outer Membrane Outer Membrane e r erat c B ts a b ptlG i A subunit A l se t with oute I P G e ptlF t G a oxin l

E the

I I

X X X X a

F with the

H l

l i

t t s

T T T

T ptlE

p p e P P P P v ssoc t Toxin subuni E G D a i ne ts a E F C ptlD G ertussis t E ssoc I mbra G 4 tion. 1. -p e G r nd a me r subuni r s a

X sec

T ptlC

genes

oute B

P B l l

t t mble

nd othe

p p

A A

l ptl

t ly and p p sse h the b S1 a t a m S1 2. roug

. h in t s3 asse d n ox Sec i a B subuni s5 ete i r c v 3. s tox . i ne s4 d ra uss b t n is se ertussis t rme r m s2 o e e f

-p toxi p e 23 o r l of s1 Hol nner m de genes 4. o e bonds a ptx h the i d i 1 oxin. f Sec Promoter Fig. 15. M throug disul holot

58 These results suggest translation of the ptl genes may be attenuated with respect to the pertussis toxin structural genes.

It has been suggested that membrane-associated S1 may constitute a nucleation site for the assembly of the holotoxin on the periplasmic face of the outer membrane (49), as depicted in Fig. 15, step3. We found that the soluble pool of periplasmic S1 was equivalent to the pool of soluble, assembled pertussis toxin, suggesting that all of the unassembled S1 was associated with the membrane fraction. Similarly, membrane associated and soluble pools of the B-subunits S2 and S3 were found. The C-terminal portion of S1 has been proposed to mediate association with the membrane (49), however the C-terminal portion of S1 is required for association with the B-pentamer (76), and assembly into holotoxin would promote disassociation of S1 from the membrane.

Previous studies have identified a domain on S1 (amino acids 55 to 57), distal from the

C-terminus, which is required for secretion of pertussis toxin (37). This region is thought to mediate recognition of pertussis toxin by the Ptl-secretion complex, however it is currently unknown how the Ptl-secretion system can discriminate between the secretion substrate, assembled pertussis toxin, and unassembled subunits.

PtlF is thought to form the actual secretion pore in the outer membrane. As few as thirty molecules per cell of PtlF were present when pertussis toxin secretion was first observed. Its closest homolog, VirB9, forms multimers (75), and PtlF is also thought to multimerize, but the number of molecules per secretion complex is not known for either protein. The secretion pore of the type IV secretion systems can be compared to the secretion pore of filamentous phage. The structure of the pIV secretion pore of filamentous phage f1 has been characterized, and the pIV protein forms tetradecamers

59 (99). If, as in the case of pIV, fourteen PtlF subunits are incorporated into each pertussis toxin secretion complex and all were active, then maximal pertussis toxin secretion (three molecules of toxin per cell per minute) can occur with only two secretion complexes per cell. At 24 hours, each cell expressed about 1070 molecules of PtlF, enough for 76 secretion complexes containing 14 molecules of PtlF. However, the rate of pertussis toxin secretion was constant, suggesting that a pool of inactive PtlF had accumulated, similar to that observed for the pertussis toxin structural subunits S1, S2, and S3. It is likely that the subunits in biologically active secretion complexes may fractionate in different compartments from inactive protein, confounding analysis of the secretion process. Our studies suggest that secretion should be examined early in the growth cycle before inactive complexes have accumulated in the cells. Functional complex assembly may be limited to only certain sites on the membrane. Polar localization would limit the number of active secretion complexes to two per cell. Polar localization has been observed for some extracellular bacterial complexes, such as flagella, pili, and the IcsA complex, which mediates intracellular spreading in Shigella (121). The A. tumefaciens

VirD4 protein, which is required for transfer of cytoplasmic substrates via the VirB secretion complex, also exhibits polar localization (77). This suggests that secretion through the VirB system may occur at the poles. However, it remains to be determined if

Ptl secretion is limited to polar sites.

Bordetella pertussis invests a great deal of resources to produce and secrete pertussis toxin, however our studies suggest it is a surprisingly inefficient process. The maximum secretion rate was only three molecules per minute. Furthermore, over the time course characterized in this study, about 12% of the assembled pertussis toxin

60 detected by CHO cell assay was retained in the periplasm, and the secretion component

PtlF accumulated in vast excess. Secretion, not assembly of pertussis toxin, appears to be the rate-limiting step.

In contrast to pertussis toxin, Vibrio cholerae secretes over 95% of folded cholera toxin to the supernatant (63). Cholera toxin is secreted by the type II secretion system also used for secretion of the cholera toxin encoding filamentous phage, CTXφ (34), and a type II system for the secretion of heat-labile enterotoxin has recently been identified in enterotoxigenic E. coli (131). Unlike Vibrio cholerae and enterotoxigenic E. coli, B. pertussis has no reservoir other than the human host, and to maintain itself as it species it must be capable of persisting in the presence of an immune response. Pertussis toxin inhibits the ability to generate an immune response. It is likely that improperly assembled pertussis toxin could elicit toxin-neutralizing antibodies, and defeat the objective of pertussis toxin. It may be that the Ptl-secretion system has evolved to ensure release of properly assembled toxin at the expense of efficiency.

While the process of pertussis toxin secretion may be inefficient, the amount of toxin secreted by B. pertussis is substantial, 3 µg/ml in 24 h. For comparison, total secretion of cholera toxin at 0.36 µg/ml in 24 hours (34) and heat-labile toxin at 0.19

µg/ml in 24 hours (131) was 10-fold lower. Only 2.5 µg of pertussis toxin is needed to kill susceptible strains of mice (57), and it is likely that a higher rate of secretion would be counterproductive to the organism’s survival. A need to prevent excess secretion of toxin may also explain the accumulation of unassembled toxin subunits. The assembled holotoxin is very stable, and highly resistant to proteases and reducing agents (91).

61 Therefore, holotoxin that was produced but not secreted by the bacterium would be more difficult to dispose of than unassembled toxin subunits.

The PtlE Protein of Bordetella pertussis has Peptidoglycanase

Activity Required for Ptl-Mediated Pertussis Toxin Secretion

INTRODUCTION

Pertussis toxin is the most complex toxin yet discovered. It is an AB5 toxin comprised of the products of five genes: S1 through S5 (84, 97). The A subunit of the toxin is the S1 polypeptide, while the pentameric B subunit is comprised of S2, S3, S4, and S5 assembled in a ratio of 1:1:2:1 (130). Secretion of pertussis toxin past the outer membrane of Bordetella pertussis requires the nine ptl (pertussis toxin liberation) genes

(39). The ptl genes are located immediately downstream of the pertussis toxin genes,

transcribed from the same promoter (36, 147). Based on homology to other type IV

systems, such as the Agrobacterium tumefaciens virB operon and to the P-plasmid tra

conjugation genes (150), it is predicted that the Ptl proteins form a large complex

spanning both the inner and outer membranes. While they do not share homology, the

type IV complexes are comparable to the flagellar basal body, or the type III secretion

systems, which also span the cytoplasm and cross the peptidoglycan barrier. During

assembly of the flagellum, flagellar subunits are secreted from the bacterium through the

basal body (1). Likewise, proteins involved in pathogenesis are secreted into the

extracellular milieu through the flagellar export apparatus of Salmonella typhimurium

(154).

63 Pertussis toxin is assembled in the periplasmic space, and the Ptl-system mediates

secretion from the periplasm past the outer membrane. However, the Ptl secretion system

appears to span the inner as well as outer membrane since Ptl proteins have been found

localized to both the inner and outer membranes (66). Therefore, the secretion complex

must also span the peptidoglycan layer.

The peptidoglycan layer forms a rigid, mesh-like barrier within the periplasmic

space that surrounds the cytoplasm and inner membrane of the bacterium (44). This rigid

layer allows the bacterium to maintain a hyperbaric internal pressure without lysis and

confers the overall shape of the organism. It is composed of parallel glycan strands of alternating subunits of N-acetylglucosamine and N-acetylmuramic acid, that encircle the bacterium and are connected by cross-linked tetrapeptides, forming a covalently closed macromolecule surrounding the inner membrane.

The peptidoglycan layer is maintained and modified by numerous enzymes. These include the peptidoglycanases, which break the β1,4 bonds between individual sugars in

the glycan strands. The peptidoglycanase family includes eukaryotic lysozymes, and

bacteriophage holins, as well as bacterial peptidoglycanases. Recently, peptidoglycanase

proteins involved in local rearrangements of peptidoglycan have been found in other

systems involving passage through the membrane. An accessory protein of the flagellar

basal body, FlgJ, of Salmonella typhimurium has been found to have peptidoglycanase

activity, which is required for motility (94). A peptidoglycan hydrolase homology has

also been identified in the VirB1 protein of the Agrobacterium tumefaciens virB type IV

secretion system (93) that has been shown to enhance tumorigenesis (83). Similarly,

several bacteriophage have been found to have a lytic transglycosylase activity thought to

64 be involved in the invasion step. These include GP16 of T7 (89) and the P7 structural protein of PRD1 (112). The activity involved in phage entry is different from the activity involved in lysis of an infected bacterium in that it affects the peptidoglycan structure only locally, and does not promote cell lysis.

This study was carried out to identify a peptidoglycanase in the Ptl system. PtlE was chosen as the candidate peptidoglycanase because it was found to possess sequence similarity to the active site of glycohydrolase enzymes at its N-terminus using the program BLOCKS (61). We showed that a polyhistidine tagged PtlE has peptidoglycanase activity. Mutants with amino acid substitutions at the putative glycohydrolase active site lacked activity and significantly reduced the secretion of pertussis toxin. On the basis of these results, we suggest that PtlE is a peptidoglycanase specific to the pertussis toxin secretion apparatus.

65 MATERIALS AND METHODS

Bacterial strains and plasmids. Strains used are shown in Table 2. E. coli

strains were grown on L agar. B. pertussis strains were grown on Bordet Gengou (BG)

agar or in Stainer Scholte broth plated on BG agar as previously described (39, 146).

Plasmids used in this study are shown in Table 3.

Table 2. Strains used in this study.

Strains Relevant Features Reference

E. coli strains

BL21[DE3](pLysS) T7 polymerase Invitrogen

DH5α High efficiency transformation, nalR Gibco BRL

UT5600 OmpT- mlt1 New England

Biolabs

B. pertussis strains

BP338 Tohama I derivative, nalR (146)

BPRA deletion of ptx/ptl promoter and S1 (4)

through S5 genes, nalR, strepR

66 Table 3. Plasmids used in this study.

Plasmids Relevant Features Reference

Commercial Vectors

pBluescript KS+ cloning vector, ampR Stratagene

pCR2.1 TA cloning vector, ampR kanR Invitrogen

pRSETB expression vector, T7 promoter, Invitrogen

polyhistidine metal binding domain,

ampR

pET-21b expression vector, T7 lac promoter, Novagen

ampR

pMAL-p2x maltose-binding protein fusion vector New England

Biolabs

His-tagging PtlE

pKC34 ptx/ptl operon in pSP72, ampR (39)

pAR186 ptlE in pRSETB this study

pAR253-1 ptlE D53A in pRSETB this study

pAR278-1 ptlE E62A in pRSETB this study

pAR278-2 ptlE D53A, E62A in pRSETB this study

pAR312-1 ptlE (1-84) in pET-21b this study

pAR312-2 ptlE D53A (1-84) in pET-21b this study

67 pAR312-3 ptlE E62A (1-84) in pET-21b this study

pAR312-4 ptlE D53A, E62A (1-84) in pET-21b this study

Expression in B. pertussis

pBBR1-MCS2 broad host range cloning vector, kanR (74)

pCW211-5 plasmid containing B. pertussis cpn10 (144)

promoter

pAR228-1 pBBR1-MCS2 with the B. pertussis this study

cpn10 promoter inserted between the

SacI and SacII sites.

pAR249-1 his-tagged ptlE in pAR228-1 this study

Cloning ptlE Mutants

pAR146 NotI to HindIII fragment from pKC34 this study

containing ptlE through ptlH genes in

pBluescript.

pKC109 oriT, gentR, cycA fragment (39)

pAR287-2 D53A mutation in pKC34 this study

pAR264-3 E62A mutation in pKC34 this study

pAR264-4 D53A, E62A mutations in pKC34 this study

Peptidoglycanase activity gels (Zymograms). Peptidoglycanase activity was detected using the methods of Potvin et al. (106) and Buist et al. (24). Bacterial cells were separated in SDS-PAGE gels containing 0.2% (wt/vol) autoclaved, lyophilized

Micrococcus lysodeikticus ATCC4698 cells (Sigma). Proteins were allowed to renature in the gels by shaking in 25 mM Tris-HCl (pH 7.5), 1% (vol/vol) Triton X-100 for 48 h, with several changes of buffer to remove SDS. Peptidoglycanase activity resulted in the formation of clear bands. Gels were stained for 5 min. with 1% methylene blue in 0.1%

(wt/vol) KOH to increase contrast, and destained in three to four changes of deionized water. As a further refinement of the procedure, the gel shown in Fig. 24 was renatured in

25 mM Tris-HCl (pH 7.5), 1% (vol/vol) Triton X-100 for 24 h, and them in 25 mM Tris-

HCl (pH 5.0), 1% (vol/vol) Triton X-100 for an additional 24 h. The pH optimum of lysozyme, and the two major E. coli transglycosylases (SLT and MLT) are in the vicinity of pH 5, so it was thought that decreasing the pH in the final step would increase the activity of the protein.

Western Blots. Western blots were performed as previously described (39).

Samples were mixed at a 1:1 ratio with sample buffer. Proteins were separated on 12% acrylamide SDS-PAGE gels, and transferred to PVDF or nitrocellulose membranes. The membranes were probed with anti-polyhistidine antibody (Sigma), or anti-PtlF antibody.

Separation of membrane and soluble proteins. B. pertussis BP338 (pAR249-

1) was grown in SS broth on BG plates as described above. Ten ml of 24 h culture was pelleted by centrifugation, washed two times in 10 ml of Tris-NaCl [20 mM Tris-HCl

(pH 7.4), 200 mM NaCl, 1 mM EDTA] at 4°C, and resuspended in 10 ml Tris-NaCl with

69 20 µl Sigma protease inhibitor cocktail product # P 8465). Cells were broken by

sonication for 8 min. in a Branson 2510 sonicating water bath, in 2.5 ml aliquots.

Sonicated cultures were centrifuged at 9,000g for 10 min. to remove unbroken cells.

Samples were then centrifuged at 100,000g for 1 h to separate the membrane and soluble

fractions. Membranes were resuspended in 1 ml Tris-NaCl by sonicating for 1 min.

Soluble fractions were precipitated with 20% w/v trichloroacetic acid (TCA) and

resuspended in 1 ml Tris-NaCl.

Construction of fusion proteins for overexpression in E. coli. The PtlE gene was cloned out of pKC34 using primers 5-E180 and 3-E180, which add the restriction enzyme sites XbaI to the 5’ end and HindIII to the 3’ end. The PCR product was TA cloned into pCR2.1 as described above, and then ligated into expression vector pRSETB at the NheI and HindIII sites, resulting in an N-terminal polyhistidine fusion, plasmid pAR186 (Table 3).

Overexpression of fusion proteins in E. coli. The polyhistidine tagged PtlE fusion proteins were expressed in E. coli BL21[DE3](pLysS). Cultures were grown in L- broth containing ampicillin and chloramphenicol at appropriate concentrations. Single, freshly transformed colonies were added to 10 ml L-broth and incubated overnight without shaking at 37°C. The overnight culture (0.2 ml) used to inoculate 10 ml of fresh

L-broth, and incubated with shaking at 37°C until mid-log phase growth. Expression of the fusion protein was induced by the addition of IPTG to a final concentration of 1 mM.

Cultures were incubated an additional 2 h and harvested in 1 ml aliquots by centrifugation. Cell pellets were resuspended to an OD600 corresponding to 4 for

analysis.

70 Construction of fusion proteins for overexpression in B. pertussis. A vector for the expression of fusion proteins in B. pertussis was constructed in the broad host- range cloning vector pBBR1-MCS2 (74). Primers 5-HSP and 3-HSP were used to amplify the B. pertussis cpn10 promoter (53) from pCW211-5 (144) and add the restriction enzyme sites SacI to the 5’ end and SacII to the 3’end. The promoter was

ligated into pBBR1-MCS2 at the SacI and SacII sites to create pAR228-1. This places

the promoter immediately upstream of the multiple cloning region. The his-tagged fusion

protein was ligated into the B. pertussis expression vector pAR228-1 at the XbaI and

HindIII sites to generate plasmid pAR249-1, and electroporated into B. pertussis BP338 using the procedure developed by Weingart et al (144). Colonies were selected on kanamycin and individual transformants were grown-out on Bordet-Gengou plates at

37°C for 48 h.

Construction of amino acid substitutions in ptlE. Point mutations D53A,

E62A and double mutant (D53A E62A) were constructed by PCR, using the primers listed in Table 4. The D53A mutation was made using primers 5-AR156 and 3-AR156.

The E62A mutation was made using primers 5-AR264 and 3-AR264. The nucleotides altered to produce the amino acid substitutions are underlined and bolded. The double mutant was constructed using primers 5-AR264 and 3-AR264 and a plasmid containing the PCR fragment with the D53A mutation as the template. Outside primers 5-D80 and

3-F80 were used to clone the mutations into the ptx/ptl operon. The PCR products were

TA cloned into pCR2.1. The cloned point mutations were ligated into pAR146 using

NotI and AatII. The NotI to HindIII region from the resulting plasmid was then ligated

back into the remaining portion of pKC34 to regenerate the complete operon containing

71 Table 4. Primers used in this study.

Primer Sequence

5-F80 GGCTCTAGAGACGGCTGGCAATTCAGCC

3-F80 CAGAAGCTTACCCGGTCTGAACGTGAGCC

5-E180 GGCTCTAGAATGGGCCATCCTGGCCATC

3-E280 CAGAAGCTTCATGGCTGTCCAGCCTCCG

5-HSP GAGCTCGCGAAGACCCGCC

3-HSP CCGCGGATGAGGAACTCCTG

5-AR156 CTTGACGCCTGCCCAGACGC

3-AR156 GTCTGGGCAGGCGTCAAGGGG

5-AR264 GCCGCGGCCGCGGTGGAC

3-AR264 GCGGCCGCGGCATGCCCG

3-AR301 GAAGCTTCACCATGCACGGCGTTCCGAC

5-D80 GGCTCTAGAGCGGGCCTGCGGCG

the desired nucleotide substitution(s) as shown in Fig. 19. The HindIII fragment of

pKC109 containing the gentamicin resistance gene, origin of transfer, and an internal

fragment of the adenylate cyclase gene was ligated into these plasmids to make suicide

vectors (D53A=pAR287-2, E62A= pAR264-3, and D53A, E62A = pAR264-4) for tri-

parental mating, as described in Table 3. The suicide plasmids were transformed into E.

coli HB101.

Vectors for the expression of His-tagged ptlE in E. coli, (pAR317-2, pAR317-3,

pAR317-4), containing amino acid substitutions D53A, E62A, and a double mutant were

generated in the manner described above for plasmid pAR186 using plasmids pAR287-2,

pAR264-3 and pAR264-4 as a templates for PCR. C-terminal truncations of the tagged

wild-type and mutant ptlE genes were subcloned from the full-length genes using the T7 promoter primer and primer 3-AR301. The PCR products were TA cloned, and then ligated into expression vector pET-21b at the NdeI and HindIII sites to produce plasmids pAR253-1, pAR278-1, pAR278-2 and pAR312-4. These plasmids expressed the N- terminal portion of PtlE and the PtlE point mutants up to amino acid 84.

Introduction of mutations into B. pertussis chromosome. Each plasmid containing a mutant ptlE, or the wild-type gene was integrated into the chromosome of B. pertussis via a region of adenylate cyclase homology as described previously (39). Tri- parental matings were performed as described by Barry et al. (11). Briefly, mating mixtures contained 250 µl of E. coli HB101 containing one of the suicide plasmids, and

250 µl of an E. coli strain containing helper conjugative plasmid pUW956 (146) suspended in LB, added to 2 ml B. pertussis BP338 in SS broth. The mating mixtures

73 were plated on SS plates containing 40 mM MgCl2 and incubated at 37°C. After 6 h, the mixtures were streaked on BG plates with nalidixic acid and gentamicin to select for single recombination events where the plasmid had integrated into the B. pertussis chromosome, and further screened for recombination into the adenylate cyclase locus by selecting non-hemolytic colonies.

Toxin secretion assay. Single colonies from independent tri-parental matings were streaked onto BG agar and incubated 48 h at 37°C. A suspension of this culture was made at an OD600 = 0.1 in Stainer-Scholte broth and 7 ml of the suspension was

overlayed onto a BG plate with gentamicin and nalidixic acid and incubated 24 h at 37°C.

Cells were harvested in 1 ml aliquots by centrifugation. Supernatant samples were filter

sterilized to remove remaining bacteria. Cell pellets were washed in 1 ml PBS (pH 7.4).

For Western analysis, pellets were resuspended in PBS to an OD600 corresponding to 8.

For determination of periplasmic toxin, bacterial pellets were resuspended in 100 µl 20

mg/ml lysozyme and incubated 30 min. at 37°C. The reaction was stopped by the addition of 900 µl PBS, 0.05% (vol/vol) tween-20. Samples were centrifuged to pellet cell debris and the supernatant (periplasmic fraction) was filter sterilized.

Chinese hamster ovary (CHO) cell assay. CHO cell assays were performed as described (39). Briefly, serial two-fold dilutions of samples were made in Ham’s F-12 medium containing 1% FBS. Samples were added to CHO cell monolayers in 96 well plates and incubated 48 h at 37°C in a tissue culture incubator. Pertussis toxin causes

CHO cells to lose focal adhesion and produces a “clusters of grapes” morphology. Cell morphology in wells containing test samples was compared to wells containing two-fold dilutions of purified pertussis toxin (List Biologicals, Campbell, CA, USA) and control

74 wells with no toxin. Each sample was assayed in duplicate with at least three independent repeats. The limit of detection for purified pertussis toxin was determined on each plate, and the last positive well of the test samples was assigned that value. The standard error of the mean was graphed and the Student t-test was used to determine statistical significance.

75 RESULTS

PtlE has sequence homology to glycohydrolases. The ptlE gene is one of the nine ptl genes located downstream of the pertussis toxin genes and required for the export of folded pertussis toxin past the outer membrane of the bacterium. The PtlE protein is predicted to be 276 amino acids, with a molecular mass of 30 kDa (Fig. 16). It contains a single membrane-spanning domain (amino acids 84 to 127), which we have predicted to be oriented with the N-terminus on the periplasmic side of the inner membrane using

TMpred (http://www.ch.embnet.org). A preliminary search using the program BLOCKS identified a region of homology to glycosyl hydrolase family 9 (61). This region of homology spans amino acids 51 through 76 of PtlE and is predicted to be localized to the periplasmic space. The most conserved region contains two acidic amino acids, located nine residues apart (Fig. 16, D53 and E62). These residues, an aspartic acid and a glutamic acid residue, have been shown to be catalytically important in another member of this family (136).

Peptidoglycanase activity of PtlE. Peptidoglycanase activity was monitored using activity gels. Bacterial proteins were separated on SDS polyacrylamide gels containing Micrococcus lysodeikticus cells as a source of peptidoglycan. Following electrophoresis, protein was allowed to renature, and peptidoglycanase activity was detected as uncolored bands following staining with methylene blue. Endogenous peptidoglycanases which were detected at 20 kDa in E. coli and at 60 kDa in B. pertussis acted as positive controls. In initial studies, no differences were detected between wild type B. pertussis and pertussis toxin and Ptl deletion mutants. The failure to detect this

76 184127 276

Putative hydrophobic active Possible site residues processing site D53, E62

Fig. 16. Features of the PtlE protein. The putative active site residues and membrane-spanning region are indicated.

77 activity in B. pertussis was not unexpected, and is likely due to the need to tightly regulate this potentially dangerous activity.

Construction and expression of fusion proteins. To improve sensitivity, PtlE was overexpressed as a polyhistidine tagged fusion. PtlE has two potential initiation codons. Since it is not known which of these is the actual initiation site of PtlE, the first possible start site was chosen for the fusion protein to ensure that the entire protein would be included in the resulting fusion protein. The PtlE gene was cloned out of pKC34 by

PCR using primers 5-E180 and 3-E180 (Table 3), which added the restriction enzyme sites XbaI to the 5’ end and HindIII to the 3’ end, and ligated into expression vector pRSETB at the NheI and HindIII sites, resulting in an N-terminal polyhistidine fusion.

The polyhistidine tagged PtlE protein was overexpressed in E. coli. This fusion protein ran at 30 kDa as determined by Western blots using antibody to polyhistidine

(Fig. 17A). Peptidoglycanase activity was monitored using a peptidoglycanase activity gel. Peptidoglycanase activity co-migrated with the fusion protein (Fig. 17B, induced).

No peptidoglycanase activity was detected at that molecular weight in the uninduced control (Fig. 17B, uninduced).

Expression of the PtlE fusion protein in B. pertussis. For expression in B. pertussis, vector pAR228-1 was constructed by inserting the B. pertussis cpn10 promoter into the broad-host range cloning vector pBBR1-MCS2, which is capable of replication in B. pertussis. The region encoding the fusion protein was cut out of the pRSETB vector using XbaI and HindIII and ligated into the B. pertussis expression vector to create pAR249-1.

78 d e c A. u B. induced uninduced uninduced ind

30 kDa

1 2 1 2

Fig. 17. Analysis of polyhistidine tagged PtlE expressed in E. coli BL21. Lane

1, BL21(pAR186) uninduced; Lane 2, BL21(pAR186) induced with IPTG. A.

Western analysis using anti-poyhistidine antibody. B. Zymogram analysis showing peptidoglycanase activity.

79 The his-tagged PtlE-fusion protein was expressed by wild-type B. pertussis strain BP338

as determined by Western blots (Fig. 18A). The major cross-reacting band detected by

antibodies to polyhistidine was observed to migrate at 25 kDa, slightly faster

than the same fusion protein expressed in E. coli. Since the fusion protein is N-

terminally tagged, this suggests that the C-terminus of the PtlE protein may be processed

in B. pertussis.

The native PtlE protein has been shown to localize to the membrane fraction in B.

pertussis (66). In order to determine where the fusion protein was localized, B. pertussis

BP338 (pAR249-1) expressing his-tagged PtlE was separated into soluble and membrane

fractions by sonication and high-speed centrifugation. Samples of the fractions were

analyzed by Western blot and peptidoglycanase activity gel. The fusion protein was

found to localize to the membrane fraction by Western blot (Fig. 18A). The PtlE fusion

protein in the membrane fraction was also found to retain peptidoglycanase activity (Fig.

18B).

Construction of ptlE point mutants within the ptx/ptl operon. The ptl genes have overlapping reading frames. The stop codon of the ptlI gene overlaps codons fifty and fifty-one of the ptlE gene, and the stop codon of the ptlE gene overlaps the start codon of the ptlF gene (Fig. 19). Attempting to knock out the ptlE gene for analysis by complementation is therefore impractical, and another strategy had to be used to test the effect of the point mutations on toxin secretion.

Individual amino acid substitutions D53A and E62A were made at the putative active site residues by PCR. A double mutant (D53A, E62A) was also constructed. The amino acid substitutions were inserted into the ptlE gene within the entire ptx/ptl operon

80 rane rane b b m A. m B. Soluble Me Soluble Me Cells

25 kDa 1 2 3 1 2

Fig. 18. Analysis of polyhistidine tagged PtlE expressed in B. pertussis

BP338. A. Western analysis using anti-poyhistidine antibody. Lane 1, cells; lane

2, soluble fraction; lane 3, membrane fraction. B. Zymogram analysis. Lane 1, soluble fraction; lane 2, membrane fraction.

81 by PCR, as diagramed in Fig. 19. Each plasmid containing a mutant ptlE, or the wild-

type gene was integrated into the chromosome of B. pertussis via a region of adenylate cyclase homology as described previously (39). Plasmids were introduced into B. pertussis strains by tri-parental mating. The origin of transfer (oriT) from plasmid RP4 was cloned into the plasmids along with the adenylate cyclase homology and the gentamicin cassette. Helper conjugative plasmid pUW956, containing the same origin of transfer, was co-incubated with the donor E. coli strain and the recipient B. pertussis strain. After conjugation of the two E. coli strains, the transfer proteins produced by the helper plasmid mediate transfer of the suicide plasmid into the recipient cell.

For haploid analysis, plasmids were integrated into the chromosome of BPRA, a ptx/ptl

mutant strain containing a deletion of the ptx/ptl promoter and the S1, S2, S4 and S5

genes (4), resulting in strains containing one copy of the ptx/ptl operon with the

introduced mutations. For merodiploid analysis, the wild-type strain, BP338, was used,

resulting in strains containing 2 copies of the ptx/ptl operon, one of which contained the

introduced mutations.

To insure that the amino acid substitutions had not resulted in polar mutations where the

expression of downstream genes was disrupted, immunoblot analysis was performed on

the haploid mutant strains using an antibody to PtlF, the product of the gene immediately

downstream of the ptlE gene. All three mutant plasmids, and the control wild-type

plasmid, restored expression of PtlF in BPRA, and similar levels of expression were

observed for all strains (Fig. 20).

NotI AatII

PCR product ‘D I * * E F’

NotI AatII HindIII pAR146 ‘D I E F G H

NotI HindIII Promoter B I A pKC34 S1 S2 S4 S5 S3 C D E F G H

Fig. 19. Cloning of amino acid substitutions into the ptx/ptl operon. Arrows

represent primers used to produce PCR products. Asterisks represent bases being

altered.

RA RA E62A RA D53A+E62A P P BP BPRA WT BPRA D53A B B

1 2 3 4 5

Fig. 20. Western blot of PtlF expression for wild type and PtlE mutants.

The ptx/ptl operon containing wild type PtlE or point mutants was introduced into the chromosome of pertussis toxin deletion strain, BPRA at the adneylate cyclase toxin locus. Expression of PtlF was assessed to monitor expression of the genes downstream of the introduced mutations. Lane 1, BPRA; Lane 2,

BPRA with wild type PtlE (from pKC34) ; Lane 3, BPRA with PtlE, D53A

(from pAR287-2); Lane 4, BPRA with PtlE, E62A (from pAR264-3); Lane 5,

BPRA PtlE,D53A, E62A (from pAR264-4).

84 B. pertussis ptlE mutants are defective for toxin secretion. Chinese Hamster

Ovary (CHO) cells were used to determine the concentration of active toxin in samples of culture supernatant (secreted toxin) and cell lysates (periplasmic toxin). Integration of the wild-type ptx/ptl operon into BPRA restored toxin expression and secretion, as previously demonstrated (39). Secretion was reduced by more than 70% in all three mutants when compared to the wild-type control strain (Fig. 21), and these differences were statistically significant. The defect in secretion did not result in increased levels of

periplasmic toxin, a result that has been observed for several other ptl mutants (39).

Mutations that disrupt proper folding or localization of a protein that is part of a

complex can result in dominant negative effects. A previous mutant of PtlE was found to

have a dominant negative toxin secretion phenotype. The mutants from this study were

therefore tested for dominant negative effects by integrating the mutant Ptl operon into

the adenylate cyclase toxin gene of wild-type strain BP338. The amino acid substitutions

did not affect toxin expression or secretion in the wild-type background (Fig. 22),

suggesting these mutants do not have a dominant negative phenotype.

Amino acid substitutions at the glycohydrolase active site residues reduce

peptidoglycanase activity. To demonstrate that the loss of secretion was due to the loss

of glycohydrolase activity in PtlE, his-tagged ptlE genes containing the D53A, E62A, and

D53A + E62A amino acid substitutions were expressed in E. coli using truncated ptlE

genes expressing only the N-terminal domain of the protein (through residue 84) to

improve the solubility of the protein and allow for higher levels of over-expression (Fig.

23). The recovery of mutant and wild type protein was similar in all cases, as determined

by Western blot (Fig. 24A). The proteins were tested for peptidoglycanase activity using

85 the activity gel assay (Fig. 24B) loaded with the same amount of protein as the Western blot. Peptidoglycanase activity was detected in the wild type protein, but not the mutant proteins (Fig. 24B).

15001500 Cell Associated ) l Secreted

10001000

500500 *

* * Pertussis toxin (ng/m

00 PTWT D53A E62A D53A+E62A

Fig. 21. Toxin expression and secretion in haploid strains (ptx/ptl mutant background). PTWT, BPRA with wild type PtlE (from pKC34); D53A,

BPRA with mutant PtlE from pAR287-2; E62A, BPRA with mutant PtlE from pAR264-3; D53A+E62A, BPRA with mutant PtlE from pAR264-4.

Cell associated (periplasmic) and secreted toxin were quantified using the

CHO cell activity assay. Secretion of toxin is significantly reduced strains expressing mutant ptlE genes: D53A (P<0.008), E62A and double mutant

(P<0.003), n=4.

Cell Associated 1500 Secreted ) l

1000

500 Pertussis Toxin (ng/m 0 PTWT D53A E62A D53A+E62A

Fig. 22. Toxin expression and secretion in merodiploid strains (wild-type background). PTWT, BP338 with second copy of wild type PtlE (from pKC34); D53A, BP338 with second copy of mutant PtlE from pAR287-2;

E62A, BP338 with second copy of mutant PtlE from pAR264-3; D53A+E62A,

BP338 with second copy of mutant PtlE from pAR264-4. Cell associated

(periplasmic) and secreted toxin were quantified using the CHO cell activity assay. Periplasmic and secreted toxin levels were not significantly different for any of the strains tested.

88 6x His-tag 184127 276 * * D53, E62 1 84 * * WT 1 84 A * D53A 1 84 * A E62A 1 84 A A D53A+E62A

Fig. 23. Fusion proteins for analysis of peptidoglycanase activity in mutants.

Blue represents polyhistidine tag, yellow stripes represent hydrophobic region,

asterisks represent putative catalytic residues D53 and E62, A’s show alanine

substitutions in the putative catalytic residues.

or t A. D53A WT E62A D53A+E62A Vec

19 kDa B. 19 kDa

1 2 3 4 5

Fig. 24. Activity of polyhistidine-tagged mutant PtlE proteins expressed in E. coli BL21[DE3]. Lane1, vector control (pET-21b); Lane 2, hisPtlE wild-type (pAR312-1); Lane 3, hisPtlE D53A (pAR312-2); Lane 4, hisPtlE

E62A (pAR312-3); Lane 5, hisPtlE double mutant (pAR312-4). A, Western analysis using anti-poyhistidine antibody. B. Zymogram analysis.

90 DISCUSSION

The peptidoglycan of Gram-negative bacteria is thought to restrict passage of folded proteins larger than 25 kDa through the periplasm (111). Local cleavage of peptidoglycan has been shown to be essential for the formation of large transmembrane complexes in a number of diverse systems of Gram negative bacteria, including flagellar assembly (94), conjugation (13), and phage entry into the cytoplasm (89, 112).

Soon after the sequence of the Ptl operon was completed (147), we identified PtlE as a possible candidate for performing this function in pertussis toxin secretion when it was found to match to a family of glycohydrolases using the program Blocks (61). While the overall match was very poor, there was conservation of acidic residues known to be essential for catalytic activity. Interestingly, as more sequence data has become available, the PtlE glycohydrolase match is no longer reported using this program. In addition, a blast search using amino acids 1 through 84 of PtlE does not yield any significant matches.

The peptidoglycanases, which include lysozymes and trans-glycosylases, have been grouped into several families based on low levels of homology in the region of the active site groove. However, the similarity across families is too low to establish a consensus sequence (134). In spite of the low sequence homology, the peptidoglycanases that have been crystallized have had remarkably similar structures in the region of the catalytic fold (134). All of the families of peptidoglycanases have a catalytic glutamic acid residue in their active site, and some glycanases also have a catalytic aspartic acid residue. These residues are essential for the glycanase activity (85).

91 Each of the Ptl proteins has a strong match to proteins in the VirB operon of

Agrobacterium tumefaciens. The VirB operon promotes the transfer of DNA from the bacteria into the plant cell utilizing a large protein complex that appears to be similar to the Ptl secretion complex (150). The ptlE gene and its homolog, virB8, have 50% amino acid similarity in the C-terminal region, but have no significant similarity in N-terminal region (amino acids 1-102 of PtlE, and amino acids 1-53 of VirB8). A homology to glycohydrolases has been identified in the VirB system (93), however, this match is in the virB1 gene. There is no homolog to VirB1 in the ptl operon. These results suggest that in spite of the high level of overall homology between these proteins, the N-terminal domains of PtlE and VirB8 likely perform different functions.

We have demonstrated that PtlE, a protein essential for secretion of pertussis toxin (39), also possesses peptidoglycanase activity, and this activity is essential for pertussis toxin secretion. Local removal of peptidoglycan is needed to allow for formation of the transmembrane secretion complex. We suggest that this mechanism is universal, and all type III and type IV secretion systems will require a peptidoglycanase activity for assembly.

92 SUMMARY AND FUTURE DIRECTIONS

Whooping cough remains an important cause of pediatric respiratory disease worldwide, despite a well-established vaccination program. Pertussis toxin is believed to cause many of the disease symptoms, including leukocytosis, which has been correlated with mortality in infants (101, 102). Pertussis toxin is the most complex toxin known, and is secreted by an even more complex type IV secretion system. Therapeutics that target pertussis toxin and the pertussis toxin secretion system may be of significant benefit in successfully treating this disease.

An understanding of the assembly and secretion of pertussis toxin, and the assembly and functioning of the secretion complex is necessary for the development of treatments targeting pertussis toxin or its secretion mechanism. This study examined pertussis toxin assembly and secretion over time, and examined both the levels of pertussis toxin structural and secretion complex components, and the enzymatic activity of one of the secretion complex components.

Pertussis toxin assembly and secretion. Pertussis toxin secretion was examined over the course of growth in liquid culture. The rate of toxin secretion, and the time of initiation of toxin secretion after entry into permissive conditions were determined.

Periplasmic accumulation of the S1, S2 and S3 subunits and the holotoxin were quantitated. Only about 88% of assembled pertussis toxin was secreted, compared to over 95% for cholera toxin. The accumulation of periplasmic holotoxin suggests that secretion of the assembled pertussis toxin is the rate-limiting step in toxin production and secretion. Pertussis toxin inhibits the ability to generate an immune response. Secretion

93 of improperly assembled pertussis toxin could elicit toxin-neutralizing antibodies.

Therefore, the Ptl secretion system may have evolved to ensure that only properly assembled toxin is released.

Pertussis toxin is secreted from the periplasm by the Ptl secretion system, and must interact with the secretion complex in a very different way from the protein/DNA substrates of other type IV systems, which are secreted from the cytoplasm. It is not yet known how the interaction between the holotoxin and the secretion complex occurs, or which parts of the secretion complex are involved in this interaction. It has previously been shown that the S1 subunit of pertussis toxin associates with the outer membrane of

B. pertussis (49). In this study we showed that the S2 and S3 proteins are also membrane associated, but that the holotoxin is present in soluble form in the periplasm and accumulates in the periplasm during logarithmic growth. Since pertussis toxin cannot pass through the peptidoglycan layer once it has been assembled, the portion of the secretion complex that interacts with the holotoxin to initiate secretion must be on the same side of the peptidoglycan layer as the assembled toxin. Determining whether the holotoxin in the periplasm in localized on the outside or the inside of the peptidoglycan layer (Fig. 25) will be an important first step in examining the interaction of the secretion complex and the holotoxin. This will be accomplished by analyzing a periplasmic and outer membrane fraction prepared without the addition of lysozyme for the presence of holotoxin.

Quantitation of PtlF. The genes encoding the Ptl secretion system, and the genes encoding pertussis toxin, are on the same polycistronic operon. Therefore, we also examined the accumulation of secretion system component PtlF over time. PtlF was

94 Inside the peptidoglycan layer

Outside the peptidoglycan layer

Fig 25. Possible areas for assembly of pertussis toxin in the periplasm. Pertussis

toxin is assembled in the periplasm. Pertussis toxin is too large to diffuse through the

peptidoglycan layer in the periplasm, and must be assembled on one side or the other.

Cell fractionation studies will determine whether the assembled pertussis toxin in the

periplasm is on the inside or the outside of the peptidoglycan layer. present at a low level at time zero. The level of PtlF in the cells increased about 30 fold over the course of 24 h. However, the initial amount of PtlF supported secretion at the maximal rate observed in this study. The accumulation of PtlF protein in excess of the level necessary for pertussis toxin secretion supports our conclusion that it is secretion of pertussis toxin, and not assembly of the toxin or the secretion complex that is the rate limiting step in the secretion process.

Future studies will examine the expression of the PtlF-PtlI complex in the presence and absence of the other components of the Ptl secretion complex to determine whether these proteins constitute a stable subassembly of the Ptl secretion complex. The homologs of PtlF and PtlI, VirB9 andVirB7 respectively, have been shown to form a subassembly of the VirB complex (75). The stoichiometry of PtlF-PtlI within the secretion complex will also be determined. To perform these studies, PtlF and PtlI will

95 be expressed from a plasmid in the Ptl mutant background. Chromatography and blue native gel electrophresis will be used to determine the size of the complex formed by

PtlF-PtlI in the presence and the absence of the other Ptl proteins.

Structural and enzymatic studies of PtlE. The Ptl type IV secretion system spans the inner and outer membranes. We have shown that the PtlE protein has peptidoglycanase activity, and this activity must be present for the secretion of pertussis toxin. The peptidoglycanase activity of PtlE is likely required for the removal of part of the peptidoglycan layer during the assembly of the secretion complex. This was the first identification of a protein with peptidoglycanase activity in a type IV secretion system.

PtlE is a good target for inhibitors that could potentially block pertussis toxin secretion. Its location in the periplasm makes it more accessible than cytoplasmic proteins; its activity is required for pertussis toxin secretion; and inhibitors of peptidoglycanase activity have been identified for other bacterial transglycosylases and for peptidoglycan hydrolases. To facilitate the identification of potential inhibitors, the peptidoglycanase activity of PtlE will be further characterized.

The peptidoglycanase activity of PtlE was initially characterized using a non- quantitative activity gel assay with the peptidoglycan from another bacterial species,

Micrococcus lysodeikticus. A pilot study using a quantitative turbidometric assay for peptidoglycanase activity has been performed. This assay will be used to determine the optimal conditions for the enzymatic activity of PtlE. Peptidoglycan from B. pertussis has been purified for use in the turbidometric study. Mass spectrometry of purified peptidoglycan after digestion with purified PtlE will be used to determine the products formed by the enzymatic activity of PtlE. This will tell us whether PtlE is in the

96 transglycosylase or hydrolase family of peptidoglycanases, which in addition to providing interesting clues about the evolutionary source of this region of PtlE, will be important in the development of inhibitors of PtlE.

Examination of Protein-Protein Interactions. A future goal of this project will be to examine protein-protein interactions within the Ptl complex. For these studies, antiserum for PtlF was produced using a purified PtlF fusion protein. Antisera to the other Ptl proteins will be produced using purified fusion proteins or synthetically generated peptides. In addition to quantifying expression levels of these proteins, protein-protein interactions can be examined using techniques such as co- immunoprecipitation.

In addition, methods of looking at protein-protein interactions that do not require antibodies will be used to map protein interaction domains in the Ptl proteins. A cytological two-hybrid assay that was successfully applied to the Agrobacterium tumefaciens VirB proteins is being used to examine the interactions of Ptl fusion proteins expressed in E. coli. Six truncation mutants were previously generated in our laboratory that displayed a dominant negative phenotype, demonstrating that these mutants contained protein interaction domains. These protein interaction domains will be mapped in B. pertussis by engineering further truncations in these proteins and expressing them in a wild-type B. pertussis background to determine the minimum regions necessary for the dominant negative phenotype.

Our studies have provided insights into the process of assembly and secretion of pertussis toxin by B. pertussis. However, much more remains to be learned. The knowledge gained from studying pertussis toxin and the Ptl secretion system will

97 hopefully lead to the development of new therapeutics, which will reduce the incidence of complications and severity of symptoms in patients with pertussis infections, and reduce mortality due to pertussis infection.

LITERATURE CITED

1. Aizawa, S. I. 1996. Flagellar assembly in Salmonella typhimurium. Mol.

Microbiol. 19:1-5.

2. Albert, P. R., and L. Robillard. 2002. G protein specificity: traffic direction

required. Cell Signal 14:407-418.

3. Anderson, L. B., A. V. Hertzel, and A. Das. 1996. Agrobacterium tumefaciens

VirB7 and VirB9 form a disulfide-linked protein complex. Proc. Natl. Acad. Sci.

U S A 93:8889-8894.

4. Antoine, R., and C. Locht. 1990. Roles of the disulfide bond and the carboxy-

terminal region of the S1 subunit in the assembly and biosynthesis of pertussis

toxin. Infect. Immun. 58:1518-1526.

5. Armstrong, G. D., L. A. Howard, and M. S. Peppler. 1988. Use of

glycosyltransferases to restore pertussis toxin receptor activity to

asialoagalactofetuin. J. Biol. Chem. 263:8677-8684.

6. Backert, S., E. Ziska, V. Brinkmann, U. Zimny-Arndt, A. Fauconnier, P. R.

Jungblut, M. Naumann, and T. F. Meyer. 2000. Translocation of the

Helicobacter pylori CagA protein in gastric epithelial cells by a type IV secretion

apparatus. Cell Microbiol. 2:155-164.

7. Baker, S. M., A. Masi, D. F. Liu, B. K. Novitsky, and R. A. Deich. 1995.

Pertussis toxin export genes are regulated by the ptx promoter and may be

required for efficient translation of ptx mRNA in Bordetella pertussis. Infect.

Immun. 63:3920-3926.

99 8. Bally, M., A. Filloux, M. Akrim, G. Ball, A. Lazdunski, and J. Tommassen.

1992. Protein secretion in Pseudomonas aeruginosa: characterization of seven xcp

genes and processing of secretory apparatus components by prepilin peptidase.

Mol. Microbiol. 6:1121-1131.

9. Baron, C., O. C. D, and E. Lanka. 2002. Bacterial secrets of secretion:

EuroConference on the biology of type IV secretion processes. Mol. Microbiol.

43:1359-1365.

10. Baron, C., Y. R. Thorstenson, and P. C. Zambryski. 1997. The lipoprotein

VirB7 interacts with VirB9 in the membranes of Agrobacterium tumefaciens. J.

Bacteriol. 179:1211-1218.

11. Barry, E. M., A. A. Weiss, I. E. Ehrmann, M. C. Gray, E. L. Hewlett, and M.

S. Goodwin. 1991. Bordetella pertussis adenylate cyclase toxin and hemolytic

activities require a second gene, cyaC, for activation. J. Bacteriol. 173:720-726.

12. Bass, J. W., E. L. Klenk, J. B. Kotheimer, C. C. Linnemann, and M. H.

Smith. 1969. Antimicrobial treatment of pertussis. J. Pediatr. 75:768-781.

13. Bayer, M., R. Iberer, K. Bischof, E. Rassi, E. Stabentheiner, G. Zellnig, and

G. Koraimann. 2001. Functional and mutational analysis of p19, a DNA transfer

protein with muramidase activity. J. Bacteriol. 183:3176-3183.

14. Beaupre, C. E., J. Bohne, E. M. Dale, and A. N. Binns. 1997. Interactions

between VirB9 and VirB10 membrane proteins involved in movement of DNA

from Agrobacterium tumefaciens into plant cells. J. Bacteriol. 179:78-89.

100 15. Becker, E. L., J. C. Kermode, P. H. Naccache, R. Yassin, M. L. Marsh, J. J.

Munoz, and R. I. Sha'afi. 1985. The inhibition of neutrophil granule enzyme

secretion and chemotaxis by pertussis toxin. J. Cell Biol. 100:1641-1646.

16. Beijersbergen, A., A. Dulk-Ras, R. Schilperoort, and P. Hookyaas. 1992.

Conjugative transfer by the virulence system of Agrobacterium tumefaciens.

Science 256:1324-1326.

17. Berger, B. R., and P. J. Christie. 1993. The Agrobacterium tumefaciens virB4

gene product is an essential virulence protein requiring an intact nucleoside

triphosphate-binding domain. J. Bacteriol. 175:1723-1734.

18. Berger, B. R., and P. J. Christie. 1994. Genetic complementation analysis of the

Agrobacterium tumefaciens virB operon: virB2 through virB11 are essential

virulence genes. J. Bacteriol. 176:3646-3660.

19. Boucher, P. E., A. E. Maris, M. S. Yang, and S. Stibitz. 2003. The Response

Regulator BvgA and RNA Polymerase alpha Subunit C-Terminal Domain Bind

Simultaneously to Different Faces of the Same Segment of Promoter DNA. Mol.

Cell 11:163-173.

20. Boucher, P. E., K. Murakami, A. Ishihama, and S. Stibitz. 1997. Nature of

DNA binding and RNA polymerase interaction of the Bordetella pertussis BvgA

transcriptional activator at the fha promoter. J. Bacteriol. 179:1755-1763.

21. Boucher, P. E., and S. Stibitz. 1995. Synergistic binding of RNA polymerase

and BvgA phosphate to the pertussis toxin promoter of Bordetella pertussis. J.

Bacteriol. 177:6486-6491.

101 22. Brennan, M. J., J. L. David, J. G. Kenimer, and C. R. Manclark. 1988.

Lectin-like binding of pertussis toxin to a 165-kilodalton Chinese hamster ovary

cell glycoprotein. J. Biol. Chem. 263:4895-4899.

23. Brennan, M. J., Z. M. Li, J. L. Cowell, M. E. Bisher, A. C. Steven, P.

Novotny, and C. R. Manclark. 1988. Identification of a 69-kilodalton

nonfimbrial protein as an agglutinogen of Bordetella pertussis. Infect. Immun.

56:3189-3195.

24. Buist, G., J. Kok, K. J. Leenhouts, M. Dabrowska, G. Venema, and A. J.

Haandrikman. 1995. Molecular cloning and nucleotide sequence of the gene

encoding the major peptidoglycan hydrolase of Lactococcus lactis, a muramidase

needed for cell separation. J. Bacteriol. 177:1554-1563.

25. Burnette, W. N., J. L. Arciniega, V. L. Mar, and D. L. Burns. 1992. Properties

of pertussis toxin B oligomer assembled in vitro from recombinant polypeptides

produced by Escherichia coli. Infect. Immun. 60:2252-2256.

26. Carbonetti, N. H., T. J. Irish, C. H. Chen, C. B. O'Connell, G. A. Hadley, U.

McNamara, R. G. Tuskan, and G. K. Lewis. 1999. Intracellular delivery of a

cytolytic T-lymphocyte epitope peptide by pertussis toxin to major

histocompatibility complex class I without involvement of the cytosolic class I

antigen processing pathway. Infect. Immun. 67:602-607.

27. Castro, M. G., U. McNamara, and N. H. Carbonetti. 2001. Expression, activity

and cytotoxicity of pertussis toxin S1 subunit in transfected mammalian cells. Cell

Microbiol. 3:45-54.

102 28. CDC. 2002. Pertussis - United States, 1997-2000. Morbidity and Mortality

Weekly Report.

29. Charles, I. G., J. L. Li, M. Roberts, K. Beesley, M. Romanos, D. J. Pickard,

M. Francis, D. Campbell, G. Dougan, M. J. Brennan, and et al. 1991.

Identification and characterization of a protective immunodominant B cell epitope

of pertactin (P.69) from Bordetella pertussis. Eur. J. Immunol. 21:1147-1153.

30. Christie, P. J. 1997. Agrobacterium tumefaciens T-complex transport apparatus:

a paradigm for a new family of multifunctional transporters in eubacteria. J.

Bacteriol. 179:3085-94.

31. Christie, P. J. 2001. Type IV secretion: intercellular transfer of macromolecules

by systems ancestrally related to conjugation machines. Mol. Microbiol. 40:294-

305.

32. Christie, P. J., J. E. Ward, Jr., M. P. Gordon, and E. W. Nester. 1989. A gene

required for transfer of T-DNA to plants encodes an ATPase with

autophosphorylating activity. Proc. Natl. Acad. Sci. U S A 86:9677-9681.

33. Clark, C. G., and G. D. Armstrong. 1990. Lymphocyte receptors for pertussis

toxin. Infect. Immun. 58:3840-3846.

34. Connell, T. D., D. J. Metzger, M. Wang, M. G. Jobling, and R. K. Holmes.

1995. Initial studies of the structural signal for extracellular transport of cholera

toxin and other proteins recognized by Vibrio cholerae. Infect. Immun. 63:4091-

4098.

103 35. Cook, D. M., K. M. Farizo, and D. L. Burns. 1999. Identification and

characterization of PtlC, an essential component of the pertussis toxin secretion

system. Infect. Immun. 67:754-759.

36. Covacci, A., and R. Rappuoli. 1993. Pertussis toxin export requires accessory

genes located downstream from the pertussis toxin operon. Mol. Microbiol.

8:429-434.

37. Craig-Mylius, K. A., T. H. Stenson, and A. A. Weiss. 2000. Mutations in the S1

subunit of pertussis toxin that affect secretion. Infect. Immun. 68:1276-1281.

38. Craig-Mylius, K. A., and A. A. Weiss. 2000. Antibacterial agents and release of

periplasmic pertussis toxin from Bordetella pertussis. Antimicrob. Agents

Chemother. 44:1383-1386.

39. Craig-Mylius, K. A., and A. A. Weiss. 1999. Mutants in the ptlA-H genes of

Bordetella pertussis are deficient for pertussis toxin secretion. FEMS Microbiol.

Lett. 179:479-484.

40. Dang, T. A., and P. J. Christie. 1997. The VirB4 ATPase of Agrobacterium

tumefaciens is a cytoplasmic membrane protein exposed at the periplasmic

surface. J. Bacteriol. 179:453-462.

41. Dang, T. A., X. R. Zhou, B. Graf, and P. J. Christie. 1999. Dimerization of the

Agrobacterium tumefaciens VirB4 ATPase and the effect of ATP-binding cassette

mutations on the assembly and function of the T-DNA transporter. Mol.

Microbiol. 32:1239-1253.

104 42. Das, A., L. B. Anderson, and Y. H. Xie. 1997. Delineation of the interaction

domains of Agrobacterium tumefaciens VirB7 and VirB9 by use of the yeast two-

hybrid assay. J. Bacteriol. 179:3404-3409.

43. Das, A., and Y. H. Xie. 2000. The Agrobacterium T-DNA transport pore proteins

VirB8, VirB9, and VirB10 interact with one another. J. Bacteriol. 182:758-763.

44. Dijkstra, A. J., and W. Keck. 1996. Peptidoglycan as a barrier to transenvelope

transport. J. Bacteriol. 178:5555-5562.

45. Ding, Z., Z. Zhao, S. J. Jakubowski, A. Krishnamohan, W. Margolin, and P.

J. Christie. 2002. A novel cytology-based, two-hybrid screen for bacteria applied

to protein-protein interaction studies of a type IV secretion system. J. Bacteriol.

184:5572-5582.

46. Dums, F., J. M. Dow, and M. J. Daniels. 1991. Structural characterization of

protein secretion genes of the bacterial phytopathogen Xanthomonas campestris

pathovar campestris: relatedness to secretion systems of other gram-negative

bacteria. Mol. Gen. Genet. 229:357-364.

47. Eisenbrandt, R., M. Kalkum, E. M. Lai, R. Lurz, C. I. Kado, and E. Lanka.

1999. Conjugative pili of IncP plasmids, and the Ti plasmid T pilus are composed

of cyclic subunits. J. Biol. Chem. 274:22548-22555.

48. Farizo, K. M., T. G. Cafarella, and D. L. Burns. 1996. Evidence for a ninth

gene, ptlI, in the locus encoding the pertussis toxin secretion system of Bordetella

pertussis and formation of a PtlI-PtlF complex. J. Biol. Chem. 271:31643-31649.

105 49. Farizo, K. M., S. Fiddner, A. M. Cheung, and D. L. Burns. 2002. Membrane

localization of the S1 subunit of pertussis toxin in Bordetella pertussis and

implications for pertussis toxin secretion. Infect. Immun. 70:1193-1201.

50. Farizo, K. M., T. Huang, and D. L. Burns. 2000. Importance of holotoxin

assembly in Ptl-mediated secretion of pertussis toxin from Bordetella pertussis.

Infect. Immun. 68:4049-4054.

51. Fernandez, D., T. A. Dang, G. M. Spudich, X. R. Zhou, B. R. Berger, and P.

J. Christie. 1996. The Agrobacterium tumefaciens virB7 gene product, a

proposed component of the T-complex transport apparatus, is a membrane-

associated lipoprotein exposed at the periplasmic surface. J. Bacteriol. 178:3156-

3167.

52. Fernandez, D., G. M. Spudich, X. R. Zhou, and P. J. Christie. 1996. The

Agrobacterium tumefaciens VirB7 lipoprotein is required for stabilization of VirB

proteins during assembly of the T-complex transport apparatus. J. Bacteriol.

178:3168-3176.

53. Fernandez, R. C., and A. A. Weiss. 1995. Cloning and sequencing of the

Bordetella pertussis cpn10/cpn60 (groESL) homolog. Gene 158:151-152.

54. Finberg, K. E., T. R. Muth, S. P. Young, J. B. Maken, S. M. Heitritter, A. N.

Binns, and L. M. Banta. 1995. Interactions of VirB9, -10, and -11 with the

membrane fraction of Agrobacterium tumefaciens: solubility studies provide

evidence for tight associations. J. Bacteriol. 177:4881-4889.

55. Friedman, R. L. 1988. Pertussis: the disease and new diagnostic methods. Clin.

Microbiol. Rev. 1:365-376.

106 56. Fullner, K. J. 1998. Role of Agrobacterium virB genes in transfer of T

complexes and RSF1010. J. Bacteriol. 180:430-434.

57. Gao, J. F., S. B. Call, P. D. Fillmore, T. Watanabe, N. D. Meeker, and C.

Teuscher. 2003. Analysis of the role of Bphs/Hrh1 in the genetic control of

responsiveness to pertussis toxin. Infect. Immun. 71:1281-1287.

58. Gross, R., and N. H. Carbonetti. 1993. Differential regulation of Bordetella

pertussis virulence factors. Zentralbl. Bakteriol. 278:177-186.

59. Hapfelmeier, S., N. Domke, P. C. Zambryski, and C. Baron. 2000. VirB6 is

required for stabilization of VirB5 and VirB3 and formation of VirB7

homodimers in Agrobacterium tumefaciens. J. Bacteriol. 182:4505-4511.

60. Hazes, B., A. Boodhoo, S. A. Cockle, and R. J. Read. 1996. Crystal structure of

the pertussis toxin-ATP complex: a molecular sensor. J. Mol. Biol. 258:661-671.

61. Henikoff, S., and J. G. Henikoff. 1994. Protein family classification based on

searching a database of blocks. Genomics 19:97-107.

62. Hewlett, E. L., K. T. Sauer, G. A. Myers, J. L. Cowell, and R. L. Guerrant.

1983. Induction of a novel morphological response in Chinese hamster ovary cells

by pertussis toxin. Infect Immun 40:1198-1203.

63. Hirst, T. R., and J. Holmgren. 1987. Conformation of protein secreted across

bacterial outer membranes: a study of enterotoxin translocation from Vibrio

cholerae. Proc. Natl. Acad. Sci. U S A 84:7418-22.

64. Jakubowski, S. J., V. Krishnamoorthy, and P. J. Christie. 2003.

Agrobacterium tumefaciens VirB6 protein participates in formation of VirB7 and

VirB9 complexes required for type IV secretion. J. Bacteriol. 185:2867-2878.

107 65. Jameson, B. A., and H. Wolf. 1988. The antigenic index: a novel algorithm for

predicting antigenic determinants. Comput. Appl. Biosci. 4:181-186.

66. Johnson, F. D., and D. L. Burns. 1994. Detection and subcellular localization of

three Ptl proteins involved in the secretion of pertussis toxin from Bordetella

pertussis. J. Bacteriol. 176:5350-5356.

67. Jones, A. L., K. Shirasu, and C. I. Kado. 1994. The product of the virB4 gene

of Agrobacterium tumefaciens promotes accumulation of VirB3 protein. J.

Bacteriol. 176:5255-5261.

68. Katada, T., and M. Ui. 1982. Direct modification of the membrane adenylate

cyclase system by islet-activating protein due to ADP-ribosylation of a membrane

protein. Proc. Natl. Acad. Sci. U S A 79:3129-3133.

69. Kenimer, J. G., K. J. Kim, P. G. Probst, C. R. Manclark, D. G. Burstyn, and

J. L. Cowell. 1989. Monoclonal antibodies to pertussis toxin: utilization as probes

of toxin function. Hybridoma 8:37-51.

70. Kinnear, S. M., P. E. Boucher, S. Stibitz, and N. H. Carbonetti. 1999.

Analysis of BvgA activation of the pertactin gene promoter in Bordetella

pertussis. J. Bacteriol. 181:5234-5241.

71. Kinnear, S. M., R. R. Marques, and N. H. Carbonetti. 2001. Differential

regulation of Bvg-activated virulence factors plays a role in Bordetella pertussis

pathogenicity. Infect. Immun. 69:1983-1993.

72. Kotob, S. I., and D. L. Burns. 1997. Essential role of the consensus nucleotide-

binding site of PtlH in secretion of pertussis toxin from Bordetella pertussis. J.

Bacteriol. 179:7577-7580.

108 73. Kotob, S. I., S. Z. Hausman, and D. L. Burns. 1995. Localization of the

promoter for the ptl genes of Bordetella pertussis, which encode proteins essential

for secretion of pertussis toxin. Infect Immun 63:3227-3230.

74. Kovach, M. E., P. H. Elzer, D. S. Hill, G. T. Robertson, M. A. Farris, R. M.

Roop, 2nd, and K. M. Peterson. 1995. Four new derivatives of the broad-host-

range cloning vector pBBR1MCS, carrying different antibiotic-resistance

cassettes. Gene 166:175-176.

75. Krall, L., U. Wiedemann, G. Unsin, S. Weiss, N. Domke, and C. Baron. 2002.

Detergent extraction identifies different VirB protein subassemblies of the type IV

secretion machinery in the membranes of Agrobacterium tumefaciens. Proc. Natl.

Acad. Sci U S A 99:11405-11410.

76. Krueger, K. M., and J. T. Barbieri. 1994. Assignment of functional domains

involved in ADP-ribosylation and B-oligomer binding within the carboxyl

terminus of the S1 subunit of pertussis toxin. Infect. Immun. 62:2071-2078.

77. Kumar, R. B., and A. Das. 2002. Polar location and functional domains of the

Agrobacterium tumefaciens DNA transfer protein VirD4. Mol. Microbiol.

43:1523-1532.

78. Lai, E. M., O. Chesnokova, L. M. Banta, and C. I. Kado. 2000. Genetic and

environmental factors affecting T-pilin export and T-pilus biogenesis in relation

to flagellation of Agrobacterium tumefaciens. J. Bacteriol. 182:3705-3716.

79. Lai, E. M., and C. I. Kado. 1998. Processed VirB2 is the major subunit of the

promiscuous pilus of Agrobacterium tumefaciens. J. Bacteriol. 180:2711-2717.

109 80. Lessl, M., D. Balzer, W. Pansegrau, and E. Lanka. 1992. Sequence similarities

between the RP4 Tra2 and the Ti VirB region strongly support the conjugation

model for T-DNA transfer. J. Biol. Chem. 267:20471-20480.

81. Lindeberg, M., and A. Collmer. 1992. Analysis of eight out genes in a cluster

required for pectic enzyme secretion by Erwinia chrysanthemi: sequence

comparison with secretion genes from other gram-negative bacteria. J. Bacteriol.

174:7385-7397.

82. Liu, Z., and A. N. Binns. 2003. Functional subsets of the virB type IV transport

complex proteins involved in the capacity of Agrobacterium tumefaciens to serve

as a recipient in virB-mediated conjugal transfer of plasmid RSF1010. J.

Bacteriol. 185:3259-3269.

83. Llosa, M., J. Zupan, C. Baron, and P. Zambryski. 2000. The N- and C-

terminal portions of the Agrobacterium VirB1 protein independently enhance

tumorigenesis. J. Bacteriol. 182:3437-3445.

84. Locht, C., and J. M. Keith. 1986. Pertussis toxin gene: nucleotide sequence and

genetic organization. Science 232:1258-1264.

85. Malcolm, B. A., S. Rosenberg, M. J. Corey, J. S. Allen, A. de Baetselier, and

J. F. Kirsch. 1989. Site-directed mutagenesis of the catalytic residues Asp-52 and

Glu-35 of chicken egg white lysozyme. Proc. Natl. Acad. Sci. U S A 86:133-137.

86. Manning, D. R., B. A. Fraser, R. A. Kahn, and A. G. Gilman. 1984. ADP-

ribosylation of transducin by islet-activation protein. Identification of asparagine

as the site of ADP-ribosylation. J. Biol. Chem. 259:749-756.

110 87. Melton, A. R., and A. A. Weiss. 1989. Environmental regulation of expression of

virulence determinants in Bordetella pertussis. J. Bacteriol. 171:6206-6212.

88. Mizgerd, J. P. 2002. Molecular mechanisms of neutrophil recruitment elicited by

bacteria in the lungs. Semin. Immunol. 14:123-132.

89. Moak, M., and I. J. Molineux. 2000. Role of the Gp16 lytic transglycosylase

motif in bacteriophage T7 virions at the initiation of infection. Mol. Microbiol.

37:345-355.

90. Moss, J., P. Bruni, J. A. Hsia, S. C. Tsai, P. A. Watkins, J. L. Halpern, D. L.

Burns, Y. Kanaho, P. P. Chang, E. L. Hewlett, and et al. 1984. Pertussis toxin-

catalyzed ADP-ribosylation: effects on the coupling of inhibitory receptors to the

adenylate cyclase system. J. Recept. Res. 4:459-474.

91. Moss, J., S. J. Stanley, D. L. Burns, J. A. Hsia, D. A. Yost, G. A. Myers, and

E. L. Hewlett. 1983. Activation by thiol of the latent NAD glycohydrolase and

ADP-ribosyltransferase activities of Bordetella pertussis toxin (islet-activating

protein). J. Biol. Chem. 258:11879-11882.

92. Moss, J., S. J. Stanley, P. A. Watkins, D. L. Burns, C. R. Manclark, H. R.

Kaslow, and E. L. Hewlett. 1986. Stimulation of the thiol-dependent ADP-

ribosyltransferase and NAD glycohydrolase activities of Bordetella pertussis

toxin by adenine nucleotides, phospholipids, and detergents. Biochemistry

25:2720-2725.

93. Mushegian, A. R., K. J. Fullner, E. V. Koonin, and E. W. Nester. 1996. A

family of lysozyme-like virulence factors in bacterial pathogens of plants and

animals. Proc. Natl. Acad. Sci. U S A 93:7321-7326.

111 94. Nambu, T., T. Minamino, R. M. Macnab, and K. Kutsukake. 1999.

Peptidoglycan-hydrolyzing activity of the FlgJ protein, essential for flagellar rod

formation in Salmonella typhimurium. J. Bacteriol. 181:1555-1561.

95. Neer, E. J., J. M. Lok, and L. G. Wolf. 1984. Purification and properties of the

inhibitory guanine nucleotide regulatory unit of brain adenylate cyclase. J. Biol.

Chem 259:14222-14229.

96. Neves, S. R., P. T. Ram, and R. Iyengar. 2002. G protein pathways. Science

296:1636-1639.

97. Nicosia, A., M. Perugini, C. Franzini, M. C. Casagli, M. G. Borri, G. Antoni,

M. Almoni, P. Neri, G. Ratti, and R. Rappuoli. 1986. Cloning and sequencing

of the pertussis toxin genes: operon structure and gene duplication. Proc. Natl.

Acad. Sci. U S A 83:4631-4635.

98. Nunn, D., S. Bergman, and S. Lory. 1990. Products of three accessory genes,

pilB, pilC, and pilD, are required for biogenesis of Pseudomonas aeruginosa pili.

J. Bacteriol. 172:2911-2919.

99. Opalka, N., R. Beckmann, N. Boisset, M. N. Simon, M. Russel, and S. A.

Darst. 2003. Structure of the filamentous phage pIV multimer by cryo-electron

microscopy. J. Mol. Biol. 325:461-470.

100. Pantoja, M., L. Chen, Y. Chen, and E. W. Nester. 2002. Agrobacterium type

IV secretion is a two-step process in which export substrates associate with the

virulence protein VirJ in the periplasm. Mol. Microbiol. 45:1325-1335.

101. Peters, M. J., C. M. Pierce, and N. J. Klein. 2003. Mechanisms of pulmonary

hypertension in Bordetella pertussis. Arch. Dis. Child 88:92-93.

112 102. Pierce, C., N. Klein, and M. Peters. 2000. Is leukocytosis a predictor of

mortality in severe pertussis infection? Intensive Care Med. 26:1512-1514.

103. Pittman, M. 1984. The concept of pertussis as a toxin-mediated disease. Pediatr.

Infect. Dis. 3:467-486.

104. Possot, O., C. d'Enfert, I. Reyss, and A. P. Pugsley. 1992. Pullulanase secretion

in Escherichia coli K-12 requires a cytoplasmic protein and a putative polytopic

cytoplasmic membrane protein. Mol. Microbiol. 6:95-105.

105. Possot, O., and A. P. Pugsley. 1994. Molecular characterization of PulE, a

protein required for pullulanase secretion. Mol. Microbiol. 12:287-299.

106. Potvin, C., D. Leclerc, G. Tremblay, A. Asselin, and G. Bellemare. 1988.

Cloning, sequencing and expression of a Bacillus bacteriolytic enzyme in

Escherichia coli. Mol. Gen. Genet. 214:241-248.

107. Rambow-Larsen, A. A., and A. A. Weiss. 2002. The PtlE protein of Bordetella

pertussis has peptidoglycanase activity required for Ptl-mediated pertussis toxin

secretion. J. Bacteriol. 184:2863-2869.

108. Rashkova, S., G. M. Spudich, and P. J. Christie. 1997. Characterization of

membrane and protein interaction determinants of the Agrobacterium tumefaciens

VirB11 ATPase. J. Bacteriol. 179:583-591.

109. Rashkova, S., X. R. Zhou, J. Chen, and P. J. Christie. 2000. Self-assembly of

the Agrobacterium tumefaciens VirB11 traffic ATPase. J. Bacteriol. 182:4137-

4145.

113 110. Ricci, S., R. Rappuoli, and V. Scarlato. 1996. The pertussis toxin liberation

genes of Bordetella pertussis are transcriptionally linked to the pertussis toxin

operon. Infect. Immun. 64:1458-1460.

111. Russel, M. 1998. Macromolecular assembly and secretion across the bacterial cell

envelope: type II protein secretion systems. J. Mol. Biol. 279:485-499.

112. Rydman, P. S., and D. H. Bamford. 2000. Bacteriophage PRD1 DNA entry uses

a viral membrane-associated transglycosylase activity. Mol. Microbiol. 37:356-

363.

113. Sagulenko, E., V. Sagulenko, J. Chen, and P. J. Christie. 2001. Role of

Agrobacterium VirB11 ATPase in T-pilus assembly and substrate selection. J.

Bacteriol. 183:5813-5825.

114. Sagulenko, V., E. Sagulenko, S. Jakubowski, E. Spudich, and P. J. Christie.

2001. VirB7 lipoprotein is exocellular and associates with the Agrobacterium

tumefaciens T pilus. J. Bacteriol. 183:3642-3651.

115. Sato, H., A. Ito, J. Chiba, and Y. Sato. 1984. Monoclonal antibody against

pertussis toxin: effect on toxin activity and pertussis infections. Infect. Immun.

46:422-428.

116. Sato, H., and Y. Sato. 1990. Protective activities in mice of monoclonal

antibodies against pertussis toxin. Infect. Immun. 58:3369-3374.

117. Sato, H., Y. Sato, A. Ito, and I. Ohishi. 1987. Effect of monoclonal antibody to

pertussis toxin on toxin activity. Infect. Immun. 55:909-915.

118. Savvides, S. N., H. J. Yeo, M. R. Beck, F. Blaesing, R. Lurz, E. Lanka, R.

Buhrdorf, W. Fischer, R. Haas, and G. Waksman. 2003. VirB11 ATPases are

114 dynamic hexameric assemblies: new insights into bacterial type IV secretion.

Embo. J. 22:1969-1980.

119. Scarlato, V., B. Arico, A. Prugnola, and R. Rappuoli. 1991. Sequential

activation and environmental regulation of virulence genes in Bordetella

pertussis. Embo. J. 10:3971-3975.

120. Scarlato, V., A. Prugnola, B. Arico, and R. Rappuoli. 1990. Positive

transcriptional feedback at the bvg locus controls expression of virulence factors

in Bordetella pertussis. Proc. Natl. Acad. Sci. U S A 87:6753-6757.

121. Shapiro, L., H. H. McAdams, and R. Losick. 2002. Generating and exploiting

polarity in bacteria. Science 298:1942-1946.

122. Shirasu, K., and C. I. Kado. 1993. Membrane location of the Ti plasmid VirB

proteins involved in the biosynthesis of a pilin-like conjugative structure on

Agrobacterium tumefaciens. FEMS Microbiol. Lett. 111:287-294.

123. Shirasu, K., Z. Koukolikova-Nicola, B. Hohn, and C. I. Kado. 1994. An inner-

membrane-associated virulence protein essential for T-DNA transfer from

Agrobacterium tumefaciens to plants exhibits ATPase activity and similarities to

conjugative transfer genes. Mol. Microbiol. 11:581-588.

124. Smith, C., and H. Vyas. 2000. Early infantile pertussis; increasingly prevalent

and potentially fatal. Eur. J. Pediatr. 159:898-900.

125. Stein, P. E., A. Boodhoo, G. D. Armstrong, S. A. Cockle, M. H. Klein, and R.

J. Read. 1994. The crystal structure of pertussis toxin. Structure 2:45-57.

115 126. Stein, P. E., A. Boodhoo, G. D. Armstrong, L. D. Heerze, S. A. Cockle, M. H.

Klein, and R. J. Read. 1994. Structure of a pertussis toxin-sugar complex as a

model for receptor binding. Nat. Struct. Biol. 1:591-596.

127. Stenson, T. H., and A. A. Weiss. 2002. DsbA and DsbC are required for

secretion of pertussis toxin by Bordetella pertussis. Infect. Immun. 70:2297-2303.

128. Stephens, K. M., C. Roush, and E. Nester. 1995. Agrobacterium tumefaciens

VirB11 protein requires a consensus nucleotide-binding site for function in

virulence. J. Bacteriol. 177:27-36.

129. Sternweis, P. C., and J. D. Robishaw. 1984. Isolation of two proteins with high

affinity for guanine nucleotides from membranes of bovine brain. J. Biol. Chem.

259:13806-13813.

130. Tamura, M., K. Nogimori, S. Murai, M. Yajima, K. Ito, T. Katada, M. Ui,

and S. Ishii. 1982. Subunit structure of islet-activating protein, pertussis toxin, in

conformity with the A-B model. Biochemistry 21:5516-5522.

131. Tauschek, M., R. J. Gorrell, R. A. Strugnell, and R. M. Robins-Browne.

2002. Identification of a protein secretory pathway for the secretion of heat-labile

enterotoxin by an enterotoxigenic strain of Escherichia coli. Proc. Natl. Acad. Sci.

U S A 99:7066-7071.

132. Thorstenson, Y. R., G. A. Kuldau, and P. C. Zambryski. 1993. Subcellular

localization of seven VirB proteins of Agrobacterium tumefaciens: implications

for the formation of a T-DNA transport structure. J. Bacteriol. 175:5233-5241.

116 133. Thorstenson, Y. R., and P. C. Zambryski. 1994. The essential virulence protein

VirB8 localizes to the inner membrane of Agrobacterium tumefaciens. J.

Bacteriol. 176:1711-1717.

134. Thunnissen, A. M., N. W. Isaacs, and B. W. Dijkstra. 1995. The catalytic

domain of a bacterial lytic transglycosylase defines a novel class of lysozymes.

Proteins 22:245-258.

135. Tommassen, J., A. Filloux, M. Bally, M. Murgier, and A. Lazdunski. 1992.

Protein secretion in Pseudomonas aeruginosa. FEMS Microbiol. Rev. 9:73-90.

136. Tomme, P., J. van Beeumen, and M. Claeyssens. 1992. Modification of

catalytically important carboxy residues in endoglucanase D from Clostridium

thermocellum. Biochem. J. 285:319-324.

137. Tuomanen, E., H. Towbin, G. Rosenfelder, D. Braun, G. Larson, G. C.

Hansson, and R. Hill. 1988. Receptor analogs and monoclonal antibodies that

inhibit adherence of Bordetella pertussis to human ciliated respiratory epithelial

cells. J. Exp. Med. 168:267-277.

138. Uhl, M. A., and J. F. Miller. 1994. Autophosphorylation and phosphotransfer in

the Bordetella pertussis BvgAS signal transduction cascade. Proc. Natl. Acad.

Sci. U S A 91:1163-1167.

139. Walker, K. E., and A. A. Weiss. 1994. Characterization of the dermonecrotic

toxin in members of the genus Bordetella. Infect. Immun. 62:3817-3828.

140. Ward, D. V., O. Draper, J. R. Zupan, and P. C. Zambryski. 2002. Peptide

linkage mapping of the Agrobacterium tumefaciens vir-encoded type IV secretion

117 system reveals protein subassemblies. Proc. Natl. Acad. Sci. U S A 99:11493-

11500.

141. Ward, J. E., D. E. Akiyoshi, D. Regier, A. Datta, M. P. Gordon, and E. W.

Nester. 1988. Characterization of the virB operon from an Agrobacterium

tumefaciens Ti plasmid. J. Biol. Chem. 263:5804-5814.

142. Ward, J. E., Jr., E. M. Dale, P. J. Christie, E. W. Nester, and A. N. Binns.

1990. Complementation analysis of Agrobacterium tumefaciens Ti plasmid virB

genes by use of a vir promoter expression vector: virB9, virB10, and virB11 are

essential virulence genes. J. Bacteriol. 172:5187-5199.

143. Ward, J. E., Jr., E. M. Dale, E. W. Nester, and A. N. Binns. 1990.

Identification of a virB10 protein aggregate in the inner membrane of

Agrobacterium tumefaciens. J. Bacteriol. 172:5200-5210.

144. Weingart, C. L., G. Broitman-Maduro, G. Dean, S. Newman, M. Peppler,

and A. A. Weiss. 1999. Fluorescent labels influence phagocytosis of Bordetella

pertussis by human neutrophils. Infect. Immun. 67:4264-4267.

145. Weiss, A. A., E. L. Hewlett, G. A. Myers, and S. Falkow. 1984. Pertussis toxin

and extracytoplasmic adenylate cyclase as virulence factors of Bordetella

pertussis. J. Infect. Dis. 150:219-222.

146. Weiss, A. A., E. L. Hewlett, G. A. Myers, and S. Falkow. 1983. Tn5-induced

mutations affecting virulence factors of Bordetella pertussis. Infect. Immun.

42:33-41.

118 147. Weiss, A. A., F. D. Johnson, and D. L. Burns. 1993. Molecular characterization

of an operon required for pertussis toxin secretion. Proc. Natl. Acad. Sci. U S A

90:2970-2974.

148. WHO. 2001. The World Health Report 2001.144-145.

149. Winans, S. C. 1992. Two-way chemical signaling in Agrobacterium-plant

interactions. Microbiol. Rev. 56:12-31.

150. Winans, S. C., D. L. Burns, and P. J. Christie. 1996. Adaptation of a conjugal

transfer system for the export of pathogenic macromolecules. Trends Microbiol.

4:64-68.

151. Witvliet, M. H., D. L. Burns, M. J. Brennan, J. T. Poolman, and C. R.

Manclark. 1989. Binding of pertussis toxin to eucaryotic cells and glycoproteins.

Infect. Immun. 57:3324-3330.

152. Xu, Y., and J. T. Barbieri. 1995. Pertussis toxin-mediated ADP-ribosylation of

target proteins in Chinese hamster ovary cells involves a vesicle trafficking

mechanism. Infect. Immun. 63:825-832.

153. Yeo, H. J., S. N. Savvides, A. B. Herr, E. Lanka, and G. Waksman. 2000.

Crystal structure of the hexameric traffic ATPase of the Helicobacter pylori type

IV secretion system. Mol. Cell 6:1461-1472.

154. Young, G. M., D. H. Schmiel, and V. L. Miller. 1999. A new pathway for the

secretion of virulence factors by bacteria: the flagellar export apparatus functions

as a protein-secretion system. Proc. Natl. Acad. Sci. U S A 96:6456-6461.

119 155. Zhou, X. R., and P. J. Christie. 1997. Suppression of mutant phenotypes of the

Agrobacterium tumefaciens VirB11 ATPase by overproduction of VirB proteins.

J. Bacteriol. 179:5835-5842.

156. Zhu, J., P. M. Oger, B. Schrammeijer, P. J. Hooykaas, S. K. Farrand, and S.

C. Winans. 2000. The bases of crown gall tumorigenesis. J. Bacteriol. 182:3885-

3895.

157. Zupan, J. R., D. Ward, and P. Zambryski. 1998. Assembly of the VirB

transport complex for DNA transfer from Agrobacterium tumefaciens to plant

cells. Curr. Opin. Microbiol. 1:649-655.

120 APPENDIX - ADDITIONAL STUDIES:

Characterization of BrkA expression in Bordetella bronchiseptica

ABSTRACT

BrkA confers resistance to killing by complement in Bordetella pertussis.

Complement resistance was examined in B. bronchiseptica. Four B. bronchiseptica

strains possessed the brkA gene, however only three expressed the protein. Only the

strain lacking BrkA was susceptible to complement. Introduction of the B. pertussis brkA gene restored BrkA expression to this strain but did not confer resistance. The brkA gene was mutated in the strains that naturally expressed BrkA, and loss of BrkA did not confer sensitivity to complement. As a species, B. bronchiseptica are more resistant to complement than B. pertussis and BrkA does not mediate resistance.

Previously we described BrkA, a virulence factor for Bordetella pertussis (9, 18).

BrkA is synthesized as a 103 kDa precursor that is proteolytically processed to a 73 kDa

N-terminal domain, and a 30 kDa the C-terminal domain which remains in the outer membrane (8). It is homologous to two other B. pertussis proteins, pertactin (12) and tracheal colonization factor (10). These proteins mediate attachment to cells (8, 10, 12), but only BrkA confers resistance to killing by the antibody dependent pathway of complement (8). Complement is a defense associated with serum and blood-borne pathogens, however it is also extruded to mucosal surfaces. Normal mucosa has about

10% as much complement as serum and this rises during infection (16). A mechanism of complement resistance may be essential for every mucosal pathogen.

Bordetella species are mucosal pathogens. B. pertussis causes human whooping cough, B. parapertussis causes less severe human disease and more serious infections in sheep, and B. bronchiseptica, causes kennel cough in dogs and atrophic rhinitis in pigs

(17). They are closely related, 72-94% homologous by DNA hybridization analysis, and share several toxins and adhesins (2, 17). However, some genes are differentially expressed. Pertussis toxin, which causes many of the symptoms unique to whooping cough, is only expressed by B. pertussis. B. bronchiseptica and B. parapertussis strains possess defective copies of the pertussis toxin genes, or lack them entirely (4). Only B. bronchiseptica express flagella and are motile (2, 7, 17). They also differ in the structure of their lipopolysaccharide (LPS).

B. bronchiseptica and B. parapertussis possess brkA (8). Since genes may be present but not expressed, we examined four isolates of B. bronchiseptica for expression

ii of BrkA and its role in complement resistance. 110H was from a dog (14), RB50 from a

rabbit (7), and P-4609 from a pig (1). The source of strain 213 is not known (14), but it

was chosen because it is unusual in that it lacks the genes for pertussis toxin (data not

shown). All four strains, like those described in our previous report (8) hybridized with

the BrkA gene of B. pertussis by Southern blot (data not shown), indicating all four

strains possessed the brkA gene.

Western analysis was used to detect expression of BrkA. Bacterial cells were

harvested from Bordet-Gengou agar (BGA), proteins were separated by SDS-PAGE, transferred to PVDF membranes as described (5), and probed with a polyclonal antibody from a rat immunized with a purified histidine-tagged fusion protein containing amino acids

289 to 595 of BrkA expressed in pRSETC. The blot was developed by chemiluminescence

(Renaissance kit, NEN Research Products, Boston, MA). BrkA was detected in the B. pertussis wild type strain BP338 ( A-1, lane E), as evidenced by a major band corresponding to the 73 kDa processed form, and larger and smaller bands corresponding to unprocessed (103 kDA form) and degraded forms of BrkA not present in the BrkA mutant BPM2041 (Fig. A-1, lane F). The band in lane F, the BrkA mutant, is due to non-specific cross-reactivity. Three strains of B. bronchiseptica expressed the BrkA protein, while strain RB50 did not (Fig. A-1, lane B).

We characterized 36 serum samples from humans, rabbits, guinea pigs, mice, and rats. Most had antibodies to Bordetella by western blot, which is not unexpected since

Bordetella infections are common in humans and domestic animals. Most samples had

bactericidal activity against the BrkA mutant of B. pertussis, but less activity against the

iii MW

104 89

47.7

Fig. A-1. Western analysis of BrkA production. Lane A, B. bronchiseptica

11OH; lane B, B. bronchiseptica RB50; lane C, B. bronchiseptica P-4609; lane

D, B. bronchiseptica 213; lane E, B. pertussis BP338, positive control; lane F,

B. pertussis BPM2041, negative control. The hatches indicate migration of the molecular weight markers (104, 89, and 47.7 kilodaltons).

iv wild type strain. The samples were not bactericidal for B. bronchiseptica except a

commercially available guinea pig serum (Colorado Serum Company, complement lot #

421) that was bactericidal, but only for strain RB50. This serum reacted with dozens of

antigens on all of the B. bronchiseptica strains tested by Western blot (data not shown).

A second commercial source of complement (Sigma guinea pig complement, lot

#116H9410) had only weak reactivity to a single Bordetella antigen by western blot and

had no bactericidal activity against the B. pertussis wild type strain or the BrkA mutant.

The Colorado serum with antibodies directed against multiple B. bronchiseptica antigens will be referred to as immune serum, and the Sigma serum devoid of antibodies against

B. bronchiseptica will be referred to as the source of complement.

To quantitate the bactericidal activity, bacteria from an overnight culture on BGA were suspended to an OD of approximately 0.2 in Stainer Scholte broth, and 2 µl (107

bacteria) were added to 20 µl of serum or a PBS (phosphate buffered saline) control and incubated for one hour at 37°C. The reaction was stopped by the addition of PBS containing 10 mM EDTA to chelate the divalent cations necessary for complement activity. Serial dilutions were made, and the bacteria were plated on BGA agar and allowed to grow at 37°C. Percent survival was calculated using the PBS control as the

100% value.

Incubation with serum containing complement, but lacking antibodies to B. bronchiseptica did not kill RB50 (Fig. A-2, C’ control). The immune serum killed RB50 when the complement was intact, but when this serum was heated to 56° C for 30 min to inactivate the complement, no killing was observed (data not shown). However when the

v Fig. A-2. Serum susceptibility of B. bronchiseptica strains. Percent survival was calculated for bacteria incubated in serum. , 50% heat inactivated immune serum as a source of antibodies (Colorado serum #421) plus 50% complement (C’), Sigma Guinea pig serum; , 50% heat inactivated immune serum pre-adsorbed with RB50 (serum adsorbed with WT) to remove surface antibodies plus 50% complement; , 50% heat inactivated immune serum pre-adsorbed with RB54 (serum adsorbed with Bvg¯) to remove surface antibodies plus 50% complement; , PBS plus 50% complement.

Results from four experiments were averaged. RB50, RB50 BrkA+BrkB+ (containing plasmid pUW2171), and RB50 BrkA+ (containing plasmid pRF1009) were significantly more sensitive to heat-inactivated serum with complement than complement alone, or complement plus serum adsorbed with RB50 (p < 0.02 to 0.04), but not serum adsorbed with RB54 (p < 0.055). In addition, RB50 incubated with heat inactivated serum plus complement was significantly more sensitive than RB54 incubated with heat inactivated serum plus complement (P< 0.01). The error bars indicate standard deviation. The data was analyzed by the paired t-Test.

vi heat-inactivated immune serum was mixed with the complement lacking antibodies to B. bronchiseptica, killing was restored (Fig. A-2, C’ + immune serum), suggesting that both the antibodies from the immune serum and intact complement were needed to kill the bacteria.

An unexpected observation was that several of the colonies that survived the complement killing were nonhemolytic. Nonhemolytic variants due to mutations in the bvg locus arise in B. bronchiseptica at a very high rate. Bvg is a global regulator required for the expression of the virulence factors and hemolysis. A well-characterized mutant in bvg, RB54 (7) was characterized for susceptibility to complement. RB54 was not killed

(Fig. A-2, RB54), suggesting that the nonhemolytic survivors from RB50 were

spontaneous bvg minus mutants in the population.

To assess the contribution of antibodies to killing, adsorption was used to remove

the antibodies to surface determinants. Bacterial growth from a 24-hr BGA plate was

harvested in PBS, divided into aliquots and pelleted by centrifugation. The bacterial

pellet was suspended in heat-inactivated serum and incubated on ice for several hours.

The serum was separated from the bacteria by centrifugation, the process was repeated

two times, and the sample was filter sterilized. Adsorption with RB50 should remove

antibodies to all surface determinants of RB50 and protect it from killing. That appeared

to be the case (Fig. A-2, C’ + serum adsorbed with WT). However, RB54 would only

remove antibodies to shared determinants, not antibodies to antigens only expressed by

RB50, allowing one to assess their contribution to bactericidal activity. Adsorption with

RB54 (Fig. A-2, C’ + serum adsorbed with Bvg¯), while not quite statistically significant

vii (p < 0.055), appeared to confer some protection to RB50 suggesting that bactericidal

antibodies might recognize both virulent-phase and shared antigens.

To assess the role of BrkA in serum resistance, cloned copies of the brkA gene on

plasmid pRF1009 (8), or the entire brkAB operon on pUW2171(9) were introduced into

RB50 by homologous recombination of a suicide plasmid as previously described for B.

pertussis (8, 9). Gentamicin resistant transconjugants were characterized for BrkA

expression by Western analysis. Both constructs conferred BrkA expression to RB50,

pUW2171 is shown (Fig. A-3 lane 1 vs. lane 4), but BrkA expression did not confer

serum resistance to RB50 (Fig. A-2, RB50 BrkA+/B+ and RB50 BrkA+). However, it is

theoretically possible that in both cases the recombination event that allowed RB50 to express BrkA generated a chimeric protein that lacks the domains needed to confer resistance to complement.

Similarly, a partial copy of the brkA gene in plasmid pRF1022 (8) was used to

generate BrkA mutants in strains 213 and 110H (Fig. A-4). In experiments performed in

triplicate, survival for the BrkA mutant of 110H containing pRF1022 was 65.7±16.9%,

which was not statistically different from 77.2±17.8% observed for the parental 11OH.

In a single experiment, survival for the gentamicin resistant BrkA mutant of strain 213

containing pRF1022 was 100%, vs. 87% for the parental strain.

BrkA was identified in B. pertussis and shown to mediate both adherence and

complement resistance (8). The B. bronchiseptica isolates characterized in this study all

possessed the BrkA gene, however not all expressed BrkA. Only RB50, the strain that

was unable to express BrkA, was susceptible to complement. However, when BrkA

expression was restored to this strain, it did not become resistant. Three strains that

viii Fig. A-3. Western analysis to detect restoration of BrkA expression in B. bronchiseptica. Lane 1, B. bronchiseptica RB50 control; lane 2, B. bronchiseptica 213, lane 3, B. bronchiseptica 11OH; lane 4, RB50 gentamicin resistant pUW2171 transconjugant. Approximate molecular weights are indicated in kilodaltons.

ix Fig. A-4. Western analysis to characterize BrkA mutants in B. bronchiseptica. Lane 1, B. bronchiseptica RB50, negative control; lane 2,

B. bronchiseptica 213, positive control; lane 3, B. bronchiseptica RB50 gentamicin resistant pRF1022 transconjugant; lane 4, B. bronchiseptica

11OH gentamicin resistant pRF1022 transconjugant; lane 5, B. bronchiseptica 213 gentamicin resistant pRF1022 transconjugant. The arrow denotes the mature 70kDa BrkA protein.

x expressed BrkA were completely resistant to complement, and remained resistant when

the BrkA gene was mutated. We cannot entirely rule out a role for BrkA in complement

resistance in B. bronchiseptica because like B. pertussis, it appears that antibodies are

necessary for killing. The immune serum used in this study recognizes dozens of

antigens on all of the B. bronchiseptica strains tested as determined by Western blot.

However it is well known that not all antibodies are bactericidal. This can be due to

either the inability of the constant region to activate complement, or the inability of the

antibody to recognize an antigen that will allow the membrane attack complex to form

correctly on the bacterial surface (11, 13). If the serum lacks bactericidal antibodies

against a specific strain, the contribution of a complement resistance mechanism, if

present, cannot be assessed.

Our results are consistent with reports that the species, B. bronchiseptica, is more resistant to complement than B. pertussis (6). A major difference that could account for this observation is the structure of their LPS. B. pertussis have an abbreviated LPS structure. Its O-chain is composed of a single trisaccharide that is not repeated (3). In contrast, B. bronchiseptica produces long LPS molecules with many O-chain repeats, similar to the LPS of Escherichia coli. Long LPS of the enterics is thought to confer resistance to complement by blocking the membrane attack complex from binding to the bacterial membrane (11, 13). Consistent with this, a strain of B. bronschiseptica lacking

O-chain repeats was shown to be extremely sensitive to complement (6). In addition, the core structure of B. bronchiseptica LPS varies according to the phase of the microorganism (15). Whether this accounts for the resistance of the avirulent phase bvg minus mutant RB54 remains to be determined. While it appears that BrkA does not

xi mediate serum resistance in B. bronchiseptica, it is clear that they do have a mechanism of serum resistance. This is consistent with our hypothesis that all mucosal pathogens must have a mechanism to avoid killing by complement. The discovery that under certain conditions these bacteria can be killed by complement allows one to study this process and to optimize killing as a possible therapeutic strategy.

xii LITERATURE CITED

1. Ackermann, M. R., R. B. Rimler, and J. R. Thurston. 1991. Experimental

model of atrophic rhinitis in gnotobiotic pigs. Infect. Immun. 59:3626-3629.

2. Akerley, B. J., and J. F. Miller. 1996. Understanding signal transduction during

bacterial infection. Trends Microbiol. 4:141-146.

3. Allen, A., and D. Maskell. 1996. The identification, cloning and mutagenesis of

a genetic locus required for lipopolysaccharide biosynthesis in Bordetella

pertussis. Mol. Microbiol. 19:37-52.

4. Arico, B., and R. Rappuoli. 1987. Bordetella parapertussis and Bordetella

bronchiseptica contain transcriptionally silent pertussis toxin genes. J. Bacteriol.

169:2847-2853.

5. Barry, E. M., A. A. Weiss, I. E. Ehrmann, M. C. Gray, E. L. Hewlett, and M.

S. Goodwin. 1991. Bordetella pertussis adenylate cyclase toxin and hemolytic

activities require a second gene, cyaC, for activation. J. Bacteriol. 173:720-726.

6. Byrd, D. W., R. M. Roop, H. P. Veit, and G. G. Schurig. 1991. Serum

sensitivity and lipopolysaccharide characteristics in Bordetella bronchiseptica, B.

pertussis and B. parapertussis. J. Med. Microbiol. 34:159-165.

7. Cotter, P. A., and J. F. Miller. 1994. BvgAS-mediated signal transduction:

analysis of phase-locked regulatory mutants of Bordetella bronchiseptica in a

rabbit model. Infect. Immun. 62:3381-3390.

8. Fernandez, R. C., and A. A. Weiss. 1994. Cloning and sequencing of a

Bordetella pertussis serum resistance locus. Infect. Immun. 62:4727-4738.

xiii 9. Fernandez, R. C., and A. A. Weiss. 1998. Serum resistance in bvg-regulated

mutants of Bordetella pertussis. FEMS Microbiol. Lett. 163:57-63.

10. Finn, T. M., and L. A. Stevens. 1995. Tracheal colonization factor: a Bordetella

pertussis secreted virulence determinant. Mol. Microbiol. 16:625-634.

11. Frank, M. M. 1992. The mechanism by which microorganisms avoid

complement attack. Curr. Opin. Immunol. 4:14-19.

12. Leininger, E., M. Roberts, J. G. Kenimer, I. G. Charles, N. Fairweather, P.

Novotny, and M. J. Brennan. 1991. Pertactin, an Arg-Gly-Asp-containing

Bordetella pertussis surface protein that promotes adherence of mammalian cells.

Proc. Natl. Acad. Sci. U S A 88:345-349.

13. Moffitt, M. C., and M. M. Frank. 1994. Complement resistance in microbes.

Springer Semin. Immunopathol. 15:327-344.

14. Musser, J. M., E. L. Hewlett, M. S. Peppler, and R. K. Selander. 1986.

Genetic diversity and relationships in populations of Bordetella spp. J. Bacteriol.

166:230-237.

15. Peppler, M. S., and M. E. Schrumpf. 1984. Phenotypic variation and

modulation in Bordetella bronchiseptica. Infect. Immun. 44:681-687.

16. Persson, C. G. A., I. Erjefalt, U. Alkner, C. Baumgarten, L. Grief, B.

Gustafsson, A. Luts, U. Pipkorn, F. Sundler, C. Svensson, and P. Wollmer.

1991. Plasma exudation as a first line respiratory mucosal defense. Clin. Exp.

Allergy 21:17-24.

xiv 17. Weiss, A. A. 1991. The Genus Bordetella, Volume III, Chapter 127, p. 2530-

2543. In A. Balows, H. G. Trüper, M. Dworkin, W. Harder, and K.-H. Schleifer

(ed.), The Prokaryotes, Second Edition. Springer-Verlag, New York, N. Y.

18. Weiss, A. A., and M. S. Goodwin. 1989. Lethal infection by Bordetella pertussis

mutants in the infant mouse model. Infect. Immun. 57:3757-3764.