Prevalence of Verotoxigenic Escherichia Coli in Irrigation Waters and Fresh Produce In

Prevalence of verotoxigenic Escherichia coli in Irrigation Waters and Fresh Produce in

British Columbia, Canada

Stephanie Nadya

B.Sc., The University of British Columbia, 2012

A THESIS SUBMITTED IN PARTIAL FULFILLMENT OF

THE REQUIREMENTS FOR THE DEGREE OF

MASTER OF SCIENCE

THE FACULTY OF GRADUATE AND POSTDOCTORAL STUDIES

(Food Science)

THE UNIVERSITY OF BRITISH COLUMBIA

(Vancouver)

December 2014

Irrigation water is a risk factor in the transmission of verotoxigenic Escherichia coli

(VTEC) to growing food plants. To date, there have been no systematic attempts to examine

VTEC occurrence in surface waters used to irrigate crops in British Columbia. The objectives of this study were to determine the seasonal prevalence and characteristics of VTEC in surface waters and fresh produce grown in the Lower Mainland of British Columbia.

Water samples (n=330) were collected from irrigation ditches and streams in four distinct watersheds between November 2012 – November 2013. Leafy vegetables (n=79) and berry fruits

(n=26) were obtained from seven local farm markets during the summer. Detection and isolation of VTEC in water and produce rinses were performed using a novel hydrophobic grid membrane filtration-verotoxin immunoblot method. Prospective VTEC isolates were characterized by multiplex PCR to determine virulence gene profiles (eaeA, hlyA, vt1 and vt2), serotyping, antibiotic resistance profiling and genotyping by BOX-PCR. Fecal coliform and E. coli counts were obtained on Petrifilm™.

VTEC were not recovered from 105 samples of produce but were found in 19.1% of surface water samples. Seasonal prevalence rates were significantly different (P < 0.05), ranging from 34.2% to 15.7% and 13.3%, in winter, spring/summer and fall months, respectively. BOX-

PCR revealed that 100 of 528 VTEC isolates were unique, including 3 of serotypes

O157:H7/O157:NM, 16 of non-O157 “priority” serogroups O26, O103 and O111, and 81 from

32 additional serotypes with 10 distinct virulence gene profiles. Multiple antibiotic resistance was observed in 16.3% of isolates (n=104), and resistance to florfenicol (27.9%), streptomycin

(13.5%), tetracycline (12.5%) and ampicillin (9.6%) was common. Fecal coliform and E. coli

counts did not correlate with VTEC occurrence, and isolates were recovered from 21.7% of water samples with no E. coli detected.

In conclusion, VTEC were not recovered from fresh produce despite their recurrence in surface waters. The diversity of VTEC recovered from surface waters suggests the need for further research to identify sources of contamination and factors leading to persistence. Water quality methods based on the presence of indicator species may not reliably predict the risk of contamination with VTEC.

iii

Preface

A part of Chapter 3, subsection 3.2.1, serotyping of verotoxigenic Escherichia coli, is based on work conducted in collaboration with the Laboratory for Foodborne Zoonoses, Public

Health Agency of Canada, Guelph, ON, Canada, by Dr. Roger Johnson and Ms. Kim Ziebell.

The author, Stephanie Nadya, sent the bacterial isolates to be tested and performed the analysis and interpretation of the results.

The rest of the research in this thesis was completed solely by the author, Stephanie

Nadya, under the guidance of Dr. Pascal Delaquis and Dr. Kevin Allen.

Laboratory Biological Safety Course from the Department of Risk Management Services of University of British Columbia was completed on July 27, 2012, prior to the start of the project. This project was approved by the UBC Biosafety Committee, Certificate Number B14-

0205.

The work in this thesis is original and has not been previously published.

Table of Contents

Abstract ...... ii

Preface ...... iv

Table of Contents ...... v

List of Tables ...... xi

List of Figures ...... xiv

List of Symbols ...... xvii

List of Abbreviations ...... xviii

Acknowledgements ...... xxi

Dedication ...... xxiii

Chapter 1: Introduction, literature review and research purpose ...... 1

1.1 Introduction ...... 1

1.2 Literature review ...... 2

1.2.1 Verotoxigenic Escherichia coli...... 2

1.2.1.1 O157 serogroup ...... 3

1.2.1.2 Non-O157 serogroups ...... 3

1.2.1.3 Pathogenicity of VTEC ...... 5

1.2.1.3.1 Verotoxins ...... 6

1.2.1.3.2 Attachment and effacement lesion ...... 7

1.2.1.3.3 Enterohemolysin...... 8

1.2.2 Epidemiology ...... 8

1.2.2.1 Disease treatment ...... 10

1.2.3 Reservoir and routes of transmission ...... 10 v

1.2.3.1 Prevalence and significance of VTEC in cattle ...... 12

1.2.3.2 Prevalence and significance of VTEC in surface waters ...... 14

1.2.3.2.1 Factors affecting the prevalence of VTEC in surface waters ...... 15

1.2.3.3 Prevalence and significance of VTEC in fresh produce ...... 17

1.2.4 Behaviour of VTEC in the agricultural environment ...... 19

1.2.4.1 Behaviour of VTEC in soil ...... 19

1.2.4.2 Behaviour of VTEC in water ...... 21

1.2.4.3 Behaviour of VTEC in sediment...... 23

1.2.4.4 Behaviour of VTEC on growing plants ...... 24

1.2.5 Agricultural practices in the Lower Mainland of British Columbia ...... 27

1.2.5.1 Coliforms and Escherichia coli as indicators of microbiological quality ...... 28

1.2.6 Current method of detection for VTEC ...... 29

1.2.6.1 O157 serogroup ...... 29

1.2.6.2 Non-O157 serogroups ...... 30

1.2.7 Antimicrobial resistance ...... 32

1.3 Research purpose ...... 35

Chapter 2: Prevalence of verotoxigenic Escherichia coli in surface waters, sediments and fresh produce in the Lower Mainland of British Columbia ...... 42

2.1 Introduction ...... 42

2.2 Materials and methods ...... 43

2.2.1 Surface water sampling sites ...... 43

2.2.1.1 Water sample collection ...... 43

2.2.1.2 Sediment sample collection ...... 44 vi

2.2.1.3 Weather data ...... 44

2.2.2 Detection and isolation of VTEC in water and sediment samples...... 45

2.2.2.1 Hydrophobic grid membrane filter immunoblot ...... 45

2.2.2.2 Enzyme-linked immunosorbent assay ...... 47

2.2.3 Fecal coliform/Escherichia coli counts for water samples ...... 47

2.2.4 Produce sample collection ...... 48

2.2.5 Detection and isolation of VTEC from produce samples ...... 48

2.2.6 Confirmation of Escherichia coli...... 49

2.2.7 Detection of virulence genes in presumptive VTEC by PCR ...... 50

2.2.8 Statistical analysis ...... 51

2.3 Results ...... 52

2.3.1 Selection of sampling sites...... 52

2.3.1.1 Prevalence of VTEC in surface water samples ...... 54

2.3.1.2 Effect of climatic factors on VTEC prevalence in surface water samples ...... 56

2.3.1.3 Coliform/Escherichia coli counts in surface water samples ...... 57

2.3.2 Prevalence of VTEC in sediment samples ...... 58

2.3.3 Prevalence of VTEC in produce samples ...... 58

2.4 Discussion ...... 59

2.4.1 VTEC prevalence in surface water samples ...... 60

2.4.1.1 Influence of climatic factors on VTEC prevalence in surface water ...... 62

2.4.1.2 Fecal coliforms/Escherichia coli in surface water samples ...... 63

2.4.2 VTEC prevalence in sediment samples ...... 64

2.4.3 VTEC prevalence in fresh produce samples ...... 65 vii

2.5 Conclusions ...... 68

Chapter 3: Molecular characterization of verotoxigenic Escherichia coli isolates recovered from surface waters and sediments in four watersheds in the Lower Mainland of BC ...... 100

3.1 Introduction ...... 100

3.2 Materials and methods ...... 101

3.2.1 Serotyping of VTEC isolates ...... 101

3.2.2 Virulence gene profiling of VTEC isolates ...... 101

3.2.3 Fingerprinting of VTEC isolates by BOX-PCR ...... 101

3.2.3.1 BOX-PCR data analysis ...... 102

3.3 Results ...... 102

3.3.1 Surface water samples...... 102

3.3.1.1 Serotyping, virulence gene profiles and BOX-PCR fingerprints of VTEC

isolates…………………………………………………………………………………..102

3.3.1.1.1 Lower Fraser watershed ...... 103

3.3.1.1.2 Sumas River watershed ...... 104

3.3.1.1.3 Nicomekl River watershed ...... 105

3.3.1.1.4 Serpentine River watershed ...... 106

3.3.1.1.5 Overall observations on serotypes and virulence gene profiles of the VTEC

isolates………………………………………………………………………………..107

3.3.2 Sediment samples...... 108

3.3.2.1 Serotyping, virulence gene profiles and BOX-PCR fingerprints of VTEC

isolates…………………………………………………………………………………..108

3.4 Discussion ...... 109 viii

3.4.1 Surface water samples...... 109

3.4.2 Sediment samples...... 116

3.5 Conclusions ...... 117

Chapter 4: Antibiotic resistance of verotoxigenic Escherichia coli isolated from surface waters and sediments in British Columbia ...... 127

4.1 Introduction ...... 127

4.2 Materials and methods ...... 128

4.2.1 Antibiotic susceptibility testing ...... 128

4.2.2 Statistical analysis ...... 129

4.3 Results ...... 129

4.4 Discussion ...... 131

4.5 Conclusion ...... 138

Chapter 5: Conclusion and future direction ...... 145

5.1 Conclusion ...... 145

5.2 Future direction ...... 147

Bibliography ...... 148

Appendix ...... 168

Appendix A Antibiotic resistance profile of VTEC isolates ...... 168

A.1 Antibiotic resistance profiles of VTEC isolates recovered from surface waters

collected in the Lower Fraser watershed...... 168

A.2 Antimicrobial resistance profile of VTEC isolates recovered from surface waters

collected from Sumas River watershed...... 169

A.3 Antibiotic resistance profiles of VTEC isolates recovered from surface waters collected in the Nicomekl River watershed...... 171

A.4 Antibiotic resistance profiles of VTEC isolates recovered from surface waters collected in the Serpentine River watershed...... 173

A.5 Antibiotic resistance profiles of VTEC isolates recovered from sediments collected from Site #10 of the Sumas River watershed...... 175

List of Tables

Table 1.2 Target, mode of action and resistance mechanism of the main classes of antimicrobial drugs (Walsh, 2000)...... 40

Table 1.3 Categorization of antimicrobial drugs based on importance in human medicine (CIPARS, 2011)...... 41

Table 2.1 Number of water samples collected from 61 sampling sites located in the municipalities of Abbotsford, Chilliwack, Langley, Richmond and Surrey, British Columbia, between November 2012 and February 2013. The number of samples positive for the presence of VTEC and prevalence (expressed as % of samples analyzed) are also shown...... 69

Table 2.2 Number of water samples collected from 20 sampling sites in the Lower Fraser, Sumas, Nicomekl and Serpentine River watersheds of British Columbia between November 2012 and November 2013. The number of samples positive for the presence of VTEC and prevalence (expressed as % of samples analyzed) are also shown...... 70

Table 2.4 Point biserial correlation coefficient between the environmental factors, fecal coliform and E. coli counts, and VTEC occurrence in irrigation waters from the Lower Fraser, Sumas, Nicomekl and Serpentine River watersheds...... 73

Table 3.1 Serotypes of VTEC recovered from all water samples collected in the Lower Mainland of BC (n=248). The number of isolates definitively identified as VTEC and non- VTEC are shown...... 118

Table 3.7 Virulence gene profiles of VTEC with the number of isolates and list of serotypes associated with each profile (n=100)...... 125

xii

Table 4.1 List of test antibiotics and their class, category, animal/human usage and quantity of each antibiotic class distributed for animal usage in Canada...... 139

Table 4.2 Antibiotic resistance profiles of VTEC (n=104) from different serotypes recovered from surface water and sediment in the Lower Mainland of BC watersheds. The number of isolates tested and their resistance or intermediate resistance to each antibiotic are given...... 140

Table 4.3 Antibiotic resistance profiles, serotypes and number of isolates belonging to each profile for VTEC isolates from four watersheds in the Lower Mainland of BC...... 142

Table 4.4 Number and percentage (of total) of VTEC isolates resistant to specific antibiotics and associated virulence genes...... 143

xiii

List of Figures

Figure 2.1a Map of Richmond municipality and geographic coordinates of water sampling sites. A yellow colour indicates that water samples collected in November 2012 - February 2013 were negative for VTEC. Five sampling sites selected for repeated sampling in May – November 2013 are denoted by a star-shaped marker and are numbered...... 76

Figure 2.1b Map of Richmond municipality showing land devoted to the cultivation of field crops in 2010 with the location of sampling sites. White cross (outlined red) indicates the five selected sampling sites in the Lower Fraser watershed for May – November 2013. Black coloured cross indicates other sampling sites visited in November 2012 – February 2013. The map is adapted from a report for the City of Richmond on agricultural land use (http://www.al.gov.bc.ca/resmgmt/sf/gis/lui_reports/Richmond_Maps_All_ft.pdf). 78

Figure 2.1c Map of Richmond municipality showing land devoted to livestock production in 2010 with the location of sampling sites. White cross (outlined red) indicates the five selected sampling sites in the Lower Fraser watershed for May – November 2013. Black coloured cross indicates other sampling sites visited in November 2012 – February 2013. The map is adapted from a report for the City of Richmond on agricultural land use (http://www.al.gov.bc.ca/resmgmt/sf/gis/lui_reports/Richmond_Maps_All_ft.pdf). 80

Figure 2.2a Map of Chilliwack/Abbotsford municipalities and geographic coordinates of water sampling sites. A yellow colour indicates that water samples collected in November 2012 - February 2013 were negative for VTEC, while red indicates a positive result. Five sampling sites selected for repeated sampling in May – November 2013 are denoted by a star-shaped marker and are numbered...... 82

Figure 2.2b Map of Abbotsford municipality showing land devoted to the cultivation of field crops and livestock production in 2003 with the location of sampling sites. White cross (outlined red) indicates the five selected sampling sites in the Sumas River watershed for May – November 2013. Black coloured cross indicates other sampling sites visited in November 2012 – February 2013. The map is adapted from a report for the City of Abbotsford on agricultural use (http://www.al.gov.bc.ca/resmgmt/sf/gis/lui_reports/Abbotsford2003_LUIReport. pdf)...... 84

xiv

Figure 2.2c Map of Chilliwack municipality showing land devoted to the cultivation of field crops and livestock production in 2004 with the location of sampling sites. Black coloured cross indicates sampling sites visited in November 2012 – February 2013. The map is adapted from a report for the City of Chilliwack on agricultural use (http://www.al.gov.bc.ca/resmgmt/sf/gis/lui_reports/Chilliwack2004_LUIReport.pdf) ...... 86

Figure 2.3a Map of Surrey/Langley municipalities and geographic coordinates of water sampling sites. A yellow colour indicates that water samples collected in November 2012 - February 2013 were negative for VTEC, red indicates a positive result. Ten sampling sites selected for repeated sampling in May – November 2013 are denoted by a star- shaped marker and are numbered...... 88

Figure 2.3b Map of Surrey municipality showing land devoted to the cultivation of field crops in 2010 with the location of sampling sites. White cross (outlined red) indicates the ten selected sampling sites in the Nicomekl and Serpentine Rivers watersheds for May – November 2013. Black coloured cross indicates other sampling sites visited in November 2012 – February 2013. The map is adapted from a report for the City of Surrey on agricultural land use (http://www.al.gov.bc.ca/resmgmt/sf/gis/lui_reports/Surrey2010_LUI_maps_22x17.p df)...... 90

Figure 2.3c Map of Surrey municipality showing land devoted to livestock production in 2010 with the location of sampling sites. White cross (outlined red) indicates the ten selected sampling sites in the Nicomekl and Serpentine Rivers watersheds for May – November 2013. Black coloured cross indicates other sampling sites visited in November 2012 – February 2013. The map is adapted from a report for the City of Surrey on agricultural land use (http://www.al.gov.bc.ca/resmgmt/sf/gis/lui_reports/Surrey2010_LUI_maps_22x17.p df)...... 92

Figure 2.4 Prevalence of VTEC in irrigation water samples from 20 sampling sites located in the Lower Fraser, Sumas, Nicomekl and Serpentine River watersheds of British Columbia during winter (November 2012 - February 2013), spring/summer (May - August 2013) and fall seasons (September – November 2013)...... 94

Figure 2.5 (A) Number of positive and negative water samples collected in the Lower Fraser watershed at each sampling date. (B) Mean temperature (˚C) and precipitation

accumulation (mm) on sampling day (T, P) and three days before sampling (Tb, Pb). The weather data was taken from the Richmond Nature Park (49°10'15.000" N, 123°05'35.000" W) station...... 95 xv

Figure 2.6 (A) Number of positive and negative water samples collected in the Sumas River watershed at each sampling date. (B) Mean temperature (˚C) and precipitation

accumulation (mm) on sampling day (T, P) and three days before sampling (Tb, Pb) in Abbotsford. The weather data was taken from the Sumas Canal (49°06'48.008" N, 122°06'35.004" W) and Mission West Abbey (49°09'09.002" N, 122°16'14.001" W) stations...... 96

Figure 2.7 (A) Number of positive and negative water samples collected in the Nicomekl River watershed at each sampling date. (B) Mean temperature (˚C) and precipitation

accumulation (mm) on sampling day (T, P) and three days before sampling (Tb, Pb) in Surrey. The weather data was taken from the White Rock Campbell Scientific (49°01'05.000" N, 122°47'02.000" W) station...... 97

Figure 2.8 (A) Number of positive and negative water samples collected in the Serpentine River watershed at each sampling date. (B) Mean temperature (˚C) and precipitation

Figure 2.9 Regression trees for the Sumas River watershed showing a single tree node with mean temperature during sampling (T) as the predicting variable ...... 99

Figure 2.10 Regression trees for the Serpentine River watershed showing a single tree node with

total precipitation 3 days before sampling (Pb) as the predicting variable ...... 99

Figure 4.1 Percentage of VTEC isolates (n=104) recovered from surface water and sediment in the Lower Mainland of BC watersheds that were susceptible, of intermediate resistance or resistant to eighteen antibiotics...... 144

xvi

List of Symbols

χ2 - Chi square

xvii

List of Abbreviations

AMK – amikacin

AMP – ampicillin

AMR – antimicrobial resistance

AMX – amoxicillin

BC – British Columbia

BCN – kanamycin

CFU – colony forming unit

CIP – ciprofloxacin

CIPARS - Canadian Integrated Program for Antimicrobial Resistance Surveillance

CRO – ceftriaxone

CSLI – Clinical and Laboratory Standards Institute

DAEC – diffusely adherent Escherichia coli df – degree of freedom

DNA – deoxyribonucleic acid

EAEC – enteroaggregative Escherichia coli

EHEC – enterohemorrhagic Escherichia coli

EIEC – enteroinvasive Escherichia coli

EMB – eosin methylene blue agar

EPEC – enteropathogenic Escherichia coli

EPS – extracellular polymeric substances

ETEC – enterotoxigenic Escherichia coli

ETP – ertapenem xviii

FDA – Food and Drug Administration

FFC – florfenicol

FOX – cefoxitin

GEN – gentamicin

HC – haemorrhagic colitis

HGMF – hydrophobic grid membrane filtration

HUS – haemolytic uraemic syndrome

IPM – imipenem

MAC – MacConkey agar

MAC-VC – MacConkey agar with vancomycin and cefsulodin

MEM – meropenem mTSA-VC – modified tryptic soy agar with bile salts, vancomycin and cefsulodin mTSB-VC – modified tryptic soy broth with bile salts, vancomycin and cefsulodin

NAL – nalidixic acid

OD – optical density

P – precipitation accumulation on the sampling day

Pb – precipitation accumulation three days before the sampling day

PBS – phosphate buffer saline

PCR – polymerase chain reaction

PFGE – Pulse Field Gel Electrophoresis

PGA – poly-beta-1,6-N-acetyl-D-glucosamine

REA – rapid evidence assessment

RE-EM – random effect – estimation methods xix

RTX – repeats in toxin

SMAC – sorbitol-MacConkey agar

STR – streptomycin

SXT – trimethoprim – sulfamethoxazole

T – mean temperature on the sampling day

Tb – mean temperature three days before the sampling day

TET – tetracycline

TIO – ceftiofur

TSA – tryptic soy agar

TSB – tryptic soy broth

US – the United States

USDA – the United States Department of Agriculture

UV – ultraviolet

VT – verotoxin

VTEC – verotoxigenic Escherichia coli

VT-ELISA – verotoxin Enzyme-linked Immunosorbent Assay methodology

VT-IB – verotoxin immunoblot methodology

WHO – World Health Organization

Acknowledgements

I would like to express my sincere gratitude to my supervisors, Dr. Kevin Allen and Dr.

Pascal Delaquis, for the opportunity to undertake my Master of Science. Their continual guidance, encouragement and confidence in me have been a key factor in my learning throughout my M.Sc. They are my greatest inspiration.

I am especially grateful to Dr. Pascal Delaquis who has been supportive in many ways, from the planning of the project to the completion of this thesis. His personal involvement in the project has been my greatest encouragement. Without his moral support, I would not have been able to complete this program smoothly and successfully.

My other committee members, Dr. Eunice Li-Chan and Dr. Siyun Wang, have been great mentors. I thank them for their assistance and insight.

My gratitude is also extended to Dr. Roger Johnson and Ms. Kim Ziebell from the Public

Health Agency of Canada in Guelph for their participation in the study and constant advice, as well as Dr. Vic Gannon and Ms. Cassandra Jokinen from the Public Health Agency of Canada in

Lethbridge for their hospitality during my laboratory training. Ms. Cassandra Jokinen’s guidance and knowledge allowed me to become proficient in conducting the novel methodology used in this study.

I also thank the Federal Genomics Research and Development Initiative for providing the funds, and the University of British Columbia for allowing me to conduct this study.

My friends have been my source of comfort and joy throughout the journey. I am indebted to my

Allen Lab colleagues who have helped and given me numerous inputs towards the study. Their presence has made the journey enjoyable.

xxi

My special appreciation goes to my family. My beloved parents, Lim Winady and Yanty

Lesmanadjaja, and grandparents, Hady Lesmanadjaja and Linawati, for their continual support and belief in my ability to successfully complete my graduate program. My brother, Felix

Valentino, and sister, Laurentia Nathania, has been my pillar of encouragement and strength.

xxii

Dedication

I would like to dedicate my thesis to my family - for their unconditional love and support.

xxiii

Chapter 1: Introduction, literature review and research purpose

1.1 Introduction

The Gram-negative rod-shaped bacterium Escherichia coli was discovered by Theodor

Escherich in 1885 (Blum-Oehler and Hacker, 2007). E. coli is a member of the

Enterobacteriaceae family within the gamma subdivision of the phylum Proteobacteria

(Mathusa et al., 2010; Grant et al., 2011). Typical strains grow at temperatures between 7°C -

46°C with an optimum near 37°C at pH values ranging between pH 4.5 – 9.0 (ICMFS, 1996;

Grant et al., 2011). A facultative anaerobe, E. coli is capable of both respiratory and fermentative metabolism, a characteristic which contributes to the ecological versatility of the species (Cook et al., 2011). While the lower intestines of warm-blooded animals are the primary habitat of E. coli, it may survive or and adapt to life in a range of extra-intestinal environments.

E. coli is probably the most widely studied bacterium to date. It has served as a model for extensive fundamental investigations in microbial physiology and bacterial genetics (Scheutz and

Stockbine, 2005). The latter has revealed that genomic rearrangements and mutations are responsible for the wide diversity of phenotypes expressed by strains isolated from animal, clinical samples and other environments (Vanaja et al., 2013). Serological methods using antibodies to antigenic determinants on the cell surface are currently used to differentiate E. coli or to assign them to groups with characteristics of interest (Kauffmann, 1947). Currently, the most widely used classification scheme is based on O-antigens consisting of unique polysaccharides on the outer membrane, H-protein antigens on the flagella and K-antigen capsular acidic polysaccharides (Scheutz and Stockbine, 2005). Approximately 180 O and 60 H antigens have been identified to date (Stenutz et al., 2006). Classification schemes based on 1

genomic analyses that provide higher resolution of differences between isolates and potentially useful information about their relationship to other E. coli will likely replace serological schemes in the future.

Although most E. coli are harmless to humans, some are well-known etiological agents of animal and human diseases, notably diarrheas. Human diarrheagenic E. coli, are grouped into six pathotypes (Feng and Weagan, 2002). These include the verotoxigenic E. coli (VTEC), enteropathogenic E. coli (EPEC), enterotoxigenic E. coli (ETEC), enteroaggregative E. coli

(EAEC), enteroinvasive E. coli (EIEC) and diffusely adherent E. coli (DAEC). The present work is focused on the VTEC pathotype, specifically on their occurrence and prevalence in irrigation water and fresh produce across the Lower Mainland of British Columbia (BC).

1.2 Literature review

1.2.1 Verotoxigenic Escherichia coli

Verotoxigenic Escherichia coli (VTEC) were first recognized as foodborne pathogens in

1982, when an outbreak caused by serotype E. coli O157:H7 was definitively linked to the consumption of undercooked ground beef in the United States (CDC, 1982). To date, more than

400 VTEC serotypes have been described (Grant et al., 2011). Although E. coli O157:H7 is the most significant, being responsible for 50 - 70% of VTEC infections in North America, strains belonging to six non-O157 serogroups including O26, O45, O103, O111, O121 and O145 are increasingly implicated in foodborne disease and have been declared as adulterants in non-intact beef by the United States Department of Agriculture (USDA) since 2011 (Kanama et al., 2008;

Gill and Gill, 2010; BCCDC, 2013; Grant et al., 2011; USDA, 2011).

1.2.1.1 O157 serogroup

Public health awareness and the development of effective VTEC detection methods have improved the frequency of diagnosis and reporting of illness. Serogroup O157 is the most widely reported cause of VTEC disease in both Canada and the United States (Gill and Gill, 2010).

Within the O157 serogroup, serotype O157:H7 is most often associated with human infections.

Contrary to most VTEC and other E. coli strains, E. coli O157:H7 is unable or slow to ferment sorbitol due to the absence of the enzyme β-D-glucuronidase (Rosser et al., 2008; Grant et al.,

2011). This characteristic facilitates detection with differential and selective media such as sorbitol-MacConkey agar (SMAC) (Gould et al., 2009).

Exceptions do exist however, and in 1988 a sorbitol fermenting strain of E. coli

O157:NM (non-motile) was found to be pathogenic to humans (Karch and Bielaszewska, 2001).

Infection with serotype O157:NM results in more cases of HUS than with O157:H7 (Rosser et al., 2008). This has been attributed to higher levels of adherence to human cells due to the presence of the efa1 gene that encodes for an enterohemorrhagic factor for adherence and to increased expression of curli which favour adhesion, rather than to an alteration in the type or quantity of toxin produced (Rosser et al., 2008).

1.2.1.2 Non-O157 serogroups

More than 150 VTEC serotypes from a range of serogroups can cause human disease. In the US six non-O157 serogroups (the “big six”) including O26, O45, O103, O111, O121 and

O145 are responsible for the majority of clinically confirmed infections (Gould et al., 2009;

Mathusa et al., 2010; Coombes et al., 2011). In contrast, serogroup O145 is rarely reported in

Canada where the major non-O157 VTEC serogroups are O18, O26, O55, O125, O126 and 3

O128 (Vanaja et al., 2013).The incidence of infection with specific VTEC serogroups and serotypes are known to vary between continents, countries and regions (Johnson et al., 2006;

Gould et al., 2013; Vanaja et al., 2013).

Clinical manifestations of disease caused by non-O157 infection are also variable due to differences in the complement of virulence factors in pathogenic strains (Mathusa et al., 2010).

There is significant evidence that genes encoding for virulence can be exchanged between pathogenic E. coli and other closely related species through horizontal gene transfer by conjugation, transduction or transformation (Kaspar et al., 2010; Van Elsas et al., 2010). For example, analysis of both O157 and non-O157 VTEC from serogroups O26, O103, and O111 showed that all “contained a large number of prophages and transmissible integrative genetic elements containing virulence genes” (Ogura et al., 2009). The gain or deletion of genes between the strains has often led to the emergence of highly virulent and antibiotic resistance pathogens

(Van Elsas et al., 2010). Further, a study on the virulence characteristics of O26 VTEC isolates revealed the presence of genes that encode pesticin receptor and yersiniabactin, both important virulence factors in Yersinia spp. including the plague bacterium Yersinia pestis (Zhang et al.,

2000). Neither are present in the O157 serogroup. Hence genetic recombination in E. coli has produced a wide array of genotypes with a range of pathotypes.

Detection and identification of non-O157 VTEC has long been challenging due to the lack of unique or distinguishing physiological features that can be exploited for the differentiation of the group from other E. coli strains (Mathusa et al., 2010; Grant et al., 2011).

In the past, the lack of reliable culture-based detection methods likely contributed to erroneous clinical diagnoses. As a result, the historical burden of non-O157 human disease is difficult to estimate (BCCDC, 2011; Grant et al., 2011). However, recent improvements in methodology 4

have enhanced both the quantity and reliability of relevant data. Analysis suggests that rates of infection with non-O157 VTEC have been underreported and may be increasing in western countries (Gould et al., 2009; Gould et al., 2013; Stigi et al., 2012).

1.2.1.3 Pathogenicity of VTEC

The pathogenicity of VTEC is variable, as are the consequences of infection. A highly pathogenic subgroup of VTEC termed enterohemorrhagic E. coli (EHEC), represented by the now well-known O157:H7 serotype, is associated with the most severe illnesses (Gill and Gill,

2010). The pathogenicity of individual VTEC pathotypes varies according to the complement of virulence genes in the genome, particularly the eaeA, hlyA, vt1 and vt2 genes (Gill and Gill, 2010;

Mathusa et al., 2010). Their expression enables attachment to and invasion of intestinal cells and, where the implicated genes are present, to produce highly toxic verotoxins responsible for the most acute clinical manifestations of infection (Mathusa et al., 2010).

The incubation period for VTEC varies between one day and one week (Mathusa et al.,

2010). Infected individuals may experience initial symptoms including severe abdominal pain, non-bloody diarrhea and occasionally vomiting. The infection often subsides and hospitalization is unnecessary. Where infection is caused by EHEC strains, 10% of patients may develop bloody diarrhea or haemorrhagic colitis (HC), haemolytic uremic syndrome (HUS) and neurological disorders (Kanama et al., 2008; Gill and Gill, 2010; Mathusa et al., 2010; Grant et al., 2011).

HUS may lead to acute renal failure, hemolytic anemia and thrombocytopenia. Reported mortality rates approach 12% and 25% of survivors endure lifelong health issues, including renal insufficiency and neurological impairment (Garg et al., 2003).

The infectious dose for VTEC such as E. coli O157:H7 is believed to be below 10 cells

(Grant et al., 2011). In addition, VTEC strains are frequently acid resistant and may withstand the environment in the gastrointestinal tract (Mathusa et al., 2010). These characteristics undoubtedly contribute to ease of transmission along the fecal-oral route through contaminated food, water, contact with infected individuals and environmental sources of contamination

(Grant et al., 2011).

1.2.1.3.1 Verotoxins

VTEC are characterized by their ability to produce verotoxins, type III proteins made up of a single A-subunit and 5 B-subunits (Nataro and Kaper, 1998). VTEC acquired verotoxin 1

(VT 1) and verotoxin 2 (VT 2) phage through transduction of a toxin-converting bacteriophage

(Vanaja et al., 2013). VT 1 variants derived from the expression of the vt1 gene have >99% similarity in both A and B subunits with the Shiga toxin produced by Shigella dysenteriae

(Mainil and Daube, 2005; Gill and Gill, 2010). In contrast, the products of the vt2 gene include

VT 2 variants with A subunits that have 57% to 95% similarity and B subunits with 60% to 95% similarity with S. dysenteriae Shiga toxin (Mainil and Daube, 2005; Gill and Gill, 2010). The A subunit of the toxin, the larger 33 kDa component, causes most cellular damage by termination of protein synthesis through cleavage of a specific adenine nucleotide of the 28S ribosomal subunit of the rRNA (Nataro and Kaper, 1998). The smaller 7.5 kDa B subunit of the protein binds to globotriaosylceramide (Gb3) receptors in the membranes of eukaryotic cells and facilitates cell permeation. Because Gb3 receptors are most abundant in the kidney cells and neurons, clinical manifestations of EHEC disease often include kidney failure leading to HUS, and impairment of neurological functions (Nataro and Kaper, 1998). 6

At least 11 verotoxin variants have been identified including VT 1a, VT 1b, VT 1c, VT

1d, VT 2a, VT 2c, VT 2d, VT 2e, VT 2f and VT 2g (Gill and Gill, 2010; Grant et al., 2011).

Disparities in the toxicity of the variants is ascribed to differences in the efficiency of attachment to target receptors on human cells (Gill and Gill, 2010; Grant et al., 2011). VT 2 variants are

1000X more toxic to human renal microvascular endothelial cells than VT 1 variants (Louise and

Obrig, 1995; Gill and Gill, 2010; Grant et al., 2011). Unsurprisingly, VTEC that produce VT 2 are more often associated with severe infections and acute diseases such as HUS (Boerlin et al.,

1999).

1.2.1.3.2 Attachment and effacement lesion

The presence of the eaeA gene also tends to increase the virulence of VTEC strains

(Boerlin et al., 1999). eaeA is located within the locus of enterocyte effacement (LEE) which also includes genes that encode for the structural components of a type III secretion system, a translocated intimin receptor and other effector proteins (Grant et al., 2011). Together, these components, including intimin produced by the eaeA gene, result in the formation of the so- called “attaching and effacing (A/E) lesion” on the surface of intestinal cells (Grant et al., 2011).

The A/E lesions are formed when translocated intimin receptors, which are inserted into the outer membrane of the host cell, serve as anchorage for the intimin on the surface of the bacteria

(Mathusa et al., 2010; Grant et al., 2011). These interactions are followed by modification of the host cell cytoskeleton which results in the disappearance (ie. “effacement”) of the microvilli (Gill and Gill, 2010; Grant et al., 2011).

The presence of the eaeA gene and derived virulence factors is not essential for infection however, and eaeA negative E. coli strains have been reported to cause disease (Mathusa et al., 7

2010; Grant et al., 2011). One notable example is the strain responsible for a large outbreak caused by contaminated fenugreek sprouts in Germany in 2011. The implicated strain, E. coli

O104:H4, lacked the eaeA gene but was capable of producing VT 2 (Bielaszewska et al., 2011).

1.2.1.3.3 Enterohemolysin

Many VTEC pathotypes also produce the virulence factor enterohemolysin, an intracellular protein produced under the control of the plasmid encoded hlyA gene.

Enterohemolysin is a pore-forming RTX (repeats in toxin) cytolysin (Mathusa et al., 2010; Grant et al., 2011). Pore formation leads to disruption of membrane permeability in mammalian cells resulting in cellular death (Mathusa et al., 2010; Grant et al., 2011). The hlyA gene is found in approximately 90% of all VTEC strains (Nataro and Kaper, 1998) and the presence of the gene is often associated with HC and HUS; however, the role of enterohemolysin in VTEC disease remains to be fully established as hlyA negative strains have also been reported in cases with similar clinical outcomes (Gill and Gill, 2010).

1.2.2 Epidemiology

In a recent study, Majowicz et al. (2014) suggested that the global rate of infection with

VTEC is approximately 43.1 incidences per 100,000 person-years. A conservative estimate of outcomes suggested that these resulted in 2,801,000 acute illnesses, 3890 HUS cases and 230 deaths annually, with children between age 0 and 4 years old most affected (Majowicz et al.,

2014). Children are more likely to suffer secondary consequences of infection due to the high density of Gb3 receptors in the infant kidney (Gould et al., 2013). In Canada, 94% of infantile

HUS is VTEC associated, with a mortality rate of 4% (Proulx and Sockett, 2005). The elderly 8

are also more susceptible than median age populations. Sex has been suggested as a risk factor for developing HUS, with females being more susceptible. However, it should be noted that some researchers have rejected the notion of a sex bias due to the variability in disease data

(Mathusa et al., 2010; Gould et al., 2013; Majowicz et al., 2014).

Gould et al. (2013) evaluated the frequency and incidence of VTEC in the United States

(US) from the year 2000 to 2010 and reported that 5688 cases could be ascribed to serogroup

O157 and 2006 to non-O157 VTEC serogroups (Gould et al., 2013). Over the ten years covered by the study the incidence of non-O157 infection increased (0.12 to 0.95 incidences per 100,000 population) while infections with serogroup O157 decreased (2.17 to 0.95 incidences per

100,000 population) (Gould et al., 2013). In Canada, it has been estimated that 22,344 cases of

VTEC infection occur annually, costing the national economy a total of $ 403.9 million for both primary and long-term health care (Sockett et al., 2014). In British Columbia (BC), rates of infection with VTEC have been higher than the Canadian average since 2004 (BCCDC, 2013).

The average BC VTEC incidence rate between 2004 and 2011 was 3.3 cases per 100,000 persons per year as compared to Canadian average of 2.5 cases per 100,000 persons per year (BCCDC,

2013). Reasons for this difference are unknown. Serogroup O157 (57.8%) was the leading cause for 136 VTEC infections reported in BC in 2012, followed by O121 (21.6%), O26 (7.8%), O103

(5.9%), O111 (3.9%) and other/unspecified (6.8%) serotypes (BCCDC, 2013). While 18.8% of the cases were international travel-related the remainder were endemic, with children aged 1 to 4 years and adults 20 to 24 years mostly affected (BCCDC, 2013).

Rates of infection with non-O157 VTEC in Canada are uncertain due to continuing underreporting. A limited number of studies have been performed to determine their role in clinical cases presenting disease symptoms often associated with VTEC infections. In one of the 9

few detailed investigations available non-O157 VTEC were isolated from 50% to 70% of stool samples of patients suffering from diarrhea or HUS (Thompson et al., 2005).

1.2.2.1 Disease treatment

The use of antibiotics to treat patients with VTEC infection is contraindicated in North

America (Allen et al., 2013). Studies have shown that aggressive antibiotic treatments are ineffective against many strains or may cause more harm due to stimulation of VT production.

For example, ciprofloxacin causes E. coli O157:H7 strains to increase the release of VTs and phages that contain vt genes into the gastrointestinal tract of the host (Bielaszewska et al., 2012).

These phages can subsequently infect other E. coli cells resulting in transfer of the genes.

Supportive care including fluid replacement and careful monitoring of the patient is therefore favored unless there is evidence of secondary infection (Sockett et al., 2014). Where there is evidence of renal distress or neurological complication, dialysis is routinely provided (Sockett et al., 2014). In severe cases where the infection leads to HUS, kidney damage can be extensive and transplant may be necessary.

1.2.3 Reservoir and routes of transmission

Ruminants, especially cattle, are the most important reservoir of VTEC. Consequently, considerable research has been devoted to the examination of their prevalence in the intestinal tracts or feces of cattle. However, other animal species including sheep, horses, farmed deer, goats, pigs, rabbits and birds may serve as VTEC carriers and have been implicated in transmission to humans (Garcia and Fox, 2003; Gill and Gill, 2010; Mathusa et al., 2010; Grant et al., 2011). 10

VTEC colonize the mucosal epithelium in the bovine terminal rectum and are asymptomatically carried due to the absence of Gb3 receptors in ruminants (Low et al., 2005;

Mathusa et al., 2010). The feces of healthy cattle normally contains small numbers of VTEC and shedding is transient (Arthur et al., 2010). In contrast, a small fraction of cattle, so-called “super shedders”, may consistently shed ≥103 or ≥104 CFU VTEC g-1 of feces (Arthur et al., 2010).

Examination of VTEC populations in super shedders have revealed a high proportion of PT

21/28 phage type strains that appear to have enhanced ability to colonize bovine hosts (Chase- topping et al., 2007). However, other factors such as breeding age, stress and warm climates can result in high shedding of VTEC (Chase-topping et al., 2007; Cooley et al., 2013). Cattle acquire

VTEC through contact with infected animals or by the ingestion of feed or water contaminated with fecal matter (Kaspar et al., 2010). Some studies have suggested that the presence of super shedders results in higher transmission of VTEC within a herd (Low et al., 2005; Arthur et al.,

2010).

Several routes of VTEC transmission to humans have been recognized. An analysis of outbreaks between 1997 and 2001 in Ontario, Canada, indicated that 40.5% and 21.5% were associated with meat and water consumption, respectively (Lee and Middleton, 2003). These findings indicate that direct transmission resulting from the contamination of meat during slaughter is significant. In contrast, infection via water or fresh fruits and vegetables is suggestive of far more indirect routes of transmission, for example through the contamination of irrigation water supplies by run-off from fields fertilized with animal manures (Arthur et al.,

2010). Other routes of transmission have been documented including contact with infected animals or persons and cross-contamination during food preparation (Arthur et al., 2010; Gill and Gill, 2010; Grant et al., 2011). There is also evidence that transmission route and may be 11

serogroup or strain-dependent. Outbreaks caused by person-to-person transmission are more commonly associated with non-O157 (28.8%) than O157 (6.8%) serogroups (Kaspar et al.,

2010). Additionally, water and meat are more frequently associated with outbreaks caused by serogroup O157 (25.6% and 24.6%, respectively) than non-O157 (10.0% and 11.2%, respectively) (Kaspar et al., 2010). It is important to note, however, that the source of infection in 18.8% of non-O157 outbreaks was unknown, likely due to aforementioned analytical constraints (Kaspar et al., 2010).

1.2.3.1 Prevalence and significance of VTEC in cattle

Awareness that cattle are a major reservoir for VTEC led to the examination of prevalence in herds from various countries. A global survey conducted by Hussein and Bollinger

(2005) indicated that the prevalence of E. coli O157:H7 in cattle fecal sample was 0.2% - 27.8%, while that of non-O157 VTEC ranged between 2.1% - 70.1%. Evidence that the prevalence of non-O157 serogroups may have been underestimated in the past is also provided by Bettelheim

(2001). Furthermore, the bovine intestinal tract may be colonized by a wide diversity of VTEC serotypes. A review of available literature by Hussein and Bollinger (2005) revealed that 193 distinct serotypes have been isolated from dairy and 261 from beef cattle. Comparison with clinical databases suggested that 12% (dairy cattle) and 17% (beef cattle) of the non-O157 serotypes reported in these studies have been associated with human illness (Hussein and

Bollinger, 2005).

Additional evidence of VTEC carriage by livestock can be derived from analysis of animals or their products at slaughter. Barkocy-Gallagher et al. (2003) reported E. coli O157:H7 prevalence rates of 5.9%, 60.6%, and 26.7% in fecal, hide, and pre-evisceration carcass samples 12

from a US beef processing plant; the same samples yielded prevalence rates of 34.3%, 92.0%, and 96.6% for non-O157 VTEC. A similar study by Arthur et al. (2002) revealed that 32.9% of fecal samples from four beef processing plants were positive for both O157 and non-O157

VTEC, including 361 non-O157 VTEC serotypes from 41 different serogroups.

High prevalence rates for non-O157 VTEC have also been reported in Canadian cattle. A study performed in the province of Alberta revealed that 7.5% of 1247 fecal samples were positive for E. coli O157:H7 and 42.6% for non-O157 VTEC (Van Donkersgoed et al., 1999).

Five distinct O157:H7 strains and 38 non-O157 isolates from 26 different serogroups were recovered from the samples (Van Donkersgoed et al., 1999). In a recent study carried out in the province of Ontario, Kanama et al. (2011) used a VT-ELISA method to detect VT-producing E. coli in 10.2% of 500 fecal samples. VTEC recovered from the positive samples included isolates from 24 serotypes of which twelve are known to be associated with human infection (Kanama et al., 2011).

Given the prevalence of VTEC in cattle, there are concerns that the risk of human infection may be influenced by the density of livestock in a given geographic region. A study conducted in Germany suggested that such a risk may increase by 68% per 100 cattle/km2 (Frank et al., 2008). An analysis of public health data and cattle densities in the province of Alberta led the authors to conclude that intensive livestock densities (more than 1 million beef cattle within a

500 km2 area) in some districts was positively correlated with higher rates of E. coli O157 infections (Socket et al., 2014).

1.2.3.2 Prevalence and significance of VTEC in surface waters

Poor water quality is clearly linked to waterborne disease outbreaks around the world

(Jokinen et al., 2010). It has been estimated that 3.4 million people die annually from consuming contaminated water either directly or indirectly (WHO/UNICEF, 2000). Waterborne disease outbreaks are not restricted to the underdeveloped or developing world. In Walkerton, Ontario,

Canada, an outbreak caused by the contamination of drinking water with E. coli O157:H7 from cattle manure resulted in more than 2300 cases of gastrointestinal illness and seven deaths in

2000 (Jokinen et al., 2010).

There have been few attempts to determine the prevalence of VTEC in natural watersheds. Cooley et al. (2013; 2014) recovered both O157 and non-O157 from surface waters in an agricultural region of California using immunomagnetic bead separation methods. The prevalence of E. coli O157:H7 in two successive years was 3.3% and 8%, while that of non-

O157 was 14% and 11%. Approximately 20% of non-O157 isolates belonged to the “big six” serogroups and had variable virulence characteristics (Cooley et al., 2013; Cooley et al., 2014).

A study of the Grand River watershed in Ontario by Johnson et al. (2014) yielded variable

VTEC prevalence rates ranging from 11% to 35%. The latter study was conducted using a newly developed method for the detection of VTEC based on the recognition of VT-production using an immunoblot procedure (VT-IB). Fifty-three distinct serotypes were recovered from the positive water samples and 37% contained strains from the “big six” and O157 serogroups

(Johnson et al., 2014).

In addition, Johnson et al. (2014) performed a rapid evidence assessment (REA) using data from six Canadian, four US and one European study on VTEC prevalence in surface waters.

Overall, serogroup O157 prevalence ranged from 0% to 54% and rates in Canadian watersheds 14

ranged from 0% to 6.7%. One of the Canadian datasets was derived from a study carried out in the Sumas River and Salmon River in BC (Jokinen et al., 2010; Edge et al., 2012). In addition, a recent report from FoodNet Canada indicated that VTEC prevalence was 31% (14/45) in surface waters collected between May to December 2013 from five irrigation ditches in the Sumas River watershed (Anonymous, 2014). Methods used to detect VTEC were not described in the report and there was no indication that the isolates were characterized (Anonymous, 2014).

1.2.3.2.1 Factors affecting the prevalence of VTEC in surface waters

Water can serve as a route for the transmission of pathogens in natural environments.

Precipitation plays an important role in the transport of fecal contaminants from livestock, wildlife and human sources from sites on land to surface waters (Arthur et al., 2010; Gill and

Gill, 2010; Grant et al., 2011; Edge et al., 2011). Increased water flow from heavy rainfall can dislodge pathogens trapped in sediments where VTEC such as E. coli O157:H7 may survive for several months or proliferate at warm temperatures (Edge et al., 2011). Cooley et al. (2013) have also documented the presence of E. coli O157:H7 (4.4%) and non-O57 VTEC (12.3%) in sediments within agricultural watersheds.

The prevalence of VTEC may be subject to climatic and seasonal variation. Positive correlation has been reported between rainfall and VTEC prevalence in some watersheds

(Jokinen et al., 2010; Edge et al., 2011; Gu et al., 2013). The prevalence E. coli O157:H7 and non-O57 VTEC increased significantly after heavy rainfall in a California river (Cooley et al.,

2007; 2013). Analysis of large sample volumes was necessary to detect seasonal variation in these studies due to low overall prevalence rates. Other studies conducted with smaller sample sizes failed to detect significant seasonal effects (Wilkes et al., 2009; Jokinen et al., 2010; Edge 15

et al., 2011; Cooley et al., 2014). Geographic areas such as the Lower Mainland of British

Columbia typically receive more precipitation during the winter and spring. Interestingly, land manure application occurs primarily during the spring and fall seasons in this region, a practice which is common in many temperate agricultural zones (Beaulieu, 2004). Run-off from fields fertilized with animal manures has been shown to carry VTEC and may represent an important source of surface water contamination (Wilkes et al., 2009; Cooley et al., 2014).

Water temperature is known to influence the prevalence of pathogens. Edge et al. (2011) observed that more bacterial pathogens could be recovered from surface waters at temperatures less than 14°C when precipitation was low (82% of samples) than from water at higher temperature when precipitation was higher (15%). In contrast, Cooley et al. (2014) noted that non-O157 VTEC prevalence in the Salinas River of California was high during the summer and fall dry season. These authors suggested that the phenomenon was likely due to contamination from nearby lakes that spill into the river (Cooley et al., 2014). During dry seasons, the microbial ecology of moving surface waters may be further altered by restricted flow or stagnation (Wilkes et al., 2009; Edge et al., 2012). Higher E. coli O157:H7 counts were also observed at higher water temperature by Gu et al. (2013). The authors suggested that high E. coli O157:H7 recovery was found at water temperatures near the optimum for growth of the species (Gu et al., 2013).

Distance from livestock is another critical factor that determines VTEC prevalence in surface waters (Wilkes et al., 2009; Cooley et al., 2014). The number of VTEC recovered is often negatively correlated with distance from source (Cooley et al., 2007). Wilkes et al. (2009), however, showed that E. coli O157:H7 could be detected in 93% of water samples collected 5 km downstream from pasturing livestock. Identical strains were also recovered 24 km apart from the same drainage system (Cooley et al., 2007). While the combination of environmental stresses 16

encountered in surface waters undoubtedly serve to lessen prevalence following a contamination event, it is clear that VTEC can persist and be carried over long distances in water. However, the role of additional carriers such as wildlife and birds in the transport and reintroduction of pathogens in watersheds should not be overlooked (Cooley et al., 2007; 2014).

1.2.3.3 Prevalence and significance of VTEC in fresh produce

Fresh produce consumption has increased significantly in recent times. Diets rich in fresh fruits and vegetables are widely held to reduce the risk of cardiovascular disease, cancer and stroke (Health Canada, 2000). Canada’s Food Guide recommends consuming between four and ten servings per day (Health Canada, 2011). In 2003, fresh produce consumption in Canada was twice the rate observed in the US (Burfield, 2003). This trend has continued and Canadian fresh produce consumption per capita is among the highest in the world, with 150 kg of fresh vegetables and 74 kg of fresh fruits per capita in 2009 (USDA, 2004; Statistics Canada, 2010b).

Consumption of fresh produce in BC is more than five fruit and vegetable servings per day

(Statistics Canada, 2010a).

Unfortunately, the consumption of fresh produce is increasingly associated with the risk of infection with foodborne pathogens (Table 1.1). Produce-associated outbreaks currently account for nearly half of all foodborne outbreaks in the US (Cooley et al., 2013; Gould et al.,

2013). VTEC infections have been linked to various produce commodities such as lettuce, sprouts, spinach and prepared salads (Cooley et al., 2013). Recent outbreaks of VTEC disease in the US include multistate outbreaks caused by E. coli O157:H7 (ready-to-eat salad, 2013 - 33 cases), serogroup O26 (raw clover sprouts, 2012 – 29 cases), and serogroup O121 (raw clover sprouts, 2014 – 19 cases) (CDC, 2012; 2013; 2014). The largest produce-associated outbreak to 17

date occurred in Germany in 2011 where fenugreek sprouts contaminated with the rare serotype

O104:H4 led to an outbreak that resulted in more than 3000 cases (Grant et al., 2011). Recurrent outbreaks have prompted many product recalls and reports of VTEC infections in Canada. In

August 2014 an E. coli O157:H7 outbreak responsible for 122 cases was reported in the province of Alberta (CBCNEWS, 2014b). The source of this outbreak was still uncertain at the time of writing but many of the victims patronized a local Asian food restaurant. There were also strong indications of linkage to an earlier outbreak in the city of Edmonton associated with contaminated bean sprouts which resulted in 20 cases (CBCNEWS, 2014a).

Several potential sources of contamination during the production of fresh produce have been proposed including animal fertilizers, irrigation water and farm workers (Islam et al.,

2004b; Grant et al., 2011). Outbreak investigations suggest that irrigation water is likely the most significant risk factor in horticultural production systems (Islam et al., 2004b; Fremaux et al.,

2008; Cooley et al., 2013). This was illustrated by a 2006 outbreak of E. coli O157:H7 (199 cases including 31 HUS) linked to spinach irrigated with water subject to frequent contamination by animal waste (CDC, 2006). Irrigation water is applied repeatedly throughout the production cycle resulting in multiple opportunities for the transfer of microorganisms to a crop (Grant et al., 2011). Microorganisms from irrigation water may also accumulate in soil which can serve as a source of re-contamination until the point of harvest (Islam et al., 2004b; Oliveira et al., 2012).

Despite the increasing number of produce-associated outbreaks, few surveys of fresh produce in the marketplace have been done to date. Cooley et al. (2013) reported that no E. coli

O157:H7 were recovered from 2462 samples collected in the US but that 0.3% were found to contain non-O157 VTEC. E. coli O157:H7 was not detected in surveys of lettuce in Belgium

(n=88) (Holvoet et al., 2014) and fresh produce collected from farmer’s markets in Alberta, 18

Canada (n=644) (Bohaychuk et al., 2009). The prevalence of VTEC in fresh produce grown in the province of BC has not been examined to date.

1.2.4 Behaviour of VTEC in the agricultural environment

Understanding factors that govern the survival and spread of VTEC is key to the development of mitigation strategies to reduce or prevent the risk of contamination during the production of horticultural crops. The persistence of VTEC in agricultural environments is affected by a range of factors including temperature, moisture, UV irradiation, availability of nutrients and microbial competition (Islam et al., 2004b; Cooley et al., 2007; Fremaux et al.,

2008; Oliveira et al., 2012).

1.2.4.1 Behaviour of VTEC in soil

Research in laboratory model systems has shown that VTEC such as E. coli O157:H7 can survive, replicate and travel vertically in various soil types (Gagliardi and Karns, 2000; Islam et al., 2004b). The influence of animal manures on these events has been examined in some detail in view of reports of extended VTEC survival in fresh or composted manures and their widespread use as fertilizers (Kudva et al., 1998; Gagliardi and Karns, 2000). For example, E. coli O157:H7 and an O26 isolate were shown to survive for 231 days at 21°C and more than 365 days at 20°C, respectively (Jiang et al., 2002; Fremaux et al., 2008). Islam et al. (2004b) reported that E. coli O157:H7 was able to survive for up to 217 days in field soil mixed with composted manure under conditions that simulated fall and winter seasons. Comparatively few studies have been performed under field conditions due to biosafety hazards associated with the release of potentially infectious microorganisms in the environment. However, available data 19

indicate that long-term survival is likely in manure-amended soils. For example, Mukherjee et al.

(2006) showed that E. coli O157:H7 survived for 69 days in garden plots fertilized with cattle manure. Additional research aimed at the characterization of the multiple factors that may influence VTEC behaviour in soil has mainly been carried out in laboratory model systems.

Soil moisture content and temperature affect VTEC persistence to varying degrees. Berry and Miller (2005) reported that E. coli O157:H7 populations decreased in dry feedlot surface soil but remained unchanged or increased slightly at higher moisture content. In contrast, Jiang et al.

(2002) and Fremaux et al. (2008) found that both E. coli O157:H7 and an O26 isolate could survive over extended period of time in dry soils at < 1% and < 8% moisture content, respectively. Fremaux et al. (2008) noted that the O26 isolate used in their work survived longer and decayed at a slower rate in dry soil held at 4°C than in wet soil held at 20°C, and suggested that moisture content and temperature may act synergistically to influence decay rates. Reduced microbial competition at lower temperature was offered as a possible explanation for this effect.

However, the decline of E. coli O157:H7 was faster at 4°C (10 days) than at ambient temperature

(92 days) in manure-amended soil recovered from a site that was naturally contaminated with raw cattle manure (Mukherjee et al., 2006).

The role of soil composition on the survival of VTEC has also been examined in the laboratory. Basic soil pH and low salinity favoured the survival of E. coli O157:H7 and E. coli

O26:H11 (Jiang et al., 2002; Ma et al., 2014). The presence of organic matter also increased survival, possibly by stimulating the formation of aggregates that provide physical barriers against potentially harmful chemical, biological, or environmental stresses (Kearney et al., 1993;

Ma et al., 2014). Protection from competitors or predators by absorption particles in high clay content soils is known to promote enteric bacterial survival (Santamaria and Toranzos, 2003). 20

Comparison of survival rates for an O26 isolate in different soils showed that a high clay content favoured survival at 20°C (Fremaux et al., 2008).

Strain-associated differences in the persistence of VTEC in soil have also been described.

Ma et al. (2014) compared the survival of serogroup O157 and non-O157 isolates in organic and conventionally managed soils from California and Arizona. E. coli O157:NM and non-O157 isolates, including O26:H11 and O103:H2 strains, survived twice longer (31 days) than a clinical of E. coli O157:H7 (Ma et al., 2014). Chemical analysis of the soils pointed to strong soil type effects. High total nitrogen content had a positive effect on the survivability of E. coli

O157:H7 and E. coli O157:NM, while low salinity and silt content favoured the survival of E. coli O103:H2 (Ma et al., 2014).

Much remains to be learned about the behaviour of VTEC in agricultural soils. Until more accurate means are found to anticipate decay rates in contaminated soil, it is prudent to assume that survival may span seasons.

1.2.4.2 Behaviour of VTEC in water

E. coli is known to survive for extended periods of time in aquatic environments. The

VTEC group is capable of similar behaviour, although the capacity for survival is strain specific.

Watterworth et al. (2006) examined the decay of isolates from three serogroups (O26, O111 and

O157) in well water. At 10˚C, populations of some strains fell from 107 CFU/ml to 103-5

CFU/ml while others were reduced to < 0.8 log CFU/ml. The survival characteristics of serotype

O157:H7 and O26:H11 isolates were similar in this study (Watterworth et al., 2006).

Temperature has a significant impact on the survivability of VTEC in water. Watterworth et al. (2006) found that the rate of population decline was higher at 22°C than 10°C. Eight VTEC 21

strains (n=15) that were detectable after 56 days (2-5 log CFU/ml) at 10°C were no longer recovered from samples incubated at 22°C. The enhanced survival of VTEC at low temperature was confirmed in several additional studies (Rice et al., 1992; Geidrich et al., 1992; Wang and

Doyle, 1998; Czajkowska et al., 2005). Wang and Doyle (1998) showed that E. coli O157:H7 can survive in water for more than 91 days at 8°C and only between 14 to 21 days at 15°C and

25°C.

Additional environmental stresses may influence the survival of VTEC in water, including the intensity of UV exposure from sunlight, the presence of organic carbon and nitrogen, water composition and microbial competition (Cook et al., 2011; Gu et al., 2013). UV irradiation causes DNA and RNA damage and the survival of E. coli decreases upon exposure to wavelengths between 250 and 488 nm (Vermeulen et al., 2008). In a study carried out by

Whitman et al. (2004), E. coli counts in a public beach area of Lake Michigan decreased exponentially with day length and resulting exposure to solar radiation, but remained essentially unchanged on cloudy days. Organic nitrogen derived from soil or manure indirectly affects survivability of VTEC by changing the dynamics of copiotrophic microorganisms (ie. microorganisms that grow best in nutritionally rich environments). The latter compete more efficiently for available nutrients than enteric bacteria (Gu et al., 2013). E. coli O157:H7 was also found to survive better in municipal water and sterile well water than in untreated waters where the potential for microbial competition is high (Wang and Doyle, 1998; Watterworth et al., 2006). Some contradictory observations are occasionally reported however, notably in a study by Czajkowska et al. (2005) which indicated higher survival of E. coli O157:H7 at 6°C in muddy water (65 days) collected near a sediment bed compared with surface water (51 days).

Oxygen concentration and pH are known to affect the survival of E. coli in water (Stevenson et 22

al., 2004). In the Czajkowska et al. (2005) study, however, these factors did not correlate with survival rates measured in muddy or surface waters.

Aquatic biota, including other microorganisms, can also affect the survival of VTEC in surface water (Dewedar and Bahgat, 1995; Karim et al., 2004; Carr et al., 2005). For example,

VTEC was found to be related to the presence of Cladophora, a species of green algae, in southern Lake Michigan (Byappanahalli et al., 2009).

1.2.4.3 Behaviour of VTEC in sediment

Although sediments are known reservoir for microorganisms there have been few attempts to examine VTEC survival in this environment. Bennani et al. (2011) reported that

VTEC prevalence in sediments recovered from the coast of Morocco was high (40%, n=115) and dependent on upstream agricultural activities and season. Cooley et al. (2014) recovered isolates of VTEC serogroups O26, O103, O104 and O157 from a California watershed over a period of several months. Some of the isolates were recurrent, a finding indicative of continuous reintroduction from stable reservoirs in the watershed. Although re-introduction of specific strains by wildlife typically leads to random recovery rates, continuous release from contaminated sediments was proposed as a more plausible explanation for the recurring recovery of the same

VTEC isolates (Cooley et al., 2014). Total coliform populations in sediments were 1000 times greater than in water in an agricultural stream studied by Davies-Colley et al. (2004). In the event of flooding, re-suspension of pathogens in the sediment increases the risk of crop contamination as the pathogen concentration in the water increases (Cooley et al., 2007). Fecal coliform and E. coli concentrations in surface waters have been reported to increase two to three fold after storm events (Hunter et al., 1992). 23

Sediments provide protection for microorganisms against environmental stresses, particularly UV, elevated salinity and competing microorganisms (Goyal et al., 1977; Garzio-

Hadzick et al., 2010; Pachepsky and Shelton, 2011). The size and texture of sediment play an important role in bacterial survival. The highest median E. coli concentrations were observed in sediment sizes between 0.125- to 0.5-mm while lower concentrations were found in finer particles, presumably due to reduced porosity and permeability (Goyal et al., 1977; Cinotto,

2005). Other factors, such as low temperature, high organic material and clay content, also aids in the persistence of E. coli in sediment (Craig et al., 2004). Similarly, Czajkowska et al. (2005) reported that E. coli O157:H7 could persist for 100 days at 6°C and 60 days at 20°C in river and lake shore sediments. Although the carbon content, percentage dry mass and pH of the sediments examined by Czajkowska et al. (2005) were not significantly different, the rate of E. coli

O157:H7 decay was observed to vary between different sediment sources.

The genetic diversity of E. coli inhabiting sediments may differ from that found in surface water or feces of animal due to resuspension and redistribution of sediment within the watershed. Atwill et al. (2007) compared E. coli isolates recovered from sediment and water samples by BOX-PCR method and no match was found. In contrast, Vogel et al. (2007) observed that the percentage of E. coli isolated from both water and sediment in Plum Creek watershed originated from cattle (water – 57%; sediment – 58%) and wildlife (water – 29%; sediment – 29%) was similar.

1.2.4.4 Behaviour of VTEC on growing plants

Recurrent outbreaks associated with fresh produce have prompted research to examine the fate of VTEC on growing plants, primarily salad vegetables. Investigations have been carried 24

out both in controlled environments generated in growth chambers and under variable field conditions. The length of VTEC survival observed experimentally is clearly influenced by experimental design, type of produce, strain-associated characteristics, inoculum size, time of contamination and method of analysis (Knudsen et al., 2001; Solomon et al., 2002; Islam et al.,

2004b; Patel et al., 2010; Bezanson et al., 2012; Shaw et al., 2015). Examples of the range of experimental outcomes include studies by Solomon et al. (2002), where E. coli O157:H7 was recovered from lettuce in growth chambers 20 days after inoculation; Islam et al. (2004b) who found that E. coli O157:H7 survived on lettuce and parsley for up to 77 and 177 days, respectively; and Petal et al. (2010) who reported that E. coli O157:H7 survived for < 14 days on spinach irrigated with contaminated water.

High temperature, high UV and low humidity could negatively affect VTEC survival on field crops. Oliveira et al. (2012) concluded that the survival of E. coli O157:H7 on lettuce was longer in the fall (5 weeks) than in spring (7 weeks) when lower temperature and high humidity were observed. However, these factors had little effect on E. coli O157:H7 survival on spinach

(Mitra et al., 2009). Furthermore, the timing of contamination exerted the greatest influence on

E. coli O157:H7 survival in several studies carried out with leafy greens and berries (Solomon et al., 2002; Islam et al., 2004b; Shaw et al., 2015). In these studies contamination during the late stages of a production cycle was conducive to longer survival.

The ability to attach and form biofilms may promote the colonization of plants by VTEC.

Physicochemical forces promote the initial adhesion of bacterial cells to plant surfaces (Delaquis et al., 2007). Extracellular polymeric substances (EPS), such as cellulose, colanic acid and poly- beta-1,6-N-acetyl-D-glucosamine (PGA) produced under conditions of stress subsequently consolidate the attachment of the cell (Matthysse et al., 2008). Filamentous structures such as 25

curli and fimbriae may contribute to the process in some strains (Van Elsas et al., 2010;

Macarisin et al., 2012). Attachment is favoured by plant structures, as evidenced in a study on spinach that showed stronger attachment of E. coli O157:H7 to plant stomata or wounds than on the smoother features of spinach leaves (Mitra et al. (2009). The availability of nutrients in stomata or wounded tissue is believed to promote colonization and enhance survival. Work by

Aruscavage et al. (2008) showed that E. coli O157:H7 survived longer on damaged than intact lettuce leaves. Survival of E. coli O157:H7 was also sustained by damage to strawberry tissues in a study by Knudsen et al. (2001). However, the native microflora on plant surfaces can compete for available nutrients and affect the survivability of VTEC (Liao and Fett 2001;

Schuenzel and Harrison, 2002). This was suggested as a cause for the limited survival of E. coli

O157:H7 survival on spinach in a study by Petal et al. (2010) and on minimally processed lettuce

(Schuenzel and Harrison, 2002).

Attachment of bacteria on the openings such as stomata and wounds is considered by some workers as the initial step in a process leading to invasion resulting in “internalization” of plant tissues. Internalization has also been suggested to occur through the root system. Attempts to confirm this behavior, however, have led to different conclusions. Solomon et al. (2002) reported that E. coli O157:H7 was able to migrate from contaminated soil to lettuce seedlings and contaminate edible portions of the plant despite the absence of contact with contaminated soil or irrigation water. Internalization of E. coli O157:H7 by growing leafy vegetable plants has also been suggested in other studies (Hora et al., 2005; Sharma et al., 2009; Deering et al.,

2012). On the other hand, more recent work suggested that internalization is rare and may be highly dose dependent (Erickson et al., 2010). Zhang et al. (2009) also concluded that E. coli

O157:H7 internalization did not occur on the plant leaves and roots of lettuce regardless of dose, bacterial strain, type or age of lettuce.

“Internalized” bacterial pathogens could also resist attempts at disinfection during fresh- cut processing (Solomon et al., 2002; Islam et al., 2004b). Internalization of E. coli O157:H7 at the cell junctions of the cut edges of lettuce tissues during processing has been documented

(Takeuchi and Frank, 2000). Penetration was greater at 4˚C than 7˚C, 22˚C and 37˚C over a 24 ±

1 h time period, presumably due to lower plant respiration (Takeuchi and Frank, 2000).

1.2.5 Agricultural practices in the Lower Mainland of British Columbia

There were approximately 20,000 farms and over 2.6 million hectares under cultivation in BC in 2012 (Anonymous, 2013). The more than 200 agricultural products (both crops and livestock) generated 2.8 billion Canadian dollars in farm cash receipt in 2012 (Anonymous,

2013). Mild climatic condition in BC makes it possible for the province to produce a wide variety of farm commodities. A total of 3,223 farms are currently located in the Lower Mainland

(Anonymous, 2013) where intensive farming activities and increasing urban development occur in close proximity. In addition, the area experiences high precipitation each year, a factor known to increase the risk of watershed contamination by microorganisms from human activity, livestock production, domestic animals and wildlife. Irrigation water quality is therefore a critical concern for BC agriculture which currently supplies more than half of the total produce consumed in the province (BCMAL, 2006).

The guidelines for irrigation water quality in BC state that 100 ml of irrigation water should contain less than 1,000 CFU of coliforms and less than 77 CFU of E. coli (Anonymous,

1988) and less than 200 CFU coliforms if used for crops eaten raw (Anonymous, 2003). Should 27

the counts in irrigation water exceed these recommended levels, producers are required to cease using irrigation water for a minimum of 14 days prior to harvest. It should be noted that elevated fecal coliform/E. coli levels have been detected in natural water sources located near agricultural systems in the Lower Mainland of BC in previous studies (Shead, 2004; Payette, 2006; Edge et al., 2012). This finding suggests the possible presence of pathogenic VTEC in irrigation water and a potential vehicle for the transmission of VTEC to fresh produce.

1.2.5.1 Coliforms and Escherichia coli as indicators of microbiological quality

Coliforms and E. coli have long been used as indicators of microbiological quality in food, water or environmental samples (Edge et al., 2012; Odonkor and Ampofo, 2013).

Coliforms are bile-tolerant, lactose fermenting Gram-negative bacilli commonly found in the intestines of mammals. Their presence signals the possibility of direct or indirect contact with fecal material and the potential risk of contamination with enteric human pathogens. Methods to enumerate total coliforms rely on the use of selective media that are incubated for 48h at 37°C.

Because some non-enteric bacteria capable of growth on selective media at 37°C can obscure the value of total coliform counts, fecal coliform counts are often used in their stead (Doyle and

Erickson, 2006). Fecal coliform counts are performed at 44°C, a temperature which discourages the growth of most non-enteric bacteria (Doyle and Erickson, 2006). As methods for the selective enumeration of E. coli became more reliable, standards based on E. coli counts gained prominence over total coliform and, in some cases, fecal coliform counts. E. coli is a true inhabitant of the intestinal tract that was once believed not to survive in extra-intestinal environments. However, there is increasing evidence that it can colonize some niches in the natural environment and the value of E. coli as an indicator of fecal contamination has also been 28

questioned (Odonkor and Ampofo, 2013). In the absence of alternatives, fecal coliform and E. coli counts are currently being used as indicators for fecal contamination as well as the risk of pathogen occurrence in water (Edge et al., 2012).

Past attempts to correlate fecal indicator counts with the presence of VTEC in water have led to contradictory outcomes. Positive correlation was observed between fecal indicators and potentially virulent E. coli O157 isolated from irrigation water by Gu et al. (2013) study. In contrast, a study focused on validation of E. coli guidelines in Canada showed that the current benchmark might not be sufficient for pathogens like VTEC since 80% of the water tested with low E. coli concentration of < 100 CFU/ml were positive for waterborne pathogens (Edge et al.,

2012).

1.2.6 Current method of detection for VTEC

1.2.6.1 O157 serogroup

Methods for the isolation and detection of E. coli O157:H7 in food are well developed in both the US (MLG 5.08 - USDA, 2014a) and Canada (MFLP-80 - Health Canada, 2008). The methods involve an enrichment step with modified tryptic soy broth with novobiocin. Isolation and detection was performed using immunomagnetic separation (IMS) on beads coated with

O157 specific antibodies or using different selective media such as Rainbow agar™ and supplemented SMAC agar with cefixime and tellurite (CT-SMAC). Irrespective of approach, confirmation is achieved using biochemical test by VITEK® 2 Compact microbial identification system for E. coli identification (BioMérieux, Saint-Laurent, Quebec, Canada; USDA, 2014a) and antigen-based latex agglutination assay or by the detection of vt genes by the Polymerase

Chain Reaction (PCR) (Health Canada, 2008; USDA, 2014a). 29

1.2.6.2 Non-O157 serogroups

There are currently no approved methods for the detection of non-O157 VTEC in

Canada. The US Food and Drug Administration (FDA) has developed and endorsed methods

(MLG 5B.05) that enable detection of “big six” non-O157 VTEC particularly in meat products.

The approach involves enrichment of samples using modified tryptic soy broth with novobiocin, followed by the use of multiplex Real-time PCR assays to detect the presence of vt and eaeA genes, culture and isolation using IMS beads coated with relevant antibodies and plating on modified Rainbow Agar™ (mRBA). If vt and/or eaeA genes are not detected samples are considered to be negative for non-O157 VTEC. Confirmation of presumptive non-O157 is done using specific antigen-based latex agglutination assay or serogroup specific multiplex PCR

(USDA, 2014b).

Several approaches have been followed in attempts to develop effective methods for the direct detection of non-O157 VTEC in food and environmental samples. Selective and differential media that exploit unique characteristics, such as carbohydrate sources and utilization, have been developed for the purpose (Mathusa et al., 2010). Different colour reactions are obtained with various serogroups of non-O157 grown on chromogenic agars such as Rainbow agar™ (Mathusa et al., 2010). Colony development is often deficient on these media however, and colours may vary in larger colonies (Mathusa et al., 2010). Cultural methods also do not provide information on VT production, which necessitates further analysis to confirm this critical characteristic.

Molecular methods that target vt1 and vt2 genes, among others, are increasingly used to screen clinical, food and environmental samples for the presence of VTEC. Detection of the 30

eaeA gene is also required for methods that target “big six” non-O157 VTEC. Because molecular methods do not provide phenotypic characteristics, they are used primarily to determine the need for isolation using cultural methods. They have also found use for confirmation and assignment of serogroup, using serogroup-specific PCR assay, for example. Molecular methods should provide fast turnaround time and the capacity for multiplex testing (Grant et al, 2011).

Immunological methods using antigens to non-O157 serotypes can enhance their isolation from complex sample matrices (Mathusa et al., 2010). Immunomagnetic separation with beads specific to O26, O103, O111, and O145 serogroups is widely used for this purpose

(Grant et al., 2011). The method is sensitive and allows the isolation of viable strains. However, antigens for all non-O157 serogroups are still not available. Immunoblotting using VT antibodies targeted to both VT 1 and VT 2 toxins allows the detection of all VTEC present in a sample

(Magi and Liberatori, 2005; Mathusa et al., 2010). A novel method involving recovery of VTEC on a Hydrophobic Grid Membrane Filter (HGMF) followed by immunoblotting to detect VT production and confirmation by Enzyme-linked Immunosorbent Assay (VT-ELISA) was recently developed for this purpose (Johnson et al., 2014). VT-ELISA was shown to be more sensitive than PCR for the detection of verotoxin in a study on VTEC prevalence in cattle

(Karama et al., 2008). However, positive reactions may occur due to the presence of Gram- negative bacteria such as Shigella ﬂexneri and Citrobacter braakii that are capable of producing

VT (Schmidt et al., 1993 and Paton and Paton, 1996). In addition, VTEC isolated using such methods are not differentiated and further analysis is required to assign pathotypes or other characteristics of interest.

1.2.7 Antimicrobial resistance

The use of antibiotics in human medicine and animal agriculture to prevent, control and treat diseases as well as to promote growth and feed efficiency has been common since the early

1950s (Anderson et al., 2003; Maal-Bared et al, 2013). Antibiotics can exert bactericidal (lethal) or bacteriostatic (growth preventing) effects by interfering with critical metabolic functions including cell wall biosynthesis, protein and folate synthesis and DNA replication and repair

(Walsh, 2000). Classes of antibiotics, such as β-lactams, aminoglycosides, tetracyclines, quinolones and sulfonamides target different metabolic functions (Table 1.2).

Intensive and occasionally inappropriate use of antibiotics has resulted in the emergence of antibiotic resistance (Table 1.2). Resistance may be due to the acquisition of efflux pumps, enzymes that degrade antibiotics or the ability to reprogram the bacterial target structure (Table

1.2). The development of resistance is rapid and is often acquired through mutation or gene transfer via plasmid exchange within a bacterial colony (Walsh, 2003; Finley et al., 2013).

The occurrence of antibiotic resistance in foodborne pathogens such as VTEC,

Campylobacter, Listeria and Salmonella is clearly increasing (Anderson et al., 2003). Evidence has shown that resistance can be transmitted to humans through the consumption of foods that have acquired resistant bacteria (Khachatourians, 1998; Ramchandani et al., 2005). Antibiotic resistant O157 and non-O157 VTEC have been isolated from livestock and Ramchandani et al.

(2005) reported that antimicrobial resistant strains of pathogenic VTEC isolated from cattle have caused human infections. However, antibiotic resistance has been reported to occur at lesser frequencies in clinical VTEC isolates. Meng et al. (1998) examined the prevalence of resistant E. coli O157:H7 and O157:NM and found that 34% of cattle, 20% of food isolates but only 10% clinical isolates were resistant to one or more antibiotics. On the other hand, about 44% of 32

clinical VTEC isolates (n=25) from BC were sensitive to at least one or more antibiotics, and resistance to neomycin, streptomycin and tetracycline were most common (Allen et al., 2013).

The high rate of prevalence in BC VTEC clinical isolates raises serious concerns given the small sample size examined by the investigators.

In Canada, more than 75% of antibiotics are used for veterinary purposes (CIPARS,

2011). Antibiotics are categorized according to their importance to human medicine with

Category I being most important and Category IV the least (Table 1.3; CIPARS, 2011). A report released by BC Ministry of Agriculture indicated that the total usage of antibiotics for livestock and poultry in BC increased by 11% from 2002 to 2012 due to an increase in Category III and IV antibiotics usage (Radke, 2014a). The most commonly used antibiotics in BC include penicillin

(Category II) and tetracycline (Category III), which are also of importance to human medicine

(Radke, 2014a). No Category I antibiotics are being used in veterinary medicine in BC (Radke,

2014a). The occurrence of antibiotic resistance in VTEC from BC livestock has not been documented. However, resistance to a number of antibiotics belonging to Category I, II, and III was reported in E. coli isolated (n=88) from beef during retail meat surveillance in the province in 2008 (CIPARS, 2011). High resistance was observed to tetracycline (22%), sulfisoxazole

(10%), streptomycin (10%) and ampicillin (6%). Isolates resistant to one or more antibiotics accounted for 28% of all isolates, while 3% were resistant to five or more antimicrobials, frequently including tetracycline (CIPARS, 2011). Resistance to tetracycline is often associated with resistance to other antibiotics (Kümmerer, 2004). Similar observation was also observed in the later survey in 2012 where resistance to tetracycline (34%), streptomycin (20%) and ampicillin (4%) was common (CIPARS, 2014b).

There have been few attempts to determine the extent of antibiotic resistance in VTEC recovered from natural environments in the Lower Mainland of BC. A limited study performed in the Elk Creek watershed (municipality of Chilliwack) led to the isolation of E. coli O157:H7 from water, sediment and biofilms with resistance to tetracyline (18/27), ampicillin (3/27), streptomycin (2/27) and nalidixic acid (2/27) (Maal-Bared et al., 2013). Isolates recovered from water were less resistant than isolates recovered from sediment and biofilms in which resistance to tetracycline and ampicillin was common (Maal-Bared et al., 2013). Wood et al. (2014) examined antibiotic resistance in generic E. coli (n=33) recovered from leafy vegetables grown in BC. Resistance to amikacin (58%), trimethoprim (48%), and trimethoprim-sulfamethoxazole

(45%) was common and 97% of isolates were resistant to one or more antibiotics. Resistance to nalixidic acid (36%), ampicillin (24%), and tetracycline (6%) was also observed (Wood et al.,

2014).

Antibiotic resistance profiles are known to vary in VTEC strains of different origin.

Between 20% - 80% of isolates from pigs, cattle and broilers examined in various studies showed resistance to one or more antibiotics (Meng et al., 1998; Mora et al., 2005; Gow and

Waldner, 2009; Cabal et al., 2013). Resistance to tetracyline, streptomycin and sulfonamide was common but varied depending on host species. Resistance to quinolones and β-lactams was frequently detected in avian strains (Mora et al., 2005; Cabal et al., 2013), while high sulfonamide and trimethoprim resistance was more common in VTEC isolated from swine

(Jakobsen et al., 2011). VTEC isolated from cattle are generally less resistant to many antibiotics, but resistance to gentamycin, kenamycin and chloramphenicol is often reported

(Meng et al., 1998; Mora et al., 2005; Gow and Waldner, 2009; Cabal et al., 2013). The antibiotic resistance profile of E. coli O157:H7 isolates was more complex than those of non- 34

O157 isolated from cattle, and the latter were particularly resistance to florfenicol and cephalosporins (Cabal et al., 2013).

Although antibiotics are not widely used to treat VTEC infection due to reports of HUS induction, some recent studies have shown otherwise. A cohort study was conducted for the administration of antibiotics to VTEC infected patients during the 2011 E. coli O104:H4 outbreak in Germany (Menne et al., 2012). A mixture of meropenem and ciprofloxacin was used in combination with rifaximin for intensive care patients. The results showed that antibiotic- treated patients had shorter symptoms, fewer seizures and lower mortality (Menne et al., 2012).

Other antibiotics, such as fosfomycin and azithromycin, also led to positive outcomes (Ikeda et al., 1999; Nitschke et al., 2012). This suggests that antibiotics may provide potential clinical benefits; therefore, it is important to assess the extent of antibiotic resistance of VTEC in anticipation of future attempts to improve antibiotic therapies for the treatment of severe infections.

1.3 Research purpose

There have been no systematic attempts to examine the prevalence of VTEC in BC food chains. The purpose of this study was to verify the occurrence and characteristics of VTEC in irrigation water and fresh produce across the Lower Mainland of BC. Results from this study may provide insight into high rates of VTEC infection in BC. In addition, the information would be beneficial for the development of strategies aimed at reducing the risk of infection due to agricultural practices in the production of fresh produce.

Several hypotheses will be tested in this study, including:

1. Surface waters used for irrigation and sediments in the Lower Mainland of BC are

reservoir for VTEC;

2. The prevalence rate of VTEC in fresh produce from across the Lower Mainland of

BC is high;

3. The occurrence of VTEC in surface waters used for irrigation is determined by

environmental factors;

4. Diverse VTEC serotypes with variable virulence gene and antibiotic resistance

profiles are present in natural environments in BC;

5. Fecal coliform/E. coli counts can be used as indicator for VTEC occurrence in surface

waters used for irrigation in BC.

To test these hypotheses, several objectives were included in this study:

1. To determine the prevalence of VTEC in surface waters used for irrigation and

associated tributaries, sediments and fresh produce grown in the Lower Mainland of

BC;

2. To evaluate the relationship between VTEC occurrence and environmental factors

including temperature, precipitation and fecal coliform/E. coli counts;

3. To assess any relationship in regards to VTEC prevalence in water, sediments as well

as locally grown produce;

4. To phenotypically and genotypically characterize isolated VTEC by serotyping,

virulence gene profiling and testing for antibiotic resistance.

Table 1.1 Produce-related VTEC outbreak in North America from 1995-2014. (The information in the table is based on two publications (Sewell and Farber, 2001 and Kozak et al., 2013), Public Health Agency of Canada website (http://www.phac-aspc.gc.ca/fs-sa/phn-asp/index-eng.php), US Centers for Disease Control and Prevention website (http://www.cdc.gov/ecoli/outbreaks.html) and Foodborne Illness Outbreak Database website (http://outbreakdatabase.com/). Number of Number of Hospitalization Other Year VTEC Vehicle Country States/Provinces Cases (Death) Information Involved 1995 O157:H7 Leaf lettuce US 1 92 13 (0) 1995 O157:H7 Iceberg lettuce Canada 1 23 Unknown (0) Hospital Mesclun 1996 O157:H7 US 5 61 21 (0) lettuce Fundraising 1998 O157:H7 Potato salad Canada 1 194 Unknown (0) event 1999 O157:H7 Iceberg lettuce US 1 72 8 (0) Restaurant Romaine Restaurant/ 1999 O157:H7 US 1 14 6 (0) lettuce Private home Romaine Retirement / 1999 O157:H7 US 2 45 7 (0) lettuce Private home Salad and/or 2002 O157:H7 Canada 1 17 Unknown (0) sandwich 2002 O157:H7 Lettuce US 2 78 Unknown (0) Camp Dole ready-to- 2005 O157:H7 US 2 32 12 (1) eat lettuce Wendy’s 2006 O121:H19 Lettuce US 1 73 3 (0) Restaurant 2006 O157:H7 Iceberg lettuce US 2 81 23 (0) Restaurant Taco Bell 2006 O157:H7 Lettuce US 4 78 55 (0) Restaurant 37

Table 1.1 continued Number of Number of Hospitalization Other Year VTEC Vehicle Country States/Province Cases (Death) Information Involved 199 2006 O157:H7 Fresh Spinach US 26/1 102 (3) Canada-1 Lettuce 2006 O157:H7 Canada 1 7 Unknown (0) (suspected) Mesclun 2007 O157:H7 US 1 8 5 (0) Restaurant lettuce 2007 O157:H7 Lettuce US 1 26 11 (1) Restaurant Spanish onion 2008 O157:H7 Canada 1 235 26 (0) Restaurant (suspected) 2008 O157:H7 Iceberg lettuce Canada 1 3 Unknown (0) Restaurant 2008 O157:H7 Bagged lettuce US 1 10 5 (0) 2008 O157:H7 Spinach US Unknown 13 0 (0) Prepackaged 2009 O157:H7 US 1 16 0 (0) lettuce 2009 O157:H7 Lettuce US 2 10 1 (0) Romaine 2009 O157:H7 US 3 29 3 (0) Restaurant Lettuce Shredded 2010 O145 Romaine US 5 33 12 (0) Lettuce Romaine 2011 O157:H7 US 9 58 33 (0) Salad bar Lettuce Raw Clover 2012 O26 US 11 29 7 (0) Restaurant Sprouts 38

Table 1.1 continued Number of Number of Hospitalization Other Year VTEC Vehicle Country States/Province Cases (Death) Information Involved Organic Spinach and 2012 O157:H7 US 5 33 13 0 Spring Mix Blend Romaine 2012 O157:H7 US, Canada N/A 28 14 (0) lettuce Organic 2012 O157:H7 spinach, spring US 3 33 10 (0) mix blend Ready to Eat 2013 O157:H7 US 4 33 7 (0) Salad KFC- 2013 O157:H7 Lettuce Canada 3 13 Unknown (0) Taco Bell Restaurant Raw Clover 2014 O121 US 6 19 8 (0) Sprouts 2014 Unknown Bean sprout Canada 1 20 Unknown (0) 2014 O157:H7 Unknown Canada 1 122 17 (0) Restaurant

Table 1.2 Target, mode of action and resistance mechanism of the main classes of antimicrobial drugs (Walsh, 2000). Antibiotic class Target Mode of action Resistance mechanism

β-Lactams Transpeptidases/ Blockade of crosslinking enzymes in β-Lactamases, transglycosylases peptidoglycan layer of cell walls Transpeptidases/transglycosylases mutants

Aminoglycosides Peptidyl transferase Blockage of protein synthesis Enzymatic modification of drug

Amphenicols Peptidyl transferase Blockage of protein synthesis Enzymatic modification of drug,

Tetracyclines Peptidyl transferase Blockage of protein synthesis Drug efflux

Sulfonamides Dihydropteroate Blockage of folate synthesis Dihydropteroate synthetase mutants synthetase

Fluoroquinolones DNA gyrase Blockage of DNA replication Gyrase mutation to drug resistance

Quinolones DNA gyrase Blockage of DNA replication Gyrase mutation to drug resistance

Table 1.3 Categorization of antimicrobial drugs based on importance in human medicine (CIPARS, 2011). Category of importance in human medicine Antimicrobial class

Carbapenems Cephalosporins - the 3rd and 4th generations Fluoroquinolones Glycopeptides Glycylcyclines Ketolides Lipopeptides I Very high importance Monobactams Nitroimidazoles (metronidazole) Oxazolidinones Penicillin-β-lactamase inhibitor combinations Polymyxins (colistin) Therapeutic agents for tuberculosis (e.g. ethambutol, isoniazid, pyrazinamide, and rifampin) Aminoglycosides (except topical agents) Cephalosporins - the first and second generations (including cephamycins) Fusidic acid II High importance Lincosamides Macrolides Penicillins Quinolones (except fluoroquinolones) Streptogramins Trimethoprim-sulfamethoxazole Aminocyclitols Aminoglycosides (topical agents) Bacitracins Fosfomycin III Medium importance Nitrofurans Phenicols Sulfonamides Tetracyclines Trimethoprim IV Low importance Flavophospholipols Ionophores

Chapter 2: Prevalence of verotoxigenic Escherichia coli in surface waters, sediments and fresh produce in the Lower Mainland of British Columbia

2.1 Introduction

Human pathogens are known to survive and be carried over long distances in surface waters. Contaminated water can therefore serve as a transmission vector for human pathogens if it is used to irrigate fruits and vegetables. Information about the prevalence and persistence of human pathogens in irrigation water is required to assess the risk of transfer to growing crops.

Current water quality standards based on fecal coliform/E. coli counts occasionally correlate poorly with the potential presence of pathogens in irrigation water sources, especially for low occurring pathogens such as verotoxigenic Escherichia coli (VTEC) (Edge et al., 2012; Gu et al., 2013). Studies carried out in natural watersheds using various methods for the detection of

VTEC suggest that prevalence varies, but up to 35% of samples analyzed in some watersheds were found to contain the pathogen (Cooley et al., 2013; Cooley et al., 2014; Johnson et al.,

2014).

In British Columbia (BC), rates of infection with VTEC have been higher than the

Canadian average since 2004 (BCCDC, 2013). VTEC are primarily transmitted to humans through contaminated food and water. Mixed agricultural activities are common in the Lower

Mainland of BC and could contribute to the high infection rates in the province. High fecal coliform/E. coli levels have been reported in surface waters located near agricultural systems in this region (Shead, 2004; Payette, 2006; Edge et al., 2012). Extended survival in sediments may contribute to the persistence of pathogens in surface waters (Pachepsky and Shelton, 2011;

Cooley et al., 2014). Information about the types of pathogens in surface waters used to irrigate crops in BC is scarce. Furthermore, there have been few attempts to determine if the pathogen is likely to be found on fresh produce grown in the province. Therefore, the prevalence of VTEC in surface waters used for irrigation, sediments and on fresh produce from the Lower Mainland of

BC were examined in this study. The relationship of environmental factors and fecal indicators with VTEC occurrence was also determined.

2.2 Materials and methods

2.2.1 Surface water sampling sites

A total of 61 sampling sites including 13 in the municipalities of Richmond, 22 in

Chilliwack/Abbotsford and 26 in Langley/Surrey were selected for an initial survey from

November 2012 to February 2013 to determine VTEC prevalence in surface waters in the Lower

Mainland of BC (Figure 2.1 – 2.3). Samples were collected from tributaries and irrigation ditches where pumping stations used to draw water for irrigation purposes were evident. Sampling sites in Langley and Surrey municipalities were also selected on the basis of a previous report on water quality (fecal coliform and E. coli counts) conducted between 2002 and 2004 (Payette,

2006). The purpose of the initial survey was also to identify watersheds and sampling locations for a longitudinal study of VTEC prevalence that was carried out between May and November

2013.

2.2.1.1 Water sample collection

Water samples were collected in sterile 250 ml wide-mouth high density polyethylene bottles (VWR, Edmonton, Alberta, Canada). The bottles were held in a small plastic bucket at 43

the end of a long sampling pole or in a metal bucket attached to a rope to allow sampling from the side or above the source, depending on access. Duplicate 250 ml water samples were collected from each sampling site once a month from May to November 2013. All water samples were kept in a cooler with ice packs during transport to the laboratory and were held at 4°C prior to and during analysis.

2.2.1.2 Sediment sample collection

Sediment was collected in the Sumas River at Site #10. Up to 4 sediment samples were collected at each sampling date from different sides of the river using either the sampling pole or the metal bucket. The pole was used when sampling was possible from the river bank. The river bottom was scraped with the bucket and the sediment was transferred to a sterile 250 ml wide- mouth high density polyethylene bottle (VWR). Where access to the bank was not possible the sediment samples were collected from bridges. The metal bucket was thrown as far as possible and pulled forward to collect sediment. The materials were then transferred from the bucket to a sterile 250 ml wide-mouth high density polyethylene bottle (VWR). The sampling vessels were disinfected with a 70% ethanol solution between samples. All sediment samples were kept in a cooler with ice packs during transport and at 4°C during processing.

2.2.1.3 Weather data

Mean temperature and precipitation accumulation data (on the day of sampling (T, P) and three days before sampling (Tb, Pb)) for the nearest Environment Canada weather station (within

15 km from the sampling sites) were retrieved from Historical Climate Data records stored at: http://climate.weather.gc.ca/. The weather station chosen for the Fraser River watershed was 44

Richmond Nature Park (49°10'15.000" N, 123°05'35.000" W). For the Sumas River watershed, the weather data was taken from Sumas Canal (49°06'48.008" N, 122°06'35.004" W) and, when the data was missing, the weather data from Mission West Abbey (49°09'09.002" N,

122°16'14.001" W) was used. The weather data for both Nicomekl and Serpentine River watersheds was taken from White Rock Campbell Scientific (49°01'05.000" N, 122°47'02.000"

W) since both watersheds were located in close proximity.

2.2.2 Detection and isolation of VTEC in water and sediment samples

Water and sediment samples were processed within 24h of collection. Methods developed by Johnson et al. (2014) were used for the detection and isolation of VTEC. Briefly, the samples were filtered by Hydrophobic Grid Membrane Filtration (HGMF) and the filters were incubated on an Immunoblot membrane (VT-IB) to detect presumptive verotoxin (VT)- producing colonies. An Enzyme-linked Immunosorbent Assay (VT ELISA) was then performed to confirm VT production. An E. coli O163:NM strain producing both VT 1 and VT 2 was used as positive control while E. coli ATCC 25922 was used as negative control. The control strains were provided by Dr. Roger Johnson (Public Health Agency of Canada, Guelph, Ontario,

Canada).

2.2.2.1 Hydrophobic grid membrane filter immunoblot

All samples were stirred and allowed to settle for 5 min before processing. The supernatants (between 10 and 100 ml, depending on filter performance) were then passed through 0.45 µm HGMF filters (Neogen, Lansing, Michigan, US). The filters were incubated at

37°C for 18 - 24 h on VT-capture membranes applied to the surface of agar plates containing 45

modified tryptic soy agar (Oxoid, Napean, Ontario, Canada) amended with 1.5 g/l bile salts No.

3, 10 µg/ml vancomycin and 10 µg/ml cefsulodin (Sigma, Oakville, Ontario, Canada) (mTSA-

VC) to discourage the growth of non E. coli species (Gill et al., 2012). VT-capture membranes consisted of 0.2 µm pore size nitrocellulose (Biotrace, Pall Life Sciences, Mississauga, Ontario,

Canada) pre-coated with rabbit anti-VT antibodies reactive to all known VTs (LFZ Guelph) and blocked with Phosphate Buffer Saline (PBS) - 1% gelatin (Invitrogen, Burlington, Ontario,

Canada; BioRad, Mississauga, Ontario, Canada). After incubation, the paired HGMF and VT- capture membranes on each plate were marked by needle puncture for later re-orientation. The

VT-capture membranes were removed and probed at room temperature with a mixture of four monoclonal antibodies (LFZ Guelph) (see section 2.2.2.2), followed by alkaline phosphatase- labeled rabbit anti-mouse IgG (Jackson Immunoresearch, Cedarlane Laboratories, Burlington,

Ontario, Canada) and the substrate nitroblue tetrazolium and 5-bromo-4-choloro-3-indolyl- phosphate (Sigma). Clearly stained dark purple areas on the VT-capture membrane denoted the presence of VT. Small, faintly colored dots were occasionally observed, notably when colony growth on the HGMFs was very dense. Up to eight individual colonies on the HGMF filter corresponding to the location of the dots on the VT-capture membrane were retained for further analysis. Each colony was applied to the surface of MacConkey (MAC) agar (Oxoid) or eosin methylene blue (EMB) agar (Oxoid) and the plates were incubated at 37°C for 18 - 24 h. Six presumptive individual colonies from these plates (pink, reddish pink colonies on MAC or dark blue-black colonies with metallic green sheen on EMB) were grown in 500 µl of modified tryptic soy broth (Oxoid) containing 1.0 g/l bile salts No. 3, 10 µg/ml vancomycin and 10 µg/ml cefsulodin (Sigma) (mTSB-VC) on 96-well megablock (Fisher) at 37°C for 18 - 24 h and the resulting broths were tested by VT ELISA to confirm VT production. 46

2.2.2.2 Enzyme-linked immunosorbent assay

Duplicate 100 µl volumes of the mTSB-VC broth were transferred to 96-microwell plates

(Fisher) pre-coated with rabbit anti-VT antibodies (LFZ Guelph) reactive with all known VTs for

30 min at room temperature. To detect bound VTs the microwell plates were sequentially incubated for 30 min at room temperature with 100 µl of a mixture of four monoclonal antibodies (LFZ Guelph) recognizing all VTs, followed by horseradish-peroxidase-labeled rabbit anti-mouse IgG (Jackson Immunoresearch, Cedarlane Laboratories). The wells were washed five times with 300 µl PBS-T after each incubation step, 100 µl of substrate tetramethylbenzidine

(Sigma) was added for color development and the plates were incubated with slow agitation for

10 min. The reaction was stopped by addition of 100 µl of 0.2 M sulfuric acid (Sigma) to each well and the mixture was slowly agitated for 10 min. Absorbance was measured immediately with a microplate reader (SpectraMax M2 Microplate Reader, MTX Lab Systems, Inc., US) at a dual wavelength of 450/620 nm; the blank was air. Samples were scored as suspicious or positive for VT when the mean optical densities (OD) were > 1.25-1.5x or < 1.5x the mean OD of the negative controls.

2.2.3 Fecal coliform/Escherichia coli counts for water samples

Fecal coliform/E. coli counts were obtained on 3M Coliform/E. coli Petrifilm™. One ml of undiluted water sample was applied to the films which were incubated at 42°C for 18 - 24 h.

Fecal coliform counts were obtained by counting all red colonies with evidence of gas formation;

E. coli counts were obtained by counting blue colonies with evidence of gas formation.

2.2.4 Produce sample collection

Produce samples were collected twice a month between June 2013 and September 2013.

Samples were purchased from farmers markets in the Lower Mainland of BC including Trout

Lake Farmers Market, Kitsilano Farmers Market, Main Street Station at Thornton Park,

Kerrisdale Village Farmers Market, Chilliwack Farmer’s Market, Surrey Urban Farmer’s

Market, and Steveston Farmer’s and Artisan Market. One or two markets were visited on each sampling day and products were selected from vendors located in Richmond, Surrey/Langley and Abbotsford/Chilliwack municipalities. Leafy vegetable (green/red lettuce, green/red romaine, green/red butter, spinach, kale, bok choy and farmer’s blend) and field berry

(strawberry, blueberry and raspberry) samples were obtained at each visit. All samples were placed in a plastic bag provided by the vendor and kept in a cooler with ice packs during transport and at 4°C before processing. The provenance of each sample (farm address) was recorded.

2.2.5 Detection and isolation of VTEC from produce samples

All produce was processed within 24 h of collection. Samples (200 – 225 g) were weighed in a sterile Stomacher bag (Fisher, Edmonton, Alberta, Canada) and an equivalent weight of mTSB with bile salts (1.5 g/l) (Oxoid; Sigma) was added. For leafy vegetable samples the bags were agitated at 100 rpm on a rotary shaker for 30 min and shaken by hand 25 times in a

20-cm arc. For berry samples the bags were not shaken but were placed on a rotary shaker for 45 min. The rinses were then filtered through the HGMF in volumes varying between 10 - 100 ml and were analyzed using the VT-IB method. Rinse volumes varied between samples due to differences in the performance of the filter. The remaining contents of the bag were enriched for 48

VTEC by incubation at 42°C for 4 h, followed by addition of vancomycin (10 µg/ml) and cefsulodin (3 µg/ml) (Sigma) and further incubation for 14 - 20 h at 42°C. Ten µl of the enrichment fluids were then spread onto MAC-VC agar plates (vancomycin: 10 µg/ml and cefsulodin: 3 µg/ml) (Oxoid; Sigma) in duplicate. The plates were incubated at 37°C for 18 - 24 h. Three to four presumptive pink, reddish pink colonies were picked from each plate using sterile toothpicks and were inoculated into 500 µl of mTSB-VC broth in separate wells in a 96- well megablock (Fisher). The megablock was incubated at 37°C for 18 - 24 h and VT ELISA was performed on duplicate samples from each well.

2.2.6 Confirmation of Escherichia coli

Presumptive VTEC isolates were confirmed using a monoplex-PCR assay targeting the gadA gene according to methods described in Doumith et al. (2012) in DNA lysates extracted using a boiling method. Individual test cultures were grown at 37°C overnight in 2.5 ml TSB

(Oxoid). An aliquot (360 µl) of the culture was transferred to a 1.5 ml microcentrifuge tube

(Invitrogen) with 40 µl 10X pH 7.2 PBS (Invitrogen). The mixture was boiled at 96°C under constant agitation at 600 rpm for 10 minutes. After boiling, the microcentrifuge tube was placed on ice for 10 minutes and was then spun in a centrifuge (Microcentrifuge 5415 R, Eppendorf,

Mississauga, Ontario, Canada) at 13,200 rpm for 5 min. The supernatant containing DNA lysate was decanted into a new microcentrifuge tube and stored at -20°C until analyzed.

PCR was performed with 1 μl DNA lysate amplified with TopTaq DNA Polymerase

(Qiagen, Toronto, Ontario, Canada) in 25 μl reaction mixtures containing 1X Buffer Solution,

1X Coral Dye, 50 μM dNTP’s (Invitrogen), 0.625 U/rxn TopTaq DNA Polymerase, 5 μl Q- solution and 1 μM of the primers: 49

gadA-F 5’-GATGAAATGGCGTTGGCAAG-3’;

gadA-R 5’-GGCGGAAGTCCCAGACGATATCC-3’.

The PCR reaction was carried out under the following conditions in a thermal cycler (C1000

Touch™ Thermal Cycler, BioRad, Canada): 94°C for 4 min, followed by 30 cycles consisting of

94°C for 30 sec, 65°C for 30 sec and 72°C for 30 sec, with a final extension step at 72°C for 5 min. PCR products were held at 4°C until they could be visualized in SYBR® Safe (Invitrogen) stained 2% agarose gels following electrophoresis using 1X TAE buffer (BioRad) at 80V for 45 min. The expected amplicon size for gadA was 373 bp. E. coli O157:H7 donated by Linda

Hoang (BC Centre for Disease Control, Vancouver, British Columbia, Canada) was used as positive control for gadA while water was used as negative control.

2.2.7 Detection of virulence genes in presumptive VTEC by PCR

The presence of genes associated with virulence in VTEC (eaeA, hlyA, vt1, and vt2) was verified by multiplex PCR according to methods described by Paton and Paton (1998). Template

DNA was prepared by the boiling extraction method described in section 2.2.6. DNA lysate (1

μl) from each isolate was amplified with TopTaq DNA Polymerase (Qiagen) in 25 μl reaction mixtures containing 1X Buffer Solution, 1X Coral Dye, 50 μM dNTP’s (Invitrogen), 0.625

U/rxn TopTaq DNA Polymerase, 5 μl Q-solution, 1 μM of primers:

eaeA-F 5’- GACCCGGCACAAGCATAAGC-3’;

eaeA-R 5’- CCACCTGCAGCAACAAGAGG-3’;

hlyA-F 5’- GCATCATCAAGCGTACGTTCC-3’;

hlyA-R 5’- AATGAGCCAAGCTGGTTAAGCT -3’;

and 0.4 µM of primers:

vt1-F 5’- ATAAATCGCCATTCGTTGACTAC-3’;

vt1-R 5’- AGAACGCCCACTGAGATCATC-3’;

vt2-F 5’- GGCACTGTCTGAAACTGCTCC-3’;

vt2-R 5’- TCGCCAGTTATCTGACATTCTG-3’.

The PCR reaction was carried out under the following conditions in a thermal cycler (C1000

Touch™ Thermal Cycler, BioRad, Canada): 95°C for 3 min, followed by 35 cycles each consisting of a denaturation step at 95°C for 1 min; an annealing step at 65°C for 2 min for the first 10 cycles, decrementing 1°C per cycle to 60°C by cycle 15; and an elongation step at 72°C for 1.5 min, incrementing to 2.5 min from cycles 25 to 35; with a final extension step at 72°C for

5 min. PCR products were held at 4°C until they could be visualized in SYBR® Safe

(Invitrogen) stained 2% agarose gels following electrophoresis using 1X TAE buffer (BioRad) at

80V for 45 min. Expected amplicon size for vt1, vt2, eaeA and hlyA was 180 bp, 255 bp, 384 bp and 534 bp respectively. E. coli O157:H7 possessing all vt1, vt2, eaeA and hlyA was used as positive control while water was used as negative control. The positive control, E. coli O157:H7, was a donation from Linda Hoang (BC Centre for Disease Control, Vancouver, British

Columbia, Canada).

2.2.8 Statistical analysis

VTEC prevalence for each region, season and type of sample (water, sediment and fresh produce) was calculated from the number of positive samples divided by the total number of samples. The Chi square (χ2) test was applied to compare prevalence between seasons as the data was categorical. VTEC prevalence in water and sediment were analyzed using Fisher’s exact test 51

due to small expected values for the sediment samples. The correlation between environmental factors, such as temperature, precipitation accumulation, fecal coliforms and E. coli, and presence of VTEC in the water was analyzed using a point biserial correlation. This approach was selected because the variables were dichotomous for the presence and absence of VTEC and continuous for the environmental factors (Gu et al., 2013). All analyses were performed with the

R software package (R Core Development Team, Vienna, Austria). The P - value was 0.05 unless otherwise specified.

Regression trees were constructed using the Random Effect – Estimation Methods (RE-

EM) with the REEMtree software package (version 0.90.3) in R (R Core Development Team,

Vienna, Austria) to examine the influence of weather data on VTEC prevalence. The regression tree was chosen as the data was longitudinal, where results from repeated sampling from the same sampling sites were not independent (Jones et al., 2014). In the analysis, sampling sites were the random variable while VTEC occurrence and environmental factors were the dependent and independent variables, respectively. The environment factors included in this analysis were mean temperature and accumulated precipitation (T, Tb, P, Pb). Each regression tree was run with a 10-fold cross validation.

2.3 Results

2.3.1 Selection of sampling sites

Surface water samples were collected in the municipalities of Abbotsford, Chilliwack,

Langley, Richmond and Surrey during an initial survey carried out during the winter of 2012-3.

Figures 2.1 - 2.3 show the locations of the sampling sites and available land use maps for the production of field crops and livestock in each region. The land use map for the municipalities of 52

Abbotsford and Chilliwack was prepared from data collected in 2003 and 2004, respectively.

However, agricultural production of field crops and livestock remains intensive in both regions.

Land use maps for the municipalities of Richmond and Surrey were prepared from comparatively more recent data collected in 2010. Agricultural activity in the municipality of

Langley is presently confined to an area near Orchard Creek, hence no land use map is shown.

The number of sites visited and water samples collected were variable and reflected differences in the intensity of crop production in each region (Table 2.1).

The prevalence of VTEC in water samples collected during the initial survey is shown in

Table 2.1. VTEC were recovered from water samples collected in 11 sites in the municipalities of Abbotsford and Surrey. Sites yielding positive samples were located in three defined watersheds, specifically the Sumas, Nicomekl and Serpentine River watersheds. No VTEC were recovered from the water samples collected in the municipalities of Richmond, Chilliwack or

Langley during the winter season. There is presently no information on geographic or seasonal variation in the prevalence of human pathogens in surface waters in the Lower Mainland of BC.

It was therefore considered prudent to continue sampling in one of these regions, and the watershed located in the municipality of Richmond was chosen for this purpose. Although not currently recognized as a separate watershed within the Lower Mainland, it will be referred to as the Lower Fraser watershed here and elsewhere in this work.

Results of the preliminary survey and proximity to livestock and field crop production according to the land use maps given in Figures 2.1b, 2.1c, 2.2b, 2.2c, 2.3b and 2.3c were considered in the selection of twenty sites to examine the longitudinal prevalence of VTEC in the region. These included five sites in the Lower Fraser watershed within the municipality of

Richmond (catchment and irrigation ditches); five in the Sumas River watershed in the 53

municipality of Abbotsford (irrigation ditches and surface streams); and five each in the

Nicomekl and Serpentine River watersheds in the municipality of Surrey (irrigation ditches and surface streams).

2.3.1.1 Prevalence of VTEC in surface water samples

The overall prevalence of VTEC in surface water samples collected between November

2012 and November 2013 in the Lower Mainland of BC, including samples from the preliminary survey, was 15.9% (63/396). VTEC were isolated from 63 of 330 water samples collected in the

20 sampling sites selected for the longitudinal study over a one year period, for a prevalence rate of 19.1% (Table 2.2). The lowest prevalence rate (9.2%, n=65) was in the Lower Fraser watershed. An examination of land use maps in Figures 2.1c, 2.2b and 2.3c reveals there is comparatively little livestock production in this region. A total of 528 VTEC isolates were recovered in numbers ranging between 1 and 86 in individual samples (Table 2.3).

The prevalence of VTEC in each sampling site on different sampling dates is shown in

Table 2.3. No VTEC were recovered from samples collected from site #1 and #2 in the Lower

Fraser watershed (Table 2.3). Site #1 is located near a medium scale livestock operation (Figure

2.1c), while site #2 was located next to a berry farm (Figure 2.1b). In both cases samples were drawn from irrigation ditches where flow is limited and the water was very turbid. VTEC were occasionally recovered from sites #3, #4 and #5 in the Lower Fraser watershed (Table 2.3), all of which are located in proximity to, or downstream from small, medium and large scale livestock farms (Figure 2.1c). In contrast, VTEC were frequently recovered from all sampling sites (#6 -

#10) in the Sumas River watershed (Table 2.3). Livestock production is intensive in this area

(Figure 2.2b) and cattle have direct access to the water body in site #7. Water flow was typically much higher than in sampling sites in the Lower Fraser watershed.

VTEC prevalence was also low in water samples from irrigation ditches in sites #11 and

#13 in the Nicomekl River watershed, which are not located in areas of intensive livestock production (Table 2.3; Figure 2.3c). Water from these sites was typically turbid or foamy and is clearly used to irrigate vegetable and berry crops (Figure 2.3b). VTEC were frequently recovered from the other sampling sites in the Nicomekl River watershed, particularly site #12 (Erickson

Creek) where the rate of recovery was high (Table 2.3). The sampling site was located downstream from a large livestock operation (Figure 2.3c) and had strong flow. No VTEC were recovered from samples collected in site #15 in the Nicomekl River watershed (Table 2.3; Figure

2.3c) which is located upstream of a livestock farm; this contrasted with recovery of VTEC in nearly one half of the water samples from site #14 which was located downstream from the farm along a ditch with heavy flow (Table 2.3).

Only one water sample collected in Site #16 in the Serpentine River watershed (Latimer

Creek) contained VTEC (Table 2.3). Unlike Erickson Creek, Latimer Creek has limited flow and there is little livestock production in the area (Figure 2.3c). Water from the irrigation ditch at site

#17 in the Serpentine River watershed was typically foamy and malodorous. VTEC were recovered from one half of the water samples collected at this site (Table 2.3) which is located near several large scale livestock operations (Figure 2.3b; 2.3c). VTEC prevalence in site #18 was lower than in sites #19 and #20 which were both located downstream from large livestock farms (Figure 2.3c).

2.3.1.2 Effect of climatic factors on VTEC prevalence in surface water samples

Overall, significant differences in the seasonal prevalence of VTEC were observed, ranging from 34.2% to 15.7% and 13.3%, in winter, spring/summer and fall months, respectively

(χ2 = 14.84, df = 2, P < 0.001, Figure 2.4). This corresponded to the months of November 2012 to February 2013 (winter), May 2013 to August 2013 (spring/summer), and September 2013 to

November 2013 (fall).

The mean temperature (T) and total precipitation (P) on sampling day and three days before sampling (Tb, Pb) in each watershed are shown in Figures 2.5 - 2.8. In the winter months,

T, Tb, P and Pb ranged between 2.4°C – 8.8°C, -1.3°C – 7.4°C, 0.2 – 17.4 mm, 2.4 – 45.8 mm, respectively, in all watersheds. Mean temperatures and total precipitation during the winter season were generally lower in the Sumas River watershed than in the Nicomekl River and

Serpentine River watersheds. Interestingly, VTEC was recovered for all sampling collection during the winter months in all watersheds except for February 16 and 22, 2013 samplings in

Nicomekl River watershed. The recovery rate was between 20 – 60% of the water samples collected.

During the spring/summer season mean temperatures were slightly higher in the Sumas

River watershed (Figures 2.5-2.8), but T and Tb of all watersheds ranged between 12.9°C –

20.8°C and 11.5°C – 22.3°C, respectively. Total precipitation during this season was low, ranging between 0 – 2.4 mm, except on May 25, 2013 where Tb was as high as 10.6 mm. Six

VTEC positive water samples (28.6%, n=21) were recovered on this date in the Lower Fraser basin and Nicomekl River watersheds.

In the fall, T, Tb, P and Pb ranged between 0.8°C – 14°C, 2.3°C – 16.2°C, 0 – 23.4 mm, 0

– 81.4 mm, respectively, in all watersheds (Figures 2.5-2.8). In general, higher mean temperature 56

and total precipitation was observed during the fall months in the Sumas watershed. No VTEC were recovered from samples collected when Pb was between 0 – 0.4 mm before sampling.

Correlation analysis was performed to examine the relationship between climate and

VTEC prevalence in the surface water samples. T and Tb were negatively correlated (P<0.05) with VTEC prevalence in all sampling regions except the Nicomekl River watershed (Table 2.4).

P was not correlated with prevalence, but Pb was positively correlated (P<0.05) with VTEC prevalence in all watersheds.

Regression trees were also computed to further characterize the influence of climate on

VTEC prevalence in the 20 sites that were sampled repeatedly. The overall tree for all sampling sites resulted in a root node only, where no splitting was observed for each variable. A root node only result was observed for the Lower Fraser and Nicomekl River watersheds. This indicated that T, Tb, P, and Pb had no strong predictive power for VTEC prevalence in these areas. In the

Sumas River watershed, on the other hand, a single tree node was observed with T of ≥ 6.15°C as the split with 80% of water samples collected in the area was predicted to be positive if sampled when T < 6.15°C, while only 21% of samples would be positive if T ≥ 6.15°C (Figure

2.9). Similarly, a single tree node was obtained for VTEC positive samples in the Serpentine

River watershed with Pb as the predictive variable. Fifty-three percent of water samples collected on sampling days where Pb > 2.5 mm were predicted to be positive while only five percent of sample with Pb < 2.5 mm were positive (Figure 2.10).

2.3.1.3 Coliform/Escherichia coli counts in surface water samples

Fecal coliform counts ranging from 1 - >300 cfu/ml were measured in 78.7% and E. coli counts ranging from 1 - 89 cfu/ml in 72.0% of the samples analyzed (n=329). Counts exceeded 57

provincial irrigation water guidelines for crops that are eaten raw based on fecal coliforms (≥

200 cfu/100 ml) in 66.3% of the samples, and on E. coli (≥ 77 cfu/100 ml) in 72.0% of the samples. A comparison with VTEC prevalence by point biserial correlation showed that fecal coliforms (rpb = -0.009, P = 0.877) and E. coli (rpb = -0.036, P = 0.510) counts measured with

Petrifilm™ were not correlated with prevalence (Table 2.3). In addition, VTEC were recovered from 21.7% of water samples in which no E. coli were detected on Petrifilm™.

2.3.2 Prevalence of VTEC in sediment samples

Twenty one sediment samples were collected from site #10 located in the Sumas River watershed at six different times. Differences were noted in the appearance of samples collected from four separate locations in the river. Sediments collected from the middle of the river were typically sandy while those collected near the shore contained clay and decaying plant material.

Seventeen VTEC isolates were recovered from five samples (23.8% prevalence) collected on three different dates (Table 2.5). VTEC were not detected in water samples collected from the same sites on most sampling occasions except on November 16, 2013. Analysis using the Fisher exact test revealed a low probability (P = 0.573) of simultaneous VTEC detection in water and sediment.

2.3.3 Prevalence of VTEC in produce samples

A total of 105 produce samples were obtained from seven farmer’s market between June

2013 and September, 2013. This included 79 leafy vegetable (green/red lettuce, green/red romaine, green/red iceberg, green/red butter, spinach, kale and farmer’s blend) and 26 field berry

(strawberry, blueberry and raspberry) samples. VTEC were not recovered from the samples 58

(Table 2.6). Despite care to avoid damage during analysis, tissue disruption during sample processing was considerable, particularly with berries. Coloured materials extracted during the rinsing step were often retained by the HGMF membrane and interfered with filtration. The maximum volume of rinsing solution filtered was approximately 35 ml but considerably lesser amounts passed through the membranes in samples where processing damaged the sample tissues.

2.4 Discussion

The present is one of the first reports on the prevalence of VTEC in surface waters, sediments and fresh produce in the Lower Mainland of BC. A novel, efficient Hydrophobic Grid

Membrane Filter – Immunoblot (VT-IB) detection and isolation method (Johnson et al., 2014) was used for this purpose. Immunoblot methods have generally proven more reliable than molecular methods for the detection of VTEC (Karama et al., 2008). However, previous methods based on this approach have tended to rely on broth enrichment followed by immunoblotting.

The enrichment step can reduce efficiency of recovery from water samples due to the presence of predators or competitive microorganisms that inhibit the growth of VTEC (Johnson et al., 2014).

The direct plating approach prevents enrichment of potential competitors but does not completely prevent the co-isolation of bacterial species from other genera, such as Enterobacter,

Citrobacter and Shigella, that may also produce VTs. In the present work, presumptive VT producing colonies recovered on the HGMF filters were frequently found in mixed culture with such bacteria. A second round of culture was often required to obtain presumptive isolates in pure culture for confirmation of VT production by ELISA. It was also necessary to perform a

PCR to confirm the isolates were E. coli to reduce further testing of non-VTEC isolates. Hence, 59

the VT-IB method can be laborious and turnaround times may be long. In addition, false negative results often occur when dense growth is seen on the HGMFs where immunostained dots are often smaller and fewer (Johnson et al., 2014). However, the qualitative method was used to successfully recover a wide array of VTEC isolates from water and sediment samples collected in the Lower Mainland of BC.

2.4.1 VTEC prevalence in surface water samples

A preliminary survey conducted during the winter of 2012 suggested that surface waters in the Lower Mainland of BC are frequently contaminated with VTEC. Longitudinal sampling of surface waters in the Lower Fraser, Sumas, Nicomekl and Serpentine River watersheds revealed the presence of VTEC in 19.1% of water samples collected from different sources over the course of one calendar year. There is presently little data on the prevalence of these pathogens in

BC surface waters. The only relevant data at the time of writing was derived from studies carried out in the Elk Creek, and Sumas and Salmon rivers which indicated that E. coli O157:H7 occurred in 0% to 6.7% of water samples collected in each respective site (Jokinen et al., 2010;

Edge et al., 2012). However, the methods used in these studies detected only one VTEC serotype. Results reported here were derived from analysis using a method designed for maximum recovery of VTEC from all serotypes, including O157:H7. A recent report from

FoodNet Canada (2013) revealed that VTEC prevalence was comparatively higher (31%) than that reported in this study in surface waters from five irrigation ditches in the Sumas watershed collected from May to December 2013 (Anonymous, 2014). Methods used for VTEC isolation and exact sampling locations were not provided in the report. Nonetheless, findings from the latter study and the present research strongly suggest that surface waters in watersheds located in 60

the Lower Mainland of BC are subject to persistent sources of contamination. The recovery of multiple isolates from individual water samples was indicative of high levels of contamination in some sites.

VTEC prevalence was higher in the Sumas, Nicomekl and Serpentine River watersheds than in the Lower Fraser. All three are located in areas with considerable agricultural activity.

Each of these watersheds has unique hydrogeology and includes flowing natural water courses

(rivers, creeks), drainage ditches, canals and dedicated irrigation ditches. VTEC were frequently recovered from smaller streams in these watersheds (site #12, for example), a result consistent with other studies where higher E. coli concentrations were reported in streams (Lyautey et al.,

2010; Edge et al., 2012). There is comparatively much less agricultural activity in the Lower

Fraser watershed located in the municipality of Richmond, due to on-going displacement by urban and industrial development. The comparatively low density of livestock in the watershed may therefore have contributed to lower VTEC prevalence. Further, the municipality of

Richmond is located in a floodplain with no distinguishable natural water courses. An extensive system of dykes and drainage ditches serve to control water levels in low lying areas at, or very near to, sea level. Unless the ditches are under active use, flow is limited and waters may stagnate. E. coli populations have been reported to decline at faster rates in stagnant waters due to the presence of predator microorganisms and changes in the chemical composition of water.

For example, high nitrogen and oxygen concentration were shown to negatively affect the survival of VTEC by Gu et al. (2012).

No attempt was made to track the source(s) of VTEC recovered from the water samples and their origin must remain a matter of speculation. However, the watersheds examined in this study are potentially affected by a range of agricultural activities, including the production of 61

livestock. Dairy and poultry operations can serve as reservoirs for VTEC that may contaminate the agricultural environment, including surface waters (Van Donkersgoed et al., 1999; Arthur et al., 2002; Garcia and Fox, 2003; Gill and Gill, 2010; Mathusa et al., 2010; Grant et al., 2011;

Cooley et al., 2013; 2014). A study by Wilkes et al. (2009), showed that E. coli O157:H7 could be detected in 93% of water samples collected 5 km downstream from pasturing livestock.

Hence, proximity to sites with high densities of livestock may contribute to the prevalence of

VTEC in these watersheds. It should be noted that livestock intrusion was occasionally observed in sampling sites where VTEC occurrence was common. In addition, wildlife and birds are common in some of these watersheds and may contribute to the contamination of surface waters.

2.4.1.1 Influence of climatic factors on VTEC prevalence in surface water

The Lower Mainland of BC is located in the Pacific Maritime ecozone. Precipitation in the region is highest (306 - 338 mm/month) in November/December and lowest (72 - 78 mm/month) in July/August (The Weather Network, 2014). Higher VTEC prevalence rates measured during the winter months (and following a particularly heavy rainfall prior to the May

25th, 2013 sampling) indicate that climatic events likely influence the microbiology of surface waters in the region. Positive correlation between the detection of human pathogens in surface waters and precipitation events have been reported previously (Cooley et al., 2007; Jokinen et al., 2010; Edge et al., 2011; Gu et al., 2013; Cooley et al., 2013). Precipitation plays an important role in the transport of fecal contaminants from livestock, wildlife and human sources from sites on land to surface waters. Carriage by wind or in runoff from fields fertilized with animal manures is a notable concern (Arthur et al., 2010; Gill and Gill, 2010; Grant et al., 2011;

Edge et al., 2011). Interestingly, it has been reported that in the Province of BC approximately 62

two thirds of annual manure applications are applied in the fall and spring, and the remainder during the fall and summer (Beaulieu, 2004). Hence, the highest VTEC prevalence rates measured in this work occurred during months associated with high precipitation and increased manure application.

There was no significant correlation between VTEC prevalence and ambient temperatures in most of the watersheds examined in this work with the exception of the Sumas

River watershed, where the rate of detection was higher when mean temperatures were ≤

6.15°C. Low temperatures have been reported to enhance the survival of enteric bacterial pathogens in the environment (Rice et al., 1992; Geidrich et al., 1992; Wang and Doyle, 1998;

Czajkowska et al., 2005; Watterworth et al., 2006). For example, Edge et al. (2011) recovered more enteric bacterial pathogens from surface waters at temperatures less than 14°C when precipitation was low (82% of samples), than from water at higher temperature when precipitation was high (15%). However, the latter suggests that climatic factors act concurrently to influence bacterial survival in a specific watershed.

2.4.1.2 Fecal coliforms/Escherichia coli in surface water samples

Fecal coliform and E. coli counts are commonly used in food and water sanitation to assess the risk of contamination with fecal material and, by inference, with human pathogens.

Using an approved method of analysis employing Petrifilm™, high levels of fecal coliforms and

E. coli were often detected in large numbers in the water samples collected in this study. This further confirms the possible fecal contamination to the water bodies in all watersheds. However, the counts did not correlate with the presence of VTEC. This result was in contradiction with the report by Gu et al. (2010), wherein correlation was found between fecal coliform counts and the 63

presence of E. coli O157:H7. The methods used by these authors were designed to detect only E. coli O157:H7, unlike procedures used in the present work that bypass potentially problematic enrichment procedures for the detection of all VTEC serotypes. In addition, the VT-IB method includes a filtration step to process sample volumes ranging from 10 - 100 ml, thereby increasing the limit of detection over more common procedures that usually accommodate sample sizes in the 1 - 10 mL range. Hence, the VT-IB method provides greater sensitivity of VTEC detection than other methodologies that have been used for this purpose and the outcomes from the present work cannot be compared directly with previous findings.

It was troubling to note that 21.7% of the water samples found to contain VTEC yielded a negative result on Petrifilm™, suggesting that measurements of fecal coliform and E. coli populations may not reliably predict the presence of potentially pathogenic VTEC in irrigation water. The use of fecal coliforms and E. coli indicators for water microbial risk assessment is an on-going challenge. Frequent lack of correlation with measurements based on microbial indicators led Edge et al. (2012) to conclude that the current Canadian E. coli guidelines for irrigation water quality (< 100 CFU/ 100 ml) might not be sufficient for low occurring pathogens such as VTEC. Findings from the present study support this conclusion and reinforce the urgent need to re-examine the reliability of existing safety standards for irrigation water.

2.4.2 VTEC prevalence in sediment samples

VTEC were recovered from 23.8% of sediment samples collected from a site in the

Sumas River watershed in which water samples were free of the pathogen, with one exception.

On this occasion (November 16, 2013) a period of heavy rainfall (31.2 mm over three days) preceded sample collection. E. coli is known to persist in sediments, where low temperatures, 64

high organic material and clay content promote bacterial survival (Craig et al., 2004;

Czajkowska et al., 2005). The ecology of sediments can be complex and microbial populations may vary in samples collected from the same location (Garzio-Hadzick et al., 2010; Pachepsky and Shelton, 2011). Sediment stirring by heavy current flow, disturbance by animals or irrigation water intakes can lead to the re-suspension of microorganisms (Czajkowska et al., 2005; Paulos et al., 2006; Cooley et al., 2014). Two to three fold increases in the concentration of fecal coliforms and E. coli in surface waters have been measured after storm events (Hunter et al.,

1992). However, the role of sediments in the ecology of VTEC in the natural environment remains unclear. The observations derived from analyses carried out in the present work provide strong preliminary evidence that sediments may serve as important reservoirs for VTEC and that weather events influence their transport to the bulk water phase. Further study is clearly warranted to establish the role of sediments in the ecology of VTEC in the watersheds examined in this work.

2.4.3 VTEC prevalence in fresh produce samples

Microbiological studies confirmed that sources of irrigation water in regions where fresh produce is grown in the Lower Mainland of BC are prone to contamination with VTEC. Crop irrigation is common during the summer months due to low rainfall. A survey was therefore conducted to determine the prevalence of VTEC in locally grown fresh produce. VTEC were not recovered from 105 samples that included several varieties of vegetables and berries. Lack of detection in fresh produce collected from farmers’ markets during the summer months could be due to the lower VTEC prevalence observed during the growing season described above.

However, this finding is in line with the results of surveys in other jurisdictions where very low 65

to non-detectable levels of VTEC were recovered from variable numbers of samples (Bohaychuk et al., (2009), 0/329 samples; Cooley et al., (2013), 16/2462, prevalence rate = 0.65%; Holvoet et al. (2014), 0/120; Wood et al., (2014), 0/33).

Reasons for the inability to recover VTEC from crops grown in a region where the pathogen occurs with high prevalence in irrigation waters were not immediately apparent.

Analytical difficulties associated with the detection of VTEC in fresh produce undoubtedly introduce uncertainty in the validity of survey data. The internalization of pathogens in plant tissues has been suggested to interfere with recovery using methods that rely on removal of target microorganisms using rinsing procedures (Solomon et al., 2002; Islam et al., 2004b).

Disruption of tissues by blending or homogenization releases phytochemicals, such as phenolics and organic acids, with bactericidal and outer membrane disintegrating properties that may inhibit the growth of bacterial targets and the performance of diagnostic reagents (Puupponen-

Pimiä et al., 2004; Barros and Saltveit, 2013). In the present study, sample preparation led to mechanical plugging of filters that imposed restrictions on sample process volumes, thus decreasing the sensitivity of the method. In addition, an increase in the number of produce samples could have improved sensitivity of detection and the validity of the survey. However, the VT-IB method used to recover VTEC is labour intensive and carries a high cost, factors that invariably influence the scale and scope of microbiological food surveys. The latter illustrates the need and value of cost-effective methods for the detection of human pathogens in fresh produce.

Human pathogens in the crop production environment are subjected to numerous interacting and potentially lethal stresses. Variable observations are reported when VTEC is introduced experimentally to growing produce. For example, Petal et al. (2010) reported that E. coli O157:H7 survived for < 14 days on spinach but for up to 77 days on lettuce subsequent to 66

irrigation with contaminated water (Solomon et al., 2002; Islam et al., 2004b). Aruscavage et al.

(2008) examined the effect of leaf damage on the survival of E. coli O157:H7 on lettuce and found that populations remained essentially stable after 10 days on intact leaves but were reduced to less than 101 CFU/g on damaged leaves. In contrast, E. coli O157:H7 populations remained unchanged over seven days on damaged strawberries but were reduced by 101 - 102

CFU on intact fruit (Knudsen et al., 2001). Epiphytic species or direct competitors such as

Aeromonas spp. may also influence survival in the plant phylosphere (Liao and Fett, 2001;

Schuenzel and Harrison, 2002). High temperatures and UV exposure during the summer months are widely held to influence the fate of VTEC on field crops (Oliveira et al., 2012), although a study by Mitra et al. (2009) indicated that these factors had little effect on E. coli O157:H7 survival on spinach. There is also evidence that contamination during the late stages of a production cycle is conducive to longer survival E. coli O157:H7 on both leafy greens and berries (Solomon et al., 2002; Islam et al., 2004b; Shaw et al., 2015). Hence, available information indicates that several interacting factors influence the fate of VTEC in the production environment and that it remains difficult to anticipate the extent of survival in any given crop or geographic location. The results presented herein suggest that it is likely low.

However, it must be stressed that analyses were conducted on produce samples collected during a single growing season. Furthermore, the number of samples was undeniably small in relation to current BC fresh produce consumption, which is among the highest in Canada (Statistics Canada,

2010a). There is clearly a need to carry out further surveys to determine the risk that BC consumers are exposed to VTEC through the consumption of locally grown fresh fruits and vegetables.

2.5 Conclusions

High VTEC prevalence rates in both water and sediment samples suggested that surface waters used for irrigation in four watersheds in the Lower Mainland of BC are subjected to persistent sources of contamination. The simultaneous occurrence of VTEC in both water and sediments, however, was not observed. Temperature and precipitation accumulation before sampling day were negatively and positively correlated with detection of VTEC in water. An examination of agricultural land use maps revealed varying levels of livestock production in each watershed; however, further research must be done to establish linkage to high VTEC prevalence rates in surface waters. Fecal coliform and E. coli counts were shown to be unreliable predictors for VTEC occurrence in irrigation water. VTEC were not detected in a limited survey of locally grown fresh produce collected from farmers’ market in the Lower Mainland of BC. However, the analytical method used in this study, particularly during the sample preparation step, imposed limits on the sensitivity of detection. Additional research to address these limitations is needed to establish the risk posed by VTEC in water used to irrigate food crops in the Lower Mainland of

BC.

Abbotsford 36 9 (25%)

Chilliwack 6 0 (0%)

Langley 8 0 (0%)

Richmond 14 0 (0%)

Surrey 78 17 (21.8%)

Total 142 26 (18.3%)

Sumas 97 21 (21.6%)

Nicomekl 86 20 (23.2%)

Serpentine 82 16 (19.5%)

Total 330 63 (19.1%)

Table 2.3 Number of water samples containing VTEC at each sampling site in the Lower Fraser, Sumas, Nicomekl and Serpentine River watersheds on different sample collection dates from November 2012 to November 2013. The number of VTEC isolates recovered from the samples is also shown. Number of samples containing VTEC / Number of isolates recovered* Site 11 12 12 12 1 2 2 5 5 6 6 7 7 7 8 9 10 10 11 11 11 /15 /6 /12 /22 /5 /16 /22 /11 /25 /6 /19 /13 /19 /27 /10 /22 /1 /28 /16 /22 /29 Lower Fraser Site #1 -a ------Site #2 - a ------+b +c Site #3 - a - - - - (1) (36) +c Site #4 - a - - - - - (16) +b Site #5 - a - - - - - (7) Sumas +b +b +b Site #6 - a - - - - - (13) (4) (3) +a +b +b +b +c +c +c +b Site #7 - - - - (15) (4) (34) (3) (18) (13) (4) (5) +b Site #8 - a ------(2) +b Site #9 - a ------(3) +b +b +b +b +b Site #10 - a ------(4) (6) (6) (8) (3)

Table 2.3 continued Number of samples containing VTEC / Number of isolates recovered* Site 11 12 12 12 1 2 2 5 5 6 6 7 7 7 8 9 10 10 11 11 11

/15 /6 /12 /22 /5 /16 /22 /11 /25 /6 /19 /13 /19 /27 /10 /22 /1 /28 /16 /22 /29 Nicomekl +b +c Site #11 ------(6) (11) +c +c +b +c +c +b +b Site #12 - - - (43) (13) (5) (17) (9) (2) (6) +b Site #13 ------(2) +b +c +b +b Site #14 - - - - - (8) (34) (1) (4) Site #15 ------Serpentine +b Site #16 ------(4) +c +b +c +b Site #17 - - - - - (19) (1) (86) (3) +b Site #18 ------(2) +c +b +b +b Site #19 - - - - (14) (5) (4) (3) +c +b Site #20 - - - - - (13) (5) * Total number of samples containing VTEC: 63; Total number of VTEC isolates recovered from water samples: 528. (-) denotes no VTEC recovered from the samples; (+) denotes VTEC recovered from the samples a One water sample was collected at the sampling site on the each sampling date. b VTEC recovered from one of two water samples collected at the site on sampling date. c VTEC recovered from both water samples collected at the site on sampling date.

Tb -0.239 0.002 P 0.056 0.475

Pb 0.187 0.017 Sumas T -0.387 0.005

Tb -0.391 0.005 P -0.023 0.875

Pb 0.276 0.052 Nicomekl T -0.015 0.925

Tb -0.009 0.957 P -0.062 0.684

Pb -0.018 0.908 Serpentine T -0.415 0.007

Tb -0.353 0.023 P 0.106 0.509

Pb 0.078 0.626 All sites T -0.194 0.011

Tb -0.218 0.004 P 0.062 0.421

Pb 0.196 0.010 Fecal coliforms3 -0.009 0.877 E. coli3 -0.036 0.510 1 The environmental factors are defined as: T – Mean temperature (°C) during sampling Tb – Mean temperature (°C) for three days before sampling P – Precipitation accumulation (mm) on the day of sampling Pb – Precipitation accumulation (mm) for three days before sampling 2 Significant correlation between the environmental factors and VTEC occurrence (P < 0.05) are shown in bold font. 3 Populations of fecal coliforms and E. coli (CFU/ml) (n = 329).

Table 2.5 Number of sediment samples collected from site #10 in the Sumas River watershed on each sample collection date, the number of VTEC positive sediment samples, prevalence rate (%) and the number of VTEC isolates recovered. No. of sediment No. of VTEC No. of VTEC isolates Sample collection samples collected positive samples (%) recovered July 13, 2013 1 1 (100%) 5

July 19, 2013 4 - -

August 10, 2013 4 - -

October 1, 2013 4 - -

November 16, 2013 4 3 (75%) 7

November 29, 2013 4 1 (25%) 5

Total 21 5 (23.8%) 17

Table 2.6 Number of fresh produce (leafy vegetables and berry) sampled from seven farmer’s markets in the Lower Mainland of British Columbia from June 2013 to September 2013 and the number of VTEC positive produce samples. Type of produce No. of samples No. of VTEC positive samples Leafy vegetables Green lettuce 25 0 Green iceberg 7 0 Green romaine 10 0 Green butter 4 0 Red lettuce 15 0 Red iceberg 2 0 Red romaine 2 0 Red butter 3 0 Spinach 6 0 Kale 1 0 Bok choy 1 0 Farmer’s blend 2 0 Berry Blueberry 11 0 Strawberry 15 0 Raspberry 1 0 Total 105 0

Ditch 49°12'5.95"N Richmond 123° 2'47.64"W

Ditch 49°11'17.78"N 123° 2'49.16"W Ditch 49°11'4.26"N 122°59'41.80"W (4) Ditch 49°11'4.68"N 123° 3'27.38"W North Arm Fraser River 49°10'55.01"N (3) Ditch 49°10'23.84"N 122°59'18.30"W 123° 2'47.42"W

Ditch 49°10'11.68"N (2) Ditch 49°10'7.93"N 123° 1'25.66"W 123° 0'25.47"W

Ditch 49°10'10.08"N 123° 0'44.69"W

(1) Ditch 49° 8'40.40"N 123° 4'9.33"W

Fraser River 49° 8'25.05"N 123° 3'21.17"W

(5) Ditch 49° 8'28.70"N 123° 4'49.68"W

Ditch 49° 8'12.50"N 123° 4'7.50"W

McGilliary Canal 49° 7'6.22"N 122° 4'45.90"W Chilliwack

McGilliary Canal 49° 7'5.92"N 122° 4'31.92"W Ditch 49° 6'18.08"N 122° 4'6.49"W

Abbotsford Ditch 49° 5'25.19"N 122° 6'28.48"W Vedder Canal 49° 6'11.37"N 122° 4'36.71"W

Sumas Lake Canal 49° 5'22.13"N 122° 7'1.29"W

Stewart Canal and Slough Canal 49° 4'16.58"N 122° 4'32.77"W (9) Sumas Lake Canal 49° 3'37.51"N 122° 7'2.46"W Stewart Canal 49° 4'7.41"N 122° 4'44.86"W (10) Sumas River 49° 3'22.73"N 122°10'49.03"W Ditch 49° 3'37.39"N (8) Ditch 49° 2'44.84"N 122° 6'34.59"W Sumas Lake Canal 49° 3'0.88"N 122°10'56.06"W 122° 8'21.66"W

Sumas Lake Canal 49° 2'46.95"N 122°11'1.65"W Ditch 49° 2'39.24"N Ditch 49° 1'38.92"N 122° 9'41.83"W 122°11'1.16"W (7) Sumas River 49° 1'37.96"N 122°13'7.76"W

Sumas River 49° 1'11.93"N 122°13'8.41"W Ditch 49° 1'48.19"N 122°11'40.71"W Sumas River 49° 1'1.56"N 122°13'18.84"W

Ditch 49° 0'15.29"N 122°15'37.38"W (6) Sumas River 49° 0'9.37"N 122°13'51.22"W

Figure 2.2a Map of Chilliwack/Abbotsford municipalities and geographic coordinates of water sampling sites. A yellow colour indicates that water samples collected in November 2012 - February 2013 were negative for VTEC, while red indicates a positive result. Five sampling sites selected for repeated sampling in May 2013 – September 2013 are denoted by a star-shaped marker and are numbered.

Serpentine River 49°10'57.23"N 122°46'0.73"W

Surrey (18) Serpentine River 49° 9'46.68"N 122°44'51.79"W (16) Latimer Creek 49° 9'18.07"N 122°42'35.59"W

Ditch 49° 9'11.88"N 122°42'44.45"W

(19) Serpentine River (17) Ditch 49° 8'52.67"N 49° 7'56.48"N 122°43'12.36"W 122°45'24.48"W Serpentine River 49° 8'41.05"N Langley 122°44'5.54"W

Logan Creek 49° 6'35.75"N Nicomekl River 49° (20) Serpentine River 49° 7'8.35"N 122°47'6.21"W 122°39'3.15"W Orchard Creek 5'6.36"N 49° 6'27.08"N 122°42'46.89"W 122°37'27.34"W Logan Creek 49° 6'28.79"N 122°38'37.62"W

(15) Nicomekl River 49° 5'23.08"N 122°43'22.62"W Nicomekl River Serpentine River 49° 5'43.14"N 49° 5'39.88"N 122°48'3.88"W Ditch Ditch 49° 5'22.99"N 122°41'27.86"W 49° 6'15.80"N 122°44'26.68"W 122°38'8.64"W

(13) Ditch 49° 3'37.10"N 122°45'41.15"W (14) Nicomekl River 49° 5'8.92"N 122°44'7.06"W Nicomekl River 49° 4'29.05"N 122°47'35.27"W Ditch 49° 4'28.38"N 122°42'36.64"W

(11) Ditch 49° 4'28.57"N 122°43'28.05"W Nicomekl River 49° 4'10.77"N 122°49'30.06"W (12) Erickson Creek 49° 3'37.71"N 122°42'48.57"W Nicomekl River 49° 4'6.94"N Creek 49° 3'20.09"N 122°50'10.58"W 122°43'11.94"W 88

Figure 2.1a Map of Surrey/Langley municipalities and geographic coordinates of water sampling sites. A yellow colour indicates that water samples collected in November 2012 - February 2013 were negative for VTEC, red indicates a positive result. Ten sampling sites selected for repeated sampling in May – November 2013 are denoted by a star-shaped marker and are numbered.

100 13.3% 90 15.7% 34.2% 80

50 86.7% 40 84.3%

% of water samples water of % 65.7% 30

0 Winter (n=76) Spring/Summer (n=134) Fall (n=120) Negative Positive

Figure 2.4 Prevalence of VTEC in irrigation water samples from 20 sampling sites located in the Lower Fraser, Sumas, Nicomekl and Serpentine River watersheds of British Columbia during winter (November 2012 – February 2013), spring/summer (May – August 2013) and fall seasons (September – November 2013).

10 A

2 No. of water water of samples No.

0 15-Nov-12 25-May-13 19-Jun-13 27-Jul-13 22-Sep-13 28-Oct-13 22-Nov-13 Negative Positive

90 80 B T 70 Tb

60 P

50 Pb

Cmm / ° 30 20 10 0 15-Nov-12 25-May-13 19-Jun-13 27-Jul-13 22-Sep-13 28-Oct-13 22-Nov-13

Figure 2.5 (A) Number of positive and negative water samples collected in the Lower Fraser watershed at each sampling date. (B) Mean temperature

(˚C) and precipitation accumulation (mm) on sampling day (T, P) and three days before sampling (Tb, Pb). The weather data was taken from the Richmond Nature Park (49°10'15.000" N, 123°05'35.000" W) station. 95

A 8

2 No. of water water of samples No.

Negative Positive 90 80 B T 70 Tb 60 P 50 Pb

40 C/mm

° 30 20 10 0 -10

Figure 2.6 (A) Number of positive and negative water samples collected in the Sumas River watershed at each sampling date. (B) Mean temperature

(˚C) and precipitation accumulation (mm) on sampling day (T, P) and three days before sampling (Tb, Pb) in Abbotsford. The weather data was taken from the Sumas Canal (49°06'48.008" N, 122°06'35.004" W) and Mission West Abbey (49°09'09.002" N, 122°16'14.001" W) stations. 96

10 A

2 No. of water water of samples No.

0 22-Dec-12 05-Jan-13 16-Feb-13 22-Feb-13 25-May-13 19-Jun-13 27-Jul-13 01-Oct-13 28-Oct-13 22-Nov-13 Negative Positive

90 80 B T 70 Tb 60 P 50 Pb

C/mm 40 ° 30 20 10 0 22-Dec-12 05-Jan-13 16-Feb-13 22-Feb-13 25-May-13 19-Jun-13 27-Jul-13 01-Oct-13 28-Oct-13 22-Nov-13 Figure 2.7 (A) Number of positive and negative water samples collected in the Nicomekl River watershed at each sampling date. (B) Mean temperature

(˚C) and precipitation accumulation (mm) on sampling day (T, P) and three days before sampling (Tb, Pb) in Surrey. The weather data was taken from the White Rock Campbell Scientific (49°01'05.000" N, 122°47'02.000" W) station. 97

2 No. of water water of samples No.

0 05-Jan-13 16-Feb-13 22-Feb-13 11-May-13 06-Jun-13 13-Jul-13 01-Oct-13 16-Nov-13 29-Nov-13 Negative Positive

90 B 80 70 T 60

Tb 50 P

40 Pb

C/mm ° 30 20 10 0 05-Jan-13 16-Feb-13 22-Feb-13 11-May-13 06-Jun-13 13-Jul-13 01-Oct-13 16-Nov-13 29-Nov-13 Figure 2.8 (A) Number of positive and negative water samples collected in the Serpentine River watershed at each sampling date. (B) Mean temperature

Sumas Serpentine Mean temperature Total precipitation 3 days during sampling before sampling ≥ 6.15 ˚C < 6.15 ˚C < 2.5 mm > 2.5 mm

21% 80% 5% 53%

Figure 2.9 Regression trees for the Sumas River watershed Figure 2.10 Regression trees for the Serpentine River showing a single tree node with mean temperature during watershed showing a single tree node with total precipitation 3 sampling (T) as the predicting variable. days before sampling (Pb) as the predicting variable.

Chapter 3: Molecular characterization of verotoxigenic Escherichia coli isolates recovered from surface waters and sediments in four watersheds in the Lower Mainland of BC

3.1 Introduction

Molecular typing using serological methods (serotyping) and the detection of virulence genes including eaeA and hlyA, vt1 and vt2 (virulence gene profiling) are widely applied in the characterization and assessment of the pathogenic potential of VTEC. Serotyping provides a means to identify serogroups and specific serotypes that are associated with human diseases, including haemorrhagic colitis (HC) and haemolytic uremic syndrome (HUS) (Kanama et al.,

2008; Gill and Gill, 2010; Grant et al., 2011). VTEC that possess the eaeA and/or vt2 genes are of particular concern due to their ability to induce attachment and effacement lesions with the host intestinal cells and to produce the more toxic verotoxin (VT) 2 (Louise and Obrig, 1995; Boerlin et al., 1999; Gill and Gill, 2010; Mathusa et al., 2010; Grant et al., 2011).

The serological and genetic diversity of VTEC has been examined in surface waters in agricultural regions of California (Cooley et al., 2013; Cooley et al., 2014) and the Grand River watershed of Ontario (Johnson et al., 2014). Numerous distinct serotypes and genotypes were recovered in both sites and 37% of the isolates belonged to above-mentioned serogroups associated with human disease. High VTEC prevalence rates in surface waters used for irrigation and in sediments from watersheds across the Lower Mainland of British Columbia (BC) described in Chapter 2 were suggestive of a multiplicity of sources, which typically enhances the diversity of environmental isolates. Consequently, the serotypes of isolates recovered from the

100

watersheds were determined in parallel with virulence genes profiles to assess diversity within

VTEC populations in the region. A secondary objective was to examine the prevalence of VTEC serotypes and virulence gene profiles of concern to public health.

3.2 Materials and methods

3.2.1 Serotyping of VTEC isolates

Serotyping of the isolates was performed courtesy of Dr. Roger Johnson and Ms. Kim

Ziebell at the E. coli Reference Laboratory, Laboratory for Foodborne Zoonoses (LFZ), Public

Health Agency of Canada (PHAC), Guelph, Ontario, using standard agglutination procedures to detect O-somatic and H-flagellar antigens.

3.2.2 Virulence gene profiling of VTEC isolates

The virulence gene profiles of the VTEC isolates (presence of eaeA and hlyA, vt1 and vt2 genes) were determined by multiplex PCR using methods described in section 2.2.7.

3.2.3 Fingerprinting of VTEC isolates by BOX-PCR

Several isolates were occasionally recovered from single water or sediment samples. A fingerprinting technique was used to examine the genetic relatedness of the isolates. Clonal relationships were established by comparison of fingerprints obtained by Rep-PCR using the

BOX A1R primer (5’-CTACGGCAAGGCGACGCTGACG-3’) according to methods described in Dombek et al. (2000). Template DNA was extracted with a Qiagen DNeasy Blood & Tissue

Kit (Qiagen, Toronto, Ontario, Canada) from 1.5 mL of overnight grown culture at 37˚C in

Tryptic Soy Broth as recommended by the manufacturer. Five μl of DNA template from each 101

isolate was amplified in 25μl reaction mixtures containing 12.5μl Multiplex PCR Master Mix

(Qiagen), 1.4 μM BOX A1R primer and 2.5 Q-solution. The PCR cycle was 95°C for 2 minutes, followed by 35 cycles of 94°C for 3 seconds, 92°C for 30 seconds, 50°C for 1 minute and 65°C for 8 minutes, and a final extension step of 65°C for 8 minutes. PCR products were held at 4°C until they could be visualized in SYBR® Safe (Invitrogen, Burlington, Ontario, Canada) stained

1.5% agarose gels following electrophoresis using 1X TAE buffer (BioRad, Mississauga,

Ontario, Canada) at 50V for 900 min in a cold room at 4°C. After electrophoresis, the gel was further stained in SYBR® Safe in 1X TAE buffer (1: 50 ratio) for 30 min with gentle agitation before imaging. E. coli O103:H25 and E. coli O157:H7 were used as positive controls to ensure that the reaction was successful for each run. These isolates were provided by Linda Hoang (BC

Centre for Disease Control, Vancouver, British Columbia, Canada).

3.2.3.1 BOX-PCR data analysis

Banding patterns on the gels were examined visually to establish similarity and/or differences between VTEC isolates.

3.3 Results

3.3.1 Surface water samples

3.3.1.1 Serotyping, virulence gene profiles and BOX-PCR fingerprints of VTEC isolates

Two hundred and forty eight of the 528 isolates recovered from surface water samples were selected for further characterization by serotyping and virulence gene profiling. Using in- house methods for serological agglutination in microtitre plates according to protocols described in Ewing (1986), the LFZ (Guelph) confirmed 225 as VTEC. These were assigned to 40 different 102

serotypes that included O157:H7/O157:NM (9 isolates), non-O157 “priority” serogroups O26,

O103 and O111 (31 isolates), and 32 other serotypes (185 isolates) (Table 3.1). Of the 23 isolates that were considered non-VTEC according to criteria employed by the LFZ, 5 were from generic E. coli serotypes (O6:H1, O34:H32, O46:H52, O133:H29), 2 were identified as

Citrobacter spp., 3 as Enterobacter spp., and 13 were unidentified (Table 3.1). The virulence gene profiles for the latter were confirmed by repeat analysis (Section 2.2.7), vt1 and vt2 genes were still observed in some of the isolates.

3.3.1.1.1 Lower Fraser watershed

Seven distinct VTEC serotypes were isolated from the Lower Fraser watershed on three different sampling dates (Table 3.2). Serotype O26:H11 strains (eaeA, hlyA, and vt1 positive) were isolated from irrigation ditches in Site #3 and Site #4 on May 25, 2013 and were found to be clonal, suggesting a common source. The two sites are located in close proximity, downstream from a livestock operation. Additional serotypes, including hlyA, vt1 and vt2 positive

O?:H19 and O151:H12, were also recovered from Site #4 on May 25, 2013. The O?:H19 could not be assigned to O-antigen serogroup but had the H19 flagellar antigen. Monaghan et al.

(2011) highlighted the need for new antisera to detect emerging VTEC serogroups to accommodate the increasing frequency of O non-typable strains being recovered. In their study,

6 of the 107 VTEC strains isolated from bovine farms were O non-typable (Monaghan et al.,

2011). Site #3 was again positive for VTEC on June 19, 2013, when serotype O165:H25 and

O165:NM strains possessing all four virulence genes were isolated, and on September 22, 2013, when serotype O6:H10 (vt1 positive) and O103:H25 (eaeA, hlyA, and vt1 positive) were found

(Table 3.2). 103

3.3.1.1.2 Sumas River watershed

Twenty distinct VTEC serotypes were isolated from the Sumas River watershed over the one year sampling period (Table 3.3). VTEC were recovered frequently from Site #7, including strains of serotypes O26:H11 (eaeA, hlyA, and vt1 positive), O103:H11 (eaeA, hlyA, and vt1 positive), O111:NM (eaeA, hlyA, vt1 and vt2 positive) and O157:H7 (eaeA, hlyA, vt1 and vt2 positive) which are known to cause human illness. Banding patterns obtained by BOX-PCR were identical and indicative of clonality for the O26:H11 and O103:H11 strains isolated on

December 20, 2012 and the O111:NM strains isolated on November 16, 2013 possessed all four virulence genes. Serotype O177:NM (eaeA, hlyA, and vt2 positive) isolates were also recovered from Site #7 on December 6, 2012. Although rarely associated with human illness, the serotype has been linked to clinical cases in the province of BC.

Some VTEC serotypes were isolated recurrently from the Sumas River watershed. For example, serotype O136:H12 was recovered from samples taken on three separate occasions.

However, isolates recovered from Site #7 on December 6, 2012 and January 15, 2013 were not clonal and had different virulence gene profiles, although isolates from a sampling on January

15, 2013 were identical to those from Site #9 (October 1, 2013), all of which possessed only the vt1 gene. Interestingly, VTEC serotype O136:H12 isolates that yielded different Pulse Field Gel

Electrophoresis (PFGE) patterns were recovered from cattle and small rodents in proximity to cattle farms in a study carried out in Denmark by Neislen et al. (2004). It has also been reported in cattle in Switzerland (Zweifel at al., 2005) and Canada (Karmali et al., 2003), although there are very few reports of human infection associated with serogroup O136 (Bettelheim, 2007).

BOX-PCR fingerprints showed that clonal O136:H12 isolates and the O136:H16 isolated from

Site #6 (July 19, 2013) were similar. 104

Additional serotypes such as O8:H19 (hlyA, and vt2 positive), O26:H11 (eaeA, hlyA, and vt1 positive), O111:NM (eaeA, hlyA, vt1 and vt2 positive), O163:H19 (hlyA, vt1 and vt2 positive) and O182(O109):H5 (vt1 positive) were also recovered from different sampling sites on different sampling occasions and were clonal. It should be noted that some VTEC with similar virulence gene profiles were found to be clonal despite being of different serotype, for example, the

O141ac:H8 and O168:H8 strains isolated from Site #10 on December 12, 2012, the O111:H8 and

O111:NM strains isolated from Site #10 on January 15, 2013 and the O163:NM, O163:H19 and

OR:NM strains isolated from Site #7 on February 16, 2013. Other serotypes recovered from the

Sumas River watershed included O84:H2 (eaeA, hlyA, and vt1 positive), O113:H21 and OR:H21

(vt2 positive), O128:H2 (vt1 and vt2 positive) and O165:NM (eaeA, hlyA and vt2 positive) (Table

3.3).

3.3.1.1.3 Nicomekl River watershed

Eighteen distinct VTEC serotypes were recovered from the Nicomekl River watershed over the one year sampling period (Table 3.4). Serotype O103:H2 (eaeA, hlyA, and vt1 positive) and O157:H7 (eaeA, hlyA, vt1 and vt2 positive) strains were isolated from Site #14 and Site #12 respectively. In parallel with the Sumas River watershed, clonal isolates from several serotypes were recurrent. These included O5:NM (eaeA, hlyA, and vt1 positive), O76:H19 (hlyA, and vt1 positive), O116:H25 (vt2 positive), O136:H12 (vt1 positive), and O156:H25 (eaeA, hlyA, and vt1 positive). Repeated recovery of clonal isolates from the same site, for example O5:NM and

O116:H25 from Site #12, was suggestive of persistent sources of contamination. The O128:H2 isolates recovered from Site #12 on two different sampling dates possessed different virulence gene profiles (hlyA, vt1 and vt2 positive; May 25, 2013 and vt1 and vt2 positive; October 1, 2013) 105

and were not clonal, suggesting different origins. On the other hand, the O174:H21 (vt1 and vt2 positive) strains recovered from Site #13 (January 15, 2013) and Site #14 (May 25, 2013) had the same virulence profile but were not clonal. Furthermore, O22:H8 and O130:H8 isolates from

Site #14 on January 15, 2013 were clonal and had the same virulence profile (vt2 positive). Other serotypes recovered from the Nicomekl River watersheds included O8:H19 (hlyA, vt1 and vt2 positive), O84:H2 (eaeA, hlyA, and vt1 positive), O91:NM (vt1 and vt2 positive) and O174:H8 (vt1 and vt2 positive) (Table 3.4).

3.3.1.1.4 Serpentine River watershed

Eleven distinct VTEC serotypes were recovered from the Serpentine River watershed over the one year sampling period (Table 3.5). One O157:H7 strain possessing all four virulence genes was isolated from Site #17 on June 6, 2013. The O111:H8 and O111:NM strains except for one O111:H8 strain (all eaeA, hlyA, and vt1 positive) isolated from Site #17 on January 15, 2013 were clonal and were indistinguishable from those isolated from Site #19 on October 1, 2013.

However, one O111:H8 strain from Site #17 sampled on January 15, 2013 was unique, suggesting a different origin from the clonal O111 strains recovered from the same sample.

Likewise, strains of other serotypes from different sampling sites in the Serpentine River watershed on different sampling days shared common characteristics. Examples include strains of serotypes O69:H11 (eaeA, hlyA, and vt1 positive), O98:NM (eaeA, hlyA, and vt1 positive),

O103:H25 (eaeA, hlyA, and vt1 positive) and O182(O109):H5 (vt1 positive). The isolates recovered on February 16, 2013 from all positive sites were clonal with either O163:H19,

O163:NM, O163:NM/O163:H19 or OR:NM serotypes (hlyA, vt1 and vt2 positive). A similar relationship was observed in positive sites in the Sumas River watershed on February 16, 2013. 106

It should be noted that contamination during the transfer of colonies from HGMF filters to the

96-well megablocks could account for this occurrence since the isolates were clonal to the

O163:NM positive control. The clonal O163:H19 strains were also isolated from Sumas River watershed on the later date which suggests that this serotype is present in the environment. One other serotype recovered from the Serpentine River watersheds was O8:H9 (vt2 positive) recovered from Site #17 on October 1, 2013. (Table 3.5)

3.3.1.1.5 Overall observations on serotypes and virulence gene profiles of the VTEC isolates

In total, 100 unique VTEC isolates were recovered from the 63 surface water samples positive for VTEC, including 3 (3.0%) of serogroup O157 (H7 or NM), 16 (16.0%) of non-O157

“priority” serogroups O26, O103 and O111, and 81 (81.0%) of 32 from other VTEC serogroups

(Table 3.6). The overall prevalence was 0.9% (3/330 samples) for serogroup O157 and 19.1%

(63/330) for the non-O157 serogroup, including 3.6% (12/330) for “big six” non-O157 serogroups. Twenty five surface water samples (7.5%) contained more than one VTEC serotype.

In similarity with the control E. coli O157:H7 strain, a clinical isolate from BC, the

O157:H7 (2) and O157:NM (1) isolates possessed all four virulence genes (eaeA, hlyA, vt1 and vt2) (Table 3.6). The 16 “big six” non-O157 isolates belonged to six different serotypes,

O26:H11 (4), O103:H2 (1), O103:H11 (1), O103:H25 (3), O111:H8 (4) and O111:NM (3)

(Table 3.6). All possessed eaeA, hlyA, and vt1 genes except for the O111:H8 and O111:NM isolates in which all four genes were detected (Table 3.6). Non-O157 serotypes that were recovered at least three times included O5:NM, O8:H19, O128:H2, O136:H12, O165:H25 and

107

O182(O109):H5 (Table 3.2-3.5). Serotype O109:H5 is suggested to be an emerging serotype by

Monaghan et al. (2011) where frequent recovery observed from bovine farms.

The distinct VTEC isolates were randomly distributed among ten virulence gene profiles

(Table 3.7). Twenty six of the isolates (26.0%) possessed eaeA, hlyA, and vt1 genes, of which more than half belonged to the “big six” non-O157 serotypes. The virulence gene profiles for the majority of the isolates were hlyA, vt1 and vt2 positive (22.0%), vt1 positive (18.0%) and vt2 positive (12.0%). Nine of the isolates (9.0%) possessed eaeA, hlyA, vt1 and vt2, including those from the O157, O111 and O165 serogroups. Interestingly, 61.0% of the VTEC isolates recovered were eaeA-negative. The vt1, vt2 and combination of vt1 and vt2 genes were present in 48.0%,

17.0% and 35.0% of the VTEC isolates. (Table 3.7)

3.3.2 Sediment samples

3.3.2.1 Serotyping, virulence gene profiles and BOX-PCR fingerprints of VTEC isolates

Twelve VTEC isolates recovered from five sediment samples were subjected to serotyping. Five isolates from a sample collected on July 13, 2013, belonged to serotype

O88:H25 (hlyA, vt1 and vt2 positive) and were clonal. Five isolates recovered from three different samples collected on November 16, 2013 were from serotype O103:H2 (eaeA, hlyA, and vt1 positive), although two distinct banding patterns were obtained by BOX-PCR. Two of five isolates recovered on November 29, 2013 were also from serotype O103:H2 (eaeA, hlyA, and vt1 positive). The five isolates were clonal and yielded banding pattern identical to one of the

O103:H2 strains recovered on November 16, 2013 (Table 3.8). Overall, four distinct strains of

O88:H25 and O103:H2 serotypes were recovered from the sediment samples from three different

108

sampling dates. On one occasion (November 16, 2013), VTEC were recovered from both surface water (serotype O84:H2) and sediment samples (serotype O103:H2) collected from Site #10.

3.4 Discussion

3.4.1 Surface water samples

A wide diversity of VTEC including 100 distinct VTEC strains distributed across 40 different serotypes was recovered from surface water in the Lower Mainland of BC using the novel verotoxin immunoblot (VT-IB) method over a period of one year. In a similar study carried out by the originators of the method (Johnson et al., 2014) in the Grand River watershed of Ontario, 53 VTEC serotypes were recovered from surface water (75 of 236 samples) over a period of three years. High rates of recovery were ascribed to the increased sensitivity afforded by the VT-IB method, which also enhances recovery of non-O157 serogroups. The latter represents a significant advance in methodology in support of international efforts to provide public and regulatory laboratories with improved analytical tools for the detection of this increasingly important group of enteric pathogens (Health Canada, 2008; Johnson et al., 2014;

USDA, 2014a; USDA, 2014b).

The sensitivity of the VT-IB method is mainly due to the efficient antibody-based detection of VT 1 and VT 2. In the present study production of VTs by presumptive isolates was confirmed in pure cultures using an ELISA, the presence of genes (vt1, vt2) associated with their production was verified, and PCR was carried out to differentiate E. coli from closely related

Gram-negative bacteria. Despite these measures, 9.2% of the presumptive isolates recovered from water samples using the VT-IB method could not be serotyped. Analysis with the Vitek®2 microbial identification system revealed these included Citrobacter sp., Enterobacter sp., non- 109

verotoxigenic E. coli and several unidentified species. Although they are primarily associated with VTEC and Shigella sp., the genes encoding VT production are known to occur in other bacteria (Mauro and Koudlka, 2011). Non-VTEC species are also capable of producing VT, including Citrobacter sp. and Enterobacter sp. which have been implicated in haemolytic uremic syndrome (HUS) (Schmidt et al., 1993 and Paton and Paton, 1996). Furthermore, the PCR assay used for differentiation of E. coli targets the highly conserved gadA gene encoding for glutamic acid decarboxylase (GAD) (Smith et al., 1992). However, other Gram-negative bacteria such as

Shigella ﬂexneri and Citrobacter braakii have acquired the ability to produce GAD similar to that of E. coli, possibly through transduction (Feehily and Karatzas, 2012; Park and Diez-

Gonzalez, 2004). Hence, closely related bacterial species may exhibit phenotypic and/or genotypic traits characteristic of the VTEC group. The VT-IB method is clearly not sufficiently selective to avoid the co-isolation of such bacteria and highlights the need to confirm the identity of isolates.

Non-O157 serogroups were isolated at much higher frequency from BC surface waters than the O157 serogroup (2.7% of total 528 isolates). This finding is in agreement with results obtained by Johnson et al. (2014) in an Ontario watershed where O157 isolates accounted for only 4% of the all VTEC recovered, and Cooley et al. (2013) for California surface waters where non-O157 serogroup occurrence was approximately five fold higher than O157. A wide diversity of VTEC serogroups may be shed in the feces of livestock and wildlife (Van Donkersgoed et al.,

1999, 26 serogroups; Arthur et al., 2002, 41 serogroups; Kanama et al., 2011, 24 serotypes).

Consequently, the prevalence of individual serogroups in surface waters likely mirrors VTEC populations in primary animal reservoirs located within a natural or agricultural environment and associated watersheds (Cooley et al., 2013; 2014). 110

Serogroup O157 and serotypes from “big six” non-O157 serogroups O26, O121, O145 and O157 have been the cause outbreaks linked to the consumption of fresh produce (Table 1.1).

The detection of multiple O157 (3.0% of samples) and “big six” non-O157 (16.0% of samples) serogroups VTEC in surface waters used for irrigation in the Lower Mainland of BC is a cause for concern given the strong association between contamination of irrigation water and produce- associated outbreaks (for example a 2006 Spinach outbreak in California; CDC, 2006).

Furthermore, a number of the serogroups recovered from surface waters used for irrigation in the present study have also caused infections in BC, including serogroups O8, O26, O103, O111,

O121, O146, O157, O165 and O177 (Allen et al., 2012). In this regard, serotype O157:H7 and

O157:NM isolates recovered from the Nicomekl, Serpentine, and Sumas River watersheds were significant because they possessed all four virulence genes and gel banding patterns by BOX-

PCR that were similar to that obtained with a clinical O157:H7 isolate from BC. Moreover, strains of serotype O157:NM are frequently reported to be more virulent than motile strains due their increased capacity for adherence to human cells (Rosser et al., 2008).

Several isolates of serotype O26:H11 were recovered from the Lower Fraser and Sumas river watersheds. The O26 serogroup had been linked to an outbreak caused by raw clover sprouts in the US (CDC, 2012) and several large outbreaks of both HC and HUS in Japan,

Germany and Ireland (Kudoh et al., 1994; Zhang et al., 2000; Hiruta et al., 2001; McMaster et al., 2001; Werber et al., 2002). Bettelheim (2007) examined sources of O26:H11 and O26:NM and concluded that both serotypes tend to survive well in the bovine intestinal tract and are known to cause infections in cattle (Bettelheim, 2003). The isolates recovered in this study only produce VT 1, a characteristic that is common in bovine isolates (Bielaszewska et al., 2007).

111

Bovines are the main reservoir for serogroup O103 (Bettelheim, 2007). Serotypes

O103:H2, O103:H11 and O103:H25 were isolated from all four watersheds in the Lower

Mainland of BC. These serotypes have been reported to cause sporadic diarrhea and HUS cases worldwide and belong to three distinct clonal groups (Iguchi et al., 2012). Serotype O103:H2 was first identified in 1992 and is the most frequently isolated clinical serotype where HUS cases are common (Mariani-Kurkdjian et al., 1993). Serotypes O103:H11 and O103:H25 are more rarely associated with HC and HUS, although cases have been reported in Japan, Canada and

Norway (Seto et al., 2007; Schimmer et al., 2008; Iguchi et al., 2012). Isolates from the three serotypes recovered in the present study had the same virulence gene profile but yielded different banding patterns by BOX-PCR fingerprinting. Interestingly, Iguchi et al. (2012) reported that

O103:H11 is closely related to O26:H11, both serotypes having evolved from “a common ancestor with one or more exchange (s) of the region encoding O-antigen biosynthesis”. A sample collected from Site #7 on December 20, 2013 yielded O26:H11 and O103:H11 strains that yielded identical banding patterns by BOX-PCR, which supports the notion that may be closely related.

The O111 serogroup is the main cause of human non-O157 VTEC infections

(Bettelheim, 2013). Both serotypes O111:H8 and O111:NM may be present in clinical samples and pathogenic strains are frequently reported to carry plasmids analogous to serogroup O157 plasmids, and the eaeA gene which enhances virulence (Morabito et al., 1999). Isolates of serotype O111:H8 and O111:NM were recovered from samples collected in the Sumas and

Serpentine rivers, although virulence profiles (eaeA, hlyA, vt1 and vt2 positive and eaeA, hlyA, and vt1 positive, respectively) differed in the two watersheds. Clonal isolates of both serotype

O111:H8 and O111:NM with the same virulence profile were recovered from Sumas River 112

watershed Site #10 (January 15, 2013) and Serpentine River watershed Site #17 (January 15,

2013) on two different occasions. Beutin et al. (2004) indicated that analysis of the flagellar protein fliC gene by PCR in O111:NM strains is often suggestive of the H8 genotype, which hints that the two serotypes are likely the same. Deletions or mutations in the fliC gene that hinder expression of flagellar proteins in O111:NM strains could also lead to conflicting serotyping outcomes (Feng et al., 1996). Cattle are reported to be the main reservoir for the

O111 serogroup, although low rates of isolation from feces suggest the serogroup is a minor component of VTEC populations (Bettelheim, 2007). Strains possessing both eaeA and hlyA genes have been isolated from the feces of infected bovines (Hornitzky et al., 2005).

Isolates from a range of less common serogroups were recovered in addition to the more established O157 and non-O157 serogroups. Some have known association with human disease and their presence in surface waters should not be overlooked. For example, the O128:H2 serotype, which was recovered repeatedly in this study, had been associated with outbreaks in

Japan and Australia. The serotype is dominant in sheep, but occurs intermittently in cattle

(Kudoh et al., 1994; Bettelheim et al., 1999; Bettelheim et al., 2007). The O5:NM serotype has caused a serious HC and HUS outbreak in the United Kingdom (Bettelheim et al., 2003). In fact, a survey of clinical reports revealed that all of the non-O157 serotypes detected in this study with the exception of serotype O182(O109):H5 have been linked to human infections, notably serotypes belonging to serogroups O8 and O91 (Bettelheim et al., 2007).

The O182(O109):H5 serotype was of interest since it was recovered repeatedly over a one year period from different sampling sites in the Sumas and Serpentine River watersheds, suggesting that carriage is likely common in these areas. Despite the seemingly restricted virulence profile of the isolates (vt1 positive), the risk posed by O182(O109):H5 should not be 113

overlooked. VTEC strains from serogroups O6, O136 and O146 with similar virulence profile and capable of producing only VT 1 have caused infections or have been implicated in cases where co-infection was suspected (Bettelheim et al., 2007).

There were several instances where serotyping results indicated differences in serotype while fingerprinting by BOX-PCR suggested clonality, including isolate pairs O22:H8 and

O130:H8, O145ac:H8 and O168:H8, O113:H21 and OR:H21, and O165:H25 and O165:NM.

Genetic alteration has been shown to induce changes in serological reactions. As mentioned earlier (and as reported by Iguchi et al., 2012), an exchange in genes associated with O-antigen biosynthesis could account for the different serologies of otherwise similar O22:H8 and

O130:H8, and O145ac:H8 and O168:H8 isolates. Mutations resulting in shorter core oligosaccharide lacking the O-antigen known as rough lipopolysaccharides (hence the O Rough designation) lead to colonies with mucoidal phenotypes on solid media (Schnaitman and Klena,

1993). O rough strains have been shown to retain phenotypic and genetic characteristics, including virulence factors, of the parent strain; however, somatic antigenic determinants are not detected in OR strains (Feng et al., 1998). A similar mutation could be responsible for the transformation of OR:H21 from an O113:H21 parent strain. The O113 serogroup has also been reported to be the predominant serogroup in surveys of bovine isolates, especially in Europe

(Blanco et al., 2004; Zwiefel et al., 2005; Monaghan et al., 2011). Genetic alterations in genes associated with flagellar antigens can also induce changes in determinants targeted in serological typing schemes. For example, mutations or deletions in the fliC gene have been reported to reduce or prevent the motility of O165:NM strains (Feng et al., 1996; Seto et al., 2007). Similar mutations could be responsible for the transformation of the O165:NM isolates from O165:H25 parent strains recovered from the watersheds studied in this work. 114

Virulence genes in O157 and “big six” non-O157 serogroups were distributed between eaeA, hlyA, and vt1 positive and eaeA, hlyA, vt1 and vt2 positive profiles, which were detected in

26.0% and 9.0% of the isolates respectively. These patterns are significant because they are often observed in VTEC strains that cause human disease. In addition, VTEC isolates lacking the eaeA gene which aids in the attachment of E. coli to intestinal cells, were also common (61.0%).

Lower frequency of the eaeA gene in bovine strains was reported previously (Blanco et al., 2004,

151/514 VTEC strains; Monaghan et al., 2011, 18/107). In the present study, the vt2 gene was detected at a frequency of 52.0% which is lower than that reported for bovine isolates in other studies (Blanco et al., 2004, 80%; Monaghan et al., 2011, 78%). This was also considerably lower than the frequency reported for environmental isolates in the study by Cooley et al. (2013) where the prevalence of the vt2 gene was 97% for O157 (n=670) and 74% non-O157 (n=3,284).

VTEC lacking the eaeA gene but capable of producing VT 2 encoded by the vt2 gene have been of concern since a large outbreak caused by contaminated fenugreek sprouts in Germany in 2011

(Bielaszewska et al., 2011). The implicated strain, E. coli O104:H4, lacked the eaeA gene but was capable of producing VT 2 which is more toxic to human renal microvascular endothelial cells than VT 1 (Louise and Obrig, 1995; Gill and Gill, 2010; Bielaszewska et al., 2011; Grant et al., 2011).

The reintroduction of VTEC from reservoirs to the environment or surface waters has been reported by Cooley et al. (2014). Recovery of clonal VTEC strains from the same sampling site on different sampling days, for example serotype O76:H19 strains which were recovered from Site #12 on October 28 and November 22, 2013, was suggestive of continuous reintroduction of VTEC in the watersheds examined in this work. However, there were several instances where unique isolates were encountered. In addition, persistence within the same site 115

cannot be discounted as long term survival of VTEC in water is well documented (Rice et al.,

1992; Geidrich et al., 1992; Wang and Doyle, 1998; Czajkowska et al., 2005; Watterworth et al.,

2006; Cook et al., 2011; Gu et al., 2013). The recovery of clonal O103:H25 strains from Site #19 and Site #20 along the Serpentine River on November 16, 2013 was indicative of survival in water that favoured transport. A similar observation is reported in Cooley et al. (2007) where clonal isolates were recovered in the same drainage system from sites that were located 24 km apart. Hence, it remains unclear to what extent the persistence of VTEC in the watersheds examined in this study is due to continuous reintroduction from reservoirs or long term survival in water.

3.4.2 Sediment samples

VTEC serotypes O88:H25 and O103:H2 recovered from sediment have been associated with human infections (Bettelheim et al., 2007). Two clonal O103:H2 isolates were recovered from samples collected on separate dates. Long-term VTEC survival in sediments has been reported (Czajkowska et al., 2005) and the survival of strains such as O103:H2 cannot be discounted. Resuspension and redistribution of sediment within the watershed could also contribute to the genetic diversity of VTEC in both water and sediments as noted in other studies

(Atwill et al., 2007). Sediment sampling in the present study was limited however, and further work will be required to determine the most likely sources of persistent VTEC in surface water sediments in the region.

116

3.5 Conclusions

VTEC belonging to multiple serotypes with a range of virulence gene profiles were recovered from watersheds in the Lower Mainland of BC. The results were indicative of multiple and recurrent sources of contamination, although additional research is needed to confirm this suggestion and to identify salient sources of these bacteria. The frequent recovery of isolates belonging to serogroup O157, “big six” non-O157 serogroups and others reported to cause human infections supports the need for enhanced scrutiny of waters used for irrigation of fresh produce.

117

Table 3.1 Serotypes of VTEC recovered from all water samples collected in the Lower Mainland of BC (n=248). The number of isolates definitively identified as VTEC and non-VTEC are shown. No. of isolates Serotypes or others1 VTEC 9 O157:H7, O157:NM O26:H11, O103:H2, O103:H11, O103:H25, O111:H8, 31 O111:NM O5:NM, O6:H10, O8:H9, O8:H19, O22:H8, O69:H11, O76:H19, O84:H2, O91:NM, O98:NM, O113:H21, O116:H25, O128:H2, O130:H8, O136:H12, O136:H16, O141ac:H8, 185 O146:H8, O151:H12, O156:H25, O163:NM, O163:H19, O165:H25, O165:NM, O168:H8, O174:H8, O174:H21, O177:NM, O182(O109):H5, OR:NM, OR:H21, O?:H19 Total VTEC 225

Non-VTEC 5 E. coli O6:H1, O34:H32, O46:H52, O133:H29 2 Citrobacter 3 Enterobacter 13 Unidentified Total 23 non-VTEC 1 Citrobacter and Enterobacter were identified with the VITEK® 2 Compact microbial identification system (BioMérieux, Saint-Laurent, Quebec, Canada).

118

Table 3.2 Serotypes of isolates recovered from surface water samples collected in the Lower Fraser watershed of BC. The number of isolates recovered on each sampling date at different sampling site, serotypes, virulence gene profiles and clonality of isolates determined by BOX-PCR are shown. Virulence characteristics Clonality by Date sample Location No. of isolates Serotype1 vt1 vt2 eaeA hlyA BOX PCR May 25, 2013 Site #3 1 O26:H11a + - + + Site #4 9 O26:H11a + - + + Y 6 O?:H19 + + - + Y 1 O151:H12 + + - + June 19, 2013 Site #3 34* O165:H25 + + + + Y 1 O165:NM + + + + September 22, 2013 Site #5 1 O6:H10 + - - - 6 O103:H25 + - + + Y * The isolates were recovered from two water samples, therefore, two isolates were included as unique VTEC isolates. 1 The letter denotes similar banding patterns observed among the isolates recovered from different sites on different sampling dates.

119

Table 3.3 Serotypes of isolates recovered from surface water samples collected in the Sumas River watershed of BC. The number of isolates recovered on each sampling date at different sampling site, serotypes, virulence gene profiles and clonality of isolates determined by BOX-PCR are shown. Virulence characteristics Clonality by Date sample Location No. of isolates Serotype1 vt1 vt2 eaeA hlyA BOX PCR December 6, 2012 Site #7 2 O136:H12 + - - + Y 10 O157:NM + + + + Y2 3 O177:NM - + + + Y December 12, 2012 Site #7 4 O8:H19a - + - + Y Site #10 1 O141ac:H8 - + - - Y 3 O168:H8 - + - - December 20, 2012 Site #7 5 O26:H11b + - + + Y 1 O103:H11b + - + + Site #10 34 O8:H19a - + - + Y January 15, 2013 Site #7 3 O136:H12c + - - - Y Site #10 2 O111:H8d + + + + Y 4 O111:NMd + + + + February 16, 2013 Site #7 15* O163:NMe + + - + 2* O163:H19e + + - + Y 1 OR:NMe + + - + May 11, 2013 Site #6 12 O113:H21 - + - - Y 1 OR:H21 - + - - Site #10 8 O182(O109):H5f + - - - Y June 6, 2013 Site #7 13* O182(O109):H5f + - - - Y July 19, 2013 Site #6 4 O136:H16c + - - - Y October 1, 2013 Site #7 4* O165:NM - + + + Y Site #9 2 O26:H11b + - + + Y 1 O136:H12c + - - - November 16, 2013 Site #6 3 O128:H2 + + - - Y Site #7 3 O111:NMd + + + + Y

120

Table 3.3 continued Virulence characteristics Clonality by Date sample Location No. of isolates Serotype1 vt1 vt2 eaeA hlyA BOX PCR November 16, 2013 Site #8 2 O163:H19e + + - + Y Site #10 3 O84:H2 + - + + Y * The isolates were recovered from two water samples, therefore, two isolates were included as unique VTEC isolates. 1 The letter denotes similar banding patterns observed among the isolates recovered from different sites on different sampling dates. 2 Similar banding patterns with control E. coli O157:H7.

121

Table 3.4 Serotypes of isolates recovered from surface water samples collected in the Nicomekl River watershed of BC. The number of isolates recovered on each sampling date at different sampling site, serotypes, virulence gene profiles and clonality of isolates determined by BOX-PCR are shown. Virulence characteristics Clonality by Date sample Location No. of isolates Serotype1 vt1 vt2 eaeA hlyA BOX PCR December 20, 2012 Site #11 5 O136:H12a + - - - Y Site #12 1 O5:NMb + - + + 37* O116:H25c - + - - Y January 15, 2013 Site #12 4 O5:NMb + - + + Y 7* O146:H8 + - - - Y Site #13 1 O174:H21 - + - - Site #14 2 O22:H8 - + - - Y 1 O130:H8 - + - - 4 O156:H25d + - + + Y May 25, 2013 Site #12 4 O128:H2 + + - + Y Site #14 16* O5:NMb + - + + Y 8 O8:H19 + + - + Y 6 O156:H25d + - + + Y 4 O174:H21 - + - - Y June 19, 2013 Site #11 8* O136:H12a + - - - Y Site #12 13* O84:H2 + - + + Y 3 O157:H7 + + + + Y2 Site #14 1 O136:H12a + - - - July 27, 2013 Site #14 4 O103:H2 + - + + Y October 1, 2013 Site #12 1 O91:NM + + - - 3 O116:H25c - + - - Y 1 O128:H2 + + - - 4 O174:H8 + + - - Y October 28, 2013 Site #12 2 O76:H19e + - - + Y November 22, 2013 Site #12 6 O76:H19e + - - + Y * The isolates were recovered from two water samples, therefore, two isolates were included as unique VTEC isolates. 1 The letter denotes similar banding patterns observed among the isolates recovered from different sites on different sampling dates. 2 Similar banding patterns with control E. coli O157:H7. 122

Table 3.5 Serotypes of isolates recovered from surface water samples collected in the Serpentine River watershed of BC. The number of isolates recovered on each sampling date at different sampling site, serotypes, virulence gene profiles and clonality of isolates determined by BOX-PCR are shown. Virulence characteristics Clonality by Date sample Location No. of isolates Serotype1 vt1 vt2 eaeA hlyA BOX PCR January 15, 2013 Site #17 2 O69:H11a + - + + Y 4 O98:NMb + - + + Y 1 O111:H8 + - + + 2 O111:H8c + - + + Y 1 O111:NMc + - + + 8* O182(O109):H5d + - - - Y February 16, 2013 Site #16 3 O163:NMe + + - + Y Site #18 1 OR:NMe + + - + Site #19 11* O163:NMe + + - + Y 3* OR:NMe + + - + Y Site #20 10* O163:NMe + + - + Y 1 O163:H19e + + - + 1 OR:NMe + + - + O163:NM/ 1 + + - + O163:H19e February 22, 2013 Site #17 1 O69:H11a + - + - Site #19 5 O182(O109):H5d + - - - Y June 6, 2013 Site #17 38* O98:NMb + - + + Y 1 O157:H7 + + + + 2 46* O182(O109):H5d + - - - Y October 1, 2013 Site #19 3 O111:H8c + - + + Y November 16, 2013 Site #17 3 O8:H9 - + - - Y Site #19 3 O103:H25f + - + + Y Site #20 5 O103:H25f + - + + Y * The isolates were recovered from two water samples, therefore, two isolates were included as unique VTEC isolates. 1 The letter denotes similar banding patterns observed among the isolates recovered from different sites on different sampling dates. 2 Similar banding patterns with control E. coli O157:H7.

123

Table 3.6 List of unique O157 and “big six” non-O157 and other serotypes recovered from surface water in the Lower Mainland of BC, number of isolates recovered and their virulence gene profiles (n=100). Virulence characteristics Serotype1 (No. of serotypes) No. of isolates (%) Comments vt1 vt2 eaeA hlyA O157 (2) 3 (3.0%) O157:H7 2 + + + + O157 isolates have the same banding pattern as O157:NM 1 + + + + control E. coli O157:H7

“Big six” non-O157 (6) 16 (16.0%) O26 O26:H11 4 + - + + O103 O103:H2 1 + - + + O103:H11 1 + - + + O103:H25 3 + - + + O111 O111:H8 3 + - + + O111:H8 1 + + + + O111:NM 1 + - + + O111:NM 2 + + + +

Others non-O157 (32) 81 (81.0%) Varied 1 Some positive samples had more than one serotype: 38 samples had one serotype and 25 samples had two or more serotypes.

124

Table 3.7 Virulence gene profiles of VTEC with the number of isolates and list of serotypes associated with each profile (n=100). Virulence gene profile No. of isolates (%) Serotypes (eaeA, hlyA, vt1 and vt2)

eaeA, vt1 1 (1.0%) O69:H11

hlyA, vt2 2 (2.0%) O8:H19

hlyA, vt1 3 (3.0%) O76:H19, O136:H12

eaeA, hlyA, vt2 3 (3.0%) O165:NM, O177:NM

vt1, vt2 4 (4.0%) O91:NM, O128:H2, O174:H8

eaeA, hlyA, vt1 and vt2 9 (9.0%) O111:H8, O111:NM, O157:H7, O157:NM, O165:H25, O165:NM

vt2 12 (12.0%) O8:H9, O22:H8, O113:H21, O116:H25, O130:H8, O141ac:H8, O168:H8, O174:H21, OR:H21

vt1 18 (18.0%) O6:H10, O136:H12, O136:H16, O146:H8, O182(O109):H5

hlyA, vt1, vt2 22 (22.0%) O8:H19, O128:H2, O151:H12, O163:NM, O163:H19, O163:NM/O163:H19, OR:NM, O?:H19

eaeA, hlyA, vt1 26 (26.0%) O5:NM, O26:H11, O69:H11, O84:H2, O98:NM, O103:H2, O103:H11, O103:H25, O111:H8, O111:NM, O156:H25

125

Table 3.8 Serotypes of isolates recovered from sediment samples collected from Site #10 in the Sumas River watershed of BC. The number of isolates recovered on each sampling date at different sampling site, serotypes, virulence gene profiles and clonality of isolates determined by BOX-PCR are shown. Isolates recovered Serotype or Virulence gene profile Clonality by BOX Sample collection 1 (sent for serotyping) others vt1 vt2 eaeA hlyA PCR July 13, 2013 5 (5) O88:H25 + + - + Y 3 isolates clonal but November16, 2013 4 (3) O103:H2 + - + + 1 not clonal1 2 (1) Non-VTEC Y 1 (1) Enterobacter Y, clonal to the 1 November 29,2013 5 (2) O103:H2 + - + + unique O103:H2 isolate recovered on November 16, 2013 1 Enterobacter were identified by VITEK® 2 Compact (BioMérieux, Saint-Laurent, Quebec, Canada). 2 The one unique O103:H2 isolate recovered on November 16, 2013 was sent for serotyping.

126

Chapter 4: Antibiotic resistance of verotoxigenic Escherichia coli isolated from surface waters and sediments in British Columbia

4.1 Introduction

Resistance to antibiotics has increased rapidly over the years due to their extensive use in human and animal medicine and in agriculture (Anderson et al., 2003; Maal-Bared et al, 2013).

Bacteria acquire resistance through mutation or by the uptake or exchange of genes that impart resistance within or between carriers (Finley et al., 2013). The development of resistance is known to be common in natural environments and in farm settings (Anderson et al., 2003).

Prevalence is often reported to be particularly high in bacteria associated with food animals, such as livestock. Transfer of antibiotic resistance to verotoxigenic Escherichia coli (VTEC) has been documented and is a concern given the potential for transmission to humans via the consumption of food and water. Antibiotic treatment of VTEC infections was long contraindicated in North

America due to the assumed potential for increased verotoxin (VT) production. However, recent studies have shown the opposite effect and reported beneficial outcomes in the treatment of

VTEC infected patients will undoubtedly stimulate increased clinical use (Nitschke et al., 2012;

Menne et al., 2012)

Allen et al. (2013) reported that 44% of clinical VTEC isolates from the province of

British Columbia were resistant to at least one antibiotic. To date, there have been few attempts to determine the extent of antibiotic resistance in VTEC from environmental sources in British

Columbia (BC) and it is unknown whether it is similar to that found in clinical strains. The

127

antibiotic resistance profiles of isolates recovered from surface waters and sediments in the

Lower Mainland of BC are examined in this chapter.

4.2 Materials and methods

4.2.1 Antibiotic susceptibility testing

As described in Chapter 3, BOX-PCR analysis revealed that 104 unique VTEC isolates of different serotypes and clonality were recovered from positive surface waters and sediment samples. The isolates were subjected to antibiotic susceptibility testing using the Kirby-Bauer disc diffusion assay (Bauer et al., 1966). A 70 µl aliquot of an 18-24 h culture grown in Mueller

Hinton broth (MH; BD) at 37˚C was mixed with 7 ml of 0.75% molten agar (44˚C) and overlaid on MH agar (BD). The plate was then incubated at ambient temperature for 10 min before applying up to four antibiotic discs to the surface of the plates which were subsequently incubated at 37°C for 24 h. Zones of inhibition were then measured to the nearest millimeter using a ruler. Assignment of the test strain to the “susceptible”, “intermediate resistance” and

“resistant” categories was based on the diameter of the inhibition zone according to the Clinical and Laboratory Standards Institute (CLSI) guidelines (2011). E. coli ATCC 25922 was used as the reference quality control strain to monitor the performance of the assay. Eighteen antibiotics were tested, including amikacin (AMK; 20/10 g), amoxicillin/clavulanic acid (AMX; 30 g), ampicillin (AMP; 10 g), cefoxitin (FOX; 30 g), ceftiofur (TIO; 30 g), ceftriaxone (CRO; 30

µg), chloramphenicol (CHL; 30 g), ciprofloxacin (CIP; 5 g), ertapenem (ETP; 10 µg), gentamicin (GEN; 10 g), imipenem (IPM; 10 g), kanamycin (BCN; 30 g), meropenem

(MEM; 10 µg), nalidixic acid (NAL; 30 g), streptomycin (STR; 10 g), tetracycline (TET; 30

128

g) and trimethoprim-sulfamethoxazole (SXT; 1.25/23.75 µg) (BD), and florfenicol (FFC; 30

µg) (Oxoid).

4.2.2 Statistical analysis

The relationship between virulence gene profile (eaeA, hlyA, vt1 and vt2 as per Chapter 3) and resistance to antibiotics was examined in strains that displayed resistance. The Chi square

(χ2) test was applied to compare the presence of individual or groups of virulence genes with resistance to the antibiotics. When the expected values were small, Fisher’s exact test was used instead. The analyses were performed with the R software package (R Core Development Team,

Vienna, Austria). The P - value was 0.05 unless otherwise specified.

4.3 Results

Resistance to the antibiotics FFC (27.9% of isolates), STR (13.5%), TET (12.5%), AMP

(9.6%), BCN (6.7%), SXT (6.7%), AMX (3.8%), CHL (2.9%), TIO (1.9%) and FOX (1%) was detected in multiple VTEC isolates (Figure 4.1). Conversely, all the isolates were susceptible to

CIP, IPM, ETP and MEM (Figure 4.1), and two isolates of serotype O174:H21 (Site #13,

January15, 2013) and O182(O109):H5 (Site #10, May 11, 2013) were susceptible to all antibiotics (Appendix 1.3). Intermediate resistance to at least one antibiotic was observed in

98.1% of the isolates (102/104) and 18.3% were of intermediate resistance to GEN (Figure 4.1).

Moreover, 90.4% and 64.4% of the isolates were either resistant or had intermediate resistance to

FFC and TET, respectively, while resistance or intermediate resistance to AMP (45.2%), STR

(41.4%), TIO (37.5%) and BCN (36.5%) were also common (Figure 4.1).

129

Isolates from VTEC serotypes belonging to O157, “big six” non-O157 and other non-

O157 serogroups had variable antibiotic resistance profiles (Table 4.2). Serotype O157:H7 isolates showed no resistance to any of the antibiotics, although intermediate resistance to FFC and CHL was observed in one isolate and to TET in the second. In contrast, the O157:NM isolate had intermediate resistance to six antibiotics (TIO, GEN, BCN, STR, TET, FFC). All four

O26:H11 isolates had intermediate resistance to FFC and one also to TET. The O103:H2,

O103:H11 and O103:H25 isolates were either resistant or had intermediate resistance to 7, 1 and

3 antibiotics respectively, notably to AMP and FFC. In contrast, the O111:H8 and O111:NM isolates were either resistant or of intermediate resistance to 10 and 11 antibiotics respectively, most commonly AMX, AMP, TIO, STR, SXT, TET and FFC. A number of additional non-O157 serotypes with resistance to 5 or more antibiotics were found, including O76:H19, O84:H2,

O98:NM, O116:H25 and O165:H25/NM. Serotype O163:H19, O163:NM and OR:NM isolates were of interest as there is a high likelihood that these were clonal (see Chapter 3). All were either resistant or had reduced susceptibility to 10 antibiotics, particularly to TIO, BCN, STR,

TET and FFC.

Forty (38.5%) of the 104 isolates were resistant to at least one antibiotic (Table 4.3). Of these, 22 (55.0%) from 15 distinct VTEC serotypes were resistant to FFC,

including an O103:H25 isolate recovered from Site #19 on November 16, 2013. One O6:H10 isolate was resistant to TET. Multiple resistance was observed in 17 (16.3%) of the isolates, including resistance to 4, 5 and 9 antibiotics in isolates of serotypes O103:H2, O111:H8 and

O111:NM, respectively. The O111:H8/NM isolates resistant to 4 antibiotics (AMP-STR-SXT-

TET) were recovered from Site #10, and the O111:H8 isolates resistant to 9 antibiotics (AMX-

AMP-TIO-FOX-STR-SXT-CHL-TET-FFC) from Site #7 in the Sumas River watershed. 130

Serotype O111:H8/NM isolates recovered from the Serpentine River watershed had varied antibiotic resistance profiles. One O111:H8 isolate showed susceptibility to almost all antibiotics and intermediate resistance only to TIO, GEN, STR, TET, FFC (Appendix 1.4). Multiple resistance was also evident in ten additional non-O157 serogroup isolates. It is noteworthy that resistance to STR and TET was common to all isolates with resistance to four or more antibiotics

(Table 4.2). The resistance profiles of the O163:H19, O163:NM and OR:NM isolates was also of interest given the possibility raised in Chapter 3 that these isolates are clonal. However, the antibiotic resistance profiles of the isolates were different, suggesting that they may not have a common lineage.

Resistance to specific antibiotics was examined against the presence of individual virulence genes and gene profiles (Table 4.4). Significantly more VTEC isolates bearing the eaeA gene were resistant to STR (eaeA+ 26.8%; eaeA- 4.8%; χ2 = 8.37, P = 0.004), SXT (eaeA+

14.6%; eaeA- 1.6%; P = 0.02) and TET (eaeA+ 26.8%; eaeA- 3.2%; χ2 = 10.42, P = 0.001) than were isolates lacking the gene (Table 4.3). Eleven (84.6%) of 13 eaeA positive VTEC were resistant to three or more antibiotics. In contrast, no relationship was found between antibiotic resistance and the presence of either hlyA, vt1 or vt2 genes alone or in combination.

4.4 Discussion

Eighteen antibiotics used in human medicine and agriculture were included in the analysis of resistance in VTEC recovered from surface waters and sediments. Overall, resistance to STR, SXT and TET was more frequent in strains bearing the eaeA gene. Mora et al. (2005) also found higher rates of resistance in eaeA positive non-O157 VTEC, particularly to STR and

TET, although a similar relationship was found in strains with the vt1 gene. The lack of 131

association with the presence of the vt1 gene is also in disagreement with an examination of 88 human non-O157 VTEC recovered in Germany by Schmidt et al. (1998), who observed multiple antibiotic resistance in 68% of vt1 positive strains compared with 16% vt2 positive and 16% vt1vt2 positive strains. It must be noted that the strains examined in previous studies and in the present work were clearly isolated from different environments. Consequently, broad conclusions about the association between virulence factors and antibiotic resistance would be premature.

However, the results of the present work are suggestive of a trend that warrants further investigation to verify the association between VTEC virulence gene profile and antibiotic resistance in strains common to BC.

All strains examined in the present work were susceptible to CIP, IPM, ETP and MEM.

The use of CIP for animal health in Canada is reported to be low (381 kg, Table 4.1) while IPM,

ETP and MEM are not registered in Canada either for treatment, disease prevention and/or growth promotion; consequently, the absence of resistance to CIP, IPM, ETP and MEM in

VTEC isolates was expected. Other studies which included CIP and IPM in panels of antibiotics tested against E. coli O157:H7/O157:NM and non-O157 VTEC isolated from livestock and environmental samples also led to the conclusion that resistance to these antibiotics is rare in

VTEC (Meng et al., 1998; Mora et al., 2005; Gow and Waldner, 2009; Cabal et al., 2013; Maal-

Bared et al., 2013). A similar observation was derived from the analysis of clinical O157 (n=10) and non-O157 (n=15) isolates from the province of BC (Allen et al., 2013). The second generation fluoroquinolone CIP has been used sparingly for the treatment of VTEC infections since it was shown to cause the induction of VT-bacteriophage and VT production in both in vivo and in vitro studies in a mouse model (Zhang et al., 2000). However, CIP continues to be used as a second line agent for severe urinary tract infections in some countries, notably in Ireland 132

(Carey et al., 2011). More importantly, a mixture of CIP and the carbapenem MEM was successfully used to alleviate the symptoms of HUS caused by E. coli O104:H4 in patients affected by a large sprout-associated outbreak in Germany (Menne et al., 2012). The carbapenem class antibiotics, including MEM, IPM and ETP are considered “antibiotics of last resort” for use when more conventional therapies have failed to control infections caused by Gram-negative bacteria (Papp-Wallace et al., 2011). It was therefore reassuring to note that none of the VTEC isolates examined in this work were resistant to antibiotics likely to be deployed to treat severe infections caused by VTEC.

In contrast, the frequency of resistance to STR, TET and AMP is more troubling given that these antibiotics remain of high importance in human medicine (CIPARS, 2011). Use of ß- lactam and tetracycline classes of antibiotics is common in BC livestock production (Table 4.1;

CIPARS, 2014a; Radke, 2014a). A recent report by the Canadian integrated program for antimicrobial resistance surveillance (2014) showed that resistance to TET in generic E. coli was high for bovine (45/165 isolates), avian (88/173) and swine (154/184) isolates recovered from abattoir samples collected across Canada. Reported resistance to ß-lactam and aminoglycoside classes of antibiotics were also high for E. coli isolates recovered from poultry and swine abattoirs, but not from establishments that slaughter cattle where only 1/165 isolates was resistant to AMP and STR, compared with 68 and 87/173 avian, and 66 and 73/184 swine isolates, respectively (CIPARS, 2014b). In comparison, fully 46.9% of clinical E. coli isolates recovered in BC in 2012 (n=26,288) were reported to be resistant to AMP (BCCDC, 2013). The prevalence of STR resistance in clinical BC E. coli isolates was not reported, however 8.3%

(n=26,289) were resistant to GEN which belongs to the same aminoglycoside class of antibiotic as STR (BCCDC, 2013). Resistance to AMP and GEN in BC increased significantly (AMP: P < 133

0.001; GEN: P = 0.025) between 2007 and 2012 (BCCDC, 2013). Finally, the prevalence of

SXT resistance in the present study was low (6.8%), a result in line with overall rates reported in

Canadian abattoir isolates (bovine 0/165 isolates; avian 26/173; swine 25/184) (CIPARS,

2014b).

National and provincial rates of antibiotic resistance alluded to above were derived from the examination of generic E. coli strains from food animal sources and clinical isolates that cause a variety of human infections. There is presently little information on antibiotic resistance in VTEC from environments that are affected by animal production in the Lower Mainland of

BC. The only available data was derived from an investigation of the Elk Creek watershed located to the east of the Municipality of Chilliwack in an area used extensively for agriculture

(dairy farming, poultry production, intensive horticulture). Serotype O157:H7 strains isolated from water, sediment and biofilms in the Elk Creek watershed were found to be resistant to TET

(18/27), AMP (3/27) and STR (2/27) (Maal-Bared et al., 2013). Some of the strains recovered from other Lower Mainland watersheds examined in the present work were also resistant to TET,

AMP and STR, which suggests that resistance to these antibiotics may be widespread. Maal-

Bared et al. (2013) also recovered O157:H7 strains resistant to NAL (2/27). None of the

O157:H7 isolates recovered in this study were resistant to NAL, although one serotype O146:H8 strain from the Nickomekl River (Site # 12, January 15, 2012) displayed intermediate resistance.

Furthermore, Maal-Bared et al. (2013) reported that generic E. coli and E. coli O157:H7 isolates from sediment and biofilms in the Elk Creek watershed had more complex antibiotic resistance profiles than those recovered from water. In this light, it is interesting to note that a serotype

O103:H2 strain recovered from sediment (Sumas River watershed, Site #10, November 29th,

134

2013) was resistant to 6 antibiotics. The possibility that multiple antibiotic resistance promotes survival in sediments clearly warrants further investigation.

The use of the amphenicol CHL antibiotic is discouraged for veterinary applications in order to avoid the generation of chloramphenicol-resistant bacteria. FFC is widely used as an alternative for the treatment of swine and bovine respiratory disease (White et al., 2000), and for the treatment of furunculosis in farmed salmon (Anonymous, 2010). White et al. (2000) found that resistance to amphenicols was common in E. coli recovered from bovine diarrhea where

92% and 90% (n=48) of isolates were resistant to FFC and CHL, respectively. In the present work, rates of resistance to CHL in VTEC were far lower, in line with previous research which indicated absence or limited resistance to this antibiotic (Meng et al., 1998 (0/30 O157 isolates);

Mora et al., 2005, (6/141 O157 isolates, 44/581 non-O157 isolates). There are comparatively few reports of FFC resistance in VTEC. In the present work, VTEC isolates with intermediate and full resistance to FFC were common. The 2002 report by Health Canada indicated that FFC is employed in chicken and fish production and CHL in the care of domestic animals. Amphenicol use in Canada is relatively small (3,242.03 kg; Table 4.1) compared with other antibiotics, although data specific to BC is lacking. However, the prevalence of FFC resistance reported here is suggestive of usage in the geographic area examined in the study. Furthermore, there is evidence that some antibiotics including FFC remain biologically active in soil for extended periods of time (Subbiah et al., 2011). Practices such as the land application of manures from livestock species could contribute to higher rates of resistance through long-term exposure to sub-therapeutic concentrations of antibiotics in natural environments.

Resistance to STR, TET and AMP in VTEC has been documented in generic E. coli recovered from livestock, food and humans (Meng et al., 1998 (30 O157 – STR 96.7%, TET 135

86.7%); Mora et al., 2005 (141 O157- STR 36%, TET 35%, AMP 7%; 581 non-O157 - STR

28%, TET 31%, AMP 10%); Gow and Waldner, 2009; Cabal et al., 2013). Penicillin and tetracylines class of antibiotics are reported to be commonly used in veterinary medicine in BC

(Radke, 2014a), though its particular usage in agriculture has not been documented. Retail surveillance in BC (2012) indicated that E. coli isolated from beef (n=70) were resistant to TET

(34%), STR (20%) and AMP (4%) (CIPARS, 2014b). High resistance was also observed in E. coli from BC retail chicken, pork and turkey meats (CIPARS, 2014b). Isolates from chicken and turkey were resistant to more antibiotics than beef (CIPARS, 2014b). There is little information on TIO and BCN resistance in VTEC, although Allen et al. (2013) noted intermediate resistance in some clinical isolates from BC. Mora et al. (2005) found that 8/141 O157 and 40/581 non-

O157 serotypes were resistant to BCN, an observation repeated by Cabal et al. (2013), although the latter did not report a rate of resistance.

Serotype O157 isolates were susceptible to all antibiotics tested except CHL, TIO, GEN,

BCN, STR, TET and FFC. The number of O157 isolates was small (n=3) however, and precluded comparison with previous studies performed with larger sample sizes (Meng et al.,

1998; Mora et al., 2005; Gow and Waldner, 2009; Cabal et al., 2013; Maal-Bared et al., 2013;

Allen et al., 2013). Various resistance profiles were seen with non-O157 isolates from other “big six” serogroups. O26:H11 and O103:H11 isolates were susceptible to most antibiotics but had intermediate resistance to TET and FFC. Resistance to TET was observed in one of four

O26:H11 BC clinical isolates by Allen et al. (2013), and resistance to 5 or more antibiotics was found in eight O26:H11 isolates tested by Mora et al. (2005). Resistance profiles for isolates from serotypes O103:H2, O103:H25, O111:H8 and O111:NM reported here were generally more

136

complex, particularly for the O111 serogroup. Mora et al. (2005) found that three O111:NM isolates were resistant to 5 or more antibiotics.

Multiple resistance was also found in strains of O69:H11, O116:H25, O163:H19/NM and

O165:H25/NM, serotypes that are commonly associated with human disease (Bettleheim, 2007).

In parallel with results obtained with a clinical strain from BC (Allen et al., 2013), the O165:NM isolate recovered from water in the present work was resistant to several antibiotics, notably

TET, which often occurs in tandem with resistance to other antibiotics (Kümmerer, 2004).

Antibiotic resistant Gram-negative bacterial pathogens have been detected in natural and agricultural environments in many jurisdictions (Meng et al., 1998; Mora et al., 2005; Gow and

Waldner, 2009; Cabal et al., 2013; CIPARS, 2014). In the present work, a range of VTEC with variable antibiotic resistance profiles was found in four watersheds known to be affected by urban development and intensive agriculture in the Lower Mainland of BC. Resistance to specific classes or types of antibiotics is known to be species-associated. For example, resistance to quinolones and β-lactams is recurrent in bacteria of avian origin (Mora et al., 2005; Cabal et al., 2013), while high SXT resistance is more common in pig isolates (Jakobsen et al., 2011), and resistance to GEN, BCN and CHL are often reported in bovine isolates (Meng et al., 1998; Mora et al., 2005; Gow and Waldner, 2009; Cabal et al., 2013). These observations were corroborated in E. coli recovered from abattoirs across Canada where multiple resistance was more common in avian (101/173 isolates) and pig (124/184) isolates than in bovine (20/165) isolates (CIPARS,

2014). Furthermore, multiple resistance in isolates recovered from retail meats sold in BC was higher in chicken (40/74) and turkey (49/101) than in beef (17/70) and pork (7/37). Further analysis of antibiotic resistance in VTEC isolated in BC watersheds could provide important clues about the origin of these bacteria and factors that promote the development of resistance. 137

4.5 Conclusion

VTEC with resistance to a range of antibiotics commonly used in human medicine and in agriculture were detected in surface waters used for the irrigation of crops in the Lower

Mainland of BC. Given the lack of information on antibiotics used in agriculture in the province, it was difficult to account for some of the observed antibiotic resistance profiles. Probable causes for resistance to specific antibiotics must also remain a matter of speculation. Nevertheless, the observations derived from this work point to the potential emergence of VTEC that could prove difficult to treat with existing antibiotics.

138

Table 4.1 List of test antibiotics and their class, category, animal/human usage and quantity of each antibiotic class distributed for animal usage in Canada. Quantity distributed for Class of antibiotics (category)1 Antibiotics Human Animal animal usage in Canada 2010 (CIPARS, 2014a) Aminoglycosides (II) Amikacin Yes Yes Gentamicin Yes Yes 3961 kg Kanamycin Yes Yes Streptomycin Yes Yes Β-lactams Aminopenicillins; Amoxicillin-clavulanic acid Yes Yes Beta-lactamase Inhibitors (I) Aminopenicillins (II) Ampicillin Yes Yes Carbapenems (I) Ertapenem Yes No 201,934 kg Imipenem Yes No Meropenem Yes No Cephalosporins, second generation (II) Cefoxitin Yes Yes Cephalosporins, third generation (I) Ceftiofur Yes Yes Ceftriaxone Amphenicols (III) Chloramphenicol Yes Yes 3,242.03 kg* Florfenicol No Yes Fluoroquinolone, second generation (I) Ciprofloxacin Yes Yes 381 kg Quinolones (II) Nalidixic acid Yes Yes N/A Tetracyclines (III) Tetracycline Yes Yes 535,142 kg Trimethoprim- Trimethoprim/Sulfonamides (I) Yes Yes 48,221 kg sulfamethoxazole 1 Category I is the most important in human medicine and Category III is the least important. 2 Data taken from CIPARS 2008 Annual Report (CIPARS, 2011). 139

Table 4.2 Antibiotic resistance profiles of VTEC (n=104) from different serotypes recovered from surface water and sediment in the Lower Mainland of BC. The number of isolates tested and their resistance or intermediate resistance to each antibiotic are given. Serotype No. of isolates Resistance phenotype (No. of isolates) O157 O157:H7 2 CHLI(1), TETI(1), FFCI(2) O157:NM 1 TIOI, GENI, BCNI, STRI, TETI, FFCI

“Big six” non-O157 O26 O26:H11 4 TETI(1), FFCI(4) O103 O103:H2 4 AMPI(3), BCNI(1), STR(1), SXT(1), CHL(1), TET(1), FFCI(4) O103:H11 1 FFCI O103:H25 3 AMPI(3), TIOI(1),FFC(1)I(2) O111 AMXI(2), AMP(2), TIO(1)I(2), GENI(1), BCN(1), STR(3)I(1), SXT(2), CHL(1), O111:H8 4 TET(3)I(1), FFC(2)I(2) AMX(1)I(2), AMP(3), TIO(1)I(1), FOX(1), GENI(1), BCN(1)I(1), STR(3), SXT(2), O111:NM 3 CHL(1), TET(3), FFC(2)I(1)

Other non-O157 O5:NM 4 AMXI(3), AMPI(2), TETI(2), FFC(1)I(3) O6:H10 1 STRI, TET O8:H9 1 AMPI, FFCI O8:H19 3 TET(3), FFCI(3) O22:H8 1 AMXI, AMPI, TETI, FFC O69:H11 2 AMXI(2), AMP(2), STR(2), SXT(2), TET, FFCI(2) AMXI(1), AMPI(1), TIOI(2), GENI(1), BCNI(1), STRI(1), CHLI(1), TETI(1), O76:H19 2 FFC(1)I(1) O84:H2 3 AMKI(1), AMPI(3), TIOI(2), BCNI(3), STRI(3), CHLI(1), TETI(3), FFCI(3) O88:H25 1 AMPI, TETI, FFC 140

Table 4.2 continued Serotype No. of isolates Resistance phenotype (No. of isolates) Other non-O157 O91:NM 1 STRI, FFCI O98:NM 3 TIOI(1), GENI(1), BCNI(1), STRI(2), CHLI(2), TETI(3), FFCI(3) O113:H21 1 FFCI AMKI(3), AMX(3), AMP(3), TIOI(3), FOXI(3), CROI(3), GENI(3), BCNI(3), O116:H25 3 STRI(3), CHLI(1), TETI(3), FFCI(3) O128:H2 3 AMPI(2), TIOI(1), TETI(3), FFCI(2) O130:H8 1 AMXI, AMPI, TETI, FFC O136:H12 7 AMPI(3), TIOI(1), FFCI(7) O136:H16 1 FFCI O141ac:H8 1 TETI, FFC O146:H8 2 BCNI(2), NALI(1), TETI(2), FFC(1)I(1) O151:H12 1 TIOI, FFCI O156:H25 2 TETI(1), FFC(1)I(1) O163:H19/O163:NM/ AMKI(1), AMXI(6), AMPI(9), TIOI(13), GENI(9), BCN(2)I(14), STR(1)I(15), 18 OR:NM CHLI(4), TETI(18), FFC(10)I(8) O165:H25 2 AMPI(2), TIOI(1), BCN(2), STR(2), TET(2), FFC(2) O165:NM 3 AMPI(3), BCN(1), STR(1), TET(1)I(2) , FFC(3) O168:H8 1 AMPI, TIOI, GENI, BCNI, STRI O174:H8 1 AMPI, TIOI, GENI, BCNI, STR, TETI, FFC O174:H21 2 AMXI(1) O177:NM 1 TETI, FFCI O182(O109):H5 8 TIOI(5), BCNI(3), TETI(4), FFC(1)I(4) OR:H21 1 FFCI O?H19 1 FFCI I Denotes intermediate resistance to the antibiotic. List of antibiotics: amikacin (AMK), amoxicillin/clavulanic acid (AMX), ampicillin (AMP), cefoxitin (FOX), ceftiofur (TIO), ceftriaxone (CRO), chloramphenicol (CHL), ciprofloxacin (CIP), ertapenem (ETP), gentamicin (GEN), imipenem (IPM), kanamycin (BCN), meropenem (MEM), nalidixic acid (NAL), streptomycin (STR), tetracycline (TET), trimethoprim-sulfamethoxazole (SXT) and florfenicol (FFC).

141

Table 4.3 Antibiotic resistance profiles, serotypes and number of isolates belonging to each profile for VTEC isolates from four watersheds in the Lower Mainland of BC. No. of No. of isolates Antibiotic resistance profile List of serotypes (No. of isolates)* resistance (%) (No. of isolates)* 1 23 (22.3%) TET O6:H10

FFC(22) O5:NM, O22:H8, O76:H19, O88:H25, O103:H25, O130:H8, O141ac:H8, O146:H8, O156:H25, O163:NM(3), O165:NM(2), O168:H8, O174:H8, O182(O109):H5, OR:NM(5)

2 4 (3.9%) AMX-AMP(3) O116:H25(3)

BCN-FFC O163:H19/O163:NM

3 1 (1%) BCN-STR-FFC O163:H19

4 8 (7.7%) AMP-STR-SXT-TET(4) O69:H11(2), O111:H8, O111:NM

BCN-STR-TET-FFC(3) O165:H25(2), O165:NM

STR-SXT-CHL-TET O103:H2

5 3 (2.9%) AMP-BCN-STR-TET-FFC O111:NM

AMP-TIO-BCN-STR-TET O111:H8

STR-SXT-CHL-TET-FFC O111:H8

9 1 (1%) AMX-AMP-TIO-FOX-STR- O111:NM SXT-CHL-TET-FFC Total 40 (38.8%) * Bolded serotypes belong to the “big six” serotype. List of antibiotics: amoxicillin/clavulanic acid (AMX), ampicillin (AMP), cefoxitin (FOX), ceftiofur (TIO), chloramphenicol (CHL), kanamycin (BCN), streptomycin (STR), tetracycline (TET), trimethoprim-sulfamethoxazole (SXT) and florfenicol (FFC). 142

Table 4.4 Number and percentage (of total) of VTEC isolates resistant to specific antibiotics and associated virulence genes.1 2 + 3 - + + + + Antibiotic eaeA (n=41) eaeA (n=62) hlyA (n=69) vt1 (n=86) vt2 (n=52) vt1 vt2 (n=35)

AMX (n=4)4 1 2.4% 3 4.8% 1 1.4% 1 1.2% 4 7.7% 1 2.9%

AMP (n=10) 7 17.1% 3 4.8% 6 8.7% 7 8.1% 6 11.5% 3 8.6%

TIO (n=2) 2 4.9% 0 0% 2 2.9% 2 2.3% 1 1.9% 1 2.9%

FOX (n=1) 1 2.4% 0 0% 1 1.4% 1 1.2% 1 1.9% 1 2.9%

BCN(n=7) 5 12.2% 2 3.2% 7 10.1% 7 8.1% 5 9.6% 5 14.3%

STR (n=14) 11* 26.8% 3* 4.8% 12 17.4% 14 16.3% 8 15.4% 8 22.9%

SXT (n=7) 6* 14.6% 1* 1.6% 6 8,7% 7 8.1% 3 5.8% 3 8.6%

CHL (n=3) 2 4.9% 1 1.6% 3 4.3% 3 3.5% 1 1.9% 1 2.9%

TET (n=13) 11* 26.8% 2* 3.2% 11 15.9% 13 15.1% 6 11.3% 6 17.1%

FFC (n=29) 11 26.8% 18 29.0% 23 33.3% 23 26.7% 21 40.4% 15 71.4%

1 + - + + + Table shows the number and percentage of eaeA , eaeA , hlyA , vt1 , vt2 and vt1vt2 for each resistant antibiotic. No significant difference was observed in the - - - antibiotic phenotype with the presence and absence of hlyA, vt1 and vt2, genes, therefore the number and percentage of hlyA , vt1 , vt2 for each resistant antibiotic was not provided. 2 List of antibiotics: amoxicillin/clavulanic acid (AMX), ampicillin (AMP), cefoxitin (FOX), ceftiofur (TIO), chloramphenicol (CHL), kanamycin (BCN), streptomycin (STR), tetracycline (TET), trimethoprim-sulfamethoxazole (SXT) and florfenicol (FFC). 3 n is the number of VTEC isolates positive for eaeA, hlyA, vt1 and vt2 genes and negative for the eaeA gene. 4 n is the number of VTEC isolates resistant to each antibiotic. * Significant (P < 0.05) using the Chi square (χ2) test.

143

100%

90%

80%

70%

60%

50%

40%

30%

20%

10%

0% AMK AMX AMP TIO FOX CRO CIP GEN BCN NAL STR SXT CHL TET IPM ETP MEM FFC Susceptible (%) Intermediate resistance (%) Resistant (%)

Chapter 5: Conclusion and future direction

5.1 Conclusion

The present study is one of the first that aimed to determine the occurrence and characteristics of verotoxigenic Escherichia coli (VTEC) in irrigation water and fresh produce across the Lower Mainland of British Columbia (BC). An overall prevalence rate of 19.1% in surface waters used for irrigation provided clear evidence of contamination with VTEC. Given the intensity of animal production in some regions, notably the Sumas, Nicomekl and Serpentine

River watersheds, there is a high probability that these activities are contributing to the dispersal of VTEC in the environment and the contamination of surface waters. Prevalence was higher in the Sumas, Nicomekl and Serpentine River watersheds than the Lower Fraser watershed where livestock production has declined in recent years.

VTEC prevalence rates varied seasonally between 13.3% and 34.2% in the four watersheds. Temperature and precipitation accumulation before sampling had negative and positive correlation to VTEC occurrence, respectively, which resulted in a lower prevalence during the growing season. This observation could account for the lack of detection in fresh produce collected from farmer’ markets during the summer months. However, the sample size was limited and analytical difficulties associated with sample preparation for analysis by the

HGMF-immunoblot method could have interfered with recovery of VTEC from fresh produce.

Nonetheless, the frequent presence of VTEC in water used for irrigation is a potential concern, given the high consumption of locally-grown produce in the province of BC.

145

Despite the small number of samples analysed, the prevalence of VTEC in sediment was high. This suggested the possibility that sediment serves as a reservoir for VTEC, however, the simultaneous occurrence of these bacteria in water and sediment was not observed in this study.

The diversity of serotypes, virulence gene profiles and antibiotic resistance observed in isolates characterized in the present work were indicative of multiple sources of contamination.

Furthermore, the presence of serotypes known to cause human infections (particularly O157 and

“big six” non-O157) signaled potential safety risks associated with the use of surface waters to irrigate crops that are meant to be consumed raw. In addition, current methods for the assessment of the microbiological quality of irrigation water based on the presence of fecal coliforms and E. coli did not reliably predict the risk of contamination with VTEC.

Therefore, considering the hypotheses stated at the outset of this study:

1. Surface waters used for irrigation and sediments in the Lower Mainland of BC are

reservoir for VTEC. This hypothesis is accepted.

2. The prevalence rate of VTEC in fresh produce from across the Lower Mainland of

BC is high. This hypothesis is not accepted.

3. The occurrence of VTEC in surface waters used for irrigation is determined by

environmental factors. This hypothesis is accepted.

4. Diverse VTEC serotypes with variable virulence gene and antibiotic resistance

profiles are present in the environment of BC. This hypothesis is accepted.

5. Fecal coliform/E. coli counts can be used as indicator for VTEC occurrence in surface

waters used for irrigation in BC. This hypothesis is not accepted.

146

5.2 Future direction

In this study, it was shown that surface waters used to irrigate crops in the Lower

Mainland of BC are contaminated with VTEC. However, the putative source(s) of VTEC were not identified. Future research, using source tracking techniques, for example, should be conducted to identify the origins of these microorganisms. The collection of isolates derived from the present work will be useful for this purpose. Comparative genomic analysis with isolates known to be associated with animal species could provide some important clues about potential sources of VTEC. In addition, factors that contribute to persistence of VTEC in surface waters and sediments should be examined in greater detail. Collectively, this information would be invaluable for the development of strategies to improve the microbiological quality of surface waters used for irrigation.

Finally, there is a need to conduct more comprehensive surveys of fresh produce grown in the Province of BC, to verify the link between the microbiological quality of irrigation water and the risk of contamination with human pathogens. Improvements in methods for the preparation of samples from various produce types will be required to enhance the reliability of analyses and the validity of future surveys.

147

Bibliography

Allen, K.J., Laing, C.R., Cancarevic, A., Zhang, Y., Mesak, L.R., Xu, H., Paccagnella, A., Gannon, V.P.J., Hoang, L., 2013. Characteristics of clinical Shiga toxin-producing Escherichia coli isolated from British Columbia. Journal of Biomedicine and Biotechnology 11, Article ID 878956.

Anderson, G.G., Palermo, J.J., Schilling, J.D., Roth, R., Heuser, J., Hultgren, S.J., 2003. Intracellular bacterial biofilm-like pods in urinary tract infections. Science 301, 5629, 105–107.

Anonymous, 2003. Treating irrigation and crop was water for irrigation. Retrieved October, 2014 from http://www.agf.gov.bc.ca/resmgmt/publist/500Series/512000-3.pdf

Anonymous, 2010. List of veterinary drugs that are authorized for sale by Health Canada for use in food-producing aquatic animals. Retrieved October 29, 2014 from http://www.hc- sc.gc.ca/dhp-mps/vet/legislation/pol/aquaculture_anim-eng.php.

Anonymous, 2013. Fast stats 2012 – Agriculture, seafood and agrifood. Retrieved August 20, 2014, from http://www.agf.gov.bc.ca/stats/faststats/FastStats2012.pdf

Anonymous, 2014. 2013 short report FoodNet Canada – Canada’s national Integrated enteric pathogen surveillance system. Retrieved October 20, 2014 from http://publications.gc.ca/collections/collection_2014/aspc-phac/HP37-17-1-2013- eng.pdf

Arthur, T.M., Brichta-Harhay, D.M., Bosilevac, J.M., Kalchayanand, N., Shackelford, S.D., Wheeler, T.L., Koohmaraie, M., 2010. Super shedding of Escherichia coli O157:H7 by cattle and the impact on beef carcass contamination. Meat Science 86, 32–37.

Aruscavage, D., Miller, S.A., Lewis-Ivey, M.L., Lee, K., LeJeune, J.T., 2008. Survival and dissemination of Escherichia coli O157:H7 on physically and biologically damaged lettuce plants. Journal of Food Protection 71, 2384-2388.

Atwill, R., Lewis, D., Pereira, M., Huerta, M., Bond, R., Ogata, S., Bass, P., 2007. Characterizing freshwater inflows and sediment reservoirs of fecal coliforms and E. coli at five estuaries in Northern California. University of California School of Veterinary Medicine and Cooperative Extension in Sonoma and Marin Counties, Davis, CA. Retrieved October 25, 2014 from http://ucce.ucdavis.edu/files/filelibrary/2161/41255.pdf.

148

Barkocy-Gallagher, G.A., Arthur, T.M., Rivera-Betancourt, M., et al., 2003. Seasonal prevalence of Shiga toxin-producing Escherichia coli, including O157:H7 and non-O157 serotypes, and Salmonella in commercial beef processing plants. Journal of Food Protection 66, 1978–1986.

Bauer, A.W., Kirby, W.M.M., Sherris, J.C., Turck, M., 1966. Antibiotic susceptibility testing by a standardized single disk method. American Journal of Clinical Pathology 36, 493-496.

Beaulieu, M.S., 2004. Manure management in Canada. Retrieved October 1, 2014 from http://dsp-psd.pwgsc.gc.ca/Collection/Statcan/21-021-M/21-021-MIE2004001.pdf

Bennani, M., Badri, S., Baibai, T., Oubrim, N., Hassar, M., Cohen, N., Amarouch, H., 2011. First detection of Shiga toxin-producing Escherichia coli in shellfish and coastal environments of Morocco. Applied Biochemistry and Biotechnology doi:10.1007/s12010-011-9251-x.

Bettelheim, K.A. 2001. Enterohaemorrhagic Escherichia coli O157:H7: a red herring? Journal of Medical Microbiology 50, 201–202.

Bettelheim, K.A., 2003. Non-O157 verotoxin-producing Escherichia coli: a problem, paradox, and paradigm. Experimental Biology and Medicine 228, 333–344.

Bettelheim, K.A., 2007. The non-O157 Shiga-toxigenic (verocytotoxigenic) Escherichia coli; under-rated pathogens. Critical Reviews in Microbiology 33, 67-87.

Bettelheim, K.A., Bowden, D.S., Doultree, J., Catton, M.G., Chibo, D., Ryan, N.J.P., Wright, P.J., Gunesekere, I.C., Griffith, J.M., Lightfoot, D., Hogg, G.G., Bennett-Wood, V., and Marshall, J.A., 1999. Combined infection of norwalk-like virus and verotoxin- producing bacteria associated with a gastroenteritis outbreak. Journal of Diarrhoeal Diseases Research 17, 34–36.

Bevilacqua, P.D., Bastos, R.K., Mara, D.D., 2014. An evaluation of microbial health risks to livestock fed with wastewater-irrigated forage crops. Zoonoses Public Health 61, 4, 242-249.

Bielaszewska, M., Idelevich, E.A., Zhang, W., Bauwens, A., Schaumburg, F., Mellmann, A., Peters, G., Karch, H., 2012. Effects of antibiotics on Shiga toxin 2 production and bacteriophage induction by epidemic Escherichia coli O104:H4 strain. Antimicrobial Agents and Chemotherapy 56, 3277-3282.

149

Bielaszewska, M., Mellmann, A., Zhang, W.L., Köck, R., Fruth, A., Bauwens, A., Peters, G., Karch, H, 2011. Characterisation of the Escherichia coli strain associated with an outbreak of haemolytic uraemic syndrome in Germany, 2011: a microbiological study. The Lancet Infectious Diseases 11, 9, 671-676.

Bielaszewska, M., Zhang, W., Mellmann, A., Karch, H., 2007. Enterohaemorrhagic Escherichia coli O26:H11/H-: a human pathogen in emergence. Berliner und Münchener tierärztliche Wochenschrift 120, 7-8, 279-87.

Blanco, M., Blanco, J.E., Mora, A., Dahbi, G., Alonso, M.P., González, E.A., Bernández, M.I., Blanco, J., 2004. Serotypes, virulence genes and intimin types of Shiga toxin (verotoxin)-producing Escherichia coli isolates from cattle in Spain and identification of a new intimin variant gene (eae-ξ). Journal of Clinical Microbiology 42, 2, 645-651.

Blum-Oehler, G., Hacker, J., 2007. In appreciation of Theodor Escherich. Nature Reviews Microbiology 5, 12, 902.

Boerlin, P., McEwen, S.A., Boerlin-Petzold, F., Wilson, J.B., Johnson, R.P., Gyles, C.L., 1999. Associations between virulence factors of Shiga toxin-producing Escherichia coli and disease in humans. Journal of Clinical Microbiology 37, 3, 497–503.

Bohaychuk, V.M., Bradbury, R.W., Dimock, R., Fehr, M., Gensler, G.E., King, R.K., Rieve, R., Romer Barrios, P., 2009. A microbiological survey of selected Alberta-grown fresh produce from farmers' markets in Alberta, Canada. Journal of Food Protection 72, 415- 420.

British Columbia Center of Disease Control, 2013. British Columbia annual summary of reportable diseases 2012. Retrieved August 10, 2014, from http://www.bccdc.ca/NR/rdonlyres/F30377E3-D33E-4755-B3F4- 6844E01BD678/0/FinalAR2012.pdf

Brooks, J.T., Sowers, E.G., Wells, J.G., et al., 2005. Non-O157 Shiga toxin-producing Escherichia coli infections in the United States, 1983–2002. The Journal of Infectious Diseases 192, 1422–1429.

Burfield, T., 2003. U.S. in catch-up mode: Canadians consume more produce than Americans. Produce Merchandising 16, 1-3.

150

Byappanahalli, M.N., Sawdey, R., Ishii, S., Shively, D.A., Ferguson, J.A., Whitman, R.L., Sadowsky, M.J., 2009. Seasonal stability of Cladophora-associated Salmonella in Lake Michigan watersheds. Water Research 43, 806–814.

Carey, B., Murphy, M., Bradley, C., Cunney, R., Byrne, S., O’Connor, N., Sheehan, A., 2011. Guidelines for antimicrobial prescribing in primary care in Ireland, Health Protection Surveillance Centre: Dublin, Ireland, pp. 24.

Carr, G.M., Morin, A., Chambers, P.A., 2005. Bacteria and algae in stream periphyton along a nutrient gradient. Freshwater Biology 50, 1337–1350.

CBCNEWS, 2014a. More than 20 sick after E. coli outbreak in Edmonton. Retrieved August 20, 2014, from http://www.cbc.ca/news/canada/edmonton/more-than-20-sick-after-e-coli- outbreak-in-edmonton-1.2725777

CBCNEWS, 2014b. 122 Albertans diagnosed with E. coli as AHS looks for cause. Retrieved August 20, 2014, from http://www.cbc.ca/news/canada/edmonton/122-albertans- diagnosed-with-e-coli-as-ahs-looks-for-cause-1.2741491

Centers for Disease Control and Prevention, 1982. Isolation of E. coli O157:H7 from sporadic cases of hemorrhagic colitis – United States. Morbidity and Mortality Weekly Report 31, 580-585.

Centers for Disease Control and Prevention, 2006. Update on multi-state outbreak of E. coli O157:H7 infections from fresh spinach, October 6, 2006. Retrieved August 10, 2014, from http://www.cdc.gov/ecoli/2006/september/updates/100606.htm

Centers for Disease Control and Prevention, 2010. Investigation update: multistate outbreak of human E. coli O145 infections linked to shredded romaine lettuce from a single processing facility. Retrieved August 10, 2014, from http://www.cdc.gov/ecoli/2010/ecoli_o145/index.html

Centers for Disease Control and Prevention, 2012. Multistate outbreak of Shiga toxin-producing Escherichia coli O26 infections linked to raw clover sprouts at Jimmy John's restaurants (final update). Retrieved August 10, 2014, from http://www.cdc.gov/ecoli/2012/O26- 02-12/index.html

Centers for Disease Control and Prevention, 2013. Multistate outbreak of Shiga toxin-producing Escherichia coli O157:H7 infections linked to ready-to-eat salads (final update). Retrieved August 10, 2014, from http://www.cdc.gov/ecoli/2013/O157H7-11- 13/index.html

151

Centers for Disease Control and Prevention, 2014. Multistate outbreak of Shiga toxin-producing Escherichia coli O121 infections linked to raw clover sprouts (final update). Retrieved August 10, 2014, from http://www.cdc.gov/ecoli/2014/O121-05-14/index.html

Chase-Topping, M.E., McKendrick, I.J., Pearce, M.C., MacDonald, P., Matthews, L., Halliday, J., Allison, L., Fenlon, D., Low, J.C., Gunn, G., Woolhouse, M.E.J., 2007. Risk factors for the presence of high-level shedders of Escherichia coli O157 on Scottish farms. Journal of Clinical Microbiology 45, 5, 1594-1603.

Cinotto, P.J., 2005. Occurrence of fecal-indicator bacteria and protocols for identification of fecal contamination sources in selected reaches of the West Branch Brandy-wine Creek, Chester County, Pennsylvania. U.S. Geological Survey Scientific Investigation Report 5039, 91.

CIPARS, 2011. Canadian integrated program for antimicrobial resistance surveillance (CIPARS) 2008 – Annual report. Retrieved October 25, 2014 from http://www.phac- aspc.gc.ca/cipars-picra/2008/index-eng.php

CIPARS, 2014a. Canadian integrated program for antimicrobial resistance surveillance (CIPARS) 2012 – Annual report. Retrieved October 31, 2014 from http://publications.gc.ca/collections/collection_2014/aspc-phac/HP2-4-2010-eng.pdf

CIPARS, 2014b. Canadian integrated program for antimicrobial resistance surveillance (CIPARS) 2012 – Annual report. Retrieved October 31, 2014 from http://publications.gc.ca/collections/collection_2014/aspc-phac/HP2-4-2012-2-eng.pdf

Clinical and Laboratory Standards Institute, 2011. M100-S21 (M2). Disk diffusion supplemental tables, CSLI, Wayne, Pa.

Cook, K.L., Bolster, C.H., Ayers, K.A., Reynolds, D.N., 2011. Escherichia coli diversity in livestock manures and agriculturally impacted stream waters. Current Microbiology 63, 439-449.

Cooley, M.B, Carychao, D., Crawford-Miksza, L., Jay, M.T., Myers, C., et al., 2007. Incidence and tracking of Escherichia coli O157:H7 in a major produce production region in California. PLoS ONE 2: e1159. doi: 10.1371/journal.pone.0001159.

Cooley, M.B., Jay-Russell, M., Atwill, E.R., Carychao, D., Nguyen, K., Quiñones, B., et al., 2013. Development of a robust method for isolation of Shiga toxin-positive Escherichia coli (STEC) from fecal, plant, soil and water samples from a leafy greens production region in California. PLoS ONE 8:e65716. doi:10.1371/journal.pone.0065716.

152

Cooley, M.B., Quiñones, B., Oryang, D., Mandrell, R.E., Gorski, L., 2014. Prevalence of Shiga toxin producing Escherichia coli, Salmonella enterica, and Listeria monocytogenes at public access watershed sites in a California Central Coast agricultural region. Frontiers in Cellular and Infection Microbiology doi: 10.3389/fcimb.2014.00030.

Coombes, B.K., Gilmour, M.W., Goodman, C.D., 2011. The evolution of virulence in non-O157 Shiga toxin-producing Escherichia Coli. Frontiers in Microbiology 2, 90.

Craig, D.L., Fallowfield, H.J., Cromar, N.J., 2004. Use of microcosms to determine persistence of Escherichia coli in recreational coastal water and sediment and validation with in situ measurements. Journal of Applied Microbiology 96, 922–930.

Czajkowska, D., Witkowska-Gwiazdowska, A., Sikorska, I., Boszczyk-Maleszak, H., Horoch, M., 2005. Survival of Escherichia coli serotype O157:H7 in water and in bottom-shore sediments. Polish Journal of Environmental Studies 14, 4, 423-430.

Deering, A.J., Mauer, L.J., Pruitt, R.E., 2012. Internalization of E. coli O157:H7 and Salmonella spp. in plants: a review. Food Research International 45, 567-575.

Delaquis, P., Bach, S., Dinu, L.D., 2007. Behavior of Escherichia coli O157:H7 in leafy vegetables. Journal of Food Protection 70, 1966-1974.

Dewedar, A., Bahgat, M., 1995. Fate of fecal coliforms in the waste water retention reservoir containing Lemma Gibba L. Water Research 29, 2598–2600.

Doumith, D., Day, M.J., Hope, R., Wain, J., Woodford, N., 2012. Improved multiplex PCR strategy for rapid assignment of the four major Escherichia coli phylogenetic groups. Journal of Clinical Microbiology 50, 3108-3110.

Doyle, M.P., Erickson, M.C., 2006. The fecal coliform assay, the results of which have led to numerous misinterpretations over the years, may have outlived its usefulness. Microbiology 1, 162-163.

Edge T.A., El-Shaarawi, A., Gannon, V., Jokinen, C., Kent, R., Khan, I.U.H., Koning, et al., 2012. Investigation of an Escherichia coli environmental benchmark for waterborne pathogens in agricultural watersheds in Canada. Journal of Environmental Quality 41, 21-30.

Erickson, M., Webb, C., Diaz-Perez, J., Phatak, S., Silvoy, J., Davey, L., Payton, A., Liao, J., Ma, L., Doyle, M., 2010. Infrequent internalization of Escherichia coli O157:H7 into fieldgrown leafy greens. Journal of Food Protection 73, 500–506.

153

Feehily, C., Karatzas, K.A.G.,2012. Role of glutamate metabolism in bacterial responses towards acid and other stresses. Journal of Applied Microbiology doi:10.1111/j.1365- 2672.2012.05434.x.

Feng, P., Fields, P. I., Swaminathan, B., Whittham, T.S., 1996. Characterization of nonmotile variants of Escherichia coli O157 and other serotypes by using an antiflagellin monoclonal antibody. Journal of Clinical Microbiology 34, 11, 2856–2859.

Feng, P., Sandlin, R.C., Park, C.H., Wilson, R.A., Nishibuchi, M., 1998. Identification of a rough strain of Escherichia coli O157:H7 that produces no detectable O157 antigen. Journal of Clinical Microbiology 36, 8, 2339–2341.

Feng, P., Weagant, S.D., 2002. Diarrheagenic Escherichia coli, Chapter 4A, rev. Sept. 2002. In: FDA bacteriological analytical manual, 8th edn, Rev A. Gaithersburg, MD, USA: AOAC International.

Finley, R.L., Collignon, P., Larsson, D.G.J., McEwen, S.A., Li, X.Z., Gaze, W.H., Reid-Smith, R., Timinouni, M., Graham, D.W., Topp, E., 2013. The scourge of antibiotic resistance: the important role of the environment. Clinical Infectious Diseases doi: 10.1093/cid/cit355.

Frank, C., Kapfhammer, S., Werber, D., Stark, K., Held, L., 2008. Cattle density and Shiga toxin-producing Escherichia coli infection in Germany: increased risk for most but not all serogroups. Vector-Borne and Zoonotic Diseases 8, 5, 635-643.

Franz, E., Visser, A.A., van Diepeningen, A.D., Klerks, M.M., Termorshuizen, A.J., van Bruggen, A.H.C., 2007. Quantification of contamination of lettuce by GFP-expressing Escherichia coli O157:H7 and Salmonella enterica serovar Typhimurium. Food Microbiology 24, 106–112.

Fremaux, B., Prigent-Combaret, C., Delignette-Muller, M.L., Mallen, B., Dothal, M., Gleizal, A., Vernozy-Rozand, C., 2008. Persistence of Shiga toxin-producing Escherichia coli O26 in various manure-amended soil types. Journal of Applied Microbiology 104, 1, 296- 304.

Gagliardi, J.V., Karns, J.S., 2000. Leaching of Escherichia coli O157:H7 in diverse soils under various agricultural management practices. Applied Environmental Microbiology 66, 877–883.

154

Garg, A.X., Rita, M.A., Suri, S., et al., 2003. Long-term renal prognosis of diarrhea-associated hemolytic uremic syndrome: A systematic review, meta-analysis, and meta-regression. Journal American Medical Association 290, 1360–1370.

Garzio-Hadzick, A., Shelton, D., Hill, R.L., Pachepsky, Y.A., Guber, A.K., Rowland, R., 2010. Survival of manure-borne E. coli in streambed sediment: effects of temperature and sediment properties. Water Research 44, 2753–2762.

Geldrich, E.E., Fox, KR., Goodrich, ].A., Rice, E.W., Clark, R.M., Swerdlow, D.L., 1992. Searching for a water supply connection in the Cabool, Missouri disease outbreak of Escherichia coli O157:H7. Water Research 26, 1127-1137.

Ghoneim, N.H., Abdel-Moein, A.K., Mohamed, M.A., 2014. Are non-O157 Shiga toxin- producing Escherichia coli imposing their predominance over O157 in farm animals and human? Global Veterinarian 12, 5, 636-642.

Gill, A., Gill, C.O., 2010. Non-O157 verotoxigenic Escherichia coli and beef: A Canadian perspective. The Canadian Journal of Veterinary Research 74, 161-169.

Gow, S.P., Waldner, C.L., 2009. Antimicrobial resistance and virulence factors stx1, stx2, and eae in generic Escherichia coli isolates from calves in western Canadian cow-calf herds. Microbial Drug Resistance 15, 1, 61-67.

Goyal, S.M., Gerba, C.P., Melnick, G.L., 1977. Occurrence and distribution of bacterial indicators and pathogens in canal communities along the Texas Coast. Applied and Environmental Microbiology 43, 139–149.

Grant, M.A., Hedberg, C., Johnson, R., Harris, J., Logue, C.M., Meng, J., Sofos, J.N., Dickson, J.S., 2011. The significance of non-O157 Shiga toxin producing Escherichia coli in food. Food Protection Trends 31, 32-45.

Gu, G., Luo, Z., Cevallos-Cevallos, J.M., Adams, P., Vellidis, G., Wright, A., Bruggen, A.H.C.V., 2013. Factors affecting the occurrence of Escherichia coli O157 contamination in irrigation ponds on produce farms in the Suwannee River watershed. Canadian Journal of Microbiology 59, 175-182.

Health Canada, 2000. Health claim assessments – acceptable disease risk reduction or therapeutic claims. Retrieved August 10, 2014, from http://www.hc-sc.gc.ca/fn- an/labeletiquet/claims-reclam/assess-evalu/index-eng.php.

Health Canada, 2008. MFLP-80, Isolation of E. coli O157 or NM in foods. Retrieved August 20, 2014, from http://www.hc-sc.gc.ca/fn-an/res-rech/analy-meth/microbio/index_e.html 155

Health Canada, 2011. Canada's food guide. Retrieved August 10, 2014, from http://www.hcsc.gc.ca/fn-an/food-guide-aliment/index-eng.php.

Hiruta, N., Murase, T., Okamura, N., 2001. An outbreak of diarrhoea due to multiple antimicrobial-resistant Shiga toxin-producing Escherichia coli O26:H11 in a nursery. Epidemiology and Infection 127, 221–227.

Holvoet, K., Sampers, I., Seynnaeve, M., Uyttendaele, M., 2014. Relationships among hygiene indicators and enteric pathogens in irrigation water, soil and lettuce and the impact of climatic conditions on contamination in the lettuce primary production. International Journal of Food Microbiology 171, 21-31.

Hora, R., Warriner, K., Shelp, B.J., Griffiths, M.W., 2005. Internalization of Escherichia coli O157:H7 following biological and mechanical disruption of growing spinach plants. Journal of Food Protection 68, 2506–2509.

Hornitzky, M.A., Mercieca, K., Bettelheim, K.A., Djordjevic, S.P., 2005. Bovine feces from animals with gastrointestinal infections are a source of serologically diverse atypical enteropathogenic Escherichia coli and Shiga toxin-producing E. coli strains that commonly possess intimin. Applied and Environmental Microbiology 71, 3405–3412.

Hunter, C., McDonald, A., Bevin, K., 1992. Input of fecal coliforms bacteria to an upland stream channel in the Yorkshire Deales. Water Resources Research 28, 1869–1876.

Ikeda, K., Ida, O., Kimoto, K., Takatorige, T., Nakanishi, N., Tatara, K., 1999. Effect of early fosfomycin treatment on prevention of hemolytic uremic syndrome accompanying Escherichia coli O157:H7 infection. Clinical Nephrology 52, 6, 357– 362.

International Commission on Microbiological Specifications for Foods, 1996. Intestinally pathogenic Escherichia coli. Chapter 7 in microorganisms in foods 5: characteristics of microbial pathogens. Blackie Academic and Professional, London.

Islam, M., Doyle, M.P., Phatak, S.C., Millner, P., Jiang, X., 2004b. Persistence of enterohemorrhagic Escherichia coli O157:H7 in soil and on leaf lettuce and parsley grown in fields treated with contaminated manure composts or irrigation water. Journal of Food Protection 67, 7, 1365–1370.

Islam, M., Morgan, J., Doyle, M.P., Phatak, S.C., Millner, P., Jiang, X., 2004a. Persistence of Salmonella enterica serovar Typhimurium on lettuce and parsley and in soils on which they were grown in fields treated with contaminated manure composts or irrigation water. Foodborne Pathogens and Disease 1, 1, 27-35.

156

Jiang, X., Morgan, J., Doyle, M.P., 2002. Fate of Escherichia coli O157:H7 in manure-amended soil. Applied and Environmental Microbiology 68, 5, 2605–2609.

Johnson, K.E., Thorpe, C.M., Sears, C.L., 2006. The emerging clinical importance of non-O157 Shiga toxin–producing Escherichia coli. Clinical Infectious Diseases 43, 1587–95.

Jokinen, C.C., Schreier, H., Mauro, W., Taboada, E., Isaac-Renton, J.L., Topp, E., Edge, T., Thomas, J.E., Gannon, V.P., 2010. The occurrence and sources of Campylobacter spp., Salmonella enterica and Escherichia coli O157:H7 in the Salmon River, British Columbia, Canada. Journal of Water and Health 8, 2, 374-386.

Jones, L.S., Worobo, R.W., Smart, C.D., 2014. Plant-pathogenic oomycetes, E. coli, and Salmonella spp. frequently found in surface water used for irrigation of fruit and vegetable crops in New York State. Applied and Environmental Microbiology doi:10.1128/AEM.01012-14.

Kanama, M., Johnson, R.P., Holtslander, R., McEwen, S.A., Gyles, C.L., 2008. Prevalence and characterization of verotoxin-producing Escherichia coli (VTEC) in cattle from an Ontario abattoir. Canadian Journal of Veterinary Research 72, 4, 297–302.

Karch, H., Bielaszewska, M., 2001. Sorbitol-fermenting Shiga toxin-producing Escherichia coli O157:H+ strains: epidemiology, phenotypic and molecular characteristics, and microbiological diagnosis. Journal of Clinical Microbiology 9, 2043–2049.

Karim, M.R., Manshadi, F.D., Karpiscak, M.M., Gerba, C.P., 2004. The persistence and removal of enteric pathogens in constructed wetlands. Water Research 38, 1831–1837.

Karmali, M.A., Mascarenhas, M., Shen, S., Ziebell, K., Johnson, S., Reid-Smith, R., et al., 2003). Association of genomic O island 122 of Escherichia coli EDL 933 with verocytotoxin-producing Escherichia coli seropathotypes that are linked to epidemic and/or serious disease. Journal of Clinical Microbiology 41, 4930–4940.

Kauffman, F., 1947. The serology of the coli group. Journal of Immunology 57, 7.

Kearney, T.E., Larkin, M.J., Levett, P.N., 1993. The effect of slurry storage and anaerobic digestion on survival of pathogenic bacteria. Journal Applied Bacteriology 74, 86–93.

Khachatourians, G.G., 1998. Agricultural use of antibiotics and the evolution and transfer of antibiotic-resistant bacteria. Canadian Medical Association Journal 159, 1129-1136.

157

Klerks, M.M., Franz, E., van Gent-Pelzer, M., Zijlstra, C., van Bruggen, A.H.C., 2007a. Differential interaction of Salmonella enterica serovars with lettuce cultivars and plant microbe factors influencing the colonization efficiency. ISME Journal 1, 620–631.

Klerks, M.M., van Gent-Pelzer, M., Franz, E., Zijlstra, C., van Bruggen, A.H.C., 2007b. Physiological and molecular responses of Lactuca sativa to colonization by Salmonella enterica serovar Dublin. Applied and Environmental Microbiology 73, 4905–4914.

Knudsen, D.M., Yamamoto, S.A., Harris, L.J., 2001. Survival of Salmonella spp. and Escherichia coli O157:H7 on fresh and frozen strawberries. Journal of Food Protection 64, 10, 1483-1488.

Kudoh, Y., Kai, A., Obata, H., Kusunoki, J., Monma, C., Shingaki, M., Yanagawa, Y., Yamada, S., Mtsushita, S., Itoh, T., Ohta, K., 1994. Epidemiological surveys on verocytotoxin- producing Escherichia coli infections in Japan. Recent Advances in Verocytotoxin- producing Escherichia Coli Infections. Verocytotoxin-producing Escherichia coli in children with hemolytic uremic syndrome and diarrhea in the Czech Republic. In M.A. Karmali, A.G. Goglio (Eds.), Recent Advances in Verocytotoxin-producing Escherichia Coli Infections, Excerpta Medica International Congress Series 1072. Elsevier Science, Amsterdam, The Netherlands, pp. 53–56.

Kudva, I.T., Blanch, K., Hovde, C.J.,1998. Analysis of Escherichia coli O157:H7 survival in ovine or bovine manure and manure slurry. Applied and Environmental Microbiology 64, 9, 3166-3174.

Kümmerer K., 2004. Resistance in the environment. Journal of Antimicrobial Chemotherapy 54, 311–320.

Lange R., Hengge-Aronis, R., 1991. Identification of a central regulator of stationary-phase gene expression in Escherichia coli. Molecular Microbiology 5, 49–59.

Lee, M., Middleton, D., 2003. Enteric illness in Ontario, Canada, from 1997 to 2001. Journal of Food Protection 66, 953–961.

Liao, C.H., Fett, W.F., 2001. Analysis of native microflora and selection of strains antagonistic to human pathogens on fresh produce. Journal of Food Protection 64, 1110–1115.

Louise, C.B., Obrig, T.G.,1995. Specific interaction of Escherichia coli O157:H7 derived Shiga- like toxin type II with human renal endothelial cells. The Journal of Infectious Diseases 172, 1397–1401.

158

Low, J.C., McKendrick, I.J., McKechnie, C., Fenlon, D., Naylor, S.W., Currie, C., Smith, D.G., Allison, L., Gally, D.L., 2005. Rectal carriage of enterohemorrhagic Escherichia coli O157 in slaughtered cattle. Applied and Environmental Microbiology 71, 93-97.

Lyautey, E., Lu, Z., Lapen, D.R., Wilkes, G., Scott, A., Berkers, T., Edge, T.A., Topp, E., 2010. Distribution and diversity of Escherichia coli populations in the South Nation River drainage basin, Eastern Ontario, Canada. Applied and Environmental Microbiology 76, 1486–1496.

Ma, J., Ibekwe, A.M., Crowley, D.E., Yang. C-H., 2014. Persistence of Escherichia coli O157 and non-O157 strains in agricultural soils. The Science of the Total Environment 490, 822–829.

Ma, J., Ibekwe, A.M., Yi, X., Wang, H., Yamazaki, A., et al., 2011. Persistence of Escherichia coli O157:H7 and its mutants in soils. PLoS ONE 6: e23191. doi: 10.1371/journal.pone.0023191.

Maal-Bared, R., Bartlett, K.H., Bowie, W.R., Hall, E.R., 2013. Phenotypic antibiotic resistance of Escherichia coli and E. coli O157 isolated from water, sediment and biofilms in an agricultural watershed in British Columbia. Science of the Total Environment 443, 315– 323.

Macarisin, D., Patel, J., Bauchan, G., Giron, J.A., Sharma, V.K., 2012. Role of curli and cellulose expression in adherence of Escherichia coli O157:H7 to spinach leaves. Foodborne Pathogens and Disease 9, 160–167.

Mainil, J.G., Daube, G., 2005. Verotoxigenic Escherichia coli from animals, humans and foods: Who’s who? Journal of Applied Microbiology 98, 1332–1344.

Mariani-Kurkdjian, P., Denamur, E., Milon, A., Picard, B., Cave, H., Lambert-Zechovsky, N., Loirat, C., Goullet, P., Sansonetti, P.J., Elion, J., 1993. Identification of a clone of Escherichia coli O103:H2 as a potential agent of hemolytic-uremic syndrome in France. Journal of Clinical Microbiology 31, 296 –301.

Mathusa, E.C., Chen, Y., Enache, E., Hontz, L., 2010. Non-O157 Shiga toxin-producing Escherichia coli in foods. Journal of Food Protection 73, 9, 1721-36.

Matthysse, A.G., Deora, R., Mishra, M., Torres, A.G., 2008. Polysaccharides cellulose, poly- beta-1,6-n-acetyl-D-glucosamine, and colanic acid are required for optimal binding of Escherichia coli O157:H7 strains to alfalfa sprouts and K-12 strains to plastic but not for binding to epithelial cells. Applied and Environmental Microbiology 74, 2384–2390.

159

Mauro,S.A., Koudelka,G.B., 2011. Shiga toxin: expression, distribution, and its role in the environment. Toxins 3, 608–625.

McMaster, C., Roch, E.A., Willshaw, G.A., Doherty, A., Kinnear, W., Cheasty, T., 2001. Verocytotoxin-producing Escherichia coli serotype 026:H11 outbreak in an Irish cr`eche. European Journal of Clinical Microbiology 20, 430–432.

Meng, J., Zhao, S., Doyle, M.P., Joseph, S.W., 1998. Antibiotic resistance of Escherichia coli O157:H7 and O157:NM isolated from animals, food, and humans. Journal of Food Protection 61, 11, 1511-1514.

Menne, J., Nitschke, M., Stingele, R., et al., 2012. Validation of treatment strategies for enterohaemorrhagic Escherichia coli O104:H4 induced haemolytic uraemic syndrome: case-control study. British Medical Journal 345, Article ID e4565.

Miranda, J.M., Vázquez, B.I., Fente, C.A., Calo-Mata, P., Cepeda, A., Franco, C.M., 2008. Comparison of antimicrobial resistance in Escherichia coli, Staphylococcus aureus, and Listeria monocytogenes strains isolated from organic and conventional poultry meat. Journal of Food Protection 71, 12, 2537-2542.

Mitra, R., Cuesta-Alonso, E., Wayadande, A., Talley, J., Gilliland, S., Fletcher, J., 2009. Effect of route of introduction and host cultivar on the colonization, internalization, and movement of the human pathogen Escherichia coli O157:H7 in spinach. Journal of Food Protection 72, 1521–1530.

Monaghan, A., Byrne, B., Fanning, S., Sweeney, T., McDowell, D., Bolton, D.J., 2011. Serotypes and virulence profiles of non-O157 Shiga toxin-producing Escherichia coli isolates from bovine farms. Applied and Environmental Microbiology 77, 24, 8662- 8668.

Mora, A., Blanco, J.E., Blanco, M., Alonso, M.P., Dhabi, G., Echeita, A., González, E.A., Bernárdez, M.I., Blanco, J., 2005. Antimicrobial resistance of Shiga toxin (verotoxin)- producing Escherichia coli O157:H7 and non-O157 strains isolated from humans, cattle, sheep and food in Spain. Research Microbiology 156, 7, 793-806.

Morabito, S., Karch, H., Schmidt, H., Minelli, F., Molecular characterization of verocytotoxin- producing Escherichia coli of serogroup O111 from different countries. Journal of Medical Microbiology, 48, 891-896.

160

Mukherjee, A., Cho, S., Scheftel, J., Jawahir, S., Smith, K., Diez-Gonzalez, F., 2006. Soil survival of Escherichia coli O157:H7 acquired by a child from garden soil recently fertilized with cattle manure. Journal of Applied Microbiology 101, 429–436.

Nataro, J.P., Kaper, J.B., 1998. Diarrheagenic Escherichia coli. Clinical Microbiology Reviews 11, 142–201.

Nielsen, E.M., Skov, M.N., Madsen, J.J., Lodal, J., Jespersen, J.B., Baggesen, D.L., 2004. Verocytotoxin-producing Escherichia coli in wild birds and rodents in close proximity to farms. Applied and Environmental Microbiology 70, 11, 6944-6947.

Nitschke, M., Sayk, F., Hartel, C., et al., 2012. Association between azithromycin therapy and duration of bacterial shedding among patients with Shiga toxin-producing enteroaggregative Escherichia coli O104:H4. Journal of the American Medical Association 307, 10, 1046–1052.

Odonkor, S.T., Ampofo, J.K., 2013. Escherichia coli as an indicator of bacteriological quality of water: an overview. Microbiology Research doi:10.4081/mr.2013.e2.

Ogura, Y., Ooka, T., Iguchi, A., Toh, H., Asadulghani, M., Oshima, K., Kodama, T., Abe, H., Nakayama, K., Kurokawa, K., Tobe, T., Hattori, M., Hayashi, T., 2009. Comparative genomics reveal the mechanism of the parallel evolution of O157 and non-O157 enterohemorrhagic Escherichia coli. Proceedings of the National Academy of Sciences USA 106, 17939–17944.

Oliveira, M., Viñas, I., Usall, J., Anguera, M., Abadias, M., 2012. Presence and survival of Escherichia coli O157:H7 on lettuce leaves and in soil treated with contaminated compost and irrigation water. International Journal of Food Microbiology 156, 133-140.

Pachepsky, Y., Shelton, D., 2011. Escherichia coli and fecal coliforms in freshwater and estuarine sediments. Critical Reviews in Environmental Science and Technology 41, 1067–1110.

Papp-Wallace, K.M., Endimiani, A., Taracila, M.A., Bonomo, R.A., 2011. Carbapenems: Past, present and future. Antimicrobial agents and chemotherapy 55, 11, 4943-4960.

Park, G., and Diez-Gonzalez, F. (2004) A novel glutamate-dependent acid resistance among strains belonging to the Proteeae tribe of Enterobacteriaceae. FEMS Microbiology Letters 237, 303–309.

161

Patel, J.R., Millner, P.D., Nou, X.W., Sharma, M., 2010. Persistence of enterohemorrhagic and non-pathogenic Escherichia coli O157:H7 on spinach leaves and in rhizosphere soil. Journal of Applied Microbiolology 108, 1789–1796.

Paton and Paton, 1996. Enterobacter cloacae producing a Shiga-like toxin II-related cytotoxin associated with a case of hemolytic-uremic syndrome. Journal of Clinical Microbiology 34, 2, 463–465.

Paton, A.W., Paton, J.C., 1998. Detection and characterization of Shiga toxigenic Escherichia

coli by using multiplex PCR assays for stx1, stx2, eaeA Enterohemoorrhagic E. coli hlyA, RFBO111 , and rfbO157. Journal of Clinical Microbiology 34, 598.

Payette, K., 2006. Water quality assessment of watercourses used for irrigation of ready-to-eat produce in Cloverdale, BC Summer 2002 – Spring 2004. Retrieved September 3, 2014 from https://mail- attachment.googleusercontent.com/attachment/u/0/?ui=2&ik=c8b41da59a&view=att&t h=13b6ecd43beccd93&attid=0.1&disp=inline&safe=1&zw&saduie=AG9B_P9aCFA50 LZEfYaABJWaRk19&sadet=1363364188408&sads=7IjkHwzRFzoqWKSJP6bsLNZkv ck

Proulx, F., Sockett, P., 2005. Prospective surveillance of Canadian children with haemolytic uraemic syndrome. Pediatric Nephrology 20, 786–790.

Public Health Agency of Canada, 2002. Release of the final report of the advisory committee on animal uses of antimicrobials and impact on resistance and human health. Retrieved October 25, 2014 from http://www.hc-sc.gc.ca/dhp-mps/pubs/vet/amr-ram_final_report- rapport_06-27_cp-pc-eng.php#a8

Public Health Agency of Canada, 2014. Public health notices. Retrieved August 20, 2014, from http://www.phac-aspc.gc.ca/fs-sa/phn-asp/index-eng.php

Radke, B.R., 2014a. Use of over-the-counter antibiotics in BC livestock and poultry, 2002 – 2012. Retrieved October 25, 2014 from http://www.agf.gov.bc.ca/lhmr/pubs/otcu_amu.pdf

Radke, B.R., 2014b. Comparison of Health Canada and US FDA assessments of antibiotics importance in human medicine. Retrieved October 25, 2014 from http://www.agf.gov.bc.ca/lhmr/forms/comparisonHC&FDAantib.pdf

162

Rice, E.W., Johnson, C.W., Wild, D.K., Reasoner, D.J., 1992. Survival of Escherichia coli O157:H7 in drinking water associated with a waterborne disease outbreak of hemorrhagic colitis. Letters in Applied Microbiology 15, 38–40.

Rosser, T., Dransfield, T., Allison, L., Hanson, M., Holden, N., Evans, J., Naylor, S., La Ragione, R., Low, J.C., Gally, D.L., 2008. Pathogenic potential of emergent sorbitol- fermenting Escherichia coli O157:NM. Infection and Immunity 76, 12, 5598-5607.

Santamaria, J., Toranzos, G.A., 2003. Enteric pathogens and soil: a short review. International Microbiology 6, 5–9.

Scheutz, F., Stockbine, N.A., 2005. Genus 1. Escherichia. In D.J. Brenner, N.R. Krieg, J.T. Staley (Eds.). Bergey’s Manual of Systematic Bacteriology, 2nd edition, Volume 2. Springer and Bergey’s Manual Trust, Michigan, pp. 607–623.

Schimmer, B., Nygard, K., Eriksen, H.M., Lassen, J., et al., 2008. Outbreak of haemolytic uraemic syndrome in Norway caused by stx2-positive Escherichia coli O103:H25 traced to cured mutton sausages. BMC Infectious Disease 8, 41, doi:10.1186/1471- 2334-8-41.

Schmidt, H., Montag, M., Bockemuhl, J., Heeseman, J., Karch, H., 1993. Shiga- like toxin II- related cytotoxins in Citrobacter freundii strains from humans and beef samples. Infection and Immunity 61, 534-543.

Schnaitman, C. A., Klena, J.D., 1993. Genetics of lipopolysaccharide biosynthesis in enteric bacteria. Microbiological Review 57, 655-682.

Schuenzel, K.M., Harrison, M.A., 2002. Microbial antagonists of foodborne pathogens on fresh, minimally processed vegetables. Journal of Food Protection 65, 1909-1915.

Seto, K., Taguchi, M., Kobayashi, K., Kozaki, S., 2007. Biochemical and molecular characterization of minor serogroups of Shiga toxin-producing Escherichia coli isolated from humans in Osaka prefecture. Journal of Veterinary Medical Science 69, 1215– 1222.

Sharma, M., Ingram, D.T., Patel, J.R., Millner, P.D., Wang, X., Hull, A.E., Donnenberg, M.S., 2009. A novel approach to investigate the uptake and internalization of Escherichia coli O157:H7 in spinach cultivated in soil and hydroponic medium. Journal of Food Protection 72, 1513–1520.

163

Shaw, A.L., Svoboda, A., Jie, B., Nonnecke, G., Mendonca, A., 2015. Survival of Escherichia coli on strawberries grown under greenhouse conditions. Food Microbiology 46, 200- 203.

Singh, G., Vajpayee, P., Ram, S., Shanker, A., 2010. Enterotoxigenic Escherichia coli in South Asian Gangetic Riverine System. Environmental Science and Technology 44, 16, 6475– 6480.

Smith, D.K., Kassam, T., Singh, B., Elliott, J.F., 1992. Escherichia coli has two homologous glutamate decarboxylase genes that map to distinct loci. Journal of Bacteriology 174, 5820-5826.

Sockett, P., Goebel, S.E., Varela, N.P., Guthrie, A., Wilson, J., Guilbault, L.A., Clark, W.F., 2014. Verotoxigenic Escherichia coli: Costs of illness in Canada, including long-term health outcomes. Journal of Food Protection 77, 2, 216–226.

Solomon, E.B., Yaron, S., Matthews, K.R., 2002. Transmission of Escherichia coli O157:H7 from contaminated manure and irrigated water to lettuce plant tissue and its subsequent internalization. Applied and Environmental Microbiology 68, 397-400.

Statistics Canada, 2010a. Canadian community health survey, 2008. Retrieved August 10, 2014, from http://www.statcan.gc.ca/pub/82-229-x/2009001/deter/fvc-eng.html.

Statistics Canada, 2010b. The food statistics for 2009. Retrieved August 10, 2014, from http://www.statcan.gc.ca/pub/21-020-x/2009001/t002-eng.html.

Stecher, B., Denzler, R., Maier, L., Bernet, F., Sanders, M.J., et al., 2012. Gut inflammation can boost horizontal gene transfer between pathogenic and commensal Enterobacteriaceae. Proceedings of the National Academy of Sciences 109, 4, 1269-1274.

Stenutz, R., Weintraub, A., Widmalm, G., 2006. The structures of Escherichia coli O- polysaccharide antigens. FEMS Microbiology Reviews 30, 382–403.

Subbiah, M., Mitchell, S.M., Ullman, J.L., Call, D.R., 2011. Β-lactams and florfenicol antibiotics remain bioactive in soils while ciprofloxacin, neomycin and tetracycline are neutralized. Applied and Environmental Microbiology 77, 20, 7255-7260.

164

Takeuchi, K., Frank, J.F., 2000. Penetration of Escherichia coli O157:H7 into lettuce tissues as affected by inoculum size and temperature and effect of chlorine treatment on cell viability. Journal of Food Protection 63, 434-440.

The Weather Network, 2014. Statistics. Retrieved October 25, 2014 from http://past.theweathernetwork.com/statistics/CL1106180/cabc2523.

Thompson, L.H., Giercke, S., Beaudoin, C., Woodward, D., Wylie, J.L., 2005. Enhanced surveillance of non-O157 verotoxin-producing Escherichia coli in human stool samples from Manitoba. Canadian Journal of Infectious Diseases & Medical Microbiology 16, 329–334.

USDA, 2014a. MLG 5.08, Detection, isolation and identification of Escherichia coli O157:H7 from meat products and carcass and environmental sponges. Retrieved August 20, 2014, from http://www.fsis.usda.gov/wps/wcm/connect/51507fdb-dded-47f7-862d- ad80c3ee1738/MLG-5.pdf?MOD=AJPERES

USDA, 2014b. MLG 5B.05, Detection and isolation of non-O157 Shiga toxin-producing Escherichia coli (STEC) from meat products and carcass and environmental sponges. Retrieved August 20, 2014, from http://www.fsis.usda.gov/wps/wcm/connect/7ffc02b5- 3d33-4a79-b50c-81f208893204/MLG-5B.pdf?MOD=AJPERES

USDA, U.S. Food and Drug Administration, 2004. NAFTA trade in fruits and vegetables. Global trade patterns in fruits and vegetables. Retrieved August 10, 2014, from http://www.ers.usda.gov/media/320480/wrs0406f_1_.pdf.

Van Elsas, J.D., Semenov, A.V., Costa, R., Trevors, J.T., 2010. Survival of Escherichia coli in the environment: fundamental and public health aspects. The ISME Journal 5, 173–183.

Vanaja, S.K., Jandhyala, D.M., Mallick, E.M., Leong, J.M., Balasubramanian, S., 2013. Chapter 5 - Enterohemorrhagic and other Shiga toxin-producing Escherichia coli, In M.S. Donnenberg (Ed), Escherichia coli – Pathotypes and Principles of Pathogenesis 2nd edition. Elsevier Inc, pp. 121-182.

Vogel, J.R., Stoeckel, D.M., Lamendella, R., Zelt, R.B., Santo Domingo, J.W., Walker, S.R., Oerther, D.B., 2007). Identifying fecal sources in a selected catchment reach using multiple source-tracking tools. Journal of Environmental Quality 36, 718–729.

Wang G., Doyle M.P., 1998. Survival of enterohaemorrhagic Escherichia coli O157:H7 in water. Journal of Food Protection 61, 662-667.

165

Watterworth, L., Rosa, B., Schraft, H., Topp, E., Leung, K.L., 2006. Survival of various ERIC- genotypes of Shiga toxin-producing Escherichia coli in well water. Water, Air, and Soil Pollution 177, 367–382.

Werber, D., Fruth, A., Liesegang, A., Littmann, M., Buchholz, U., Prager, R., Karch, H., Breuer, T., Tsch¨ape, H., Ammon, A., 2002. A multistate outbreak of Shiga toxin-producing Escherichia coli O26:H11 infections in Germany, detected by molecular subtyping surveillance. The Journal of Infectious Diseases 186, 419–422.

White, D.G., Hudson, C., Maurer, J.J., Ayers, S., Zhao, S., Lee, M.D., Bolton, L., Foley, T., Sherwood, J., 2000. Characterization of chloramphenicol and florfenicol resistance in Escherichia coli associated with bovine diarrhea. Journal of Clinical Microbiology 38, 12, 4593-4598.

Whitman, R.L., Nevers, M.B., Ginger, C.K., Byappanahalli, M.N., 2004. Solar and temporal effects on Escherichia coli concentration at a Lake Michigan swimming beach. Applied and Environmental Microbiology 70, 7, 4276–4285.

Wilkes, G., Edge, T., Gannon, V., Jokinen, C., Lyautey, E., Medeiros, D., Neumann, N., Reucker, N., Topp, E., Lapen, D.R., 2009. Seasonal relationships among indicator bacteria, pathogenic bacteria, Cryptosporidium oocysts, Giardia cysts, and hydrological indices for surface waters within an agricultural landscape. Water Research 43, 2209– 2223.

Wood, J.L., Chen, J.C., Friesen, E., Delaquis, P., Allen, K.J., 2014. Microbiological survey of local grown lettuce in Vancouver, British Columbia, farmers’ market. Journal of Food Protection doi:10.4315/0362-028X.JFP-14-199 “in press”.

Zhang, G., Ma, L., Beuchat, L.R., Erickson, M.C., Phelan, V.H., Doyle, M.., 2009. Lack of internalization of Escherichia coli O157:H7 in lettuce (Lactuca sativa L.) after leaf surface and soil inoculation. Journal of Food Protection 72, 2028–2037.

Zhang, X., McDaniel, A.D., Wolf, L.E., Keusch, G.T., Waldor, M.K., Acheson, D.W.K., 2000. Qionolone antibiotics induce Shiga toxin-encoding bacteriophages, toxin production and death in mice. The Journal of Infectious Disease 181, 2, 664-670.

166

Zhang,W.L., Bielaszewska, M., Liesegang, A., Tschäpe, H., Schmidt, H., Bitzan, M., Karch, H., 2000. Molecular characteristics and epidemiological significance of Shiga toxin- producing Escherichia coli O26 strains. Journal of Clinical Microbiology 38, 6, 2134– 2140.

Zweifel, C., Schumacher, S., Blanco, M., Blanco, J.E., Tasara, T., Blanco, J., Stephan, R., 2005. Phenotypic and genotypic characteristics of non-O157 Shiga toxin-producing Escherichia coli (STEC) from Swiss cattle. Veterinary Microbiology 105, 37–45.

167

Appendix

Appendix A Antibiotic resistance profile of VTEC isolates

A.1 Antibiotic resistance profiles of VTEC isolates recovered from surface waters collected in the Lower Fraser watershed. A A A T F C C G B N S S C T I E M F Date sample Site Serotype1 M M M I O R I E C A T X H E P T E F K X P O X O P N N L R T L T M P M C May 25, 2013 Site #3 O26:H11a S2 S S S S S S S S S S S S S S S S I2 Site #4 O26:H11a S S S S S S S S S S S S S S S S S I O?:H19 S S S S S S S S S S S S S S S S S I O151:H12 S S S I S S S S S S S S S S S S S I June 19, 2013 Site #3 O165:H25b S S I I S S S S R2 S R S S R S S S R O165:H25b S S I S S S S S R S R S S R S S S R O165:NMb S S I S S S S S R S R S S R S S S R September 22, 2013 Site #5 O6:H10 S S S S S S S S S S I S S R S S S S O103:H25 S S I I S S S S S S S S S S S S S I 1 The letter represents similar banding patterns observed between the isolates. 2 Denotes S – susceptible; I – intermediate resistance; R – resistant. List of antibiotics: amikacin (AMK), amoxicillin/clavulanic acid (AMX), ampicillin (AMP), cefoxitin (FOX), ceftiofur (TIO), ceftriaxone (CRO), chloramphenicol (CHL), ciprofloxacin (CIP), ertapenem (ETP), gentamicin (GEN), imipenem (IPM), kanamycin (BCN), meropenem (MEM), nalidixic acid (NAL), streptomycin (STR), tetracycline (TET), trimethoprim-sulfamethoxazole (SXT) and florfenicol (FFC).

168

A.2 Antimicrobial resistance profile of VTEC isolates recovered from surface waters collected from Sumas River watershed. A A A T F C C G B N S S C T I E M F Date sample Site Serotype1 M M M I O R I E C A T X H E P T E F K X P O X O P N N L R T L T M P M C December 6, 2012 Site #7 O136:H12 S2 S S S S S S S S S S S S S S S S I2 O157:NM S S S I S S S I I S I S S I S S S I O177:NM S S S S S S S S S S S S S I S S S I December 12, 2012 Site #7 O8:H19a S S S S S S S S S S S S S I S S S I Site #10 O141ac:H8 S S S S S S S S S S S S S I S S S R2 O168:H8 S S I I S S S I I S I S S I S S S R December 20, 2012 Site #7 O26:H11b S S S S S S S S S S S S S I S S S I O103:H11b S S S S S S S S S S S S S S S S S I Site #10 O8:H19a S S S S S S S S S S S S S I S S S I January 15, 2013 Site #7 O136:H12c S S S S S S S S S S S S S S S S S I Site #10 O111:H8d S I R S S S S S S S R R S R S S S I O111:NMd S I R S S S S S S S R R S R S S S I February 16, 2013 Site #7 O163:NMe I S I S S S S I I S I S S I S S S I O163:NMe S I S S S S S S I S I S S I S S S I O163:H19e S S S S S S S S I S S S S I S S S I O163:H19e S S I I S S S I R S R S S I S S S R OR:NMe S S I I S S S I S S I S I I S S S R May 11, 2013 Site #6 O113:H21 S S S S S S S S S S S S S S S S S I OR:H21 S S S S S S S S S S S S S S S S S I Site #10 O182(O109):H5f S S S S S S S S S S S S S S S S S S 169

A.2 continued A A A T F C C G B N S S C T I E M F Date sample Site Serotype1 M M M I O R I E C A T X H E P T E F K X P O X O P N N L R T L T M P M C June 6, 2013 Site #7 O182(O109):H5f S S S I S S S S S S S S S S S S S I O182(O109):H5f S S S I S S S S S S S S S S S S S I July 19, 2013 Site #6 O136:H12c S S S S S S S S S S S S S S S S S I October 1, 2013 Site #7 O165:NMg S S I S S S S S S S S S S I S S S R O165:NMg S S I S S S S S S S S S S I S S S R Site #9 O26:H11b S S S S S S S S S S S S S S S S S I O136:H12c S S S S S S S S S S S S S S S S S I November 16, 2013 Site #6 O128:H2 S S I S S S S S S S S S S I S S S S Site #7 O111:NMd S R R R R I S I I S R R R R S S S R Site #8 O163:H19e S S S S S S S S I S I S S I S S S I Site #10 O84:H2 I S I I S S S S I S I S I I S S S I 1 The letter represents similar banding patterns observed between the isolates. 2 Denotes S – susceptible; I – intermediate resistance; R – resistant. List of antibiotics: amikacin (AMK), amoxicillin/clavulanic acid (AMX), ampicillin (AMP), cefoxitin (FOX), ceftiofur (TIO), ceftriaxone (CRO), chloramphenicol (CHL), ciprofloxacin (CIP), ertapenem (ETP), gentamicin (GEN), imipenem (IPM), kanamycin (BCN), meropenem (MEM), nalidixic acid (NAL), streptomycin (STR), tetracycline (TET), trimethoprim-sulfamethoxazole (SXT) and florfenicol (FFC).

170

A.3 Antibiotic resistance profiles of VTEC isolates recovered from surface waters collected in the Nicomekl River watershed. A A A T F C C G B N S S C T I E M F Date sample Site Serotype1 M M M I O R I E C A T X H E P T E F K X P O X O P N N L R T L T M P M C December 20, 2012 Site #11 O136:H12a S2 S S I2 S S S S S S S S S S S S S I Site #12 O5:NMb S I I S S S S S S S S S S I S S S I O116:H25c I R2 R I I I S I I S I S S I S S S S O116:H25c I R R I I I S I I S I S S I S S S I January 15, 2013 Site #12 O5:NMb S I I S S S S S S S S S S I S S S R O146:H8 S S S S S S S S I S S S S I S S S R O146:H8 S S S S S S S S I I S S S I S S S I Site #13 O174:H21 S S S S S S S S S S S S S S S S S S Site #14 O22:H8 S I I S S S S S S S S S S I S S S R O130:H8 S I I S S S S S S S S S S I S S S R O156:H25d S S S S S S S S S S S S S I S S S R May 25, 2013 Site #12 O128:H2 S S I S S S S S S S S S S I S S S I Site #14 O5:NMb S I S S S S S S S S S S S S S S S I O5:NMb S S S S S S S S S S S S S S S S S I O8:H19 S S S S S S S S S S S S S I S S S I O156:H25d S S S S S S S S S S S S S S S S S I O174:H21 S I S S S S S S S S S S S S S S S S

171

A.3 continued A A A T F C C G B N S S C T I E M F Date sample Site Serotype1 M M M I O R I E C A T X H E P T E F K X P O X O P N N L R T L T M P M C June 19, 2013 Site #11 O136:H12a S S I S S S S S S S S S S S S S S I O136:H12a S S I S S S S S S S S S S S S S S I Site #12 O84:H2e S S I I S S S S I S I S S I S S S I O84:H2e S S I S S S S S I S I S S I S S S I O157:H7 S S S S S S S S S S S S S S S S S I Site #14 O136:H12a S S I S S S S S S S S S S S S S S I July 27, 2013 Site #14 O103:H2 S S S S S S S S S S S S S S S S S I October 1, 2013 Site #12 O91:NM S S S S S S S S S S I S S S S S S I O116:H25c I R R I I I S I I S I S I I S S S S O128:H2 S S S I S S S S S S S S S I S S S I O174:H8 S S I I S S S I I S R S S S S S S S October 28, 2013 Site #12 O76:H19f I S I I S S S I I S I S I I S S S I November 22, 2013 Site #12 O76:H19f S S S I S S S S S S S S S S S S S R 1 The letter represents similar banding patterns observed between the isolates. 2 Denotes S – susceptible; I – intermediate resistance; R – resistant. List of antibiotics: amikacin (AMK), amoxicillin/clavulanic acid (AMX), ampicillin (AMP), cefoxitin (FOX), ceftiofur (TIO), ceftriaxone (CRO), chloramphenicol (CHL), ciprofloxacin (CIP), ertapenem (ETP), gentamicin (GEN), imipenem (IPM), kanamycin (BCN), meropenem (MEM), nalidixic acid (NAL), streptomycin (STR), tetracycline (TET), trimethoprim-sulfamethoxazole (SXT) and florfenicol (FFC).

172

A.4 Antibiotic resistance profiles of VTEC isolates recovered from surface waters collected in the Serpentine River watershed. A A A T F C C G B N S S C T I E M F Date sample Site Serotype1 M M M I O R I E C A T X H E P T E F K X P O X O P N N L R T L T M P M C January 15, 2013 Site #17 O69:H11a S2 I2 R2 S S S S S S S R R S R S S S I O98:NMb S S S I S S S I S S I S S I S S S I O111:H8 S S S I S S S I S S I S S I S S S I O111:H8c S I R R S S S S R S R S S R S S S I O111:NMc S I R I S S S S R S R S S R S S S R O182(O109):H5d S S S I S S S S I S S S S I S S S R February 16, 2013 Site #16 O163:NMe S S I I S S S I I S I S S I S S S I O163:NMe S I I I S S S I I S I S I I S S S R Site #18 OR:NMe S I S S S S S S I S I S S I S S S R Site #19 O163:NMe S S S I S S S S I S I S S I S S S I O163:NMe S S S I S S S S I S I S S I S S S R OR:NMe S I I I S S S S I S I S S I S S S R OR:NMe S I I I S S S I I S I S I I S S S R Site #20 O163:NMe S S S I S S S I I S I S I I S S S R O163:NMe S S S I S S S S I S I S S I S S S I O163:H19e S S S I S S S S S S S S S I S S S I OR:NMe S I I I S S S I I S I S S I S S S R O163:NM/ e S S I I S S S I R S I S S I S S S R O163:H19 173

A.4 continued A A A T F C C G B N S S C T I E M F Date sample Site Serotype1 M M M I O R I E C A T X H E P T E F K X P O X O P N N L R T L T M P M C February 22, 2013 Site #17 O69:H11a S I R S S S S S S S R R S R S S S I Site #19 O182(O109):H5d S S S S S S S S I S S S S I S S S S June 6, 2013 Site #17 O98:NMb S S S S S S S S S S I S I I S S S I O98:NMb S S S I S S S S S S S S S I S S S S O157:H7 S S S S S S S S S S S S I I S S S I O182(O109):H5d S S S I S S S S S S S S S S S S S I O182(O109):H5d S S S S S S S S S S I S I I S S S I October 1, 2013 Site #19 O111:H8c S S S I S S S S S S R R R R S S S R November 16, 2013 Site #17 O8:H9 S S I S S S S S S S S S S S S S S I Site #19 O103:H25f S S I S S S S S S S S S S S S S S R Site #20 O103:H25f S S I S S S S S S S S S S S S S S I 1 The letter represents similar banding patterns observed between the isolates. 2 Denotes S – susceptible; I – intermediate resistance; R – resistant. List of antibiotics: amikacin (AMK), amoxicillin/clavulanic acid (AMX), ampicillin (AMP), cefoxitin (FOX), ceftiofur (TIO), ceftriaxone (CRO), chloramphenicol (CHL), ciprofloxacin (CIP), ertapenem (ETP), gentamicin (GEN), imipenem (IPM), kanamycin (BCN), meropenem (MEM), nalidixic acid (NAL), streptomycin (STR), tetracycline (TET), trimethoprim-sulfamethoxazole (SXT) and florfenicol (FFC).

174

A.5 Antibiotic resistance profiles of VTEC isolates recovered from sediments collected from Site #10 of the Sumas River watershed. A A A T F C C G B N S S C T I E M F Date sample Serotype1 M M M I O R I E C A T X H E P T E F K X P O X O P N N L R T L T M P M C July 13, 2013 O88:H25 S2 S I2 S S S S S S S S S S I S S S R2 November16, 2013 O103:H2a S S I S S S S S S S S S S S S S S I O103:H2a S S I S S S S S S S S S S S S S S I November 29,2013 O103:H2 S S I S S S S S I S R R R R S S S I 1 The letter represents similar banding patterns observed between the isolates. 2 Denotes S – susceptible; I – intermediate resistance; R – resistant. List of antibiotics: amikacin (AMK), amoxicillin/clavulanic acid (AMX), ampicillin (AMP), cefoxitin (FOX), ceftiofur (TIO), ceftriaxone (CRO), chloramphenicol (CHL), ciprofloxacin (CIP), ertapenem (ETP), gentamicin (GEN), imipenem (IPM), kanamycin (BCN), meropenem (MEM), nalidixic acid (NAL), streptomycin (STR), tetracycline (TET), trimethoprim-sulfamethoxazole (SXT) and florfenicol (FFC).

175