Thrombopoietin from Hepatocytes Promotes Hematopoietic Stem Cell Regeneration After

bioRxiv preprint doi: https://doi.org/10.1101/2021.05.13.443980; this version posted May 13, 2021. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made available under aCC-BY 4.0 International license. Page 1

Thrombopoietin from hepatocytes promotes hematopoietic stem cell regeneration after

myeloablation

Longfei Gao1, Matthew Decker1, Haidee Chen, and Lei Ding2

Columbia Stem Cell Initiative, Department of Rehabilitation and Regenerative Medicine,

Department of Microbiology and Immunology, Columbia University Medical Center, New York,

NY, 10032, USA.

1 These authors contribute equally.

2 Author for correspondence: Columbia Stem Cell Initiative, Department of Rehabilitation and

Regenerative Medicine, Department of Microbiology and Immunology, Columbia University

Irving Medical Center, 650 West 168th ST, BB 1103C, New York, NY, 10032; phone 212-305-

7468; fax 212-342-3889; email [email protected]

Abstract

The bone marrow niche plays a critical role in hematopoietic recovery and hematopoietic stem

cell (HSC) regeneration after myeloablation. However, it is not clear whether systemic factors

beyond the local niche are required for these essential processes in vivo. Thrombopoietin (TPO)

is a critical cytokine promoting hematopoietic rebound after myeloablation and its transcripts are

expressed by multiple cellular sources. The upregulation of bone marrow-derived TPO has been

proposed to be crucial for hematopoietic recovery and HSC regeneration after stress.

Nonetheless, the cellular source of TPO in stress has never been investigated genetically. We

assessed the functional sources of TPO following two common myeloablative perturbations: 5-

fluorouracil (5-FU) administration and irradiation. Using a Tpo translational reporter, we found

that the liver but not the bone marrow is the major source of TPO protein after myeloablation.

Mice with conditional Tpo deletion from osteoblasts or bone marrow stromal cells showed

normal recovery of HSCs and hematopoiesis after myeloablation. In contrast, mice with

conditional Tpo deletion from hepatocytes showed significant defects in HSC regeneration and

hematopoietic rebound after myeloablation. Thus, systemic TPO from the liver is necessary for

HSC regeneration and hematopoietic recovery in myeloablative stress conditions.

Introduction

Hematopoietic stem cells (HSCs) generate all blood and immune cells, and play critical roles in

the regeneration of the blood system after stress. They reside in the bone marrow niche where

Leptin Receptor+ (LepR+) perivascular stromal cells and endothelial cells are the major sources

of factors that promote their maintenance 1-3. Following myeloablative stress, HSCs regenerate

in the bone marrow niche, which is essential for the recovery of hematopoiesis 4-7. Several

signaling pathways, including Notch, EGF/EGFR, pleiotrophin, Dkk1, Angiogenin, and SCF/c-

KIT, have been shown to be critical for this process 8-13. Many of these cytokines arise from the

local bone marrow niche for HSC regeneration and hematopoietic recovery in a paracrine

fashion 12,14-16. However, it is not clear whether systemic signals that originate outside the bone

marrow also regulate HSC regeneration and hematopoietic recovery after stress.

Thrombopoietin (TPO) is critical for bone marrow HSC maintenance and hematopoietic

recovery 17-20. TPO was first identified as the ligand to the MPL receptor and a driver of

megakaryopoiesis and platelet production 21-23. It was later shown that the TPO/MPL signaling

was required for the maintenance of HSCs 24. The TPO/MPL signaling also plays a crucial role

in hematopoietic stress response, particularly after myeloablation. The characteristic

hematopoietic progenitor rebound following administration of the antimetabolite drug 5-

fluorouracil (5-FU) is dependent on MPL 25. After irradiation, the TPO/MPL signaling is similarly

essential for hematopoietic recovery and survival 20,26-28. Indeed, TPO mimetic drugs, such as

romiplostim and eltrombopag, have been shown to improve recovery after ablative challenge,

and have also been used clinically to support hematopoiesis in diseases such as immune

thrombocytopenic purpura and aplastic anemia 29-32.

The regulation of TPO production has been extensively investigated, but the in vivo source of

TPO for HSC regeneration and hematopoietic recovery after myeloablation is not clear. bioRxiv preprint doi: https://doi.org/10.1101/2021.05.13.443980; this version posted May 13, 2021. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made available under aCC-BY 4.0 International license. Page 4

Previous studies have found that bone marrow populations such as stromal cells and

osteoblasts may upregulate TPO in hematopoietic stress conditions, while the liver produces

Tpo transcripts at a constant level 19,33. However, other investigators have found no significant

changes in bone marrow Tpo transcript levels after 5-FU-mediated myeloablative treatment 25.

Because Tpo expression is under heavy translational control 34, it is not clear what cells produce

TPO protein for HSC regeneration and hematopoietic recovery after myeloablation.

Furthermore, although upregulation of TPO may be a key mechanism of the bone marrow

response to hematopoietic stress, the role of local TPO from bone marrow niche and systemic

TPO from the liver for HSC and hematopoietic recovery has not been functionally investigated in

vivo. Nonetheless, most studies proposed that local TPO derived from the bone marrow niche is

critical for HSC and hematopoietic recovery after myeloablation 19,35. Here we genetically

dissected the in vivo source of TPO for HSC and hematopoietic recovery following

myeloablative stress.

Results

Myeloablation induced by 5-FU drives TPO-dependent hematopoietic recovery and HSC

expansion

5-FU is a commonly used chemotherapy agent that leads to myeloablation. To test whether

TPO is required for hematopoietic recovery after 5-FU treatment, we administrated 5-FU to Tpo

knockout (Tpogfp/gfp) 17 and wild-type control mice at 150mg/kg via a single intraperitoneal

injection. Because Tpogfp/gfp mice may have phenotypes compared with wild-type controls

without any treatment 17, we also normalized hematopoietic parameters with baseline mice of

the same genotype without any treatment. Ten days after the 5-FU administration, treated wild-

type mice showed normal leukocyte and neutrophil counts, normal reticulocyte frequency, but

significantly increased platelet counts, while treated Tpogfp/gfp mice had no platelet expansion

(Fig. S1 A-D). When normalized to baseline levels, Tpogfp/gfp mice had a significant reduction of bioRxiv preprint doi: https://doi.org/10.1101/2021.05.13.443980; this version posted May 13, 2021. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made available under aCC-BY 4.0 International license. Page 5

leukocyte, neutrophil, and platelet counts as well as reticulocyte frequency compared with wild-

type controls (Fig. S1 A-D), suggesting that Tpo is required for hematopoietic recovery.

Normalized post-treatment bone marrow cellularity did not differ significantly while spleen

cellularity was significantly reduced in Tpogfp/gfp mice compared with wild-type controls (Fig. S1 E

and F). The frequencies of bone marrow and spleen HSCs (Lineage- Sca-1+ c-kit+ CD150+CD48-

, LSKCD150+CD48- ) were more than 10 fold greater in 5-FU treated wild-type mice than

baseline controls, while 5-FU treated Tpogfp/gfp mice showed no change from baseline (Fig. S1 G

and H). Overall, 5-FU stimulated a 3.7-fold increase of total HSC number in wild-type mice, but

no significant effects were observed in Tpogfp/gfp mice (Fig. S1 I). Compared with wild-type

controls, the HSC increase responsiveness to 5-FU in Tpogfp/gfp mice was 8 fold less (Fig. S1 I).

The effects of 5-FU on bone marrow and spleen hematopoietic progenitor cells (LSK) were also

blunted in Tpogfp/gfp mice (Fig. S1 J and K). Thus, hematopoietic recovery, expansion of HSCs

and hematopoietic progenitors following chemoablation mediated by 5-FU is TPO-dependent.

Hepatic but not bone marrow TPO is required for HSC and hematopoietic recovery after

5-FU-mediated myeloablation

To identify the source of TPO, we investigated Tpo expression following 5-FU treatment. It has

been reported that the bone marrow upregulates Tpo mRNA in stress conditions 33. Although

bone marrow stromal cells (CD45- Ter119- ) express Tpo transcripts, we did not observe a

significant upregulation of Tpo transcripts 14 days after 5-FU injection compared with baseline

levels (Fig. S2 A). TPO protein production is under strong translational controls 34. To assess

translation and generation of TPO protein following 5-FU treatment, TpocreER; ZsGreenLSL

translational reporter mice 17 were injected with 5-FU and immediately started on a 10-day

course of tamoxifen treatment. Although robust expression of the ZsGreen was observed in the

liver (Fig. 1 A), no ZsGreen fluorescence was appreciated in the bone marrow (Fig. 1 B). Within bioRxiv preprint doi: https://doi.org/10.1101/2021.05.13.443980; this version posted May 13, 2021. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made available under aCC-BY 4.0 International license. Page 6

the liver, ZsGreen were from HNF4a+ hepatocytes (Fig. 1 C and D). These data suggest that

hepatocytes but not the bone marrow is the major source of TPO after 5-FU treatment.

Although we did not detect appreciable Tpo translation in the bone marrow after 5-FU treatment

(Fig. 1 B), osteoblasts and LepR+ mesenchymal stromal cells are the major bone marrow cells

expressing Tpo transcripts 17,33,36, and based on antibody staining, it has been reported that

osteoblasts express TPO protein after 5-FU treatment 19. To formally test the function of TPO

from these cells, we conditionally deleted Tpo from osteoblasts (Col2.3-cre; Tpofl/gfp) or

mesenchymal stromal cells (Lepr-cre; Tpofl/gfp). Deletion of Tpo from osteoblasts or LepR+

stromal cells had no significant effects on leukocytes, neutrophils, platelets, reticulocytes, bone

marrow and spleen cellularity, HSCs, or LSKs after 5-FU treatment (Fig. 1 E-M, Fig. S2 B and

C). These results show that hematopoietic recovery and HSC regeneration from 5-FU treatment

does not require TPO production by bone marrow osteoblasts or mesenchymal stromal cells.

It is possible that osteoblasts and mesenchymal stromal cells serve as redundant sources of

TPO. We thus also generated Prx1-cre; Tpofl/gfp mice. Prx1-cre drives recombination in

mesenchymal lineage cells in murine long bones, including both osteoblasts and mesenchymal

stromal cells 3,37,38, allowing conditional deletion of Tpo from both osteoblasts and mesenchymal

stromal cells. Adult baseline Prx1-cre; Tpofl/gfp mice had normal blood cell counts, normal bone

marrow cellularity, normal HSC and LSK frequencies, and showed no signs of extramedullary

hematopoiesis in the spleen (Fig. S2 D-N), consistent with the notion that TPO from the bone

marrow is not required for HSC maintenance or hematopoiesis 17. We then administrated 5-FU

to these mice. Deletion of Tpo from both osteoblasts and mesenchymal cells in Prx1-cre;

Tpofl/gfp mice had no effects on leukocytes, neutrophils, platelets, reticulocytes, bone marrow

and spleen cellularity, HSCs, or LSKs after 5-FU chemoablation (Fig. 1 E-M, Fig. S2 B and C). bioRxiv preprint doi: https://doi.org/10.1101/2021.05.13.443980; this version posted May 13, 2021. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made available under aCC-BY 4.0 International license. Page 7

These results strengthen our finding that the bone marrow is not a source of TPO for

hematopoietic recovery and HSC regeneration following 5-FU treatment.

Hepatic TPO is required for steady-state bone marrow HSC maintenance as conditional deletion

of Tpo from hepatocytes leads to HSC depletion 17. We found that hepatocytes are also the

major source of TPO after 5-FU treatment (Fig. 1 A-D). To address whether hepatic TPO is

required for hematopoietic recovery and HSC regeneration after 5-FU-mediated stress, we

treated adult Tpofl/fl mice with hepatotropic AAV8-TBG-cre virus (AAV) concurrently with 5-FU

injection. A single dose of this Cre-bearing adenovirus drives efficient and specific

recombination in hepatocytes 17. Ten days after the treatment, AAV-treated mice showed a

significant reduction of platelet and reticulocyte expansion, with normal leukocyte and neutrophil

responses relative to controls (Fig. 2 A-D, Fig. S3 A and B). Although the response of spleen

HSC frequency to 5-FU was not significantly impacted by AAV treatment, the responses of bone

marrow HSC frequency and the total number of HSCs were significantly decreased in AAV-

treated mice compared to controls (Fig. 2 E-N), indicating a compromised HSC recovery after 5-

FU treatment. Consistently, bone marrow cells from these AAV-treated mice after 5-FU

administration showed a significant reduction in reconstituting irradiated recipient mice

compared with controls (Fig. 2 O). The responses of bone marrow and spleen LSK frequencies

to 5-FU were largely normal in AAV-treated mice compared with controls (Fig. S3 C and D),

suggesting that the effects of acutely disrupted TPO signaling are most pronounced on HSCs,

rather than restricted hematopoietic progenitors. Altogether, these data suggest that hepatic but

not bone marrow-derived TPO is required for hematopoietic and HSC recovery after 5-FU

treatment.

Hematopoiesis from TPO-deficient mice are sensitive to ionizing radiation bioRxiv preprint doi: https://doi.org/10.1101/2021.05.13.443980; this version posted May 13, 2021. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made available under aCC-BY 4.0 International license. Page 8

Ionizing radiation is another common myeloablative treatment. To test whether TPO is required

for hematopoietic recovery in this condition, we exposed mice to a single 5.5 Gy dose of

radiation. Four weeks after the irradiation, both wild-type and Tpogfp/gfp mice had leukopenia,

decreased bone marrow cellularity, and decreased bone marrow LSKs relative to non-irradiated

baseline levels (Fig. S4 A-F). However, Tpogfp/gfp mice had significantly more severe

perturbations and additionally had no detectable bone marrow HSCs (Fig. S4 A-G). The

functional impact of these differences was demonstrated by a significant increase in mortality

among Tpogfp/gfp mice following irradiation (Fig. S4 H). Compared with baseline levels, neither

wild-type nor Tpogfp/gfp mice had notable differences in platelet counts, spleen cellularity, or

spleen LSK frequency in response to irradiation (Fig. S4 C, I and J). However, Tpogfp/gfp mice

had diminished regeneration of spleen HSC frequency and total HSC numbers compared with

controls (Fig. S4 K and L). Thus, Tpo is required for hematopoietic and HSC recovery after

irradiation.

Hepatic but not bone marrow TPO is required HSC regeneration after ionizing radiation

It is not clear what cells are the major source of TPO after irradiation. Bone marrow stromal cells

(CD45- Ter119- ) did not have significantly upregulated Tpo transcripts 14 days after irradiation

(Fig. S2 A). To assess the translation of TPO protein following irradiation, TpocreER; ZsGreenLSL

translational reporter mice were irradiated and immediately dosed with a 10-day course of

tamoxifen treatment. Although robust recombination of the ZsGreenLSL allele was observed in

the liver (Fig. 3 A), no ZsGreen was observed in the bone marrow (Fig. 3 B). Hepatocytes were

the major cell type that expressed TPO in the liver after irradiation (Fig. 3 C and D). This finding

suggests that hepatocytes are the major source of TPO with no appreciable expression in the

bone marrow following radioablation.

To functionally test whether osteoblasts and bone marrow mesenchymal cells are sources of

TPO for hematopoietic recovery and HSC regeneration after irradiation, we gave Col2.3-cre;

Tpofl/gfp or Lepr-cre; Tpofl/gfp mice, along with littermate controls, a single 5.5 Gy dose of radiation

and analyzed them four weeks later. Compared with irradiated controls, Col2.3-cre; Tpofl/gfp, or

Lepr-cre; Tpofl/gfp, mice showed no significant differences in leukocytes, neutrophils, platelets,

and reticulocytes (Fig. 3 E-H). Bone marrow cellularity, LSK and HSC frequencies were also

normal (Fig. 3 I and J, Fig. S5 A). These mice also had normal spleen cellularity, LSK and HSC

frequency, as well as total HSC numbers (Fig. 3 K-M and Fig. S5 B). These data suggest that

osteoblasts or the bone marrow mesenchymal stromal cells are a dispensable source of TPO

for HSC and hematopoietic recovery from radioablative challenges.

To test the role of hepatocyte-derived TPO, we then irradiated Tpofl/fl mice treated with AAV8-

TBG-cre virus. Compared to control mice, these mice showed a similar response to irradiation in

leukocyte, neutrophil and platelet counts as well as reticulocyte frequency (Fig. 4 A, and Fig. S5

C-E). Although the bone marrow cellularity response to irradiation was similar between Tpofl/fl

mice treated with AAV and control, there was a significant reduction in bone marrow HSC but

not LSK frequency recovery relative to controls after irradiation (Fig. 4 C-F and Fig. S5 F).

Compared with controls, spleen cellularity, LSK and HSC frequencies from Tpofl/fl mice treated

with AAV had a similar recovery after irradiation (Fig. 4 G-J and Fig. S5 G). Overall, Tpofl/fl mice

treated with AAV had a significant reduction in total HSC number recovery after irradiation (Fig.

4 K and L). Importantly, bone marrow cells from these irradiated AAV-treated mice showed

functional defects in reconstituting irradiated recipients (Fig. 4 M). These data suggest that

hepatic TPO is required for proper functional recovery of HSCs following irradiation-mediated

myeloablation.

Discussion bioRxiv preprint doi: https://doi.org/10.1101/2021.05.13.443980; this version posted May 13, 2021. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made available under aCC-BY 4.0 International license. Page 10

Our data show that the bone marrow does not meaningfully upregulate TPO protein after 5-FU

treatment or irradiation. Although we did not exhaustively investigate all models of ablative

conditioning, it appears that the bone marrow is not a functional source of TPO in hematopoietic

recovery from acute myeloablative stress. However, our data do not rule out the possibility that

bone marrow may serve as a source of TPO in certain specific stress conditions, such as

idiopathic thrombocytopenia purpura 33. Future investigation into additional stress conditions is

needed. We found that liver hepatocytes are an important source of TPO for stress

hematopoiesis. Although several other studies have investigated the role of TPO on

hematopoietic recovery after stress, the source of TPO and its impact on HSCs (rather than

hematopoietic progenitors) have not been examined. By examining HSCs and hematopoietic

progenitors, we show that HSCs are more sensitive to acute TPO perturbation than

hematopoietic progenitors (LSKs), suggesting the major role of TPO in myeloablation is to

promote HSC regeneration, at least under the conditions we studied. To our knowledge, TPO is

the first systemic factor required for HSC regeneration and hematopoietic recovery identified to

date. The presence of a stem-cell hormone, like TPO, raises the possibility of other endocrine

regulators of HSC regeneration and hematopoietic recovery.

Numerous connections between hepatic and hematopoietic pathophysiology have long been

appreciated. Aplastic anemia is a known sequela of pediatric liver failure, and thrombocytopenia

is a well-characterized feature of hepatic disease 39-41. While mechanisms such as metabolic

toxicity and splenic sequestration may play a role in mediating these effects, it seems likely that

disruption of TPO signaling is also involved. Indeed, several recent clinical studies have shown

that newly developed TPO agonists can reduce the need for platelet transfusions in patients

with chronic liver disease 42,43. While early trials of TPO mimetics in primary and acquired

aplastic anemia have been promising, to our knowledge, no group has specifically studied their

use in liver failure-associated aplastic anemia 31,32. Given that hepatic Tpo mRNA and serum bioRxiv preprint doi: https://doi.org/10.1101/2021.05.13.443980; this version posted May 13, 2021. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made available under aCC-BY 4.0 International license. Page 11

TPO levels are significantly downregulated in liver failure 44, further studies are warranted. Our

data suggest that cancer patients with underlying liver disease may have greater sensitivity to

myeloablative conditioning and supplementing TPO mimetics may help alleviate the adverse

effects associated with myeloablative conditioning in these patients.

Materials and methods

Mice

All mice were 8-16 weeks old and maintained on a C57BL/6 background. Prx1-cre, Lepr-cre and

LoxpZsGreen mice were obtained from the Jackson Laboratory. Col2.3-cre mice were

described previously 45. Generation of Tpogfp, TpocreER and Tpofl mice was described previously

17. All mice were housed in specific pathogen-free, Association for the Assessment and

Accreditation of Laboratory Animal Care (AAALAC)- approved facilities at the Columbia

University Medical Center. All protocols were approved by the Institute Animal Care and Use

Committee of Columbia University.

Genotyping PCR

Primers for genotyping TpocreER: OLD815, 5’-CCACCACCATGCCTAACTCT-3’; OLD816, 5’-

GTTCTCCTCCACGTCTCCAG-3’; and OLD817, 5’-TCGCTAGCTGCTCTGATGAA-3’.

Primers for genotyping loxpZsGreen: GGCATTAAAGCAGCGTATCC and

AACCAGAAGTGGCACCTGAC

Primers for genotyping Tpofl: OLD581, 5’-CATCTCGCTGCTCTTAGCAGGG-3’ and OLD582, 5’-

GAGCTGTTTGTGTTCCAACTGG-3’.

Primers for genotyping Tpogfp: OLD292, 5’-CGGACACGCTGAACTTGTGG-3’; OLD528 5’-

ACTTATTCTCAGGTGGTGACTC-3’ and OLD653 5’-AGGGAGCCACTTCAGTTAGAC-3’. bioRxiv preprint doi: https://doi.org/10.1101/2021.05.13.443980; this version posted May 13, 2021. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made available under aCC-BY 4.0 International license. Page 12

Primers for genotyping Lepr-cre: OLD434 5’-CATTGTATGGGATCTGATCTGG-3’ and OLD435

5’-GGCAAATTTTGGTGTACGGTC-3’.

Primers for genotyping cre: OLD338, 5’-GCATTTCTGGGGATTGCTTA-3’ and OLD339, 5’-

ATTCTCCCACCGTCAGTACG-3’.

Chemoablative challenge

5-Fluorouracil (5-FU) (150mg/kg) was administered to mice via a single intraperitoneal injection.

Ten days post-injection, mice were euthanized for analysis.

Radioablative challenge

Mice were irradiated by a Cesium 137 Irradiator (JL Shepherd and Associates) at 300 rad/min

with one dose of 550 rad. Four weeks after irradiation, mice were euthanized for analysis.

Tamoxifen administration

Tamoxifen (Sigma) was dissolved in corn oil for a final concentration of 20mg/mL. Every other

day for 10 days, 50uL of the solution was administered by oral gavage. Mice were analyzed 2-4

days after the final tamoxifen administration.

Viral infections

Replication-incompetent AAV8-TBG-cre was obtained from the Penn Vector Core or Addgene.

AAV8-TBG-cre carries Cre recombinase under the regulatory control of hepatocyte-specific

thyroid-binding globulin (TBG) promoter. Efficient recombination was achieved at a dose of 2.5 x

1011 viral particles diluted in sterile 1x PBS. AAV8-TBG-cre was administered to mice via retro-

orbital venous sinus injection.

Flow cytometry bioRxiv preprint doi: https://doi.org/10.1101/2021.05.13.443980; this version posted May 13, 2021. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made available under aCC-BY 4.0 International license. Page 13

Bone marrow cells were isolated by flushing the long bones or by crushing the long bones,

pelvis, and vertebrae with mortar and pestle in Ca2+ and Mg2+free HBSS with 2% heat-

inactivated bovine serum. Spleen cells were obtained by crushing the spleens between two

glass slides. The cells were passed through a 25G needle several times and filtered with a

70µm nylon mesh. The following antibodies were used to perform HSC staining: lineage

markers (anti-CD2 (RM2-5), anti-CD3 (17A2), anti-CD5 (53-7.3), anti-CD8a (53-6.7), anti-B220

(6B2), anti-Gr-1 (8C5), anti-Ter119), anti-Sca-1 (E13-161.7), anti-c-kit (2B8), anti-CD48 (HM48-

1), anti-CD150 (TC15-12F12.2).

For flow cytometric sorting of bone marrow stromal cells, bone marrow plugs were flushed as

described above, then digested with collagenase IV (200 U/mL) and DNase1 (200 U/mL)

at 37°C for 20min. Samples were then stained with anti-CD45 (30F-11), and anti-Ter119

antibodies and sorted on a flow cytometer.

qRT-PCR

Cells were sorted directly into Trizol. Total RNA was extracted according to manufacturer’s

instructions. Total RNA was subjected to reverse transcription using SuperScript III (Invitrogen)

or ProtoScript II (NEB). Quantitative real-time PCR was run using SYBR green on a CFX

Connect system (Biorad). β-actin was used to normalize the RNA content of samples. Primers

used were: Tpo: OLD390, CCTTTGTCTATCCCTGTTCTGC and OLD391,

ACTGCCCCTAGAATGTCCTGT. β-actin: OLD27, 5’-GCTCTTTTCCAGCCTTCCTT-3’ and

OLD28, 5’-CTTCTGCATCCTGTCAGCAA-3’.

Bone and liver sectioning

Freshly disassociated long bones were fixed for 3h in a solution of 4% paraformaldehyde, 7%

picric acid, and 10% sucrose (W/V). The bones were then embedded in 8% gelatin, immediately bioRxiv preprint doi: https://doi.org/10.1101/2021.05.13.443980; this version posted May 13, 2021. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made available under aCC-BY 4.0 International license. Page 14

snap frozen in liquid N2, and stored at -80 °C. Bones were sectioned using a CryoJane system

(Instrumedics). For liver, cardiac perfusion with formalin was performed immediately after

mouse sacrifice, and perfused liver tissue was dehydrated in a 30% sucrose solution overnight

at 4 °C. Liver tissue was then placed in PELCO Cryo-Embedding compound (Ted Pella, Inc.),

frozen on dry ice, and stored at -80 °C. Liver tissue was sectioned and directly transferred onto

microscope slides. Both bone and liver sections were dried overnight at room temperature and

stored at -80 °C. Sections were rehydrated in PBS for 5min, stained with DAPI for 15min, then

mounted with Vectashield Hardset Antifade Mounting Medium (Vector Laboratories). Images

were acquired on a Nikon Eclipse Ti confocal microscope (Nikon Instruments) or a Leica SP8

confocal microscope (Leica Microsystems).

Long-term competitive reconstitution assay

Adult recipient mice were lethally irradiated by a Cesium 137 Irradiator (JL Shepherd and

Associates) at 300 rad/min with two doses of 550 rad (total 1100 rad) delivered at least two

hours apart. Cells were transplanted by retro-orbital venous sinus injection of anesthetized

mice. Donor bone marrow cells were transplanted along with recipient bone marrow cells into

lethally irradiated recipient mice. The recipient bone marrow cells were from mice that are

treated similarly as the donor mice. Mice were maintained on antibiotic water (Baytril 0.17g/L)

for 14 days then switched to regular water. Recipient mice were periodically bled to assess the

level of donor-derived blood lineages, including myeloid, B, and T cells for at least 16 weeks.

Blood was subjected to ammonium chloride potassium red cell lysis before antibody staining.

Antibodies including anti-CD45.2 (104), anti-CD45.1 (A20), anti-CD3 (17A2), anti-B220 (6B2),

anti-Gr-1 (8C5), and anti-Mac-1 (M1/70) were used to stain cells. Mice with presence of donor-

derived myeloid, B, and T cells for 16 weeks were considered as long-term multilineage

reconstituted. bioRxiv preprint doi: https://doi.org/10.1101/2021.05.13.443980; this version posted May 13, 2021. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made available under aCC-BY 4.0 International license. Page 15

Statistical Analysis

All analyses were done using GraphPad Prism 7.0. In any comparison between a pooled control

cohort and multiple experimental conditions, we used one-way ANOVA with Dunnett’s test. For

all other comparisons we used unpaired Welch’s t-test. P-values and adjusted p-values between

0.01 and 0.1 were displayed; those greater than 0.1 were designated ‘not significant’. In all

figures, error bars represent standard error of mean.

Data Sharing Statement

For original data, please contact the corresponding author by email

([email protected]).

Acknowledgements

This work was supported by the National Heart, Lung and Blood Institute (R01HL132074). L.G.

was supported by the NYSTEM Columbia training program in stem cell research and a

Columbia Stem Cell Initiative Seed Grant. M.D. was supported by the Columbia Medical

Scientist Training Program and the NIH (1F30HL137323). L.D. was supported by the Rita Allen

Foundation, the Irma Hirschl Research Award, the Schaefer Research Scholar Program and the

Leukemia and Lymphoma Society Scholar award, R01HL153487 and R01HL155868. Images

were collected in the Confocal and Specialized Microscopy Shared Resource of the Herbert

Irving Comprehensive Cancer Center at Columbia University, supported by NIH grant

P30CA013696 (National Cancer Institute). We thank M. Kissner at the Columbia Stem Cell

Initiative for help on flow cytometry.

Author Contributions bioRxiv preprint doi: https://doi.org/10.1101/2021.05.13.443980; this version posted May 13, 2021. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made available under aCC-BY 4.0 International license. Page 16

L.G., M.D., and H.C. performed all of the experiments. L.G., M.D., and L.D. designed the

experiments, interpreted the results, and wrote the manuscript.

Author Information

The authors declare no competing financial interests.

Figure Legends

Figure 1. Bone marrow TPO is not required for hematopoietic recovery and HSC

expansion after 5-FU chemoablation

(A) Confocal images of liver sections from tamoxifen-treated TpocreER; loxpZsGreen mice 10

days after 5-FU injection.

(B) Confocal images of femur sections from tamoxifen-treated TpocreER; loxpZsGreen mice 10

days after 5-FU injection.

(C and D) Confocal images showing immunostaining of HNF4α on liver sections from tamoxifen-

treated TpocreER; loxpZsGreen mice 10 days after 5-FU injection.

(E-H) Blood counts of mice with Tpo conditionally deleted from osteoblasts, bone marrow

stromal cells, or both, and controls after 5-FU challenge. n=3-10 mice.

(I-L) Cellularity and frequencies of HSCs in the bone marrow and spleens from mice with Tpo

conditionally deleted from osteoblasts, bone marrow stromal cells, or both, and controls after 5-

FU challenge. n=3-10 mice. bioRxiv preprint doi: https://doi.org/10.1101/2021.05.13.443980; this version posted May 13, 2021. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made available under aCC-BY 4.0 International license. Page 17

(M) Total number of HSCs in the bone marrow and spleens from mice with Tpo conditionally

deleted from osteoblasts, bone marrow stromal cells, or both, and controls after 5-FU challenge.

n=3-10 mice.

Con: Tpogfp/+ control mice. Col2.3-cre: Col2.3-cre; Tpofl/gfp mice. Lepr-cre: Lepr-cre; Tpofl/gfp mice.

Prx1-cre: Prx1-cre; Tpofl/gfp mice. Data represent mean ± sem. ns, not significant. Statistical

significance was calculated with one-way ANOVA. Each dot represents one independent mouse

in E-M.

Figure 2. Hepatic TPO is required for hematopoietic recovery and HSC expansion after 5-

FU chemoablation

(A-D) Platelet counts and reticulocyte frequencies (A and C) and normalized fold change

relative to no treatment baseline (B and D) of mice with Tpo conditionally deleted from

hepatocytes and their respective controls with and without 5-FU challenge. n=4-16 mice.

(E-L) Cellularity and frequencies of HSCs (E, G, I, K) and normalized fold change (F, H, J, L) in

the bone marrow and spleens from mice with Tpo conditionally deleted from hepatocytes and

controls with and without 5-FU challenge. n=4-16 mice.

(M and N) Total number of HSCs (M) and normalized fold change (N) in the bone marrow and

spleens from mice with Tpo conditionally deleted from hepatocytes and controls with and

without 5-FU challenge. n=4-16 mice.

(O) Numbers of total recipients and long-term multilineage reconstituted recipients after

transplantation of 50,000 bone marrow cells from PBS- or AAV-treated Tpofl/fl and 5-FU

challenged mice along with 500,000 unchallenged competitor bone marrow cells. Recipients

were scored as reconstituted if they showed donor-derived myeloid, B and T cells in the

peripheral blood 16 weeks after transplantation. Data were from recipients of three independent

donor pairs from two independent experiments. bioRxiv preprint doi: https://doi.org/10.1101/2021.05.13.443980; this version posted May 13, 2021. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made available under aCC-BY 4.0 International license. Page 18

Con: Tpofl/fl or wild-type control mice. AAV: AAV8-TBG-cre-treated Tpofl/fl mice. Data represent

mean ± sem. ns, not significant, *P<0.05, ** P<0.01, *** P<0.001, ****P<0.0001. Statistical

significance was assessed with two-way ANOVA (A, C, E, G, I, K, M), student's t-test (B, D, F,

H, J, L, N), or Fisher’s exact test (O). Each dot represents one independent mouse in A-N.

Figure 3. Bone marrow TPO is not required for hematopoietic recovery from irradiation

(A) Confocal images of liver sections from tamoxifen-treated TpocreER; loxpZsGreen mice 10

days after irradiation.

(B) Confocal images of femur sections from tamoxifen-treated TpocreER; loxpZsGreen mice 10

days after irradiation.

(C and D) Confocal images showing immunostaining of HNF4α on liver sections from tamoxifen-

treated TpocreER; loxpZsGreen mice 10 days after irradiation.

(E-H) Blood counts of mice with Tpo conditionally deleted from osteoblasts, bone marrow

stromal cells, and controls after irradiation. n=4-7 mice.

(I-L) Cellularity and frequencies of HSCs in the bone marrow and spleens from mice with Tpo

conditionally deleted from osteoblasts, bone marrow stromal cells, and controls after irradiation.

n=4-7 mice.

(M) Total number of HSCs in the bone marrow and spleens from mice with Tpo conditionally

deleted from osteoblasts, bone marrow stromal cells, and controls after irradiation. n=4-7 mice.

Con: Tpogfp/+ control mice. Col2.3-cre: Col2.3-cre; Tpofl/gfp mice. Lepr-cre: Lepr-cre; Tpofl/gfp mice.

Prx1-cre: Prx1-cre; Tpofl/gfp mice. Data represent mean ± sem. ns, not significant. Statistical

significance was assessed with one-way ANOVA. Each dot represents one independent mouse

in E-M.

Figure 4. Hepatic TPO is required for effective HSC recovery from ionizing radiation

(A and B) Platelet counts (A) and normalized fold change (B) in mice with Tpo conditionally

deleted from hepatocytes and controls with and without irradiation. n=5-7 mice.

(C-J) Cellularity and frequencies of HSCs in the bone marrow and spleens from mice with Tpo

conditionally deleted from hepatocytes and controls with and without irradiation. n=6-7 mice.

(K and L) Total number of HSCs in the bone marrow and spleens from mice with Tpo

conditionally deleted from hepatocytes with and without irradiation. n=6-7 mice.

(M) Numbers of total recipients and long-term multilineage reconstituted recipients after

transplantation of 1,000,000 bone marrow cells from PBS- or AAV-treated Tpofl/fl and irradiated

donor mice along with 1,000,000 irradiated competitor bone marrow cells. Recipients were

scored as reconstituted if they showed donor-derived myeloid, B and T cells in the peripheral

blood 16 weeks after transplantation. Data were from independent recipients of two donor pairs

from two independent experiments.

Con: Tpofl/fl or wild-type control mice. AAV: AAV8-TBG-cre-treated Tpofl/fl mice. Data represent

mean ± sem. ns, not significant, *** P<0.001. Statistical significance was assessed with two-way

ANOVA (A, C, E, G, I, K), student's t-test (B, D, F, H, J, L), or Fisher’s exact test (M). Each dot

represents one independent mouse in A-L.

References 1. Lee Y, Decker M, Lee H, Ding L. Extrinsic regulation of hematopoietic stem cells in development, homeostasis and diseases. Wiley Interdiscip Rev Dev Biol. 2017;6(5).

2. Ding L, Saunders TL, Enikolopov G, Morrison SJ. Endothelial and perivascular cells maintain haematopoietic stem cells. Nature. 2012;481(7382):457-462.

3. Ding L, Morrison SJ. Haematopoietic stem cells and early lymphoid progenitors occupy distinct bone marrow niches. Nature. 2013;495(7440):231-235. bioRxiv preprint doi: https://doi.org/10.1101/2021.05.13.443980; this version posted May 13, 2021. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made available under aCC-BY 4.0 International license. Page 20

4. Hooper AT, Butler JM, Nolan DJ, et al. Engraftment and reconstitution of hematopoiesis is dependent on VEGFR2-mediated regeneration of sinusoidal endothelial cells. Cell stem cell. 2009;4(3):263-274.

5. Bo Zhou LD, Sean Morrison. Hematopoietic stem and progenitor cells regulate the regeneration of their niche by secreting Angiopoietin-1. ELife. 2015.

6. Li XM, Hu Z, Jorgenson ML, Wingard JR, Slayton WB. Bone marrow sinusoidal endothelial cells undergo nonapoptotic cell death and are replaced by proliferating sinusoidal cells in situ to maintain the vascular niche following lethal irradiation. Exp Hematol. 2008;36(9):1143-1156.

7. Kopp HG, Avecilla ST, Hooper AT, et al. Tie2 activation contributes to hemangiogenic regeneration after myelosuppression. Blood. 2005;106(2):505-513.

8. Kimura Y, Ding B, Imai N, Nolan DJ, Butler JM, Rafii S. c-Kit-mediated functional positioning of stem cells to their niches is essential for maintenance and regeneration of adult hematopoiesis. PloS one. 2011;6(10):e26918.

9. Doan PL, Himburg HA, Helms K, et al. Epidermal growth factor regulates hematopoietic regeneration after radiation injury. Nature medicine. 2013;19(3):295-304.

10. Butler JM, Nolan DJ, Vertes EL, et al. Endothelial cells are essential for the self-renewal and repopulation of Notch-dependent hematopoietic stem cells. Cell Stem Cell. 2010;6(3):251- 264.

11. Himburg HA, Muramoto GG, Daher P, et al. Pleiotrophin regulates the expansion and regeneration of hematopoietic stem cells. Nature medicine. 2010;16(4):475-482.

12. Himburg HA, Doan PL, Quarmyne M, et al. Dickkopf-1 promotes hematopoietic regeneration via direct and niche-mediated mechanisms. Nature medicine. 2017;23(1):91-99.

13. Goncalves KA, Silberstein L, Li S, et al. Angiogenin Promotes Hematopoietic Regeneration by Dichotomously Regulating Quiescence of Stem and Progenitor Cells. Cell. 2016;166(4):894-906.

14. Zhou BO, Yu H, Yue R, et al. Bone marrow adipocytes promote the regeneration of stem cells and haematopoiesis by secreting SCF. Nat Cell Biol. 2017;19(8):891-903.

15. Poulos MG, Guo P, Kofler NM, et al. Endothelial Jagged-1 is necessary for homeostatic and regenerative hematopoiesis. Cell reports. 2013;4(5):1022-1034.

16. Guo P, Poulos MG, Palikuqi B, et al. Endothelial jagged-2 sustains hematopoietic stem and progenitor reconstitution after myelosuppression. J Clin Invest. 2017;127(12):4242-4256.

17. Decker M, Leslie J, Liu Q, Ding L. Hepatic thrombopoietin is required for bone marrow hematopoietic stem cell maintenance. Science. 2018;360(6384):106-110.

18. Qian H, Buza-Vidas N, Hyland CD, et al. Critical role of thrombopoietin in maintaining adult quiescent hematopoietic stem cells. Cell stem cell. 2007;1(6):671-684. bioRxiv preprint doi: https://doi.org/10.1101/2021.05.13.443980; this version posted May 13, 2021. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made available under aCC-BY 4.0 International license. Page 21

19. Yoshihara H, Arai F, Hosokawa K, et al. Thrombopoietin/MPL signaling regulates hematopoietic stem cell quiescence and interaction with the osteoblastic niche. Cell stem cell. 2007;1(6):685-697.

20. Mouthon MA, Van der Meeren A, Gaugler MH, et al. Thrombopoietin promotes hematopoietic recovery and survival after high-dose whole body irradiation. Int J Radiat Oncol Biol Phys. 1999;43(4):867-875.

21. Kaushansky K, Lok S, Holly RD, et al. Promotion of megakaryocyte progenitor expansion and differentiation by the c-Mpl ligand thrombopoietin. Nature. 1994;369(6481):568- 571.

22. Lok S, Kaushansky K, Holly RD, et al. Cloning and expression of murine thrombopoietin cDNA and stimulation of platelet production in vivo. Nature. 1994;369(6481):565-568.

23. de Sauvage FJ, Hass PE, Spencer SD, et al. Stimulation of megakaryocytopoiesis and thrombopoiesis by the c-Mpl ligand. Nature. 1994;369(6481):533-538.

24. Kimura S, Roberts AW, Metcalf D, Alexander WS. Hematopoietic stem cell deficiencies in mice lacking c-Mpl, the receptor for thrombopoietin. Proceedings of the National Academy of Sciences of the United States of America. 1998;95(3):1195-1200.

25. Li X, Slayton WB. Molecular mechanisms of platelet and stem cell rebound after 5- fluorouracil treatment. Exp Hematol. 2013;41(7):635-645 e633.

26. de Laval B, Pawlikowska P, Petit-Cocault L, et al. Thrombopoietin-increased DNA-PK- dependent DNA repair limits hematopoietic stem and progenitor cell mutagenesis in response to DNA damage. Cell stem cell. 2013;12(1):37-48.

27. de Laval B, Pawlikowska P, Barbieri D, et al. Thrombopoietin promotes NHEJ DNA repair in hematopoietic stem cells through specific activation of Erk and NF-kappaB pathways and their target, IEX-1. Blood. 2014;123(4):509-519.

28. Wang C, Zhang B, Wang S, et al. Recombinant human thrombopoietin promotes hematopoietic reconstruction after severe whole body irradiation. Sci Rep. 2015;5:12993.

29. Yamaguchi M, Hirouchi T, Yokoyama K, Nishiyama A, Murakami S, Kashiwakura I. The thrombopoietin mimetic romiplostim leads to the complete rescue of mice exposed to lethal ionizing radiation. Sci Rep. 2018;8(1):10659.

30. Rodeghiero F, Ruggeri M. Treatment of immune thrombocytopenia in adults: the role of thrombopoietin-receptor agonists. Semin Hematol. 2015;52(1):16-24.

31. Gill H, Leung GM, Lopes D, Kwong YL. The thrombopoietin mimetics eltrombopag and romiplostim in the treatment of refractory aplastic anaemia. Br J Haematol. 2017;176(6):991- 994.

32. Desmond R, Townsley DM, Dumitriu B, et al. Eltrombopag restores trilineage hematopoiesis in refractory severe aplastic anemia that can be sustained on discontinuation of drug. Blood. 2014;123(12):1818-1825. bioRxiv preprint doi: https://doi.org/10.1101/2021.05.13.443980; this version posted May 13, 2021. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made available under aCC-BY 4.0 International license. Page 22

33. Sungaran R, Markovic B, Chong BH. Localization and regulation of thrombopoietin mRNa expression in human kidney, liver, bone marrow, and spleen using in situ hybridization. Blood. 1997;89(1):101-107.

34. Ghilardi N, Wiestner A, Skoda RC. Thrombopoietin production is inhibited by a translational mechanism. Blood. 1998;92(11):4023-4030.

35. Kaushansky K. The molecular mechanisms that control thrombopoiesis. The Journal of clinical investigation. 2005;115(12):3339-3347.

36. Guerriero A, Worford L, Holland HK, Guo GR, Sheehan K, Waller EK. Thrombopoietin is synthesized by bone marrow stromal cells. Blood. 1997;90(9):3444-3455.

37. Logan M, Martin JF, Nagy A, Lobe C, Olson EN, Tabin CJ. Expression of Cre Recombinase in the developing mouse limb bud driven by a Prxl enhancer. Genesis. 2002;33(2):77-80.

38. Greenbaum A, Hsu YM, Day RB, et al. CXCL12 in early mesenchymal progenitors is required for haematopoietic stem-cell maintenance. Nature. 2013;495(7440):227-230.

39. Tung J, Hadzic N, Layton M, et al. Bone marrow failure in children with acute liver failure. J Pediatr Gastroenterol Nutr. 2000;31(5):557-561.

40. Hadzic N, Height S, Ball S, et al. Evolution in the management of acute liver failure- associated aplastic anaemia in children: a single centre experience. J Hepatol. 2008;48(1):68- 73.

41. Peck-Radosavljevic M. Thrombocytopenia in chronic liver disease. Liver Int. 2017;37(6):778-793.

42. Peck-Radosavljevic M, Simon K, Iacobellis A, et al. Lusutrombopag for the Treatment of Thrombocytopenia in Patients With Chronic Liver Disease Undergoing Invasive Procedures (L- PLUS 2). Hepatology. 2019;70(4):1336-1348.

43. Xu H, Cai R. Avatrombopag for the treatment of thrombocytopenia in patients with chronic liver disease. Expert Rev Clin Pharmacol. 2019;12(9):859-865.

44. Wolber EM, Ganschow R, Burdelski M, Jelkmann W. Hepatic thrombopoietin mRNA levels in acute and chronic liver failure of childhood. Hepatology. 1999;29(6):1739-1742.

45. Liu F, Woitge HW, Braut A, et al. Expression and activity of osteoblast-targeted Cre recombinase transgenes in murine skeletal tissues. The International journal of developmental biology. 2004;48(7):645-653.

bioRxiv preprint doi: https://doi.org/10.1101/2021.05.13.443980; this version posted May 13, 2021.DAPI The copyright/ZsGreen holder/HNF4α for this preprint (which was not certifiedDAPI by/ ZsGreenpeer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made A availableMerge under aCC-BYC 4.0 International license. liver

100 µm Merge B Merge D

BM Marrow Bone Marrow Bone Marrow Bone

10 µm Merge Leukocytes Neutrophil Platelets E 30 F 3 G 4,000 ns

/μl) ns 3 ns /μl)

3 3,000 μl ) /

20 2 3 ns ns ns 10 2,000 ns (x

ns s 10 1

ns ele t 1,000 la t Neutrophil (x 10 P

White Blood Cells (x 10 0 0 0

Con Con Con Lepr-crePrx1-cre Lepr-crePrx1-cre Lepr-crePrx1-cre Col2.3-cre Col2.3-cre Col2.3-cre H Reticulocytes I BM Cellularity J BM HSCs )

2.0 9 1.5 0.3 ns ns 1.5 1.0 0.2 ns 1.0 ns ns

0.5 ns HSCs (% ) 0.1 0.5 ns Reticulocytes (% ) ns ns Bone Marrow Cells (x 10 0.0 0.0 0.0

Con Con Con Lepr-crePrx1-cre Lepr-crePrx1-cre Lepr-crePrx1-cre Col2.3-cre Col2.3-cre Col2.3-cre K Spleen Cellularity L Spleen HSCs M Total HSC number 4 0.08 ns 10

) ns 8 ns

) 8 3 0.06 ns 5 ns 6 2 0.04 Cs (x10

S 4 HSCs (% ) H 1 0.02 Spleen Cells (x 10 ns 2 0 0.00 0

Con Con Con Lepr-crePrx1-cre Lepr-crePrx1-cre Lepr-crePrx1-cre Col2.3-cre Col2.3-cre Col2.3-cre

FIGURE 1

DAPI/ZsGreen DAPI/ZsGreen/HNF4α A Merge C Merge liver

100 µm B Merge D Merge BM

Bone Marrow Bone Marrow Bone Marrow 10 µm

E Leukocytes F Neutrophils G Platelets 6 2.5 800 μl ) /

3 ns

0 ns l) 1 μl )

2.0 ns / μ 3 /

x 600 3 ( 0

ns 0

4 1 ns 1 1.5 x (x ns ( Cell s

400 1.0 ts el e loo d rophil 2 t B a

l 200 e P t

i 0.5 Neu t h W 0 0.0 0

Con Con Con Lepr-cre Lepr-cre Lepr-cre Col2.3-cre Col2.3-cre Col2.3-cre H Reticulocytes I BM cellularity J BM HSCs 0.008 10 1.5 ns ns

)

8 8 0.006 0 ) ns 1 % (

1.0 (x

6 s 0.004 C S Cells H

0.5 M 0.002 B ns Reticulocytes (% ) ns ns 2 0.000 0.0 0 Con Con Con Lepr-cre Lepr-cre Col2.3-cre Lepr-cre Col2.3-cre Col2.3-cre K Spleen cellularity L Spleen HSCs M Total HSC number 2.5 0.0008 5

ns ) )

ns 4 8 ns 2.0 0.0006 4 ) %

( ns 1.5 s (x10 3

0.0004 ns C Cs S S 1.0 H 2 H 0.0002 ns 5.0 1 Spleen Cells (x10

0.0 0.0000 0

Con Con Con Lepr-cre Lepr-cre Lepr-cre Col2.3-cre Col2.3-cre Col2.3-cre

FIGURE 3 Platelets BM cellularity Con ns Con Rad A Rad **** B C ns D ns ns ns ns ）

9 ns 1,000 ns ns 2.0 1.5 0.9 (x1 0 /µl)

3 800 0.8 1.5 10

Cells 1.0 x (

600 0.7 s t 1.0 el e

t 400 0.6 Marrow a Rad/baseline l 0.5 P 0.5 Rad/baseline

200 one 0.5 B 0 0.0 0.0 0.4 PBS AAV PBS AAV PBS AAV PBS AAV BM HSCs Spleen cellularity Con F G Con ns E Rad ns Rad ns H *** ns ns ns 0.020 0.8 2.5 1.5 ns ns ns )

8 2.0 0.015 0.6 1.0 1.5 0.010 0.4 1.0 Rad/baseline Rad/baseline HSCs (% ) 0.5 0.005 0.2 0.5 Spleen Cell s (x10 0.000 0.0 0.0 0.0 PBS AAV PBS AAV PBS AAV PBS AAV

Spleen HSCs Total HSC number I Con ns J K Con ns L Rad ns Rad ns ns ns ns ns 0.0015 4 ns 1.5 0.6 *** ) 3 5 0.0010 1.0 0.4 2 Rad/baseline HSCs (x 10 HSCs (% ) 0.0005 0.5 Rad/baseline 0.2 1

0.0000 0 0 0.0 PBS AAV PBS AAV PBS AAV PBS AAV

M recipient number donor non-reconstituted reconstituted total p-value PBS 3 7 10 <0.05 AAV 7 1 8

FIGURE 4 Leukocytes Neutrophils Platelets ns Con ns Con Con A 5-FU B 5-FU C ns ns 5-FU **** ns ns ns ns ns ns * 25 3 ** 5 3 4,000 *** 6 /µl) ** 3 0 1

20 /μl ) 4 3 x /μl ) (

3 3,000

2 2 0 4 15 3 1 x ( baseline Cell s baseline baseline /

/ 2,000 / U U 10 2 U 1

lood 2 1 ele ts 5- F 5- F 5- F

B 1,000 5 1 la t e P Neutrophil (x 1 0 hi t

W 0 0 0 0 0 0 +/+ gfp/gfp +/+ gfp/gfp +/+ gfp/gfp +/+ gfp/gfp +/+ gfp/gfp +/+ gfp/gfp

Reticulocytes BM Cellularity Spleen Cellularity Con ns ns 5-FU Con Con ns D E 5-FU * F ** 5-FU ns ）

8 20 ** 9 0.8 ns 5 2.0 1.5 ) ns 0 **** **** ns ns 8

1 * ) ** x (

% 4 ( 6 15 0.6 1.5 s 1.0 s (x10

Cell s 3 Cel l baseline baseline baseline 4 10 0.4 / 1.0 / / U ulo cyt e U U 2 c i 0.5 5- F pleen Marrow 5- F 2 5 5- F 0.2 0.5 S Re t 1 one 0 0 B 0.0 0.0 0 0.0 +/+ gfp/gfp +/+ gfp/gfp +/+ gfp/gfp +/+ gfp/gfp +/+ gfp/gfp +/+ gfp/gfp

BM HSCs Spleen HSCs Total HSC number G ** H * I Con Con ns Con ** 5-FU ns 5-FU 5-FU ns ns ns ** 400 15 0.4 ** 50 ** 0.10 1.5 *** ** ns 40 0.08 300 ) ** 6 0.3 ) ) 10 % 1.0 % ( ( 30 0.06 s

baseline 200 baseline C s (x10 baseline /

0.2 / Cs / S C U U S 20 0.04 U H S H 0.5 5 H 5- F 5- F

100 5- F 0.1 10 0.02

0.0 0 0.00 0 0.0 0 +/+ gfp/gfp +/+ gfp/gfp +/+ gfp/gfp +/+ gfp/gfp +/+ gfp/gfp +/+ gfp/gfp

BM LSKs Spleen LSKs ns J K Con ns ns Con ns 5-FU 5-FU * ns ns 10 80 0.8 * 150 * ** ) 8 ) 60

% 0.6 % ( ( 100 6 40

baseline 0.4 Cells baseline Cell s / /

4 U U

SK 50 SK L L 5- F 20 5- F 2 0.2

0 0 0.0 0 +/+ gfp/gfp +/+ gfp/gfp +/+ gfp/gfp +/+ gfp/gfp

FIGURE S1 BM LSKs (10 days after 5-FU） Spleen LSKs (10 days after 5-FU） BM TPO levels A B 10 C 1 2.0 ns ns ns ns ns ) n ) o i % ( % s 0.1 1.5 ( 1 ns Cells Cell s expre s 1.0

SK 0.01 iv e

SK 0.1 t L L

Rel a 0.5 0.01 0.001 0.0 Con Con 5-FU Rad Con Lepr-crePrx1-cre Lepr-crePrx1-cre Col2.3-cre Col2.3-cre D Leukocytes E Neutrophils F Platelets G Reticulocytes ns /μl) ) 3 ns ns 15 4 2 ns 600 - 5 0 /μl) 0 1 3 x 0 /μl) ( 3 4

3 0 1 10 x 1 ( 400 (% , x 1

(x 3 Cells

es 2 s

rophil 2 lood 5 ele t 200 ulocy t B

1 la t c e i Neu t P 1 hi t Re t W 0 0 0 0

+/gfp +/gfp +/gfp +/gfp

BM cellularity BM LSKs BM HSCs Spleen Celluarity H I J ns K )

2 ns 8 - 10 6 2.5 ns ) 0 8 ) 1 0 ns )

8 3 - 1 x 0 8 2.0 0

1 6 (x 1

x 4 (x (% , 6 1.5 Cs

4 S (% , H cells s

Cells 4 1.0 C

M 2 S B

2 SK

2 H 0.5 L pleen S 0 0 0 0.0

+/gfp +/gfp +/gfp +/gfp L Spleen LSKs M Spleen HSCs N Total HSC number 6 3 ns

) 8 3

ns ) - ns -4 0 ) 4

6 0 4 1 2 (x (% , x 1 4 Cs S

cells 2

H 1

HSCs (%, x10 2 SK L 0 0 0

+/gfp +/gfp +/gfp

FIGURE S2

Leukocytes Neutrophils Platelets A Con B C Con * ** * Rad ns ns Rad *** ns ns 1.0 * 5 2,000 4 /µl) 20 * ns ns ns

3 ) 3 * ** L 0 /µl) u 1 0.8 3 4 x 1,500 3 ( 15 10 2 0.6 3 1000 / x ( Cell s 1,000 2 baseline 10 baseline 0.4 2 baseline lood

1 ele ts Rad / Rad /

500 Rad / 1 B 5 0.2 la t e 1 Neutrophil (x P hi t

W 0 0.0 0 0 0 0 +/+ gfp/gfp +/+ gfp/gfp +/+ gfp/gfp +/+ gfp/gfp +/+ gfp/gfp +/+ gfp/gfp D Reticulocytes E BM cellularity F BM LSKs Con ** ns ns Con Rad Con ns Rad ns Rad ** ** ) 0.8 0.4 1.5 20 ns 150 9 2.5 ** ns **** ns ) *

% 2.0 * ( 15 (x10 0.6 0.3

s 100 1.0 e t 1.5 y 10 Cell s 0.4 0.2 baseline baseline

ulo c 1.0 c i 50 0.5 LSK Cells (% ) Rad / Rad / 0.2 0.1

5 Marrow

Re t 0.5 Rad/Con fold chang e not available one 0.0 0 0 B 0.0 0.0 0.0 +/+ gfp/gfp +/+ gfp/gfp +/+ gfp/gfp +/+ gfp/gfp +/+ gfp/gfp +/+ gfp/gfp BM HSCs Spleen cellularity Survival curve Con ns G Con H I after 5.5Gy radiation Rad Rad ** ns *** 100 ns ns ns ns al 4 1.5 v ns

0.015 2.0 i ) 8 * v p=0.02 r u

s 3

1.5 t 50 s (x10 1.0 0.010 n +/+ e Cel l c 2 r 1.0 gfp/gfp baseline e P HSCs (% ) 0.005 0.5 Rad / 0 pleen 1 0.5 0 10 20 30 S Rad/Con fold chang e Days elapsed 0 0.0 0.000 0.0 +/+ gfp/gfp +/+ gfp/gfp +/+ gfp/gfp +/+ gfp/gfp Spleen LSKs Spleen HSCs Total HSC number ns J Con K **** L Rad ns Con ns Con ns ns ns Rad Rad ns ns *** 0.04 4 0.0010 ** 4 2.0 1.5 *** ns ns *

0.0008 ) 0.03 3 3 5 1.5 1.0 0.0006 0.02 2 2 1.0 0.0004 HSCs (% )

HSC s (x10 0.5 LSK Cells (% ) 0.01 1 1 0.5 0.0002 Rad/Con fold chang e Rad/Con fold chang e Rad/Con fold chang e 0.00 0 0.0000 0 0 0.0 +/+ gfp/gfp +/+ gfp/gfp +/+ gfp/gfp +/+ gfp/gfp +/+ gfp/gfp +/+ gfp/gfp

FIGURE S4 A BM LSKs B Spleen LSKs 0.15 0.03 ns

0.10 0.02 ns LSK (% ) 0.05 ns 0.01 ns LSK Cells (% )

0.00 0.00

Con Con Lepr-cre Lepr-cre Col2.3-cre Col2.3-cre Leukocytes Neutrophils C Con ns D Con ns Rad Rad ns ns ns

/µl) 10 2.5 4 10 ns 3 ns ns ns ns 10 /μl) 3

(x 2.0 8 3 8 6 1.5 6 Cells 2 Rad/baseline lood 4 1.0 4 Rad/baseline B

e 1

0.5 Neutrophil (x 10 2

hi t 2 W 0 0.0 0 0 PBS AAV PBS AAV PBS AAV PBS AAV Reticulocytes BM LSKs ns Con ns Con E F Rad Rad ns * ns 2.5 ns ns 4 ns 0.25 * 1.5 ns 2.0 0.20 3 1.0 1.5 0.15 2

1.0 LSK Cells (% ) 0.10

Rad/baseline 0.5 1 Rad/baseline

Reticulocytes (% ) 0.5 0.05

0.0 0 0.00 0.0 PBS AAV PBS AAV PBS AAV PBS AAV Spleen LSKs G Con ns Rad ns ns ns 0.020 8 ns

0.015 6

0.010 4 Rad/baseline

LSK Cells (% ) 0.005 2

0.000 0 PBS AAV PBS AAV FIGURE S5