Vaccination Against the Brown Stomach Worm, Teladorsagia

Total Page:16

File Type:pdf, Size:1020Kb

Load more

Rooney et al. Parasites Vectors (2021) 14:189 https://doi.org/10.1186/s13071-021-04688-4 Parasites & Vectors RESEARCH Open Access Vaccination against the brown stomach worm, Teladorsagia circumcincta, followed by parasite challenge, induces inconsistent modifcations in gut microbiota composition of lambs James Rooney1, Alba Cortés1,2†, Riccardo Scotti1†, Daniel R. G. Price3, Yvonne Bartley3, Karen Fairlie‑Clarke3, Tom N. McNeilly4, Alasdair J. Nisbet3 and Cinzia Cantacessi1* Abstract Background: Growing evidence points towards a role of gastrointestinal (GI) helminth parasites of ruminants in modifying the composition of the host gut fora, with likely repercussions on the pathophysiology of worm infec‑ tion and disease, and on animal growth and productivity. However, a thorough understanding of the mechanisms governing helminth‑microbiota interactions and of their impact on host health and welfare relies on reproducibility and replicability of fndings. To this aim, in this study, we analysed quantitative and qualitative fuctuations in the fae‑ cal microbiota composition of lambs vaccinated against, and experimentally infected with, the parasitic GI nematode Teladorsagia circumcincta over the course of two separate trials performed over two consecutive years. Methods: Two trials were conducted under similar experimental conditions in 2017 and 2018, respectively. In each trial, lambs were randomly assigned to one of the following experimental groups: (i) vaccinated/infected, (ii) unvac‑ cinated/infected and (iii) unvaccinated/uninfected. Faecal samples collected from individual animals were subjected to DNA extraction followed by high‑throughput sequencing of the V3‑V4 region of the bacterial 16S rRNA gene and bioinformatics and biostatistical analyses of sequence data. Results: Substantial diferences in the populations of bacteria afected by immunisation against and infection by T. circumcincta were detected when comparing data from the two trials. Nevertheless, the abundance of Prevotella spp. was signifcantly linked to helminth infection in both trials. Conclusions: Despite the largely conficting fndings between the two trials, our data revealed that selected gut microbial populations are consistently afected by T. circumcincta infection and/or vaccination. Nevertheless, our study calls for caution when interpreting data generated from in vivo helminth‑microbiome interaction studies that may be infuenced by several intrinsic and extrinsic host‑, parasite‑ and environment‑related factors. Keywords: Teladorsagia circumcincta, Gastrointestinal helminth, Ruminant, Microbiome, Vaccine, Prevotella spp. *Correspondence: [email protected] †Alba Cortés and Riccardo Scotti contributed equally to this work 1 Department of Veterinary Medicine, University of Cambridge, Cambridge, UK Full list of author information is available at the end of the article © The Author(s) 2021. This article is licensed under a Creative Commons Attribution 4.0 International License, which permits use, sharing, adaptation, distribution and reproduction in any medium or format, as long as you give appropriate credit to the original author(s) and the source, provide a link to the Creative Commons licence, and indicate if changes were made. The images or other third party material in this article are included in the article’s Creative Commons licence, unless indicated otherwise in a credit line to the material. If material is not included in the article’s Creative Commons licence and your intended use is not permitted by statutory regulation or exceeds the permitted use, you will need to obtain permission directly from the copyright holder. To view a copy of this licence, visit http:// creat iveco mmons. org/ licen ses/ by/4. 0/. The Creative Commons Public Domain Dedication waiver (http:// creat iveco mmons. org/ publi cdoma in/ zero/1. 0/) applies to the data made available in this article, unless otherwise stated in a credit line to the data. Rooney et al. Parasites Vectors (2021) 14:189 Page 2 of 13 Background can signifcantly impact the composition of the ruminant It has been estimated that, by 2050, the global human gut microbiota [22–25]. Te efects of worm-mediated population will exceed 9 billion and that such a dra- changes in gut microbiota composition on the host abil- matic growth will exacerbate the already strained abil- ity to mount efective immune responses against the ity to meet the increasing demand of meat and dairy invading parasites are yet to be fully explored. Never- products [1]; thus, to avoid a potential food security theless, in a recent study [25], we investigated the fuc- crisis, global eforts are directed towards improved live- tuations in faecal microbiota composition of lambs stock health management practices via disease preven- vaccinated against, and experimentally infected with, T. tion and control [2, 3]. Amongst infectious agents of circumcincta; immunisation was achieved by inoculation livestock, parasitic helminths are a leading cause of dis- of eight recombinant parasite antigens [25]. In this study, ease in ruminants, with severe repercussions on both qualitative and quantitative changes in faecal microbiota animal health and welfare, and production efciency [3, composition were associated mainly with parasite infec- 4]. Worldwide, such losses are estimated at US $3 bil- tion rather than with vaccination-induced immunity. lion annually because of the decreased feed conversion However, data reproducibility across independent stud- ratio, stock death and replacement and the costs linked ies and cohorts of helminth-infected animals is pivotal in to regular use of anthelmintics [5]. order to harness the potential benefts of gut microbiome Whilst control of worms of livestock heavily relies manipulation for parasite control [22, 26–28]. on administration of antiparasitic drugs, global emer- Recently, Nisbet et al. [16] compiled data from several gence of parasite strains resistant to all available classes independent in vivo trials to select a pair of recombinant of anthelmintics makes the use of parasiticides as a sole immunogens from the original eight-component vac- means of helminth control unsustainable. Tus, over the cine (i.e. a mutated form of a calcium-dependent apyrase last decades, signifcant research eforts have been chan- [mTci-APY-1] and an astacin-like metalloprotease derived nelled into the development of vaccines against parasitic from T. circumcincta [Tci-MEP-1]) whose administration nematodes of ruminants [6–13], with several promising had the most impact of each of the original eight antigens prototypes being developed [14–16]. Amongst these is a on reducing cumulative faecal egg counts (cFEC) post- recombinant vaccine against one of the most economi- challenge infection. Te present project builds on data cally important gastrointestinal (GI) helminths of small from these trials, as well as on fndings from Cortés et al. ruminants in temperate regions, Teladorsagia circumci- [25], to investigate reproducibility of worm-microbiota ncta, which resides in the abomasum or ‘true stomach’ interaction studies using the Teladorsagia-sheep sys- [14, 17]. In particular, in a study by Nisbet et al. [14], tem. In particular, we utilise high-throughput amplicon a vaccine composed of eight recombinant helminth- sequencing of the bacterial 16S rRNA gene coupled with derived proteins administered to sheep prior to chal- bioinformatics and biostatistical analyses of sequence data lenge infection led to a reduction in T. circumcincta to explore the efect of vaccination against, and experi- faecal egg counts (FEC) and abomasal worm numbers mental infection with, T. circumcincta in two independ- by up to 75% compared with non-vaccinated controls. ent in vivo trials carried out over consecutive years under Te results of this and other studies [16, 18] show prom- largely similar experimental conditions. We show that, ise for the future use of vaccines as viable alternatives to whilst the full set of taxonomic changes in faecal micro- anthelmintics for parasite eradication; nevertheless, vac- biota composition of lambs infected with T. circumcincta cination studies published to date report varying ef- is inconsistent between trials, the relative abundance of cacy, thus suggesting that other immunity-independent, selected bacterial groups (e.g. Prevotella) are reproduc- unexplored factors may be contributing to parasite sur- ibly altered upon colonisation by this parasite and might vival within the host [5, 18]. A deeper understanding of therefore represent biomarkers of infection. the fundamental biology of the parasite and of the inter- actions between worm, host and gut environment might Materials and methods assist to enhance vaccine efcacy and/or to develop novel Experimental design, sample collection and molecular efective means of parasite control. biology procedures Amongst these interactions, the cross-talk among the Faecal samples analysed in this study were derived from parasites, host and resident gut fora is receiving increas- animals enrolled in two separate trials, conducted in 2017 ing attention, particularly due to the key roles of the ver- [16] and 2018 (A.J. Nisbet, unpublished data), respec- tebrate gut microbiome in immunity development and tively. Briefy, in each trial, 30 Texel crossbred lambs, defence against pathogens [19–21]. Indeed, over the fve to six months of age and helminth-free (verifed and last few years, a growing number of studies have pro- confrmed by parasitological examination of individual
Recommended publications
  • Macellibacteroides Fermentans Gen. Nov., Sp. Nov., a Member of the Family Porphyromonadaceae Isolated from an Upflow Anaerobic Filter Treating Abattoir Wastewaters

    Macellibacteroides Fermentans Gen. Nov., Sp. Nov., a Member of the Family Porphyromonadaceae Isolated from an Upflow Anaerobic Filter Treating Abattoir Wastewaters

    International Journal of Systematic and Evolutionary Microbiology (2012), 62, 2522–2527 DOI 10.1099/ijs.0.032508-0 Macellibacteroides fermentans gen. nov., sp. nov., a member of the family Porphyromonadaceae isolated from an upflow anaerobic filter treating abattoir wastewaters Linda Jabari,1,2 Hana Gannoun,2 Jean-Luc Cayol,1 Abdeljabbar Hedi,1 Mitsuo Sakamoto,3 Enevold Falsen,4 Moriya Ohkuma,3 Moktar Hamdi,2 Guy Fauque,1 Bernard Ollivier1 and Marie-Laure Fardeau1 Correspondence 1Aix-Marseille Universite´ du Sud Toulon-Var, CNRS/INSU, IRD, MIO, UM 110, Case 925, Marie-Laure Fardeau 163 Avenue de Luminy, 13288 Marseille Cedex 9, France [email protected] 2Laboratoire d’Ecologie et de Technologie Microbienne, Institut National des Sciences Applique´es et de Technologie, Centre Urbain Nord, BP 676, 1080 Tunis Cedex, Tunisia 3Microbe Division/Japan Collection of Microorganisms, RIKEN BioResource Center 2-1 Hirosawa, Wako, Saitama 351-0198, Japan 4CCUG, Culture Collection, Department of Clinical Bacteriology, University of Go¨teborg, 41346 Go¨teborg, Sweden A novel obligately anaerobic, non-spore-forming, rod-shaped mesophilic bacterium, which stained Gram-positive but showed the typical cell wall structure of Gram-negative bacteria, was isolated from an upflow anaerobic filter treating abattoir wastewaters in Tunisia. The strain, designated LIND7HT, grew at 20–45 6C (optimum 35–40 6C) and at pH 5.0–8.5 (optimum pH 6.5–7.5). It did not require NaCl for growth, but was able to grow in the presence of up to 2 % NaCl. Sulfate, thiosulfate, elemental sulfur, sulfite, nitrate and nitrite were not used as terminal electron acceptors.
  • Comparative Genomics of the Genus Porphyromonas Identifies Adaptations for Heme Synthesis Within the Prevalent Canine Oral Species Porphyromonas Cangingivalis

    Comparative Genomics of the Genus Porphyromonas Identifies Adaptations for Heme Synthesis Within the Prevalent Canine Oral Species Porphyromonas Cangingivalis

    GBE Comparative Genomics of the Genus Porphyromonas Identifies Adaptations for Heme Synthesis within the Prevalent Canine Oral Species Porphyromonas cangingivalis Ciaran O’Flynn1,*, Oliver Deusch1, Aaron E. Darling2, Jonathan A. Eisen3,4,5, Corrin Wallis1,IanJ.Davis1,and Stephen J. Harris1 1 The WALTHAM Centre for Pet Nutrition, Waltham-on-the-Wolds, United Kingdom Downloaded from 2The ithree Institute, University of Technology Sydney, Ultimo, New South Wales, Australia 3Department of Evolution and Ecology, University of California, Davis 4Department of Medical Microbiology and Immunology, University of California, Davis 5UC Davis Genome Center, University of California, Davis http://gbe.oxfordjournals.org/ *Corresponding author: E-mail: ciaran.ofl[email protected]. Accepted: November 6, 2015 Abstract Porphyromonads play an important role in human periodontal disease and recently have been shown to be highly prevalent in canine mouths. Porphyromonas cangingivalis is the most prevalent canine oral bacterial species in both plaque from healthy gingiva and at University of Technology, Sydney on January 17, 2016 plaque from dogs with early periodontitis. The ability of P. cangingivalis to flourish in the different environmental conditions char- acterized by these two states suggests a degree of metabolic flexibility. To characterize the genes responsible for this, the genomes of 32 isolates (including 18 newly sequenced and assembled) from 18 Porphyromonad species from dogs, humans, and other mammals were compared. Phylogenetic trees inferred using core genes largely matched previous findings; however, comparative genomic analysis identified several genes and pathways relating to heme synthesis that were present in P. cangingivalis but not in other Porphyromonads. Porphyromonas cangingivalis has a complete protoporphyrin IX synthesis pathway potentially allowing it to syn- thesize its own heme unlike pathogenic Porphyromonads such as Porphyromonas gingivalis that acquire heme predominantly from blood.
  • WO 2018/064165 A2 (.Pdf)

    WO 2018/064165 A2 (.Pdf)

    (12) INTERNATIONAL APPLICATION PUBLISHED UNDER THE PATENT COOPERATION TREATY (PCT) (19) World Intellectual Property Organization International Bureau (10) International Publication Number (43) International Publication Date WO 2018/064165 A2 05 April 2018 (05.04.2018) W !P O PCT (51) International Patent Classification: Published: A61K 35/74 (20 15.0 1) C12N 1/21 (2006 .01) — without international search report and to be republished (21) International Application Number: upon receipt of that report (Rule 48.2(g)) PCT/US2017/053717 — with sequence listing part of description (Rule 5.2(a)) (22) International Filing Date: 27 September 2017 (27.09.2017) (25) Filing Language: English (26) Publication Langi English (30) Priority Data: 62/400,372 27 September 2016 (27.09.2016) US 62/508,885 19 May 2017 (19.05.2017) US 62/557,566 12 September 2017 (12.09.2017) US (71) Applicant: BOARD OF REGENTS, THE UNIVERSI¬ TY OF TEXAS SYSTEM [US/US]; 210 West 7th St., Austin, TX 78701 (US). (72) Inventors: WARGO, Jennifer; 1814 Bissonnet St., Hous ton, TX 77005 (US). GOPALAKRISHNAN, Vanch- eswaran; 7900 Cambridge, Apt. 10-lb, Houston, TX 77054 (US). (74) Agent: BYRD, Marshall, P.; Parker Highlander PLLC, 1120 S. Capital Of Texas Highway, Bldg. One, Suite 200, Austin, TX 78746 (US). (81) Designated States (unless otherwise indicated, for every kind of national protection available): AE, AG, AL, AM, AO, AT, AU, AZ, BA, BB, BG, BH, BN, BR, BW, BY, BZ, CA, CH, CL, CN, CO, CR, CU, CZ, DE, DJ, DK, DM, DO, DZ, EC, EE, EG, ES, FI, GB, GD, GE, GH, GM, GT, HN, HR, HU, ID, IL, IN, IR, IS, JO, JP, KE, KG, KH, KN, KP, KR, KW, KZ, LA, LC, LK, LR, LS, LU, LY, MA, MD, ME, MG, MK, MN, MW, MX, MY, MZ, NA, NG, NI, NO, NZ, OM, PA, PE, PG, PH, PL, PT, QA, RO, RS, RU, RW, SA, SC, SD, SE, SG, SK, SL, SM, ST, SV, SY, TH, TJ, TM, TN, TR, TT, TZ, UA, UG, US, UZ, VC, VN, ZA, ZM, ZW.
  • The Possible Role of the Microbiota-Gut-Brain-Axis in Autism Spectrum Disorder

    The Possible Role of the Microbiota-Gut-Brain-Axis in Autism Spectrum Disorder

    International Journal of Molecular Sciences Review The Possible Role of the Microbiota-Gut-Brain-Axis in Autism Spectrum Disorder Piranavie Srikantha and M. Hasan Mohajeri * Department of medicine, University of Zurich, Winterthurerstrasse 190, 8057 Zürich, Switzerland; [email protected] * Correspondence: [email protected]; Tel.: +41-79-938-1203 Received: 27 March 2019; Accepted: 28 April 2019; Published: 29 April 2019 Abstract: New research points to a possible link between autism spectrum disorder (ASD) and the gut microbiota as many autistic children have co-occurring gastrointestinal problems. This review focuses on specific alterations of gut microbiota mostly observed in autistic patients. Particularly, the mechanisms through which such alterations may trigger the production of the bacterial metabolites, or leaky gut in autistic people are described. Various altered metabolite levels were observed in the blood and urine of autistic children, many of which were of bacterial origin such as short chain fatty acids (SCFAs), indoles and lipopolysaccharides (LPS). A less integrative gut-blood-barrier is abundant in autistic individuals. This explains the leakage of bacterial metabolites into the patients, triggering new body responses or an altered metabolism. Some other co-occurring symptoms such as mitochondrial dysfunction, oxidative stress in cells, altered tight junctions in the blood-brain barrier and structural changes in the cortex, hippocampus, amygdala and cerebellum were also detected. Moreover, this paper suggests that ASD is associated with an unbalanced gut microbiota (dysbiosis). Although the cause-effect relationship between ASD and gut microbiota is not yet well established, the consumption of specific probiotics may represent a side-effect free tool to re-establish gut homeostasis and promote gut health.
  • Description of Gabonibacter Massiliensis Gen. Nov., Sp. Nov., a New Member of the Family Porphyromonadaceae Isolated from the Human Gut Microbiota

    Description of Gabonibacter Massiliensis Gen. Nov., Sp. Nov., a New Member of the Family Porphyromonadaceae Isolated from the Human Gut Microbiota

    Curr Microbiol DOI 10.1007/s00284-016-1137-2 Description of Gabonibacter massiliensis gen. nov., sp. nov., a New Member of the Family Porphyromonadaceae Isolated from the Human Gut Microbiota 1,2 1 3,4 Gae¨l Mourembou • Jaishriram Rathored • Jean Bernard Lekana-Douki • 5 1 1 Ange´lique Ndjoyi-Mbiguino • Saber Khelaifia • Catherine Robert • 1 1,6 1 Nicholas Armstrong • Didier Raoult • Pierre-Edouard Fournier Received: 9 June 2016 / Accepted: 8 September 2016 Ó Springer Science+Business Media New York 2016 Abstract The identification of human-associated bacteria Gabonibacter gen. nov. and the new species G. mas- is very important to control infectious diseases. In recent siliensis gen. nov., sp. nov. years, we diversified culture conditions in a strategy named culturomics, and isolated more than 100 new bacterial Keywords Gabonibacter massiliensis Á Taxonogenomics Á species and/or genera. Using this strategy, strain GM7, a Culturomics Á Gabon Á Gut microbiota strictly anaerobic gram-negative bacterium was recently isolated from a stool specimen of a healthy Gabonese Abbreviations patient. It is a motile coccobacillus without catalase and CSUR Collection de Souches de l’Unite´ des oxidase activities. The genome of Gabonibacter mas- Rickettsies siliensis is 3,397,022 bp long with 2880 ORFs and a G?C DSM Deutsche Sammlung von content of 42.09 %. Of the predicted genes, 2,819 are Mikroorganismen protein-coding genes, and 61 are RNAs. Strain GM7 differs MALDI-TOF Matrix-assisted laser desorption/ from the closest genera within the family Porphyromon- MS ionization time-of-flight mass adaceae both genotypically and in shape and motility.
  • Endosymbiont Diversity and Evolution Across Weevil Tree of Life

    Endosymbiont Diversity and Evolution Across Weevil Tree of Life

    bioRxiv preprint doi: https://doi.org/10.1101/171181; this version posted August 1, 2017. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made available under aCC-BY-NC 4.0 International license. Endosymbiont diversity and evolution across weevil tree of life Guanyang Zhang1#, Patrick Browne1,2#, Geng Zhen1#, Andrew Johnston4, Hinsby Cadillo-Quiroz5, and Nico Franz1 1 School of Life Sciences, Arizona State University, Tempe, Arizona, USA 2 Department of Environmental Science, Aarhus University, 4000 Roskilde, Denmark # These authors contributed equally to this work ABSTRACT As early as the time of Paul Buchner, a pioneer of endosymbionts research, it was shown that weevils host diverse bacterial endosymbionts, probably only second to the hemipteran insects. To date, there is no taxonomically broad survey of endosymbionts in weevils, which preclude any systematic understanding of the diversity and evolution of endosymbionts in this large group of insects, which comprise nearly 7% of described diversity of all insects. We gathered the largest known taxonomic sample of weevils representing four families and 17 subfamilies to perform a study of weevil endosymbionts. We found that the diversity of endosymbionts is exceedingly high, with as many as 44 distinct kinds of endosymbionts detected. We recovered an ancient origin of association of Nardonella with weevils, dating back to 124 MYA. We found repeated losses of this endosymbionts, but also cophylogeny with weevils. We also investigated patterns of coexistence and coexclusion. INTRODUCTION Weevils (Insecta: Coleoptera: Curculionoidea) host diverse bacterial endosymbionts.
  • Research Article Review Jmb

    Research Article Review Jmb

    J. Microbiol. Biotechnol. (2017), 27(0), 1–7 https://doi.org/10.4014/jmb.1707.07027 Research Article Review jmb Methods 20,546 sequences and all the archaeal datasets were normalized to 21,154 sequences by the “sub.sample” Bioinformatics Analysis command. The filtered sequences were classified against The raw read1 and read2 datasets was demultiplexed by the SILVA 16S reference database (Release 119) using a trimming the barcode sequences with no more than 1 naïve Bayesian classifier built in Mothur with an 80% mismatch. Then the sequences with the same ID were confidence score [5]. Sequences passing through all the picked from the remaining read1 and read2 datasets by a filtration were also clustered into OTUs at 6% dissimilarity self-written python script. Bases with average quality score level. Then a “classify.otu” function was utilized to assign lower than 25 over a 25 bases sliding window were the phylogenetic information to each OTU. excluded and sequences which contained any ambiguous base or had a final length shorter than 200 bases were Reference abandoned using Sickle [1]. The paired reads were assembled into contigs and any contigs with an ambiguous 1. Joshi NA, FJ. 2011. Sickle: A sliding-window, adaptive, base, more than 8 homopolymeric bases and fewer than 10 quality-based trimming tool for FastQ files (Version 1.33) bp overlaps were culled. After that, the contigs were [Software]. further trimmed to get rid of the contigs that have more 2. Schloss PD. 2010. The Effects of Alignment Quality, than 1 forward primer mismatch and 2 reverse primer Distance Calculation Method, Sequence Filtering, and Region on the Analysis of 16S rRNA Gene-Based Studies.
  • The Microbiome of the Footrot Lesion in Merino Sheep Is Characterized by a Persistent Bacterial Dysbiosis T ⁎ Andrew S

    The Microbiome of the Footrot Lesion in Merino Sheep Is Characterized by a Persistent Bacterial Dysbiosis T ⁎ Andrew S

    Veterinary Microbiology 236 (2019) 108378 Contents lists available at ScienceDirect Veterinary Microbiology journal homepage: www.elsevier.com/locate/vetmic The microbiome of the footrot lesion in Merino sheep is characterized by a persistent bacterial dysbiosis T ⁎ Andrew S. McPherson, Om P. Dhungyel, Richard J. Whittington Farm Animal Health, Sydney School of Veterinary Science, Faculty of Science, The University of Sydney, 425 Werombi Rd, Camden, New South Wales, 2570, Australia ARTICLE INFO ABSTRACT Keywords: Footrot is prevalent in most sheep-producing countries; the disease compromises sheep health and welfare and Footrot has a considerable economic impact. The disease is the result of interactions between the essential causative Merino agent, Dichelobacter nodosus, and the bacterial community of the foot, with the pasture environment and host Sheep resistance influencing disease expression. The Merino, which is the main wool sheep breed in Australia, is Microbiome particularly susceptible to footrot. We characterised the bacterial communities on the feet of healthy and footrot- Dichelobacter nodosus affected Merino sheep across a 10-month period via sequencing and analysis of the V3-V4 regions of the bacterial 16S ribosomal RNA gene. Distinct bacterial communities were associated with the feet of healthy and footrot- affected sheep. Infection with D. nodosus appeared to trigger a shift in the composition of the bacterial com- munity from predominantly Gram-positive, aerobic taxa to predominantly Gram-negative, anaerobic taxa. A total of 15 bacterial genera were preferentially abundant on the feet of footrot-affected sheep, several of which have previously been implicated in footrot and other mixed bacterial diseases of the epidermis of ruminants.
  • Type of the Paper (Article

    Type of the Paper (Article

    Supplementary Materials S1 Clinical details recorded, Sampling, DNA Extraction of Microbial DNA, 16S rRNA gene sequencing, Bioinformatic pipeline, Quantitative Polymerase Chain Reaction Clinical details recorded In addition to the microbial specimen, the following clinical features were also recorded for each patient: age, gender, infection type (primary or secondary, meaning initial or revision treatment), pain, tenderness to percussion, sinus tract and size of the periapical radiolucency, to determine the correlation between these features and microbial findings (Table 1). Prevalence of all clinical signs and symptoms (except periapical lesion size) were recorded on a binary scale [0 = absent, 1 = present], while the size of the radiolucency was measured in millimetres by two endodontic specialists on two- dimensional periapical radiographs (Planmeca Romexis, Coventry, UK). Sampling After anaesthesia, the tooth to be treated was isolated with a rubber dam (UnoDent, Essex, UK), and field decontamination was carried out before and after access opening, according to an established protocol, and shown to eliminate contaminating DNA (Data not shown). An access cavity was cut with a sterile bur under sterile saline irrigation (0.9% NaCl, Mölnlycke Health Care, Göteborg, Sweden), with contamination control samples taken. Root canal patency was assessed with a sterile K-file (Dentsply-Sirona, Ballaigues, Switzerland). For non-culture-based analysis, clinical samples were collected by inserting two paper points size 15 (Dentsply Sirona, USA) into the root canal. Each paper point was retained in the canal for 1 min with careful agitation, then was transferred to −80ºC storage immediately before further analysis. Cases of secondary endodontic treatment were sampled using the same protocol, with the exception that specimens were collected after removal of the coronal gutta-percha with Gates Glidden drills (Dentsply-Sirona, Switzerland).
  • The Human Gut Virome Is Highly Diverse, Stable and Individual-Specific

    The Human Gut Virome Is Highly Diverse, Stable and Individual-Specific

    bioRxiv preprint doi: https://doi.org/10.1101/657528; this version posted June 3, 2019. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made available under aCC-BY-NC-ND 4.0 International license. 1 The human gut virome is highly diverse, stable and individual-specific. 2 3 Andrey N. Shkoporov*†, Adam G. Clooney, Thomas D.S. Sutton, Feargal J. Ryan, 4 Karen M. Daly, James A. Nolan, Siobhan A. McDonnell, Ekaterina V. Khokhlova, Lorraine 5 A. Draper, Amanda Forde, Emma Guerin, Vimalkumar Velayudhan, R. Paul Ross., Colin 6 Hill.* 7 8 APC Microbiome Ireland & School of Microbiology, University College Cork, Cork 9 T12 YT20, Ireland 10 11 * Correspondence: [email protected], [email protected] 12 † Lead contact. 13 14 Summary 15 The human gut contains a vast array of viruses, mostly bacteriophages. The majority 16 remain uncharacterised and their roles in shaping the gut microbiome and in impacting on 17 human health remain poorly understood. Here we performed a longitudinal focused 18 metagenomic study of faecal bacteriophage populations in healthy adults. Our results reveal 19 high temporal stability and individual specificity of bacteriophage consortia which correlates 20 with the bacterial microbiome. We report the existence of a stable, numerically predominant 21 individual-specific persistent personal virome. Clustering of bacteriophage genomes and de 22 novo taxonomic annotation identified several groups of crAss-like and Microviridae 23 bacteriophages as the most stable colonizers of the human gut.
  • The Role of the Intestinal Microbiota in Inflammatory Bowel Disease Seth Bloom Washington University in St

    The Role of the Intestinal Microbiota in Inflammatory Bowel Disease Seth Bloom Washington University in St

    Washington University in St. Louis Washington University Open Scholarship All Theses and Dissertations (ETDs) 1-1-2012 The Role of the Intestinal Microbiota in Inflammatory Bowel Disease Seth Bloom Washington University in St. Louis Follow this and additional works at: https://openscholarship.wustl.edu/etd Recommended Citation Bloom, Seth, "The Role of the Intestinal Microbiota in Inflammatory Bowel Disease" (2012). All Theses and Dissertations (ETDs). 555. https://openscholarship.wustl.edu/etd/555 This Dissertation is brought to you for free and open access by Washington University Open Scholarship. It has been accepted for inclusion in All Theses and Dissertations (ETDs) by an authorized administrator of Washington University Open Scholarship. For more information, please contact [email protected]. WASHINGTON UNIVERSITY IN ST. LOUIS Division of Biology and Biomedical Sciences Molecular Microbiology and Microbial Pathogenesis Dissertation Examination Committee: Thaddeus S. Stappenbeck, Chair Paul M. Allen Wm. Michael Dunne David B. Haslam David A. Hunstad Phillip I. Tarr Herbert W. “Skip” Virgin, IV The Role of the Intestinal Microbiota in Inflammatory Bowel Disease by Seth Michael Bloom A dissertation presented to the Graduate School of Arts and Sciences of Washington University in partial fulfillment of the requirements for the degree of Doctor of Philosophy May 2012 Saint Louis, Missouri Copyright By Seth Michael Bloom 2012 ABSTRACT OF THE DISSERTATION The Role of the Intestinal Microbiota in Inflammatory Bowel Disease by Seth Michael Bloom Doctor of Philosophy in Biology and Biomedical Sciences Molecular Microbiology and Microbial Pathogenesis Washington University in St. Louis, 2012 Professor Thaddeus S. Stappenbeck, Chairperson Inflammatory bowel disease (IBD) arises from complex interactions of genetic, environmental, and microbial factors.
  • Tenebrio Molitor Larvae Meal Affects the Cecal Microbiota of Growing Pigs

    Tenebrio Molitor Larvae Meal Affects the Cecal Microbiota of Growing Pigs

    Tenebrio Molitor Larvae Meal Affects the Cecal Microbiota of Growing Pigs Sandra Meyer, Denise K. Gessner, Garima Maheshwari, Julia Röhrig, Theresa Friedhoff, Erika Most, Holger Zorn, Robert Ringseis and Klaus Eder Table S1. Characteristics of gene-specific primers used for qPCR analysis in small intestinal mucosa. Annealing PCR Forward (5` to 3`) NCBI GeneBank Gene Temperature Product Slope R2 E Reverse (5` to 3`) Accession No. (°C) Size (bp) Reference genes CAGTCACCTTGAGCCGGGCGA ATP5MC1 64 94 NM_001025218 -3.55 0.999 1.91 TAGCGCCCCGGTGGTTTGC AGGGGCTCTCCAGAACATCATCC GAPDH 60 446 NM_001206359 -3.33 1.000 2.00 TCGCGTGCTCTTGCTGGGGTTGG GTCGCAAGACTTATGTGACC RPS9 62 325 XM_021094878 -3.28 0.999 2.02 AGCTTAAAGACCTGGGTCTG CTACGCCCCCGTCGCAAAGG SDHA 64 380 XM_021076930 -3.32 1.000 2.00 AGTTTGCCCCCAGGCGGTTG Target genes GATCGGCTCCATCGTCAGCA CLDN1 60 115 NM_001244539 -3.54 0.994 1.92 CGACACGCAGGACATCCACA ACTTCCAAACTGGCTGTTGC CXCL8 59 120 NM_213867 -3.59 0.994 1.90 GGAATGCGTATTTATGCACTGG GTTCTCTGAGAAATGGGAGC IL1B 58 143 NM_214055 -3.51 0.997 1.93 CTGGTCATCATCACAGAAGG AAGGTGATGCCACCTCAGAC IL6 60 151 NM_001252429 -3.54 0.994 1.92 TCTGCCAGTACCTCCTTGCT MUC1 CGGGCTTCTGGGACTCTTTT 58 312 XM_021089728 -3.63 0.999 1.89 1 TTCTTTCGTCGGCACTGACA TGTGTTTTGCTTTGGGTCCAG MUC13 58 171 NM_001105293 -3.58 1.000 1.90 CACAGCCAACTCCACTGTAGC CTTCCAACCATCCTCCCACC MUC2 58 174 XM_021082584 -3.53 0.996 1.92 GCCGTCTTGAAATCATCGCC GCCTACTCGTCCAACGGGAA OCLN 60 246 NM_001163647 -3.60 0.999 1.90 GCCCGTCGTGTAGTCTGTCT CAGACTTCGACCACAACGGA SLC15A1 58 99 NM_214347 -3.52 0.998 1.93 TTATCCCGCCAGTACCCAGA CGCAACCATTGGAGTTGGCGC SLC2A2 63 122 NM_001097417 -3.37 0.997 1.98 TGGCACAAACAAACATCCCACTCA CTGACACTGGTGCTTGCTTT SLC2A5 57 156 XM_021095282 -3.45 0.989 1.95 TTCGCTCATGTATTCCCCGA GTGGCGGACAGTAGTGAACA SLC5A1 57 89 NM_001164021 -3.31 1.000 1.92 AGAAGGCAGGATTTCAGGCA GTCGTCCTGATCCTGACCCG TJP1 60 207 XM_021098827 -3.26 0.996 2.03 TGGTGGGTTTGGTGGGTTGA CCAAGGACTCAGATCATCGT TNF 58 146 NM_214022 -3.36 1.000 1.99 GCTGGTTGTCTTTCAGCTTC Table S2.