General Introduction

Promoters: Prof. Dr. Godelieve Gheysen Department of Molecular Biotechnology Ghent University, Belgium Prof. Dr. ir. Tina Kyndt Department of Molecular Biotechnology Ghent University, Belgium Prof. Dr. Abdul Mannan Akanda Department of Plant Pathology Bangabandhu Sheikh Mujibur Rahman Agricultural University, Bangladesh

Dean: Prof. dr. ir. Marc Van Meirvenne

Rector: Prof. Dr. Anne De Paepe

Characterisation of the interaction between rice and the parasitic nematode Ditylenchus angustus

Shakhina Khanam

Thesis submitted in fulfillment of the requirements for the degree of Doctor (PhD) of Applied Biological Sciences

Karakterisatie van de interactie tussen rijst en de parasitaire nematode Ditylenchus angustus

Cover illustration: The picture of the front cover represents the susceptibility symptoms in rice caused by the nematode Ditylenchus angustus which is characterized by white patches at the leaf base.

Khanam, S. (2016). Characterisation of the interaction between rice and the parasitic nematode Ditylenchus angustus. Phd thesis, Ghent University, Ghent, Belgium

ISBN-number: 978-90-5989-927-8

The author and the promotors give the authorization to consult and to copy parts of this work for personal use only. Any other use is limited by the laws of Copyright. Permission to reproduce any material contained in this work should be obtained from the author.

Promoters Author

Prof. dr. Godelieve Gheysen Shakhina Khanam Prof. dr. ir. Tina Kyndt Prof. dr. Abdul Mannan Akanda

Members of the examination committee

Prof. dr. ir. Patrick Van Damme (chairman) Department of Plant Production Tropical and Subtropical Agricultural and Ethnobotany Unit Faculty of Bioscience Engineering, Ghent University

Prof. dr. ir. Monica Höfte (secretary) Department of Crop protection Faculty of BioScience Engineering, Ghent University

Prof. dr. Godelieve Gheysen (promoter) Department of Molecular Biotechnology Ghent University, Belgium

Prof. dr. ir. Tina Kyndt (promoter) Department of Molecular Biotechnology Ghent University, Belgium

Prof. dr. Abdul Mannan Akanda (promoter) Department of Plant Pathology Bangabandhu Sheikh Mujibur Rahman Agricultural University, Bangladesh

Prof. dr. Sofie Goormachtig Department of Plant Systems Biology, Flanders Interuniversity Institute for Biotechnology (VIB) Faculty of Science, Ghent University

Prof. dr. Dirk De Waele Department of Biosystems, Faculty of Bioscience Engineering, K. U. Leuven

Prof. dr. ir. Wim Wesemael Crop Protection Institute for Agricultural and Fisheries Research (ILVO) Merelbeke

Acknowledgements

First and foremost I would like to express my special appreciation and thanks to my promoter, Professor dr. Godelieve Gheysen, for giving me the oppurtunity to start my PhD research in her lab. She has been very kind and supportive since the days I began working the project, never losing her belief in me to finish this project successfully. I will remain ever thankful to her. My another promoter, Professor dr. ir. Tina Kyndt deserves a very special thanks. Her scientific knowledge, inspiring ideas, and enthusiasm about my research project was a real support to me over the last few years. I thank my local promoter, Professor dr. Abdul Mannan Akanda for his help and support, I received during the research period in Bangladesh.

I thank the members of the examination committee, Prof. dr. ir. Patrick Van Damme, Prof. dr. ir. Monica Höfte, Prof. dr. Sofie Goormachtig, Prof. dr. Dirk De Waele and Prof. dr. ir. Wim Wesemael.

I thank my lovely (ex-) colleagues of NEMA research group of the Department of Molecular Biotechnology for supporting and inspiring me in various ways. Thanks for the nice moments we spent together. Special thanks to Sofie and Fien for your kind help and cooperation.

The financial and administrative support rendered by VLIR-UOS, Belgium is highly acknowledged.

Lastly, I would like to thank my family for all their love and encouragement. For my parents who raised me with a love of science and supported me in all my pursuits. And most of all for my loving, supportive, encouraging, and patient husband whose faithful support during the final stages of this PhD is so appreciated. I express my heavenly love to my son Rahmi. My Bangladeshi friends live in and out of Belgium also deserve my sincerest thanks.

Shakhina Khanam

Contents

List of abbreviations ...... 1 Chapter 1. General Introduction ...... 3 1.1 Rice (Oryza sativa L.): the host ...... 4 1.1.1 Origin and geographical distribution ...... 4 1.1.2 Morphology and plant growth stages ...... 5 1.1.3 Types of rice ...... 6 1.1.4 Rice agro-ecosystem ...... 6 1.1.5 Rice production in Bangladesh ...... 7 1.2 Nematodes: the pathogens ...... 9 1.2.1 Nematodes of rice ...... 9 1.2.2 Nematode under study: Ditylenchus angustus ...... 14 1.2.3 Management and control of plant parasitic nematodes ...... 19 1.3 The Plant immunity system ...... 22 1.4 Induced resistance ...... 24 1.4.1 Systemic acquired resistance ...... 25 1.4.2 Induced systemic defense ...... 26 1.4.3. Priming defence ...... 28 1.4.4 Induced resistance signaling molecules against plant parasitic nematodes ...... 29 1.5 Mechanisms of resistance against plant parasitic nematodes ...... 31 1.6 Plant hormone signaling in defence ...... 32 1.6.1 Salicylate signaling pathway ...... 32 1.6.2 Jasmonate signaling pathway ...... 34 1.6.3 Ethylene signaling pathway ...... 35 1.6.4 Cross talk between hormones ...... 36 1.6.5 Role of hormones in rice-nematode interactions ...... 39 1.7 Pathogenesis-related (PR) proteins...... 41 1.8 Secondary metabolites ...... 42 1.9 Biocontrol activity of Bacillus species ...... 43 2.0 Scope and outline of the thesis ...... 46

Chapter 2. Identification of Bangladeshi rice varieties resistant to ufra disease caused by the nematode Ditylenchus angustus ...... 48 2.1 Abstract ...... 49 2.2. Introduction ...... 49 2.3. Results ...... 51 2.3.1. Relationship between the early scoring system and the number of nematodes inside the plant 51 2.3.2. Response of rice genotypes to D. angustus in pot experiments: early scoring ...... 53 2.3.3. Response of rice genotypes to D. angustus in pot experiments: late scoring ...... 54 2.3.4. Confirmation of the resistant genotypes under field conditions in rainfed conditions ...... 58 2.4. Discussion ...... 59 2.5. Conclusion ...... 61 2.6 Materials and methods ...... 62 2.6.1. Rice germplasm collection ...... 62 2.6.2. Pot experiment ...... 62 2.6.3. Field experiment ...... 63 2.6.4. Nematode culture...... 63 2.6.5. Inoculum preparation and inoculation ...... 63 2.6.6. Relationship between the early scoring system and the actual number of nematodes inside the plant ...... 64 2.6.7. Susceptibility/Resistance scoring methods ...... 64 2.6.8. Data analysis ...... 65 Chapter 3. The rice cultivar Manikpukha is resistant to the stem nematode Ditylenchus angustus due to post- infection mechanisms ...... 66 3.2 Introduction ...... 67 3.3 Results ...... 69 3.3.1 Ditylenchus angustus invaded equally in resistant and susceptible rice genotypes ...... 69 3.3.2 The Development of D. angustus is delayed in the resistant genotype compared to the susceptible genotypes ...... 70 3.3.3 D. angustus completely failed to reproduce within the resistant genotype ...... 72 3.4 Discussion ...... 73 3.5 Conclusion ...... 76 3.6. Materials and methods ...... 76 3.6.1 Rice genotypes ...... 76

3.6.2 Nematode culture...... 76 3.6.3 Analysis of invasion, development, and reproduction ...... 76 3.6.4 Data analysis ...... 77 Chapter 4. The resistant Manikpukha shows a rapid defense response to Ditylenchus angustus infection, with higher PAL expression and lignin accumulation ...... 78 4.1 Abstract ...... 79 4.2 Introduction ...... 79 4.3 Results ...... 81 4.3.1 Mutants or transgenic rice plants deficient in SA/JA/ET are more susceptible to Ditylenchus angustus infection ...... 81 4.3.2 Hormones and hormone inhibitors treatment confirm a positive role of the SA/JA/ET pathways in the control of D. angustus infection ...... 82 4.3.3 Innate defence response in rice shoot tissues upon D. angustus infection ...... 84 4.3.4. SA and JA accumulation upon nematode infection in the ufra susceptible Nipponbare and the resistant Manikpukha ...... 87 4.3.5. Lignin accumulation upon nematode infection in the ufra susceptible Nipponbare and the resistant Manikpukha ...... 88 4.4 Discussion ...... 89 4.5 Conclusion ...... 93 4.6 Materials and methods ...... 93 4.6.1 Plant materials and growth condition ...... 93 4.6.2 Infection experiments ...... 94 4.6.3 Chemical treatments ...... 94 4.6.4 Data collection and statistical analysis ...... 95 4.6.5 RNA extraction, and cDNA synthesis ...... 95 4.6.6 qRT-PCR ...... 96 4.6.7 SA and JA quantification ...... 96 4.6.8 Lignin measurement ...... 97 Chapter 5: Effect of Bacillus velezensis strain BSK isolated from Bangladesh on rice growth and defence against Ditylenchus angustus ...... 98 5.1 Abstract ...... 99 5.2 Introduction ...... 99 5.3 Results ...... 102

5.3.1 Effect of Bacillus velezensis strain BSK on rice growth ...... 102 5.3.2 Determination of Ditylenchus angustus infection in Bacillus velezensis strain BSK treated rice plants ...... 103 5.3.2 Gene expression in systemic rice shoots upon Bacillus velezensis strain BSK inoculation ..... 104 5.4 Discussion ...... 105 5.5 Conclusion ...... 108 5.6 Materials and methods ...... 109 5.6.1 Plant materials and bacterial culture conditions ...... 109 5.6.2 Nematode culture...... 109 5.6.3 Growth analysis of rice treated with Bacillus velezensis strain BSK ...... 109 5.6.4 Infection experiments with Ditylenchus angustus ...... 110 5.6.5 Data collection and statistical analysis ...... 110 5.6.6 RNA extraction, and cDNA synthesis ...... 111 5.6.7 qRT-PCR ...... 111 Chapter 6. General conclusion and perspectives ...... 113 6.1 ‘Manikpukha’, a promising ufra resistant variety ...... 114 6.2 SA, JA and ET play a positive role in rice basal defence against the rice stem nematode D. angustus ...... 117 6.3 Bacillus velezensis strain BSK, a potential bio-control agent against D. angustus ...... 118 Summary ...... 121 Nederlandse samenvatting ...... 124 References ...... 126 Curriculum Vitae ...... 178 Appendix ...... 179

List of abbreviations

ABA abscisic acid ACC amino cyclopropane carboxylate ACO aminocyclopropane-1-carboxylate oxidase gene ANOVA analysis of variance AOA aminooxyacetic acid AOS allene oxide synthase Avr avirulence BR brassinosteroids BTH benzo(1,2,3)thiadiazole-7-carbothloic acid 5 –methyl ester cDNA copy DNA dai days after-inoculation DIECA ammonium diethyldithiocarbamic acid DNA deoxyribonucleic acid dNTPs deoxynucleoside triphosphates dpi days post inoculation dsRNA double stranded RNA DTT dithiotreitol Eth ethephon ERF ethylene response factor ET ethylene ETI effector-triggered immunity ETS effector-triggered susceptibility FLS2 FLAGELLIN-SENSING 2 F-primer forward primer HR hypersensitive response

H2O2 hydrogen peroxide ICS isochorismate synthase ISR induced systemic resistance JA jasmonic acid

LOX lipoxygenase MAMP Microbe Associated Molecular Pattern M(A)PK mitogen-activated protein kinase MeJA methyl jasmonate mRNA messenger RNA NahG salicylate hydroxylase NB-LRR Nucleotide binding-leurine rich repeat NH1 NPR1 homolog 1 NPR1 non-expresser of PR proteins 1 OPR Phytodienoic acid reductase PAL phenylalanine ammonia lyase PGPR plant growth promoting rhizobacteria PGPF Plant growth promoting fungi PAMP pathogen-associated molecular pattern PCR polymerase chain reaction PDF1.2 plant defensing 1.2 PPN plant parasitic nematode PR pathogenesis-related PRR pattern recognition receptor PTI PAMP-triggered immunity RKN root-knot nematode RNA ribonucleic acid RNAi RNA interference R-primer reverse primer ROS reactive oxygen species RT reverse transcription qRT-PCR quantitative reverse transcription polymerase chain reaction SA salicylic acid SAR systematic acquired resistance TFs Transcription factors WT wild type

Chapter 1. General Introduction

Chapter 1 General introduction

1.1 Rice (Oryza sativa L.): the host

1.1.1 Origin and geographical distribution

Rice (Oryza sativa L.) was domesticated in South and Southeast Asia but its origin and domestication process are contentious and have long been argued. One genetic evidence indicated that the two main subspecies of Asian rice, indica and japonica originate from a single domestication of wild rice O. rufipogon about 8,200–13,500 years ago, in the region of Yangtze Valley of China (Molina et al., 2011). Another genetic study showed that O. sativa subsp. japonica was first domesticated from O. rufipogon around the central area of the Pearl River in southern China and O. sativa subsp. indica rice was later developed from crosses between japonica rice and local wild rice which was spread into South East and South Asia (Huang et al., 2012). The monsoonal rain, the warm and humid environment and the specific physiography of the Yangtze Valley of China offered a perfect environment for this rice domestication. Now rice is cultivated throughout the tropical and subtropical regions of the world between 55 N and 36 S latitudes (Fig 1.1). Rice can inhabit a variety of ecosystems, and tolerate extremes in sun exposure and moisture levels (Vaughan, 1994). The most favourable temperature for rice growth, development and reproduction is 30oC during daytime and 20oC during night time. Heavy soils such as clay, clay loam and loam that have a high water holding capacity with pH ranging from 5 to 8 are suitable for rice cultivation (Warrier et al., 2011).

Fig 1.1 Map showing rice (Oryza sativa L.) cultivation area around the world. The area in red shows the centre of origin of rice. (Source of the figure: http://www.targetmap.com/viewer.aspx?reportId=17614)

Chapter 1 General introduction

1.1.2 Morphology and plant growth stages

The rice plant is an annual grass consisting of roots, round hollow jointed culms, leaves and a terminal panicle. The root system consists of two main types: crown roots (mat roots and ordinary roots) and nodal roots (Fig 1.2). After seed germination, small roots called seminal roots or embryonic roots are observed for a short period of time and they are later replaced by the crown roots. Crown roots develop below the soil surface, they are fibrous and produce root hairs to absorb water and nutrients. Nodal roots develop from the nodes above the soil surface and can often be found in deep water rice. The rice stem or culm is made up of a series of nodes and internodes in alternating order. The internode is hollow and the length of internode generally increases from the lower to the upper part of the stem. The node is the solid portion that bears a leaf and a bud which can grow into a tiller. An inflorescence or panicle is the terminal component of the rice tiller. The panicle bears rice spikelets, which develop into grains. A spikelet consists of the pedicel and the floret. A floret includes the lemma, palea and the flower. A flower consists of a pistil (female organ) and six stamens (male organs). The rice grain is the ripened ovary, with the lemma and palea firmly attached to it (IRRI, 2007a).

Fig 1.2 The morphology of a rice plant (Source of the figure: http://www.rkmp.co.in/content/morphology-of-rice-plant-copy).

The growth of the rice plant can be divided into three main stages: 1. vegetative (germination to panicle initiation), 2. reproductive (panicle initiation to flowering) and 3. ripening (flowering to mature grain). The growth duration of a rice plant depends on the variety and growing environment.

Chapter 1 General introduction

Traditional rice varieties require about 150 days whereas the modern, high yielding and early maturing varieties require 90 days to reach the mature grain stage.

1.1.3 Types of rice

The genus Oryza contains two cultivated and twenty-one wild species. The two cultivated species of rice are: O. sativa, the Asian rice which is widely grown and O. glaberrima, the African rice, which is grown in West Africa. Most rice cultivars can be positioned within two major subspecies of O. sativa: subsp. japonica and subsp. indica, which differ in physiology and morphological traits (Londo et al., 2006). Indica rice is usually found in the lowlands of tropical Asia, whereas japonica rice is typically found in the upland hills of southern China, northeast Asia, Southeast Asia and Indonesia, as well as in regions outside Asia such as, Africa, North America, Europe and South America (Khush, 1997). Indica plants have broad to narrow, light green leaves with tall to intermediate plant stature, grains are long to short, slender and spikelets are awnless. Indica grains shatter easily and the amylose content in the seed is 23-31%. On the other hand, Japonica has narrow, dark green leaves, medium-height tillers. Grains are short, roundish with awnless to long awned spikelets. Japonica grains do not shatter easily and amylose content in the grain is 0-20% (IRRI, 2007b). New promising African upland rice varieties called NERICA have been developed through crossing African rice varieties and Asian rice varieties.

1.1.4 Rice agro-ecosystem

Rice agro-ecosystems can be divided into four major ecosystems, based on hydrological characteristics: 1. irrigated, 2. rainfed upland, 3. rainfed lowland and 4. Flood-prone rice (Khush, 1997). Irrigated rice is divided into irrigated wet season area and irrigated dry season area. Irrigated rice is grown in bunded fields with irrigation at regular intervals to maintain a layer of 5-10 cm standing water in the field. This system is the most important rice production system in Asia. The irrigated ecosystem accounts for 50% of the harvested rice area (Fig 1.3) which provides 75% of the world’s rice production. The rice productivity is higher in the irrigated system compared to other ecosystems, with an average yield vary from about 3 t/ha to 10 t/ha (FAO, 2016).

Rainfed lowland rice is grown in river deltas and coastal areas mainly in South Asia, parts of Southeast Asia, and Africa. This rice is grown in bunded fields. This ecosystem is more subject

Chapter 1 General introduction to flooding and drought compared to the irrigated rice ecosystems because of lack of water supply and/or water control for irrigation. Approximately 34% of rice is grown in this ecosystem (Fig 1.3), which covers 20% of the world’s rice production. The rice productivity is very low due to the lack of improved management practices, with an average yield of about 1.5–2.5 t/ha (FAO, 2016).

Rainfed upland rice is grown in un-bunded field in Asia, Latin America and Africa. In this ecosystem, water supply relies only on rainfall resulting in mostly aerobic soil conditions. This ecosystem accounts for 9% of the harvested rice area (Fig 1.3) which provides 4% of the world’s total rice production. Rice yields in upland systems are generally low, averaging 1 to 2 t/ha (FAO, 2016).

The flood prone ecosystem is divided into the deep water rice and the intermediate rainfed lowland. Special rice types in this ecosystem are deep water rice, tidal rice, floating rice and submergence tolerant rice. Flooding occurs during part of the growing season and the water depth varies from 50 cm to more than 3m. This flood prone rice grown in low-lying lands in river deltas of South and Southeast Asia accounts for 7% of the harvested rice area from which 3% area is covered with deep water rice.

Fig 1.3 The percentage of rice area under the different ecosystems (IRRI, 2007c).

1.1.5 Rice production in Bangladesh

Rice is the second most important cereal crop in the world. The total annual rice production in the world is 741.3 million tonnes (494.4 million tonnes, milled basis) (FAO, 2015) where over 90% of

Chapter 1 General introduction the world’s rice is being produced in Asia (Fig 1.4). In Bangladesh, rice is a staple food for about 162 million people. The rice sector in Bangladesh contributes one-half of the agricultural gross domestic product (GDP) and one-sixth of the national income.

Fig 1.4 The top ten rice producing countries in the world (FAO, 2015)

In Bangladesh, rice is planted in about 75% of the total cropped area and over 80% of the total irrigated area. All rice varieties in Bangladesh are grouped into five distinct ecotypes 1. Boro, 2. Transplanted Aus (T. Aus), 3. Transplanted Aman (T. Aman), 4. Upland Aus (direct-seeded Aus) and 5. Deepwater rice (floating rice). Boro rice is grown completely under the irrigated ecosystem during the dry period (November to July) while T. Aman (during July to December), T. Aus (during April to August) and Upland rice (during March to July) are grown under the rainfed ecosystem (Sattar, 2005). In 2015, the rice harvested area in Bangladesh reached 12 million ha from which 52 million ton of rice is produced (34 million tonnes, milled basis). The production of Aman and Boro was 19.8 million and 29.0 million tonnes (13.2 million and 19.3 million tonnes, milled basis) respectively. The average yield of rice is 4.3 t/ha (USDA, 2015). Bangladesh is one of the top ten rice producing countries of the world (Fig 1.4, FAO, 2015). The rice production in Bangladesh has risen steadily from 10.59 million tons in the year 1971 to 52 million tons in 2015. This increasing rate of rice production is mainly due to the adoption of modern high yielding rice varieties. The Bangladesh Rice Research Institute (BRRI) has developed 72 high yielding modern rice varieties and four hybrid rice varieties so far. These BRRI released high yielding varieties cover 56% of the total rice area which contributes about 74% of the total annual rice production of the country.

Chapter 1 General introduction

1.2 Nematodes: the pathogens The nematodes or roundworms under the phylum Nematoda (De Ley & Blaxter, 2002) are pseudocoelomate, unsegmented worm-like animals. Nematodes are the most numerous Metazoa on earth, occurring in almost every habitat (Cobb, 1915). Till now over 25,000 nematode species have been described (Hodda, 2011; Zhang, 2013). They undergo four molts from juvenile to the adult phase. Based on small subunit ribosomal RNA phylogenetics (Blaxter et al., 1998), the phylum nematoda was divided into five different clades. In a recent update, the phylum was divided over twelve clades (Van Megan et al., 2009). This molecular phylogenetic analysis also indicated that the nematodes have evolved several times the ability to parasitize animals and plants during their evolution (Blaxter et al., 1998). Nematodes are either free living, feeding on bacteria, fungi, protozoa or parasites of animals (44% of the described species) and plants (17% of the described species).

Plant parasitic nematodes are recognized as major agricultural pathogens and cause crop losses throughout the world. Damage caused by plant plant nematodes has been estimated at $US80 billion per year (Nicol et al., 2011). The first described plant parasitic nematode was the wheat seed gall nematode Anguina tritici, discovered by Needham in 1743 in wheat seed. Till now about 4100 plant parasitic nematode species have been described (Decraemer & Hunt, 2006). Plant parasitic nematode feed on all part of the plant mostly by piercing the plant cell wall with a hollow, retractable, needle-like mouth spear called stylet. Plant parasitic nematodes cause significant yield losses in rice, ranging from 10% to 25% worldwide (Bridge et al., 2005).

Based on the parasitic strategies, plant parasitic nematodes can be classified into two major groups: ectoparasitic nematodes and endoparasitic nematodes. Each group can be further divided into migratory and (semi) sedentary plant parasitic nematodes according to their feeding strategies. Endoparasitic nematodes can be further divided into migratory or sedentary nematodes.

1.2.1 Nematodes of rice

Here, the focus will be on plant parasitic nematodes that are able to infect rice. More than 200 species of plant parasitic nematodes have been reported that parasitize rice (Prot, 1994). The distribution of some nematodes is geographically restricted, while others occur throughout the rice

Chapter 1 General introduction growing areas of the world. Nematode parasites on rice may be divided into foliar parasites and root parasites.

Root parasites a) Ectoparasitic nematodes

Ectoparasitic nematodes remain outside of the plant tissue thoughout their life cycle and feed on the cytoplasm by using the stylet to puncture plant cells. The longer the stylet the deeper they can feed within plant tissues. Several species of Tylenchorhynchus (T. marlini, T. mashhoodi, T. brassicae, T. annulatus), Criconemoides (C. onoensis, C. rustica, C. komanaensis), Helicotylenchus (H. pseudorobustus, H. exallus) have been reported in rice. This type of nematodes feeds on root hairs and/or epidermal cells and the damage is limited to necrosis of the cells. b) Endoparasitic nematodes

Migratory endoparasitic nematodes

In this type of parasitism, the entire nematode penetrates the root tissues. All life stages of the nematodes can be found in the soil or in the plant tissues. They have no fixed feeding site within plant tissues but feed while migrating through plant cells (Fig. 1.5A). Aboveground symptoms include stunting, leaf chlorosis, reduction of tillering and wilting. In the root, they cause cell necrosis and cavities, and as a result infected roots turn brown and rot. The most important migratory endoparasitic nematodes of rice belong to the genus Hirschmanniella, known as the rice root nematodes. Several species of Hirschmanniella (H. belli, H. oryzae, H. gracilis, H. imamuri, H. mucronata) have been reported from irrigated, lowland and deep water rice with the most commonly reported species being H. oryzae. Another type of migratory nematode that parasitizes rice is Pratylenchus spp. known as root-lesion nematode. P. zeae and P. brachyurus are the most common Pratylenchus species recorded on rice.

Chapter 1 General introduction

Sedentary endoparasitic nematodes

Sedentary nematodes establish a permanent feeding site within the host plant where they reside for almost their whole life cycle. Among sedentary endoparasites, the two most damaging nematodes are the root-knot (Meloidogyne spp.) and cyst nematode (Heterodera spp.).

Root-knot nematodes (RKN)

A number of Meloidogyne spp. (M. graminicola, M. oryzae, M. incognita, M. javanica, M. arenaria, M. salas) have been recorded that parasitize rice throughout the rice growing areas. Among these, M. graminicola and M. incognita are the most damaging, causing up to 70% yield losses in rice at the field level (Bridge et al., 2005). The infective second stage juveniles (J2s) of root-knot nematodes are attracted to plant roots and penetrate the root at the cell elongation region just behind the root tip. After penetration, J2s migrate intercellularly until they have found a suitable cell to initiate feeding site formation. The feeding sites formed by root-knot nematodes are called giant cells, formed by nuclear divisions without cell division. Hyperplasy and hypertrophy of the surrounding cells leads to the formation of a gall or root-knot (Jones & Payne, 1978; Gheysen & Jones, 2006). J2s feed on the giant cells, and undergo three moults to become pyriform shaped females, which lay eggs inside the root tissues. The life cycle of a root knot nematode is presented in fig 1.5B. The galls produced by M. graminicola at the root tip of young plant are hook shaped. The above ground symptoms caused by the nematodes are chlorosis, stunting, reduction of tillering, unfilled spikelets and poor yield. M. graminicola can survive in waterlogged soil whereas M. incognita cannot survive long periods under flooded conditions (Bridge & Page, 1982). M. graminicola can survive in waterlogged soil as eggs in egg masses or juveniles for a long period; juveniles can survive for at least 5 months (Bridge & Page, 1982) and some egg masses can remain viable for at least 14 months (Roy, 1982). Juveniles cannot invade the rice roots in flooded conditions but immediately invade the roots when the water is drained (Bridge & Page, 1982). In contrast to M. graminicola-galls, the galls produced by M. incognita are not hook-shaped and females lay their egg masses on the root surface.

Chapter 1 General introduction

Fig 1.5 Life cycle of different types of root nematodes, from Kyndt et al. (2014).

Cyst nematodes

Four species of cyst nematodes have been reported from upland and irrigated rice fields. Heterodera sacchari is commonly found in West Africa and Trinidad, H. elachista in Japan, H. oryzae in West Africa and Bangladesh and H. oryzicola in India (Fortuner & Merny, 1979). The life cycle of cyst nematodes is similar to root-knot nematode. J2s of cyst nematodes penetrate the root tissue and migrate to the vascular cylinder to induce a feeding site called a syncytium. A syncytium is a large multinucleate cell formed by widening of plasmodesmata and cell wall degradation by plant enzymes, resulting in the fusion of adjacent protoplasts of over hundred cells (Grundler, 1998). The J2s feed from the syncytium and undergo three molts to become adults, the adult female is fertilized by the male. Some of the eggs are deposited outside the female’s body in a gelatinous matrix, and the remaining eggs are retained within the female’s body. The female body of cyst nematodes becomes tanned and hard to form the typical cyst. The life cycle of a cyst nematode is presented in fig 1.5C. Symptoms caused by cyst nematode infection on rice include stunting, chorosis, reduction of tillers, root necrosis, early flowering, and partial filling of kernels (Coyne & Plowright, 2000). Yield losses caused by H. elachista and H. oryzicola have been reported to be 20% and 40% respectively (Bridge et al., 2005).

Chapter 1 General introduction

C) Semi-endoparasitic nematodes

The reniform nematode, Rotylenchulus reniformis, a sedentary semi-endoparasite, was found to be associated with upland rice (Villanueva et al., 1992) but it is not a common parasite of rice (Bridge et al., 2005). The young females (infective stage) penetrate the plant roots, inserting about one- third of the anterior body, and they establish feeding sites on endodermal and pericycle cells which are similar to the syncytia of cyst nematodes. After feeding, the posterior part of the female swells near the vulval region and the female body outside the root takes a bean or kidney shape. The uterine glands produce a gelatinous matrix into which eggs are laid.

Foliar parasite

The foliar parasitic nematodes on rice include two important species: Aphelenchoides besseyi and Ditylenchus angustus.

Aphelenchoides besseyi

A. besseyi is globally distributed and causes white tip disease in rice. It is one of the few seed borne nematodes and it is restricted to deep water, irrigated and flooded rice systems. The nematodes feed ectoparasitically on the growing point of the plant. With the development of the plant, the nematodes move to the developing panicles, spikelets, and feed on the plant’s reproductive structures, eventually settle in the rice seeds (Huang & Huang, 1972; Fig 1.6). They remain coiled and desiccated inside the grains until they become again active when the crop is sown. The nematodes complete their lifecycle within 8–12 days at 30oC. The nematode causes characteristic whitening of the top 3 to 5 cm of the leaf tips (Bridge et al., 2005). The flag leaf becomes crinkled and distorted, infected seeds stay small and distorted with necrotic lesions. The yield losses due to these nematodes vary with country, locality and rice environment (Bridge et al., 2005).

Ditylenchus angustus

The other major foliar nematode in rice is Ditylenchus angustus, which is mostly limited to the south and southeast of Asia (Butler, 1919; Bridge et al., 2005). Because this nematode was studied in this research, it is described in more detail in the subsequent paragraph.

Chapter 1 General introduction

Fig 1.6 Life cycle of different types of foliar nematodes, from Kyndt et al. (2014).

1.2.2 Nematode under study: Ditylenchus angustus

Scientific classification

Phylum: Nematoda Class: Tylenchoidea Order: Tylenchida Family: Anguinidae Genus: Ditylenchus Species: Ditylenchus angustus (Butler, 1913) Filipjev, 1936

Ditylenchus angustus was first reported by Butler (1913) in Bangladesh (former East Bengal) and was named Tylenchus angustus. In 1932, Goodey transferred the genus to Anguillulina which was finally transferred to the genus Ditylenchus by Filipjev (1936).

Common name

The preferred common name for D. angustus is the rice stem nematode. The disease caused by this nematode in rice is known as ufra disease, hence this nematode is also referred to as the ufra nematode. In Bangladesh, locally this disease is called as “dak pora”. In Myanmar this nematode is known as “akhet-pet”, in Vietnam as “tiem dot san”, in Thailand as “yadngo” (CABI/EPPO, 1999).

Chapter 1 General introduction

Morphological features

Measurements of the critical morphological features were reported by many investigators (Butler, 1913; Goodey, 1932; Mian & Latif, 1994; Ibrahim & Perry, 1994; Das & Bajaj, 2008). Mian & Latif (1994) provided measurements of Bangladeshi isolates of D. angustus and according to them the length of the female is 1.0–1.2mm and the male is 0.9–1.1mm. General body morphology in case of female and male nematodes is similar. Males are as numerous as females. The nematode body is slender with fine transverse striated cuticle. The lip region is flat, unstriated, the set off from the body is not distinct. The cephalic region is lightly sclerotized, hexaradiate with six equal lips. The nematode stylet is moderately developed, the conus is attenuated, about 45% of total stylet length, the knob is small but distinct. Lateral fields are one-fourth of body width or slightly less, with 4 incisures, extending almost to the tail tip. Deirids are immediately posterior to the level of excretory pore. Phasmids are close behind the mid-part of the tail, pore-like, difficult to see. The procorpus is cylindrical, the median oesophageal bulb oval, with a distinct valvular apparatus, the isthmus narrow, cylindrical, slightly overlapping the intestine mainly on the ventral side, cardia are absent. The nerve ring is conspicuous, behind the median oesophageal bulb (Fig 1.7).

In case of female, the vulva is a transverse slit, the vaginal tube oblique, reaching more than half- way across the body. The spermathecal is very elongated, filled with large rounded sperms. The anterior ovary is outstretched with oocytes in a single row. The post-uterine sac is collapsed, without sperms. The tail is conoid, tapering to a sharply pointed terminus resembling a mucro (Fig 1.7).

In case of male, spicules is ventrally curved, simple; the gubernaculum is short and simple. A bursa is present, extending almost to the tail tip (Fig 1.7).

Juveniles are similar to adults in gross morphology, with the oesophagus proportionally longer than in adults. The size range of second stage juveniles (J2) is 0.28-0.43 mm, the third stage juveniles (J3) is 0.43-0.63 mm and fourth stage juveniles (J4) is from 0.63 to 0.87 mm.

Chapter 1 General introduction

Fig 1.7 Ditylenchus angustus (Butler, 1913) Filipjev, 1936. A. Female B. Female oesophageal region C. En-face view D. Cephalic framework E. Female cross section at mid-body F. Female tail G. Lateral field at mid-body H. Juvenile tail I. Male tail, lateral view J. Male tail, ventral view K. Female vulval region. Taken from Seshadri & Dasgupta (1975).

Biology and Life cycle

All life stages of D. angustus are infective although the J4 stage shows the highest infectivity (Plowright & Gill, 1994). The nematode feeds mainly as ectoparasite but endoparasitic behaviour has also been observed (Singh et al., 2013 and personal observations: Fig 1.8). The nematode enters the plant mainly at the collar region, migrates upward with the growth of the shoot and feeds on newly forming tissues in the rolled leaf sheath (Fig 1.6). At rice harvest, the nematodes remain in a coiled, quiescent state, mainly in the dried glumes of the lower panicle spikelets (Latif et al., 2006), in crop residues (Cox & Rahman, 1979; Kinh, 1981), soil (Cuc, 1982a), seeds (Ibrahim & Perry, 1993; Prasad & Varaprasad, 2002) and weed host (Latif et al., 2006). Although the presence of living nematodes in the grains has been reported (Prasad & Varaprasad, 2002), the chance of transmission by seed is very unlikely when the seeds are properly sun dried to a moisture content between 12 and 14% (Bridge & Starr, 2007; Ibrahim & Perry, 1993). It has been reported that the

Chapter 1 General introduction nematode can survive in desiccated conditions for several months in infested plant materials (Butler, 1913; Cox & Rahman, 1979; Ibrahim & Perry, 1993). The J4 has superior survival attributes compared to all other stages (Ibrahim & Perry, 1993). The activity and infectivity of the nematode resumes as the water content of the field increases. Dissemination of nematodes from field to field is mainly through irrigation water (Sein & Zan, 1977; Rahman & Evans, 1987) and tidal fresh water inundation in deep water rice. Stem or leaf contact under high humidity also causes nematode spreading (Rahman & Evans, 1987). The nematodes can invade a host within one hour (Rahman, 2003).

Reproduction is amphimictic and the nematode completes its life cycle within 10-20 days at 27- 30oC (Bridge & Starr, 2007). The nematodes may complete at least three generations within one growing season (Rahman, 2003). The females start to oviposit 1 day after reaching adulthood (Ali & Ishibashi, 1996). The females lay 50 to 100 eggs in their lifetime (Rahman, 2003). At 24–26°C, the eggs are deposited at the two-celled stage. The J1 molts into J2 within the egg and hatches spontaneously in water without host stimuli (Ali & Ishibashi, 1996; Ali et al., 1995). The J2 and J3 require one day each, while the J4 stage requires two days to become adults (Ali et al., 1997).

Fig 1.8 Ditylenchus angustus and eggs inside a rice leaf stained with acid fuchsin, revealing endoparastic behaviour.

Signs and symptoms

In the vegetative stage of the crop, D. angustus infestation is characterized by malformations and white patches, or speckles in a splash pattern at the leaf base (Fig 1.9A). Brownish stains may develop on leaves and leaf sheaths, and the area of the upper internodes of the stem turn dark brown (Rahman, 2003). Infected leaf bases and sheath become twisted and distorted (Fig 1.9B). Sometimes, lower nodes become swollen with irregular branching giving the appearance of a bushy plant (Rahman, 2003).

Chapter 1 General introduction

Fig 1.9 Rice plant infected by Ditylenchus angustus A. white patches at the leaf base B. twisted and distorted panicles and flag leaf.

At the reproductive stage, the nematodes move upwards to feed on the ear primordia and the developing ear heads. The panicle’s head and flag leaves become twisted and distorted. Depending on the time and degree of infestation, panicles often remain completely enclosed within a swollen sheath or partially emerge or without filled grains (Bridge et al., 2005; Rahman, 2003). Based on the extent of panicle emergence, Cox & Rahman (1980) identified three types of ufra disease: 1. Ufra I (panicle fails to emerge and completely enclosed by the leaf sheath), 2. Ufra II (panicles partially emerge with or without filled grains), 3. Ufra III (panicles fully emerge without filled grains) (Fig 1.10). In the field, the disease looks as dark brown patches (Bridge et al., 2005; Cox & Rahman, 1980). Diseased plants can be differentiated from healthy plants by their erect posture.

Fig 1.10 Rice plants infected by Ditylenchus angustus A. Ufra I (panicle fails to emerge and completely enclosed by the leaf sheath), B. Ufra II (panicles partially emerge with or without filled grains) and C. Ufra III (panicles fully emerge without filled grains). Source of images: http://www.knowledgebank-brri.org/rice_disease.php

Chapter 1 General introduction

Known hosts

D. angustus is an obligate parasite that infects cultivated and wild rice species (Oryza sativa, O. alta, O. cubensis, O. eichingeri, O. glaberrima, O. latifolia, O. meyeriana, O. minuta, O. nivara, O. perennis, O. officinalis, O. rufipogon) (McGeachie & Rahman, 1983; Bridge et al., 1990) and a few weed species (Leersia hexandra, Echinocloa colona, Sacciolepsis interrupta) (Vuong & Rabarijoela, 1968; Cuc & Giang, 1982b).

Economic importance

The disease mainly occurs in deep water rice (Butler, 1919). However together with the shrinkage of deep water rice cultivation and increased production of irrigated and rainfed rice, infections caused by D. angustus also appear in these conditions (Prasad et al., 2000; Latif et al., 2004). Nevertheless, the economic impact caused by this nematode in the world is relatively low (Rahman, 2003) because of its restricted distribution (Bridge et al., 2005). But if the nematode occurs, yield loss can reach 100% in deepwater, irrigated and lowland rice (Cuc & Kinh, 1981). Yield loss studies in different countries have demonstrated the devastation caused by the nematode (Rao et al., 1986; Hashioka, 1963; Cuc & Kinh, 1981). For instance, in Bangladesh, 40 to 49% or sporadically 90% yield losses have been reported (Latif et al., 2011a; Latif et al., 2011b). Even a low infection percentage in transplanted seedlings can cause substantial yield losses (Bridge & Starr, 2007).

1.2.3 Management and control of plant parasitic nematodes

Preventive

Phytosanitary measures are of major importance to reduce the economic loss caused by plant- parasitic nematodes. According to the International Plant Protection Convention (IPPC), phytosanitary measures include any regulation, legislation or procedure to prevent the introduction and/or spread of a plant pest. Certification of plant propagating materials, clean machinery, and controlled irrigation water can reduce the nematode dissemination. Phytosanitary approaches appear to be effective in managing D. angustus. Burning of infested stubble, straw, ratoon crops, and control of water flow are effective to reduce ufra disease (Rahman, 2003).

Chapter 1 General introduction

Cultural control

Cultural control practices can play an important role for PPN management. Cultural control of PPN encompasses crop rotation, hot water treatment, dry heating, multiple cropping, weed control, soil amendment, cover crops and flooding. The success of optimum use of cultural practices depends on the understanding of the target nematode including its identification, hosts, and environmental preferences. Lengthening the overwinter period of D. angustus can decrease the nematodes as well as the nematode infectivity (Cox & Rahman, 1980; Das & Bhagawati, 1992). As D. angustus has a relatively narrow host range compared to other root knot nematodes, removal of wild rice and other weed hosts can reduce the chances of nematode survival between crops. Late sowing, earlier harvesting by using short duration cultivars can prolong the time that the nematodes should survive in the absence of a host plant (Rahman, 2003). Crop rotation is also a useful approach in the management of ufra disease. Rotation of rice with non-host crops such as jute or mustard can reduce ufra incidence (Chakraborti, 2000; Miah & Rahman, 1985; Rahman, 2003). Application of different organic amendments such as neem (Azadirachta indica), leaf dust, neem cake, neem seed dust, mustard (Brassica nigra) cake, sesame (Sesamum indicum) cake, jute (Corchorus olitorius) seed dust, biskatali (Polygonum hydropiper) leaf dust, bankalmi (Ipomoea sepiaria) leaf dust can significantly reduce the ufra severity (Latif et al., 2006).

Chemical control

Nematicides are applied to reduce plant damage by reducing nematode invasion in the plant root or to reduce the transmission of nematode-borne viruses to the plant. It is used as part of integrated management approach or as the sole component. Nematicides can be classified according to their chemical group (e.g. carbamates, organophosphates), mode of application (e.g. fumigant, non- fumigant) and mode of action (e.g. acetylcholinesterase). Several nematicides have been used effectively to manage ufra nematode. The use of carbofuran, benomyl (Miah & Rahman, 1985), Miral (isazofos) and Tecto 60FL (thiabendazole) (Mondal & Miah, 1987), fenamiphos and disulfoton (Rahman & Miah, 1985), carbosulfan and triazophos (Das, 1997) resulted in significant control of ufra disease. However, the use of nematicides generates public concern due to the adverse impact of chemicals on the environment, soil microorganisms, ground water and human

Chapter 1 General introduction health. So there is increased pressure to reduce or abandon the use of chemicals (Haydock et al., 2013).

Biological control

According to Eilenberg et al. (2001), biological control can be defined as the use of living organisms to suppress the population density or impact of a specific pest organism, making it less abundant or less damaging than it would otherwise be. Biological control is an environmentally friendly method for pest and disease management. A number of organisms including fungi, bacteria, viruses, nematodes and other invertebrates showed antagonistic activity against plant parasitic nematodes (Stirling, 1991; Viaene et al., 2006; Lee & Kim, 2016; Zhang et al., 2016; Vos et al., 2012).

Host resistance

With increasing restrictions on chemical control, the use of nematode-resistant cultivars offers an effective and environmentally safe alternative to chemicals for plant parasitic nematodes control. Both plant resistance and tolerance to nematodes are important as control strategies. Plants carry inherent disease resistance in both natural and cultivated populations. A large number of rice genotypes have been screened against D. angustus and some resistance to D. angustus has been found in different rice genotypes. The wild rice species O. subulata and the cultivar Rayada (RDA)- 16-06 (Miah & Bakr, 1977), RDA B3, RDA 14, RDA 4, RDA 2, RDA B4, RDA B8, RDA 3, Bazail 65 and RDA B5 (Bora & Medhi, 1992; Das et al., 2000; Das & Sarmah, 1995), Fukuhonami, Hayakikari, Akiyutaka, Matsuhonami, Aokazi, Koshinishini, Kinonishiki, Akinishiki, Shinanokogane, Hunenwase, Rayeda 4849 and Rayeda 4851 (Latif et al., 2011a; Latif et al., 2011b) showed resistance against D. angustus. The Burmese cultivar, B-69-1 showed tolerance towards ufra nematode infection (Sein, 1977). The current cultivation of these identified resistant varieties in the field is limited because of their low yield potential. Although nematode resistance genes have been characterized in several crop plants (Veremis et al., 1996; Cai et al., 1997; Kaloshian et al., 1998; Milligan et al., 1998), no resistance gene has been identified in rice against D. angustus so far. To develop high yielding ufra resistant variety by breeding or genetic engineering, it is prerequisite to identify and characterize the resistance gene(s).

Chapter 1 General introduction

1.3 The Plant immunity system

Plants come across a wide range of pathogenic microorganisms in their natural environment. To protect themselves against microbes and diseases, plants have developed an extraordinary array of immune and defence mechanisms in their cells. The initial barrier for any kind of invader is plant preformed defence including the plant cell walls and their reinforcements (Underwood, 2015) and toxic phytochemicals (Broekaert et al., 1997). Beside these, plants induce a sophisticated system of responses upon infection which is triggered by two-tiered microbial recognition (Jones & Dangl, 2006; Dodds & Rathjen, 2010).

The first tier of plant innate immunity is governed by pattern recognition receptors (PRRs) that are activated by recognition of evolutionary conserved pathogen- or microbial-associated molecular patterns (PAMPs/MAMPs) such as fungal chitin, bacterial flagellin or bacterial lipopolysaccharides, peptidoglycan. Activation of PRRs leads to multiple downstream defence signalling events such as production of ion fluxes, callose, phenolics, reactive oxygen species that limit colonization. This immunity is known as PAMP- triggered immunity (PTI) (Fig 1.11, Jones & Dangl, 2006). PTI also leads to produce phytoalexins, pathogenesis-related proteins (PR proteins), the activation of the mitogen activated protein kinase (MAPK) cascade and transcriptional changes (Spoel & Dong, 2012). PAMPs/MAMPs are molecules that are important for survival and pathogenicity and are conserved among diverse pathogens species or strains. Mutation of these PAMPs/MAMPs limits the ability of a pathogen to spread in populations by impairing the infection processes (Lee et al., 2006). In plants, the receptors to recognize PAMPs/MAMPs are typically receptor kinases (Ronald & Beutler, 2010). The bacterial elicitor flg22, a peptide representing the elicitor-active epitope of flagellin triggers immunity in Arabidopsis seedlings carrying the receptor-like kinase FLS2 (Gomez-Gomez & Boller, 2000). In rice, flg22 triggered immunity is mediated through OsFLS2, which is the rice ortholog of FLS2.

Flagellin induces the expression of numerous defence related genes, H2O2 generation and hypersensitive cell death in various plants (Tanaka et al., 2003; Zipfel et al., 2004). In rice, a variety of different PAMPs have been found to be active, for instance, fungal chitin, bacterial lipopolysaccharides (Desaki et al., 2006; Kaku et al., 2006). Recently ascarosides (Ascr#18) were identified as an evolutionarily conserved family of nematode pheromones that can be recognized by plants. After ascaroside recognition plants induce hallmark defense responses including the

Chapter 1 General introduction expression of genes associated with PTI, such as activation of MAPKs, as well as salicylic acid- and jasmonic acid-mediated defense signaling pathways (Manosalva et al., 2015). Teixeira et al. (2016) showed that root-knot nemtode induces PTI in Arabidopsis root. Nematode recognition leading to PTI response involves camalexin and glucosinolate biosynthesis. They have also showed that root-knot nematode-induced glucosinolate biosynthesis pathway was BRASSINOSTEROID INSENSITIVE-ASSOCIATED KINASE 1 (BAK1, a common partner of distinct receptors of PAMPs/MAMPs) dependent and the camalexin biosynthesis pathway was only partially dependent on BAK1 suggesting the existence of diverse nematode recognition mechanisms.

Virulent pathogens are able to circumvent PTI by secreting so-called effectors into the host, thereby leading to effector-triggered susceptibility (ETS). However, pathogen effectors (avirulence proteins, Avr) can be recognised by nucleotide binding-leucine rich repeat (NB-LRR) proteins of plant, encoded by most R (resistance) genes. This second tier of immunity called effector-triggered immunity (ETI), acts largely inside the cell (Fig 1.11). ETI is a stronger and more intense defence response, often associated with programmed cell death of the infected cells, known as hypersensitive response (HR). NB-LRR proteins activate defence responses including oxidative burst, changes in cellular redox and in gene expression. LRR-mediated disease resistance is effective against obligate biotrophs, or hemibiotrophic pathogens but not against necrotrophic pathogens (Glazebrook, 2005). Recognition of specific pathogen effectors by R genes is either through direct binding or by recognition of the effector’s alteration of a host protein (Jones & Dangl, 2006). Among different rice NB-LRR proteins, PITA is the best characterized one (Bryan et al., 2000). This protein directly recognizes the Magnaporthe grisea avirulence protein (AvrPita), inducing localized cell death to prevent M. grisea to spread to adjoining rice cells (Jia et al., 2000). To date approximately 100 rice R genes conferring resistance to Magnaporthe oryzae have been identified and more than 20 of them have been cloned (Guo et al., 2016; Liu et al., 2014; Zhai et al., 2014; Devanna et al., 2014).

Chapter 1 General introduction

Fig 1. 11 A zigzag model illustrates the quantitative output of the plant immune system. From Jones & Dangl (2006). PAMPS: Pathogen Associated Molecular Patterns, PTI: PAMP-Triggered Immunity, ETS: Effector-Triggered Susceptibility, ETI: Effector-Triggered Immunity, Avr-R, Avirulence-Resistance proteins.

1.4 Induced resistance

Induced resistance can be defined as a state of enhanced defensive capacity of plants that results in resistance to subsequent attackers. The induced state of resistance in plants elicited by certain biological or chemical inducers can be effective against a broad range of pathogens including fungi, bacteria, viruses, nematodes and insect herbivores. This type of resistance is expressed not only locally at the site of induction but also systemically in different plant parts that are separated from the inducer. The induced resistance can be divided broadly into systemic acquired resistance (SAR), induced systemic resistance (ISR), β-aminobutyric acid -induced resistance (BABA-IR), and wound induced resistance (WIR). These resistance signaling pathways that are elicited by pathogens, beneficial microbes, insects or any kind of defence-inducing molecule somewhat overlap and share common signalling components (Pieterse et al., 2014). The induced resistance is often related with an enhanced capacity to mobilize cellular defence responses – a process called ‘priming’ (Conrath et al., 2006). The primed plants are able to show more rapid and enhanced/better defence responses to subsequent biotic and abiotic stress.

In this section, we provide an overview of two best-studied induced resistance mechanisms: systemic acquired resistance (SAR) and induced systemic resistance (ISR). SAR and ISR can be distinguished on the basis of the nature of the elicitor and the regulatory pathways associated. 24

Chapter 1 General introduction

Typically, SAR is mediated by the salicylic acid (SA) pathway with the activation of a large set of genes that encode pathogenesis-related proteins (PRs), on the other hand ISR is generally regulated by jasmonic acid (JA) - and ethylene (ET)-dependent signaling pathways and is typically not related with the direct activation of PR genes (Fig 1.12, Van Wees et al., 1997; Vallad & Goodman, 2004).

Fig 1.12 a. Schematic representation of biologically induced disease resistance triggered by pathogen infection (SAR; red arrow) and colonization of the roots by beneficial microbes (ISR; purple arrow) b. Schematic representation of molecular components and mechanisms involved in pathogen-induced SAR and rhizobacteria-mediated ISR. Solid black lines indicate established interactions; dashed black lines indicate hypothetical interactions. Colored arrows indicate systemic translocation of long-distance signals (indicated in the same color at the base of the arrows). Ac acetylation, ET ethylene, ETI effector-triggered immunity, Fe iron, ISR induced systemic resistance, JA jasmonic acid, MAMP microbe-associated molecular pattern, Me methylation, PAMP pathogen-associated molecular pattern, PRR pattern-recognition receptor, PTI PAMP-triggered immunity, R protein Resistance protein, SA salicylic acid, SAR systemic acquired resistance, TF transcription factor. From Pieterse & Van Wees (2015).

1.4.1 Systemic acquired resistance

First evidence of systemic acquired resistance came from Ross in 1961, who observed that inoculation of tobacco mosaic virus (TMV) in half-leaves of tobacco plant induced a high level of resistance to TMV in the opposite half-leaves. SAR can be induced by virulent, avirulent, and nonpathogenic microbes or by application of various synthetic chemical compounds such as SA or its

Chapter 1 General introduction functional analogs INA (2,6-dichloroisonicotinic acid) and BTH (S-methyl benzo-1, 2,3- thiadiazole-7-carbothioate), probenazole (3-allyloxy-1,2-benziso-thiazole-1,1-dioxide), BIT (1,2- benzisothiazole-1,1-dioxide) NCI (N-cyanomethyl-2 chloroisonicotinamide) or tiadinil (3’-chloro- 4,4’-dimethyl-1,2,3 -thiadiazole-5-carboxanilide).

Activation of SAR involves the generation and transport of signals from locally infested leaves to the uninfected distal tissues (Guedes et al., 1980; Tuzun & Kuc, 1985). Past years, many translocated signals contributing SAR have been proposed (Park et al., 2007; Chaturvedi et al., 2012; Yu et al., 2013; Jung et al., 2009; Navarova et al., 2012; El-Shetehy et al., 2015). The plant hormone SA and several components of the SA pathway including the methylated derivative of SA (methyl SA, MeSA, Park et al., 2007) are major regulators of SAR. Upon SAR induction, a biphasic change in cellular reduction potential occurs, resulting in reduction of NONEXPRESSER OF PATHOGENESIS-RELATED GENES1 (NPR1) from oligomers to a monomers (Mou et al., 2003). The SA signal is transduced by monomeric NPR1 into the nucleus. In the nucleus, NPR1 interacts with TGA transcription factors along with WRKY transcription factors to activate SA- responsive PR gene. Recent findings reveals that SA-independent systemic signals induce a gene encoding SNF1-RELATED PROTEIN KINASE 2.8 (SnRK2.8), which phosphorylates NPR1 during SAR (Lee et al., 2015). Together with the SA-mediated monomerization of NPR1, their observations indicate that SA signals and SnRK2.8-mediated phosphorylation function coordinately to activate NPR1 through a dual-step process in developing systemic immunity in Arabidopsis thaliana. Recent evidence shows that NPR1 and its two paralogues, NPR3 and NPR4 are SA receptors that bind to SA with different affinity to regulate NPR1 stability (Fu et al., 2012; Wu et al., 2012). PR−1 is the best characterized PR gene that can be used as a marker for SAR in many plant species (Van Loon et al., 2006; Fu & Dong, 2013).

1.4.2 Induced systemic defense

In 1991, ISR was described by several researchers who demonstrated that plant roots colonized by several strains of plant growth-promoting rhizobacteria (PGPR) can excite the plant immune system in above-ground plant parts resulting in resistance against a broad spectrum of pathogens (Van Peer et al., 1991; Wei et al. 1991; Alstrom 1991). ISR can be triggered by various PGPR including different strains of Bacillus, Pseudomonas, Serratia, non-pathogenic plant growth- promoting fungi (PGPF) like Fusarium oxysporum, Trichoderma spp., Piriformospora indica 26

Chapter 1 General introduction strains and also symbiotic arbuscular mycorrhizal fungi (Van Wees et al., 2008; Pieterse et al., 2014). A number of beneficial microorganisms are known to induce ISR in rice (De Vleesschauwer et al., 2006; 2009; Chithrashree et al., 2011; Radja Commarea et al., 2002).

Beneficial microbes produce elicitors that are responsible for ISR. A number of elicitors produced by beneficial microbes have been demonstrated to elicit ISR including lipopolysaccharides (LPS), iron-regulated metabolites pyoverdin, SA, 2,4 diacetylphloroglucinol (DAPG), pyocyanin, N-acyl homoserine lactones, specific volatile organic compounds (Lee et al., 2012). Different microbial molecules have been recognized as ISR elicitors in monocots. For instance, Pseudomonas strains produce siderophores and antibiotics such as pseudobactins and pyocyanin that are defence elicitors in rice against Magnaporthe oryzae (De Vleesschauwer et al., 2008; De Vleesschauwer & Hofte, 2009).

Studies with defence signaling pathways involved in ISR revealed that pathogen-induced SAR and rhizobacteria-mediated ISR are regulated by distinct signaling pathways. Analysis of a large number of ISR-triggering plant-beneficial microbes demonstrated that not SA, but JA and ET are often the central regulators of ISR (Van Loon & Bakker 2005; Van Wees et al., 2008; Pieterse et al., 2014). For example, in Arabidopsis, the nonpathogenic, root-colonizing strain WCS417r of Pseudomonas fluorescens triggers an ISR response against infection by the bacterial leaf pathogen P. syringae pv. tomato. It has been shown that the transgenic Arabidopsis NahG plants that are unable to accumulate SA and wild-type plants were equally responsive to P. fluorescens WCS417r-mediated induction of resistance (Pieterse et al., 1996). On the other hand, the jasmonate response mutant jar1 and the ethylene response mutant etr1 were incapable to develop ISR against P. syringae pv. tomato (Pieterse et al., 1998). In rice, ISR triggered by P. fluorescens WCS374r against the leaf blast pathogen M. oryzae is regulated by an SA-independent but jasmonic acid/ethylene-modulated signal transduction pathway (De Vleesschauwer et al., 2008). Although ISR triggered by beneficial microbes is usually regulated through SA-independent resistance mechanisms, several examples of PGPR and PGPF have been reported to trigger ISR in an SA- dependent manner (De Vleesschauwer & Hofte 2009; Van de Mortel et al., 2012; Molitor et al., 2011).

The regulatory protein NPR1 is not only important for SAR but also plays an essential role for rhizobacteria-ISR. The role of NPR1 in ISR appears to be different from SAR because in SAR,

Chapter 1 General introduction

NPR1 functions as a transcriptional co-activator of SA-responsive PR genes whereas, ISR generally functions without PR gene activation. However, the molecular mechanism by which NPR1 functions in JA/ET-dependent ISR is unknown. Few studies have investigated to identify the signaling components involved in ISR related long distance signaling. Several studies indicating that the R2R3 type transcription factor MYB72 plays an essential role in the generation and/or translocation of a long-distance ISR signal (Verhagen et al., 2004; Zamioudis et al., 2014; Van der Ent et al., 2008).

1.4.3. Priming defence

Priming is the phenomenon by which cells are enabled to react to very low levels of a stimulus in a more rapid and robust manner than non-primed cells. Hence, primed plants show faster and/or stronger, activation of defence responses when challenged by biotic and abiotic stress (Conrath, 2009, 2011; Conrath et al., 2015). Many molecular and genetic studies reveal that defence priming is one of the important key process in various types of systemic plant immunity such as, SAR (Kohler et al., 2002; Jung et al., 2009), ISR (Conrath et al., 2002; Pieterse et al., 2014), resistance conferred by arbuscular mycorrhizal fungi (Pozo et al., 2009), β-aminobutyric acid–induced resistance (BABA-IR, Jakab et al., 2002) and wound-induced resistance (Chassot et al., 2008). Priming can be elicited by beneficial microorganisms, hervivores, necrotizing attackers, MAMPs, pathogen-derived effectors and various natural and synthetic compounds (Conrath et al., 2006; Heil & Bueno, 2007; Frost et al., 2008).

Studies with molecular aspects of defence priming found for different molecules in the priming mechanism: accumulation of dormant MAPKs, enhanced PAL1 and PR1 defence gene expression (Beckers et al., 2009), elevated levels of pattern recognition receptors (Tateda et al., 2014), activation of defence related transcription factors, chromatin modifications (Bruce et al., 2007) alterations of primary metabolism (Bolton, 2009), and accumulation of the azelaic acid (Jung et al., 2009) are all potentially crucial in the priming mechanism. However, the exact molecular mechanism of priming still remains elusive.

The benefits of priming are that it is cost-effective, since it does not involve direct activation of defence pathways, and it can provide resistance against a broad range of attackers. Therefore,

Chapter 1 General introduction priming offers an environmentally safe, effective, economically cheap, and ecologically long lasting option for sustainable crop production.

1.4.4 Induced resistance signaling molecules against plant parasitic nematodes

Induced resistance has been shown to be a possible strategy for the control of plant parasitic nematodes. A number of PGPR and PGPF were found to be effective against plant parasitic nematodes in different plant species (Lee & Kim, 2016; Zhang et al., 2016; Vos et al., 2012). Among PGPR, Bacillus spp. and Pseudomonas spp. are dominant populations in the rhizosphere that can affect plant parasitic nematode (Rovira & Sands, 1977; Racke & Sikora 1992; Sikora, 1992). Rhizobacteria can reduce nematode populations by different mechanisms such as by affecting nematode behaviour (Sikora & Hoffmann-Hergarten, 1992), competing for essential nutrients (Oostendorp & Sikora, 1990), promoting plant growth (El-Nagdi & Youssef, 2004), interfering with plant–nematode recognition (Oostendorp & Sikora, 1990), antagonising by means of the production of toxins, enzymes and other metabolic products (Siddiqui & Mahmood, 1999) and inducing systemic resistance in the plant (Hasky-Gunther & Sikora, 1995). Rhizobacteria- mediated ISR against PPN has been studied by many researchers (Hasky-Gunther & Sikora, 1995; Hasky-Gunther et al., 1998; Mahdi et al., 2001a; 2001b, Hauschild et al., 2000; Anita et al., 2004). Siddiqui & Shaukat (2004) reported that ISR in tomato induced by P. aeruginosa 7NSK2 and P. fluorescens CHA0 against M. javanica works through an SA independent signal transduction pathway. Biocontrol activity of P. fluorescens isolate Pf1 against M. incognita in tomato is associated with enhanced PR-protein activity, the involvement of enzymes in the phenylpropanoid pathway and with an accumulation of phenolics (Anita et al., 2004). Schafer (2007) demonstrated that the gene coding for the phenylalanine ammonia-lyase enzyme (PAL5) was upregulated Bacillus sphaericus B43- mediated ISR against M. incognita in tomato.

Arbuscular mycorrhizal fungi (AMF) are well known PGPF that can successfully control PPN. In addition to direct competition or inhibition, altered plant growth and altered rhizosphere interactions, AMF can also trigger biochemical changes associated with plant defense mechanisms and induced resistance in controlling plant parasitic nematodes (Elsen et al., 2008; Vos et al., 2012; Hao et al., 2012). Elsen et al. (2008) first demonstrated that the AMF Glomus intraradices has the ability to induce systemic resistance in banana plants towards Radopholus similis and Pratylenchus coffeae using a split-root compartmental set-up. 29

Chapter 1 General introduction

SAR against PPN with different chemicals has been studied in many plant-nematode interactions. Fujimoto et al. (2011) investigated the effect on RKN, M. incognita infection and gene expression in tomato after foliar application with methyl jasmonate (MeJA). They found that foliar treatment with MeJA significantly reduced RKN infection and the expression level of proteinase inhibitors and multicystatin may be effective as marker genes for estimating the induced resistance response against RKN. Foliar application with BTH, MeJA and ET are also effective against M. graminicola and H. oryza in rice (Nahar et al., 2011; Nahar et al., 2012). Molinari et al. (2014) tested SA and its synthetic functional analogues BTH and INA in tomato, eggplant and pepper against M. incognita and found that soil drench with SA and INA and root dipping with SA and BTH can inhibit nematode reproduction and reduce root galling.

Priming of rice with β-aminobutyric acid (BABA) treatment inhibited M. graminicola penetration, and delayed nematode and giant cell development. It has been demonstrated that BABA-induced resistance against this RKN likely occurs independently of JA and ET, mainly through the activation of basal defense mechanisms of the plant, such as reactive oxygen species accumulation, lignin formation, and callose deposition (Ji et al., 2015a). Huang et al. (2015a) demonstrated that the priming effect of biochar amendments (Biochar is a product of biomass pyrolysis) in rice (Oryza sativa cv. Nipponbare) against M. graminicola partially depends on the ET signaling pathway and enhanced H2O2 accumulation. Same authors also showed that priming effect of thiamine (Vitamin

B1, VB1) against M. graminicola in rice involves H2O2 and phenylpropanoid-mediated lignin production (Huang et al., 2015b).

Light quality can also modify the resistance of tomato plants to M. incognita. The exposure of tomato shoots to red light at night (20 µmol m−2 s−1) induces systemic resistance against RKN in the roots and this effect is partly dependent on the JA and SA defence pathways (Yang et al., 2014). Both positive and negative photo-orientation of the nematodes have been measured in vitro (Burr et al., 1989; Burr et al., 2000; Riga, 2004). However, information regarding the mechanism of photo-orientation in nematodes is limited. Generally, root plant parasitic nematodes remain in the soil and inside the root tissues. So the light induced plant resistance towards these nematodes is most likely caused by a priming effect.

Chapter 1 General introduction

1.5 Mechanisms of resistance against plant parasitic nematodes

In nematology, resistance is defined as the ability of a host to block or reduce nematode reproduction (Cook & Evan, 1987; Trudgill, 1991). Resistant plants can interfere at several levels of the nematode infection cycle such as, root attraction, penetration or invasion, migration, feeding site establishment (in case of sedentary nematodes), development and reproduction of nematodes. Resistance occuring before nematodes enter into the root or shoot tissues is referred to as pre- infectional resistance. If the resistance occurs after the nematodes penetrate or invade the root or shoot surface it is termed post-infectional resistance (Cook & Evans, 1987). Investigation of resistance mechanisms in many incompatible plant-nematode interactions indicates that both types of resistance (pre and post infectional) occur depending on specific plant-nematode interactions.

Recognition of and attraction to host plants are important steps that precede infection to the host. In case of root parasitic nematodes, host recognition involves signals from the root that can stimulate egg hatch and attraction toward the roots (Perry, 1997). It is generally accepted that nematodes get oriented to the roots over gradients of chemicals such as CO2 (Perry, 1997; Prot, 1980), root exudates (Green, 1971), pH, electrical potentials (Bird, 1959). Auxin-oriented migration and multiplication has been reported in case of rice foliar nematode Aphelenchoides besseyi (Feng et al., 2014). However, to the best of our knowledge, there is no report about attraction of D. angustus towards the plant shoot.

Cabasan et al. (2012) found that resistant rice genotypes expressed a mechanism of pre-infectional resistance to M. graminicola infection. J2 penetration was significantly lower in the resistant rice genotypes compared with the susceptible rice genotypes. This type of pre-infectional mechanism was also observed in other incompatible host-nematode interactions (Bendezu & Starr, 2003; Das et al., 2008; Moon et al., 2010). Differences in root morphology or biochemical defence compounds could contribute to this type of resistance (Huang, 1985; Diomande, 1984; Valette et al., 1998).

Attraction, penetration, motility, and reproduction of Pratylenchus thornei in wheat was studied by Linsell et al. (2014). They observed no significant difference in the rate of attraction toward or penetration of P. thornei in resistant or susceptible roots. However, the nematode migration, juvenile maturation and reproduction was significantly lower in and near resistant roots suggesting

Chapter 1 General introduction that resistance acts post-infectional. Other studies have also reported suppression of migration, development and reproduction in resistant plants associated with accumulation of phytoalexins such as the isoflavonoid glyceolin (Huang & Barker, 1986; Kaplan et al., 1980). Differences in invasion and reproduction of D. angustus between rice cultivars have been reported by Plowright et al. (1996).

1.6 Plant hormone signaling in defence

Plant hormones are a group of structurally unrelated small molecules that act at low concentrations to regulate many aspects of plant growth, development and defence. In this section, we report on current knowledge on the role of the classical defence hormones salicylate (SA), jasmonate (JA), and ethylene (ET) in plant-pathogen interactions. At the end of this section, we provide an overview of their role in rice-nematode interactions. Studies with mutants and transgenic plants affected in biosynthesis, perception and signal transduction of these hormones have been helpful to understand the role of each component of hormone signaling pathways in plant defence. A number of excellent recent reviews describes the hormone signaling pathways in rice (De Vleesschauwer et al., 2013, 2014; Sharma et al., 2013; Yang et al., 2013).

1.6.1 Salicylate signaling pathway

The possible role of SA in defence signaling disease resistance was first demonstrated by White and his co-workers who showed increased PR proteins accumulation and enhanced resistance to tobacco mosaic virus (TMV) upon injection of tobacco leaves with SA or aspirin (Raskin, 1992; Klessig & Malamy, 1994). In plants, SA can be synthesized via two distinct enzymatic pathways: the phenylpropanoid pathway and the isochorismate pathway. Both pathways require the primary metabolite chorismate. In the phenylpropanoid pathway, chorismate-derived L-phenylalanine is converted into SA via a series of reactions intially catalyzed by phenylalanine ammonia lyase (PAL, Lee et al., 1995). In the isochorismate pathway, chorismate is converted to SA via isochorismate catalysed by isochorismate synthase (ICS) and isochorismate pyruvate lyase (IPL) (Wildermuth et al., 2001; Verberne et al., 2000).

The defence signaling pathway mediated by SA plays an essential role in SAR. NPR1 (NONEXPRESSOR OF PATHOGENESIS-RELATED GENES1) is the central positive regulator

Chapter 1 General introduction of SAR in Arabidopsis. Among NPR1-like genes in rice, OsNH1 is the closest homolog sharing 60% similarity with Arabidopsis NPR1 (Chern et al., 2005; Yuan et al., 2007). WRKY family of TFs has been suggested to play an important role through the W-box motif in their promoter regions (Rushton et al., 1996; Eulgem et al., 1999; Maleck et al., 2000). In Arabidopsis, more than 99% of BTH response genes are regulated by NPR1 and several WRKY TFs are regulated downstream of NPR1.

Rice has a large WRKY transcription family where OsWRKY45 is the key regulator of BTH- induced and SA-mediated defence responses, conferring broad spectrum resistance to rice (Shimono et al., 2007; 2012; Takatsuji et al., 2010). OsWRKY45 is also involved in the regulation of diterpenoid phytoalexin production in the SA/cytokinin signaling pathway as well as BTH mediated priming in rice leaves (Akagi et al., 2014). In rice OsWRKY45 is independent of OsNPR1 and it has been proven that the SA signaling pathway in rice branches into two subpathways: OsNPR1- and OsWRKY45- dependent pathway (Shimono et al., 2007).

After pathogen infection, accumulation of SA and its conjugates induces multiple PR proteins and the onset of local and systemic acquired resistance (SAR) in the plant (Durrant & Dong 2004). Transgenic plants expressing the bacterial salicylate hydroxylase gene (NahG) that prevents SA accumulation by degrading SA to catechol (Gaffney et al., 1993; Delaney et al., 1994) or plants defective in SA biosynthesis (with suppressed PAL expression or mutations in SID2/EDS16 that encode ICS) failed to develop SAR or PR gene expression and showed enhanced pathogen susceptibility (Pallas et al., 1996; Nawarth et al., 2002). On the other hand, application of SA or its synthetic functional analog BTH activates PR-gene expression and enhances resistance to pathogens. A significant reduction in mature females and egg deposition of root-knot nematodes was observed after foliar application of BTH on grapevine (Owen et al., 2002). Resistant tomato plants carrying the Mi-1 gene partially lost the resistance against root knot nematodes (Branch et al., 2004) and aphids (Li et al., 2006) when also expressing the NahG gene and the resistance was restored when BTH was supplied to the tomato plant (Branch et al., 2004). A. thaliana mutants perturbed in SA biosynthesis or signal transduction were more susceptible whereas SA-treated wild type plants showed decreased susceptibility towards H. schachtii infection (Wubben et al., 2008).

Rice seedlings accumulate high levels of free endogenous SA (up to 37 µg g-1 fresh weight) compared to healthy tobacco or Arabidopsis (< 0.1 µg g-1 fresh weight) (Silverman et al., 1995;

Chapter 1 General introduction

Chen et al., 1997). Despite such high endogenous SA levels, application of more SA or BTH to rice plants induces PR-gene expression, activates local and systemic acquired resistance and enhances resistance to pathogens. In addition, it is shown that endogenous SA plays an essential role to modulate redox potential and protect rice plants from oxidative damage caused by aging as well as biotic and abiotic stress (Yang et al., 2004). It was observed that the response against M. grisea after SA application on rice was plant age dependent; the adult rice plants showed resistance to M. grisea but not the young plants (Iwai et al., 2007).

1.6.2 Jasmonate signaling pathway

JA and its metabolites, collectively called jasmonates, play a key role in plant defence responses to pathogen infection and insect herbivory (Pieterse et al., 2012; Farmer et al., 2003; Blee, 2002). Jasmonates, lipid-derived signal molecules are initially generated in the chloroplast involving the conversion of the LOX product to the unstable allene oxide 12, 13 (S)-epoxy octadecatrienoic acid by Allene oxide synthase (AOS). This unstable epoxide is then converted by allene oxide cyclase (AOC) to the cyclopentenone ring-containing 12-oxo-phytodienoic acid (OPDA). OPDA then translocates into peroxisomes, where JA is synthesized from OPDA through reduction by 12-oxo- phytodienoic acid reductase (OPR) and three steps of β-oxidation. Jasmonic acid carboxyl methyltransferase (JMT) converts JA to methyl jasmonate (MeJA). In JA signaling, WRKY TFs and jasmonoyl-L-isoleucine (JA-Ile) play important roles in modulating plant defence against pathogen attack (Schluttenhofer et al., 2014). In the rice genome there are more than 100 WRKY genes identified; many genes of them associated with plant defence (Pandey & Somssich, 2009; Tao et al., 2009). In rice, the expression of OsJAR1 (encoding JA-I1e synthase) after blast attack indicates its involvement in pathogen defence (Wakuta et al., 2011)

Studies with transgenic rice lines overexpressing JA biosynthesis and response genes revealed that JA plays a significant role in defence gene activation against fungi and bacteria (Mei et al., 2006; Agrawal et al., 2003; Deng et al., 2012). Riemann et al. (2013) found that the JA deficient mutants cpm2 and hebiba were more susceptible against Magnaporthe oryza. JA also plays an important role in regulating the biosynthesis of different secondary metabolites for instance, terpenes, terpene indole alkaloids, flavonoids, and phenylpropanoids (Wasternack & Hause, 2013). In rice, flavonoid and diterpenoid phytoalexins (such as momilactones, sakuranetin) have been found (Miyamoto et

Chapter 1 General introduction al., 2014) and some of these are induced in rice leaves after pathogen infections (Wakuta et al., 2011; Riemann et al., 2013; Shimizu et al., 2013).

JA biosynthesis and signaling pathways are important in plant defence against plant parasitic nematodes infection. Arabidopsis infected with H. schachtii showed significant upregulation of JA biosynthesis genes in early parasitism which was paralleled by increased endogenous JA concentrations (Kammerhofer et al., 2015). Later stages of H. schachtii infection showed no changes in JA gene expression (Hamamouch et al., 2011). Kammerhofer et al. (2015) confirmed the importance of the JA biosynthesis pathway by showing that JA biosynthesis mutants, dde and lox6 are more susceptible to H. schachtii compared to wild type. However, both the JA biosynthesis and signaling pathways were supressed during syncytium formation and nematode development in the compatible interaction of H. glycines and soybean at 5 and 10 dpi (Ithal et al., 2007). On the other hand, root knot nematode susceptibility of tomato depends on intact JA signaling pathway through COI1, not on JA biosynthesis (Bhattarai et al., 2008). It has been shown that exogenous MeJA application enhanced resistance against different nematode species in oat, spinach, and tomato plant probably by uplifting the level of different compounds for instance phytoectosteroids, flavonoids, proteinase inhibitors (Thurau et al., 2003; Soriano et al., 2004; Cooper et al., 2005).

1.6.3 Ethylene signaling pathway

ET is a gaseous phytohormone that plays important roles in plant’s growth and development as well as biotic and abiotic stress responses of plants (Morgan & Drew, 1997; van Loon et al., 2006). ET is generated from S-adenosyl L-methionine. At first S-adenosyl L-methionine is converted to ACC (S-adenosyl-L-methionine methylthioadenosine-lyase) by the enzyme ACC synthase (ACS) and then ACC is oxidized by ACC oxidase (ACO) to form ethylene, CO2 and cyanide (Adams & Yang, 1979). In rice, six putative OsACS and seven putative OsACO and their respective genes were reported (Iwai et al., 2006; Rzewuski & Sauter, 2008). In the ET signaling pathway, EIN2 (ETHYLENE INSENSITIVE2) is the key signaling component which is cleaved off (the C- terminal part of EIN2) after activation and moves to the nucleus to mediate the ET signaling through the key transcription factor EIN3 (ETHYLENE INSENSITIVE3) and EIL1 (EIN3 LIKE1). EIN3 and EIL1 activate expression of ERF1 (ETHYLENE RESPONSE FACTOR1) (Merchante et al., 2013; Solano et al., 1998; Zander et al., 2012). The rice homologs of other genes

Chapter 1 General introduction in ET signaling have been isolated, characterized and reviewed (Watanabe et al., 2004; Yau et al., 2004; Mao et al., 2006; Nakano et al., 2006).

ET plays a prominent role in mediating rice disease resistance against rice blast (M. oryzae) and sheath blight disease (R. solani). Transgenic rice lines overexpressing OsACS2 showed increased ET levels and defence gene expression upon pathogen infection compared to wild type plants (Helliwell et al., 2013). Iwai et al. (2006) also showed the importance of ET and the coproduct, cyanide for hypersensitive reaction (HR) accompanying resistance to blast (M. grisea) in young rice plants. On the other hand, application of aminooxyacetic acid, an ACS inhibitor, resulted in expanding lesions instead of HR lesions (Iwai et al., 2006). However, the importance of ET biosynthesis and signaling pathways in disease resistance are sometimes controversial. For example, ET application on soybean roots increased their attractivity towards the soybean cyst nematode (SCN), while ET inhibitors reduced penetration (Tucker et al., 2010). Arabidopsis mutants overproducing ET (eto1, eto2 and eto3) showed hyper-susceptibility to H. schachtii (Wubben et al., 2001). In contrast, the ET biosynthesis and signaling pathways positively contribute to RKN (M. hapla) resistance in tomato, and elevated levels of ethylene were shown to be correlated with decreased host attraction by RKN (Fudali et al., 2013). Such differences in the role of ET biosynthesis and signaling pathways in plant defence could be due to differences in the specific plant-pathogen interactions (Glazebrook, 2005; Pieterse et al., 2012).

1.6.4 Cross talk between hormones

Defence signaling pathways interact with each other in regulating defence responses against pathogens. Cross talk between hormone signaling pathways are important for effective systemic immunity.

Cross-talk between SA and other hormone pathways

In general, SA is associated with plant defence against biotrophic and hemibiotrophic pathogens and JA and ET play important role in defence against necrotrophic pathogens and insect herbivory (Glazebrook, 2005). Arabidopsis plants infected with biotrophic Pseudomonas syringae show an activated SA pathway and suppressed JA signaling, rendering the plants more susceptible to the necrotrophic pathogen Alternaria brassicicola (Spoel et al., 2009). This cross-communication is

Chapter 1 General introduction mediated through a novel function of NPR1 in the cytosol. Spoel et al. (2003) showed that treatment of 35S:NPR1-HBD (the mutant npr1 plants engineered to constitutively express a fusion protein of NPR1 and the hormone binding domain of the rat glucocorticoid receptor) with both SA and MeJA, suppressed the MeJA-induced expression of PDF1.2, not only in the presence of DEX (steroid hormone dexamethasone that allow the NPR1-HBD fusion protein to translocate into the nucleus) but also in its absence, when NPR1 was retained in the cytosol indicating that nuclear localization of NPR1 is not required to suppress the MeJA induced expression of PDF1.2 by SA. The antagonistic interaction between SA and JA has also been observed in rice and OsNH1, the closest rice homolog of NPR1 also represses JA signaling pathway (Yuan et al., 2007). Rice defence mediated by OsWRKY13 activates the SA-dependent signaling pathway and suppresses the JA-dependent signaling pathway against bacterial blight and fungal blast (Qiu et al., 2007).

Although the interaction between SA- and JA-dependent signaling is mostly antagonistic, synergistic interactions have been described as well (Schenk et al., 2000; Kunkel & Brooks, 2002; Beckers & Spoel, 2006; Mur et al., 2006). Rice microarray analysis showed that a common defence system is activated by both JA and SA. More than half of all the BTH-induced genes are upregulated by JA application proposing that a major portion of the SA-upregulated genes are regulated by JA-dependent signaling in rice (Tamaoki et al., 2013).

Many studies have demonstrated that SA and ET interact negatively in relation to defence (O’Donnell et al., 2001; Shen et al., 2011) however also synergistic interactions have been reported. In tobacco plants, ET is essential for SA-dependent SAR that is triggered upon infection by tobacco mosaic virus (Verberne et al., 2003). ET enhances the expression of the the SA- responsive marker gene PR-1 in Arabidopsis through EIN2 dependent ET signaling (De Vos et al., 2006). Glazebrook et al. (2003) showed that the ein2 mutation affects the expression of many SA- responsive genes in Arabidopsis. Moreover, it has been demonstrated that ET shapes the final outcome of the SA-JA signal interaction (Leon-Reyes et al., 2009). Synergistic interactions among SA, JA and ET have been reported in several plant species in response to RKN (Fujimoto et al., 2011; Fudali et al., 2013).

With few exceptions, abscisic acid (ABA) interacts negatively with SA dependent defence. ABA induces susceptibility in Arabidopsis to an avirulent strain of P. syringae pv. tomato via suppression of the accumulation of components crucial for a resistance response. Microarray

Chapter 1 General introduction analysis in Arabidopsis revealed that ABA treatment suppressed many defence-related genes, including those important for the biosynthesis of phenylpropanoids, such as lignin and salicylic acid (Mohr & Cahill, 2007). In rice, ABA suppresses the SA-mediated defence and renders the plants more susceptible to Magnaporthe oryzae (Jiang et al., 2010) and Xanthomonas oryzae pv. oryzae (Xu et al., 2013). It has been reported that auxin promotes disease symptoms caused by P. syringae pv. tomato strain DC3000 in Arabidopsis (Chen et al., 2007). Wang et al. (2007) demonstrated that SA represses auxin-related genes, including the TIR1 receptor gene to promote resistance. In rice, brassinosteroids antagonize gibberellin- and salicylate-mediated root immunity against Pythium graminicola (De Vleesschauwer et al., 2012).

Cross-talk between JA and other hormone pathways

Generally JA and ET act synergistically against necrotrophic pathogens and herbivorous insects (Glazebrook, 2005; Howe & Jander, 2008). But there is also evidence of synergistic interactions between JA and ET against biotrophic pathogens (Nahar et al., 2011). In Arabidopsis, regulation of the plant defensin gene PDF1.2 requires concomitant activation of the JA and ET response pathways (Leon-Reyes et al., 2009). Two transcription factors, ERF1 and ORA59 are also induced and expressed synergistically by these two hormones (Lorenzo et al., 2003; Pre et al., 2008). However, an antagonistic interaction between JA and ET may also occur. Knocking-out OsEDR1 in rice resulted in reduced expression levels of the ACC synthase gene family and decreased production of ET. However, the rice plants showed activated JA- and SA-associated pathways and enhanced resistance to bacteria Xanthomonas oryzae pv. oryzae. This phenomenon suggest that OsEDR1 regulates the antagonistic interaction between the JA or SA pathway and the ET pathway (Shen et al., 2011).

A complex interplay between JA and ABA signaling pathways to regulate plant defence gene expression in Arabidopsis has been reported. Adie et al. (2007) showed that treatment with ABA induced JA accumulation, indicating synergism. In contrast, disruption of a positive regulator of ABA signaling AtMYC2, increased transcription of JA-responsive defense genes in Arabidopsis which suggest an antagonism between JA and ABA signaling pathways (Anderson et al., 2004). The cross talk between JA and auxin has been well studied in Arabidopsis. It has been reported that auxin downregulates the genes involved in JA biosynthesis (Liu & Wang, 2006; Rojo et al, 1998). In contrast, positive interaction between JA and auxin was also demonstrated (Grunewald 38

Chapter 1 General introduction et al., 2009). Also gibberellins can play a role in plant defence (Navarro et al., 2008; Beneventi et al., 2013). The GA-responsive DELLA proteins promote susceptibility to biotrophic pathogens and resistance to necrotrophic pathogens by modulating the relative strength of the SA and JA signaling pathways (Navarro et al., 2008).

Cross-talk between ET and ABA

ET not only interacts with SA and JA that are mentioned above, but also with other hormone signaling pathways. For example, ET and ABA function antagonistically during rice defence responses. Bailey et al. (2009) observed that exogenous ABA application reduced ET generation in rice resulting in blast disease susceptibility. On the other hand, exogenous ABA enhances resistance against the brown spot pathogen Cochliobolus miyabeanus in rice through antagonistically cross-talking with the ET pathway in an OsMPK5-dependent manner (De Vleesschauwer et al., 2010). RNAi suppression of the ABA-inducible OsMPK5 gene resulted in increased levels of ET, constitutive expression of PR genes and enhanced disease resistance (Xiong & Yang, 2003; Bailey et al., 2009).

1.6.5 Role of hormones in rice-nematode interactions

The hormone signaling network involved in plant defence against nematodes has been studied mostly on dicotyledonous plants against fungal and bacterial pathogens, but there are limited studies on hormone-regulated processes in the interaction between monocots and nematodes. However, progress has been made in recent years concerning the role of hormone signaling pathways in rice-nematode interactions.

The role of the three classical hormones SA, JA and ET was investigated in rice defence against RKN, M. graminicola and migratory root nematode Hirschmanniella oryzae infection by Nahar et al. (2011) and Nahar et al. (2012). They found that exogenous hormone application in the rice shoot activated the SA, JA or ET pathway in the root resulting in lower susceptibility of rice against these nematodes. JA biosynthesis is of major importance against RKN, whereas an intact SA, JA and ET pathway is a prerequisite for defence against H. oryzae. The SA, JA and ET biosynthesis and signaling pathways also play important roles in resistant responses of rice. Kumari et al. (2016) reported that the RKN resistant variety Vandana significantly upregulated the SA biosynthesis

Chapter 1 General introduction genes, JA and ET pathway genes at early (2 days post inoculation) and later (6 days post inoculation) stages of nematode infection whereas in susceptible variety Pusa 1121, these genes are suppressed at later stage (6 dpi) of nematode infection.

Other hormones, such as ABA, gibberellins (GA), auxin, cytokinins (CKs) and brassinosteroids (BRs) also play important roles in regulation of the immune signaling network in rice against nematodes often through crosstalk with the SA, JA/ET pathways. ABA plays a negative role in rice defence against the migratory root nematode, H. oryzae by antagonizing JA biosynthesis and signaling (Nahar et al., 2012). BRs interact negatively with JA in rice roots against RKN (Nahar et al., 2013). MeJA application on the shoots of rice plants activates JA-dependent rice innate immunity and strongly supresses the BR pathway in the root. Moreover, the involvement of auxin, GA, BR in feeding site formation caused by RKN has been documented (Kyndt et al., 2012; Ji et al., 2013). The positive and negative role of different hormones and their interaction in rice defence against the RKN and the migratory nematode is represented in fig 1.13 (Kyndt et al., 2014).

In addition, there is also evidence that plant pathogens can produce phytohormones or their functional mimics to manipulate hormone biosynthesis and signaling resulting in hormonal imbalances and alterations in plant defence. PPN secrete so-called effectors into their host plant in order to facilitate infection. Increasing evidence indicates that effectors are able to suppress the plant defence responses through deregulation of hormone biosynthesis (Hewezi & Baum, 2013;

Kikuchi et al., 2014; Bauters et al., 2014; Haegeman et al., 2013).

However, the role of phytohormones has only been investigated so far for defence against rice root nematodes, but almost no research has been conducted on their role in defence against rice foliar nematodes, like D. angustus.

Chapter 1 General introduction

Fig 1.13 Model showing the interactions between hormones in the root system and their effect in defence against the root-knot nematode Meloidogyne graminicola and the migratory nematode Hirschmanniella oryzae in rice. Red lines indicate nematodes interfering with the hormonal defense network to achieve root susceptibility. Perpendicular lines indicate antagonism, and arrows indicate activation. From Kyndt et al. (2014). Abbreviations: ABA, abscisic acid; BR, brassinosteroid; ET, ethylene; JA, jasmonic acid; SA, salicylic acid.

1.7 Pathogenesis-related (PR) proteins

PR proteins can be defined as proteins induced in plants under pathological or related conditions. PR proteins were first discovered in the early 1970s in tobacco leaves that showed a hypersensitive reaction to tobacco mosaic virus. Like other plant species, the structure, function and evolutionary relationships of a number of PR gene families have been studied in rice (Mitsuhara et al., 2008; Nakazaki et al., 2006; van Loon et al., 2006). In rice, PR genes are induced in various tissues by diverse biotic stresses (Zhao et al., 2008; Mitsuhara et al., 2008; Wu et al., 2011), environmental stresses (drought, cold stress, salt, wounding; Kim et al., 2008; Hashimoto et al., 2004), and chemical treatments (jasmonic acid, salicylic acid, ethylene, H202) (Kim et al., 2008; Nakashita et al., 2001). Some PR proteins have been found in different parts of healthy tissues induced by internal plant development stimuli and thus play a role in rice growth and development (Mitsuhara et al., 2008; Nakazaki et al., 2006; van Loon et al., 2006). PR proteins are very stable at low pH and relatively resistant to the action of proteolytic enzymes. They are monomers with low molecular mass and they are localized in different compartments such as the vacuole, the cell wall and/or the apoplast. Basic PR proteins are mostly located in the vacuole and most acidic PR proteins are found in the intercellular space (Van Loon et al., 2006).

Chapter 1 General introduction

Plants induce distinct sets of PR proteins in response to different pathogens. In Arabidopsis thaliana, SA induces the expression of PR1, PR2, and PR5 in response to biotrophic pathogen, whereas JA induces PR3, PR4 and PR12 in the defence reaction against necrotrophic pathogens (Thomma et al., 1998). Many reports have demonstrated that PR proteins play important roles in resistance responses. Susceptible tomato plants infected with Meloidogyne incognita downregulate the PR genes in both roots and shoots whereas resistant tomato infected plants induced higher levels of PR-1 gene expression in shoots (Molinari et al., 2014). Overexpression of PR5 in rice reduced infection of rice caused by Rhizoctonia solani (Grover & Growthaman, 2003). Wu et al. (2011) observed higher levels of OsPR1A, OsPR1B, and OsPR10A proteins in Xa21-mediated resistance response in rice to Xanthomonas oryzae pv. oryzae (Xoo). There is also evidence that the abundance of some PR proteins is greater in susceptible interactions compared to resistant reactions and different PR proteins have different functions in susceptible and resistant interactions (Hou et al., 2012). Ji et al. (2015b) showed the important role of rice thionin genes (PR13 family, also known as thionins, a group of antimicrobial peptides) in rice defence against two damaging root pathogens of rice, M. graminicola and Pythium graminicola. They found that transgenic lines of Oryza sativa cv. Nipponbare overproducing OsTHI7 decreased susceptibility to M. graminicola infection and Pythium graminicola colonization.

1.8 Secondary metabolites

Secondary metabolites are organic compounds that play an important role in defence against herbivores, pests and pathogens (Wink, 2003; Verpoorte, 2000). More than 100000 diverse secondary metabolites are produced by plants (Dixon, 2001). Based on their biosynthetic origins, secondary metabolites can be divided into three major groups: the terpenoids, the alkaloids, and the phenylpropanoids and allied phenolic compounds.

Elicitors such as, chitosan (CHT), salicylic acid (SA), methyl salicylate (MeSA) and methyl jasmonate (MeJA) trigger induction of defence response in plants by altering phenolic compounds of the plant. For instance, these elicitors increased total phenolic content of eggplant roots. The lignin deposition in the cell wall and PAL activity were significantly higher in eggplant roots after elicitation and this increased resistance against Ralstonia solanacearum (Mondal, 2010). Ji et al.

Chapter 1 General introduction

(2015a) observed that BABA induces PAL gene expression and lignin deposition in the gall produced by RKN, M. graminicola in rice.

Secondary metabolites play important roles in plant defence against PPN. Sclareol, a natural diterpene increased resistance in tomato and Arabidopsis roots against RKN by inhibiting root penetration. Sclareol induced phenylpropanoid metabolism and ET biosynthesis and signaling genes by activating MPK3 and MPK6, mitogen activated protein kinase, ET dependent lignin accumulation in Arabidopsis roots (Fujimoto et al., 2015). The elevated level of phenolics and lignin deposition has been found to be important in tomato resistance to the root-knot nematode M. incognita (Paulson & Webster, 1972; Melillo et al., 1989). Phytoalexin medicarpin play a role in resistance of alfalfa (Medicago sativa) to the root-lesion nematode, P. penetrans (Baldridge et al., 1998).

Phenolics play an essential role for nematode resistance in Musa spp. towards the burrowing nematode Radopholus similis infection. Tannins, flavan-3, 4-diols and anigorufone phenylphenalenone-type phytoalexins (Collingborn et al., 2000; Holscher et al., 2014) were detected in the resistant Musa cultivars. In addition, extensive secondary cell wall lignification of vascular bundles was observed in R. similis-infected plants compared to non-infected plants (Dhakshinamoorthy et al., 2014). Plowright et al. (1996) observed an increased production of phenolic compounds such as, chlorogenic acid and the rice phytoalexin sakuranetin in the ufra resistant cultivar Rayada 16-06 at 5 days after D. angustus infection.

1.9 Biocontrol activity of Bacillus species

Bacillus species are widely used for biological control of many plant diseases in different hosts including B. amyloliquefaciens, B. subtilis, B. pasteurii, B. cereus, B. pumilus, B. mycoides, and B. sphaericus (Kloepper et al., 2004; McSpadeen Gardener, 2004). Several Bacillus species have been developed as commercial bio-pesticides, because Bacillus species can produce endospores and persist successfully in natural environments for a long period after treatment (Hu et al., 2011). Several Bacillus spp. have been used in rice cultivation for the promotion of plant growth and control of rice insects (Kandibane et al., 2010) and diseases (Jetiyanon & Plianbangchang, 2010; Maketon 2004). New species are continually being described and evaluated to control different plant pathogens (Nascimento et al., 2016; Bach et al., 2016; Zhou et al., 2016).

Chapter 1 General introduction

Rice plants treated with B. amyloliquefaciens FZB42 suspensions showed significant improvement in resistance to bacterial leaf blight caused by Xanthomonas oryzae pv. oryzae and bacterial leaf streak caused by X. oryzae pv. oryzicola over untreated plants by producing the antibiotic compounds difficidin and bacilysin (Wu et al., 2015). Wu et al. (2015) observed that difficidin and bacilysin caused downregulated expression of genes involved in Xanthomonas virulence, cell division, and protein and cell wall synthesis. Elshakh et al. (2016) investigated the in vitro and in vivo bactericidal mode of action of Bacillus strains including B. subtilis A15, B. amyloliquefaciens D29 and B. methylotrophicus H8 against bacterial leaf blight caused by X. oryzae pv. oryzae. They found that the antibacterial mechanisms of the three strains may be at least partly associated with the ability to secrete lipopeptides (bacillomycin, fengycin, iturin and surfactin). Controlling the bacterial blight disease in greenhouse conditions was achieved through through activation of inducing systemic resistance mechanisms (Elshakh et al., 2016). A novel endophytic strain, B. oryzicola YC7007 has been reported to suppress bacterial blight of rice caused by Xanthomonas oryzae pv. oryzae, panicle blight caused by Burkholderia glumae via induced systemic resistance and antibiotic production (Chung et al., 2015). This strain can also control bakanae disease of rice, caused by Fusarium fujikuroi (Hossain et al., 2016) by direct inhibition, and was also capable of inducing systemic resistance against the pathogen through primed induction of the jasmonic acid pathway (Hossain et al., 2016). Chandler et al. (2015) showed that soil application of B. subtilis BBG111 trigger induced systemic resistance in rice against rice sheath blight caused by Rhizoctonia solani. They also revealed that B. subtilis BBG111 cyclic lipopeptides, fengycin and surfactin target the JA, ET and/or auxin pathways indicating the role of fengycin and surfactin, in the induced defence state.

Numerous Bacillus strains can also supress plant parasitic nematode infection. In addition to direct antagonism by Bacillus spp. towards plant parasitic nematode species (Kloepper et al., 1992, Siddiqui & Mahmood, 1999; Li et al., 2005), Bacillus spp. also induce systemic resistance to suppress the nematode population in different crop species (Hasky-Gunther & Sikora, 1995; Schafer et al. 2006; Hauschild et al. 2000; Almaghrabi et al., 2013). Treatment of tomato plants with an isolate of B. thuringiensis, designated CR‐371 resulted in a significant reduction in galls caused by the root‐knot nematode, M. incognita in both greenhouse and field trials. The same strain also reduced the Pratylenchus penetrans population in the root of strawberry plants under greenhouse conditions (Zuckerman et al., 1993). Li et al. (2007) and Li et al. (2008) identified

Chapter 1 General introduction nematicidal cry genes such as cry5B and cry6A from B. thuringiensis and integrated them by genetic modification into crops to control Meloidogyne spp. B. firmus is an important nematophagous bacterium that effectively controls several different plant parasitic nematodes (Mendoza et al., 2008; Mendoza & Sikora, 2009; Schrimsher et al., 2011; Terefe et al., 2009; Xiong et al., 2015). A B. firmus strain isolated from soil in Israel has been developed as biological nematicidal agent by the Agro-Green Company and registered under the trade name of BioNem- WP in Israel. A peptidase S8 superfamily protein called Sep1 was identified in B. firmus strain DS- 1 that had toxicity against the nematodes Caenorhabditis elegans and M. incognita. The Sep1 protein degrade multiple cuticle-associated proteins and destroys host physical barriers due to its serine protease activity (Geng et al., 2016). Treatment of tomato seeds with B. subtilis isolates Sb4-23, Mc5-Re2, and Mc2-Re2 significantly reduced the numbers of galls and egg masses produced by M. incognita on tomato compared with the untreated control by induced systemic resistance (Adam et al., 2014). B. amyloliquefaciens FZB42 has been shown to reduce the numbers of galls and egg masses in tomato caused by M. incognita (Burkett-Cadena et al., 2008). Soil drenches or seed treatments of tomato with the B. methylotrophicus strain R2-2 can suppress disease caused by root-knot nematode M. incognita in plate, greenhouse and field conditions (Zhou et al., 2016). Although ISR in plants against plant parasitic nematodes mediated by different Bacillus spp. has been documented, no studies thus far have evaluated ISR in rice against the rice foliar nematode D. angustus.

Even though a great amount of research focused on species of the genus, the taxonomic organization of the group remains disordered and often confusing. Accurate taxonomic information is necessary because it enables scientists to understand the biodiversity and relationships among living organisms from different ecosystems (Gevers et al., 2005). To better understand the phylogenetics of a number of Bacillus species, recently Dunlap et al. (2016) showed that there are minor differences between the strains B. oryzicola KACC 18228, B. velezensis NRRL B-41580, B. methylotrophicus KACC 13015 and B. amyloliquefaciens subsp plantarum FZB42 through morphological, physiological, chemotaxonomic and comparative genome analysis. The pairwise in silico DNA-DNA hybridization values calculated in comparisons between the strains were all greater than 84%, which is well above the standard species threshold of 70%. Hence, Dunlap et al. (2016) propose that B. methylotrophicus KACC 13015, B. amyloliquefaciens subsp plantarum

Chapter 1 General introduction

FZB42, and B. oryzicola KACC 18228 should be reclassified as later heterotypic synonyms of B. velezensis NRRL B-41580.

2.0 Scope and outline of the thesis

Environmentally friendly approaches to control the nematode D. angustus are limited. Whether plant resistance and biological control are environmentally sound and economically viable for nematode control remains to be further studied for this nematode. Moreover, in contrast to root nematodes of rice, there is no knowledge concerning signaling pathways involved in rice defence against foliar nematodes, such as Ditylenchus angustus. Studies involving rice-D. angustus interactions will provide valuable information for the development of sustainable ufra management strategies.

In chapter 2, we evaluated the susceptibility of different rice genotypes (irrigated, rainfed, deep water and landraces) for the Bangladeshi population of D. angustus to identify resistant varieties. The experiment was initially conducted in plastic pots using artificial inoculation, in both rainfed and irrigated ecosystems, and the promising varieties were analysed further in field conditions. The rice varieties were first scored at two different time points: at 28 days post inoculation (dpi), based on the postinfectional reactions and at 55 dpi, based on the percentage of tiller infections. Out of the 87 varieties, one landrace named ‘Manikpukha’ was found to be highly resistant in both pot and field conditions.

Chapter 3 focuses on the resistance mechanism of rice cultivar Manikpukha to D. angustus. We investigated invasion, post-infectional development, and reproduction of D. angustus in the resistant rice genotype Manikpukha and in the susceptible rice genotypes BR26 and Nipponbare to identify the stage (s) at which resistance occurs.

In chapter 4, we examined the role of SA, JA, and ET in rice defence against D. angustus. Nematode infection experiments with rice lines that are mutants or transgenics deficient in SA, JA and ET biosynthesis or signaling pathways, exogenous hormone applications, biosynthesis inhibition were performed. A gene expression analysis was done to observe the expression pattern of some SA/JA/ET-marker genes between a compatible and incompatible rice-D. angustus interaction. Furthermore, level of SA, JA and lignin was measured in resistant versus susceptible cultivars.

Chapter 1 General introduction

Chapter 5 describes the potential of a rhizobacterium B. velezensis strain BSK, isolated from Bangladesh, in promoting plant growth of rice and inducing systemic resistance to D. angustus. We also studied the relative expression of some SA/JA/ET-marker genes involved in rice-D. angustus- bacteria interactions.

Finally, in chapter 6, we briefly recapitulate the results and discuss the applications of this work and future prospects.

Chapter 2. Identification of Bangladeshi rice varieties resistant to ufra disease caused by the nematode Ditylenchus angustus

This chapter is adapted from: Khanam, S., Akanda, A.M., Ali, A.M., Kyndt, T. and Gheysen, G (2016). Identification of Bangladeshi rice varieties resistant to ufra disease caused by the nematode Ditylenchus angustus. Crop Protection 79, 162–169.

Chapter 2 Susceptibility of rice genotypes to D. angustus

2.1 Abstract

The rice stem nematode Ditylenchus angustus causes “Ufra” disease in rice resulting in substantial yield losses. Although it is predominant in deep water rice in South and Southeast Asia, this nematode also infects irrigated and rainfed low land rice. This study evaluates the susceptibility of different rice genotypes (irrigated, rainfed, deep water and landraces) for the Bangladeshi population of D. angustus to identify resistant varieties. The experiment was executed using artificial inoculation, in both rainfed and irrigated ecosystems. The rice varieties were first scored at 28 days post inoculation (dpi), and ranked based on the postinfectional reactions and severity of symptoms on a 0-16 rating scale. The susceptibility of the varieties was also evaluated at a later time point, i.e. 55 dpi, based on the percentage of tiller infections, using a disease index scoring system ranging from 0 to 9. Both screening methods showed a similar ranking of the varieties for susceptibility/resistance against this nematode. The experiment was initially conducted in plastic pots, and the promising varieties were analysed further in field conditions. Out of the 87 varieties, one landrace named ‘Manikpukha’ proved to be highly resistant, while 6 other varieties showed resistance and 13 varieties showed moderately resistant responses under both pot and field conditions. The promising varieties found in the present investigation can be used in rice breeding programs as well as for further detailed studies to develop a sustainable ufra management strategy.

2.2. Introduction

Ufra disease caused by the rice stem nematode, Ditylenchus angustus (Butler, 1913), is known as one of the most devastating rice diseases in some South and South-East Asian countries (Bridge et al., 1990). Ufra disease was first reported by Butler (1913) in Bangladesh (former East Bengal). The disease mainly occurs in deep water rice (Butler, 1919). However together with the shrinkage of deep water rice cultivation and increased production of irrigated and rainfed rice, infections caused by D. angustus also appear in these conditions (Prasad et al., 2000; Latif et al., 2004).

All life stages of the nematode are infective although the J4 stage shows the highest infectivity (Plowright & Gill, 1994). The nematode enters the plant mainly at the collar region, migrates upward with the growth of the shoot and feeds on newly forming tissues in the rolled leaf sheath causing malformation. In the vegetative stage, white patches, or speckles in a splash pattern are

Chapter 2 Susceptibility of rice genotypes to D. angustus observed at the leaf base. Brownish stains may develop on leaves and leaf sheaths. Upon severe infection, the panicle heads and flag leaves become twisted and distorted. Yield loss studies in different countries have demonstrated the devastation caused by the nematode. For instance, in Bangladesh, 40 to 49% or sporadically 90% yield losses have been reported (Latif et al., 2011a; Latif et al., 2011b). Even a low infection percentage in transplanted seedlings can cause substantial yield losses (Bridge & Starr, 2007).

Reproduction is amphimictic and the nematode completes its life cycle within 10-20 days at 27- 30oC (Bridge & Starr, 2007). At rice harvest, the nematodes remain in a coiled, quiescent state, mainly in the dried glumes of the lower panicle spikelets (Latif et al., 2006). Although the presence of living nematodes in the grains has been reported (Prasad & Varaprasad, 2002), the chance of transmission by seed is very unlikely when the seeds are properly sun dried (Bridge & Starr, 2007). Survival of nematodes from one season to another takes place in crop residues, soil and alternative hosts like weeds (Cox & Rahman, 1979). Dissemination of nematodes from field to field is mainly through irrigation water (Rahman & Evans, 1987).

For nematode management, different practices like burning of stubble and straw, destruction of ratoons, wild rice, regulation of irrigation water (Sein & Zan, 1977), delayed sowing and transplanting (McGeachie & Rahman, 1983), use of organic amendments, and crop rotation (Chakraborti, 2000; Latif et al., 2006) are recommended. But implementation of these cultural and physical practices are constricted due to socioeconomic reasons. Highly persistent nematicides, principally carbofuran, are the main basis of nematode management in Bangladesh. However, negative effects of nematicides on the environment and non-target organisms (Haydock, 2006) underline the urgent need for alternative environment-friendly strategies.

Host plant resistance to D. angustus is a promising and sustainable option to limit yield losses caused by this nematode. A large number of rice genotypes, wild rice, and breeding lines have been screened for resistance against the nematode in different countries. Some sources of resistance were identified in previous studies (Miah & Bakr, 1977; Rahman, 1987; Latif et al., 2011a; Latif et al., 2011b), but there is no high-yielding ufra-resistant variety available. Currently, some high-yielding varieties released by the Bangladesh Rice Research Institute (BRRI) and different landraces are being cultivated in different part of Bangladesh. However, except for a few varieties, the information on the host response of most of these high yielding varieties and several Bangladesh

Chapter 2 Susceptibility of rice genotypes to D. angustus landraces to D. angustus remains unknown. Therefore the present study was performed to evaluate the host response to D. angustus infection of Bangladesh Rice Research Institute (BRRI) released high-yielding varieties, some local varieties and deep water rice varieties.

2.3. Results

2.3.1. Relationship between the early scoring system and the number of nematodes inside the plant

Before screening the rice genotypes for ufra susceptibility/resistance the early scoring method was evaluated using 11 rice genotypes (Table 2.1) known to have different levels of susceptibility from previous studies (Latif et al., 2011a; Latif et al., 2011b). These rice genotypes were inoculated with 100 nematodes per seedling and evaluated using the early scoring system i.e., based on the intensity of chlorotic discolorations at the leaf base (Fig. 2.1), represented in Table 2.1. Counting of nematodes at 28 dpi revealed that there was a strong linear correlation (r = 0.953, P <0.001) between symptom scoring and the total number of D. angustus per variety (Fig. 2.2).

Fig 2.1. Susceptibility symptoms to Ditylenchus angustus with severity rated 0 to 16.

Chapter 2 Susceptibility of rice genotypes to D. angustus

Table 2.1

Symptom rating of rice susceptibility to D. angustus at 28 dpi based on chlorotic discoloration at the leaf base. Rice genotypes Symptom type Rice genotypes Symptom type R-16-06-3 S0 Gabura S4 Kartik sail S1 IR56 S8 Aokazi S1 Bazail 249 S8 Bazail 252 S2 BR11 S16 IR30 S2 BR3 S16 Indra sail S4

S0, S1, S2, S4, S8, S16 represent different intensities of ufra symptoms.

Fig. 2.2. Relationship between the early scoring system (at 28 dpi) and the actual number of nematodes inside the plant. Black dots represent the mean and standard error of 15 plants and different letters on the dot indicate significant differences (Duncan Multiple Range Test with P = 0.05). The graph is the representation of one of two independent experiments with similar results and r represents the correlation co-efficient value with p value. Data was not pooled for repeated experiments due to the large variation in nematode numbers and virulence in control plants between experiments. The data from another replicate is shown in appendix Fig A1.

Chapter 2 Susceptibility of rice genotypes to D. angustus

2.3.2. Response of rice genotypes to D. angustus in pot experiments: early scoring

The main symptom of D. angustus infection in vegetative rice plants is leaf chlorosis. White patches or white splash patterns are observed at the basis of young leaves (Fig. 2.3A). Based on the intensity of this leaf chlorosis (Fig. 2.1) all tested rice genotypes were scored at 28 dpi. This evaluation was executed under both rainfed and irrigated conditions. Results were similar in both ecosystems (Table 2.2). One landrace named Manikpukha showed a resistant reaction (Fig. 2.3: B- D). Six BRRI-released high-yielding varieties showed susceptibility with score 1. Thirteen varieties received score 2 and fourteen varieties were scored as 4 (Table 2.2). Twenty six varieties, mostly landraces and some BRRI-released varieties showed symptoms with severity rating score 8. The rest of the varieties, mainly including the deep water varieties, was scored as 16 with maximum susceptibility (Table 2.2).

Fig. 2.3. Reactions in rice to Ditylenchus angustus infection. A. Susceptibility symptom: white splash pattern at the leaf base, B-D. Resistant responses in Manikpukha: pale yellowish green patches on the leaf blade (B), whitish discoloration over the entire length of the mid-rib (C), and yellowish white rectangular pattern in the leaf blade which gradually turns into necrosis (D).

Chapter 2 Susceptibility of rice genotypes to D. angustus

Table 2.2

Response of rice genotypes to D. angustus at 28 dpi based on chlorotic discoloration at the leaf base under rain-fed and irrigated conditions in pot experiments.

Symptom types Response of rice genotypes under rain-fed and irrigated ecosystem

S0=R Manikpukha, R-16-6-3 (Resistant control) S1 BR7, BR18, BRRI Dhan 35, BRRI Dhan 37, BRRI Dhan 40, BRRI Dhan 45 S2 BR5, BR9, BR10, BR17, BR23, BRRI Dhan 31, BRRI Dhan 32, BRRI Dhan 34, BRRI Dhan 44, BRRI Dhan 46, BRRI Dhan 52, BRRI Dhan 54, BRRI Dhan 56 S4 Sadamota, Mowlata, BR 1, BR4, BR20, BR24, BR25, BRRI Dhan 27, BRRI Dhan 30, BRRI Dhan 38, BRRI Dhan 39, BRRI Dhan 42, BRRI Dhan 49, BRRI Dhan 51 S8 Maloti, Kalomota, Dudkolom, Kheya, Sakkhor khora, Nakhuchimota, DWR9, DWR12, DWR14, DWR17, DWR20, BR2, BR6, BR8, BR15, BR16, BR19, BR22, BRRI Dhan 28, BRRI Dhan 29, BRRI Dhan 33, BRRI Dhan 36, BRRI Dhan 43, BRRI Dhan 47, BRRI Dhan 48, BRRI Dhan 55 S16 Munar, Chikon. DWR1, DWR2, DWR3, DWR4, DWR5, DWR6, DWR7, DWR8, DWR10, DWR11, DWR13, DWR15, DWR16, DWR18, DWR19, BR3, BR11 (Susceptible control), BR12, BR14, BR21, BR26, BRRI Dhan 41, BRRI Dhan 50, BRRI Dhan 53

S0, S1, S2, S4, S8, S16 represent different intensities of ufra symptoms and R represents resistance

2.3.3. Response of rice genotypes to D. angustus in pot experiments: late scoring

With further development and depending upon the severity of infection, the symptoms appeared in different parts of the plant such as tillers, panicles, spikelets and seeds. All genotypes were analysed at 55 dpi under both irrigated and rainfed conditions based on percentage of tiller infection (Table 2.4). From figure 2.4, 2.5 and 2.6 it can be observed that each variety showed a similar reaction in both ecosystems, although the tiller infections were generally less severe in irrigated conditions compared to rainfed conditions. As expected the resistant control variety R-16-6-3 showed a resistant response while the susceptible control BR11 showed a highly susceptible response. No tiller infection (0%) was observed in ‘Manikpukha’, resulting in disease index 0 in both ecosystems. Six varieties showed a resistant reaction (disease index 1) with 6.6 to 17.5% tiller infection in rain-fed conditions and 5 to 15% in irrigated conditions. Thirteen varieties showed a moderately resistant reaction in both ecosystems (disease index 3). A moderately susceptible response (disease index 5) was shown by fourteen varieties. Most of the deep water and local varieties showed a susceptible to highly susceptible reaction (disease index 7 and 9 respectively) in both ecosystems.

Chapter 2 Susceptibility of rice genotypes to D. angustus

There was a clear correlation between the response of the tested rice genotypes at 28 dpi and at 55 dpi (Table 2.2, Fig. 2.4-2.6). Genotypes that scored lower in terms of symptom scoring at 28 dpi (Table 2.2) also showed less tiller infections at 55 dpi (Fig. 2.4-2.6). For instance, Manikpukha, which showed no susceptibility symptoms at 28 dpi, also did not show any tiller infections at 55 dpi. The varieties with the strongest symptoms at 28 dpi also showed the highest percentage of tiller infections, and were hence categorized as highly susceptible.

Fig. 2.4. Percentage of tiller infections of the local varieties under irrigated and rainfed condition at 55 dpi in pot experiments. The code above the bar represents the reaction of the varieties towards D. angustus based on the percentage of tiller infections (HR= Highly Resistant, HS= Highly Susceptible, S= Susceptible, MS= Moderately Susceptible). The number at the bottom of the bar represents the disease index (DI) depending upon percentage tiller infections.

Chapter 2 Susceptibility of rice genotypes to D. angustus

Fig. 2.5. Percentage of tiller infections of the deep water rice (DWR) varieties under irrigated and rainfed condition at 55 dpi in pot experiments. The code above the bar represents the reaction of the varieties towards D. angustus based on the percentage of tiller infections (HS= Highly Susceptible, S= Susceptible). The number at the bottom of the bar represents the disease index (DI) depending upon percentage tiller infection.

Chapter 2 Susceptibility of rice genotypes to D. angustus

Fig. 2.6. Percentage of tiller infections of the BRRI released high yielding varieties under irrigated and rainfed condition at 55 dpi in pot experiments including resistant and susceptible control varieties A) from BR1 to BRRI dhan 30 and B) from BRRI dhan 31 to BRRI dhan 56. The code above the bar represents the reaction of the varieties towards D. angustus based on the percentage of tiller infections ((HR= Highly Resistant, R=Resistant, MR=Moderately Resistant, MS= Moderately Susceptible, S= Susceptible, HS= Highly Susceptible). The number at the bottom of the bar represents the disease index (DI) depending upon percentage tiller infections.

Chapter 2 Susceptibility of rice genotypes to D. angustus

2.3.4. Confirmation of the resistant genotypes under field conditions in rainfed conditions

The varieties that were identified to be highly resistant, resistant and moderately resistant in the pot experiments were further evaluated in the field. The results in the field (Table 2.3 and fig. 2.7) confirmed the results of the pot experiments. Tiller infections of most varieties were slightly higher in the field in comparison with pot experiments although the percentage of tiller infections was within the range of the reaction categories (Table 2.4).

Table 2.3

Response of rice genotypes to D. angustus at 28 dpi based on chlorotic discoloration at the leaf base under rain-fed conditions in field experiment.

Symptom types Response of rice genotypes under rain-fed conditions in the field

S0 = R Manikpukha, R-16-06-03 (Resistant control) S1 BR7, BR18, BRRI Dhan 35, BRRI Dhan 37, BRRI Dhan 40, BRRI Dhan 45 S2 BR5, BR9, BR10, BR17, BR23, BRRI Dhan 31, BRRI Dhan 32, BRRI Dhan 34, BRRI Dhan 44, BRRI Dhan 46, BRRI Dhan 52, BRRI Dhan 54, BRRI Dhan 56 S16 BR11 (Susceptible control)

S0, S1, S2, S16 represent different intensities of susceptible ufra symptoms and R represents the resistance reactions.

Fig. 2.7. Percentage of tiller infections of the highly resistant, resistant and moderately resistant varieties in the field under rainfed condition at 55 dpi. The code above the bar represents the reaction of the varieties towards D. angustus based on the percentage of tiller infections (HR= Highly Resistant, HS= Highly Susceptible, R= Resistant, MR= Moderately Resistant). The number at the bottom of the bar represents the disease index (DI) depending upon percentage tiller infections.

Chapter 2 Susceptibility of rice genotypes to D. angustus

2.4. Discussion

To identify good sources of resistance against D. angustus, 85 rice genotypes were evaluated at two different time points after infection, an earlier time point based on symptom development (28 dpi) and at a later time point based on the percentage of tiller infections (55 dpi). Screening for disease resistance largely depends on accurate and precise screening methods. These methods must also be rapid, enabling the screening of a large number of materials with reproducible results. Plowright et al. (1992) described the so-called ‘seedling based technique’ to assess rice resistance and susceptibility to D. angustus at early rice growth stage. This technique, which we followed to score our genotypes at the early time point, is based on symptom development on the youngest leaf on a scale of 0-16. Rice screening against ufra resistance has also been executed based on the percentage of tiller infections by many investigators (Miah & Bakr, 1977; Rahman, 1987; Latif et al., 2011a; Latif et al., 2011b). In our studies we combined both methods for the evaluation of rice genotypes. It has to be noted that these early and late screening methods gave similar results in all evaluated genotypes and under all growth conditions. This suggests that both screening methods are equally effective to screen a large number of rice genotypes for ufra resistance.

Plowright et al. (1992) also counted the number of nematodes per plant at 28 dpi. The number of nematodes per genotype was not counted in the here-executed experiment. However we have demonstrated for a small set of genotypes that there is a strong correlation (r = 0.953, P <0.001) between the number of nematodes and the used symptom scoring system at the early time point. Plowright & Gill (1994) also demonstrated a good correlation (r = 0.735, P < 0.001) between symptom rating and number of nematodes. Studies with other stem nematodes also showed a close relationship between symptoms and reproduction of nematodes in infected seedlings (Williams, 1972; Whitehead et al., 1987). Several experiments have showed the relationship between the symptoms and yield: a higher percentage of ufra symptoms resulted in significant yield losses compared to healthy panicles (Latif et al., 2011a; Latif et al., 2011b).

(Latif et al., 2011a; Latif et al., 2011b). It has been found that higher percentage of total ufra (damage tiller+ufra1+ufra2+ufra3) resulted significant yield losses compared to healthy panicles.

Inoculum density and inoculation technique are important factors to screen for genotype resistance. A seedling inoculation method was implemented in the current study as it mimics natural

Chapter 2 Susceptibility of rice genotypes to D. angustus conditions and this method has been proven to be the easiest and most effective method for nematode inoculation (Rahman & Evans, 1987). The water level was maintained at the collar region of the top leaf during inoculation, because shallow water level or submergence of the leaf sheath delays infection and symptom development (Plowright & Gill, 1994). In our experiment, 100 nematodes per seedling were used as inoculum, as it was observed in a previous study that 100 or more nematodes per seedling are able to establish and spread infection to new tillers (Rahman & Evans, 1987). Although different environmental conditions may lead to differences in nematode population density in the same rice variety (Ramakrishnan et al., 1984; Dash et al., 2008), our tested rice genotypes showed more or less similar responses in the two tested ecosystems (irrigated and rainfed condition), in both pot and field experiments. Nevertheless, the percentage of tiller infections was generally slightly lower in irrigated conditions compared to rain-fed conditions. This difference could be due to a slower reproduction of the nematodes at lower temperatures (Dao, 1970; Vrain et al., 1978).

A wide range of susceptibility was observed among BRRI released high yielding varieties, deep water rice varieties and landraces. Out of 85 varieties, one landrace was found to be highly resistant, 6 varieties were classified as resistant and 13 varieties were moderately resistant, 14 varieties were moderately susceptible and the rest of the varieties in our study were scored as susceptible to highly susceptible to D. angustus in the pot experiment. Some varieties such as BR3, BR11, BRRI dhan 28, BRRI dhan 48, Kartik sail, Aokazi, Bazail 252, IR50, Indra sail, Gabura, IR 56, Bazail 249 that were evaluated in previous studies (Latif et al., 2011a; Latif et al., 2011b) responded similarly in our experiment. This type of genotypic variation in susceptibility of rice genotypes to D. angustus was also observed in previous investigations (Latif et al., 2011a; Latif et al., 2011b; Miah & Bakr, 1977; Bora & Medhi, 1992; Rahman, 1987). Rahman (1987) identified some sources of resistance in deep water rice, for example, Bazail 65, CNL 319 and the Rayada group of lines. A large number of irrigated and rainfed rice genotypes were screened by Latif et al. (2011a) and Latif et al. (2011b) and some sources of resistance were identified. But the use of those varieties in the farmers’ field are limited because of the lower yield potentials. In Bangladesh, farmers mainly cultivate the BRRI released high yielding varieties (see Appendix Table A1), or in some cases high yielding local rice varieties. The results of our experiment provide information about the status of ufra susceptibility of the currently used varieties in Bangladesh. Confirmation of the highly resistant, resistant and moderately resistant varieties in the field demonstrates the

Chapter 2 Susceptibility of rice genotypes to D. angustus potential of these varieties to be used in the farmer fields. Remarkably, most of the tested local varieties showed a susceptible to highly susceptible reaction. This observation underlines the high risk of ufra related yield losses in Bangladeshi rice fields.

In the current study, a hypersensitive response (HR) was observed in the highly resistant variety Manikpukha. This HR includes pale yellowish green patches on the leaf blade, whitish discoloration at the entire length of the mid-rib and yellowish white rectangular patterns in the leaf blade gradually turning into necrosis. Plowright & Gill (1994) observed similar types of reactions in resistant rice genotypes. A hypersensitive response towards D. angustus might be due to the presence of one or more resistance genes. Nematode resistance genes have been identified in several crop plants, mapped to chromosomal locations, characterized and cloned (Veremis et al., 1996; Cai et al., 1997; Kaloshian et al., 1998; Milligan et al., 1998; Rouppe van der Voort et al., 1999). One of the best-characterized nematode resistance genes is the Mi gene of tomato, which confers resistance to several root knot nematode species, some isolates of potato aphids and white flies (Williamson, 1998; Vos et al., 1998; Rossi et al., 1998; Nombela et al., 2003). Also for migratory nematodes loci conferring resistance have been identified in some crops (Williams et al., 2002; Zwart et al., 2005; Nicol and Ortiz-Monasterio, 2004; Sharma et al., 2011; Galal et al., 2014). To the best of our knowledge, no resistance gene has been identified in rice against D. angustus. Plowright et al. (1996) reported differences of phenolic compounds in ufra resistant and susceptible varieties and showed that chlorogenic acid and the phytoalexin sakuranetin could be involved in rice resistance against D. angustus. The here-identified highly resistant variety Manikpukha or other promising BRRI released high yielding resistant varieties can be used for further investigation of resistance mechanisms, identification of resistance gene(s) and analysis of rice-D. angustus interaction at the molecular level that will provide valuable information to develop ufra resistant varieties.

2.5. Conclusion

From the current study of BRRI released high yielding varieties, local varieties and deep water rice varieties, we conclude that a wide range of disease reactions in response to D. angustus was observed. Among the genotypes evaluated, one variety ‘Manikpukha’ showed a highly resistant reaction, 6 varieties were classified resistant, 13 varieties moderately resistant, 14 moderately

Chapter 2 Susceptibility of rice genotypes to D. angustus susceptible, 26 susceptible and 26 varieties showed a highly susceptible reaction. The highly resistant local variety ‘Manikpukha’ can be used as a parent to develop ufra resistant high yielding varieties by hybridization programmes, as well as for further detailed studies. The results of our study also recommend the cultivation of BRRI released high yielding resistant varieties that were identified in our experiment such as BR7, BR18, BRRI Dhan 35, BRRI Dhan 37, BRRI Dhan 40, and BRRI Dhan 45 in ufra infected areas as a cost-effective, environmentally friendly method to reduce the level of D. angustus infections.

2.6 Materials and methods

2.6.1. Rice germplasm collection

The experiment was conducted in 2012 and 2013 at BRRI, Gazipur-1701. In this experiment, a total of 87 rice genotypes (see Appendix table A1), including one resistant and one susceptible control, were used for screening. Out of the 87 rice genotypes, 55 were BRRI released high yielding varieties, 21 varieties were deep water varieties and 11 landraces. All the varieties except the landraces were collected from the Genetic Resource and Seed (GRS) division of BRRI, Gazipur- 1701. The landraces were collected from farmers’ fields of the Barisal district, located in the southern part of Bangladesh.

2.6.2. Pot experiment

All varieties were first screened in plastic pots (30 cm diameter and 40 cm height) under either irrigated (November to March, average temperature for each month in 2012 was 24.5, 20, 17.8, 22.8, 26.8oC respectively and in 2013 average temperature was 24, 20, 17, 23, 26oC respectively) or rain-fed conditions (April to October, average temperature for each month in 2012 was 28.4, 29, 29.4, 29.5, 28.8, 29.4, 28.7oC respectively and in 2013 was 28, 28, 30, 29, 28, 29, 27oC respectively) (Bangladesh Meterological Department, 2013). Two-third of each pot was filled with sandy loam soil. Seeds were germinated on wet filter paper for 5 days at 30°C before sowing. Twenty germinated seeds were sown by forceps approximately 0.5 cm deep in each pot. The plants were watered and fertilized at regular intervals. The experiment was laid out in a completely randomized design with 5 replications in both ecosystems. Taken together, for each replication 100 individual seedlings were grown and evaluated.

Chapter 2 Susceptibility of rice genotypes to D. angustus

2.6.3. Field experiment

The field experiment was conducted in the research field of BRRI under rain-fed conditions, in 2013. The plot size used for the field study was 2x3 m. The distance from hill to hill and row to row was 20 cm. The soil type of the experimental field belongs to Salna Series of Madhupur Tract of Agro Ecological Zone (AEZ) 28 which is characterized by silty clay with pH value of 6-6.5. The experimental site is subtropical in nature with heavy rainfall during June-September and scanty in winter. Earthen levee 25 cm height was made around each plot to maintain the water level and to prevent the spread of nematodes. The experiment was laid out in a randomized block design with 3 plots per variety. Fertilization and weeding were done at regular intervals.

2.6.4. Nematode culture

The nematode, Ditylenchus angustus obtained from Plant Pathology Division of BRRI was originally isolated from an infested farmer’s field in the Gazipur district, Bangladesh. The nematode culture was maintained on the susceptible rice cultivar BR11 in controlled greenhouse conditions (25 to 28oC; RH 80%).

2.6.5. Inoculum preparation and inoculation

The nematodes were extracted from ufra infected rice stems of greenhouse grown rice plants using the modified Baermann method (Luc et al., 2005). The stems were longitudinally divided, cut into 5mm pieces and placed over a sieve to let the nematodes migrate out of the plant tissues overnight. The average number of nematodes per stem was estimated and each plant was then infected with a number of stem pieces accounting for ca. 100 nematodes for both pot and field experiments.

The inoculation method was done following the method described by Rahman (1993). This means that first the water was raised up to the upper most node of the 15-day old seedlings (Fig. 2.8). Then, infected stems, cut into small pieces, were spread evenly on top of the water. The water level was maintained to the uppermost seedling node for the following two weeks.

Chapter 2 Susceptibility of rice genotypes to D. angustus

Fig. 2.8. Seedling base inoculation method of Ditylenchus angustus

2.6.6. Relationship between the early scoring system and the actual number of nematodes inside the plant

To check the correlation between the early scoring method (according to Plowright et al., 1992; described below) and the number of infecting nematodes, an experiment was conducted with 11 rice genotypes that showed different susceptibility to ufra in previous studies (Latif et al., 2011a; Latif et al., 2011b). The genotypes were collected from the Genetic Resource and Seed (GRS) division of BRRI. The experiment was conducted in plastic pots (7.5 cm diameter and 12 cm height) filled with sandy loam. Seeds were germinated on wet filter paper for 5 days at 30°C before sowing. One germinated seed was sown in each plastic pot and 15 seedlings for each genotype were maintained per replication. Two replications were performed. Fifteen days after sowing, 100 nematodes were inoculated per plastic pot as described above. The plants were scored at 28 dpi based on the early scoring system. After scoring, the plants were cut into small pieces and soaked overnight in water, to release the nematodes. The total number of nematodes per plant was then counted using a binocular microscope.

2.6.7. Susceptibility/Resistance scoring methods

Screening of rice genotypes for ufra susceptibility was done based on scoring at two different time points: 28 days post inoculation (dpi; which we refer to as ‘early’) and 55 dpi (which we refer to

Chapter 2 Susceptibility of rice genotypes to D. angustus as ‘late’). The early scoring was done according to Plowright et al. (1992) and is based on the intensity of chlorotic discolorations at the leaf base, a characteristic symptom of ufra infection at the vegetative stage (Fig. 2.1). Different reactions like no symptom, necrosis in the mid-rib, pale green white patches with rectangular shape etc. were taken into consideration to categorize the test entries.

The late scoring method was based on the percentage of tiller infections and the test entries were categorized into six groups as proposed by Rahman (1987) and IRRI (1996) (Table 2.4).

Table 2.4

Scale of scoring at 55 days post nematode inoculation Disease % tiller infection Symptoms Response Index (DI) 0 0 No symptoms Highly resistant 1 1-20 May or may not be visible Resistant 3 21-40 Visible Moderately resistant 5 41-60 Visible Moderately susceptible 7 61-80 Visible Susceptible 9 81-100 Visible Highly susceptible

2.6.8. Data analysis

The data were analysed using IBM SPSS version 22 (IBM SPSS, Inc., Chicago, IL, USA). The data of the relationship between the early scoring system and the actual number of nematodes were analysed using ANOVA. Normality and homogeneity of the data were tested with Kolmogorov- Smirnov Test of Composite Normality (P = 0.05) and Levene test (P = 0.05) respectively. Mean nematode numbers of each rice genotype with different symptom types were compared by Duncan’s multiple mean comparison test. Correlation between the scoring system and the number of nematodes was determined by Pearson product-moment correlation coefficient with significance test (P = 0.05).

Chapter 3. The rice cultivar Manikpukha is resistant to the stem nematode Ditylenchus angustus due to post-infection mechanisms

Shakhina Khanam, Tina Kyndt and Godelieve Gheysen

Manuscript in preparation

Chapter 3 Resistance mechanism

3.1 Abstract

Invasion, post-infectional development, and reproduction of Ditylenchus angustus in the resistant rice genotype Manikpukha and in the susceptible rice genotypes BR26 and Nipponbare were compared to identify the stage (s) at which resistance occurs. There was no significant difference in nematode invasion in the resistant and susceptible genotypes at 1 and 3 days after nematode inoculation (dai). The post-infectional development of D. angustus was assessed at 7, 14, 21, and 28 dai and it was found that nematode development was slower in the resistant genotype Manikpukha compared to the susceptible genotypes BR26 and Nipponbare. Nematode reproduction completely failed in the resistant rice genotype, whereas the two susceptible genotypes supported high nematode reproduction as determined by the number of eggs per plant at 14, 21, and 28 dai. All the observations indicate that the resistance in Manikpukha is associated with reduced development and reproduction of D. angustus implying that resistance acts post- invasion.

3.2 Introduction

Plant resistance has been considered as the most promising component in parasitic nematodes management programmes. Resistance to nematodes has been defined as the ability of plants to restrict or prevent nematode reproduction (Cook & Evan, 1987; Trudgill, 1991). Resistance can interfere at several stages of the nematode-host plant infection cycle; either pre-infection (host recognition, host penetration or invasion) or post-infection (migration, feeding site formation in case of sedentary nematodes, development, and reproduction of nematodes). Basic understanding of resistance mechanisms is essential to acquire insights of nature, timing and action of resistance genes in order to efficiently use resistant cultivars in breeding programmes as well as to advance phenotypic screening methods.

The process by which Ditylenchus angustus invades and develops inside the rice plants can be separated into several steps: host recognition, invasion, development, and reproduction. It is well accepted that root parasitic nematodes are attracted to roots over gradients of chemicals and probe the root surface with their stylet to puncture the cells. However, there is no literature how D. angustus is attracted to its host plant before invasion of the shoots. D. angustus is an obligate parasite that causes “Ufra” disease in rice. All life stages of the nematode can invade the plant with

Chapter 3 Resistance mechanism infectivity ranking juvenile stage 4 (J4) > adult> J3 > J2 (Plowright & Gill, 1994). The nematode enters the plant mainly at the collar region and feeds mostly ectoparasitically on young foliar tissues. The nematode is carried or migrates upward with the growth of the shoot and feeds on newly forming tissues in the rolled leaf sheath, the panicles, and the seeds. Reproduction is amphimictic and the eggs are deposited at the two-celled stage. The J1 molts into J2 within the egg and hatches spontaneously in water without the need for host stimuli (Ali & Ishibashi, 1996; Ali et al., 1995). The nematode completes its life cycle within 10-20 days at 27-30oC (Bridge & Starr, 2007).

Resistance to D. angustus has been found in different O. sativa cultivars (Bora & Medhi, 1992; Das et al., 2000; Das & Sarmah, 1995; Latif et al. 2011a, 2011b) and in the wild rice species O. subulata (Miah & Bakr, 1977). A rice cultivar, ‘Manikpukha’ showed a very high degree of resistance against D. angustus both in pot and field experiments (Khanam et al., 2016, chapter 2). The mechanisms of resistance to nematodes have been investigated in many plant-nematode interactions (Linsell et al., 2014; Cabasan et al. 2012; Pegard et al., 2005; Pedrosa et al., 1996), however the knowledge on resistance to D. angustus is limited. Plowright et al. (1996) examined population dynamics of D. angustus in several resistant and susceptible rice cultivars. They observed that the invasion rate varied between cultivars at 2 days after inoculation; more number of nematodes invaded in susceptible cv. NC492 and resistant cv. R 16-06 (B) compared to other susceptible or resistant cultivars. The number of nematodes at 28 days after inoculation was higher in susceptible cultivars than the resistant cultivars. Their observation indicated that the mechanism of resistance varies between different resistant cultivars. However, they only focused on invasion and reproduction of D. angustus. The information on nematode development inside resistant and susceptible genotypes remains unknown. Thus, this study aimed to investigate invasion, development and reproduction of D. angustus in our identified resistant genotype Manikpukha in comparison with two susceptible genotypes, BR26 and Nipponbare to determine the stage(s) at which the resistance is acting.

Chapter 3 Resistance mechanism

3.3 Results

3.3.1 Ditylenchus angustus invaded equally in resistant and susceptible rice genotypes

The number of D. angustus invading the plants was measured at 1 and 3 days after inoculation (dai) in one resistant rice genotype, Manikpukha and two susceptible genotypes, Nipponbare and BR26. The number of nematodes recovered per plant was not significantly (α = 0.05) different in Manikpukha and Nipponbare but was significantly higher in BR26 than the other two genotypes at 1 dai (Fig 3.1). At 3 dai, no significant differences were observed among these three rice genotypes. There was a significant increase in nematode invasion over time in all genotypes (Fig 3.1). The invasion of each developmental nematode stage was also recorded by counting the number of second- or third-stage juveniles (J2/J3s), fourth-stage juveniles (J4s) and adults at 1 and 3 dai (Fig 3.2). Both at 1 and 3 dai, J4s were the highest in number invaded in the plant compared to J2/J3s and adults (Fig 3.2). At 1 and 3 dai, there was no significant difference in J2/J3s and J4s invasion among the genotypes but in case of adults, the invasion was significantly lower in the resistant Manikpukha compared with the two susceptible rice genotypes at 1 dai.

Fig 3.1. Number of Ditylenchus angustus in shoots of resistant and susceptible rice genotypes at 1 and 3 days after inoculation (dai). 15 days old rice plants were inoculated with 100 nematodes of D. angustus. Bars represent the mean and standard error of the number of nematodes per plant recorded on 8 plants. Different letters indicate statistically significant differences (Duncan’s multiple range test with α = 0.05). Data represent one of three independent experiments with similar results. RResistant genotype; SSusceptible genotype. The data from another replicate is shown in appendix Fig A2.

Chapter 3 Resistance mechanism

Fig 3.2 Shoot invasion of D. angustus second- or third–stage juveniles (J2/J3), fourth-stage juveniles (J4) and adults in resistant and susceptible rice genotypes at 1 (A) and 3 (B) days after inoculation (dai). 15 days old rice plants were inoculated with 100 nematodes of D. angustus. Bars represent the mean number of nematodes per plant recorded on 8 plants. Different letters indicate statistically significant differences (non- parametric Kruskal-Wallis test with α = 0.05). Data represent one of three independent experiments with similar results. RResistant genotype; SSusceptible genotype. The data from another replicate is shown in appendix Fig A3.

3.3.2 The Development of D. angustus is delayed in the resistant genotype compared to the susceptible genotypes

The development of D. angustus within resistant and susceptible shoots was assessed by counting the number of each developmental stage of the nematode life cycle at 7, 14, 21, and 28 dai. From figure 3.3, it is observed that juveniles had started to develop into females (40%) at 7 dai in the susceptible genotype BR26. In contrast, the resistant Manikpukha has only 14% females, which is significantly lower compared to Nipponbare and BR26. At 14 dai, both susceptible genotypes Nipponbare and BR26 have second generation J2s (75% and 74% respectively). At 21 and 28 dai, second generation J2/J3s, J4s, and adults were observed in both susceptible genotypes, whereas no second generation nematodes were observed in the resistant genotype. A higher percentage of J4 (57%) and males (29%) compared to females (14%) was observed in the resistant genotype. When comparing the total number of nematodes between resistant and susceptible genotypes at 28 dai, there was a significantly higher number of D. angustus in Nipponbare and BR26 than in the resistant Manikpukha (Fig 3.4).

Chapter 3 Resistance mechanism

Fig 3.3. Percentage of Ditylenchus angustus developmental stages feeding on resistant and susceptible rice shoots at different times of the nematode life cycle (A) 7, (B) 14, (C) 21 and (D) 28 days after inoculation (dai). Bars represent the mean percentage of each stage of nematodes recorded on 8 plants. Nematode development in Manikpukha was compared to the susceptible rice genotypes Nipponbare and BR26. Single asterisks indicate significant differences of developmental stages of Manikpukha from BR26 and double asterisks indicate a significant difference between Manikpukha and both Nipponbare and BR26 (Independent Samples t test with α = 0.05). Data represent one of two independent experiments with similar results. RResistant genotype; SSusceptible genotype; Sg second generation. The data from another replicate is shown in appendix Fig A4.

Chapter 3 Resistance mechanism

Fig 3.4. Number of Ditylenchus angustus in shoots of resistant and susceptible rice genotypes at 7, 14, 21 and 28 days after inoculation (dai). 15 days old rice plants were inoculated with 100 nematodes of D. angustus. Lines represent the mean and standard error of the number of nematodes per plant recorded on 8 plants. Data represent one of two independent experiments with similar results. Different letters indicate statistically significant differences (Duncan’s multiple range test with α = 0.05). RResistant genotype; SSusceptible genotype. The data from another replicate is shown in appendix Fig A5.

3.3.3 D. angustus completely failed to reproduce within the resistant genotype

The number of eggs laid by D. angustus females was counted at 14, 21, and 28 dai in the resistant and susceptible genotypes (Fig 3.5). We observed that nematode reproduction completely failed in the resistant rice, whereas up to 800 eggs per plant were collected from the susceptible genotypes (Fig. 3.5). Between two susceptible genotypes, there was no difference in number of eggs per plant at 14 and 21 dai, but BR26 had significantly more eggs at 28 dai.

Chapter 3 Resistance mechanism

Fig 3.5. Number of Ditylenchus angustus eggs per plant in resistant and susceptible rice genotypes at 14, 21, and 28 days after inoculation (dai). 15 days old rice plants were inoculated with 100 nematodes of D. angustus. Bars represent the mean and standard error of the number of eggs per plant recorded on 8 plants. Data represent one of two independent experiments with similar results. Different letters indicate statistically significant differences (Duncan’s multiple range test with α = 0.05). RResistant genotype; SSusceptible genotype. The data from another replicate is shown in appendix Fig A6.

3.4 Discussion

To gain insights in the resistance mechanism of rice cultivar Manikpukha to D. angustus, this study investigated the invasion, post-infectional development, and reproduction of the nematode in the resistant and two susceptible genotypes. Before host invasion, hatching, recognition of, and attraction to host plants are essential steps for host-nematode interactions. Plant signals such as root diffusates and temperature are regarded as important stimuli for hatching and attraction of many parasitic nematodes toward the host roots (Green, 1971; Schmitt & Riggs, 1991; Baxter & Blake, 1967). However, it is known that hatching of D. angustus is not dependent on host stimuli; it spontaneously occurs in water (Ali & Ishibashi, 1996; Ali et al., 1995). Hatching of root-knot nematodes is dependent solely on suitable temperature and moisture conditions, without host stimulus. However, in some cases, root diffusates and generation number within a season can influence the hatching response (Curtis et al., 2009).

The ability of plant parasitic nematodes to find host roots or to respond to a chemical stimulus has been studied with a number of diverse experimental conditions and some of them found to be effective to assess host-finding behaviour of root parasitic nematodes in the laboratory (Dalzell et al., 2011; Wang et al., 2009; Wuyts et al., 2006). For examples, gradients of chemicals such as

Chapter 3 Resistance mechanism

CO2 (Perry, 1997; Prot, 1980), pH, temperature, and electrical potentials (Bird, 1959), auxin (Feng et al., 2014) play a role for attracting the nematodes. However, in many cases, activity of root diffusates does not seem to be associated to host resistance or susceptibility (William & Beane, 1979; Turner & Stone, 1984; Rawsthorne & Brodie, l986). Our results show that the rate of invasion of D. angustus in the resistant and susceptible rice genotypes was not significantly different, suggesting that host attraction is not important for the resistance reaction of Manikpukha. In several other cases as well, resistance does not interfere with nematode root attraction (Linsell et al., 2014; Balhadere & Evans, 1994; Cabasan et al., 2012).

Our results also demonstrate that all vermiform stages of D. angustus invaded the rice genotypes (Fig 3.2). The rate of invasion by J4 was significantly higher than the other stages, which is similar with previous observations (Plowright & Gill, 1994; Ibrahim & Perry, 1994). Plowright et al. (1996) examined population dynamics of D. angustus in several resistant and susceptible rice cultivars and observed that the number of nematodes that invaded the plant varied between cultivars; a higher number of nematodes was invading susceptible cv. NC492 and resistant cv. R 16-06 (B) compared to other susceptible or resistant cultivars. Studies of resistance mechanisms in several crop species to root knot, cyst and root lesion nematodes indicate that suppression of invasion/penetration rarely plays a role in resistance (Kim et al., 1987; Creech et al., 1995; Williams & Fisher, 1993; Linsell et al., 2014). As plant parasitic nematodes possess a stylet and generally secrete cell wall degrading enzymes, most nematodes seem able to overcome the physical barrier of plant tissues. However, in some other studies resistant plants expressed pre-infectional resistance because penetration and/or invasion of nematodes were significantly lower in resistant plants compared to susceptible plants (Cabasan et al. 2012; Pegard et al., 2005; Fogain & Gowen, 1998; Valette et al., 1998) which might be due to extra cell wall barriers in the root or biochemical defence compounds (Huang, 1985; Diomande, 1984; Valette et al., 1998).

The analysis of nematode development over time in the resistant and susceptible rice genotypes performed in the current study showed that nematodes progress to the next developmental stage at a faster and higher rate in the shoots of susceptible genotypes compared to the resistant rice genotype. In the resistant variety Manikpukha more nematodes remained in the juvenile stage resulting in less adult nematodes. The higher percentage of male nematodes compared to females at 21 and 28 dai in the resistant genotype indicates that the nematodes had undergone stress conditions in the resistant genotypes (Bird 1971; Triantaphyllou 1973). In our study, we observed 74

Chapter 3 Resistance mechanism that resistance to D. angustus in Manikpukha may not only be due to delayed development but also to suppressed fecundity of the female. The reproduction of the nematodes completely failed in the resistant genotype. Such delayed nematode development and hence reduced egg production have also been reported in previous studies on resistant cultivars (McClure et al 1974; Pedrosa et al., 1996, Linsell et al., 2014).

All the observations indicate that the resistance in Manikpukha is associated with reduced development and reproduction, which means that the resistant plant expressed post-infectional resistance to D. angustus. This incompatible interaction in Manikpukha with D. angustus is characterized by a hypersensitive reaction (HR) that leads to necrosis (chapter 2). Cell necrosis in the cortex and vascular tissues has been reported to halt or delay the nematode growth, development, reproduction, and/or establishment of nematode feeding sites in various crop species (Jena & Rao, 1977; Anwar & McKenry, 2000). HR responses in plants, following the recognition of nematodes, are accompanied by changes in transcriptional and defence signaling pathways such as production or release of reactive oxygen species (ROS, Davies et al., 2015), H2O2 accumulation (Melillo et al., 2006), salicylic acid, lipoxygenase enzymes (Bhattarai et al., 2008; Klink et al., 2009), and phenolic compounds (Paulson & Webster, 1972; Pegard et al., 2005).

Plowright et al. (1996) observed an increased level of chlorogenic acid in response to D. angustus infection in resistant varieties, but not in D. angustus infected susceptible plants. Another phenolic compound in rice, the phytoalexin sakuranetin was identified in the resistant variety Rayada 16-06 and this compound could have a functional role in resistance against the ufra nematode. Histological observations of a Radopholus similis infected, partially resistant, banana cultivar ‘Yangambi Km 5’ revealed the constitutive presence of phenolics such as high levels of lignin and flavonoids limiting host penetration and colonization by R. similis (Valette et al., 1998). Recently, Holscher et al. (2014) isolated, identified and located a banana specific group of phytoalexins, the phenylphenalenones, in R. similis-caused lesions in roots. An in-depth investigation of the rice–D. angustus interaction at the cellular and molecular level could lead to the development of more efficient control strategies against this nematode.

Chapter 3 Resistance mechanism

3.5 Conclusion

The resistance in Manikpukha acts post invasion with the suppression of female development and, thus, reproduction. There was no significant difference in the rate of invasion in the resistant and susceptible shoots. Development of D. angustus is suppressed in resistant plants suggesting that the resistant genotype could produce compounds that inhibit juvenile development or constrain nematode feeding. Further biochemical and molecular investigations into the D. angustus-rice response can enhance the development of Ufra resistant high yielding rice varieties.

3.6. Materials and methods

3.6.1 Rice genotypes

The study investigated three rice genotypes that showed a different response to D. angustus: one D. angustus resistant genotype Manikpukha (Khanam et al., 2015, chapter 2) and two susceptible genotypes: BR26 (Latif et al., 2011, chapter 2) and Nipponbare. The seeds of Manikpukha (indica type) and BR26 (indica type) were collected from Bangladesh Rice Research Institute (BRRI) and the seeds of Nipponbare (japonica type) were provided by USDA, GSOR-100.

3.6.2 Nematode culture

The nematode, D. angustus obtained from the Plant Pathology Division of BRRI was originally isolated from an infested farmer's field in the Gazipur district, Bangladesh. The nematode culture was maintained in vivo on a susceptible rice cultivar, BR11 (indica type; provided by BRRI) at

26°C under a 12h/12h light-regime (150 μmol/m²/s) and 70-75% Relative Humidity. The nematodes were extracted from ufra infected rice stems using the modified Baermann method (Luc et al., 2005). The stems were longitudinally divided, cut into 5mm pieces and placed over a sieve to let the nematodes migrate out of the plant tissues overnight.

3.6.3 Analysis of invasion, development, and reproduction

The experiments to assess the invasion, development, and reproduction of D. angustus within resistant and susceptible rice genotypes were conducted under controlled room conditions (26°C, 12h/12h light-regime, 70-75% Relative Humidity). The seeds were pre-germinated on wet filter

Chapter 3 Resistance mechanism paper for 5 days at 30°C before transfer to SAP-substrate (Reversat et al., 1999) in a glass tube (15×2.5 cm). 15 days old rice plants were inoculated with 100 nematodes of D. angustus. The inoculation method was done as described by Rahman (1993). This means that first the water was raised up to the upper most node of the 15-day old seedlings, then ca. 100 nematodes were spread evenly on top of the water. The water level was maintained to the uppermost seedling node for one week. Afterwards, the water was removed from the tube.

For the invasion experiment, the plants were collected at 1 and 3 days after nematode inoculation (dai) and for the development and reproduction experiments, the plants were collected at 7, 14, 21, and 28 dai. The stems were longitudinally divided, cut into 5mm pieces and placed over a sieve to let the nematodes migrate out of the plant tissues overnight. The number of D. angustus that invaded plants was determined by counting the J2/J3s, J4s, and adults per plant using a stereomicroscope. Different nematode developmental stages were identified on the basis of visual separation of stages using total body length (Ibrahim & Perry, 1994). Reproduction was assessed by calculating the number of eggs per plant.

3.6.4 Data analysis

The data from each experiment were analysed using IBM SPSS version 22 (IBM SPSS, Inc., Chicago, IL, USA). Normality and homogeneity of the data were tested with the Kolmogorov- Smirnov Test of Composite Normality (α = 0.05) and the Levene test (α = 0.05) respectively. The number of nematode developmental stages at 1 and 3 dai were analysed using the non-parametric Kruskal-Wallis test with α = 0.05. Percentage of D. angustus developmental stages at 7, 14, 21, and 28 dai within Manikpukha was compared to the susceptible rice genotype Nipponbare and BR26 and the data were analysed using Independent Samples t test. All other data were subjected to analysis of variance (ANOVA). When a significant difference was identified, individual comparisons were done by Duncan’s multiple range test (α = 0.05).

Chapter 4. The resistant Manikpukha shows a rapid defense response to Ditylenchus angustus infection, with higher PAL expression and lignin accumulation

Shakhina Khanam, Tina Kyndt and Godelieve Gheysen

Manuscript in preparation

Chapter 4 Role of SA, JA, and ET in rice defence against D. angustus

4.1 Abstract

Next to their well-documented function in plant growth and development, plant hormones regulate the signaling network in plant defence responses against different biotic and abiotic stresses. In this chapter, we studied the role of three classical defence hormones salicylate (SA), jasmonate (JA) and ethylene (ET) in rice defence against Ditylenchus angustus. Nematode infection experiments with rice lines that are mutants or transgenics deficient in SA, JA and ET biosynthesis or signaling pathways showed that these lines are more susceptible to the nematodes compared to the control plants. Exogenous foliar application of methyl jasmonate, BTH (Benzothiadiazole, an analog of SA) and ethephon makes the plants more resistant towards the nematodes, whereas pharmacological inhibition of biosynthesis of these three hormones increases nematode susceptibility. Collectively, our results demonstrate that the SA, JA and ET pathways are important in basal defence of rice against D. angustus. A gene expression analysis showed a remarkable contrast in the expression pattern of some SA/JA/ET-marker genes between a compatible and incompatible rice-D. angustus interaction. Our data reveal that OsPAL1 might be triggering the defence response in the resistant cultivar, but this is not correlated with increased SA production. Lignin measurement showed that, although their basal levels are similar, the resistant cultivar had a significantly higher lignin content upon nematode infection, while this content was decreased upon nematode infection in the susceptible cultivar.

4.2 Introduction

Plants have developed an extraordinary array of immune and defence mechanisms to protect themselves against a wide range of pathogenic microorganisms. Besides preformed defence (Underwood, 2015; Broekaert et al., 1997), plants induce a sophisticated system of responses upon pathogen infection which is triggered by two tiered microbial recognition, termed PAMP-triggered immunity (PTI) and effector-triggered immunity (ETI) (Jones & Dangl, 2006; Dodds & Rathjen, 2010). Timely recognition of a pathogen combined with fast and effective induction of defence responses ultimately determines the resistance/susceptibility of a plant.

PTI is triggered by pattern recognition receptors (PRRs) that are activated by recognition of evolutionary conserved pathogen- or microbial-associated molecular patterns (PAMPs/MAMPs).

Chapter 4 Role of SA, JA, and ET in rice defence against D. angustus

Activation of PRRs at the cell surface leads to a battery of host defence responses ensuing a basal level of resistance to prevent pathogen growth. Virulent pathogens are able to circumvent PTI by secreting so-called effectors into the host. In turn, plants acquired resistance (R) genes to recognize specific pathogen effectors resulting in ETI which is often associated with programmed cell death of the infected cells, known as hypersensitive response (HR). PTI as well as ETI activation are correlated, among others, with the activation of complex phytohormone-based signaling networks, in which salicylic acid (SA), jasmonic acid (JA), and ethylene (ET) play central roles.

The importance of SA, JA and ET signaling pathways and their interaction in the regulation of the plant’s immune response to microbial pathogens, nematodes and insect pests is well documented (Pieterse et al., 2012; Nahar et al., 2011; 2012; Howe & Jander, 2008). In general, SA is associated with plant defence against biotrophic and hemibiotrophic pathogens and JA and ET play important roles in defence against necrotrophic pathogens, insect herbivory and root-knot nematodes (Glazebrook, 2005; Howe & Jander, 2008; Nahar et al., 2011). In addition to well established antagonistic interactions between SA and JA/ET defence pathways, a number of synergistic interactions have also been reported (Beckers & Spoel 2006; Mur et al., 2006; Makandar et al., 2010; Zhu et al., 2014). Although most information on the molecular interplay between plants and pathogens were generated on dicotyledonous plants, tremendous progress has been made into the immune-regulatory role of phytohormones in monocots such as rice. Rice is one of the most important food crops in the world and a promising model system for studying monocots because of its amount of genetic and molecular resources, the small and fully sequenced genome and its ease of transformation (Jung et al., 2008).

The production of secondary metabolites play important in constitutive or induced defence plays an important role in plant defence against PPN (Fujimoto et al., 2015; Dhakshinamoorthy et al., 2014; Holscher et al., 2014; Ji et al., 2015; Kumari et al., 2016). One of the most well-known secondary metabolic pathways in plants involves the biosynthesis of phenylpropanoids through the shikimic acid pathway. In the starting point of the pathway, phenylalanine ammonia-lyase (PAL) catalyzes the deamination of phenylalanine to cinnamate. Phenylpropanoid metabolism involves a complex series of branching biochemical pathways that provide plants with many different compounds, which are widely used as structural cell components (lignin, suberin and other cell wall-associated phenolics), pigments (flavonoids, anthocyanins), immunity signals (SA) and toxins (coumarins and furanocoumarins; Dixon et al., 2002; Vog, 2010). 80

Chapter 4 Role of SA, JA, and ET in rice defence against D. angustus

Mounting evidence suggests the significant role of SA, JA and ET in defence of rice in response to plant-parasitic nematodes. For instance, the JA pathway is of central importance in root defence against the root knot nematode Meloidogyne graminicola, whereas SA, JA and ET are all important for defence against the migratory root nematode Hirschmanniella oryzae (Nahar et al., 2011; Nahar et al., 2012). A gene expression analysis of rice upon root knot nematode infection reveals significant differential expression patterns of a number of well-identified SA/JA/ET-marker genes when comparing susceptible and resistant interactions (Kumari et al., 2016). However, in contrast to root nematodes of rice, there is no knowledge concerning signaling pathways involved in rice defence against foliar nematodes, such as Ditylenchus angustus.

D. angustus is an obligate parasite of rice that causes substantial yield losses in South and Southeast Asia. The nematode invades the plant mainly at the collar region where it feeds mostly ectoparasitically on newly forming tissues in the rolled leaf sheath, the panicles, and the seeds. Reproduction is amphimictic and the nematode completes its life cycle within 10-20 days at 27- 30oC (Bridge & Starr, 2007). For nematode management through environment friendly approaches, it is pre-requisite to investigate the plant-nematode interaction at a molecular level, in order to design effective strategies for nematode resistance in crops. In this chapter, we present an in-depth characterization of the role of SA, JA and ET in plant susceptibility/resistance to D. angustus. By using exogenous hormone and hormone inhibitor application, mutants and transgenic lines, gene expression analyses and metabolite measurements, we provide several lines of evidence that SA, JA and ET play a positive role in rice basal defence against D. angustus.

4.3 Results

4.3.1 Mutants or transgenic rice plants deficient in SA/JA/ET are more susceptible to Ditylenchus angustus infection

The role of SA, JA and ET in rice defence against D. angustus was evaluated by studying different rice mutants or transgenic plants that are impaired in one of these three pathways. Fig 4.1 shows that mutant and transgenic rice plants affected in either the SA, JA or ET hormone pathway had a significantly higher number of nematodes per plant compared to control plants. The SA-signaling deficient WRKY45-RNAi line contained 36% more nematodes, the SA-deficient transgenic NahG had 42% more nematodes, the ethylene insensitive EIN2b RNAi line had 46% more nematodes

Chapter 4 Role of SA, JA, and ET in rice defence against D. angustus and the JA insensitive Coi-RNAi line had 56% more nematodes compared to control Nipponbare (Fig 4A). Fig 4B shows that the JA biosynthesis mutant hebiba also had a significantly higher (50% increase) number of nematodes per plant compared to the control Nihonmasari.

Fig 4.1. (A). Susceptibility towards Ditylenchus angustus in SA signalling deficient WRKY45 RNAi, SA deficient transgenic NahG, ET insensitive Ein2b, JA insensitive Coi RNAi, and the corresponding wild type Nipponbare plants and (B) Susceptibility for D. angustus in JA biosynthesis mutant hebiba and the corresponding wild type Nihonmasari. Bars represent the mean and standard error of the number of nematodes per plant 20 days after nematode inoculation, recorded on 8 plants. Different letters in the picture A and B indicate statistically significant differences (Duncan Multiple Range Test with α = 0.05). Data represent one of three independent experiments with similar results. The data from another replicate is shown in appendix Fig A7.

4.3.2 Hormones and hormone inhibitors treatment confirm a positive role of the SA/JA/ET pathways in the control of D. angustus infection

Given the observed D. angustus susceptibility of SA, JA or ET hormone pathway mutant and transgenic rice plants, we studied the effect of application of these hormones and corresponding hormone inhibitors on D. angustus infection in rice. The data are presented in Fig 4.2.

From fig 4.2, it is observed that the exogenous application of Benzo-1, 2, 3-Thiadiazole-7- Carbothioic Acid S-Methyl Ester (BTH, a synthetic analog of SA), methyl jasmonate (MeJA) or 82

Chapter 4 Role of SA, JA, and ET in rice defence against D. angustus

2-chloroethyl phosphonic acid (Ethephon, Eth) 24h before inoculation significantly reduces the number of nematodes per plant. BTH-, Eth- and MeJA-treated plants had a 51%, 46%, and 39% reduction in number of nematodes per plant in comparison with control plants, respectively. In contrast, blocking of SA, JA and ET biosynthesis yielded a significant increase in the number of nematodes per plant compared to the untreated control plants. Inhibition of ET production through aminooxyacetic acid application (AOA; Mao et al., 2006; Iwai et al., 2006) resulted in a 22% increase, blocking of JA biosynthesis with diethyldithiocarbamic acid (DIECA; Farmer et al., 1994) resulted in 24% increase and blocking of the phenylpropanoid pathway with L-2-Aminooxy- 3-phenylpropinoic acid (AOPP; Amrhein & Godeke, 1977 resulted in 31% increase in number of nematodes per plant compared to the control plants. The root and shoot growth of the plants were monitored throughout the experiment but no observable phenotypic differences in plant growth and development were detected.

Fig 4.2 Effect of foliar application of plant hormones and corresponding hormone inhibitors on rice defence against D. angustus infection. Shoots of fifteen-day-old plants were sprayed until runoff with 100 µM MeJA, 250 µM BTH, 500 µM ethephon, 25 mM AOA, 100 µM DIECA, 100 µM AOPP or the corresponding control solution. After 24 h of treatment, plants were inoculated with 100 nematodes of D. angustus. Bars represent the mean and standard error of the number of nematodes per plant 20 days after nematode inoculation recorded on 8 plants. Different letters indicate statistically significant differences (Duncan’s multiple range test with ɑ = 0.05). Data represent one of three independent experiments with similar results. MeJA, Methyl jasmonate; Eth, Ethephone; BTH, Benzathiadiazole; AOA, Aminooxyacetic acid; DIECA, Diethyldithiocarbamic acid; AOPP, L-2-Aminooxy-3-phenylpropinoic acid. The data from other replicate is shown in appendix Fig A8.

Chapter 4 Role of SA, JA, and ET in rice defence against D. angustus

4.3.3 Innate defence response in rice shoot tissues upon D. angustus infection

To investigate the response of a susceptible and a resistant rice genotype upon D. angustus infection, expression of 12 SA/JA/ET- marker genes was evaluated. Shoot tissues of ufra susceptible Nipponbare and ufra resistant Manikpukha were evaluated at 1, 5, 10, and 21 dpi, using quantitative real-time PCR (qRT-PCR). This gene expression profile was compared to uninfected control plants of the same age. The results are presented in fig 4.3.

4.3.3.1 SA-dependent responses upon D. angustus infection in rice shoot tissues

Two SA biosynthesis genes, OsICS1 (Chen et al., 2009) and OsPAL1 (Lee et al., 1995) and one SA response gene OsWRKY45 (Qiu et al., 2004) were evaluated for studying the importance of SA-dependent response in rice upon nematode infection. In plants, SA can be synthesized via two distinct enzymatic pathways: the phenylpropanoid pathway and the isochorismate pathway. OsPAL1 is a key enzyme of the phenylpropanoid pathway starting from phenylalanine, while OsICS1 is the first catalytic enzyme of the isochorismate pathway starting from chorismate. mRNA levels of OsPAL1 were significantly and consistently down-regulated at all the time points (1, 5, 10, and 21 dpi) in the shoots of Nipponbare in response to D. angustus infection. On the contrary, the OsPAL1 gene was strongly up-regulated in the infected shoots of Manikpukha at all time points. OsICS1, on the other hand did not show differential expression compared to non- infected control plants in Nipponbare, while this gene was slightly induced in Manikpukha at all time points compared to corresponding non-infected shoot tissues. The transcript level of the SA responsive gene OsWRKY45 was only slightly changed in Nipponbare shoot tissues compared to non-infected control plants at 1 and 5 dpi, but significantly up-regulated at 10 and 20 dpi. However, in the shoots of infected Manikpukha, OsWRKY45 was only significantly upregulated at 1 dpi, but not significantly altered at other time points.

4.3.3.2 JA-dependent responses upon D. angustus infection in rice shoot tissues

To investigate the importance of the JA-dependent response upon D. angustus infection, OsAOS2 (a key enzyme in JA biosynthesis; Agrawal et al., 2004; Mei et al., 2006), OsJMT1 (enzyme which converts JA to the volatile component MeJA; Seo et al., 2001) and OsJAmyb (JA-inducible Myb transcription factor; Lee et al., 2001) were evaluated as JA-marker genes.

Chapter 4 Role of SA, JA, and ET in rice defence against D. angustus

Early upon infection (at 1 and 5 dpi), OsAOS2 was slightly downregulated in the shoots of Nipponbare but this gene was significantly up-regulated at 10 dpi. On the other hand, the mRNA level of OsAOS2 was slightly higher in the shoot tissues of infected Manikpukha in comparison with the control tissues. OsJMT1 was strongly up-regulated in Manikpukha at 1 dpi, but not at other time points or in Nipponbare. OsJAmyb was significantly up-regulated at 1 dpi in Nipponbare, but not at other time points. In the shoots of infected Manikpukha, OsJAmyb was slightly induced at all time points.

4.3.3.3 ET-dependent responses upon D. angustus infection in rice shoot tissues

Two ET biosynthesis genes, OsACS1 and OsACO7 (Iwai et al., 2006), one ET signaling gene, OsEin2b (EIN2 is a central signal transducer in the ET signaling pathway; Jun et al., 2004) and one ET-responsive gene, OsERF1 (Hu et al., 2008) were evaluated to investigate the ET-dependent response upon D. angustus infection.

The mRNA level of OsACO7 did not show differential levels in the shoots of Nipponbare or Manikpukha at any time point upon nematode infection. A near baseline expression or downregulation of OsACS1 was detected in the infected shoots of Nipponbare at all time points, with significant downregulation at 21 dpi. On the other hand, in the incompatible interaction OsACS1 was slightly induced with significant induction at 10 dpi. Almost no transcription alteration of OsEin2b was detected in the infected shoots of Nipponbare at 1, 5, and 10 dpi but this gene was significantly up-regulated at 21 dpi compared to corresponding non-infected plants. On the contrary, in Manikpukha OsEin2b was consistently upregulated at all time points, with significant up-regulation at 5 and 10 dpi. The ET-inducible gene OsERF1 was consistently attenuated in the infected shoots of Nipponbare, although only significant at 5 dpi. In the shoots of Manikpukha upon nematode infection, this OsERF1 gene was slightly upregulated at 1, 10 and 21 dpi and slightly down-regulated at 5 dpi.

4.3.3.2 General defence responses upon D. angustus infection in rice shoot tissues

To further elucidate the general defence response of rice triggered upon nematode infection, the differential expression of two PR genes, OsPR1a (Mitsuhara et al., 2008) and OsPR5 (Anzlovar & Dermastia, 2003) was assessed. mRNA level of OsPR1a was not differentially expressed in the infected shoots of both Nipponbare and Manikpukha. However, this gene was slightly downregulated or near baseline in Nipponbare, while slightly up-regulated in Manikpukha at all time 85

Chapter 4 Role of SA, JA, and ET in rice defence against D. angustus points except at 5 dpi. OsPR5 was up-regulated in the infected shoots of Nipponbare at all 4 time points, with significant induction at 1, 5, and 10 dpi. On contrary, OsPR5 was not differentially expressed in the shoots of Manikpukha upon D. angustus infection.

Fig 4.3 Analysis of the expression levels (using qRT-PCR) of some selected defense-related genes in the shoot tissues of the ufra susceptible genotype, Nipponbare A) and the ufra resistant genotype Manikpukha B) at 1, 5, 10, and 21 days after infection (dpi) with Ditylenchus angustus. Bars represent the mean and standard error of the relative amount of transcripts of these genes from two biological replicates (n=2), each containing a pool of shoot tissue from three infected plants in comparison with uninfected control plants grown under the same conditions. Gene expression levels were normalized using two internal reference genes, OsEXP and OsEXPNarsai. Asterisks indicate statistically significant (P=0.001) differential expression in comparison with untreated uninfected plants, performed by 2000 randomisations using REST2009.

Chapter 4 Role of SA, JA, and ET in rice defence against D. angustus

4.3.4. SA and JA accumulation upon nematode infection in the ufra susceptible Nipponbare and the resistant Manikpukha

Based on the observed expression profiles, we decided to quantify the SA and JA accumulation in the collar region of infected and non-infected shoots of Nipponbare and Manikpukha at 1 dpi, using high performance liquid chromatography followed by mass spectrometry analysis. Results (Fig. 4.4) indicated that the endogenous SA level is very high in rice shoots compared to JA level, which is consistent with the fact that rice accumulates very high levels of SA in young shoots and leaves (Yang et al., 2004). From fig 4.4A it is observed that there was no significant difference in SA accumulation among uninfected Nipponbare and Manikpukha plants. Upon infection, SA levels significantly decreased in Nipponbare, but not in Manikphukha. In case of JA, the level of JA significantly increased upon infection in the resistant Manikpukha plants compared to uninfected Manikpukha, but did not change upon infection in Nipponbare (Fig. 4.4B). The basal level of JA was not different when comparing the susceptible with the resisant genotype.

Fig 4.4. Results of SA (A) and JA (B) accumulation in infected and non-infected collar region of shoots of the ufra susceptible Nipponbare and the resistant Manikpukha at 1 dpi. SA and JA were quantified in shoot tissues using mass spectrophotometry, and is expressed as ng hormone per g of tissue. Bars represent the mean and standard error of six replicates, each containing a pool of shoot tissues from three plants. Different letters represent statistically significant differences according to the non-parametric Kruskal-Wallis test in A) and according to Duncan’s multiple range test B) with P ≤ 0.05. Nipp ctrl, Nipponbare uninfected control; Nipp 1 dpi, Nipponbare 1 days post inoculation; Manik ctrl, Manikpukha uninfected control; Manik 1 dpi, Manikpukha 1 days post inoculation. 87

Chapter 4 Role of SA, JA, and ET in rice defence against D. angustus

4.3.5. Lignin accumulation upon nematode infection in the ufra susceptible Nipponbare and the resistant Manikpukha

The remarkable contrasting expression pattern of OsPAL1 gene in the compatible versus the incompatible rice-D. angustus interaction, together with the fact that PAL-inhibition leads to a significant increase in nematode numbers in the susceptible genotype (Fig. 4.2) prompted us to assess lignin accumulation in the shoot tissues of both cultivars. The results showed that there are no significant differences in lignin content in non-infected Nipponbare versus Manikpukha shoots. However, upon nematode infection, the resistant plants accumulated a significantly higher amount of lignin. Remarkably, the lignin content was significantly decreased in the susceptible genotype upon infection.

Fig 4.5. Lignin content in infected and non-infected rice shoots of the ufra susceptible Nipponbare and the resistant Manikpukha at 5 dpi. Lignin accumulation is expressed as percentage of cell wall residues. Bars represent the mean and standard error of five replicates, each containing 100 mg of dry cell walls, isolated from a pool of shoot tissues from six plants. Different letters indicate statistically significant differences (Duncan’s multiple range test with P ≤ 0.05). Nipp ctrl, Nipponbare uninfected control; Nipp 5 dpi, Nipponbare 5 days post inoculation; Manik ctrl, Manikpukha uninfected control; Manik 5 dpi, Manikpukha 5 days post inoculation.

Chapter 4 Role of SA, JA, and ET in rice defence against D. angustus

4.4 Discussion

SA, JA and ET are the three main defence hormones that play key roles in regulating responses to a wide variety of internal and external stimuli. A number of studies have been done to characterize the role of these three classical hormones against PPN mostly on dicotyledonous plants (e.g. Wubben et al., 2001; 2008; Bhattarai et al., 2008; Kammerhofer et al., 2015), also some on monocotyledonous plants. To our knowledge, no research has been done regarding defence signaling pathways in rice upon infection with foliar nematodes, among which D. angustus. This nematode is an obligate biotroph that feeds on newly forming tissues in the rolled leaf sheath, the panicles, and the seeds.

Our investigation on the susceptibility level of D. angustus in rice mutants or transgenic plants impaired in the SA, JA or ET pathways showed that the all these lines were more susceptible compared to control plants. It has already been reported that the SA-deficient transgenic NahG plants (Yang et al., 2004), the JA biosynthesis mutant hebiba (Riemann et al., 2003) and ET insensitive EIN2b (Bailey et al., 2009) are more susceptible towards M. graminicola and migratory nematode, H. oryzae (Nahar et al., 2011; Nahar et al., 2012). The rice mutant hebiba is due to a genomic deletion of 169 kb, which comprises 26 annotated genes (Riemann et al., 2013; Nordström et al., 2013). One of the genes encodes allene oxide cyclase (AOC), part of the jasmonate biosynthetic pathway, loss of which leads to jasmonate deficiency. Another gene contained within the deleted interval gene encondes the alpha/ beta-fold hydrolase DWARF14LIKE (D14L), which is homologous to Arabidopsis thaliana KARRIKIN INSENSITIVE2/HYPOSENSITIVE TO LIGHT (KAI2/ HTL; Gutjahr et al., 2015). This hydrolase acts together with the F-box protein DWARF3/MORE AXILLIARY GROWTH2 (D3/MAX2) in the perception of karrikins. Karrikin is a plant growth regulator first identified in smoke that induce seed germination in fire-chasing plants (Waters et al., 2012; Guo et al., 2013). Karrikin is also a necessary signaling component for the establishment of arbuscular mycorrhizal (AM) symbiosis (Gutjahr et al., 2015). Therefore, the enhanced susceptibility of hebiba to D. angustus could also be casued by other factors than the lower JA level.

For further confirmation, we sprayed MeJA, Eth and BTH and corresponding hormone inhibitors on the shoots of ufra susceptible Nipponbare and we found that exogenous MeJA, Eth and BTH application are equally important for resistance against D. angustus, while the hormone inhibitors

Chapter 4 Role of SA, JA, and ET in rice defence against D. angustus make the plants more susceptible to this nematode. It is important to note that AOPP not only inhibits PAL but also auxin biosynthesis (Soeno et al., 2010). Hormone application has been shown to induce defence against many fungal, bacterial and nematode pathogens (De Vleesschauwer et al., 2008; Nakashita et al., 2003; Nahar et al., 2011; Nahar et al., 2012). BTH/SA application on roots of Arabidopsis or tomato, and shoots of okra, cowpea or grapevines induce resistance to cyst and RKN (Owen et al., 2002; Nandi et al., 2003; Branch et al., 2004; Wubben et al., 2008), possibly by elevated expression of defence related genes. Nahar et al. (2011) observed that foliar application with MeJA and ethephon strongly activated defence pathways in systemic rice roots, exemplified by the strong upregulation of pathogenesis-related genes OsPR1a and OsPR1b and make the rice plants more resistant towards RKN, M. graminicola. BTH, MeJA, and Eth application on rice shoot also induced resistance against migratory nematode, H. oryzae (Nahar et al., 2012).

Analysis of gene expression of SA, JA and ET defence signaling pathway in both compatible and incompatible rice-D. angustus interaction revealed that OsICS1 and OsWRKY45-based SA- signaling is induced at 1 dpi in resistant plants, while the OsPAL1 seems important throughout the time points. Based on its contrasting expression profile between the compatible and incompatible interaction, we hypothesize that OsPAL1 is involved in triggering the defence responses in the resistant Manikpukha. Moreover, the slight but consistent upregulation of OsICS1 probably contributes to the defence in the resistant cultivar. SA responsive OsWRKY45 might play a role during the early defence response (1 dpi) of Manikpukha, but is only later induced (10 and 20 dpi) in Nipponbare upon D. angustus infection.

The result also showed that JA biosynthesis and signaling at 1 dpi and OsACS1, OsERF1 at 5 and 10 dpi might a have role in defence in resistant plants to the nematode. However, downregulation (OsPAL1, OsACS1 and OsERF1) or base line expression of most of the genes of SA, JA and ET pathway in the susceptible cultivar during the time course of nematode infection indicates that D. angustus can suppress the defence response triggered by the plants. Taken together, these data indicate that the JA pathway might be temporarily activated during the early defence response (1 dpi) of Manikpukha upon D. angustus infection and a consistent upregulation of OsACS1 and OsEin2b upon nematode infection in the incompatible interaction suggests a positive correlation between ET-inducible gene expression in rice and defence to D. angustus. Previous data from our lab on other rice-nematode interactions showed that SA (except OsPAL1) and ET pathway genes were attenuated at 1-3 days after RKN inoculation in locally infected tissues (Nahar et al., 2011) 90

Chapter 4 Role of SA, JA, and ET in rice defence against D. angustus as well as in systemic shoot tissues (Kyndt et al., 2012). On the other hand, OsACS1 and OsAOS2 was upregulated in the root of H. oryzae infected plants (Nahar et al., 2011), whereas the phenylpropanoid pathway and ethylene pathway genes were upregulated in systemic shoot tissues at 3 days after H. oryzae inoculation (Kyndt et al., 2012). Kumari et al. (2016) found that the RKN resistant variety Vandana significantly upregulated the SA biosynthesis genes, JA and ET pathway genes at early (2 days post inoculation) and later (6 days post inoculation) stages of nematode infection whereas in susceptible variety Pusa 1121, these genes are suppressed at later stages of nematode infection.

Activation of rice OsPR1 genes (OsPR1a and OsPR1b) is an important part of rice defence which can be regulated by different hormone signaling molecules such as JA, SA, ET and ABA (Agrawal et al., 2000, 2001a, 2001b; Reymond & Farmer, 1998). The rice OsPR5 gene also has been shown to be effective against pathogens (Datta et al., 1999; Grover & Growthaman, 2003) and is regulated by SA and JA (Rakwal et al., 2001; Fu et al., 2013). The importance of PR genes in rice defence against PPN has been reported in previous investigations (Nahar et al., 2011; 2012; Ji et al., 2015; Kyndt et al., 2012; Kumari et al., 2016). PR genes such as, OsPR1b, OsPR10 and OsPR1a are strongly upregulated in rice roots upon M. graminicola infection at 3 and 7 dpi suggesting activation of defence pathways in the roots (Kyndt et al., 2012). Kumari et al. (2016) demonstrated that OsPR1a and OsPR10 were consistently upregulated in the roots of both susceptible and resistant cultivars during RKN infection at 2 and 6 dpi whereas, OsPR1b was significantly attenuated in the susceptible root at both time points. We have investigated two PR genes, OsPR1a and OsPR5 in both compatible and incompatible interactions in the current study. Intriguingly, our result showed that only OsPR5 was significantly upregulated in susceptible shoot tissues at all time points (1, 5, 10 and 21 dpi) upon D. angustus infection. In the incompatible interactions, these two PR genes did not show significant differential expression upon nematode infection. The explanation could be that OsPR5 may have particular function in susceptible response compared to resistant reactions and different PR proteins have different functions in susceptible and resistant interactions (Hou et al., 2012) or the nematodes can influence the expression pattern of our studied PR genes. Nevertheless, our experiments showed interesting phenomena awaiting further interpretation. However, differential expression of PR genes has also been reported in systemic shoot tissues of different crops upon RKN and H. oryzae infection (Sanz-Alferez et al. 2008; Hamamouch et al., 2011; Kyndt et al., 2012; Molinari et al., 2014; Kumari et al., 2016).

Chapter 4 Role of SA, JA, and ET in rice defence against D. angustus

Measurement of SA in susceptible and resistant cultivars of rice at 1 dpi showed no significant changes in hormone accumulation after nematode infection in the resistant cultivar but the SA accumulation was significantly reduced in the infected susceptible Nipponbare plants at 1 day after nematode infection. However, our gene expression analysis with the resistant cultivar showed that the phenylpropanoid pathway (involving OsPAL1) was strongly activated in the shoots of the resistant variety, but this is not paralleled with SA level at 1 dpi (Fig 4.3 and Fig. 4.4A). We therefore hypothesize that PAL, which is the entry-point enzyme of the general phenylpropanoid pathway could contribute to the biosynthesis of phenolics, lignins, stilbenes and many other compounds (Winkel-Shirley, 2001; Vogt, 2010; Fraser & Chapple, 2011), rather than SA production. It has been reported that phytoalexins, isoflavonoids, phenylpropanoids, lignins play important roles in plant defence (Hölscher et al. 2014; Collingborn et al. 2000; Plowright et al., 1996). It has been reported that the phenylpropanoid pathway is known to be positively regulated by JA and its derivate methyl jasmonate (MeJA), which have been found to induce the accumulation of PAL (Kazan & Manners, 2008; Galis et al., 2006; Pauwels et al., 2008; Taheri et al., 2010). In case of JA measurements, a significant increase in JA accumulation was observed in the resistant Manikpukha plants at 1 dpi. The results of gene expression analysis of JA pathways show strong similarity with the observed JA accumulation at 1 dpi (Fig 4.3 and Fig. 4.4B).

The contribution of lignin to the plant basal defence against PPN has been well documented (Fogain & Gowen, 1995; Wuts et al., 2006; Wuts et al., 2007). We found a significantly higher lignin content in the resistant cultivar upon nematode infection compared to the susceptible cultivar. This high accumulation of lignin in the shoot tissues of the resistant cultivar probably strengthens the plant cell wall, which can inhibit nematode penetration and migration inside the resistant plants (Gheysen & Jones, 2006). The higher lignin content in the resistant cultivar is most likely due to the high upregulation of the OsPAL1 gene upon infection. PAL catalyzes the deamination of phenylalanine to trans-cinnamic acid, also a precursor for the lignin biosynthesis pathway (Dixon & Pavia, 1995). The results also showed that the lignin content and the OsPAL1-expression decreases in the susceptible plant after nematode infection. Similarly, PAL genes were significantly suppressed in giant cells induced by M. graminicola in rice (Ji et al., 2013). β-aminobutyric acid (BABA) application, which makes the plants more resistant towards RKN, also strongly induces the genes involved in lignin biosynthesis in rice plants (Ji et al., 2015). Again similar to our results,

Chapter 4 Role of SA, JA, and ET in rice defence against D. angustus

Kumari et al. (2016) recorded a greater induction of lignin biosynthesis genes in the roots of a resistant cultivar versus a susceptible cultivar at 2 days after RKN inoculation.

The OsPAL1 gene was significantly upregulated in the resistant cultivar Manikpukha which is comparable with the result of fig. 4.2 where we found that application of PAL inhibitor makes the plants more susceptible for nematode infection resulting in a higher number of nematodes per plant. We have also found that this increased upregulation OsPAL1 is not correlated with SA production. Interestingly higher lignin content in the resistant cultivar which might be partly due to high upregulation of OsPAL1 upon nematode infection indicates that the general phenylpropanoid pathway might have an important role in rice resistance against D. angustus. Therefore, it will be particularly interesting to investigate other secondary metabolites such as phenolics, flavonoids in the resistant cultivar upon nematode infection. Moreover, the application of PAL inhibitor in Manikpukha will provide valuable insights about the important of the phenylpropanoid pathway.

4.5 Conclusion

In summary, SA, JA and ET play a positive role in rice basal defence against D. angustus. We have also shown that OsPAL1 is upregulated in the resistant plant upon nematode infection, but its induction is not correlated with increased SA production. Our data rather demonstrate that lignin accumulation contributes to rice resistance against the nematode, D. angustus.

4.6 Materials and methods

4.6.1 Plant materials and growth condition

The SA-deficient NahG lines (Yang et al., 2004), ET transgenic OsEin2b RNAi line (Bailey et al., 2009) were kindly provided by Yinong Yang (Pennsylvania State University) and the corresponding wild type ‘Nipponbare’ (japonica type) was provided by USDA; GSOR-100. The JA biosynthesis mutant hebiba (Riemann et al., 2003) and it background ‘Nihonmasari’ were generously provided by P. Nick (Karlsruhe University, Germany). OsWRKY45 RNAi line was a gift from Hiroshi Takatsuji (Plant Disease Resistant Research Unit, National Institute of Agrobiological Sciences, Ibaraki 305-8602, Japan). Manikpukha (indica type), an ufra resistant variety (Khanam et al., 2015) was collected from Bangladesh Rice Research Institute (BRRI),

Chapter 4 Role of SA, JA, and ET in rice defence against D. angustus

Gazipur-1706. Before transferring to SAP-substrate (Reversat et al., 1999) in glass tube (15×2.5 cm), the seeds were pre-germinated on wet filter paper for 5 days at 30°C. The glass tubes were kept at 26°C under a 12h/12h light-regime (150 μmol/m²/s) and 70-75% Relative Humidity.

4.6.2 Infection experiments

The nematode, D. angustus obtained from Plant Pathology Division of BRRI was originally isolated from an infested farmer's field in the Gazipur district, Bangladesh. The nematode culture was maintained in vivo on a susceptible rice cultivar, BR3 (indica type; provided by BRRI) at 26°C under a 12h/12h light-regime (150 μmol/m²/s) and 70-75% Relative Humidity. The nematodes were extracted from D. angustus infected rice stems using the modified Baermann method (Luc et al., 2005). The stems were longitudinally divided, cut into 5mm pieces and placed over a sieve to let the nematode migrate out of the plant tissues overnight. The nematode suspension was collected and counted using a stereomicroscope. Fifteen days old rice seedlings were inoculated with approximately 100 nematodes of D. angustus per plant or mock-inoculated with water. The inoculation method was done as described by Rahman (1993). At 15 days after sowing, the water was raised up to the upper most node of the seedling. The infection level of the plant was evaluated at 20 days post inoculation (dpi) by counting the number of nematodes per plant.

4.6.3 Chemical treatments

The chemicals methyl jasmonate (MeJA), and ethephon and BTH (benzo 1, 2, 3 thiadiazole-7- carbothioic acid S-methyl ester were purchased from Sigma (Bornem, Belgium). For the pharmacological experiment, JA biosynthesis inhibitor, diethyldithiocarbamic acid (DIECA), ET biosynthesis inhibitor aminooxyacetic acid (AOA) and SA pathway inhibitor, L-2-Aminooxy-3- phenylpropinoic acid (PALi) were also purchased from Sigma (Bornem, Belgium). The chemicals were used in the following concentrations: MeJA (100 μM), BTH (250 μM), ethephon (500 μM), DIECA (100 μM), AOA (25-50mM) and PALi (100 μM). All hormone and hormone inhibitor solutions were prepared in separate vaporizers; the solutions were dissolved in water containing 0.02% (v/v) Tween 20. Before diluting into water, the chemicals were first dissolved in ethanol except ethephon and BTH. The prepared chemicals with indicated concentration were sprayed with vaporizers as a fine mist of either compound on to the leaves of 15 days old seedlings until runoff. In the control treatment, only distilled water containing 0.02% (v/v) Tween 20 was sprayed. In the

Chapter 4 Role of SA, JA, and ET in rice defence against D. angustus infection experiment, the nematode inoculation was done 24 hours after the chemical spray. All experiments were repeated three times.

4.6.4 Data collection and statistical analysis

Gene expression analysis was done by analysing the qPCR obtained data using the REST software 2009 (Corbett Research; Pfaffl et al., 2002). This software compares the relative expression between control and sample group with statistical significance. All other data were analysed in statistical software, IBM SPSS version 22 (IBM SPSS, Inc., Chicago, IL, USA). Collected data from infection experiments were analysed using analysis of variance (ANOVA) and the mean differences of the control and treated group were analysed by Duncan’s multiple range test (α = 0.05). Before analysis, normality of the data were tested with Kolmogorov-Smirnov Test of Composite Normality (α = 0.05) by boxplot visualization. Homogeneity of variance was checked by applying the Levene test (α = 0.05). The assumptions of normality and homoscedasticity of the data were found to be fulfilled. Data from hormone measurement experiments were analysed using the non-parametric Kruskal-Wallis test (α =0.05).

4.6.5 RNA extraction, and cDNA synthesis

RNA extraction was done by using the RNeasy Plant Mini kit (Qiagen, Venlo, The Netherlands). After addition of RTL buffer, an extra sonication step was done. The concentration and purity of RNA was measured by a NanoVueTM spectrophotometer (GE Healthcare). Afterwards, the extracted RNA was treated with DNaseI to remove all contaminating DNA. One microgram of RNA was treated with 1 µl DNaseI (1 U· µl−1; Fermentas), 1 µl RiboLockTM RNase Inhibitor (40 U· µl−1; Fermentas) and 1.8 µl DNaseI buffer (10×, Fermentas) in a total volume of 18 µl. The mixture was incubated at 37oC for 30 min. Then 2 µl 25mm EDTA (Fermentas) were added followed by another incubation at 65oC for 10 min to stop the reaction.

Chapter 4 Role of SA, JA, and ET in rice defence against D. angustus min at 42oC. The third step was addition of 1 µl SuperScript II Reverse Transcriptase (200 U· µl−1; Invitrogen), with incubation for 2 h at 42oC. After completing the final step of cDNA synthesis, 60 µl water was added to the solution to dilute. The cDNA quality was examined by standard PCR with some reference genes and the PCR products were checked on a 1.5% agarose gel.

4.6.6 qRT-PCR

The SensiMix SYBR No-ROX Kit (Bioline, London, UK) was used to perform qRT-PCR. Each reaction contained 10µl of 2×SensiMix, 500 nM of each primer and 1 µl of cDNA in a total volume of 20 µl. All reactions were performed in three technical replicates on a Rotor-Gene 3000 (Corbett Life Science, Hilden, Germany) and analyzed with Rotor-Gene 6000 software version 1.7. The conditions for performing the PCR reactions were: 10 min at 95oC and 45 cycles of (25 s at 95oC, 60s at 58oC and 20 s at 72oC). A melting curve was generated after the PCR reaction by gradually increasing the temperature to 95oC to test for amplicon specificity. The data were analyzed by REST 2009 software to determine statistically significant differences (Pfaffl et al., 2002).

Table 4.1: Summary of the reference and target genes used in the study, with their GenBank accession number or locus number, and the primer pair used for qRT-PCR

Target Gene GenBank Forward primer (5’-3’) Reverse primer (5’-3’) Accession/Locus no. OsEXP LOC_Os03g27010 TGTGAGCAGCTTCTCGTTTG TGTTGTTGCCTGTGAGATCG OsEXPNarsai LOC_Os07g02340.1 CACGTTACGGTGACACCTTTT GACGCTCTCCTTCTTCCTCAG OsPAL1 LOC_Os02g41630 TGTGCGTGCTTCTGCTGCTG AGGGTGTTGATGCGCACGAG OsICS1 LOC_Os09g19734 TGTCCCCACAAAGGCATCCTGG TGGCCCTCAACCTTTAAACATGCC OsWRKY45 Os05g0323900 AATTCGGTGGTCGTCAAGAA AAGTAGGCCTTTGGGTGCTT OsAOS2 NM_001055971.1 TGCGCGACCGCCTCGATTTC GGCCAGGCGGGACGTTGATG OsJMT1 LOC_Os06g0314600 CACGGTCAGTCCAAAGATGA CTCAACCGTTTTGGCAAACT OsJAmyb AY026332 GAGGACCAGAGTGCAAAAGC CATGGCATCCTTGAACCTCT OsACS1 LOC_Os03g51740 GATGGTCTCGGATGATCACA GTCGGGGGAAAACTGAAAAT OsACO7 LOC_Os01g39860 GGACTACTACCAGGGCACCA GATTAGCGCACGCGATTTTA OsEin2b Os07g06190 GCGCATGTTGTAGAAGACGA CAGGCAGCTTCGAATCAAGT OsERF1 LOC_Os04g46220 AAGGGTCATAATTCGCGTCA TCCACACCACAAGACATCGT OsPR1a Os07g0418500 TCGTATGCTATGCTACGTGTTT CACTAAGCAAATACGGCTGACA OsPR5 X68197 ACCTCTTCCGCTGTCCTC GAAGACGACTTGGTAGTTGC

4.6.7 SA and JA quantification

The phytohormone SA and JA were quantified in the shoots of D. angustus infected and non- infected Nipponbare and Manikpukha at 5 dpi. Collected shoot materials were homogenized by grinding in liquid N2 and extracted at -80°C using the modified Bieleski solvent. After filtration

Chapter 4 Role of SA, JA, and ET in rice defence against D. angustus and evaporation, chromatographic separation was performed on a U-HPLC system (Thermo Fisher

Scientific) equipped with a Nucleodur C18 column (50 x 2 mm; 1,8 µm dp) and using a mobile phase gradient consisting of acidified methanol and water. Mass spectrometric analysis was carried out in selected-ion monitoring (SIM) mode with a Q Exactive™ Orbitrap mass spectrometer (Thermo Fisher Scientific), operating in both positive and negative electrospray ionization mode at a resolution of 70,000 full width at half maximum.

4.6.8 Lignin measurement

Lignin content was measured in the shoots of D. angustus infected and non-infected Nipponbare and Manikpukha at 5 dpi. Lignin content was measured using a modified Klason method (Bosch et al., 2015), where the 4 hour incubation with a soxhlet extractor was replaced by a 1 hour incubation at 121 °C in an autoclave.

Chapter 5: Effect of Bacillus velezensis strain BSK isolated from Bangladesh on rice growth and defence against Ditylenchus angustus

Shakhina Khanam, Abdul Mannan Akanda, Tina Kyndt and Godelieve Gheysen

Chapter 5 BSK mediated ISR

5.1 Abstract

The potential of a rhizobacterium, Bacillus velezensis strain BSK isolated from Bangladesh in promoting plant growth of rice and inducing systemic resistance to the rice stem nematode, Ditylenchus angustus was evaluated in this study. The effect of the bacterium on plant growth was tested at three different concentrations (104, 106 and 108 colony forming units per ml; cfu ml-1) and with two different methods of inoculation (seed and soil inoculation). Our results showed that soil inoculation with 104 cfu ml-1 appeared to increase root and shoot length with a significant increase of root and shoot weight. Soil drenching with bacteria prior to D. angustus inoculation in rice resulted in a significantly lower number of nematodes per plant as compared with non-treated control plants. The plant response upon soil inoculation of bacteria with or without D. angustus infection was studied at the transcriptional level in systemic shoot tissues by qRT-PCR. The relative expression of some SA/JA/ET-marker genes was investigated. The result reveals that the bacteria can influence the gene expression in the systemic shoot tissues and this might affect the outcome of the rice-D. angustus interaction.

5.2 Introduction

Biological control is considered as an ecologically and economically friendly approach to reduce plant diseases. Biological control can be defined as the use of living organisms or their metabolites to reduce the population density or disease impact of a specific pathogen or pest organism (Eilenberg et al., 2001). Bacteria that colonize the rhizosphere and exert beneficial effects on plant growth and development are generally termed as plant growth-promoting rhizobacteria (PGPR) (Kloepper et al., 1980; Lugtenberg and Kamilova, 2009). PGPR are one of the important group of soil microorganisms that are capable of suppressing a wide range of pathogens including plant- parasitic nematodes (PPN). Among PGPR, Bacillus spp. and Pseudomonas spp. are dominant populations in the rhizosphere that can affect PPN (Rovira & Sands, 1977; Rack & Sikora 1992; Sikora, 1992). Rhizobacteria can reduce nematode populations by different mechanisms such as by affecting nematode behaviour (Sikora & Hoffmann-Hergarten, 1992), competing for essential nutrients (Oostendorp & Sikora, 1990), promoting plant growth (El-Nagdi & Youssef, 2004), interfering with plant–nematode recognition (Oostendorp & Sikora, 1990), antagonising the

Chapter 5 BSK mediated ISR nematodes by the production of toxins, enzymes and other metabolites (Siddiqui & Mahmood, 1999) and inducing systemic resistance (Hasky-Gunther & Sikora, 1995).

The bacterial strain used in the current study was isolated from a field of Bangbandhu Sheikh Mujibur Rahman Agricultural University, Gazipur, Bangladesh. The isolated bacteria was identified based on partial gyrase B (gyrB) gene sequence analysis using BLAST. The isolated bacteria showed closest similarity to Bacillus methylotrophicus strain B25, B. amyloliquefaciens subsp. plantarum strain NJN-6, B. amyloliquefaciens subsp. plantarum strain CAU B946, and B. amyloliquefaciens strain BGP20, all with 100% sequence identity. However, Dunlap et al. (2016) recently showed that B. oryzicola KACC 18228, B. velezensis NRRL B-41580, B. methylotrophicus KACC 13015 and B. amyloliquefaciens subsp plantarum FZB42 are closely related and they propose to reclassify these strains as later heterotypic synonyms of B. velezensis. Hence, we named our isolate B. velezensis strain BSK. Bacterial strains belonging to the clade B. velezensis are all plant-associated microorganisms that have been reported as potential bio-control agents against a number of pathogens including nematodes (Borriss, 2011; Chowdhury et al., 2013, 2015; Burkett-Cadena et al., 2008; Almaghrabi et al., 2013).

Besides production of antimicrobial, antiviral and nematicidal compounds, PGPR also can induce systemic resistance (ISR; Van Wees et al., 2008; Pieterse et al., 2014; De Vleesschauwer et al., 2006; 2009; Doornbos et al., 2012) which contributes to pathogen suppression. A number of bacterial elicitors contributing to ISR such as flagella, lipopolysaccharides, quorum-sensing molecules, volatile organic compounds and cyclic lipopeptides (Jourdan et al., 2009; Pieterse et al., 2014) has been identified. Cyclic lipopeptides namely surfactin, iturin and fengycin family CLPs can be produced by multiple Bacillus spp. with a number of biological activities (Raaijmakers et al., 2010; Wu et al., 2015; Elshak et al., 2016). Cawoy et al. (2014) showed that lipopeptides are the main ingredients for inhibition of fungal phytopathogens by B. subtilis/amyloliquefaciens. Stimulation of ISR by bacterial metabolites is likely the main mechanism responsible for biocontrol action of B. amyloliquefaciens strains FZB42 (Wu et al., 2015; Chowdhury et al., 2015; Cawoy et al., 2015). Soil application of B. subtilis BBG111 triggers induced systemic resistance in rice against rice sheath blight caused by Rhizoctonia solani. Cyclic lipopeptides, fengycin and surfactin produced by B. subtilis BBG111 target JA, ET and/or auxin pathways indicating the role of fengycin and surfactin in the induced defence state (Chandler et al.

100

Chapter 5 BSK mediated ISR

2015). Geng et al. (2016) identified a protein from B. firmus DS-1 called Sep 1 that exhibited serine protease activity and degraded the intestinal tissues of nematodes.

Studies with defence signaling pathways revealed that ISR triggered by PGPR is generally regulated by jasmonic acid (JA) - and ethylene (ET)-dependent signaling pathways and is typically not related with the direct activation of PR genes (Van Wees et al., 1997; Vallad & Goodman, 2004). However, several examples of PGPR have been reported to trigger ISR in an SA-dependent manner (De Vleesschauwer & Hofte 2009; Van de Mortel et al., 2012). Treatment with B. amyloliquefaciens Lx-11 that was found to possess biocontrol activity against rice bacterial leaf streak (BLS) caused by Xanthomonas oryzae pv. oryzicola concurrently induced the defence- related genes PR1a, PR1b, NPR1 and PAL in the leaves of rice (Zhang et al., 2012). Siddiqui & Shaukat (2004) reported that ISR in tomato induced by P. aeruginosa 7NSK2 and P. fluorescens CHA0 against Meloidogyne javanica works through an SA independent signal transduction pathway.

The rice stem nematode, Ditylenchus angustus (Butler, 1913) is one of the most important plant parasitic nematode of rice in South and Southeast Asia which is responsible for “Ufra” disease in rice. It is an obligate parasite that causes considerable yield losses in deep water, irrigated and rainfed rice (Prasad et al., 2000; Latif et al., 2004). Farmers are mostly dependent on nematicides as a relatively reliable method of nematode control. However, increasing use of chemical inputs causes numerous negative effects, i.e., development of nematode resistance and non-target environmental impacts (Weger et al., 1995; Haydock et al., 2013), emphasizing the need for an environmentally friendly, alternative management strategy to control this nematode. The use of beneficial microbes, in association with host resistance, holds great prospective as an environmentally friendly approach for plant disease management (Pérez-García et al., 2011).

In this chapter, we evaluated (1) the effect of B. velezensis strain BSK on rice growth at different bacterial concentrations, (2) the potential of strain BSK to induce systemic resistance against D. angustus at different bacterial concentrations and (3) the involvement of SA, JA and ET defence signaling pathways involved in rice-D. angustus- B. velezensis strain BSK interactions.

101

Chapter 5 BSK mediated ISR

5.3 Results

5.3.1 Effect of Bacillus velezensis strain BSK on rice growth

From Fig. 5.1 A it is observed that in case of shoot and root length, there was no significant difference between bacteria treated and control rice plants. Among three concentrations tested as seed and soil treatment, soil treatment with 104 cfu ml-1 bacterial concentration performed best. In case of fresh shoot and root weight (Fig. 5.1 B), a significant increase was observed in plants treated with the lowest concentration of bacteria compared to the control plants. Soil treatment with 104 cfu ml-1 produced significantly higher shoot and root weight than control plants respectively.

102

Chapter 5 BSK mediated ISR

Fig 5.1. Effect of Bacillus velezensis strain BSK on rice growth at 104, 106 and 108 cfu ml-1 upon seed and soil treatment, at 28 days after sowing. (A) Shoot and root length, (B) Fresh shoot and root weight. The bars represent the mean and standard error recorded on 8 plants. Different letters indicate statistically significant differences (Duncan’s multiple range test with α= 0.05). Data represent one of three independent experiments with similar results. The data from the other replicates is shown in appendix fig A9.

5.3.2 Determination of Ditylenchus angustus infection in Bacillus velezensis strain BSK treated rice plants

Based on the positive effect on rice growth after soil treatment with the bacteria, we further studied the potential of strain BSK as an antagonistic organism against the rice stem nematode, D. angustus. The bacteria treated rice plants had a significantly reduced number of nematodes per plant compared to the control plants. The plants treated with 104 cfu ml-1 had 69%, 106 cfu ml-1 had 103

Chapter 5 BSK mediated ISR

68% and 108 cfu ml-1 had 12% reduction in number of nematodes per plant compared to the control plants.

Fig 5.2. Effect of soil treatment with Bacillus velezensis strain BSK, at different concentrations, on the number of nematodes per plant. The bacteria at 104, 106 and 108 cfu ml-1 were drenched over SAP-substrate during seedling sowing and 12 days after sowing. Plants were inoculated with 100 nematodes of D. angustus at 1 day after bacteria inoculation. The bars represent the mean and standard error of the number of nematodes per plant 20 days after nematode inoculation recorded on 8 plants. Different letters indicate statistically significant differences (Duncan’s multiple range test with α = 0.05). Data represent one of three independent experiments with similar results. The data from other replicates is in appendix Fig A10.

5.3.2 Gene expression in systemic rice shoots upon Bacillus velezensis strain BSK inoculation

The plant response in systemic shoot tissues upon soil inoculation of bacteria with or without D. angustus infection was studied at the transcriptional level by qRT-PCR. The relative expression of 6 defence related genes of SA/JA/ET-marker genes was investigated (Fig 5.3). The expression of most tested genes was not significantly different between treatment and control (Fig. 5.3). The SA pathway genes OsICS1 and OsWRKY45 tend to be downregulated in shoot tissues from infected plants, except for OsICS1 being slightly upregulated at 6 days after nematode inoculation in the bacteria treated plants. The JA pathway genes, OsAOS2 and OsJAmyb tend to be upregulated upon nematode infection with or without bacteria treatment. The OsEIN2 gene from the ET pathway showed a downregulation trend at 6 dai upon nematode infection with or without bacteria

104

Chapter 5 BSK mediated ISR treatment. The pathogenesis gene OsPR10 was upregulated in all cases with a significant difference at 6 dai in nematode-infected plants which were treated with B. velezensis strain BSK.

Fig 5.3. Analysis of the expression levels (using qRT-PCR) of some selected defence-related genes in rice shoots upon Bacillus velezensis strain BSK with or without Ditylenchus angustus infection at 1 and 6 days after bacterial inoculation (dai). Bars represent the mean and standard error of the relative amount of transcripts of these genes from two biological replicates (n=2), each containing a pool of shoot tissue from three infected plants in comparison with the corresponding control plants grown under the same conditions. Gene expression levels were normalized using two internal reference genes, OsEXP and OsEXPNarsai. Asterisks indicate statistically significant (P ≤ 0.001) differential expression in comparison with untreated uninfected plants, performed by 2000 randomisations using REST 2009.

5.4 Discussion Biological control using antagonistic bacteria is considered to be environmentally friendly and can be applied as an integrated disease management tool. In line with this view, in this study we evaluated the efficacy of a rhizobacterium, B. velezensis strain BSK on rice growth and possible ISR activity against D. angustus. Moreover, we have investigated the underlying gene expression pattern with regards to the phytohormone pathways of SA, JA and ET in the rice- strain BSK -D. angustus interaction.

The study of strain BSK effect on rice growth showed that soil treatment with 104 cfu ml-1 promotes a significant increase of root and shoot weight compared to control plants. However, the higher bacterial concentrations (106 and 108 cfu ml-1) showed no difference in shoot, root length and weight compared with the non-inoculated control rice plants. The growth promoting effect at low

105

Chapter 5 BSK mediated ISR bacterial concentration supports the findings of Ramírez & Joseph (2010), who have shown that plant growth promotion by B. amyloliquefaciens FZB45 depends on inoculum rate and P-related soil properties; the lower rate (106 spores per seedling) was superior compared to the higher (108 spores per seedling) for shoot fresh weight and plant inorganic P content. They observed that strain FZB45 exerts a direct mechanism on plant growth, probably by indole-3-acetic acid (IAA) production, which creates a concentration-dependent response to inoculation and interacts with phytase-mediated effects (Ramírez & Joseph, 2010).

B. methylotrophicus sp. nov. from rice rhizosphere soil was found to promote plant growth (Madhaiyan et al., 2010). A number of rhizobacteria has been identified as plant growth promoting in rice (Adhikari et al., 2001; Ashrafuzzaman et al., 2009; Suprapta et al., 2016). PGPR promote plant growth and development through a variety of mechanisms such as the production of phytohormones, the suppression of deleterious organisms, the activation of phosphate solubilisation and promotion of the mineral nutrient uptake. It has been reported that the presence of IAA and phytase activity of B. amyloliquefaciens FZB45 are important for plant growth- promotion under phosphate limitation (Idris et al., 2007; Idriss et al., 2002). Ryu et al. (2003) found that B. subtilis GB03 and B. amyloliquefaciens IN937a release a blend of volatile components, in particular, the volatile components 2, 3-butanediol and acetoin that promote growth of Arabidopsis thaliana. Nothing is know about B. velezensis strain BSK. Further studies are needed to reveal the mechanism of growth promotion by strain BSK.

A number of Bacillus species has been shown to induce systemic resistance reducing penetration and reproduction of RKN or cyst nematodes in different crop species (Hasky-Gunther & Sikora, 1995; Schafer et al. 2006; Hauschild et al. 2000; Almaghrabi et al., 2013). Using the strain BSK we evaluated for the first time the effect of ISR against the rice stem nematode, D. angustus. We observed that drenching of soil with strain BSK significantly reduced the number of D. angustus on rice by up to 69% compared to the control without BSK. Our results also showed that treatment with a low concentration of strain BSK (104 and 106 cfu ml-1) performed better for controlling nematodes compared to a higher concentration (108 cfu ml-1). Soil drenches or seed treatments of tomato with a new Bacillus species, B. methylotrophicus strain R2-2 has been found to suppress disease caused by the root-knot nematode M. incognita in petridish, greenhouse and field conditions (Zhou et al., 2016). Another B. methylotrophicus strain BC79 was found to reduce the

106

Chapter 5 BSK mediated ISR rice blast caused by Magnaporthe oryzae (Shan et al., 2013). A novel endophytic strain, B. oryzicola YC7007 isolated from rice roots has been reported to suppress bacterial blight of rice caused by Xanthomonas oryzae pv. oryzae, panicle blight caused by Burkholderia glumae and bakanae disease of rice caused by Fusarium fujikuroi (Hossain et al., 2016) via direct inhibition, induced systemic resistance through primed induction of the jasmonic acid pathway (Hossain et al., 2016) and antibiotic production (Chung et al., 2015). It has been reported that volatile compounds consisting of 2, 3- butanediol and acetoin (3-hydroxy-2-butanone) from B. amyloliquefaciens activates ISR in Arabidopsis seedlings (Ryu et al., 2003). Chowdhury et al. (2015) demonstrated that cyclic lipopolysaccharide contribute to the ISR plant response triggered by FZB42. However, almost nothing is known about strain BSK mediated ISR against pathogens and hence the mechanisms remains to be further studied.

Typically, rhizobacteria mediated ISR is mediated by JA and/or ET signaling pathways. By contrast, SA seems to be an important messenger in SAR (Pieterse et al., 2014). However, analysis using the B. subtilis strain FB17 on defense-compromised mutants of A. thaliana indicated that ISR against Pseudomonas syringae pv. tomato DC3000 occurs via NPR1 and requires SA/ET whereas jasmonic acid (JA) is not essential (Rudrappa et al., 2010). Chowdhury et al. (2015) observed that B. amyloliquefaciens subsp. plantarum FZB42 increased expression of PR1 (pathogenesis protein 1, an SA marker gene), and plant defensin factor 1.2 (PDF1.2; defensin, JA/ET marker gene) in lettuce in absence of the pathogen, suggesting that SA and ET pathways are involved in upregulating the defense response. However, simultaneous presence of these rhizobacteria and the pathogen R. solani enhanced PDF1.2 expression and decreased PR-1 expression suggesting a synergistic activation of the JA/ET pathway and suppression of the SA pathway in presence of both micro-organisms. We studied SA, JA and ET signaling pathway to elucidate the BSK mediated ISR against D. angustus in rice (Fig 5.3). In our observation, no significant differential expression of any of the SA, JA and ET pathway genes was detected. However, we observed a trend of downregulation of the SA pathway genes and upregulation of OsAOS2 and OsPR10 genes at 1 day after BSK inoculation in absence of the nematodes. In presence of both BSK and the nematodes, a trend of upregulation was observed for OsICS1, OsAOS2, and OsJamyb and a significant upregulation was observed for the OsPR10 genes. Although further experiments are clearly needed, our results provide an indication that SA biosynthesis and the JA pathway and OsPR10 activation might be involved in strain BSK induced priming for resistance to D. angustus. OsPR10 is a

107

Chapter 5 BSK mediated ISR defence marker gene in rice which is positively regulated by different hormone signaling molecules such as SA, JA and ABA (Rakwal et al., 2001; Hwang et al., 2008; Choi et al., 2015). A strong upregulation of the JA inducible PR marker genes JiOSPR10 and PR10b was observed in rice cell cultures treated with cyclic lipopeptides (fengycin and mycosubtilin) produced by B. subtilis (Chandler et al., 2015).

A number of studies revealed that ISR mediated by rhizobacteria involved cell wall reinforcement and accumulation of H2O2 and defence-related phenolics, following pathogen infection (Ahn et al., 2007; De Vleesschauwer et al., 2008). Root-drench application of surfactin and live cells of mutant B. amyloliquefaciens strain FZB42-AK3 (produces surfactin, but not bacillomycin D and fengycin) significantly reduced disease incidence caused by Magnaporthe oryzae on perennial ryegrass through activation of multi-layered induced systemic defence responses including the rapid accumulation of H2O2, phenolic/polyphenolic compounds and callose at the sites of attempted pathogen entry, together with the timely oxidative burst driving single or multicellular HR-type reaction and enhanced expression of defence related genes (Rahman et al., 2015). Biocontrol activity of P. fluorescens isolate Pf1 against M. incognita in tomato is associated with enhanced PR-protein activity, the involvement of enzymes in the phenylpropanoid pathway and with an accumulation of phenolics (Anita et al., 2004). Ji et al. (2015) showed that BABA-induced resistance against RKN likely occurs independently of JA and ET, mainly through the activation of basal defense mechanisms of the plant, such as reactive oxygen species accumulation, lignin formation, and callose deposition. The non-significant expression of SA, JA and ET signaling pathways in BSK-mediated ISR in rice to D. angustus indicates that probably other mechanisms are involved in this tripartite interaction. Thus, further molecular, biochemical and histochemical analysis in the rice-strain BSK-D. angustus interaction will provide valuable information for efficient use of this biocontrol agent against nematodes.

5.5 Conclusion In summary, our results showed that a strain similar to B. velezensis strain BSK is a potential plant growth-promoting rhizobaterium and biocontrol agent against D. angustus. Our results showed that soil inoculation with a low bacterial density (104 cfu ml-1) promotes growth in rice and controls the nematode at a significant level, suggesting B. velezensis strain BSK as an economical and ecological alternative of chemical control for nematode management. Our results also reveals that

108

Chapter 5 BSK mediated ISR the OsPR10 gene is strongly induced in the rice-BSK-D. angustus interaction while the SA biosynthesis and JA pathway are not strongly involved in B. velezensis strain BSK induced systemic resistance.

5.6 Materials and methods

5.6.1 Plant materials and bacterial culture conditions

All experiments were conducted in controlled conditions (26°C under a 12h/12h light-regime, 150 μmol/m²/s and 70-75% Relative Humidity) with Nipponbare rice (japonica type, provided by USDA; GSOR-100). B. velezensis strain BSK was isolated from roots of healthy wheat (Triticum aestivum) plants from the research field of the Bangbandhu Sheikh Mujibur Rahman Agricultural University (BSMRAU), Gazipur, Bangladesh. The bacteria were grown on solid Luria-Bertani broth (LB) medium at 25 °C for 2 days. After scraping off the plates, the bacterial cells were suspended in sterile saline (0.85% NaCl). Desired concentrations of the bacterial suspensions were adjusted based on their optical density at 620 nm.

5.6.2 Nematode culture

The nematode D. angustus was obtained from the plant pathology division of Bangladesh Rice Research Institute (BRRI), Gazipur-1706. The nematode was originally isolated from an infested rice field in Gazipur district, Bangladesh. The nematode culture was maintained in vivo on the susceptible rice cultivar BR3 (indica type; provided by BRRI) at 26°C under a 12h/12h light-regime (150 μmol/m²/s) and 70-75% Relative Humidity. Nematodes were extracted from D. angustus infected stem using the modified Baermann method (Luc et al., 2005). The stems were longitudinally divided, cut into 5mm pieces and placed over a sieve overnight to release nematodes from the plant tissues. The nematode suspension was collected and nematodes were counted under a light microscope.

5.6.3 Growth analysis of rice treated with Bacillus velezensis strain BSK

The effect of B. velezensis strain BSK on rice growth was tested at a concentration of 104, 106, and 108 cfu ml-1 with two different methods: seed and soil treatments. Rice seeds were surface-sterilized with 70% ethanol for 1 min and shaken in 1.2% (w/v) NaClO solution for 15 mins. The seeds were

109

Chapter 5 BSK mediated ISR then washed three times with sterile distilled water. The seeds were pre-germinated on wet filter paper for 5 days at 30°C before transferring to SAP-substrate (Reversat et al., 1999) in a glass tube (15×2.5 cm). In case of seed treatment, one gram of the surface sterilized seeds were soaked in 10 ml bacterial suspension (104, 106, and 108 cfu ml-1) and water as control for 30 mins and then dried under laminar air flow. For soil treatment, the bacteria was drenched over SAP-substrate at a concentration of 104, 106, and 108 cfu ml-1 during seedling transferring to SAP-substrate and 12 days after sowing. In control treatment, only distilled water was drenched over SAP-substrate. Root, shoot length and weight were measured 28 days after sowing. Bacterial association on the root surface of the plant was confirmed by the time the bioassays were discontinued. Roots of three plants of each treatment were rinsed with sterile water and serial dilutions of the water were plated on LB medium and analysed after incubation at 25 °C for 2 days.

5.6.4 Infection experiments with Ditylenchus angustus

Surface sterilization of rice seeds (Nipponbare) and bacteria culture were done as described before. The bacteria was soil drenched at a concentration of 104, 106, and 108 cfu ml-1 during seedling transferring to SAP-substrate and 12 days after sowing. In control treatment, only distilled water was drenched over SAP-substrate. At 13 days after sowing, the bacterial and mock treated plants were inoculated with approximately 100 nematodes of D. angustus per plant (as described by Rahman, 1993). The water level was raised up to the upper most node of the 13-days old seedlings and the nematodes were inoculated into the water. The infection level of the plants was evaluated at 20 days post inoculation (dpi) by counting the number of nematodes per plant.

5.6.5 Data collection and statistical analysis

110

Chapter 5 BSK mediated ISR boxplot visualization. Homogeneity of variance was checked by applying the Levene test (α = 0.05). The assumptions of normality and homoscedasticity of the data were found to be fulfilled.

5.6.6 RNA extraction, and cDNA synthesis

There were three steps in synthesizing first strand cDNA. The first step was the addition of 1 µl oligo dT (700 ng·µl−1), 2 µl 10 mm dNTPs (Invitrogen, Gent, Belgium) and 4 µl RNAse-free water to the DNAse-treated RNA and incubation at 65oC for 10 min to remove secondary structures. The second step was the addition of 8 µl 5× first strand buffer (Invitrogen) and 4 µl 0.1 M DTT (Invitrogen) to the incubated mixture from the first step. The mixtures were then incubated for 2 min at 42oC. The third step was addition of 1 µl SuperScript II Reverse Transcriptase (200 U· µl−1; Invitrogen), with incubation for 2 h at 42oC. After completing the final step of cDNA synthesis, 60 µl water was added to the solution to dilute. The cDNA quality was examined by standard PCR with some reference genes and the PCR products were checked on a 1.5% agarose gel.

5.6.7 qRT-PCR

111

Chapter 5 BSK mediated ISR

Table: Summary of the reference and target genes used in the study, with their GenBank accession number or locus number, and the primer pair used for qRT-PCR

112

Chapter 6. General conclusion and perspectives

113

General conclusion and perspectives

6.1 ‘Manikpukha’, a promising ufra resistant variety

The rice stem nematode, Ditylenchus angustus (Butler, 1913), is one of the most devastating rice nematodes in some South and South-East Asian countries (Bridge et al., 1990). The nematode causes ‘Ufra’ disease in rice resulting in substantial yield losses in deep water, irrigated and rainfed ecosystems. With increasing restrictions on the use of chemical nematicides, the use of plant resistance for nematode control has grown in importance. Although some rice genotypes have been identified as ufra resistant in previous investigations (Miah & Bakr, 1977; Latif et al. 2011a; 2011b), the current cultivation of these identified resistant varieties in the field is limited because of their low yield potential. No high-yielding ufra-resistant variety is currently available.

We screened 85 rice genotypes for resistance to D. angustus (Chapter 2), from which 55 were BRRI released high yielding varieties and 11 were local varieties that are currently cultivated in different regions of Bangladesh. Our results showed that one local variety Manikpukha was highly resistant and six high yielding varieties (BR7, BR18, BRRI Dhan 35, BRRI Dhan 37, BRRI Dhan 40, and BRRI Dhan 45) were resistant against D. angustus based on two phenotypic screening methods. In addition, we have proved that there is a strong correlation between the number of nematodes and the used phenotypic scoring systems. Our study provides a view about the status of ufra susceptibility of the currently used varieties in Bangladesh. Remarkably, most of the tested local varieties showed a susceptible to highly susceptible reaction, which provides a concern about the high risk of using those varieties in ufra infected areas. Based on this study we can also recommend the farmers to cultivate BRRI released high yielding resistant varieties in ufra infected areas. Our identified highly resistant variety ‘Manikpukha’ has some advantages compared to the resistant reference variety R-16-06-3. R-16-06-3 is a deep water rice variety, which is not cultivated in Bangladesh nowadays because of the declining cultivation of deep water rice varieties. In contrast, Manikpukha is a local aman variety that is still cultivated in some parts of Bangladesh. In Manikpukha, a comparatively lower number of nematodes was observed compared to R-16-06-3 at 28 dpi. However, it will be interesting to test wether Manikphukha is also resistant against other nematodes and other populations of D. angustus to evaluate the durability of the observed resistance.

A more detailed investigation of the resistance in relation to the nematode’s life cycle (Chapter 3) showed that the resistance in Manikpukha is associated with reduced development and

114

General conclusion and perspectives reproduction of the nematodes implying that resistance acts post-invasion. Plowright et al. (1996) observed that invasion rate of D. angustus varied among resistant rice cultivars and the number of nematodes at 28 days after inoculation was higher in the susceptible cultivars compared to resistant cultivars. However, the information on nematode development inside resistant cultivars was lacking in previous investigation. In this thesis, we showed that the development of nematode was slower in the resistant cultivar Manikpukha compared to the susceptible cultivars (Chapter 3). We also found that the reproduction of the nematodes were completely failed in the resistant genotype. In case of RKN, it has been reported that M. incognita juveniles were smaller in resistant tomatoes compared to susceptible tomatoes (Dropkin et al., 1969) and females of M. graminicola were significantly smaller inside the resistant rice genotypes in comparison with susceptible rice genotypes (Cabasan et al., 2012). Further investigations on the morphological differences of D. angustus in resistant versus susceptible rice genotypes will be interesting.

The incompatible interaction between Manikpukha and D. angustus is characterized by a hypersensitive reaction (HR) that leads to necrosis (chapter 2). HR responses in plants following the recognition of nematodes are accompanied by changes in transcriptional and defence signaling pathways such as, production or release of reactive oxygen species (ROS, Davies et al., 2015),

H2O2 accumulation (Melillo et al., 2006), salicylic acid, lipoxygenase enzymes (Bhattarai et al., 2008; Klink et al., 2009), Ca2+ (Davies et al., 2014) and secondary metabolites (Paulson & Webster, 1972; Pegard et al., 2005). In chapter 4, we have showed that lignin accumulation was significantly increased in the resistant Manikphukha upon D. angustus infection. It will be interesting to study 2+ the ROS, H2O2 and Ca production in the resistant cultivar Manikpukha in comparison with the susceptible cultivar upon nematode infection. Furthermore, isolation, identification and localization of different secondary metabolites that are present in the resistant cultivars and could trigger defence against D. angustus should be investigated using analytical, biochemical and/or histochemical analyses. The examination of anti-nematode properties of these metabolites will provide valuable information for engineering nematode resistant varieties (Hölscher et al., 2014).

A comparative study of the gene expression changes of the SA, JA and ET pathways upon D. angustus infection in the resistant cultivar Manikpukha and the susceptible cultivar Nipponbare demonstrates that some genes remarkably changed in resistant plants compared to susceptible plants. These genes could at least partly govern resistance/susceptibility of plants to nematodes (Chapter 4). At the early stage of the rice-nematode interaction (1 dpi), all of the 12 SA/JA/ET 115

General conclusion and perspectives marker genes were upregulated in the resistant variety. We observed a significant upregulation of OsPAL1, OsWRKY45 and OsJMT1, whereas most of those genes were downregulated in the susceptible cultivar. Most remarkably, OsPAL1 was significantly upregulated in the resistant variety while it was downregulated in the susceptible Nipponbare upon nematode infection at 1, 5, 10 and 21 dpi. It has been reported that PAL, which is the entry-point enzyme of the general phenylpropanoid pathway could contribute in the biosynthesis of phenolics, SA, lignins, stilbenes and many other compounds (Winkel-Shirley, 2001; Vogt, 2010; Fraser & Chapple, 2011). Our results showed that the upregulation of OsPAL1 is not correlated with increased SA production in the resistant cultivar. However, the increased lignin content in the resistant cultivar is most likely due to the high expression of OsPAL1 upon infection. Moreover, the inhibition of the phenylpropanoid pathway through application of the PAL inhibitor yielded significantly higher numbers of nematodes in the susceptible cultivar. In this susceptible cultivar, a decreased level of lignin was observed upon infection, indicating again the importance of the phenylpropanoid pathway in rice resistance to D. angustus. Therefore, it will be particularly interesting to investigate the phenylpropanoid pathway in more detail, to get insights of the underlying mechanism involved in resistance against D. angustus. Moreover, application of the PAL inhibitor in Manikpukha before nematode infection will indicate how important the phenylpropanoid pathway is in the resistance of that cultivar and how does D. angustus suppress this pathways upon infection in Nipponbare.

Studies on the resistance of Manikpukha to D. angustus (Chapter 3), expression of defence-related genes of the SA, JA and ET pathway and lignin measurements (Chapter 4) reveal that Manikpukha is a good candidate for the development of an ufra resistant high yielding variety. However, before breeding for high-yielding ufra resistant varieties can be started, more knowledge on the inheritance of the resistance (monogenic or polygenic, race-specific or race-nonspecific) is a pre-requisite. Later on, molecular markers (for marker-assisted selection) can facilitate the introduction of the resistance into breeding materials and for positional cloning of the resistance gene(s) (Rouppe van der Voort et al., 1999; Milligan et al., 199; Rossi et al., 1998; Nombela et al., 2003; Galal et al., 2014).

116

General conclusion and perspectives

6.2 SA, JA and ET play a positive role in rice basal defence against the rice stem nematode D. angustus

Even in susceptible rice plants, there is some basal defense against D. angustus infection. Three classical defence hormones SA, JA and ET are known to play a major role in regulating this plant basal defence against various pathogens and pests (Lorenzo and Solano 2005; Broekaert et al., 2006; Glazebrook, 2005). In general, SA is associated with plant defence against biotrophic and hemibiotrophic pathogens and JA and ET play important roles in defence against necrotrophic pathogens and insect herbivory (Glazebrook, 2005). Although most information on the molecular interplay between plants and nematodes were focused on dicotyledonous plants, progress has been made in recent years concerning the role of hormone signalling pathways in rice-nematode interactions. However, nothing was known about the interaction between rice and rice stem nematode, D. angustus with regards to phytohormones.

In this thesis for the first time we provided an in-depth characterization of the role of SA, JA and ET in rice basal defence against D. angustus (Chapter 4). Based on hormone treatment, biosynthesis inhibition, analysis of mutant and transgenic plants it was shown that SA, JA and ET play a positive role in basal defence of rice against D. angustus. Interestingly, similar results were obtained in rice defence against the root rot nematode, Hirschmanniella oryzae by Nahar et al. (2012) who observed that intact SA, JA and ET biosynthesis pathways are prerequisite. But in the case of the RKN Meloidogyne graminicola the same authors found that the JA pathway plays a pivotal role and the ET pathway works through activation of the JA defence pathway in rice defence against RKN (Nahar et al., 2011). Such similarities of D. angustus with the root rot nematode can be explained by the fact that both are migratory nematodes who have no fixed feeding site within plant tissues but they feed while migrating through plant cells. On the other hand, RKN induce a specialised feeding structure from which they feed during several weeks.

Hormone signalling crosstalk plays an important role in plant response to a wide range of biotic and abiotic stresses. Through cross talk between defence pathways, the plant is able to fine tune its defence reaction against a specific pathogen (Pieterse et al., 2001) which eventually determines disease resistance or susceptibility. In addition to SA, JA and ET, other hormones, such as ABA, gibberellins (GA), auxin, cytokinins (CKs) and brassinosteroids (BRs) also play important roles in regulation of the immune signaling network in rice against nematodes often through crosstalk with

117

General conclusion and perspectives the SA, JA/ET pathways (Nahar et al., 2012; 2013; Kyndt et al., 2012; Ji et al., 2013). Deciphering the crosstalk among SA, JA, ET and other hormone dependent pathways in rice defence against the foliar nematode, D. angustus is a future challenge.

Increasing evidence indicates that nematode proteins are being actively introduced into the plant throughout the nematode life cycle and some of the effector proteins are able to suppress the plant defence responses through interfering with the hormone homeostasis (Hewezi & Baum, 2013; Kikuchi et al., 2014; Bauters et al., 2014; Haegeman et al., 2013). High-throughput expressed sequence tag (EST) sequencing on mixed stages of Hirschmanniella oryzae (Bauters et al., 2014) and second-stage juveniles of M. graminicola (Haegeman et al., 2013) illustrated that the rice nematodes contain an arsenal of plant-cell-wall-modifying proteins to facilitate migration through the host roots. The presence of chorismate mutase and isochorismatase in both M. graminicola and Hirschmanniella oryzae has been reported to potentially deregulate the SA biosynthesis pathway in the host. Transcriptome sequencing of the rice white-tip nematode Aphelenchoides besseyi has also been performed (Kikuchi et al., 2014). However, almost nothing is known about D. angustus effector proteins. Further study is necessary to gain insight into the role of nematode effectors in suppressing the basal defence of rice.

6.3 Bacillus velezensis strain BSK, a potential bio-control agent against D. angustus

Biological control using microbial agents against plant-parasitic nematodes has received immense attention in the last decades as an alternative to chemical control. We evaluated the potential of a rhizobacterium, B. velezensis strain BSK isolated from Bangladesh in promoting plant growth of rice and inducing systemic resistance to D. angustus (Chapter 5).

Our result showed that strain BSK treated plants tend to have increased shoot, root length and weight compared to the control plants. We found significantly higher fresh root and shoot weight in case of soil treatment with 104 cfu ml-1 whereas higher bacterial concentrations (106 and 108 cfu ml-1) were less effective to increase the growth of rice shoots and roots. Studies with B. amyloliquefaciens strains FZB42 (Chen et al., 2007) showed that strain FZB45 exerts a direct mechanism on plant growth, probably by indole-3-acetic acid (IAA) production, which creates a concentration-dependent response to inoculation and interacts with phytase-mediated effects (Ramírez & Joseph, 2010). Our data also demonstrate that strain BSK mediated ISR significantly 118

General conclusion and perspectives reduces the number of D. angustus on rice, especially with lower inoculum concentrations (104 and 106cfu ml-1).

Recent studies have demonstrated that PGPR can regulate plant growth and elicit disease resistance without physical contact by releasing volatiles (Ryu et al., 2003; Ryu et al., 2004; Fernando et al., 2005; Bailly et al., 2012). Identification of volatiles produced by strain BSK, and investigation of the plant response to potential bacterial volatiles can be analysed using different techniques such as ultra-high performance liquid chromatography, mass spectrometry and gene expression profiling. This will provide valuable insights about the mechanisms of biocontrol activity of Bacillus velezensis strain BSK.

Bacillus spp. are known to produce a wide array of antimicrobial compounds among which lytic enzymes, antibiotics and a range of non-ribosomally synthesized (lipo)peptides and polyketides (Chen et al., 2009; Rückert et al., 2011). Cyclic lipopeptides (LPs) of the surfactin, iturin and fengycin families are of high interest because of the role of the different LP families for the inhibition of different pathogens (Wu et al., 2015; Chowdhury et al., 2015; Cawoy et al., 2015). Cyclic lipopeptides, fengycin and surfactin produced by B. subtilis BBG111 trigger JA, ET and/or auxin pathways in rice against rice sheath blight caused by Rhizoctonia solani (Chandler et al. 2015). However, nothing is known about cyclic lipopeptides produced by strain BSK and their functional role against pathogens. Further studies on bacterial lipopeptides will be an interesting topic.

A number of mechanisms have been described to be involved in PGPR mediated ISR against pathogen including plant parasitic nematodes such as involvement of SA, JA, ET and other hormone signaling pathways (Pieterse et al., 2014; Chowdhury et al., 2015), PR proteins, cell wall reinforcement, accumulation of H2O2, defence-related phenolics (Ahn et al., 2007; De Vleesschauwer et al., 2008; Rahman et al., 2015) and the involvement of enzymes in the phenylpropanoid pathway (Anita et al., 2004; Schafer 2007). We have investigated the SA, JA and ET signaling pathway within the tripartite system consisting of Bacillus velezensis strain BSK, the nematode D. angustus and the rice plant. Our results showed that OsPR10 gene is upregulated in the rice-BSK-D. angustus interaction while the SA biosynthesis and JA pathway are only marginally affected in the same interaction. It will be interesting to study the role of other hormones

119

General conclusion and perspectives or defence-related phenolics, to decipher the mode of action of strain BSK mediated induced systemic resistance against D. angustus.

Bacillus spp. can produce various molecules that are toxic to nematodes (Li et al., 2005, 2007, 2008; Siddiqui, 2002). Liu et al. (2013) identified a gene within the pzn gene cluster involved in nematicidal activity using a random transposon insertion library of FZB42. Two nematicidal compounds were identified from B. cereus strain S2, called C16 sphingosine and phytosphingosine by polarity gradient extraction, silica gel column chromatography and HPLC. It will also be interesting to study the biocontrol potential of strain BSK against root parasitic nematodes such as root knot nematodes, cyst nematodes and migratory ecto- and endoparasitic nematodes. In the case of field application, it would be prudent to select a PGPR having a broad spectrum of activity involving plant growth promotion and induction of resistance against multiple diseases and pests. Comparison of the control potential of B. velezensis strain BSK with commercially available bacterial products against plant parasitic nematodes will provide knowledge on its commercial value.

Although B. velezensis strain BSK showing great promise for antagonizing D. angustus in the lab, before application as a biocontrol agent, it requires a long way of greenhouse experiments with different rice cultivars and rotational crops, type of soils and different climatic conditions and finally, field experiments to find out the optimum bacterial formulations.

In conclusion, the knowledge gathered from the applied and fundamental research of this PhD will benefit rice cultivation in Bangladesh. Based on the result of ufra susceptibility of currently used high yielding BRRI varieties, farmers from ufra infected areas can choose the right rice variety for cultivation to avoid yield losses caused by D. angustus. Moreover, the information about the underlying mechanisms of resistance in the resistant cultivar towards this nematode provide valuable insights to develop ufra resistant high yielding varieties. With this thesis, biocontrol potential of a rhizobacteria towards D. angustus provides an alternative environmentally friendly approach to control this pest.

120

Summary Summary

Rice is the second most important cereal crop in the world as well as staple food for over half of the world’s population. The dramatic growth of global human population requires an increase in rice production. However, high rice productivity is impaired with a variety of biotic and abiotic factors. Plant parasitic nematodes cause significant yield losses in rice, ranging from 10% to 25% worldwide. The rice stem nematode, Ditylenchus angustus is an obligate parasite causing ufra disease in rice. D. angustus infection results in substantial yield losses in South and Southeast Asia. For instance in Bangladesh, yield losses by this nematode have been reported ranging from 40- 90%. The nematode enters the plant mainly at the collar region, migrates upward with shoot growth and feeds on newly forming tissues in the rolled leaf sheath, causing malformation. In the vegetative stage, white patches, or speckles in a splash pattern are observed at the leaf base. At the reproductive stage, the panicle heads and flag leaves become twisted and distorted, leading to significantly lower rice production. The control of this nematode has relied heavily on chemical nematicides in the past. However, the notorious toxicity of chemical nematicides to wildlife and human health emphasizes the urgent need for an environmentally friendly, alternative management strategy to control this nematode. In this thesis, we focused on strategies that are environmentally sound and economically viable for nematode control, such as plant resistance and biological control.

In the first part of this thesis, a number of rice genotypes (BRRI released high yielding varieties, local varieties and deep water rice varieties) were screened for resistance to the Bangladeshi population of D. angustus using different nematode inoculation assays, in both rainfed and irrigated ecosystems (Chapter 2). Out of the 85 genotypes, one landrace named ‘Manikpukha’ proved to be highly resistant, while 6 other varieties showed resistance and 13 varieties showed moderately resistant responses under both pot and field conditions. The highly resistant local variety ‘Manikpukha’ found in our study will be a potential candidate to develop ufra resistant high yielding varieties. BRRI released high yielding varieties that were identified as resistant against the nematode can be used directly in ufra infected areas as a cost-effective, environmentally friendly method to reduce the level of D. angustus infections.

121

Summary

We aimed further to explore the resistance mechanism in the identified highly resistant genotype Manikpukha. Invasion, post-infectional development, and reproduction of D. angustus in Manikpukha and in the susceptible rice genotypes BR26 and Nipponbare were compared to identify the stage (s) at which resistance occurs (Chapter 3). All the observations indicate that the resistance in Manikpukha is associated with reduced development and reproduction of D. angustus implying that resistance acts post-invasion. This valuable information of resistance mechanisms in Manikpukha is adding further insights into the nature, timing and action of resistance genes which will help to efficiently use resistant cultivars in breeding programmes as well as to advance phenotypic screening methods.

Timely recognition of a pathogen combined with fast and effective induction of defence responses ultimate determine the resistance/susceptibility of a plant. The activation of an effective defence response profoundly depends on the action of phytohormones, in which salicylic acid (SA), jasmonic acid (JA), and ethylene (ET) play central roles. The role of SA, JA and ET was investigated in rice defence against D. angustus (Chapter 4). Experiments with hormone biosynthesis inhibition, mutants and transgenic lines showed that SA, JA and ET pathways play a positive role in basal defence against the nematode. Gene expression analysis using qRT-PCR demonstrate that many defence-related genes are attenuated in shoot tissues of D. angustus infected susceptible plants while those genes are up-regulated in shoot tissues of nematode infected resistant plants. Our data reveal a significantly higher expression of OsPAL1 in the infected resistant plants, but this is not correlated with enhanced SA production. We have also observed that lignin accumulation was significantly higher in the resistant plants upon nematode infection compared to susceptible plants.

In the last part of the thesis, the potential of a rhizobacterium B. velezensis strain BSK in promoting plant growth of rice and induced systemic resistance to D. angustus was reported. Our results showed that soil inoculation with low bacterial density (104 cfu ml-1) promotes growth in rice and controls the nematode at a significant level, suggesting B. velezensis strain BSK as an economical and ecological alternative of chemical control for nematode management. qRT-PCR data shows that the OsPR10 gene is highly induced in the rice-BSK-D. angustus interaction while genes involved in the SA biosynthesis and JA pathway only show a slight response. Further studies on elucidation of the underlying mechanisms of strain BSK induced systemic resistance will provide valuable insights for potential application of strain BSK in PPN management. 122

Summary

In this thesis, we investigated several environmentally sound strategies for D. angustus management. Further molecular analysis should be focused on the rice-nematode interaction regarding plant resistance gene/genes, hormone signaling pathways, mode-of-action of B. velezensis strain BSK induced systemic resistance to enhance the development of a sustainable ufra management strategy.

123

Samenvatting Nederlandse samenvatting

Karakterisatie van de interactie tussen rijst en de parasitaire nematode Ditylenchus angustus

Rijst is het tweede belangrijkste graangewas in de wereld en maakt deel uit van de voeding voor meer dan de helft van de wereldbevolking. De dramatische bevolkingsaangroei vereist een grotere rijstproductie, die beperkt wordt door biotische en abiotische factoren. Plantenparasitaire nematoden veroorzaken wereldwijd 10-25% opbrengstverlies in rijst. De stengelnematode Ditylenchus angustus is een obligate parasiet die “ufra” veroorzaakt in rijst. Infectie door D. angustus veroorzaakt vooral opbrengstverliezen in Zuid- en Zuidoost Azië, bvb. In Bangladesh van 40-90%. De nematode dringt de plant binnen vooral via de kraag en migreert naar boven met de groeiende scheuten, zich voedend aan het jonge bladweefsel. Daardoor ontstaan misvormingen en witte vlekken. Bij de zaadvorming ontstaan vervormde aren waardoor de opbrengst drastisch kan dalen. In Bangladesh steunt de controle van deze parasiet momenteel sterk op het gebruik van nematiciden. Het is daarom voor milieu en gezondheid belangrijk om alternatieve beheersmaatregelen te ontwikkelen. In dit doctoraatsonderzoek focusen we op controlestrategieën die mileuvriendelijk en economisch haalbaar zijn zoals plantenresistentie en biologische controle.

In het eerste deel van de thesis werden een aantal rijstgenotypes, waaronder BRRI-variëteiten en lokale cultivars, getest voor resistentie tegen D. angustus in verschillende rijstcultuursystemen (Hoofdstuk 2). Uit 85 geteste genotypes werd Manikpukha geïdentificeerd als zeer resistent en verschillende andere variëteiten bleken ook enige resistentie te vertonen zowel in pot- als in veldcondities. Manikpukha is een interessante kandidaat om ufra-resistente variëteiten te ontwikkelen met hoge opbrengst. BRRI-hoge opbrengst-variëteiten die als resistent uit de testen kwamen kunnen onmiddellijk ingezet worden in ufra-besmette gebieden als een kostenefficiënte milieuvriendelijke methode om het infectieniveau van D. angustus terug te dringen.

In hoofdstuk 3 hebben we de resistentie van Manikpukha aan verder onderzoek onderworpen. De penetratie, ontwikkeling en reproductie van D. angustus werd vergeleken tussen de resistente Manikpukha en de gevoelige Nipponbare om te weten op welke stap de resistentie zijn effect heeft. Alle observaties wijzen er op dat de resistentie pas optreedt na infectie, de nematoden dringen de planten wel binnen maar ontwikkelen en vermeerderen zich minder goed in Manikpukha dan in

124

Samenvatting

Nipponbare. Deze informatie is belangrijk voor het gebruik van resistentie in veredelingsprogramma’s bv. om verschillende resistenties te combineren.

In plantenafweer is het essentieel dat de pathogeen snel herkend wordt zodat de plant tijdig kan reageren. De activatie van afweerresponsen hangt sterk af van de actie van plantenhormonen, waarbij salicylzuur (SA), jasmonaat (JA) en ethyleen (ET) een centrale rol spelen. Daarom werd de rol van deze hormonen bij de interactie tussen rijst en D. angustus geanalyseerd. Experimenten met hormooninhibitoren, mutanten en transgene lijnen toonden aan dat de SA-, JA- en ET- pathways een rol spelen in de basale plantenafweer tegen de nematode. Analyse van genexpressie via qRT-PCR toonde aan dat veel afweer-gerelateerde genen neergereguleerd worden bij infectie van een gevoelige plant, terwijl ze opgereguleerd worden in de resistente Manikpukha. Vooral de hogere expressie van OsPAL1 na infectie van de resistente plant was opvallend. Deze hogere expressie is niet gerelateerd met een hogere SA-productie, maar wel met een hogere lignine- accumulatie.

In het laatste deel van dit onderzoek werd het potentieel van de rhizobacterium B. velezensis strain BSK onderzocht voor groeibevordering van rijst en voor de inductie van systemische resistentie tegen D. angustus. Inoculatie van deze bacterie met een lage densiteit (104 cfu/ml) gaf daarbij een uitstekend resultaat, zodat het de moeite loont om deze stam verder te onderzoeken als een economisch en ecologisch aanvaardbaar alternatief voor de chemische controle van de nematode D. angustus. qRT-PCR toonde aan dat OsPR10 mogelijks een rol speelt in de rijst-BSK-D. angustus-interactie terwijl de SA- en JA-pathway minder belangrijk lijken. Verder onderzoek is echter nodig om de onderliggende mechanismen beter te begrijpen en bruikbare methoden te ontwikkelen voor de toepassing van B. velezensis strain BSK in biocontrole van nematodeninfectie bij rijst.

Samengevat hebben we in dit werk onderzoek gedaan naar mogelijke alternatieve strategieën voor controle van D. angustus-infecties in rijst. Verder moleculair onderzoek inzake de plantenresistentie tegen D. angustus en de onderliggende genen, de hormoonsignalisatie en de systemische inductie van resistentie door B. velezensis strain BSK kunnen bijdragen tot de optimalisatie van controlemethoden van ufra in rijstvelden.

125

References

126

References

Adams DO, Yang SF. 1979. Ethylene biosynthesis: identification of 1-aminocyclopropane-1- carboxylic acid as an intermediate in the conversion of methionine to ethylene. Proceedings of the National Academy of Sciences of the United States of America 76, 170–174.

Adam M, Heuer H, Hallmann J. 2014. Bacterial Antagonists of Fungal Pathogens Also Control Root-Knot Nematodes by Induced Systemic Resistance of Tomato Plants. PLoS ONE 9, doi.org/10.1371/journal.pone.0090402.

Adhikari TB, Joseph CM, Yang G, Phillips DA, Nelson LM. 2001. Evaluation of bacteria isolated from rice for plant growth promotion and biological control of seedling disease of rice. Canadian Journal of Microbiology 47, 916-924.

Adie BA, Perez-Perez J, Perez-Perez MM, Godoy M, Sanchez-Serrano JJ, Schmelz EA, Solano R. 2007. ABA is an essential signal for plant resistance to pathogens affecting JA biosynthesis and the activation of defenses in Arabidopsis. Plant Cell 19, 1665–1681.

Agrawal GK, Jwa NS, Rakwal R. 2000. A novel rice (Oryza sativa L.) acidic PR1 gene highly responsive to cut, phytohormones, and protein phosphatase inhibitors. Biochemical and Biophysical Research Communications 274, 157–165.

Agrawal GK, Jwa NS, Shibato J, Han O, Iwahashi H, Rakwal R. 2003. Diverse environmental cues transiently regulate OsOPR1 of the “octadecanoid pathway” revealing its importance in rice defense/stress and development. Biochemical and Biophysical Research Communications 310, 1073–1082.

Agrawal GK, Rakwal R, Jwa NS. 2001a. Differential induction of three pathogenesis-related genes, PR10, PR1b and PR5 by the ethylene generator ethephon under light and dark in rice (Oryza sativa L.) seedlings. Journal of Plant Physiology 158, 133–137.

Agrawala GK, Rakwalb R, Jwa NS, Agrawala VP. 2001b. Signalling molecules and blast pathogen attack activates rice OsPR1a and OsPR1b genes: a model illustrating components participating during defense/stress response. Plant Physiology and Biochemistry 39, 1095–1103.

Ahmed SAE, Anjum SI, Qiu W, Almoneafy AA, Li W, Yang Z, Cui ZQ, Li B, Sun GC, Xie GL. 2016. Controlling and defence-related mechanisms of Bacillus strains against bacterial leaf blight of rice. Journal of Phytopathology 164, 534–546.

127

References

Ahn IP, Lee SW, Suh SC. 2007. Rhizobacteria-induced priming in Arabidopsis is dependent on ethylene, jasmonic acid, and NPR1. Molecular Plant Microbe Interactions 20, 759–768.

Akagi A, Fukushima S, Okada K, Jiang CJ, Yoshida R, Nakayama A. Shimono M, Sugano S, Yamane H, Takatsuji H. 2014. WRKY45-dependent priming of diterpenoid phytoalexin biosynthesis in rice and the role of cytokinin in triggering the reaction. Plant Molecular Biology 86, 171–183.

Albuquerque EVS, Carneiro RMDG, Costa PM, Gomes ACMM, Santos M, Pereira AA, Nicole M, Fernandez D, Grossi-de-Sa MF. 2010. Resistance to Meloidogyne incognita expresses a hypersensitive-like response in Coffea Arabica. Eurorean journal of Plant Pathology 127, 365–373.

Ali MR, Ishibashi N. 1996. Growth and propagation of the ride stem nematode, Ditylenchus angustus, on rice seedlings and fungal mat of Botrytis cinerea. Japanese Journal of Nematology 26, 12-22.

Ali MR, Ishibashi N, Kondo E. 1995. Growth and reproductive parameters of the rice stem nematode Ditylenchus angustus on Botrytis cinerea. Japanese Journal of Nematology 25, 16-23.

Ali MR, Kondo E, Ishibashi N. 1997. Effect of temperature on the development and reporduction of Ditylenchus angustus on fungal mat of Botrytis cinerea Japanese Journal of Nematology 27, 7- 13.

Almaghrabi OA, Massoud SI, Abdelmoneim TS. 2013. Influence of inoculation with plant growth promoting rhizobacteria (PGPR) on tomato plant growth and nematode reproduction under greenhouse conditions. Saudi Journal of Biological Sciences 20, 57–61.

Alström S. 1991. Induction of disease resistance in common bean susceptible to halo blight bacterial pathogen after seed bacterization with rhizosphere pseudomonads. The Journal of General and Applied Microbiology 37, 495–501.

Amrhein N, Godeke KH. 1977. a-Aminooxy-p-phenylpropionic acid: A potent and specific inhibitor of L-phenylalanine ammonia-lyase in vitro and in vivo. Plant Science Letters 8, 313-317.

Anderson JP, Badruzsaufari E, Schenk PM, Manners JM, Desmond OJ, Ebert PR, Kazan K. 2004. Antagonistic interaction between abscisic acid and jasmonate-ethylene signaling pathways

128

References modulates defense gene expression and disease resistance in Arabidopsis. Plant Cell 16, 3460– 3479.

Anita B, Rajendran G, Samiyappan R. 2004. Induction of systemic resistance in tomato against root-knot nematode, Meloidogyne incognita by Pseudomonas fluorescens. Nematologica Mediterranea 32, 47–51.

Anthony F, Topart P, Martinez A, Silva M, Nicole M. 2005. Hypersensitive-like reaction conferred by the Mex-1 resistance gene against Meloidogyne exigua in coffee. Plant Pathology 54, 476–82.

Anwar SA, & Mckenry MV. 2000. Penetration, development and reproduction of Meloidogyne arenaria on two new resistant Vitis spp. Nematropica 30, 9-17.

Ashrafuzzaman M, Hossen FA, Ismail MR, Hoque A, Islam MZ, Shahidullah SM, Meon S. 2009. Efficiency of plant growth-promoting rhizobacteria (PGPR) for the enhancement of rice growth. African Journal of Biotechnology 8, 1247-1252.

Bach E, Seger GDS, Fernandes GC, Lisboa BB, Passagila LMP. 2016. Evaluation of biological control and rhizosphere competence of plant growth promoting bacteria. Applied Soil Ecology 99, 141-149.

Bailly A, Weisskopf L. 2012. The modulating effect of bacterial volatiles on plant growth: current knowledge and future challenges. Plant Signaling and Behavior 7, 79–85.

Bailey TA, Zhou X, Chen J, Yang Y. 2009. Role of ethylene, abscisic acid and MAP kinase pathways in rice blast resistance. In: Advances in Genetics, Genomics and Control of Rice Blast Disease. Wang G-L, Valent B. eds (Dordrecht: Springer), 185–190.

Baldridge GD, O’Neill NR, Samac DA. 1998. Alfalfa (Medicago sativa L.) resistance to the root- lesion nematode, Pratylenchus penetrans: defense-response gene mRNA and isoflavonoid phytoalexin levels in roots. Plant Molecular Biology 38, 999–1010.

Balhadere P, Evans AA. 1995. Histopathogenesis of susceptible and resistant responses of wheat, barley and wild grasses to Meloidogyne naasi. Fundamental and Applied Nematology 18, 531-538.

Bangladesh Meterological Department. 2013. Temperature data. http://www.bmd.gov.bd/?/p/=Temperature-Data.

129

References

Barry KM, Davies NW, Mohammed CL. 2002. Effect of season and different fungi on phenolics in response to xylem wounding and inoculation in Eucalyptus nitens. Forest Pathology 32, 163– 178.

Bauters L, Haegeman A, Kyndt T, Gheysen G. 2014. Analysis of the transcriptome of Hirschmanniella oryzae to explore potential survival strategies and host-nematode interactions. Molecular Plant Pathology 15, 352–363. doi: 10.1111/mpp.12098

Baxter RI, Blake CD. 1967. Invasion of wheat roots by Pratylenchus thornei. Nature 215, 1168- 1169.

Beckers GJM, Spoel SH. 2006. Fine-tuning plant defence signalling: salicylate versus jasmonate. Plant Biology 8, 1-10.

Beckers GJM, Jaskiewicz M, Liu Y, Underwood WR, He SY, Zhang S, Conrath U. 2009. Mitogen- activated protein kinases 3 and 6 are required for full priming of stress responses in Arabidopsis thaliana. Plant Cell 21, 944–953

Bendezu IF, Starr JL. 2003. Mechanism of resistance to Meloidogyne arenaria in the peanut cultivar COAN. Journal of Nematology 35, 115-118.

Beneventi MA, da Silva OB Jr, de Sa ME, Firmino AA, de Amorim RM, Albuquerque EVS, da Silva MCM, da Silva JP, de Araújo Campos M, Lopes MJC, Togawa RC, Pappas GJ Jr, Grossi– de–Sa MF. 2013. Transcription profile of soybean-root-knot nematode interaction reveals a key role of phythormones in the resistance reaction. BMC Genomics 14, 322.

Bhattarai KK, Xie QG, Mantelin S, Bishnoi U, Girke T, Navarre DA, Kaloshian I. 2008. Tomato susceptibility to root-knot nematodes requires an intact jasmonic acid signaling pathway. Molecular Plant–Microbe Interactions 21, 1205–1214.

Bird AF. 1959. The Attractiveness of Roots to the Plant Parasitic Nematodes Meloidogyne javanica and M. hapla. Nematologica 4, 322-335.

Blaxter ML, De LP, Garey JR, Liu LX, Scheldeman P, Vierstraete A, Vanfleteren JR, Mackey LY, Dorris M, Frisse LM, Vida JT, Thomas WK. 1998. A molecular evolutionary framework for the phylum Nematode. Nature 392, 71-75.

Blee E. 2002. Impact of phyto-oxylipins in plant defense. Trends in Plant Science 7, 315–322.

130

References

Bleve-Zacheo, T., Bongiovanni, M., Melillo, M.T., Castagnone-Sereno, P., 1998. The pepper resistance genes Me1 and Me3 induce differential penetration rates and temporal sequences of root cell ultrastructural changes upon nematode infection. Plant Science 133, 79−90.

Bolton, MD 2009. Primary metabolism and plant defense. Molecular Plant-Microbe Interactions 22, 487–497

Bora LC, Medhi, BN. 1992. Resistance of deepwater rice (DWR) varieties to ufra disease in Assam. International Rice Research Newsletter 17, 12.

Borriss R. 2011. “Use of plant-associated Bacillus strains as biofertilizers and biocontrol agents,” in Bacteria in Agrobiology: Plant Growth Responses, ed. D. K. Maheshwari (Heidelberg: Springer), 41–76.

Branch C, Hwang CF, Navarre DA, Williamson VM. 2004. Salicylic acid is part of the Mi-1- mediated defence response to root knot nematode in tomato. Molecular Plant-Microbe Interactions 17, 351-35.

Bridge J, Luc M, Plowright RA. 1990. Nematode parasites of rice. In: Plant Parasitic Nematodes in Subtropical and Tropical Agriculture. Luc M, Sikora RA, Bridge J. (eds.). CABI. Wallingford, U.K.

Bridge J, Page SLJ. 1982. The rice root-knot nematode, Meloidogyne graminicola on deep water rice (Oryza sativa subsp. indica). Revue Nematology 5, 225-232.

Bridge J, Plowright RA, Peng D. 2005. Nematode parasites of rice. In: Plant Parasitic Nematodes in Subtropical and Tropical Agriculture. Luc M, Sikora RA, Bridge J. (eds.) Wallingford, UK, 87– 128.

Bridge J, Starr JL, 2007. Cereals: Rice (Oryza sativa). In: Plant Nematodes of Agricultural Importance: A Colour Handbook. Manson Publishing, pp. 52−54.

Broekaert WF, Cammue BPA, DeBolle MFC, Thevissen K, DeSamblanx GW, Osborne RW. 1997. Antimicrobial peptides from plants. Critical Reviews in Plant Sciences 16, 297–323.

Bruce TJA, Matthes MC, Napier JA, Pickett JA. 2007. Stressful “memories” of plants: evidence and possible mechanisms. Plant Science 173, 603–608.

131

References

Bryan GT, Wul K-S, Farrall L, Jia Y, Hershey HP, McAdams SA, Faulk KN, Donaldson GK, Tarchini R, Valent B. 2000. A single amino acid difference distinguishes resistant and susceptible alleles of the rice blast resistance gene Pi-ta. Plant Cell 12, 2033–2046.

Burkett-Cadena M, Kokalis-Burelle N, Lawrence KS, van Santen E, Kloepper JW. 2008. Suppressiveness of root-knot nematodes mediated by rhizobacteria. Biological Control 47, 55–59.

Burr AHJ, Eggleton DK, Patterson R, Leutscher-Hazelhoff JT. 1989. The role of hemoglobin in the phototaxis of the nematode Mermis nigrescens. Photochemistry and Photobiology 49, 89-95.

Burr AHJ, Hunt P, Wagar DR, Dewilde S, Blaxter ML, Vanfleteren JR, Moens L. 2000. A Hemoglobin with an optical function. The Journal of Biological Chemistry 275, 4810-4815.

Butler EJ, 1913. Ufra disease of rice. Agricultural Journal of India 8, 205−220.

Butler EJ. 1919. The rice worm (Tylenchus angustus) and its control. Memorial Department of Agriculture India 10, 1-37.

Cabasan TN, Kumar A, De Waele D. 2012. Comparison of migration, penetration, development and reproduction of Meloidogyne graminicola on susceptible and resistant rice genotypes. Nematology 14, 405-415.

Cabasan TN, Kumar A, Bellafiore S, De Waele D. 2014. Histopathology of the rice root-knot nematode, Meloidogyne graminicola, on Oryza sativa and O. glaberrima. Nematology 16, 73-81.

CABI/EPPO. 1999. Ditylenchus angustus. Distribution Maps of Plant Diseases, Map No. 790. Wallingford, UK: CAB International.

Cai D, Kleine M, Kifle S, Harloff HJ, Sandal NN, Marcker KA, Klein-Lankhorst RM, Salentijn EMJ, Lange W, Stiekema WJ, Wyss U, Grundler FMW, Jung C. 1997. Positional cloning of a gene for nematode resistance in sugarbeet. Science 275, 832−834.

Cai J, Liu F, Liao X, Zhang R. 2014. Complete genome sequence of Bacillus amyloliquefaciens LFB112 isolated from Chinese herbs, a strain of a broad inhibitory spectrum against domestic animal pathogens. Journal of Biotechnology 175, 63–64.

Cawoy H, Debois D, Franzil L, De Pauw E, Thonart P, Ongena M. 2015. Lipopeptides as main ingredients for inhibition of fungal phytopathogens by Bacillus subtilis / amyloliquefaciens. Microbial Biotechnology 8, 281–295.

132

References

Chakraborti, S. 2000. Assessment of some management practices on rice stem nematode. Indian Journal of Nematology 30, 245-247.

Chandler S, Hese NV, Coutte F, Jacques P, Hofte M, De Vleesschauwer D. 2015. Role of cyclic lipopeptides produced by Bacillus subtilis in mounting induced immunity in rice (Oryza sativa L.). Physiological and Molecular Plant Pathology 91, 20–30.

Chassot C, Buchala A, Schoonbeek HJ, Metraux JP, Lamotte O. 2008. Wounding of Arabidopsis leaves causes a powerful but transient protection against Botrytis infection. Plant Journal 55, 555– 567.

Chaturvedi R, Venables B, Petros RA, Nalam V, Li M, Wang X, Takemoto LJ, Shah J. 2012. An abietane diterpenoid is a potent activator of systemic acquired resistance. Plant Journal 71, 161– 172.

Chen XH, Koumoutsi A, Scholz R, Eisenreich A, Schneider K, Heinemeyer I, Morgenstern B, Voss B, Hess WR, Reva O, Junge H, Voigt B, Jungblut PR, Vater J, Süssmuth R, Liesegang H, Strittmatter A, Gottschalk G, Borriss R. 2007. Comparative analysis of the complete genome sequence of the plant growth-promoting bacterium Bacillus amyloliquefaciens FZB42. Nature Biotechnology 25, 1007–1014.

Chen Z, Iver S, Caplan A, Klessig DF, Fan B. 1997. Differential Accumulation of Salicylic Acid and Salicylic Acid-Sensitive Catalase in Different Rice Tissues. Plant Physiology 114, 193-201.

Chen ZY, Cohen JD, He P, Shan L, Sheen J, Kunkel BN. 2007. Pseudomonas syringae type III effector AvrRpt2 alters Arabidopsis thaliana auxin physiology. Proceedings of the National Academy of Sciences of the United States of America 104, 20131–20136.

Chen XH, Koumoutsi A, Scholz R, Schneider K, Vater J, Süssmuth R, Pielc J, Borrissa R. 2009. Genome analysis of Bacillus amyloliquefaciens FZB42 reveals its potential for biocontrol of plant pathogens. Journal of Biotechnology 140, 27–37.

Chern M, Fitzgerald HA, Canlas PE, Navarre DA, Ronald PC. 2005. Overexpression of a Rice NPR1 Homolog Leads to Constitutive Activation of Defense Response and Hypersensitivity to Light. Molecular Plant Micobe Interaction 18, 511-520.

133

References

Chern MS, Fitzgerald HA, Yadav RC, Canlas PE, Dong X, Ronald PC. 2001. Evidence for a disease-resistance pathway in rice similar to the NPR1-mediated signaling pathway in Arabidopsis. Plant Journal 27, 101–113.

Chithrashree UAC, Chandra NS, Reddy MS, Srinivas C. 2011. Plant growth-promoting rhizobacteria mediate induced systemic resistance in rice against bacterial leaf blight caused by Xanthomonas oryzae pv. oryzae. Biological Control 59, 114–122.

Choi C, Hwang SH, Fang R, Kwon S, Park SR, Ahn I, Kim JB, Hwang DJ. 2015. Molecular characterization of Oryza sativa WRKY6, which binds to W-box-like element 1 of the Oryza sativa pathogenesisrelated (PR) 10a promoter and confers reduced susceptibility to pathogens. New Phytologist 208, 846–859.

Chowdhury SP, Dietel K, Rändler M, Schmid M, Junge H, Borriss R, Hartmann A, Grosch R. 2013. Effects of Bacillus amyloliquefaciens FZB42 on lettuce growth and health under pathogen pressure and its impact on the rhizosphere bacterial community. PLoS ONE 8, http://dx.doi.org/10.1371/journal.pone.0068818

Chowdhury SP, Uhl J, Grosch R, Alquéres S, Pittroff S, Dietel K, Schmitt-Kopplin P, Borriss R, Hartmann A. 2015. Cyclic lipopeptides of Bacillus amyloliquefaciens FZB42 subsp. plantarum colonizing the lettuce rhizosphere enhance plant defence responses towards the bottom rot pathogen Rhizoctonia solani. Molecular Plant Microbe Interaction 28, 984-995.

Chung EJ, Hossain MT, Khan A, Kim KH, Jeon CO, Chung YR. 2015. Bacillus oryzicola sp. nov., an endophytic bacterium isolated from the root of rice with antimicrobial, plant-growth promoting and systemic resistance-inducing activities in rice. Plant Pathology Journal 31, 152–164.

Cobb NA. 1915. Nematodes and their relationships. Yearbook of the Department of Agriculture for 1914, Washington DC, pp. 457-490.

Collingborn FMB, Gowen SR, Mueller-Harvey I. 2001. Investigations into the Biochemical Basis for Nematode Resistance in Roots of Three Musa Cultivars in Response to Radopholus similis Infection. Journal of Agricultural and Food Chemistry 48, 5297–5301.

Conrath U. 2009. Priming of induced plant defense responses. Advances in Botanical Research 16, 524-531.

134

References

Conrath U. 2011. Molecular aspects of defence priming. Trends in Plant Science 16, 524-531.

Conrath U, Beckers GJM, Flors V, Garciaa-Agustin P, Jakab G, Mauch F, Newman MA, Pieterse CMJ, Poinssot B, Pozo MJ, Pugin A, Schaffrath U, Ton J, Wendehenne D, Zimmerli L, Zimmerli B. 2006. Priming: getting ready for battle. Molecular Plant-Microbe Interactions 19, 1062–1071.

Conrath U, Beckers GJM, Langenbach, CJG, Jaskiewicz MR. 2015. Priming for enhanced defense. Annual Review of Phytopathology 53, 97–119.

Conrath U, Pieterse CMJ, Mauch-Mani B. 2002. Priming in plant-pathogen interactions. Trends in Plant Science 7, 210–216.

Cook R, Evans K. 1987. Resistance and tolerance. In: Principles and practice of nematode control in crops. Brown, R.H., Kerry, B.R. (Eds). Academic press, New York, pp. 179−231.

Cooper WR, Jia L, Goggin L. 2005. Effects of jasmonate-induced defenses on root-knot nematode infection of resistant and susceptible tomato cultivars. Journal of Chemical Ecology 31, 1953–1967.

Cox PG. Rahman L. 1979. The overwinter decay of Ditylenchus angustus. International Rice Research Newsletter 4, 14.

Cox PG, Rahman L. 1980. Effects of Ufra Disease on Yield Loss of Deepwater Rice in Bangladesh. Tropical Pest Management 26, 410-415.

Coyne DL, Plowright RA. 2000. Heterodera sacchari: field population dynamics and damage to upland rice in Cote d’Ivoire. Nematology 2, 541–550.

Creech RG, Jenkins JN, Tang B, Lawrence GW, McCarty JC. 1995. Cotton resistance to root-knot nematode .1. Penetration and reproduction. Crop Science 35, 365-368.

Cuc, NTT. 1982a. Field soil as a source of rice stem nematodes. International Rice Research Newsletter 7, 15.

Cuc NTT, Giang L-T. 1982. New weed host of rice stem nematode identified in Vietnam. International Rice Research Newsletter 7, 15.

Cuc NTT, Kinh DN. 1981. Rice stem nematode disease in Vietnam. International Rice Research Newsletter. 6, 14−15.

135

References

Curtis RHC, Robinson AF, Perry RN. 2009. Hatch and host location. In: Root-Knot Nematodes. Perry RN, Moens M, Starr JL. (Eds). CAB International, Oxfordshire, pp. 139–162.

Dalzell JJ, Kerr R, Corbett MD, Fleming CC, Maule AG. 2011. Novel bioassays to examine the host-finding ability of plant-parasitic nematodes. Nematology 13, 211-220.

Dao DF. 1970. Climatic influence on the distribution pattern of plant parasitic and soil inhabiting nematodes. Meded. LandbHoo-gesch. Wageningen 70, 1−181

Das P. 1997. An integrated approach for management of rice stem nematode, Ditylenchus angustus in deep water rice in Assam. Indian Journal of Nematology 26, 222-225.

Das D, Bajaj HK. 2008. Redescription of Ditylenchus angustus (Butler, 1913) Filipjev, 1939. Annals of Plant Protection Science 16, 195-197.

Das D, Sarma NK, Borgohain R, Das P. 2000. Rayada B3: A high-yielding, ufra-resistant deepwater rice for Assam, India. International Rice Research Notes 25, 17.

Das P, Bhagawati B. 1992. Incidence of rice stem nematode, Ditylenchus angustus in relation to sowing time of deep water rice in Assam. Indian Journal of Nematology 22, 86-88.

Das P, Sarmah NK. 1995. Sources of resistance to rice stem nematode Ditylenchus angustus, in deepwater rice genotypes. Annals of Plant Protection Sciences 3, 135-136.

Das S, DeMason DA, Ehlers JD, Close TJ. Roberts PA. 2008. Histological characterization of root-knot nematode resistance in cowpea and its relation to reactive oxygen species modulation. Journal of Experimental Botany 59, 1305-1313.

Dash BK, Sunderababu R, Swain PK, Ramakrishnan S, 2008. A simple and quicker rating scale for reaction of rice cultivars to rice-root nematode. Journal of Plant protection and Environment 5, 124−127.

Datta K, Velazhahan R, Oliva N, Ona I, Mew T, Kush GS, Muthukrishnan S, Datta SK. 1999. Over-expression of the cloned rice thaumatin-like protein (PR-5) gene in transgenic rice plants enhances environmental friendly resistance to Rhizoctonia solani causing sheath blight disease. Theoretical and Applied Genetics 98, 1138–1145.

Davies LJ, Brown CR, Elling AA. 2014. Calcium is involved in the RMc1(blb)-mediated hypersensitive response against Meloidogyne chitwoodi in potato. Plant Cell Report 34, 167-177.

136

References

Debois D, Ongena M, Cawoy H, De Pauw E. 2013. MALDI-FTICR MS imaging as a powerful tool to identify paenibacillus antibiotics involved in the inhibition of plant pathogens. Journal of the American Society for Mass Spectrometry 24, 1202–1213.

Decraemer W, Hunt DJ. 2006. Structure and classification. In: Plant Nematology. Perry RN, Moens M. (Eds). CAB International, Oxfordshire, pp. 3–32.

De Lay P, Blaxter ML. 2002. Systematic position and phylogeny. In: Lee DL (ed.). The biology of nematodes. Taylor and Francis, London, 1-30.

Delaney TP, Uknes S, Vernooij B, Friedrich L, Weymann K, Negrotto D, Gaffney T, Gut-Rella M, Kessmann H, Ward E, Ryals J. 1994. A central role of salicylic acid in plant disease resistance. Science 266, 1247-1250.

Dempsey DA, Klessig DF. 2012. SOS: too many signals for systemic acquired resistance? Trends in Plant Science 17, 538–545.

Deng H, Liu H, Li X, Xiao J, Wang S. 2012. A CCCH-type zinc finger nucleic acid-binding protein quantitatively confers resistance against rice bacterial blight disease. Plant Physiology 158, 876– 889.

Desaki Y, Miya A, Venkatesh B, Tsuyumu S, Yamane H, Kaku H, Minami E, Shibuya N. 2006. Bacterial lipopolysaccharides induce defense responses associated with programmed cell death in rice cells. Plant and Cell Physiology 47, 1530–1540.

Devanna NB, Vijayan J, Sharma TR. 2014. The blast resistance gene Pi54 of cloned from Oryza officinalis interacts with Avr-Pi54 through its novel non-LRR domains. PLoS One 9, http://dx.doi.org/10.1371/journal.pone.0104840.

De Vleesschauwer D, Cornelis P, Höfte M. 2006. Redox-active pyocyanin secreted by Pseudomonas aeruginosa 7NSK2 triggers systemic resistance to Magnaporthe grisea but enhances Rhizoctonia solani susceptibility in rice. Molecular Plant–Microbe Interactions 19, 1406–1419.

De Vleesschauwer D, Chernin L, Höfte MM. 2009. Differential effectiveness of Serratia plymuthica IC1270-induced systemic resistance against hemibiotrophic and necrotrophic leaf pathogens in rice. BMC Plant Biology 9, DOI: 10.1186/1471-2229-9-9

137

References

De Vleesschauwer D, Djavaheri M, Bakker PAHM, Höfte M. 2008. Pseudomonas fluorescens WCS374r-induced systemic resistance in rice against Magnaporthe oryzae is based on pseudobactin-mediated priming for a salicylic acid-repressible multifaceted defence response. Plant Physiology 148, 1996–2012.

De Vleesschauwer D, Höfte M. 2009. Rhizobacteria-induced systemic resistance. In: Van Loon LC, ed. Advances in botanical research, Vol. 51. Elsevier, 223–281.

De Vleesschauwer D, Van Buyten E, Satoh K, Balidion J, Mauleon R, Choi 2nd R, Vera-Cruz C, Kikuchi S, Hofte M. 2012. Brassinosteroids antagonize gibberellin- and salicylate-mediated root immunity in rice. Plant Physiology 158, 1833–1846.

De Vleesschauwer D, Yang Y, Cruz CV, Höfte M. 2010. Abscisic acid-induced resistance against the brown spot pathogen Cochliobolus miyabeanus in rice involves MAP kinase mediated repression of ethylene signaling. Plant Physiology 152, 2036–2052.

De Vleesschauwer D, Gheysen G, Höfte M. 2013. Hormone defense networking in rice: tales from a different world. Trends in Plant Science 18, 555–565.

De Vleesschauwer D, Xu J, Höfte M. 2014. Making sense of hormone mediated defense networking: from rice to Arabidopsis. Frontiers in Plant Science 5, 611.

De Vos M, Koornneef A, Korzelius JP, Dicke M, Van Loon LC, Pieterse CMJ. 2006. Herbivore- induced resistance against microbial pathogens in Arabidopsis. Plant Physiology 142, 352–363.

Dhakshinamoorthy S, Mariama K, Elsen A, De Waele D. 2014. Phenols and lignin are involved in the defence response of banana (Musa) plants to Radopholus similis infection. Nematology 16, 565-576.

Diomande M. 1984. Response of upland rice cultivars to Meloidogyne species. Revue de Nématologie 7, 57-63.

Dixon RA. 2001. Natural products and plant disease resistance. Nature 411, 843-847.

Dixon DC, Paiva NL. 1995. Stress-induced phenylpropanoid metabolism. The Plant Cell 7, 1085.

Dodds PN, Rathjen JP. 2010. Plant immunity: towards an integrated view of plant–pathogen interactions. Nature Reviews Genetics 11, 539–548.

138

References

Doornbos RF, van Loon LC, Bakker PA. 2012. Impact of root exudates and plant defense signaling on bacterial communities in the rhizosphere. A review. Agronomy for Sustainable Development 32, 227–243.

Dunlap CA, Kim SJ, Kwon SW, Rooney AP. 2015. Phylogenomic analysis shows that Bacillus amyloliquefacienssubsp. plantarum isalaterheterotypic synonym of Bacillus methylotrophicus. International Journal of Systematic and Evolutionary Microbiology 65, 2104–2109.

Durrant W, Dong X. 2004. Systemic acquired resistance. Annual Review of Phytopathology 42, 185-209.

Eilenberg J, Hajek A, Lomer C. 2001. Suggestions for unifying the terminology in biological control. Biocontrol 46, 387–400.

El-Nagdi WMA, Youssef MMA. 2004. Soaking faba bean seed in some bio-agents as prophylactic treatment for controlling Meloidogyne incognita root nematode infection. Journal of Pest Science 77, 75-78.

Elshakh ASA, Anjum SI, Qiu W, Almoneafy AA. Li W, Yang Z, Cui ZQ, Li B, Sun G-C, Xie G- L. 2016. Controlling and defence-related mechanisms of Bacillus strains against bacterial leaf blight of rice. Journal of Phytopathology 164, 534-546. El-Shetehy M, Wang C, Shine MB, Yu K, Kachroo A, Kachroo P. 2015. Nitric oxide and reactive oxygen species are required for systemic acquired resistance in plants. Plant Signaling and Behavior 10, DOI: 10.1080/15592324.2014.998544.

Elsen A, Gervacio D, Swennen R, De Waele D. 2008. AMF-induced biocontrol against plant- parasitic nematodes in Musa sp.: a systemic effect. Mycorrhiza 18, 251–256.

Eulgem T, Rushton PJ, Schmelzer E, Hahlbrock K, Somssich IE. 1999. Early nuclear events in plant defence signalling: Rapid gene activation by WRKY transcription factors. EMBO Journal 18, 4689–4699.

FAO. 2015. Rice market monitor. Available online at http://www.fao.org/fileadmin/templates/est/COMM_MARKETS_MONITORING/Rice/Images/R MM/RMM_DEC15_H.pdf

FAO. 2016. The diverse rice ecosystem. http://www.fao.org/agriculture/crops/thematic- sitemap/theme/spi/scpi home/managing-ecosystems/sustainable-rice-systems/rice-what/en/

139

References

Farmer EE, Almeras E, Krishnamurthy V. 2003. Jasmonates and related oxylipins in plant responses to pathogenesis and herbivory. Current Opinion in Plant Biology 6, 372–378.

Farmer EE, Caldelari D, Pearce G, Walker-Simmons MK, Ryan CA. 1994. Diethyl dithiocarbamic acid inhibits the octadecanoid signalling pathway for the wound induction of proteinase inhibitors in tomato leaves. Plant Physiology 106, 337-342.

Fassuliotis G, 1979. Plant breeding for root-knot nematode resistance. In: Lamberti, F., Taylor, C.E. (Eds). Root-knot nematodes (Meloidogyne species). Systematics, biology and control. Academic Press, London & New York, pp. 425−453.

Feng H, Shao Y, Wei Li-hui, Gao C-Y, Zhou Y-J. 2014. The white-tip nematode, Aphelenchoides besseyi, exhibits an auxin-orientated behaviour affecting its migration and propagation. Nematology, 16, 837 – 845.

Fernando WD, Ramarathnam R, Krishnamoorthy AS, Savchuk SC. 2005. Identification and use of potential bacterial organic antifungal volatiles in biocontrol. Soil Biology and Biochemistry 37, 955–964.

Filipjev IN. 1936. On the classification of the Tylenchinae. Proceeding of the Helminthological Society of Washington 3, 80-82.

Fogain R, Gowen SR, 1996. Investigations on possible mechanisms of resistance to nematodes in Musa. Euphytica 92, 375−381.

Fogain R, Gowen SR, 1998. “Yangambi km 5” (Musa AAA, Ibota subgroup): A possible source of resistance to Radopholus similis and Pratylenchus goodeyi. Fundamental and Applied Nematology 21, 75−80.

Fortuner R, Merny J. 1979. Root parasitic nematodes of rice. Revue de Nematologie 2, 79-102.

Fraser CM, Chapple C. 2011. The Phenylpropanoid Pathway in Arabidopsis. The Arabidopsis Book, http://dx.doi.org/10.1199/tab.0152

Frederick RD, Thilmony RL, Sessa G, Martin GB. 1998. Recognition specificity for the bacterial avirulence protein AvrPto is determined by Thr-204 in the activation loop of the tomato Pto kinase. Molecular Cell 2, 241–245.

140

References

Frost CJ, Mescher MC, Carlson JE, De Moraes CM. 2008. Plant defense priming against herbivores: getting ready for a different battle. Plant Physiology 146, 818–824.

Fudali SL, Wang C, Williamson VM. 2013. Ethylene signaling pathway modulates attractiveness of host roots to the root-knot nematode Meloidogyne hapla. Molecular Plant-Microbe Interaction 26, 75–86.

Fujimoto T, Tomitaka Y, Abe H, Tsuda S, Futai K, Mizukubo T. 2011. Expression profile of jasmonic acid-induced genes and the induced resistance against the root knot nematode (Meloidogyne incognita) in tomato plants (Solanum lycopersicum) after foliar treatment with methyl jasmonate. Journal of Plant Physiology 168, 1084-1097.

Fujimoto T, Mizukubo T, Abe H, Seo S. 2015. Sclareol Induces Plant Resistance to Root-Knot Nematode Partially Through Ethylene-Dependent Enhancement of Lignin Accumulation. Molecular Plant-Microbe Interaction 28, 398-407.

Fu ZQ, Yan S, Saleh A, Wang W, Ruble J, Oka N, Mohan R, Spoel SH, Tada Y, Zheng N, Dong X. 2012. NPR3 and NPR4 are receptors for the immune signal salicylic acid in plants. Nature 486, 228–232.

Fu ZQ, Dong X. 2013. Systemic acquired resistance: turning local infection into global defense. Annual Review Plant Biology 64, 839–863.

Fu L, Yu X, An C. 2013.Overexpression of constitutively active OsCPK10 increases Arabidopsis resistance against Pseudomonas syringae pv. tomato and rice resistance against Magnaporthe grisea. Plant Physiology and Biochemistry 73, 202–210.

Gaffney T, Friedrich L, Vernooij B, Negrotto D, Nye G, Uknes S, Ward E, Kessmann H, Ryals J. 1993. Requirement of salicylic acid for the induction of systemic acquired resistance. Science 261, 754-756.

Galal A, Sharma S, Abou-Elwafa SF, Sharma S, Kopisch-Obuch F, Laubach E, Perovic D., Ordon F, Jung C. 2014. Comparative QTL analysis of root lesion nematode resistance in barley. Theoritecal and Applied Genetics 127, 1399−1407.

141

References

Gális I, Šimek P, Narisawa T, Sasaki M, Horiguchi T, Fukuda H, Matsuoka K. 2006. A novel R2R3 MYB transcription factor NtMYBJS1 is a methyl jasmonate-dependent regulator of phenylpropanoid conjugate biosynthesis in tobacco. The Plant Journal 46, 573–59.

Gardener BBM. 2009. Biocontrol of plant pathogens and plant growth promotion by Bacillus. Gisi U, Chet L, Gullino ML. (Eds). In: Recent Developments in Management of Plant Diseases, Springer Netherlands, 10.1007/978-1-4020-8804-9_6.

Geng C, Nie X, Tang Z, Zhang Y, Lin J, Sun M, Penga D. 2016. A novel serine protease, Sep1, from Bacillus firmus DS-1 has nematicidal activity and degrades multiple intestinal-associated nematode proteins. NCBI Scientific Report. doi: 10.1038/srep25012.

Gevers D, Cohan FM, Lawrence JG, Spratt BG, Coenye T, Feil EJ, Stackebrandt E, Van de Peer Y, Vandamme P, Thompson FL, Swings J.2005. Opinion: Re-evaluating prokaryotic species. Nature Reviews Microbiology 3, 733–739.

Gheysen G, Jones J. 2006. Molecular aspects of plant nematode interactions. In: Plant nematology (eds Perry, R. N. & Moens, M.), CABI, pp 234–254.

Glazebrook J. 2005. Contrasting mechanisms of defense against biotrophic and necrotrophic pathogens. Annual Review of Phytopathology 43, 205–227.

Glazebrook J, Chen W, Estes B, Chang H-S, Nawrath C, Metraux J-P, Zhu T, Katagiri F. 2003. Topology of the network integrating salicylate and jasmonate signal transduction derived from global expression phenotyping. Plant Journal 34, 217–228.

Gómez-Gómez L, Boller T. 2000. FLS2: An LRR Receptor–like Kinase Involved in the Perception of the Bacterial Elicitor Flagellin in Arabidopsis. Molecular Cell 5, 1003-1011.

Goodey, T. 1932. The genus Anguillulina Grev. and v. Ben., 1859, vel Tylenchus Bastion, 1985. Journal of Helminthology 10, 75-180.

Guo C, Sun X, Chen X, Yang S, Li J, Wang L, Zhang X. 2016. Cloning of novel rice blast resistance genes from two rapidly evolving NBS-LRR gene families in rice. Plant Molecular Biology 90, 95– 105.

142

References

Green CD. 1971. Mating and host finding behavior of plant nematodes. In: Plant parasitic nematodes. Zuckerman, B.M., Mai, W.F. & Rohde, R.A. (Eds). Vol. II. New York, NY, Academic Press, pp. 247-266.

Grover A, Gowthaman R. 2003. Strategies for development of fungus-resistant transgenic plants. Current Science 84, 330–340.

Grunewald W, Vanholme B, Pauwels L, Plovie E, Inze D, Gheysen G, Goossens A. 2009. Expression of the Arabidopsis jasmonate signalling repressor JAZ1/TIFY10A is stimulated by auxin. EMBO Report 10, 923–928.

Grundler FMW, Sobczak M, Golinowski W. 1998. Formation of wall openings in root cells of Arabidopsis thaliana following infection by the plant-parasitic nematode Heterodera schachtii. European Journal of Plant Pathology 104, 545–551.

Guedes MEM, Richmond S, Kuc J. 1980. Induced systemic resistance to anthracnose in cucumber as influenced by the location of the inducer inoculation with Colletotrichum lagenarium and the onset of flowering and fruiting. Physiological Plant Pathology 17, 229–233.

Gutjahr C, Sawers RJH, Marti G, Andrés-Hernández L, Yang S-Y, Casieri L, Angliker H, Oakeley EJ, Wolfender J-L, Abreu-Goodger C, Paszkowski U. 2106. Transcriptome diversity among rice root types during asymbiosis and interaction with arbuscular mycorrhizal fungi. Proceedings of the National Academy of Sciences of the United States of America 112, 6754–6759.

Haegeman A, Bauters L, Kyndt T, Rahman MM, Gheysen G. 2013. Identification of candidate effector genes in the transcriptome of the rice root knot nematode Meloidogyne graminicola. Molecular Plant Pathology 14, 379–390.

Hamamouch N, Li C, Seo PJ, Park CM, Davis EL. 2011. Expression of Arabidopsis pathogenesis- related genes during nematode infection. Molecular Plant Pathology 12, 355–364.

Haque A, Russell NJ. 2005. Phenotypic and genotypic characterisation of Bacillus cereus isolates from Bangladeshi rice. International Journal of Food Microbiology 98, 23-34.

Hao K, He P, Blom J, Rueckert C, Mao Z, Wu Y, He Y, Borriss R. 2012. The genome of plant growth-promoting Bacillus amyloliquefaciens subsp. plantarum strain YAU B9601-Y2 contains a gene cluster for mersacidin synthesis. Journal of Bacteriology 194, 3264 –3265.

143

References

Hao Z, Fayolle L, Van Tuinen D, Chatagnier O, Li X, Gianinazzi S, Gianinazzi-Pearson V, 2012. Local and systemic mycorrhiza-induced protection against the ectoparasitic nematode Xiphinema index involves priming of defense gene responses in grapevine. Journal of Experimental Botany 63, 3657-3672.

Harborne JB. 1982. Introduction to Ecological Biochemistry, 2nd edition. New York: Academic Press.

Hashimoto M, Kisseleva L, Sawa S, Furukawa T, Komatsu S, Koshiba T. 2004. A novel rice PR10 protein, RSOsPR10, specifically induced in roots by biotic and abiotic stresses, possibly via the jasmonic acid signaling pathway. Plant Cell Physiology 45, 550–559.

Hashioka Y, 1963. The rice stem nematode Ditylenchus angustus in Thailand. FAO Plant Protection Bulletin 11, 97−102.

Hasky-Gunther K, Hoffmann-Hergarten S, Sikora RA. 1998. Resistance against the potato cyst nematode Globodera pallida systemically induced by the rhizobacteria Agrobacterium radiobacter (G12) and Bacillus sphaericus (B43). Fundamental and Applied Nematology 21, 511–517.

Hasky-Gunther K, Sikora RA. 1995. Induced resistance: a mechanism induced systemically throughout the root system by rhizosphere bacteria towards the potato cyst nematode Globodera pallida. Nematologica 41, 306.

Hauschild R, Hallmann J, Sikora RA. 2000. Fusarium oxysporum and Meloidogyne incognita on tomato can be controlled by antagonistic rhizobacteria. Communications in Agricultural and Applied Biological Sciences 65, 527–528.

Haydock PPJ, Woods SR, Grove IG, Hare MC. 2006. Chemical control of nematodes. Plant Nematology 392−410.

Heil M, Bueno JCS. 2007. Within-plant signaling by volatiles leads to induction and priming of an indirect plant defence in nature. Proceedings of the National Academy of Science of the United States of America 104, 5467-5472.

144

References

Helliwell EE, Wang Q, Yang Y. 2013. Transgenic rice with inducible ethylene production exhibits broad-spectrum disease resistance to the fungal pathogens Magnaporthe oryzae and Rhizoctonia solani. Plant Biotechnology Journal 11, 33–42.

Hewezi T, Baum TJ. 2013. Manipulation of plant cells by cyst and root-knot nematode effectors. Molecular Plant-Microbe Interaction 26, 9–16.

Hodda M. 2011. Phylum Nematoda Cobb, 1932. In: Zhang, Z.-Q. (Ed.) Animal biodiversity: An outline of higher-level classification and survey of taxonomic richness. Zootaxa 3148, 63–95.

Hölscher D, Dhakshinamoorthy S, Alexandrov T, Becker M, Bretschneider T, Buerkert A, Crecelius AC, De Waele D, Elsen A, Heckel DG, Heklau H, Hertweck C, Kai M, Knop K, Krafft C, Maddula RK, Matthäus C, Popp J, Schneider B, Schubert US, Sikora RA, Svatoš A, Swennen RL. 2014. Phenalenone-type phytoalexins mediate resistance of banana plants (Musa spp.) to the burrowing nematodeRadopholus similis. Proceedings of the National Academy of Sciences of the United States of America 111, 105-110.

Hossain M, Jaim WMH, Alam MS, Rahman ANMM. 2013. Rice Biodiversity in Bangladesh: Adoption Diffusion and Disappearance of Varieties. BRAC Research and Evaluation Division, BRAC, Dhaka 1212, Bangladesh.

Hossain MT, Khan A, Chung EJ, Rashid MHO, Chung YR. 2016. Biological Control of Rice Bakanae by an Endophytic Bacillus oryzicolaYC7007. Plant Pathology Journal 32, 228–241.

Hou M, Xu W, Bai H, Liu Y, Li L, Liu L, Liu B, Liu G. 2012. Characteristic expression of rice pathogenesis-related proteins in rice leaves during interactions with Xanthomonas oryzae pv. oryzae. Plant Cell report 31, 895-904.

Howe GA, Jander G. 2008. Plant immunity to insect herbivores. Annual Review of Plant Biology 59, 41–66.

Hu X, Roberts DP, Maul JE, Emche SE, Liao X, Guo X, Liu Y, McKenna LF, Buyer JS, Liu S. 2011. Formulations of the endophytic bacterium Bacillus subtilis Tu-100 suppress Sclerotinia sclerotiorum on oilseed rape and improve plant vigor in field trials conducted at separate locations. Canadian Journal of Microbiology 59, 231-236.

145

References

Huang CS, Huang SP. 1972. Bionomics of white-tip nematode, Aphelenchoides besseyi, in rice florets and developing grains. Botanical Bulletin Academia Sinica 13, 1–10.

Huang JS. 1985. Mechanisms of resistance to root-knot nematodes. In: An advanced treatise on Meloidogyne. Biology and control. Sasser, J.N. & Carter, C.C. (Eds). Raleigh, NC, North Carolina State University Graphics, pp. 165-174

Huang JS, Barker KR. 1986. Radioimmunoassay of glyceollin-I in soybean roots infected with race-1 of Heterodera glycines. Phytopathology 76, 1139-1139.

Hwang SH, Lee IA, Yie SW, Hwang DJ. 2008. Identification of an OsPR10a promoter region responsive to salicylic acid. Planta 227, 1141–1150.

Huang X, Kurata N, Wei X, Wang Z, Wang A, Zhao Q, Zhao Y, Liu K, Lu H, Li W, Guo Y, Lu Y, Zhou C, Fan D, Weng Q, Zhu C, Huang T, Zhang L, Wang Y, Feng L, Furuumi H, Kubo T, Miyabayashi T, Yuan X, Xu Q, Dong G, Zhan Q, Li C, Fujiyama A, Toyoda A, Lu T, Feng Q, Qian Q, Li J, Han B. 2012. A map of rice genome variation reveals the origin of cultivated rice. Nature 490, 497–501.

Huang WK, Ji HL, Gheysen G, Debode J, Kyndt T. 2015a. Biochar-amended potting medium reduces the susceptibility of rice to root-knot nematode infections. BMC Plant Biology 15, 267.

Huang WK, Ji HL, Gheysen G, Kyndt T. 2015b.Thiamine-induced priming against root-knot nematode infection in rice involves lignification and hydrogen peroxide generation. Molecular Plant Pathology 17, 614–624.

Ibrahim SK, Perry RN. 1993. Desiccation survival of the rice stem nematode Ditylenchus angustus. Fundamental of Applied Nematology 16, 31−38.

Ibrahim SK, Perry RN. 1994. Infectivity and population-dynamics of the rice stem nematode, Ditylenchus angustus. Nematologica 40, 412-422.

Idris EE, Iglesias DJ, Talon M, Borriss R. 2007. Tryptophan-dependent production of indole-3- acetic acid (IAA) affects level of plant growth promotion by Bacillus amyloliquefaciens FZB42. Molecular Plant–Microbe Interactions 20, 619–626.

146

References

Idriss EE, Makarewicz O, Farouk A, Rosner K, Greiner R, Bochow H, Richter T, Borriss R. 2002. Extracellular phytase activity of Bacillus amyloliquefaciens FZB45 contributes to its plantgrowth- promoting effect. Microbiology 148, 2097–2109.

Insunza V, Alstrom S, Eriksson KB. 2002. Root bacteria from nematicidal plants and their biocontrol potential against trichodorid nematodes in potato. Plant Soil 241, 271–278.

IRRI, International Rice Research Institute, 1996. Standard Evaluation System for rice. 4th Ed., P. O. Box 933, 1099 Manila, the Philippines, p. 43.

IRRI. 2007a. Morphology of the rice plant and rice grains, International Rice Research Institute

(IRRI). Available online at http://www.knowledgebank.irri.org/ericeproduction/0.1._Morphology_of_the_rice_plant.htm

IRRI. 2007b. Rice races, International Rice Research Institute (IRRI). Available online at http://www.knowledgebank.irri.org/ericeproduction/0.5_Rice_races.htm.

IRRI. 2007c. The rice environments or ecosystems, International Rice Research Institute (IRRI). Available online at http://www.knowledgebank.irri.org/ericeproduction/0.3._Rice_environments.htm IRRI.

Ithal N, Recknor J, Nettleton D, Maier T, Baum TJ, Mitchum MG. 2007. Developmental transcript profiling of cyst nematode feeding cells in soybean roots. Molecular Plant–Microbe Interactions 20, 510–525.

Iwai T. Miyasaka A, Seo S, ohashi Y. 2006. Contribution of ethylene biosynthesis for resistance to blast fungus infection in young rice plants. Plant Physiology 142, 1202-1215.

Iwai T. Seo S, Mitsuhara I, Ohashi Y. 2007. Probenazole-induced accumulation of salicylic acid confers resistance to Magnaporthe grisea in adult rice plants. Plant Cell Physiology 48, 915–924.

Jakab G, Cottier V, Toquin V, Rigoli G, Zimmerli L, Métraux JP, Mauch-Mani B. 2001. β- Aminobutyric acid–induced resistance in plants. European Journal of Plant Pathology 107, 29–37.

Jena RN. & Rao YS. 1977. Nature of resistance in rice (Oryza sativa L.) to the root-knot nematode (Meloidogyne graminicola Golden and Birchfield). II. Mechanism of resistance. Proceedings of the Indian Academy of Sciences 86, 31-38.

147

References

Jetiyanon K, Plianbangchang P. 2010. Dose-responses of Bacillus cereus RS87 for growth enhancement in various Thai rice cultivars. Canadian Journal of Microbiology 56, 1011–1019.

Jia Y, McAdams SA, Bryan GT, Hershey HP, Valent B. 2000. Direct interaction of resistance gene and avirulence gene products confers rice blast resistance. EMBO Journal 19, 4004 4014.

Jiang CJ, Shimono M, Sugano S, Kojima M, Yazawa K, Yoshida R, Inoue H, Hayashi N, Sakakibara H, Takatsuji H. 2010. Abscisic acid interacts antagonistically with salicylic acid signaling pathway in rice-Magnaporthe grisea interaction. Molecular Plant Microbe Interaction 23, 791–798.

Ji HL, Gheysen G, Denil S, Lindsey K, Topping JF, Nahar K, Haegeman A, De Vos WH, Trooskens G, Van Criekinge W, Meyer TD, Kyndt T. 2013. Transcriptional analysis through RNA sequencing of giant cells induced by Meloidogyne graminicola in rice roots. Journal of Experimental Botany 64, 3885–3898.

Ji H, Gheysen G, Ullah C, Verbeek R, Shang C, De Vleesschauwer D, Hofte M, Kyndt T. 2015b. The role of thionins in rice defence against root pathogens. Molecular Plant Pathology 16, 870- 881.

Ji H, Kyndt T, He W, Vanholme B, Gheysen G. 2015a. β-Aminobutyric Acid–Induced Resistance Against Root-Knot Nematodes in Rice Is Based on Increased Basal Defense. Molecular Plant- Microbe Interactions 28, 519-533.

Jones JDG, Dangl JL. 2006. The plant immune system. Nature 444, 323–329.

Jones M, Payne H. 1978. Early stages of nematode-induced giant-cell formation in roots of Impatiens balsamina. Journal of Nematology 10, 70.

Jourdan E, Henry G, Duby F, Dommes J, Barthélemy J, Thonart P, Ongena, M. 2009. Insights into the defense-related events occurring in plant cells following perception of surfactin-type lipopeptide from Bacillus subtilis. Molecular Plant Microbe Interactions 22, 456–468.

Jung KH, An G, Ronald P.C. 2008. Towards a better bowl of rice: assigning function to tens of thousands of rice genes. Nature Reviews Genetics 9, 91–101.

Jung HW, Tschaplinkski TJ, Wang L, Glazebrook J, Greenberg JT. 2009. Priming in systemic plant immunity. Science 324, 89–91.

148

References

Jwa NS, Agrawal GK, Tamogami S, Yonekura M, Han O, Iwahashi H, Rakwal R. 2006. Role of defense ⁄ stress-related marker genes, proteins and secondary metabolites in defining rice self- defense mechanisms. Plant Physiology and Biochemistry 44, 261–273.

Kai M, Haustein M, Molina F, Petri A, Scholz B, Piechulla B. 2009. Bacterial volatiles and their action potential. Applied Microbiology and Biotechnology 81, 1001–1012.

Kaku H, Nishizawa Y, Minami NI, Tomiyama CA, Dohmae N, Takio K, Minami E, Shibuya N. 2006. Plant cells recognize chitin fragments for defense signaling through a plasma membrane receptor. Proceedings of the National Academy of Sciences of the United States of America 103, 11086–11091.

Kaloshian I, Yaghoobi J, Liharska T, Hontelez J, Hanson D, Hogan P, Jesse T, Wijbrandi J, Simons

G, Vos P, Zabel P, Williamson VM. 1998. Genetic and physical localization of the root-knot nematode resistance locus Mi in tomato. Molecular Genetics and Genomics 257, 376−385.

Kammerhofer N, Radakovic Z, Regis JMA, Dobrev P, Vankova R, Grundler FMW, Siddique S, Hofmann J, Wieczorek K. 2015. . Role of stress-related hormones in plant defence during early infection of the cyst nematode Heterodera schachtii in Arabidopsis. New Phytologist 207, 778– 789.

Kandibane M, Kumar K, Adiroubane D. 2010. Effect of Bacillus thuringiensis Berliner formulation against the rice leaf folder Cnaphalocrocis medinalis Guenee (Pyralidae: Lepidoptera). Journal of Biopesticides 3, 445–447.

Kaplan DT, Keen NT, Thomason IJ. 1980. Studies on the mode of action of glyceollin in soybean- incompatibility to the root-knot nematode, Meloidogyne incognita. Physiological Plant Pathology 16, 319-325.

Khallouk S, Voisin R, Van Ghelder C, Engler G, Amiri S, Esmenjaud D. 2011. Histological mechanisms of the resistance conferred by the Ma gene against Meloidogyne incognita in Prunus spp. Phytopathology 101, 945-951.

Khush GS. 1984. Terminology for rice growing environments. In: Terminology of rice growing environments. International Rice Research Institute. P.O. Box 933, Manila, Philippines, 5-10.

149

References

Khush GS. 1997. Origin, dispersal, cultivation and variation of rice. Plant Molecular Biology 35, 25–34.

Kikuchi T, Cock PJA, Helder J, Jones JT. 2014. Characterisation of the transcriptome of Aphelenchoides besseyi and identification of a GHF 45 cellulase. Nematology 16, 99–107.

Kim YH, Riggs RD, Kim KS. 1987. Structural changes with resistance of soybean to Heterodera glycines. Journal of Nematology 19, 177-187.

Kim ST, Yu S, Kang YH, Kim SG, Kim JY, Kim SH, Kang KY. 2008. The rice pathogen-related protein 10 (JIOsPR10) is induced by abiotic and biotic stresses and exhibits ribonuclease activity. Plant Cell Reports 27, 593–603.

Kinh DN. 1981. Survival of Ditylenchus angustus in diseased stubble. International Rice Research Newsletter 6, 13.

Kinh DN, Nghiem NT. 1982. Reaction of rice varieties to stem nematodes in Vietnam. International Rice Research Newsletter 7, 6−7.

Klessig DF, Malamy J. 1994. The salicylic acid signal in plants. Plant Molecular Biology 26, 1439– 1458.

Klink VP, Hosseini P, Matsye P, Alkharouf NW, Matthews BF. 2009. A gene expression analysis of syncytia laser microdissected from the roots of the Glycine max (soybean) genotype PI 548402 (Peking) undergoing a resistant reaction after infection by Heterodera glycines (soybean cyst nematode). Plant Molecular Biology 71, 525–567.

Kloepper JW, Leong J, Teintze M, Schroth M. 1980. Enhancing plant growth by siderophores produces by plant-growth-promoting rhizobacteria. Nature 286, 885–886.

Kloepper JW, Rodriguez-Kabana R, Mcinroy JA, Young RW. 1992. Rhizosphere bacteria antagonistic to soybean cyst (Heterodera glycines) and root-knot (Meloidogyne incognita) nematodes: identification by fatty acid analysis and frequency of biological control activity. Plant Soil 139, 75–84.

Kloepper JW, Ryu CM, Zhang S. 2004. Induced systemic resistance and promotion of plant growth by Bacillus spp. Phytopathology 94, 1259-1266.

150

References

Kohler A, Schwindling S, Conrath U. 2002. Benzothiadiazole-induced priming for potentiated responses to pathogen infection, wounding, and infiltration of water into leaves requires the NPR1/NIM1 gene in Arabidopsis. Plant Physiology 128, 1046–56

Kumari H, Dutta TK, Banakar P, Rao U. 2016. Comparing the defence-related gene expression changes upon root-knot nematode attack in susceptible versus resistant cultivars of rice. Nature Scientific Reports. Doi: 10.1038/srep22846

Kunkel BN, Brooks DM. 2002. Cross talk between signaling pathways in pathogen defense. Current Opinion in Plant Biology 5, 325-331.

Kyndt T, Denil S, Haegeman A, Trooskens G, Bauters L, Van Criekinge W, Meyer TD, Gheysen G. 2012. Transcriptional reprogramming by root knot and migratory nematode infection in rice. New Phytologist 196, 887–900.

Kyndt T, Fernandez D, Gheysen G. 2014. Plant-parasitic nematode infection in rice: molecular and cellular insights. Annual Review of Phytopathology 52, 135-153.

Latif MA, Ali MY, Islam MR, Rahman ML. 2004. Effect of three nematicides for the control of ufra disease of rice. Journal of Agricultural Education and Technology 5, 29−32.

Latif MA, Akter S, Kabir S, Ali MA, Hossain MA, Rahman ML. 2006. Efficacy of some organic amendments for the control of Ufra disease of rice. Bangladesh Journal of Microbiology 23, 118−120.

Latif MA, Rafii MY, Haque A, Jahan QSA, Hossain MA, 2011a. Cost-effective management of ufra disease of rice and identification of resistant landraces. Scientific Research and Essays 6, 2668−2675.

Latif MA, Ullah MW, Rafii MY, Tajul MI. 2011b. Management of ufra disease of rice caused by Ditylenchus angustus with nematicides and resistance. African Journal of Microbiological Research 5, 1660−1667.

Lee B, Farag MA, Park HB, Kloepper JW, Lee SH, Ryu CM. 2012. Induced resistance by a long- chain bacterial volatile: elicitation of plant systemic defense by a C13 volatile produced by Paenibacillus polymyxa. PLoS ONE 7, http://dx.doi.org/10.1371/journal.pone.0048744.

151

References

Lee HI, Leon J, Raskin I. 1995. Biosynthesis and metabolism of salicylic acid. Proceedings of the National Academy of Sciences of the United States of America 92, 4076-4079.

Lee SW, Han SW, Sririyanum M, Park CJ, Seo YS, Ronald PC. 2009. A type I-secreted, sulfated peptide triggers XA21-mediated innate immunity. Science 326, 850–853.

Lee SW, Han SW, Bartley LE, Ronald PC. 2006. Unique characteristics of Xanthomonas oryzae pv. oryzae AvrXa21 and implications for plant innate immunity. Proceedings of the National Academy of Sciences of the United States of America 103, 18395–18400.

Lee YS, Kim KY. 2016. Antagonistic Potential of Bacillus pumilus L1 against Root-Knot Nematode, Meloidogyne arenaria. Journal of Phytopathology 164, 29-39.

Leon-Reyes A, Spoel, SH, De Lange ES, Abe H, Kobayashi M, Tsuda S, Millenaar FF, Welschen RAM, Ritsema T, Pieterse CMJ. 2009. Ethylene modulates the role of NONEXPRESSOR OF PATHOGENESIS-RELATED GENES1 in cross talk between salicylate and jasmonate signaling. Plant Physiology 149, 1797–1809.

Lee HJ, Park YJ, Seo PJ, Kim J-H, Sim H-J, Kim S-G, Park C-M. 2015. Systemic immunity requires SnRK2.8-mediated nuclear import of NPR1 in Arabidopsis. Plant Cell 27, 3425–3438.

Linsell KJ, Riley IT, Davies KA, Oldach KH. 2014. Characterization of resistance to Pratylenchus thornei (Nematoda) in wheat (Triticum aestivum): attraction, penetration, motility, and reproduction. Nematology 104, 174−187.

Li B, Xie GL, Soad A, Coosemans J. 2005. Suppression of Meloidogyne javanica by antagonistic and plant growth promoting rhizobacteria. Journal of Zhejiang University Science 6, 496-501.

Li XQ, Wei JZ, Tan A, Aroian RV. 2007. Resistance to root-knot nematode in tomato roots expressing a nematicidal Bacillus thuringiensis crystal protein. Plant Biotechnology Journal 5, 455–464.

Li XQ, Tan A, Voegtline M, Bekele S, Chen CS, Aroian RV. 2008. Expression of Cry5B protein from Bacillus thuringiensis in plant roots confers resistance to root-knot nematode. Biological Control 47, 97–102.

152

References

Li Q, Xie Q-G, Smith-Becker J, Navarre DA, Kaloshin I. 2006. Mi-1-mediated aphid resistance involves salicylic acid and mitogen-activated protein kinase signaling cascades. Molecular Plant- Microbes Interactions 19, 655-664.

Liu J, Wang, X-J. 2006. An integrative analysis of the effects of auxin on jasmonic acid biosynthesis in Arabidopsis thaliana. Journal of Integrative Plant Biology 48, 99–103.

Liu W, Liu J, Triplett L, Leach JE, Wang GL. 2014. Novel insights into rice innate immunity against bacterial and fungal pathogens. Annual Review of Phytopathology 52, 213–241.

Liu WW, Mu W, Zhu BY, Du YC, Liu F. 2008. Antagonistic activities of volatiles from four strains of Bacillus spp. and Paenibacillus spp. against soil-borne plant pathogens. Agricultural Sciences in China 7, 1104–1114.

Londo JP, Chiang YC, Hung KH, Chiang TY, Schaal BA. 2006. Phylogeography of Asian wild rice, Oryza rufipogon, reveals multiple independent domestications of cultivated rice, Oryza sativa. Proceedings of the National Academy of Sciences of the United States of America 103, 9578– 9583.

Lorenzo O, Piqueras R, Sánchez-Serrano JJ, Solano R. 2003. ETHYLENE RESPONSE FACTOR1 integrates signals from ethylene and jasmonate pathways in plant defense. Plant Cell 15, 165–178.

Luc M, Sikora RA, Bridge J. 2005. Plant Parasitic Nematodes in Subtropical and Tropical Agriculture (Revised second ed) CAB International, Wallingford, UK.

Lugtenberg B, Kamilova, F. 2009. Plant-growth-promoting rhizobacteria. Annual Review of Microbiology 63, 541–556.

Mackey D, Holt BF 3rd, Wiig A, Dangl JL. 2002. RIN4 interacts with Pseudomonas syringae type III effector molecules and is required for RPM1-mediated resistance in Arabidopsis. Cell 108, 743- 754.

Madhaiyan M, Poonguzhali S, Kwon S-W, Sa T-M, 2010. Bacillus methylotrophicus sp. nov., a methanol-utilizing, plant-growth-promoting bacterium isolated from rice rhizosphere soil. International Journal of Systematic and Evolutionary Microbiology 60 2490-2495.

153

References

Mahdy M, Hallmann J, Sikora RA. 2001a. Biological control effectivity of Rhizobium etli G12 towards sedentary and migratory nematodes on various host plants. Phytopathology 91, S138.

Mahdy M, Hallmann J, Sikora RA. 2001b. Influence of plant species on the biological control activity of the antagonistic rhizobacterium Rhizobium etli strain G12 toward the root-knot nematode, Meloidogyne incognita. Communications in Agricultural and Applied Biological Sciences 66, 655–662.

Makandar R, Nalam V, Chaturvedi R, Jeannotte R, Sparks AA, Shah J. 2010. Involvement of salicylate and jasmonate signaling pathways in Arabidopsis interaction with Fusarium graminearum. Molecular Plant-Microbe Interactions 23, 861-870.

Maketon M. 2004. Effectiveness of Biobest (Bacillus subtilis NSRS 98-24+MK-007) in controlling rice sheath blight disease from Rhizoctonia solani Kuhn. Kasetsart University Science Journal 22, 24–30.

Malamy J, Klessig DF. 1992. Salicylic acid and plant disease resistance. Plant Journal 2, 643–645.

Maleck K, Levine A, Eulgem T, Morgan A, Schmid J, Lawton KA, Dangl, JL, Dietrich, RA. 2000. The transcriptome of Arabidopsis thaliana during systemic acquired resistance. Nature Genetics 26, 403–410.

Mandal S. 2010. Induction of phenolics, lignin and key defense enzymes in eggplant (Solanum melongena L.) roots in response to elicitors. African Journal of Biotechnology 9, 8038-8047.

Mao CZ, Wang SM, Jia QJ, Wu P. 2006. OsEIL1, a rice homolog of the Arabidopsis EIN3 regulates the ethylene response as a positive component. Plant Molecular Biology 61, 141–152.

Mendoza AR, Kiewnick S, Sikora RA. 2008. In vitro activity of Bacillus firmus against the burrowing nematode Radopholus similis, the root-knot nematode Meloidogyne incognita and the stem nematode Ditylenchus dipsaci. Biocontrol Science and Technology 18, 377–389.

Mendoza AR, Sikora RA. 2009. Biological control of Radopholus similis in banana by combined application of the mutualistic endophyte Fusarium oxysporum strain 162, the egg pathogenPaecilomyces lilacinus strain 251 and the antagonistic bacteria Bacillus firmus. Biocontrol 54, 263–272.

154

References

Manosalva P, Manohar Murli, von Reuss SH, Chen S, Koch A, Kaplan F, Choe A, Micikas RJ, Wang X, Kogel K-H, Sternberg PW, Williamson VM, Schroeder FC,. Klessig DF. 2015. Conserved nematode signalling molecules elicit plant defenses and pathogen resistance. Nature Communications 6, DOI: 10.1038/ncomms8795.

Mao C, Wang S, Jia Q, Wu P. 2006. OsEIL1, a rice homolog of the Arabidopsis EIN3 regulates the ethylene response as a positive component. Plant Molecular Biology 61, 141–152.

Matsushita A, Inoue H, Goto S, Nakayama A, Sugano S, Hayashi N, Takatsuji H. 2013. Nuclear ubiquitin proteasome degradation affects WRKY45 function in the rice defense program. Plant Journal 73, 302–313.

McGeachie I, Rahman L. 1983. Ufra disease: A review and a new approach to control. Tropical Pest Management 29, 325–332.

McClure MA, Ellis KC, Nigh EL. 1974. Postinfection development and histopathology of Meloidogyne incognita in resistant cotton. Journal of Nematology 6, 21-26.

McSpadden Gardener BB. 2004. Ecology of Bacillus and Paenibacillus spp. in Agricultural Systems. Phytopathology 94, 1252-1258.

Mei C, Qi M, Sheng G, Yang Y. 2006. Inducible overexpression of a rice allene oxide synthase gene increases the endogenous jasmonic acid level, PR gene expression, and host resistance to fungal infection. Molecular Plant Microbe Interactions 19, 1127–1137.

Melillo MT, Blave-Zacheo T, Zacheo G, Gahan PB. 1989, Histochemical localisation of carboxylesterases in roots of Lvcopersicon esrutentum response to Meloidogyne incognita infection. Annals of Applied Biology 114, 325-330.

Merchante C, Alonso JM, Stepanova AN. 2013. Ethylene signaling: simple ligand, complex regulation. Current Opinion in Plant Biology 16, 554–560.

Miah SA, Bakr MA. 1977. Sources of resistance to ufra disease of rice in Bangladesh. International Rice Research Newsletter 2, 8.

Miah SA, Rahman ML. 1985. Severe ufra outbreak in transplanted rice in Bangladesh. International Rice Research Newsletter 10, 24.

155

References

Mian IH, Latif MA. 1994. Ultrastructure and morphometrics of Ditylenchus angustus (Butler, 1913) Filipjevi, 1936 (Nematoda:Anguinidae). Japanese Journal of Nematology 24, 14-19.

Milligan S, Bodeau J, Yaghoobi J, Kaloshian I, Zabel P, Williamson VM. 1998. The root knot nematode resistance gene Mi from tomato is a member of the leucine zipper, nucleotide binding, leucine-rich repeat family of plant genes. Plant Cell 10, 1307–1319.

Mitkowski NA, Abawi GS. 2003. Reproductive fitness on lettuce of populations of Meloidogyne hapla from New York state vegetable fields. Nematology 5, 77–83.

Mitsuhara I, Iwai T, Seo S, Yanagawa Y, Kawahigasi H, Hirose S, Ohkawa Y, Ohashi Y. 2008. Characteristic expression of twelve rice PR1 family genes in response to pathogen infection, wounding, and defense-related signal compounds. Molecular Genetics and Genomics 279, 415– 427.

Miyamoto K, Shimizu T, Okada K. 2014. Transcriptional regulation of the biosynthesis of phytoalexin: a lesson from specialized metabolites in rice. Plant Biotechnology. DOI: 10.5511/plantbiotechnology.14.0730a

Mohr PG, Cahill DM. 2007. Suppression by ABA of salicylic acid and lignin accumulation and the expression of multiple genes, in Arabidopsis infected with Pseudomonas syringae pv. tomato. Functional and Integrative Genomics 7, 181–191.

Molina J, Sikora M, Garud N, Flowers JM, Rubinstein S, Reynolds A, Huang P, Jackson S, Schaal BA, Bustamante CD, Boyko AR, Purugganan MD. 2011. Molecular evidence for a single evolutionary origin of domesticated rice. Proceedings of the National Academy of Sciences of the United States of America 108, 8351–8356.

Molinari S, Fanelli E, Leonett P. 2014. Expression of tomato salicylic acid (SA)-responsive pathogenesis-related genes in Mi-1-mediated and SA-induced resistance to root-knot nematodes. Molecular Plant Pathology 15, 255-264.

Molitor A, Zajic D, Voll LM, Pons-Kuhnemann J, Samans B, Kogel KH, Waller F. 2011. Barley leaf transcriptome and metabolite analysis reveals new aspects of compatibility and Piriformospora indica-mediated systemic induced resistance to powdery mildew. Molecular Plant–Microbe Interactions 24, 1427–1439.

156

References

Mondal AH, Miah SA. 1987. Ufra problem in low-lying areas of Bangladesh. International Rice Research Newsletter 12, 29-30.

Moon HS, Khan Z, Kim SG, Son SH, Kin YH. 2010. Biological and structural mechanisms of disease development and resistance in chili pepper infected with the root-knot nematode. Plant Pathology Journal 26, 149-153.

Morgan PW, Drew MC. 1997. Ethylene and plant responses to stress. Physiologia Plantarum 100, 620-630.

Mou Z, Fan W, Dong X. 2003. Inducers of Plant Systemic Acquired Resistance Regulate NPR1 Function through Redox Changes. Cell 113, 935-944.

Mur LAJ, Kenton P, Atzorn R, Miersch O, Wasternack C. 2006. The outcomes of concentration- specific interactions between salicylate and jasmonate signaling include synergy, antagonism, and oxidative stress leading to cell death. Plant Physiology 140, 249-262.

Nahar K, Kyndt T, De Vleesschauwer D, Hofte M, Gheysen G. 2011. The jasmonate pathway is a key player in systemically induced defense against root knot nematodes in rice. Plant Physiology 157, 305–316.

Nahar K, Kyndt T, Hause B, Höfte M, Gheysen G. 2013. Brassinosteroids suppress rice defense against root-knot nematodes through antagonism with the jasmonate pathway. Molecular Plant Microbe Interactions 26, 106–115.

Nahar K, Kyndt T, Nzogela YB, Gheysen G. 2012. Abscisic acid interacts antagonistically with classical defense pathways in rice-migratory nematode interaction. New Phytologist 196, 901–913.

Nakashita H, Yoshioka K, Takayama M, Kuga R, Midoh N, Usami R, Horikoshi K, Yoneyama K, Yamaguchi I. 2001. Characterization of PBZ1, a probenazole-inducible gene, in suspension cultured rice cells. Bioscience, Biotechnology and Biochemistry 65, 205–208.

Nakashita H, Yasuda M, Nitta T, Asami T, Fujioka S, Arai Y, Sekimata K, Takatsuto S, Yamaguchi I, Yoshida S. 2003. Brassinosteroid functions in a broad range of disease resistance in tobacco and rice. Plant Journal 33, 887-898.

157

References

Nakazaki T, Tsukiyama T, Okumoto Y, Kageyama D, Naito K, Inouye K, Tanisaka T. 2006 Distribution, structure, organspecific expression, and phylogenic analysis of the pathogenesis related protein-3 chitinase gene family in rice (Oryza sativa L.). Genome 49, 619–630.

Nakano T, Suzuki K, Fujimura T, Shinshi H. 2006. Genomewide analysis of the ERF gene family in Arabidopsis and rice. Plant Physiology 140, 411–432.

Nandi B, Kundu K, Banerjee N, Babu SPS. 2003. Salicylic acid-induced suppression of Meloidogyne incognita infestation of okra and cowpea. Nematology 5: 747–752

Nascimento IO, Rodrigues AAC, Moraes FH, Sousa FA, Corsi MCF, Catarino AM. 2016. Isolation, identification and in vitro evaluation of Bacillus spp. in control of Magnaporthe oryzae comparing evaluation methods. African journal of Agricultural research 11, 1743-1749.

Návarová, H, Bernsdorff F, Döring AC, Zeier J. 2012. Pipecolic acid, an endogenous mediator of defense amplification and priming, is a critical regulator of inducible plant immunity. Plant Cell 24, 5123–5141.

Navarro L, Bari R, Achard P, Lison P, Nemri A, Harberd NP, Jones JDG. 2008. DELLAs control plant immune responses by modulating the balance of jasmonic acid and salicylic acid signaling. Current Biology 18, 650–655.

Nawrath C, Heck S, Parinthawong N, Metraux JP. 2002. EDS5, an essential component of salicylic acid-dependent signaling for disease resistance in Arabidopsis, is a member of the MATE transporter family. The Plant Cell 14, 275–286.

Nicholson R, Hammerschmidt R. 1992. Phenolic compounds and their role in disease resistance. Annual Review of Phytophology 30, 369-389.

Nicol JM, Ortiz-Monasterio I. 2004. Effects of the root-lesion nematode, Pratylenchus thornei, on wheat yields in Mexico. Nematology 6, 485–493.

Nicol JM, Turner SJ, Coyne DL, den Nijs L, Hockland S, Maafi ZT. 2011. Current nematode threats to world agriculture. In: Genomics and Molecular Genetics of Plant–Nematode Interactions. Jones JT, Gheysen G, Fenoll C. (Eds). Springer, Heidelberg, pp. 21–44.

158

References

Nombela G, Williamson VM, Muniz M. 2003. The root-knot nematode resistance gene Mi-1.2 of tomato is responsible for resistance against the whitefly Bemisia tabaci. Molecular Plant Microbe Interactions 16, 645–649.

O’Donnell PJ, Schmelz EA, Moussatche P, Lund ST, Jones JB, Klee HJ. 2003. Susceptible to intolerance: a range of hormonal actions in a susceptible Arabidopsis pathogen response. Plant Journal 33, 245–57.

Oostendorp M, Sikora RA.1990. In vitro interrelationship between rhizosphere bacteria and Heterodera schachtii. Revue Nematology 13, 269-274.

Owen K, Green C, Deverall B. 2002. A benzothiadiazole applied to foliage reduces development and egg deposition by Meloidogyne spp. in glasshouse- grown grapevine roots. Australian Plant Pathology 31, 47-53.

Pallas JA, Paiva NL, Lamb C, Dixon RA. 1996. Tobacco plants epigenetically suppressed in phenylalanine ammonia-lyase expression do not develop systemic acquired resistance in response to infection by tobacco mosaic virus. Plant Journal 10, 281–293.

Pandey SP, Somssich IE. 2009. The role of WRKY transcription factors in plant immunity. Plant Physiology 150, 648–1655.

Park SW, Kaiyomo E, Kumar D, Mosher SL, Klessig DF. 2007. Methyl salicylate is a critical mobile signal for plant systemic acquired resistance. Science 318, 113–116.

Paulson RE, Webster JM. 1972. Ultrastructure of the hypersensitive reaction in roots of tomato, Lycopersicon esculentum L., to infection by the root-knot nematode, Meloidogyne incognita. Physiological Plant Pathology 2, 227-234.

Pedrosa EMR, Hussey RS, Boerma HR. 1996. Penetration and post infectional development and reproduction of Meloidogyne arenaria races 1 and 2 on susceptible and resistant soybean genotypes. Journal of Nematology 28, 343-351.

Pegard A, Brizzard G, Fazari A, Soucaze O, Abad P, Djian-Caporalino C. 2005. Histological characterization of resistance to different root-knot nematode species related to phenolics accumulation in Capsicum annuum. Phytopathology 95, 158-165.

159

References

Pérez-García A, Romero D, de Vicente A. 2011. Plant protection and growth stimulation by microorganisms: biotechnological applications of Bacilli in agriculture. Current Opinion in Biotechnology 22, 187–193.

Perry RN. 1997. Plant signals in nematode hatching and attraction. In: Cellular and Molecular Aspects of Plant-Nematode Interaction. C. Fenoll, ed. Kluwer Academic Publishers, Boston. 38- 50.

Perry RN, Moens M. 2011a. Introduction to plant-parasitic nematodes. In: Genomics and Molecular Genetics of Plant–Nematode Interactions. modes of parasitism. Jones JT, Gheysen L, Fenoll C. (Eds). Springer, Heidelberg, pp. 3–20.

Perry RN, Moens M. 2011b. Survival of parasitic nematodes outside the host. In: Molecular and Physiological Basis of Nematode Survival. Perry RN, Wharton DA. (Eds). CAB International, Oxfordshire, pp. 1–27.

Pieterse CMJ, Leon-Reyes A, Van der Ent S, Van Wees SCM. 2009. Networking by small- molecule hormones in plant immunity. Nature Chemical Biology 5, 308-316.

Pieterse CMJ, Van Wees SCM. 2015. Induced systemic resistance. In: Principles of Plant-Microbe Interactions, Lugtenberg B. (ed.), Springer International Publishing Switzerland, pp 123-133.

Pieterse CMJ, Van Wees SCM, Hoffland E, van Pelt JA, van Loon LC. 1996. Systemic resistance in Arabidopsis induced by biocontrol bacteria is independent of salicylic acid accumulation and pathogenesis-related gene expression. Plant Cell 8, 1225–1237.

Pieterse CMJ, Van Wees SCM, Van Pelt JA, Knoestera M, Laana R, Gerrits H, Weisbeek PJ, Van Loon LC. 1998. A novel signaling pathway controlling induced systemic resistance in Arabidopsis. Plant Cell 10, 1571–1580.

Pieterse CMJ, Van der Does D, Zamioudis, C, Leon-Reyes A, Van Wees SCM. 2012. Hormonal modulation of plant immunity. Annual Review of Cell and Developmental Biology 28, 489–521.

Pieterse CMJ, Zamioudis C, Berendsen RL, Weller DM, Van Wees SCM, Bakker PAHM. 2014. Induced systemic resistance by beneficial microbes. Annual Review of Phytopathology 52, 347– 375.

160

References

Ping L, Boland W. 2004. Signals from the underground: bacterial volatiles promote growth in Arabidopsis. Trends in Plant Science 9, 263–266.

Plowright RA, Gill JR. 1994. Aspects of resistance in deepwater rice to the stem nematode Ditylenchus angustus. Fundamental Applied Nematology 17, 357−367.

Plowright RA, Gill JR, Akehurst TE. 1992. Assessment of resistance and susceptibility to stem nematode Ditylenchus angustus. International Rice Research Newsletter 17, 11-12 & Erratum 17, 23.

Plowright RA, Grayer RJ, Gill JR, Rahman ML, Harborne JB. 1996. The induction of phenolic compounds in rice after infection by the stem nematode Ditylenchus angustus. Nematologica 42, 564−578.

Pauwels L, Morreel K, De Witte E, Lammertyn F, Van Montagu M, Boerjan W, Inzé D, Goossens A. 2008. Mapping methyl jasmonate-mediated transcriptional reprogramming of metabolism and cell cycle progression in cultured Arabidopsis cells. Proceedings of the National Academy of Sciences of Unites States of America 105, 380–385.

Pozo MJ, Verhage A, Garcia-Andrade J, Garcia JM, Azcon-Aguilar C. 2009. Priming plant defenses against pathogens by arbuscular mycorrhizal fungi. In Mycorrhizas: Functional Processes and Ecological Impact, Azcon-Aguilar C, Barea JM, Gianinazzi S, Gianinazzi-Pearson V (eds), pp. 137–49. Berlin/Heidelberg: Springer.

Prasad JS, Varaprasad KS. 2002. Ufra nematode, Ditylenchus angustus is seed borne. Crop Protection 21, 75−76.

Prasad JS, Varaprasad KS, Rao PRM, Rajan CD. 2000. Record of ufra nematode, Ditylenchus angustus on rice in Andhra Pradesh, India. Oryza 37, 2.

Pré, M. Atallah M, Champion A, De Vos M, Pieterse CM, Memelink J. 2008. The AP2/ERF domain transcription factor ORA59 integrates jasmonic acid and ethylene signals in plant defense. Plant Physiology 147, 1347–1357.

Prot JC. 1980. Migration of plant-parasitic nematodes towards plant roots. Revue de Nématologie 3, 305-318.

161

References

Prot J. 1994. Combination of nematodes, Sesbania rostrata, and rice: the two sides of the coin. International Rice Research Notes 19.

Qiu D, Xiao J, Ding X, Xiong M, Cai M, Cao Y, Li X, Xu C, Wang S. 2007. OsWRKY13 mediates rice disease resistance by regulating defense-related genes in salicylate- and jasmonate-dependent signaling. Molecular Plant Microbe Interactions 20, 492–499.

Quideau S, Deffieux D, Douat-Casassus C, Pouységu L. 2011. Plant polyphenols: chemical properties, biological activities, and synthesis, Angewandte Chemie International Edition 50, 586–621.

Raaijmakers JM., de Bruijn I, Nybroe O. Ongena M. 2010. Natural functions of lipopeptides from Bacillus and Pseudomonas: more than surfactants and antibiotics. Fems Microbiology Reviews 34, 1037–1062.

Racke J, Sikora R. 1992. Isolation, formulation and antagonistic activity of rhizobacteria towards the potato cyst nematode Globodera pallida. Soil Biology and Biochemistry 24, 521-526.

Radja Commarea R, Nandakumara R, Kandana A, Sureshb S, Bharathib M, Raguchandera T, Samiyappana R. 2002. Pseudomonas fluorescens based bio-formulation for the management of sheath blight disease and leaf folder insect in rice. Crop Protection 21, 671–677.

Rahman ML. 1987. Source of ufra-resistant deepwater rice. International Rice Research Newsletter 7, 6.

Rahman ML. 2003. Ufra- a menace to deepwater rice. In: Advances in Nematology. Trivedi PC. (ed.). Scientific Publishers (India), Jodhpur, India. pp 115-124.

Rahman ML, Evans AAF. 1987. Studies on host-parasite relationships of rice stem nematode, Ditylenchus angustus (Nematoda: Tylenchida) on rice, Oryza sativa, L. Nematologica 33, 451– 459.

Rahman ML, Miah SA. 1985. Chemical Control of ufra disease (Bangladesh). International Rice Research Newsletter 10, 17.

Rahman A, Uddin W, Wenner NG. 2015. Induced systemic resistance responses in perennial ryegrass against Magnaporthe oryzae elicited by semi-purified surfactin lipopeptides and live cells of Bacillus amyloliquefaciens. Molecular Plant Microbe Interactions 16, 546–558.

162

References

Rakwal R, Agrawal GK, Agrawal VP. 2001. Jasmonate, salicylate, protein phosphatase 2A inhibitors and kinetin up-regulate OsPR5 expression in cut-responsive rice (Oryza sativa). Journal of Plant Physiology 158, 1357–1362.

Rakwala R, Agrawala GK, Yonekurab M. 2001.Light-dependent induction of OsPR10 in rice (Oryza sativa L.) seedlings by the global stress signaling molecule jasmonic acid and protein phosphatase 2A inhibitors. Plant Science 161, 469–479.

Ramakrishnan S, Varadharajan G, Sutharsan PD. 1984. TKM 9 is resistant to rice-root nematode. International Rice Research Newsletter 9, 20.

Ramírez CA, Kloepper JW. 2010. Plant growth promotion by Bacillus amyloliquefaciens FZB45 depends on inoculum rate and P-related soil properties. Biology and Fertility of Soils 46, 835–844.

Raskin I. 1992. Role of salicylic acid in plants. Annual Review of Plant Physiology 43, 439–463.

Rakwal R, Komatsu S. 2000. Role of jasmonate in rice (Oryza sativa L.) self-defense mechanism using proteome analysis. Electrophoresis 21, 2492–2500.

Rao YS, Prasad JS, Panwar MS, 1986. Stem nematode (Ditylenchus angustus): a potential pest of rice in Assam and West Bengal, India. International Nematology Network Newsletter 3, 24–26.

Rawsthorne D, Brodie BB. l986. Relationship between root growth of potato, root diffusate production, and hatching of Globodera rostochiensis. Journal of Nematology 18, 379-384.

Reversat G, Boyer J, Sannier C, Pando-Bahuon A. 1999. Use of a mixture of sand and water- absorbent synthetic polymer as substrate for the xenic culturing of plant parasitic nematodes in the laboratory. Nematology 1, 209–212.

Reymond P, Farmer EE. 1998. Jasmonate and salicylate as global signals for defense gene expression. Current Opinion in Plant Biology 1, 404–411.

Riemann M, Haga K, Shimizu T, Okada K, Ando S, Mochizuki S, Nishizawa Y, Yamanouchi U, Nick P, Yano M, Minami E, Takano M, Yamane H, Iino M. 2013. Identification of rice allene oxide cyclase mutants and the function of jasmonate for defence against Magnaporthe oryzae. Plant Journal. doi:10.1111/tpj.12115.

163

References

Riga E. 2004. Orientation behaviour. In: nematode behaviour, Gaugler R. Bilgrami AL (eds), CAB International.

Robert-Seilaniantz, A. Grant M, Jones JDG. 2011. Hormone crosstalk in plant disease and defense: more than just jasmonate-salicylate antagonism. Annual Review of Phytopathology 49, 317-343.

Rojo E, Titarenko E, Leon J, Berger S, Vancanneyt G, Sanchez-Serrano JJ. 1998. Reversible protein phosphorylation regulates jasmonic acid–dependent and –independent wound signal transduction pathways in Arabidopsis thaliana. Plant Journal 13, 153–165.

Ronald PC, Beutler B. 2010. Plant and animal sensors of conserved microbial signatures. Science 330, 1061–1064.

Ross AF. 1961. Systemic acquired resistance induced by localized virus infections in plants. Virology 14, 340–358.

Rossi, M., Goggin, F., Milligan, S.B., Kaloshian, I., Ullman, D., Williamson, V.M., 1998. The nematode resistance gene Mi of tomato confers resistance against the potato aphid. Proceedings of the National Academy of Sciences of the United States of America 95, 9750–9754.

Rouppe van der Voort JR, Kanyuka K, van der Vossen E, Bendahmane A, Mooijman P, Klein- Lankhorst R, Stiekema W, Baulcombe D, Bakker J. 1999. Tight physical linkage of the nematode resistance gene Gpa2 and the virus resistance gene Rx on a single segment introgressed from the wild species Solanum tuberosum subsp. andigena CPC1673 into cultivated potato. Molecular Plant Microbe Interaction 12, 197–206.

Rovira AD, Sands DC. 1977. Fluorescent pseudomonas – a residual component in the soil microflora?. Journal of Applied Microbiology 34, 253-259.

Roy AK. 1982. Survival of Meloidogyne graminicola under different moisture conditions in vitro. Nematologia Mediterranea 10, 221-222.

Rückert C, Blom J, Chen X, Reva O, Borriss R. 2011. Genome sequence of B. amyloliquefaciens type strain DSM7T reveals differences to plant-associated B. amyloliquefaciens FZB42. Journal of Biotechnology 155, 78–85.

164

References

Rudrappa T, Biedrzycki ML, Kunjeti SG, Donofrio NM, Czymmek KJ, Paré PW, Bais HP. 2010. The rhizobacterial elicitor acetoin induces systemic resistance in Arabidopsis thaliana. Communicative and Integrative Biology 3, 130–138.

Rushton PJ, Torres JT, Parniske M, Wernert P, Hahlbrock K, Somssich IE. 1996. Interaction of elicitor-induced DNA binding proteins with elicitor response elements in the promoters of parsley PR1 genes. EMBO Journal 15, 5690–5700.

Ryu CM, Farag MA, Reddy CH, Hu MS, Wei HX, Pare PW, Kloepper JW. 2003. Bacterial volatiles promote growth in Arabidopsis. Proceedings of the National Academy of Sciences of the United States of America 100, 4927–4932.

Ryu CM, Farag MA, Hu CH, Reddy MS, Kloepper JW, Paré PW. 2004. Bacterial volatiles induce systemic resistance in Arabidopsis. Plant Physiology 134, 1017–1026.

Rzewuski G, Sauter M. 2008. Ethylene biosynthesis and signaling in rice. Plant Science 175, 32– 42.

Sanz-Alferez S, Mateos B, Alvarado R, Sanchez M. 2008. SAR induction in tomato plants is not effective against root-knot nematode infection. European Journal of Plant Pathology 120, 417–425.

Sattar SA. 2005. Bridging the rice yield gap in Bangladesh. http://www.fao.org/docrep/003/x6905e/x6905e07.htm

Schafer K. 2007. Dissecting rhizobacteria-induced systemic resistance in tomato against Meloidogyne incognita: the first step using molecular tools. Dissertation, Rheinische Friedrich- Wilhelms-Universitat Bonn, Germany.

Schaff JE, Nielsen DM, Smith CP, Scholl EH, Bird DM. 2007. Comprehensive transcriptome profiling in tomato reveals a role for glycosyltransferase in Mi-mediated nematode resistance. Plant Physiology 144, 1079–1092.

Schafer K, Silva Fabry C, Sikora RA, Hauschild R. 2006. Molecular investigations of rhizobacteria-induced systemic resistance toward the root-knot nematode Meloidogyne incognita in tomato. Multitrophic interactions in soil. IOBC/WPRS Bulletin 29, 135–140.

165

References

Schluttenhofer C, Pattanaik S, Patra B, Yuan L. 2014. Analyses of Catharanthus roseus and Arabidopsis thaliana WRKY transcription factors reveal involvement in jasmonate signaling. BMC Genomics 15, 502.

Schmitt DP, Riggs RD. 1991. Influence of selected plant species on hatching of eggs and development of juveniles of Heterodera glycines. Journal of Nematology 23, 1-6.

Schenk PM, Kazan K, Wilson I, Anderson JP, Richmond T, Somerville SC, Manners JM. 2000. Coordinated plant defense responses in Arabidopsis revealed by microarray analysis. Proceedings of the National Academy of Sciences of the United States of America 97, 11655–11660.

Schrimsher DW, Lawrence KS, Castillo J, Moore SR, Kloepper JW. 2011. Effects of Bacillus firmus GB-126 on the Soybean Cyst Nematode mobility in vitro. Phytopathology 101, 161–161.

Sein T. 1977. Seed-borne infection and ufra disease. International Rice Research Newsletter 2, 6.

Sein T, Zan K. 1977. Ufra disease spread by water flow. International Rice Research Newsletter 2, 5.

Seshadri AR, Dasgupta DR. 1975. Ditylenchus angustus. C.I.H. Descriptions of Plant Pathogenic Nematodes. Commonwealth Institute of Helminthology set 5, No. 65.

Sharma R, De Vleesschauwer D, Sharma MK, Ronald PC. 2013. Recent advances in dissecting stress-regulatory crosstalk in rice. Molecular Plant 6, 250–260.

Sharma S, Kopisch-Obuch FJ, Keil T, Laubach E, Stein N, Graner A, Jung C. 2011. QTL analysis of root-lesion nematode resistance in barley: 1. Pratylenchus neglectus. Theoritical and Applied Genetics 122, 1321–1330.

Shen X, Liu H, Yuan B, Li X, Xu C, Wang S. 2011. OsEDR1 negatively regulates rice bacterial resistance via activation of ethylene biosynthesis. Plant Cell Environment 34, 179-191.

Shimono M, Sugano S, Nakayama A, Jiang CJ, Ono K, Toki S, Takatsuji H. 2007. Rice WRKY45 Plays a Crucial Role in Benzothiadiazole-Inducible Blast Resistance. The Plant Cell 19, 2064– 2076.

Shimono M, Koga H, Akagi A, Hayashi N, Goto S, Sawada M, Takayuki K, Matsushita A, Sugano S, Jiang CJ, Kaku H, Inoue H, Takatsuji H. 2012. Rice WRKY45 plays important roles in fungal and bacterial disease resistance. Molecular Plant Pathology 13, 83–94.

166

References

Shimizu T, Miyamoto K, Miyamoto K, Minami E, Nishizawa Y, Iino M, Nojiri H, Yamane H. Okada K. 2013. OsJAR1 contributes mainly to biosynthesis of the stressinduced jasmonoyl- isoleucine involved in defense responses in rice. Bioscience, Biotechnology, and Biochemistry 77, 1556–1564.

Siddiqui IA. 1971. Histopathogenesis of galls induced by Meloidogyne naasi in oat roots. Nematologica 17, 237-242.

Siddiqui, IA. 2002. Suppression of Meloidogyne javanica by Pseudomonas aeruginosa and Bacillus subtilis in tomato. Nematologia mediterranea 30, 125–130.

Siddiqui IA, Shaukat SS. 2004. Systemic Resistance in tomato induced by biocontrol bacteria against the root-knot nematode, Meloidogyne javanica is independent of salicylic acid production. Journal of Phytopathology 152, 48-54.

Siddiqui ZA, Mahmood I. 1999. Role of bacteria in the management of plant parasitic nematodes: A review. Bioresource Technology 69, 167-179.

Siddiqui ZA, Mahmood I. 2001. Effects of rhizobacteria and root symbionts on the reproduction of Meloidogyne javanica and growth of chickpea. Bioresource Technology 79, 41–46.

Silverman P. Seskar M. Kanter D. Schweizer P, Metraux JP. Raskin I. 1995. Salicylic acid in rice: biosynthesis, conjugation, and possible role. Plant Physiology 108, 633–639.

Sikora RA. 1992. Management of the antagonistic potential in agricultural ecosystems for the biological control of plant parasitic nematodes. Annual Review of Phytopathology 30, 245-270.

Sikora RA, Hoffmann-Hergarten S. 1992. Importance of plant health-promoting rhizobacteria for the control of soil-borne fungal diseases and plant parasitic nematodes. Arab Journal of Plant Protection 10, 53–58.

Singh SK, Hodda M, Ash GJ, Banks NC. 2013. Plant-parasitic nematodes as invasive species: characteristics, uncertainty and biosecurity implications. Annals of Applied Biology 163, 323–350.

Solano R, Stepanova A, Chao Q, Ecker JR. 1998. Nuclear events in ethylene signaling: a transcriptional cascade mediated by ETHYLENE-INSENSITIVE3 and ETHYLENE-RESPONSE- FACTOR1. Genes and Development 12, 3703–3714.

167

References

Soriano IR, Asenstorfer RE, Schmidt O, Riley IT. 2004. Inducible flavone in oats (Avena sativa) is a novel defense against plant-parasitic nematodes. Phytopathology 94, 1207–1214.

Spoel SH, Dong X. 2012. How do plant achieve immunity? Defence without specialized immune cells. Nature Review Immunology 12, 89-100.

Spoel SH, Johnson JS, Dong X. 2007. Regulation of tradeoffs between plant defenses against pathogens with different lifestyles. Proceedings of the National Academy of Sciences of the United States of America 104, 18842–18847.

Spoel SH, Koornneef A, Claessens SM, Korzelius JP, Van Pelt JA, Mueller MJ, Buchala AJ, Metraux JP, Brown R, Kazan K, Van Loon LC, Dong X, Pieterse CM. 2003. NPR1 modulates cross-talk between salicylate- and jasmonate dependent defense pathways through a novel function in the cytosol. Plant Cell 15, 760–770.

Spoel SH, Mou ZL, Tada Y, Spivey NW, Genschik P, Dong X. 2009. Proteasome-mediated turnover of the transcription coactivator NPR1 plays dual roles in regulating plant immunity. Cell 137, 860–872.

Stein E, Molitor A, Kogel KH, Waller F. 2008. Systemic resistance in Arabidopsis conferred by the mycorrhizal fungus Piriformospora indica requires jasmonic acid signaling and the cytoplasmic function of NPR1. Plant Cell Physiology 49, 1747–1751.

Stirling GR. 1991. Biological control of plant-parasitic nematodes: progress, problems and prospects. CAB International, Wallingford.

Suprapta DN, Khalimi K, Darmadi AAK. 2016. Molecular identification of local plant growth promoting rhizobacteria that act as resistance inducing agent against rice blast disease. Journal of Current Research in Science 4, 1-6.

Takatsuji H, Jiang CJ, Sugano S. 2010. Salicylic acid signaling pathway in rice and the potential applications of its regulators. Japan Agricultural Research Quarterly 44, 217– 223.

Takeuchi K, Gyohda A, Tominaga M, Kawakatsu M, Hatakeyama A, Ishii N, Shimaya K, Nishimura T, Riemann M, Nick P, Hashimoto M, Endo A, Okamoto T, Jikumaru Y, Kamiya Y, Terakawa T, Koshiba T. 2011. RSOsPR10 expression in response to environmental stresses is

168

References regulated antagonistically by jasmonate/ethylene and salicylic acid signaling pathways in rice roots. Plant Cell Physiology 52, 1686–1696.

Tamaoki D, Seo S, Yamada S, Kano A, Miyamoto A, Shishido H, Miyoshi S, Taniguchi S, Akimitsu K, Gomi K. 2013. Jasmonic acid and salicylic acid activate a common defense system in rice. Plant Signaling and Behavior. Doi: 10.4161/psb.24260.

Tamogami S, Rakwal R, Kodama O. 1997. Phytoalexin production elicited by exogenously applied jasmonic acid in rice leaves (Oryza sativa L.) is under the control of cytokinins and ascorbic acid. FEBS Letters 412, 61–64.

Tanaka, N, Che FS, Watanabe N, Fujiwara S, Takayama S, Isogai A. 2003. Flagellin from an incompatible strain of Acidovorax avenae mediates H2O2 generation accompanying hypersensitive cell death and expression of PAL, Cht-1, and PBZ1, but not of Lox in rice. Molecular Plant Microbe Interactions 16, 422–428.

Tang X, Frederick RD, Zhou J, Halterman DA, Jia Y, Martin GB. 1996. Initiation of plant disease resistance by physical interaction of AvrPto and Pto kinase. Science 274, 2060–2063.

Tao Z, Liu H, Qiu D, Zhou Y, Li X, Xu C, Wang S. 2009. A pair of allelic WRKY genes play opposite roles in rice-bacteria interactions. Plant Physiology 151, 936–948.

Tateda C, Zhang Z, Shrestha J, Jelenska J, Chinchilla D, Greenberg JT. 2014. Salicylic acid regulates Arabidopsis microbial pattern receptor kinase levels and signaling. Plant Cell 26, 4171– 4187.

Taheri P, Tarighi S. 2010. Riboflavin induces resistance in rice against Rhizoctonia solanivia jasmonate-mediated priming of phenylpropanoid pathway. Journal of Plant Physiology 167, 201– 208.

Teixeira MA, Wei L, Kaloshian I. 2016. Root-knot nematodes induce pattern-triggered immunity in Arabidopsis thaliana roots. New phytologist 211, 276–287.

Terefe M, Tefera T, Sakhuja PK. 2009. Effect of a formulation of Bacillus firmus on root-knot nematode Meloidogyne incognita infestation and the growth of tomato plants in the greenhouse and nursery. Journal of Invertebrate Pathology 100, 94–99.

169

References

Thomma BPHJ. Eggermont K, Pennincks IAMA, Mauch Mani B, Vogelsang R, Cammue BPA, Broekaert WF. 1998. Separate jasmonate dependent and salicylate-dependent defense-response pathways in Arabidopsis are essential for resistance to distinct microbial pathogens. Proceedings of the National Academy of Sciences of the United States of America 95, 15107–15111.

Thurau T, Kifle S, Jung C, Cai D. 2003. The promoter of the nematode resistance gene Hs1pro1 activates a nematode-responsive and feeding site specific gene expression in sugar beet (Beta vulgaris L.) and Arabidopsis thaliana. Plant Molecular Biology 52, 643–660.

Tuzun S, Kuc J. 1985. Movement of a factor in tobacco infected with Peranospora tabacina Adam which systemically protects against blue mold. Physiological Plant Pathology 26, 321–330.

Triantaphyllou AC. 1973. Environmental sex differentiation of nematodes in relation to pest management. Annual Review of Phytopathology 11, 441-462.

Trudgill DL.1991. Resistance to and tolerance of plant parasitic nematodes in plants. Annual

Review of Phytopathology 29, 167–193.

Tucker ML, Xue P, Yang R. 2010. 1-Aminocyclopropane-1-carboxylic acid (ACC) concentration and ACC synthase expression in soybean roots, root tips, and soybean cyst nematode (Heterodera glycines)-infected roots. Journal of Experimental Botany 61, 463–472.

Turner SJ, Stone AR. 1984. Development of potato cyst-nematodes in roots of resistant Solanum tuberosum spp. andigena and S. vernei hybrids. Nematologica 30, 324-332.

Underwood W. 2012. The plant cell wall: a dynamic barrier against pathogen invasion. Frontiers in Plant Science 3, 85.

USDA. 2015. USDA foreign agricultural service. Available online at http://gain.fas.usda.gov/Recent%20GAIN%20Publications/Grain%20and%20Feed%20Annual_D haka_Bangladesh_5-5-2015.pdf

Valette C, Andary C, Geiger JP, Sarah JL, Nicole M. 1998. Histochemical and Cytochemical Investigations of Phenols in Roots of Banana Infected by the Burrowing Nematode Radopholus similis. Nematology 88, 1141-1148.

Vallad GE, Goodman RM. 2004. Systemic acquired resistance and induced systemic resistance in conventional agriculture. Crop Science 44, 1920–1934.

170

References

Van der Ent S, Verhagen BWM, Van Doorn R, Bakker D, Verlaan MG, Pel MJC, Joosten RG, Proveniers MCG, Van Loon LC, Ton J, Pieterse CMJ. 2008. MYB72 is required in early signaling steps of rhizobacteria-induced systemic resistance in Arabidopsis. Plant Physiology 146, 1293– 1304.

Van de Mortel JE, De Vos RCH, Dekkers E, Pineda A, Guillod L, Bouwmeester K, Van Loon JJA, Dicke M, Raaijmakers J. 2012. Metabolic and transcriptomic changes induced in Arabidopsis by the rhizobacterium Pseudomonas fluorescens SS101. Plant Physiology 160, 2173–2188.

Van den Bosch S, Schutyser W, Vanholme R, Driessen T, Koelewijn S.-F, Renders T, De Meester B, Huijgen WJJ, Dehaen W, Courtin CM, Lagrain B, Boerjan W, Sels BF. 2015. Reductive lignocellulose fractionation into soluble lignin-derived phenolic monomers and dimers and processable carbohydrate pulps. Energy and Environmental Science 8, 1748-1763.

Van Loon LC, Bakker PAHM. 2005. Induced systemic resistance as a mechanism of disease suppression by rhizobacteria. In: PGPR: biocontrol and biofertilization. Siddiqui ZA (ed), Springer, Dordrecht, pp 39–66

Van Loon LC, Rep M, Pieterse CM. 2006. Significance of inducible defense-related proteins in infected plants. Annual Review of Phytopathology 44, 135–162.

Van Megen H, van den Elsen S, Holterman M, Karssen G, Mooyman P, Bongers T, Holovachov O, Bakker J, Helder J. 2009. A phylogenetic tree of nematodes based on about 1200 full-length small subunit ribosomal DNA sequences. Nematology 11, 927-950.

Van Peer R, Niemann GJ, Schippers B. 1991. Induced resistance and phytoalexin accumulation in biological control of fusarium wilt of carnation by Pseudomonas sp. strain WCS417r. Phytopathology 81, 728–734.

Van Wees SCM, Pieterse CM, Trijssenaar A, Van’t Westende YA, Hartog F, Van Loon LC. 1997. Differential induction of systemic resistance in Arabidopsis by biocontrol bacteria. Molecular Plant Microbe Interaction 10, 716–724.

Van Wees SCM, Van der Ent S, Pieterse CMJ. 2008. Plant immune responses triggered by beneficial microbes. Current Opinion in Plant Biology 11, 443–448.

171

References

Vaugan DA. 1994. The wild relatives of rice: A genetic resources handbook. International Rice Research Institute. Manilla, Phillipines.

Verberne MC, Hoekstra J, Bol JF, Linthorst HJM. 2003. Signaling of systemic acquired resistance in tobacco depends on ethylene perception. Plant Journal 35, 27–32.

Verberne MC, Verpoorte R, Bol JF, Mercado-Blanco J, Linthorst HJM. 2000. Overproduction of salicylic acid in plants by bacterial transgenes enhances pathogen resistance. Nature Biotechnology 18, 779–783.

Veremis JC, Roberts PA. 1996. Identification of resistance to Meloidogyne javanica in the Lycopersicon peruvianum complex. Theoretical and Applied Genetics 93, 894–901.

Verhagen BWM, Glazebrook J, Zhu T, Chang HS, Van Loon LC, Pieterse CMJ. 2004. The transcriptome of rhizobacteria-induced systemic resistance in Arabidopsis. Molecular Plant- Microbe Interactions 17, 895–908.

Verpoorte R. 2000. Secondary metabolism. In: Verpoorte R, Alfermann AW (eds) Metabolic Engineering of Plant Secondary Metabolism. Springer Science, Dordrecht.

Viaene N, Coyne DL, Kerry BR. 2006. Biological and cultural management. In: Perry RN, Moens M (eds). Plant nematology. CABI, Wallingford.

Villanueva LM, Prot J-C, Matias DM. 1992. Plant parasitic nematodes associated with upland rice in the Philippines. Journal of Plant Protection in the Tropics 9, 143-149.

Vlot AC, Dempsey D’MA, Klessig DF. 2009. Salicylic Acid, a Multifaceted Hormone to Combat Disease. Annual Review of Phytopathology 47, 177-206.

Vrain TC, Barker KR, Holtzman GI. 1978. Influence of low temperature on rate of development of Meloidogyne incognita and M. hapla larvae. Jounal of Nematology 10, 166–171.

Vogt T. 2010. Phenylpropanoid Biosynthesis. Molecular Plant 3, 2-10.

Vos C, Claerhout S, Mkandawire R, Panis B, Dirk De W, Elsen A. 2012. Arbuscular mycorrhizal fungi reduce root-knot nematode penetration through altered root exudation of their host. Plant and Soil 354, 335–345.

172

References

Vos CM, Tesfahun AN, Panis B, De Waele D, Elsen A. 2012. Arbuscular mycorrhizal fungi induce systemic resistance in tomato against the sedentary nematode Meloidogyne incognita and the migratory nematode Pratylenchus penetrans. Applied Soil Ecology 61, 1-6.

Vos P, Simons G, Jesse T, Wijbrandi J, Heinen L, Hogers R, Frijters A, Groenendijk J, Diergaarde P, Reijans M, Fierens-Onstenk J, de Both M, Peleman J, Liharska T, Hontelez J, Zabeau M. 1998. The tomato Mi-1 gene confers resistance to both root-knot nematodes and potato aphids. Nature Biotechnology 16, 1365–1369.

Vuong HH, Rabarijoela P. 1968. Note preliminaire sure la presence des nematodes parasites duriz a Madagascar: Aphelenchoides besseyi Christie 1942 and Ditylenchus angustus (Butler 1913) Filipjev 1936. Agronomie Tropicale, Nogent-sure-marne 23(10): 1025-1048 (English summary)

Wakuta S, Suzuki E, Saburi W, Matsuura H, Nabeta K, Imai R, Matsui H. 2011. OsJAR1 and OsJAR2 are jasmonyl-L-isoleucine synthases involved in wound- and pathogen-induced jasmonic acid signalling. Biochemical and Biophysical Research Communications 409, 634–639.

Wang D, Pajerowska-Mukhtar K, Hendrickson Culler A, Dong X. 2007. Salicylic acid inhibits pathogen growth in plants through repression of the auxin signaling pathway. Current Biology 17, 1784–1790.

Warrier RK, Tripathi KK, Ahuja V, Govila OP. 2011. Biology of Oryza sativa L. (rice). Ministry of Environmental and Forests, New Delhi, India, Department of Biotechnology, 63.

Wasternack C, Hause B. 2013. Jasmonates: biosynthesis, perception, signal transduction and action in plant stress response, growth and development. An update to the 2007 review in Annals of Botany. Annals of Botany 111, 1021-1058.

Watanabe H, Saigusa M, Hase S, Hayakawa T, Satoh S. 2004. Cloning of a cDNA encoding an ETR2-like protein (Os-ERL1) from deep water rice (Oryza sativa L.) and increase in its mRNA level by submergence, ethylene, and gibberellin treatments. Journal of Experimental Botany 55, 1145–1148.

Wei G, Kloepper JW, Tuzun S. 1991. Induction of systemic resistance of cucumber to Colletrotichum orbiculare by select strains of plant-growth promoting rhizobacteria. Phytopathology 81, 1508–1512.

173

References

Whitehead AG, Fraser JE, Nichols AJF. 1987. Variation in the development of stem nematodes, Ditylenchus dipsaci, in susceptible and resistant crop plants. Annals of Applied Biology 111, 373– 383.

Wildermuth MC, Dewdney J, Wu G, Ausubel FM. 2001. Isochorismate synthase is required to synthesize salicylic acid for plant defence. Nature 414, 562–571.

Williams J, Taylor P, Bogacki P, Pallotta M, Bariana S, Wallwork H. 2002. Mapping of the root lesion nematode (Pratylenchus neglectus) resistance gene Rlnn1 in wheat. Theoretical and Applied Genetics 104, 874–879.

Williams KJ, Fisher JM. 1993. Development of Heterodera avenae Woll and host cellular- responses in susceptible and resistant wheat. Fundamenatal and Applied Nematology 16, 417-423.

Williams TD, Beane J. 1979. Temperature and root exudates on the cereal cyst nematode Heterodera avenae. Nematologica 25,397-405.

Williams WM. 1972. Laboratory screening of white claver for resistance to stem nematode. New Zealand Journal of Agricultural Research 15, 363–370.

Williamson VM. 1998. Root-knot nematode resistance genes in tomato and their potential for future use. Annual Review of Phytopathology 36, 277–293.

Wink M. 2003. Evolution of secondary metabolites from an ecological and molecular phylogenetic perspective. Phytochemistry 64, 3–19.

Winkel-Shirley B. 2001. Flavonoid Biosynthesis. A Colorful Model for Genetics, Biochemistry, Cell Biology, and Biotechnology. Plant physiology 126, 485-493.

Wong E. 1973. Plant phenolics. In: Butler GW, Bailey RW, eds. Chemistry and biochemistry of herbage, vol. 1. London: Academic Press, 265-322.

Wubben MJ 2nd, Su H, Rodermel SR, Baum TJ. 2001. Susceptibility to the sugar beet cyst nematode is modulated by ethylene signal transduction in Arabidopsis thaliana. Molecular Plant- Microbe interactions 14, 1206–1212.

Wubben MJE, Jin J, Baum TJ. 2008. Cyst nematode parasitism of Arabidopsis thaliana is inhibited by salicylic acid (SA) and elicits uncoupled SA-independent pathogenesis-related gene expression in root. Molecular Plant-Microbe interactions 21, 424-432.

174

References

Wuyts, N, Lognay G, Swennen R, De Waele D. 2006. Nematode infection and reproduction in transgenic and mutant Arabidopsis and tobacco with an altered phenylpropanoid metabolism. Journal of Experimental Botany 57, 2825-2835.

Wuyts N, Lognay G, Verscheure M, Marlier M, De Waele D, Swennen R. 2007. Potential physical and chemical barriers to infection by the burrowing nematode Radopholus similis in roots of susceptible and resistant banana (Musa spp.). Plant Pathology 56, 878-890.

Wuyts N, Swennen R, De Waele D. 2006. Effects of plant phenylpropanoid pathway products and selected terpenoids and alkaloids on the behaviour of the plant-parasitic nematodes Radopholus similis, Pratylenchus penetrans and Meloidogyne incognita. Nematology 8, 89-101.

Wu Q, Hou MM, Li LY, Liu LJ, Hou YX, Liu GZ. 2011. Induction of pathogenesis-related proteins in rice bacterial blight resistant gene Xa21-mediated interactions with Xanthomonas oryzae pv. oryzae. Journal of Plant Pathology 93, 455–459.

Wu Y, Zhang D, Chu JY, Boyle P, Wang Y, Brindle ID, Luca VD, Despres C. 2012. The Arabidopsis NPR1 protein is a receptor for the plant defense hormone salicylic acid. Cell Report 1, 639–647.

Wu L, Wu H, Chen L, Yu X, Borriss R, Gao X. 2015. Difficidin and bacilysin from Bacillus amyloliquefaciens FZB42 have antibacterial activity against Xanthomonas oryzae rice pathogens. Nature Scientific Reports 5, 12975.

Xiong J, Zhou Q, Luo H, Xia L, Li L, Sun M, Yu Z. 2015. Systemic nematicidal activity and biocontrol efficacy of Bacillus firmus against the root-knot nematode Meloidogyne incognita. World Journal of Microbiology and Biotechnology 31, 661–667.

Xiong L, Yang Y. 2003. Disease resistance and abiotic stress tolerance in rice are inversely modulated by an abscisic acid-inducible mitogen-activated protein kinase. Plant Cell 15, 745–759.

Xu J, Audenaert K, Hofte M, De Vleesschauwer D. 2013. Abscisic acid promotes susceptibility to the rice leaf blight pathogen Xanthomonas oryzae pv oryzae by suppressing salicylic acid mediated defenses. PloS one, 8: 10.1371/annotation/659105c2-8364-4cc7-94e7-66620370637a.

175

References

Yang DL, Li Q, Deng Y, Lou T, Wang M, Zhou G, Zhang Y, He Z. 2008. Altered disease development in the eui mutants and Eui overexpressors indicates that gibberellins negatively regulate rice basal disease resistance. Molecular Plant 1, 528–537.

Yang DL, Yang Y, He Z. 2013. Roles of plant hormones and their interplay in rice immunity. Molecular Plant 6, 675–685.

Yang SF, Hoffman NE. 1984. Ethylene biosynthesis and its regulation in higher-plants. Annual Review of Plant Physiology 35, 155–189.

Yang YN, Qi M, Mei C. 2004. Endogenous salicylic acid protects rice plants from oxidative damage caused by aging as well as biotic and abiotic stress. The Plant Journal 40, 909-919.

Yang YX, Wang MM, Ren Y, Onac E, Zhou G, Peng S, Xia XJ, Shi K, Zhou YH, Yu JQ. 2014. Light-induced systemic resistance in tomato plants against root-knot nematode Meloidogyne incognita. Plant Growth Regulation 76, 167-175.

Yau CP, Wang L, Yu M, Yu M, Zee SY, Yip WK. 2004. Differential expression of three genes encoding an ethylene receptor in rice during development, and in response to indole-3-acetic acid and silver ions. Journal of Experimental Botany 55, 547–556.

Yuan Y, Zhong S, Li Q, Zhu Z, Lou Y, Wang L, Wang M, Li Q, Yang D, He Z. 2007. Functional analysis of rice NPR1-like genes reveals that OsNPR1/NH1 is the rice orthologue conferring disease resistance with enhanced herbivore susceptibility. Plant Biotechnology Journal 5, 313– 324.

Yu K, Soares JM, Mandal MK, Wang C, Chanda B, Gifford AN, Fowler JS, Navarre D, Kachroo A, Kachroo P. 2013. A feedback regulatory loop between G3P and lipid transfer proteins DIR1 and AZI1 mediates azelaic-acid-induced systemic immunity. Cell Reports 3, 1266–1278.

Zamioudis C, Hanson J, Pieterse CMJ. 2014. β-Glucosidase BGLU42 is a MYB72-dependent key regulator of rhizobacteria-induced systemic resistance and modulates iron uptake responses in Arabidopsis roots. New Phytologists 204, 368–379.

Zander M, Chen S, Imkampe J, Thurow C, Gatz C. Repression of the Arabidopsis thaliana jasmonic acid/ethylene-induced defense pathway by TGA-interacting glutaredoxins depends on their C-terminal ALWL motif. Molecular Plant 5, 831–840.

176

References

Zhang Z. 2013. Animal biodiversity: An update of classification and diversity in 2013. In: Animal Biodiversity: An Outline of Higher-level Classification and Survey of Taxonomic Richness (Addenda 2013) Zhang, Z.-Q. (Ed.). Zootaxa 3703, 5–11.

Zhang J, Li Y, Yuan H, Sun B, Li H. 2016. Biological control of the cereal cyst nematode (Heterodera filipjevi) by Achromobacter xylosoxidans isolate 09X01 and Bacillus cereus isolate 09B18. Biological Control 92, 1–6.

Zhang RS, Liu YF, Luo CP, Wang XY, Liu YZ, Qiao JQ, Yu JJ, Chen ZY. 2012. Bacillus amyloliquefaciens Lx-11, a potential biocontrol agent against rice bacterial leaf streak. Journal of Plant Pathology 94, 609-619.

Zhai C, Zhang Y, Yao N, Lin F, Liu Z, Dong Z, Wang L, Pan Q. 2014. Function and interaction of the coupled genes responsible for Pik-h encoded rice blast resistance. PLoS One 9, e98067. http://dx.doi.org/10.1371/journal.pone.0098067.

Zhao CJ, Wang AR, Shi YJ, Wang LQ, Liu WD, Wang ZH, Lu GD. 2008. Identification of defense- related genes in rice responding to challenge by Rhizoctonia solani. Theoritical Applied Genetics 116, 501–516.

Zhou L, Yuen G, Wang Y, Wei L, Ji G. 2016. Evaluation of bacterial biological control agents for control of root-knot nematode disease on tomato. Crop Protection 84, 8-13.

Zhu F, Xi DH, Yuan S, Xu F, Zhang DW, Lin HH. 2014. Salicylic acid and jasmonic acid are essential for systemic resistance against tobacco mosaic virus in Nicotiana benthamiana. Molecular Plant-Microbe Interactions 27, 567-577.

Zipfel C, Robatzek S, Navarro L, Oakeley EJ, Jones JDG, Felix G, Boller T. 2004. Bacterial disease resistance in Arabidopsis through flagellin perception. Nature 428, 764–767.

Zuckerman BM, Dicklow MB, Acosta N. 1993. A Strain of Bacillus thuringiensis for the Control of Plant‐parasitic Nematodes. Biocontrol Science and Technology 3, 41-46.

Zwart, R.S., Thompson, J.P., Godwin, I.D., 2005. Identification of quantitative trait loci for resistance to two species of root-lesion nematode (P. thornei and P. neglectus) in wheat. Australian Journal of Agricultural Research 56, 345–352

177

Curriculum Vitae Curriculum Vitae

Personal information Full name: Shakhina Khanam Date of birth: 01 July 1984 Nationality: Bangladeshi Personal e-mail: [email protected] Work address: Department of Molecular Biotechnology, Coupure links 653, Gent 9000, Belgium Tel: +3292645967 Work e-mail: [email protected] Education 2011 – 2016: PhD training The Doctoral School of Bioscience Engineering, Ghent University, Belgium 2009 – 2011: Master of Science in Nematology Ghent University, Belgium 2004 – 2008: Bachelor of Science in Agriculture Sher-e-Bangla Agricultural University, Bangladesh

Professional Career VLIR-UOS ICP Sandwich PhD Scholarship (2011-2015): The Flemish competitive scholarship for doing PhD at the Ghent University of Belgium. VLIR-UOS Masters scholarship (2009-2011): The Flemish competitive scholarship for doing International Masters in Nematology at the Ghent University of Belgium. Publications with peer reviewing Khanam, S., Akanda, A.M., Ali, A.M., Kyndt, T. and Gheysen, G (2015). Identification of Bangladeshi rice varieties resistant to ufra disease caused by the nematode Ditylenchus angustus. Crop Protection 79, 162–169.

Conference and symposia contributions  Khanam, S., Akanda, A.M., Ali, A.M., Kyndt, T. and Gheysen, G. 2014. Reactions of different rice genotypes to rice stem nematode Ditylenchus angustus. 66th International Symposium on Crop Protection, Gent, Belgium, 20th May 2014. Oral presentation

 Khanam, S., Kyndt, T. and Gheysen G. 2015. The plant hormones methyl jasmonate, ethylene and salicylate enhance rice defence to the stem nematode Ditylenchus angustus. 67th International Symposium on Crop Protection, Gent, Belgium, 19th May 2015. Poster presentation

178

Appendix Appendix

Table A1. Characteristics of the rice varieties used to evaluate the response against Ditylenchus angustus

Rice variety BRRI Crop plant height Grain yield Ecosystem Ecotype Accession no. cycle (cm) (t/ha) (days) Maloti 3660 136 135-143 2.18-2.20 Rainfed Aus, Aman Munar 3889 146 135 2.10 Rainfed Aus Kalomota 5991 120 127 2.53 Rainfed Aman Sadamota 1576 134 134 2.37 Rainfed Aman Mowlata 7922 140 130 2.55 Rainfed Aman Dudkolom 4068 109 110 2.27 Rainfed Ama Kheya 1709 149 120 2.25 Rainfed Aman Chikon 1227 142 100 2.26 Rainfed Aman Nakhuchimota 1606 147 140 2.51 Rainfed Aman Sakkhor khora 1605 134 140 2.27 Rainfed Aman Manikpukha -- 155 145 1.85 Rainfed Aman DWR1 6351 127 130 1.20 DWR DWR DWR2 6352 127 130 1.05 DWR DWR DWR3 6353 133 140 0.98 DWR DWR DWR4 6354 134 140 1.20 DWR DWR DWR5 6355 125 165 1.08 DWR DWR DWR6 6356 125 165 1.30 DWR DWR DWR7 6357 127 130 1.50 DWR DWR DWR8 6358 127 140 1.38 DWR DWR DWR9 6359 127 130 1.40 DWR DWR DWR10 6360 119 160 1.02 DWR DWR DWR11 6361 141 162 1.12 DWR DWR DWR12 6362 153 145 1.25 DWR DWR DWR13 6363 141 135 1.40 DWR DWR DWR14 6364 133 140 1.40 DWR DWR DWR15 6365 125 120 1.38 DWR DWR DWR16 6366 125 130 1.02 DWR DWR DWR17 6367 127 160 1.24 DWR DWR DWR18 6368 125 140 1.23 DWR DWR DWR19 6369 131 135 1.50 DWR DWR DWR20 6370 131 127 1.60 DWR DWR BR1 6865 120-150 88 4.0-5.5 Irrigated Boro, Aus Rainfed BR2 6866 160-125 120 5.0-4.0 Irrigated Boro, Aus Rainfed BR3 4759 130-170 95-100 4.0-6.5 Rainfed Boro, Aus, Irrigated Aman BR4 7088 145 125 5.0 Rainfed Aman BR5 4343 150 120 3.0 Rainfed Aman BR6 6867 110-150 100-113 3.5-4.5 Irrigated Boro, Aus Rainfed BR7 6868 130-155 125 3.5-4.5 Irrigated Boro, Aus Rainfed BR8 6869 125-160 125 5.0-6.0 Irrigated Boro, Aus Rainfed BR9 6870 120-155 125 5.0-6.0 Irrigated Boro, Aus Rainfed BR10 7089 150 115 5.5 Rainfed Aman BR11 7318 145 115 5.5 Rainfed Aman BR12 6871 130-170 105 4.5-5.5 Irrigated Boro, Aus Rainfed

179

Appendix

Table A1. Continue

Rice variety BRRI Crop cycle plant height Grain Ecosystem Ecotype Accession no. (days) (cm) yield (t/ha) BR14 6872 120-160 120 5.0-6.0 Irrigated Boro, Aus Rainfed BR15 6873 125-165 90-100 5.0-5.5 Irrigated Boro, Aus Rainfed BR16 6874 165-130 90-110 6.0-5.0 Irrigated Boro, Aus Rainfed BR17 6875 155 125 6.0 Irrigated Boro BR18 6876 170 115 6.0 Irrigated Boro BR19 6877 170 110 6.0 Irrigated Boro BR18 3687 115 120 3.5 Rainfed Aus BR21 6199 110 100 3.0 Rainfed Aus BR22 7090 150 125 5.0 Rainfed Aman BR23 7091 150 120 5.5 Rainfed Aman BR24 4276 105 105 3.5 Rainfed Aus BR25 4277 135 138 4.5 Rainfed Aman BR26 4278 115 115 4.0 Rainfed Aus BRRI Dhan 27 4408 115 140 4.0 Rainfed Aus BRRI Dhan 28 4409 140 90 6.0 Irrigated Boro BRRI Dhan 29 4410 160 95 7.5 Irrigated Boro BRRI Dhan 30 4411 145 120 5.0 Rainfed Aman BRRI Dhan 31 4412 141 115 5.0 Rainfed Aman BRRI Dhan 32 4413 130 120 5.0 Rainfed Aman BRRI Dhan 33 7092 118 100 4.5 Rainfed Aman BRRI Dhan 34 7093 135 117 3.5 Rainfed Aman BRRI Dhan 35 6878 155 105 5.0 Irrigated Boro BRRI Dhan 36 6879 140 90 5.0 Irrigated Boro BRRI Dhan 37 7094 140 125 3.5 Rainfed Aman BRRI Dhan 38 7095 140 125 3.5 Rainfed Aman BRRI Dhan 39 7096 122 106 4.5 Rainfed Aman BRRI Dhan 41 7098 148 115 4.5 Rainfed Aman BRRI Dhan 42 6214 100 100 3.5 Rainfed Aus BRRI Dhan 43 6215 100 100 3.5 Rainfed Aus BRRI Dhan 44 7099 145 130 5.5 Rainfed Aman BRRI Dhan 45 6880 145 100 6.5 Irrigated Boro BRRI Dhan 46 7100 150 105 4.7 Rainfed Aman BRRI Dhan 47 6881 152 105 6.0 Irrigated Boro BRRI Dhan 48 7980 110 105 5.5 Rainfed Aus BRRI Dhan 49 7101 135 100 5.5 Rainfed Aman BRRI Dhan 50 6882 155 82 6.0 Irrigated Boro BRRI Dhan 51 7319 140-145 90 4.5 Rainfed Aman BRRI Dhan 52 7320 145 116 5.0 Rainfed Aman BRRI Dhan 53 7321 125 105 4.5 Rainfed Aman BRRI Dhan 54 7322 135 115 4.5 Rainfed Aman BRRI Dhan 55 7323 145-105 100 7.0- 5.0 Irrigated Boro, Aus Rainfed BRRI Dhan 56 -- 105-110 115 4.5 Rainfed Aman Rayeda 16-06-3 -- 135 160 4.5 DWR DWR All rice varieties belong to the indica type. Source: Genetic Resource and Seed (GRS) division of Bangladesh Rice research Institute (BRRI), Gazipur-1701 and Hossain et al. (2013)

180

Appendix

Fig. A1. Relationship between the early scoring system (at 28 dpi) and the actual number of nematodes inside the plant. Black dots represent the mean and standard error of 15 plants and different letters on the dot indicate significant differences (Duncan Multiple Range Test with P = 0.05). The graph is the representation of one of two independent experiments with similar results and r represents the correlation co-efficient value with p value. Data represent one of another replicate than the one in Fig 2.2.

181

Appendix

Fig A2. Number of Ditylenchus angustus in shoots of resistant and susceptible rice genotypes at 1 and 3 days after inoculation (dai). 15 days old rice plants were inoculated with 100 nematodes of D. angustus. Bars represent the mean and standard error of the number of nematodes per plant recorded on 8 plants. Different letters indicate statistically significant differences (Duncan’s multiple range test with α = 0.05). Data represent two of three independent experiments with similar results. RResistant genotype; SSusceptible genotype. Data represent another two replications (A & B) other than the one in Fig 3.1

182

Appendix

Fig A3. Shoot invasion of Ditylenchus angustus second- or third–stage juveniles (J2/J3), fourth-stage juveniles (J4) and adults in resistant and susceptible rice genotypes at 1 (A) and 3 (B) days after inoculation (dai). 15 days old rice plants were inoculated with 100 nematodes of D. angustus. Bars represent the mean number of nematodes per plant recorded on 8 plants. Different letters indicate statistically significant differences (non-parametric Kruskal-Wallis test with α = 0.05). Data represent two of three independent experiments with similar results (1 and 2) other than the one in Fig 3.2. RResistant genotype; SSusceptible genotype.

183

Appendix

Fig A4. Percentage of Ditylenchus angustus developmental stages feeding on resistant and susceptible rice shoots at different times of the nematode life cycle (A) 7, (B) 14, (C) 21 and (D) 28 days after inoculation (dai). Bars represent the mean percentage of each stage of nematodes recorded on 8 plants. Nematode development in Manikpukha was compared to the susceptible rice genotypes Nipponbare and BR26. Single asterisks indicate significant differences of developmental stages of Manikpukha from BR26 and double asterisks indicate a significant difference between Manikpukha and both Nipponbare and BR26 (Independent Samples t test with α = 0.05). Data represent one of two independent experiments with similar results. RResistant genotype; SSusceptible genotype; Sg second generation. Data represent one of another replicate than the one in Fig 3.3.

184

Appendix

Fig A5. Number of Ditylenchus angustus in shoots of resistant and susceptible rice genotypes at 7, 14, 21 and 28 days after inoculation (dai). 15 days old rice plants were inoculated with 100 nematodes of D. angustus. Lines represent the mean and standard error of the number of nematodes per plant recorded on 8 plants. Data represent one of two independent experiments with similar results. Different letters indicate statistically significant differences (Duncan’s multiple range test with α = 0.05). RResistant genotype; SSusceptible genotype. RResistant genotype; SSusceptible genotype. Data represent one of another replicate than the one in Fig 3.4.

Fig A6. Number of Ditylenchus angustus eggs per plant in resistant and susceptible rice genotypes at 14, 21, and 28 days after inoculation (dai). 15 days old rice plants were inoculated with 100 nematodes of D. angustus. Bars represent the mean and standard error of the number of eggs per plant recorded on 8 plants. Data represent one of two independent experiments with similar results. Different letters indicate statistically significant differences (Duncan’s multiple range test with α = 0.05). RResistant genotype; SSusceptible genotype. Data represent one of another replicate than the one in Fig 3.5.

185

Appendix

Fig A7. (A). Susceptibility towards Ditylenchus angustus in SA signalling deficient WRKY45 RNAi, SA deficient transgenic NahG, ET insensitive Ein2b, JA insensitive Coi RNAi, and the corresponding wild type Nipponbare plants and (B) Susceptibility for D. angustus in JA biosynthesis mutant hebiba and the corresponding wild type Nihonmasari. Bars represent the mean and standard error of the number of nematodes per plant 20 days after nematode inoculation, recorded on 8 plants. Different letters in the picture A and B indicate statistically significant differences (Duncan Multiple Range Test with α = 0.05). Data represent two (1 & 2) of three independent experiments with similar results other than the one in Fig 4.1.

186

Appendix

Fig A8. Effect of foliar application of plant hormones and corresponding hormone inhibitors on rice defence against D. angustus infection. Shoots of fifteen-day-old plants were sprayed until runoff with 100 µM MeJA, 250 µM BTH, 500 µM ethephon, 25 mM AOA, 100 µM DIECA, 100 µM PALi or the corresponding control solution. After 24 h of treatment, plants were inoculated with 100 nematodes of D. angustus. Bars represent the mean and standard error of the number of nematodes per plant 20 days after nematode inoculation recorded on 8 plants. Different letters indicate statistically significant differences (Duncan’s multiple range test with α = 0.05). Data represent two (1 & 2) of three independent experiments with similar results than the one in Fig 4.2. MeJA, Methyl jasmonate; Eth, Ethephone; BTH, Benzathiadiazole; AOA, Aminooxyacetic acid; DIECA, Diethyldithiocarbamic acid; PALi, L-2-Aminooxy-3-phenylpropinoic acid.

187

Appendix

Fig A9. Effect of Bacillus velezensis strain BSK on rice growth at 104, 106 and 108 cfu ml-1 upon seed and soil treatment, at 28 days after sowing. (A) Shoot and root length, (B) Shoot and root weight. The bars represent the mean and standard error recorded on 8 plants. Different letters indicate statistically significant differences (Duncan’s multiple range test with α= 0.05). Data represent one of three independent experiments with similar results. Data represent one of another replicate than the one in fig 5.1.

188

Appendix

Fig A10. Effect of soil treatment with Bacillus velezensis strain BSK, at different concentrations, on the number of nematodes per plant. The bacteria at 104, 106 and 108 cfu ml-1 were drenched over SAP-substrate during seedling sowing and 12 days after sowing. Plants were inoculated with 100 nematodes of D. angustus at 1 day after bacteria inoculation. The bars represent the mean and standard error of the number of nematodes per plant 20 days after nematode inoculation recorded on 8 plants. Different letters indicate statistically significant differences (Duncan’s multiple range test with α = 0.05). Data represent two of three independent experiments (1 & 2) with similar results. Data represent other than the one in fig 5.2.

189