Investigating Βpix As a Novel Upstream Regulator of the Hippo Pathway

Investigating βPix as a novel upstream regulator of the Hippo pathway

Ki Myung Song

A thesis submitted in conformity with the requirements for the degree of Master of Science

Department of Biochemistry University of Toronto

Investigating βPix as a novel upstream regulator of the Hippo pathway

Ki Myung Song

Master of Science

Department of Biochemistry University of Toronto

2015

Abstract

The Hippo pathway regulates cell growth and organ size and dysregulation of the pathway leads to cancer. In mammals, the core Hippo pathway consists of Mst/Lats kinases, which phosphorylate and inhibit transcriptional co-activators, Yap and Taz, by promoting cytoplasmic sequestration. Here, we identify the guanine nucleotide exchange factor (GEF), Arhgef7, or βPix, as a positive Hippo pathway regulator. Upon upstream Hippo signals emanating from cell-cell contact and actin cytoskeletal rearrangements, βPix functions to regulate Yap/Taz localization and activity in a GEF-independent manner. βPix interacts with Yap via the C-terminal KER domain and this physical interaction plays a key role in βPix-mediated Yap/Taz regulation. In normal mammary epithelial cells, Lats kinases are required for βPix function while Mst kinases are not required for Hippo signalling. In breast cancer cells, ectopic expression of βPIX is sufficient to re-couple the Hippo kinase cassette to Yap/Taz, suggesting a possible role as a tumour suppressor.

Acknowledgments

I would like to express my deepest gratitude to my supervisor, Professor Liliana Attisano, for her guidance, invaluable insights and engagement throughout the learning process of my Master’s thesis. This dissertation would not have been possible without her unprecedented supervision and constant support.

I would also like to extend my appreciation to my committee members, Professor Andrew Wilde and Professor Michael Ohh. I am sincerely grateful for their helpful advice and genuine remarks during the course of my study.

I want to express my warmest thanks to all members of the Attisano Lab, past and present, for offering suggestions and assistance on numerous occasions, sharing their knowledge and techniques, and encouraging me with kind words and hearts.

I would also like to thank Dr. Jeff Wrana and all members of the Wrana lab for sharing their expertise and intuitions.

Last but not least, I want to wholeheartedly thank my loved ones, including my parents, siblings and friends. I have stumbled and fallen many times, but I was able to get up with their love and support from both local and overseas. I love you.

iii

Table of Contents

Abstract…………………………………………………………………………………………………….…ii

Acknowledgements...... iii

List of Tables………………………………………………...……………………………..………………vii

List of Figures…..……….………………………………………………………………………………..viii

Chapter 1: Introduction……………………………………………………………………..……1

1.1 Core components of the Hippo pathway……..……………………..…………………1

1.1.1 Mst1 and Mst2 kinases…………………………………………………….3

1.1.2 Lats1 and Lats2 kinases…………………………………………………...5

1.1.3 Yap and Taz……………………………………………………………….6

1.2 Upstream regulators of the Hippo pathway…………………………..……………….8

1.2.1 Apical-basal polarity…………………..………………………………….....8

1.2.2 Planar cell polarity (PCP)………………………………………………….12

1.2.3 Mechanotransduction ………………………...……………………………13

1.2.4 G-protein-coupled receptor (GPCR) signalling ...…………………………15

1.3 Biological implications of the Hippo pathway…...………….………………………15

1.4 αPix and βPix ……………………………………...…………………..…………….18

1.4.1 Structure of Pix…………………………………………………………….18

1.4.2 Function of Pix……………………………………………………………..19

1.4.3 βPix-Git complex…………………………………………………………..21

1.5 Thesis overview………………….…………………………………………………..22

Chapter 2: Materials and Methods……………………………….……………………….…….24

2.1 Cell culture and transfection...……………………….………………………………24

2.2 Plasmids and chemicals...………………………………….………………………...24

2.3 Immunoblotting (IB) and Immunoprecipitation (IP).…...…….……………………..25

2.4 Quantitation …………………………………………………….……………………25

2.5 Tead reporter assay ….…………...………..………………………………………...26

2.6 Immunofluorescence microscopy……...…………………………………………….26

2.7 Quantitative Real-Time PCR …...…...…………………………..…………………..27

Chapter 3: Results………………………………………………………….……………………32

3.1 LUMIER validation and characterization of βPix-Yap interaction……………….....32

3.1.1 βPix interacts with Taz and Yap….…………….………………………….32

3.1.2 Domain mapping of Pix and Yap.…………….…………..………………..34

3.1.2.1 KER of βPix is required for Yap interaction…...………………..34

3.1.2.2 Corresponding KER of αPix is required for Yap interaction…….38

3.2 Functional analysis of Pix in the Hippo pathway ....……………….………………..41

3.2.1 Analysis of βPix function via Tead reporter assay ……..……....…………41

3.2.2 αPix is not involved in the Hippo pathway in mouse mammary epithelial cells……………………………………………………………………………….43

3.3 Analysis of βPix GEF activity in Hippo pathway regulation………..………………43

3.3.1 βPix functions independent of GEF activity on Cdc42/Rac1 ……..………43

3.4 βPix and core Hippo kinases………….…………...... 50

3.4.1 βPix and Lats kinases…...………………………………………………….50

3.4.1.1 βPix functions upstream of Lats kinases ………..……………….50

3.4.1.2 βPix does not affect phosphorylation status of Lats kinases at Thr1079/1041…………………………………………………………….50

3.4.2 βPix and Mst kinases...…….………………..……………………………..54

3.4.2.1 βPix does not interact with Mst kinases………………………….54

3.4.2.2 Increased expression of Mst by overexpressed βPIX……………57

3.4.2.3 Mst kinases bypass the canonical Hippo pathway……………….57

3.5 βPix as a re-coupler of the Hippo signal in metastatic cancer cell…………...……...62

Chapter 4: Discussion and the future direction…………….……………………..……………69

References……………………………………………………………………….………………76

List of Tables

Table 1: List of siRNAs………………………………………………………………………….28

Table 2: Sequence of qPCR Primers (mouse)……..……………………………………………31

vii

List of Figures

Figure 1.1: The core Hippo pathway……………………………………………………………...2

Figure 1.2: Domain organization of core components of the Hippo pathway…………………….4

Figure 1.3: Domain organization of the homologous βPix and αPix………………………….…20

Figure 3.1: βPix interacts with Taz/Yap ………………………………………………………...33

Figure 3.2: A schematic representation of the wild-type and deletion cDNA constructs of βPIX and αPIX………………………………………………………………………………………...35

Figure 3.3: The KER of βPix is required for interaction with Yap………………………………36

Figure 3.4: The KER of αPix is required for interaction with Yap……………………………....37

Figure 3.5: The LZ domain is required for βPix dimerization…………………………………...39

Figure 3.6: The sequence alignment of human β/αPIX, showing amino acid sequence of a possible region of interaction with Yap………………………………………………………...40

Figure 3.7: βPix knockdown promotes accumulation of Yap/Taz in the nucleus……………….42

Figure 3.8: βPix GEF activity is dispensable for regulation of Yap/Taz ………..……………....45

Figure 3.9: βPix regulates Yap/Taz localization in response to cell density in a GEF-independent manner …………………………………………………………………………………………46

Figure 3.10: βPix regulates Yap/Taz localization in response to actin cytoskeleton rearrangement in a GEF-independent manner ………………………………………………………………….48

Figure 3.11: βPix functions upstream of Lats kinases…………………………………...………51

Figure 3.12: Phosphorylated Lats1/2 kinases at Thr1079/1041 localize to cell periphery………52

Figure 3.13: Knockdown of βPix does not affect the phosphorylation status at Thr1079/1041 on Lats1/2 kinases…………………………………………………………………………………...53 viii

Figure 3.14: Overexpression of βPIX does not affect the phosphorylation status at Thr1079/1041 on Lats1/2 kinases………………………………………………………………………………..55

Figure 3.15: βPix does not interact with Mst kinases …………………………………………...56

Figure 3.16: Increased expression of Mst kinases by βPix is not physiologically relevant .….....58

Figure 3.17: Mst kinases bypass the canonical Hippo pathway in NMuMG cells …………...... 59

Figure 3.18: Mst kinases bypass the canonical Hippo pathway in EpH4 cells.……………...... 63

Figure 3.19: LATS1/2 kinases are required for βPIX-mediated YAP/TAZ inactivation in MDA- MB-231 cells……………………………………………………………………………………..66

Figure 4.1: Model of the regulatory mechanism of βPix in the Hippo pathway………………...73

ix 1

Chapter 1 Introduction

In developmental biology, the fundamental biological processes of cell proliferation, differentiation and death have been extensively explored. Proliferation ensures growth during development and proper differentiation of multiple cell types assures their functionality, while appropriate apoptosis functions to replace defective cells. Coordination of these vital processes is critical for a wide range of physiological phenomena such as the exquisite control of organ size. The mechanisms underlying the regulation of organ size had remained under a veil until the emergence of the Hippo signalling pathway approximately two decades ago. Not only has the Hippo pathway been recognized as a master regulator of organ size, this complex signalling network plays critical roles in diverse cellular processes such as tissue homeostasis and regeneration, cell fate and stem cell self-renewal (Tapon et al. 2002, Harvey et al. 2003, Jia et al. 2003, Udan et al. 2003, Wu et al. 2003; Zhao et al. 2008). Dysfunction of the Hippo pathway is also implicated in pathological conditions including tumourigenesis and organ degeneration (O’Neill et al. 2004; Jonasson et al. 2007; Cordenonsi et al. 2011; Nishio et al. 2012; Huang et al. 2012).

1.1 Core components of the Hippo pathway

Genetic mosaic screens for tumour suppressor genes in Drosophila first revealed the main components of the Hippo pathway. Central to the pathway lies a core kinase cascade consisting of the Ste20-like kinase Hippo (Hpo) and the nuclear Dbf-2-related (NDR) family kinase Warts (Wts). Hpo in complex with the scaffold adaptor protein Salvador (Sav) phosphorylates Wts and its co-factor Mats (Mob as a tumour suppressor), thereby activating Wts, which in turn phosphorylates and inhibits the downstream effector Yorkie (Yki) (Fig. 1.1; Tapon et al. 2002; Harvey et al. 2003; Jia et al. 2003; Udan et al. 2003; Wu et al. 2003; Lai et al. 2005; Huang et al. 2005). Phosphorylated Yki is retained in the cytoplasm through interaction with 14-3-3 phosphopeptide binding proteins and thus prevented from activating a transcriptional programme. When upstream Hpo/Wts kinases are inactive, Yki is hypophosphorylated and

Adapted from Yu & Guan, 2013

Figure 1.1: The core Hippo pathway.

Mst1/2 phosphorylate Sav, Lats1/2 and Mob, which in turn activate Lats1/2. Yap/Taz are phosphorylated by Lats1/2. Phosphorylated Yap/Taz are retained in the cytoplasm by interacting with 14-3-3 or subjected to protein degradation. When unphosphorylated, Yap/Taz translocate to the nucleus and induce gene transcription by interacting with transcription factor Tead1–4. Drosophila orthologs of these core components are shown in brackets.

3 translocates to the nucleus where it interacts with the DNA-binding transcription factor Scalloped (Sd) and promotes transcription of target genes (Wu et al. 2008; Zhang et al. 2008; Zhao et al. 2008). The core Hippo pathway in Drosophila is highly conserved in mammals, in which a parallel kinase cassette comprised of Mst1/2 (Hpo orthologs) and Lats1/2 (Wts orthologs), along with the adaptor proteins Sav1 (WW45) and Mob1 (Mats orthologs), phosphorylates and inhibits the transcriptional activator Yap/Taz (Yki homologs) (Fig. 1.1; Chan et al. 2005). Phosphorylated Yap/Taz are sequestered in the cytoplasm by 14-3-3 interaction or subjected to β-TRCP mediated ubiquitination and degradation (Liu et al. 2010; Zhao et al. 2010b). In the nucleus, hypophosphorylated Yap/Taz in association with DNA-binding transcription factor Tead1-4 (Sd orthologs) mediates transcription of Hippo responsive genes (Pan 2010; Zhao et al. 2010a).

1.1.1 Mst1 and Mst2 kinases

Mst1 (STK4) and Mst2 (STK3) are Ste20 family protein kinases that are homologous to the Drosophila Hpo kinase. Mst1/2 kinases possess an N-terminal catalytic domain that mediates phosphorylation of Sav1, Lats1/2 and Mob1 (Wu et al. 2003; Chan et al. 2005; Callus et al. 2006; Praskova et al. 2008), followed by a coiled-coil domain and a C-terminal SARAH (Sav/Rassf/Hpo) domain (Fig. 1.2A). The adaptor protein Sav1 interacts with Mst1/2 via the SARAH domain, thereby enhancing kinase activity and stability of Mst1/2 (Callus et al. 2006). The role of Sav in the Hippo pathway was first shown in Drosophila where Sav mutants exhibited a similar phenotype to Hpo kinase mutants with enlarged eyes (Tapon et al. 2002). Previous studies suggest the role of Sav1 as a bridge that brings Mst1/2 and Lats1/2 together (Tapon et al. 2002; Callus et al. 2006) and as a co-factor with a binary role in which stimulating Lats1/2 activity upon phosphorylation by Mst1/2 or inhibiting upon phosphorylation by salt- inducible kinases (Callus et al. 2006; Wehr et al. 2012). The Mst-Sav complex associates with and activates Lats kinase by phosphorylation (Chan et al. 2005). Drosophila studies first revealed the functional consequences of Lats activation by Mst kinases, which suppressed cell proliferation and promoted apoptosis through inhibition of genes encoding Cyclin E and Drosophila inhibitor of apoptosis protein (Diap1) (Harvey et al. 2003; Udan et al. 2003; Wu et al. 2003).

Figure 1.2: Domain organization of core components of the Hippo pathway.

(A) Structure of Mst1/2. Mst kinases phosphorylate and activate Lats kinases through kinase domain. Both Mst1 and Mst2 have the C-terminal SARAH domain required for their interaction with Sav and Rassf.

(B) Structure of Lats1/2. Lats1 kinase is activated by autophosphorylation on the activation loop (Ser909) and by Mst-mediated phosphorylation on the hydrophobic motif (Thr1079). These sites correspond to Ser871 and Thr1041 respectively on Lats2 kinase. PPxY motifs on Lats kinases enable their binding with Yap/Taz.

(C) Structure of Yap/Taz. Yap/Taz are phosphorylated by Lats kinases in the HxRxxS motifs. Ser127 in Yap and Ser89 in Taz are essential phosphorylation sites in the HxRxxS motifs required for inactivation of Yap/Taz.

(C-C) Coiled-coil domain; (TBD) Tead-binding domain; (SARAH) SARAH domain; (WW) WW domain; (TA) Transactivation domain; (P-rich) Proline-rich domain; (PAPA) Proline- alanine repeat; (P-stretch) Proline stretch.

Phosphorylation of Lats1/2 by Mst1/2 occurs at a hydrophobic motif in Lats1/2 (Lats1 Thr1079 and Lats2 Thr1041) and is required for Lats1/2 activation (Chan et al. 2005). Mst1/2 also phosphorylates Mob1, which binds to the autoinhibitory motif of Lats1/2. Mst kinases along with Mob1 subsequently elicit phosphorylation of the Lats activation loop (Lats1 Ser909 and Lats2 Ser872), thereby augmenting Lats kinase activity (Chan et al. 2005; Praskova et al. 2008). However, Mst1/2 may not be universally required for the activation of Lats1/2 and may be dependent on the specific cell types. For instance, one study demonstrated that Mst1/2 knockout in mouse embryonic fibroblasts (MEFs) had minimal effect on the phosphorylation status of Lats1/2 (Zhou et al. 2009), suggesting that additional kinases may control Lats kinase activity.

Mst kinases are subject to multiple regulatory events including caspase-dependent cleavage (Graves et al. 1998), dimerization and autophosphorylation (Lee & Yonehara, 2002). In Drosophila, Rassf competes with Sav for binding to Hpo to recruit a PP2A complex (dSTRIPAK) that inactivates Hpo by dephosphorylation (Polesello et al. 2006; Ribeiro et al. 2010). In mammals, however, multiple Rassf isoforms (Rassfl-6) were shown to execute different functions in the Hippo pathway (Praskova et al. 2004; Ikeda et al. 2009). Interaction of the Rassf1a tumour suppressor with Mst1 (Khokhlatchez et al. 2002) or Mst2 (Guo et al. 2007) activates the kinases by promoting autophosphorylation, while interaction of the Raf-1 proto- oncogene inhibits Mst1/2 by hindering dimerization and recruiting phosphatases that suppress kinase activity by removal of phosphate groups (O’Neill et al. 2004). Phosphorylation of Mst2 kinase by Akt1 has been shown to block its interaction with Rassf1a, which is sequestered by an inhibitory complex with Raf-1 (Romano et al. 2010). Mst1/2 is also activated by direct phosphorylation mediated by the thousand-and-one (TAO) amino acids kinase or TAOK1–3, which are involved in microtubule dynamics (Boggiano et al. 2011; Poon et al. 2011).

1.1.2 Lats1 and Lats2 kinases

Large tumour suppressors 1 and 2 (Lats1/2) are the NDR family protein kinases that are homologous to the Drosophila Wts kinase (Hergovich, 2013). Lats1/2 kinases share several conserved domain and motifs including the C-terminal catalytic Ser/Thr kinase domain that targets Yap/Taz, PPxY motifs that typically interact with WW domain-containing proteins, and the unique N-terminally situated stretch of amino acids that are presumed to participate in

6 protein-protein interactions (Fig. 1.2B). In Lats1, the N-terminal region encompasses a region rich in proline residues, also known as the P-stretch, while seven repeats of alternating proline- alanine residues (PAPA repeat) are found in the analogous position in Lats2 (Fig. 1.2B). Lats kinase activity is regulated by phosphorylation by Mst kinases in complex with Sav1 protein.

Lats1/2 directly phosphorylate Yap/Taz (Zhao et al. 2007; Lei et al. 2008; Oh & Irvine 2008), via direct interaction possibly mediated by PPxY motifs in Lats1/2 and WW domains in Yap/Taz (Hao et al. 2008; Oka et al. 2008). Lats1/2 recognize the consensus sequence HxRxxS on their substrate Yap/Taz (Zhao et al. 2007). In Yap, all serine residues in five HxRxxS motifs are directly phosphorylated by Lats1/2 (Zhao et al. 2007; Hao et al. 2008), among which Ser127 and Ser381 are considered to be essential sites for suppressing Yap activity. In Taz, Ser89 residue in the HxRxxS motif is subject to direct phosphorylation by Lats kinases, which enhances cytoplasmic retention of Taz by increasing interaction between Taz and 14-3-3 (Lei et al. 2008). Besides Ser89, Lats kinase phosphorylates Taz at Ser66, Ser117 and Ser311, which are also functionally important sites (Lei et al. 2008).

1.1.3 Yap and Taz

Yes-associated protein (Yap) and transcriptional co-activator with PDZ-binding motif (Taz, WWTR1) are downstream effectors of the Hippo pathway. The homologous Yap and Taz exhibit a significant overlap in structural domain organization with 46% amino acid sequence identity (Hong & Guan, 2012). Yap/Taz contain WW protein-protein interaction domains through which Lats kinases bind via PPxY domains, although Yap has two WW domains and Taz has only one (Fig. 1.2C). Upstream of the WW domains, Yap/Taz share distinct short helices of a twisted coil region that mediates interaction with Tead transcription factors, also known as the Tead binding domain (TBD) (Chen et al. 2010; Li et al. 2010). At the C-terminal region, Yap/Taz possess a transcriptional activation domain (TA) and a PDZ-binding domain, which may also mediate protein-protein interactions (Fig. 1.2C). Notably, Yap has the N-terminal proline-rich region and an internally positioned SH3-binding motif, both of which are absent in Taz (Espanel & Sudol, 2001).

Yap/Taz do not possess intrinsic DNA-binding sites. However, Yap/Taz function as transcriptional regulators by interacting with various DNA-binding transcription factors such as the well-described Tead 1-4 (Vassilev et al. 2001; Mahoney et al. 2005), the Runt family protein Runx1/2 (Yagi et al. 1999; Cui et al. 2003; Hong et al. 2005), Smad1 (Alarcon et al. 2009), Smad2/3 (Varelas et al. 2008), Smad7 (Ferrigno et al. 2002), p63/p73 (Strano et al. 2001) and ErbB4 (Komuro et al. 2003; Omerovic et al. 2004). Through interaction with the aforementioned transcription factors, Yap/Taz bind to the promoters of diverse target genes involved in proliferation, differentiation and development (Wu et al. 2008; Zhang et al. 2008; Zhao et al. 2008). While Yap/Taz show a functional redundancy by sharing a number of transcriptional partners, each also carries out distinct functions through different binding specificity. For instance, Taz displays interactions with peroxisome proliferator-activated receptor γ (Hong et al. 2005), thyroid transcription factor-1 (Park et al. 2004), Pax3 (Murakami et al. 2006) and Tbx5 (Murakami et al. 2005). Consistent with the partial overlap of interactions and functions between Yap and Taz, gene expression profiling in MCF10A mammary epithelial cells revealed both common and distinct target genes differentially regulated by Yap and Taz (Zhang et al. 2009).

When upstream kinases of the Hippo pathway are active, Yap/Taz are phosphorylated and sequestered in the cytoplasm via a 14-3-3 interaction, resulting in decreased expression of target genes (Zhao et al. 2007). In contrast, in the absence of Hippo signalling, Yap/Taz are hypophosphorylated and translocate into the nucleus where transcription of target genes is promoted (Zhao et al. 2007; Lei et al. 2008; Oh & Irvine, 2008; Ren et al. 2010b). The phosphorylation status of Yap/Taz not only determines their localization and activity, but also regulates protein stability. Lats1/2 phosphorylate Yap on Ser381 and Taz on Ser311, thereby priming the phosphorylated form of Yap/Taz for subsequent phosphorylation mediated by casein kinase 1 (CK1β/ε). This sequential phosphorylation events recruits β-transducin repeat- containing protein (β-TRCP), which is a subunit of the SCF ubiquitin E3 ligase that eventually degrades of Yap/Taz (Liu et al. 2010; Zhao et al. 2010b).

1.2 Upstream regulators of the Hippo pathway

While the core Hippo pathway has been well characterized, the upstream regulators of the pathway are less understood. To date, various efforts to elucidate the Hippo signal transduction have uncovered numerous upstream components that modulate the core kinase module. Upstream constituents known to regulate the Hippo pathway can be grouped into four main categories: 1) Apical–basal polarity in epithelial cells, 2) Planar cell polarity (PCP) in Drosophila, 3) Mechanotransduction and 4) GPCR signalling.

1.2.1 Apical–basal polarity

Cell–cell contact was one of the first discovered regulators of the Hippo pathway during the initial spurt of Hippo research (Zhao et al, 2007; Ota & Sasaki, 2008). At low cell density, Mst/Lats kinases remain inactive and Yap/Taz are localized predominantly in the nucleus, while at high cell density, kinases become active and Yap/Taz are sequestered in the cytoplasm through phosphorylation (Zhao et al. 2010). Naturally, multiple proteins involved in the maintenance of cell architecture were later identified as Hippo signalling determinants, such as apical-basal polarity complexes and junction proteins (Genevet & Tapon, 2011; Boggiano & Fehon, 2012; Schroeder & Halder, 2012). Indeed, disruption of tight junctions or adherens junctions in cultured mammalian cells has been shown to induce nuclear Yap/Taz localization and target gene expression (Varelas et al. 2010).

The role of Mer (Merlin, also known as NF2) and Ex (Expanded) in the Hippo signalling was first revealed in Drosophila where genetic inactivation of Mer and Ex caused a dramatic overgrowth phenotype similar to that of the Hpo mutants (Hamaratoglu et al. 2006). Mer and Ex belong to the FERM (Four point one Ezrin Radixin Moesin) domain-containing family of proteins that associate with various proteins localized at the plasma membrane (Silva et al. 2006). At the apical domain of polarized epithelial cells, both Mer and Ex were shown to interact and work together to induce a tumour suppressive activity by regulating cell proliferation and differentiation (McCartney et al. 2000). Another protein containing WW and C2 domains called Kibra was later shown to physically associate with Mer and Ex, and the complex of these three proteins was shown to activate Wts (Genevet et al. 2010; Yu et al. 2010) or Lats1/2 (Xiao et al.

2011) in a cooperative manner. Mer and Ex may act as a bridge that links the apical plasma membrane with actin cytoskeleton (Bretscher et al. 2002) and Kibra may localize interacting proteins to the cell surface by binding phospholipids via C2 domain (Kremerskothen et al. 2003). Sav and Hpo physically interact with Mer and Ex (Yu et al. 2010) while Kibra associates with Wts (Genevet et al. 2010), suggesting a possible function of the Mer/Ex/Kibra complex that may act to mobilize the Hippo pathway kinases to the apical plasma membrane for activation. Various findings support this speculation as Ex was shown to sequester Yki at the membrane (Badouel et al. 2009), Mats was found to be activated at the plasma membrane (Ho et al. 2010), and Mer was shown to directly bind and recruit Wts to the apical plasma membrane, thereby promoting Wts phosphorylation by the Hpo-Sav kinase complex (Yin et al. 2013). Notably, Mer behaves differently according to cell density; Mer is inactivated upon phosphorylation by Pak (p21- activate kinase) at low cell density (Okada et al. 2005; Sher et al. 2012), whereas it is activated upon dephosphorylation by the Mypt/Pp1 complex with decreased Pak activity at high cell density (Jin et al. 2006). Moreover, active mammalian Mer translocates to the nucleus where it binds to and inhibits the Crl4DCAF1 E3 ubiquitin ligase that ubiquitylates Lats1/2, leading to their degradation or inhibition (Li et al. 2014).

In mammalian cells, Mer associates with the Angiomotins, Amot and Amot-like1/2 (AmotL1/2), which interact with various tight junction proteins and carry out a crucial role in maintaining integrity of tight junctions and epithelial cell polarity (Wells et al. 2006). The connection with the Hippo pathway was discovered when Amot and Yap/Taz were shown to interact via Amot PPxY motifs and Yap/Taz WW domains (Chan et al. 2011; Wang et al. 2011; Zhao et al. 2011). Amot proteins recruit Yap/Taz to the tight junctions or actin cytoskeleton, which in turn results in decreased Yap/Taz nuclear localization and activity by promoting Yap/Taz phosphorylation at Lats target sites (Zhao et al. 2011). Amot reduces Yap/Taz activity through other means by recruiting the Aip4/Itch ubiquitin ligase to promote Yap/Taz degradation (Adler et al. 2013) and by recruiting Lats2 to induce Yap/Taz inhibitory phosphorylation (Paramasivam et al. 2011). This perhaps suggests a scaffolding function of Amot that assembles core Hippo components such as Mst2, Lats2 and Yap (Paramasivam et al. 2011). Interestingly, Amot has been shown to interact with NF2 and found to be required for tumourigenesis caused by NF2 deficiency (Yi et al. 2011).

At the tight junctions of mammalian cells, Amot along with Mer constitutes a part of the apically localized Crumbs (Crb) complex, which plays an important role in organizing apical–basal polarity (Tepass et al. 1990) as well as activating the Hippo kinase cassette in flies and mammals (Chen et al. 2010; Ling et al. 2010; Robinson et al. 2010, Varelas et al. 2010). Various proteins constitute the Crb complex, including Crb1-3, Pals1, PatJ, Lin7c and Mpdz (Shin et al. 2006; Bryant et al. 2008). Crb is a transmembrane protein with a large extracellular domain and a short intracellular domain with a FERM-binding motif (FBM) that can interact with Ex. The Crb-Ex interaction regulates the localization and stability of Ex, which in turn coordinates the activity of core Hippo kinases (CL Chen et al. 2010; Ling et al. 2010; Robinson et al. 2010). The involvement of Crb in the Hippo signalling is also reflected in studies where inactivation of Crb exhibited an overgrowth phenotype similar to that of Hpo, Mer and Ex mutants (Ling et al. 2010). However, overexpression of Crb caused Ex mislocalization and inactivation of the Hippo pathway, which could be explained by a dominant-negative effect of overexpressed Crb (CL Chen et al. 2010; Robinson et al. 2010). The Crb complex components Pals1 and PatJ were shown to interact with Mer as well as Angiomotin (Yi et al. 2011).

In addition, the Par apical complex comprised of Par6, Par3 and aPKC has been identified as a regulator of the Hippo pathway (Shin et al. 2006; Bryant et al. 2008). Previous studies have demonstrated that overexpression of aPKC can promote Yki activity and tissue overgrowth (Sun & Irvine, 2011). Also, it was found that the activity of the Par complex can be antagonized by the basal Scribble (Scrib) complex that is comprised of Scrib, Dlg and Lgl, in such a way that positively regulates the Hippo kinases (Martin-Belmonte & Perez-Moreno, 2012). In line with this observation, loss of Scrib or Lgl induced activation of Yki (Menendez et al. 2010; Sun & Irvine, 2011) while downregulation of Scrib led to Yap/Taz activation (Cordenonsi et al. 2011; Chen et al. 2012). Merlin also directly interacts with α-catenin and links α-catenin to the Par3 junction complex (Gladden et al. 2010).

α-Catenin constitutes a part of adherens junctions that connect membrane cadherins and actin cytoskeleton (Drees et al. 2005). It has been previously reported that α-catenin functions to inhibit Yap, contributing to its tumor suppressive activity (Schlegelmilch et al. 2011; Silvis et al. 2011). In keratinocytes, α-catenin strongly interacts with Ser127-phosphorylated Yap through 14-3-3 proteins (Schlegelmilch et al. 2011). The trimeric complex of α-catenin, Yap and 14-3-3 leads to sequestration of Yap at adherens junctions and prevented from activation. In mammary

11 epithelial EpH4 cells, depletion of α-catenin expression also induced Yap/Taz nuclear localization (Varelas et al. 2010), suggesting that α-catenin regulation of Yap/Taz could be prevalent in multiple cell types.

Protein tyrosine phosphatase 14 (Ptpn14), another component of adherens junctions, has also been implicated in the regulation of the Hippo pathway (JM Huang et al. 2012; Liu et al. 2012; Wang et al. 2012). Ptpn14 contains a FERM domain at the N-terminus, similar to that of Drosophila Ex. Ptpn14 can directly interact with Yap via Ptpn14 PPxY motifs and Yap WW domains (JM Huang et al. 2012; Liu et al. 2012; Wang et al. 2012). Ptpn14-Yap interaction induces cytoplasmic localization of Yap and decreased Yap activity, although whether the tyrosine phosphatase activity of Ptpn14 towards Yap is required is controversial (JM Huang et al. 2012; Liu et al. 2012; Wang et al. 2012). In addition, the Drosophila ortholog of Ptpn14, Pez, has been demonstrated to interact with Kibra to inhibit Yki (Poernbacher et al. 2012).

Several other proteins involved in maintaining apical–basal polarity have been shown to regulate the Hippo signalling. In mammalian cells, the E-cadherin/catenin complex was shown to act upstream of the core Hippo pathway as cell adhesion mediated by homophilic binding of E- cadherin led to Yap inactivation (Kim et al. 2011). Previous studies have demonstrated the role of Ajuba on Yap inhibition mediated by interaction with Sav and Lats kinases (Das Thakur et al. 2010). Furthermore, Lkb1 (liver kinase B1) has been shown to induce Yap phosphorylation (Nguyen et al. 2012) while Nphp4 (nephronophthisis 4) can bind and inhibit Lats1 (Habbig et al. 2011). ZO-2 (zona occludens-2) can induce Yap nuclear localization (Oka et al. 2010), whereas ZO-1 has been shown to repress Taz activity (Remue et al. 2010).

All in all, a diverse array of proteins involved in the establishment of cell–cell contact, integrity of cell junctions and apical–basal polarity consititutes a vital part in regulation of the Hippo pathway. Apical–basal polarity can impose a functional control on the Hippo pathway by either recruiting the Hippo kinases to the apical domain for activation or sequestering Yki/Yap/Taz at cell junctions, both of which lead to Yki/Yap/Taz inactivation.

1.2.2 Planar cell polarity (PCP)

Planar cell polarity (PCP) describes spatial differences in the shape, structure and function of clustered epithelial cells that are coordinated, aligned and orientated to a particular direction along an axis perpendicular to the apical–basal axis (Simons & Mlodzik, 2008). As one of the Wnt signalling pathways, the non-canonical PCP is also present in certain cell types, such as mesenchymal cells, and plays an essential role in cell migration and cell intercalation (Simons & Mlodzik, 2008). The Frizzled/Flamingo (Fz/Fmi) and the Fat/Dachsous (Ft/Ds) are two of the well-known systems that are critical in establishing PCP (Simons & Mlodzik, 2008). A connection between the Ft/Ds system and the Hippo pathway has been described in Drosophila, but the impact of the Fz/Fmi PCP system on the Hippo pathway is less well understood.

The Ft/Ds PCP system has been shown to regulate the Hippo signalling in Drosophila as abrogation of Ft inactivated either Ex or Wts, which in turn activated Yki (Silva et al. 2006; Willecke et al. 2006; Feng & Irvine, 2007). Analysis of Ft revealed its function as a tumour suppressor that affects tissue growth (Mahoney et al. 1991). Ft and Ds are both categorized as atypical cadherins that form intercellular heterodimers (Cho & Irvine, 2004; Matakatsu & Blair, 2004), and this dimerization is mediated by the fourjointed (Fj) protein (Ishikawa et al. 2008). Notably, Ds and Fj exhibit gradient expression with opposite directions in many tissues, and some speculate this expression pattern may be critical for Ft activity by which atypical myosin Dachs is recruited to subapical domains (Feng & Irvine, 2007; Willecke et al. 2008; Zecca & Struhl, 2010). Polarized Dachs enhances interaction of Zyxin and Wts, through which degradation of Wts occurs (Rauskolb et al. 2011). Several regulatory proteins have been shown to impose the inhibitory effect of Ft on Yki. Dco (discs overgrown) promotes Ft activity by phosphorylating the intracellular domain of Ft (Sopko et al. 2009), while Lft (lowfat) is able to interact with Ft and Ds to increase their protein stability (Mao et al. 2009). Moreover, App (approximated) has been shown to relieve the Ft inhibition on Dachs and promote its apical localization (Matakatsu & Blair, 2008).

A series of morphogens has been reported to modulate the Ft/Ds PCP system with regards to the Hippo pathway. Dpp (decapentaplegic; a BMP homolog) and Wingless (a Wnt homolog) may facilitate in establishing the gradient of Ds and Fj by regulating the expression of Ds and Fj

(Zecca & Struhl, 2010). Also, it has been speculated that Fj may act as a morphogen that regulates Ft/Ds phosphorylation (Ishikawa et al. 2008; Tagliabracci et al. 2012).

Although the role of Ft/Ds PCP system in the Drosophila Hippo pathway has been well characterized, the significance of the analogous system in mammalian system is yet to be addressed. In mammals, there are two Ds orthologs (Hchs1–2) and four Ft orthologs (Fat1–4). Even though Fat4 is highly homologous to Drosophila Ft, abnormal PCP phenotypic mice with Dchs1 and Fat4 knockout did not show defects in core mammalian Hippo pathway components, Yap and Lats1 (Mao et al. 2011). However, in zebrafish, a cystic pronephros phenotype caused by knockdown of Fat1 was rescued by knockdown of Yap1, indicating a link between Ft and Hippo signalling in mammals (Skouloudaki et al. 2009). On the other hand, an ortholog of Dachs is not present in mammals, suggesting that the regulatory effect of the Ft/Ds system on the Drosophila Hippo pathway may be limited in mammals.

1.2.3 Mechanotransduction

Several early Drosophila studies implicated the Hippo pathway as a sensor of the actin cytoskeletal environment. In vivo, the mutations in the Drosophila Capping Protein αβ heterodimer, which restricts the growth of actin filament ends, resulted in an upregulation of Yki target genes (Fernandez et al. 2011; Jezowska et al. 2011). Moreover, abolishing expression of either actin-capping protein or actin-binding protein such as Capulet, which inhibits actin polymerization, caused Yki activation and tissue outgrowth (Fernandez et al. 2011; Sansores- Garcia et al. 2011). The other actin-binding proteins controlling F-actin levels, such as Diaphanous (a formin-related actin polymerization inducer) and Cofilin (an actin depolymerization factor) were also found to be critical in regulating Yki activity (Sansores- Garcia et al. 2011). Disruption of actin polymerization all led to an increase in F-actin, emphasizing the importance of F-actin in promoting Yki activity. This functional effect of F- actin on Yki has been shown to be mediated by Wts as overexpression of Wts substantially reversed the phenotype of constitutively active Diaphanous. In mammals, CapZ (a capping protein), Cofilin and Gelsolin (an actin severing factor) have been demonstrated to antagonize Yap/Taz (Aragona et al. 2013), while F-actin polymerization mediated by the mammalian Diaphanous formin, promoted Yap nuclear accumulation (Dupont et al. 2011). Hence, capped or

14 destabilized actin filaments induce cytoplasmic sequestration of Yap, whereas actin polymerization stimulates Yap/Yki activity. Furthermore, F-actin may directly regulate the Hippo pathway kinases since Mst1/2 and Lats1 have been shown to interact or co-localize with F-actin (Densham et al. 2009; Visser-Grieve et al. 2011).

Yap/Taz can also be modulated by mechanical forces stemming from diverse surrounding stimuli, such as actin cytoskeletal rearrangement, in mammalian cells. Cell geometry was shown to contribute to Yap/Taz localization and activity as attached cells exhibited nuclear Yap/Taz whereas round and compact cells showed cytoplasmic Yap/Taz (Dupont et al. 2011; Wada et al. 2011). The stiffness of the extracellular matrix turned out to be another factor that regulates Yap/Taz activity, with active Yap/Taz in cells seeded on stiff surfaces, but inactive Yap/Taz in cells seeded on soft matrices (Dupont et al. 2011). Cell detachment also resulted in repression of Yap/Taz activity while cell attachment induced Yap/Taz activity (Zhao et al. 2012). In addition, cellular tension was shown to be another element that modulates Yap/Taz (Dupont et al. 2011). In non-muscle cells, bundles of actomyosin can generate contraction and build tension following RhoA activation (Clark et al. 2007). When cells were treated with the non-muscle myosin inhibitor blebbistatin, the ROCK (Rho-associated, coiled-coil containing kinase) inhibitor, or the myosin light chain kinase inhibitor ML-7, nuclear localization and activity of Yap/Taz was reduced (Dupont et al. 2011; Wada et al. 2011). Thus, multiple lines of evidence suggest that Yap/Taz can respond to the local mechanical environment by sensing contractile actin networks.

Rho GTPases are involved in regulating the actin cytoskeleton dynamics and cell proliferation (Jaffe & Hall, 2005). The actin-binding proteins, Diaphanous and Cofilin, are also targets of Rho signalling that have a reported effect on Yap/Taz mechanical responses (Aragona et al. 2013; Dupont et al. 2011; Feng et al. 2014). Consistent with the general functions of Rho GTPases, one of the family members, RhoA, has been shown to enhance Yap/Taz activity (Dupont et al, 2011; Zhao et al, 2012). In addition, the other two Rho family members, Rac and Cdc42, have been implicated in regulating Yap/Taz activity. Coexpression of constitutively active Rac or Cdc42 induced Yap dephosphorylation while tissue-specific inactivation of Cdc42 caused a severe defect in nephrogenesis, leading to a reduction of Yap-dependent gene expression (Zhao et al. 2012; Reginensi et al. 2013; Feng et al. 2014).

1.2.4 G-protein-coupled receptor (GPCR) signalling

Recent studies have uncovered G-protein-coupled receptor (GPCR) signalling as another class of upstream regulators of the Hippo pathway. As the largest family of plasma membrane receptors, GPCRs act through extracellular ligands and their cognate heterotrimeric G proteins, through which downstream signals are ultimately transmitted to Yap/Taz, thereby regulating their activity (Miller et al. 2012; Yu et al. 2012b). Extensive analysis of numerous GPCR systems revealed that Gα12/13-, Gαq/11-, or Gαi/o-coupled signals induce Yap/Taz activity, whereas Gαs-coupled signals inhibit Yap/Taz activity (Yu et al. 2012b). Gα12/13-, Gαq/11-, or Gαi/o-coupled signals include lysophosphatidic acid (LPA), sphingosine 1-phosphate (S1P) and thrombin, which repress Lats1/2 activity, leading to dephosphorylation and activation of Yap/Taz (Yu et al.

2012b). In Gαs-mediated Yap/Taz repression, a series of diffusible extracellular signals including glucagon, epinephrine and a dopamine receptor agonist induce Lats1/2 kinase activity, leading to phosphorylation and inhibition of Yap/Taz (Yu et al. 2012b). Hence, GPCR signalling appears to be capable of regulating Yap/Taz activity, either stimulating or inhibiting based on which Gα protein is activated. Although, the mechanism of G-protein signal transmission to the Hippo pathway is not fully defined, the Hippo pathway may mediate various biological functions of GPCRs, particularly those related to cell proliferation, cell survival and tissue growth (Yu et al.

2012a). Moreover, stimulation of protease-activated receptors (PARs), which couple to G12/13, activates Rho GTPases that inhibit Lats kinases through actin cytoskeleton (Mo et al. 2012).

1.3 Biological implications of the Hippo pathway

The Hippo pathway is widely known for its crucial role in controlling organ size. In Drosophila, inactivation of core Hippo components including Hpo, Sav, Wts and Mob all resulted in substantial tissue outgrowth of eyes, wings and appendages (Tapon et al. 2002; Harvey et al. 2003; Jia et al. 2003; Udan et al. 2003; Wu et al. 2003; Lai et al. 2005). Similarly, overexpression of Yki exhibited tissue overgrowth phenotypes (Huang et al. 2005). The regulation of organ size is also conserved in mammals as overexpression of Yap in the mouse liver or heart caused a dramatic increase in the size (Camargo et al. 2007; von Gise et al. 2012). Consistent with this observation, knockout of Mst1/2 or Sav in the liver or heart also resulted in an enlarged organ (Zhou et al. 2009; Lee et al. 2010; Lu et al. 2010; Heallen et al. 2011).

In human cancers, constitutive nuclear expressions of Yap/Taz are frequently observed (Zhao et al. 2007; Chan et al. 2008; Fernandez et al. 2009; Xu et al. 2009). Moreover, high levels of Yap mRNA were detected in aggressive glioblastomas (Orr et al. 2011) and medulloblastomas (Fernandez et al. 2009), while Taz was shown to be upregulated in breast cancer samples (Chan et al. 2008). Furthermore, downregulation of Lats1/2 has been reported in various cancers such as human sarcomas, ovarian carcinomas, aggressive breast cancer, retinoblastomas, astrocytomas and acute lymphoblastic leukemia (Hisaoka et al. 2002; Jimenez-Velasco et al. 2005; Chakraborty et al. 2007), emphasizing the importance of the Hippo pathway in cancer development.

Mer or NF2 is an extensively studied tumour suppressor, and mutations in the NF2 gene results in tissue overgrowth in Drosophila and development of the familial cancer syndrome neurofibromatosis type 2 in mammals (Hamaratoglu et al. 2006; Zhang et al. 2010). Mice with conditional NF2 knockout in the liver were shown to develop hepatocellular carcinoma, cholangiocarcinoma and bile duct hamartomas, while those with conditional NF2 knockout in lens epithelium develop cataracts (Zhang et al. 2010). Also, overexpression of NF2 in mammalian cells caused Lats activation and Yap inhibition (Zhao et al. 2007; Zhang et al. 2010). Yap transgenic mice showed an oncogenic phenotype such as hyperplasia and tumour formation (Camargo et al. 2007; Zhang et al. 2011; von Gise et al. 2012). Likewise, loss-of-function mutants of core Hippo components led to tumourigenesis in mice (Lee et al. 2008, 2010; Zhou et al. 2009, 2011; Lu et al. 2010; Nishio et al. 2012).

The Hippo pathway is also implicated in cancer-related phenomena as Yap/Taz induced an epithelial–mesenchymal transition (EMT), which is crucial for the initiation of cancer metastasis (Overholtzer et al. 2006; Lei et al. 2008; Thiery et al. 2009). Yap accelerated cancer metastasis in mice (Chen et al. 2012; Lamar et al. 2012), while Taz was shown to sustain self-renewal and induce tumour initiation of breast cancer stem cells (Cordenonsi et al. 2011). Indeed, high Yap/Taz activity had prognostic value in predicting metastasis and tumor grade in a large cohort of patients (Cordenonsi et al. 2011).

Several lines of evidence suggest that Hippo signalling contributes to the self-renewing capacity, particularly in intestinal stem cells (ISCs). In Drosophila midgut, Yki activity is induced in enterocytes upon Hippo signalling disruption, which activates the non-cell-autonomous ISC

17 proliferation through upregulation of Unpaired cytokine expression (Ren et al. 2010a; Staley & Irvine, 2010). Yki also elicits cell-autonomous ISC proliferation in response to tissue damage or disruption of upstream Hippo components (Karpowicz et al. 2010; Shaw et al. 2010). In addition, Yki was shown to be required for tissue regeneration in Drosophila wing discs (Sun & Irvine, 2011). In mammalian cells, Yap plays an important part in tissue regeneration as the level of Yap drastically increased after dextran sulfate sodium (DSS)-induced injury, and the damaged intestinal epithelium underwent regeneration while inactivation of Yap markedly hindered regeneration (Cai et al. 2010).

Yap/Taz carry out essential roles in early embryogenesis. The importance of Yap/Taz during embryonic development was discovered when Tead4 was found to be necessary for the activation of Cdx2, a transcription factor required for the development of the trophectoderm (TE) lineage (Yagi et al. 2007). Yap null mice exhibit embryonic lethality at embryonic day 8.5 (E8.5) with defects in the yolk sac, vasculogenesis, chorioallantonic fusion and body axis elongation (Morin-Kensicki et al. 2006). Although Taz null mice are viable (Hossain et al. 2007; Tian et al. 2007; Makita et al. 2008), mice lacking both Yap and Taz die extremely early, before the formation of 16-cell morula embryos (Nishioka et al. 2009). The lethality of double knockout embryos are observed before the trophectoderm fate is delineated from the inner cell mass (ICM) (Nishioka et al. 2009), implying that Hippo signalling is involved in the segregation of the ICM from the TE lineage. In a normal blastocyst, Yap exhibits nuclear localization in the TE and cytoplasmic localization in the ICM (Nishioka et al. 2009). This unique pattern of Yap distribution is important for lineage specification in the preimplantation mouse embryo (Nishioka et al. 2009), although the underlying mechanism remains to be elucidated. Altogether, these findings demonstrate that the Hippo pathway is critical for the earliest cell fate decisions in the mammalian embryo.

Notably, the Hippo pathway has been shown to be involved in the regulation of stem cells. It has been demonstrated that Yap and Taz are required in the maintenance of mouse and human embryonic stem cell pluripotency (Varelas et al. 2008; Alarcon et al. 2009; Lian et al. 2010). During embryonic stem cell (ESC) differentiation, the level of Yap phosphorylation is increased such that nuclear Yap localization and protein levels are diminished (Lian et al. 2010). Moreover, Yap knockdown resulted in loss of ESC pluripotency whereas overexpression of nuclear Yap led to increased reprogramming of fibroblasts to induced pluripotent stem (iPS) cells (Lian et al.

2010). In transgenic or knockout mice, elevated Yap/Taz activity caused an expansion of tissue- specific stem cells and the blockage of cell differentiation (Camargo et al. 2007; Lee et al. 2008, 2010; Zhou et al. 2009, 2011; Lu et al. 2010; Schlegelmilch et al. 2011; Zhang et al. 2011). Also, knockdown of Yap/Taz in mesenchymal stem cells (MSC) inhibited osteogenesis while stimulating adipogenesis, indicating that Yap/Taz contribute to MSC differentiation (Hong et al. 2005; Dupont et al. 2011). Also, Yap/Taz play important roles in myogenesis (Watt et al. 2010; Judson et al. 2012), suggesting the significance of the Hippo pathway in dictating cell specific lineages.

1.4 αPix and βPix

αPix and βPix belong to the Dbl (Diffuse B-cell lymphoma) family of guanine nucleotide exchange factors (GEFs) that activate members of the Rho GTPase family (Bagrodia et al. 1998; Manser et al. 1998). These Rho GTPases are small GTP-binding proteins that act as molecular switches, which cycle between an active GTP-bound and an inactive GDP-bound form (van Aelst & D’Souza-Schorey, 1997). The GEF proteins activate Rho GTPases by catalyzing the exchange of bound GDP for GTP (Schmidt & Hall, 2002), whereas the GTPase-activating proteins (GAPs) inactivate Rho proteins by stimulating GTPase activity (Bernards & Settleman, 2004). Rho GTPase family members include RhoA, Rac1 and Cdc42, which are known regulators of actin cytoskeleton dynamics. In vitro studies revealed the functions of these proteins as activation of Rho led to the formation of focal adhesions and actin stress fibers (Ridley & Hall, 1992; Hotchin & Hall, 1995), while activation of Cdc42 and Rac promoted the formation of filopodia, lamellipodia and focal complexes (Ridley et al. 1992; Nobes & Hall, 1995).

1.4.1 Structure of Pix

These two closely homologous proteins, αPix and βPix, are encoded by the genes Arhgef6 and Arhgef7 respectively, and categorized as Pak-binding proteins (Bagrodia et al. 1998; Manser et al. 1998). Many splice variants of βPix exist including βPix-α/β1Pix, βPix-d/b2Pix, βPix-b, βPix- bL and βPix-c, which show different tissue distributions (Kim et al. 2000; Kim & Park, 2001;

Koh et al. 2001; Rhee et al. 2004). In contrast, only one form of αPix has yet been described (Bagrodia et al. 1998; Manser et al. 1998). Both αPix and βPix show a similar domain structure with the N-terminal src homology 3 (SH3) domain, followed by a tandem arrangement of dbl homology (DH) and pleckstrin homology (PH) domains, characteristic of the GEF proteins (Fig. 1.3). As expected, low GEF activity has been demonstrated for Rac1 and Cdc42 (Manser et al. 1998; Koh et al. 2001). At the C-terminus, both αPix and the most abundant βPix isoform share a coiled-coil leucine zipper (LZ) domain required for homo- and heterodimerization (Kim et al. 2001; Koh et al. 2001; Fig. 1.3). αPix differs from βPix by the presence of a calponin homology (CH) domain, which may be required for proper targeting of αPix to the plasma membrane and interaction with its binding partner, β-parvin (Rosenberger et al. 2003; Fig. 1.3). The Pix-Pak interaction is mediated by the SH3 domain in both Pix proteins and a conserved proline-rich sequence in Pak protein (Manser et al. 1998).

1.4.2 Function of Pix

The Pix proteins are members of the Dbl family of RhoGEFs that specifically activate Cdc42 and Rac1 (ten Klooster et al. 2006; Chahdi & Sorokin 2008). Pix members contribute to diverse cellular processes such as cell motility, adhesion, neurite outgrowth and neuronal cell polarity (Nayal et al. 2006; Osmani et al. 2006; Shin et al. 2002; Za et al. 2006). Recently, βPix was shown to mediate neuroendocrine exocytosis by controlling the activity of Rac1. Moreover, the spatial localization of Rac1 activity by βPix was shown to be important in driving collective anterior visceral endoderm (AVE) migration (Omelchenko et al. 2014). In vitro biochemical assays reveal an unusual regulatory mechanism of Pix, in which the dimerization determines its specific activity. For βPix, dimerization has been suggested to be required for its association with 14-3-3, which in turn inhibits GEF activity toward Rac1 (Chahdi & Sorokin, 2008). The dimeric form of αPix functions as a specific GEF for Rac1, possibly by engaging the DH domain from one monomer and the PH domain from another, whereas the monomeric form of αPix enables it to activate Rac as well as Cdc42, most likely through the SH3 domain that interacts with Pak or the ubiquitin ligase Cbl (Feng et al. 2004; Baird et al. 2005). αPix interacts with the activated form of both Rac1 and Cdc42 and it has been shown that the binding of activated Cdc42 to the αPix dimer significantly increases its Rac-specific GEF activity (Baird et al. 2005). This

Figure 1.3: Domain organization of the homologous βPix and αPix.

βPix contains a src homology 3 (SH3), a dbl homology (DH), and a pleckstrin homology (PH) domain, as well as a region rich in leucine (K) and glutamate (E) (KER), and a leucine zipper (LZ) domain. αPix has an additional calponin homology (CH) at the N-terminus. The DH-PH cassette is commonly found in all Dbl family of guanine nucleotide exchange factors (GEFs) and the LZ domain is required for homo- and heterodimerization.

21 allosteric regulation is induced by the activated form of Cdc42 that binds to a region in αPix that is distinct from where GDP-bound Rac is located (Baird et al. 2005). Meanwhile, inhibition of Rac-specific GEF activity is mediated by the activated form of Rac that acts through negative feedback (Baird et al. 2005). Although further in vivo data are required to validate this suggested mechanism of αPix GEF activity, it has been proposed that the dissociation of αPix dimers into monomers may contribute to the Cdc42-specific activation through G-protein-coupled chemoattractant receptors in mouse neutrophils (Li et al. 2003; Baird et al. 2005). Interestingly, a mutation in Arhgef6 gene resulting in the formation of αPix that lacks 28 amino acids in the CH domain was identified in patients with X-linked non-specific mental retardation (Kutsche et al. 2000). This observation indicates that the CH domain of αPix may carry out an important function in the brain.

1.4.3 βPix-Git complex

Git proteins were originally discovered as binding partners of G protein-coupled receptor kinase (Premont et al. 2004), where it regulates Arf6-dependent trafficking of β2-adrenergic receptors (Claing et al. 2000). Git1 protein possesses an N-terminal ArfGAP domain (Premont et al. 2004), ankyrin repeats that mediate intramolecular folding (Totaro et al. 2007), Spa2 homology domain (SHD) that mediates intermolecular interactions, focal adhesion targeting domain (FAH) that includes Paxillin-binding sequence (PBS) (Zhao et al. 2000), and synaptic localization domain (SLD) that includes a coil-coiled region (Zhang et al 2003). In vivo, βPix forms a constitutive complex with the multidomain signalling protein Git1, which together provide a platform for the formation of large macromolecular assemblies. These assemblies can regulate various cellular processes such as cell polarity and directional migration (Zhao et al. 2000; Manabe et al. 2002), membrane ruffling (Ridley et al. 1992), endocytic trafficking (Lahuna et al. 2005), spine morphogenesis and synapse formation (Zhang et al. 2005; Saneyoshi et al. 2008). It is well established that oligomerization of βPix and Git is important for their physiological functions as mutations or deletions of the leucine zipper domains interfere with its correct subcellular localization and the proper GEF activity of βPix (Kim et al. 2001; Ko et al. 2001). Pix and Git are known to function together as an oligomeric scaffold complex to facilitate activation of sterile 20-like kinase (Premont et al. 2004) or to regulate focal adhesion turnover by negatively

22 modulating focal adhesion maturation and enhancing cell migration (Kuo et al. 2011). The apicobasal polarity protein Scribble has been linked to Pix and Git in mammalian cells (Audebert et al. 2004) and they localize at focal adhesions via ability of Git to interact with Paxillin (Nayal et al. 2006; Zhang et al. 2008).

βPix-Git complex formation is mediated by the Git binding domain (GBD) of βPix, which binds the SHD of Git1 (Zhao et al. 2000; Premont et al. 2004). βPix and Git both possess predicted coiled-coil segments with internal leucine zipper that allows homodimerization and heterodimerization (Paris et al. 2003; Kim et al. 2001). Notably, one particular structural study demonstrated that, contrary to prevalent dimeric models, βPix adopts an unusual trimeric conformation and that dimeric Git and trimeric Pix form a high-affinity heteropentameric complex in which each SHD of the Git1 dimer recognizes one GBD of the βPix trimer, leaving one GBD unoccupied (Schlenker & Rittinger, 2009).

1.5 Thesis overview

The Hippo signalling pathway plays a critical role in the regulation of tissue growth and organ size. Hippo signals flow through the canonical Mst/Lats kinases, which phosphorylate and promote cytoplasmic retention of the transcriptional regulators, Yap and Taz, thereby inhibiting transcriptional programmes. While the core Hippo pathway has been well established, upstream components that modulate the core kinase cassette are less known. So far, apical-basal polarity complexes, GPCR signalling as well as cellular mechanical forces constitute the regulatory modules in mammalian cells, even though we lack mechanistic details. Therefore, to gain insight into the regulation of the Hippo pathway, the Attisano lab implemented the high throughput protein-protein interaction screen LUMIER to uncover novel Hippo players. In this thesis, I describe identification of the RhoGEF βPix as a Yap partner that is a positive Hippo pathway regulator that acts through well-characterized upstream regulators including cell density and actin cytoskeleton remodelling. To understand the regulatory mechanism of βPix, the interface of βPix that mediates Yap interaction was investigated by domain mapping and the significance of βPix GEF activity was tested. Previous reports suggest anomalies in the canonical Mst/Lats kinase cassette of the Hippo pathway where the signalling may bypass Mst kinases or Mst/Lats altogether. Thus, our model of study, specifically mouse mammary epithelial cells, was explored

23 in order to investigate whether the core kinase cassette is conserved in this particular cell line. Moreover, implications of βPix function were probed in a cancer context.

Chapter 2 Materials and Methods

2.1 Cell culture and transfection

NMuMG cells were cultured in DMEM supplemented with 10% FBS and 10 μg/ml insulin, EpH4 and HEK293T cells in DMEM with 10% FBS, and MDA-MB-231 cells in RPMI with 5%

FBS. All cells were grown at 37°C with 5% CO2. siRNA oligonucleotide complexes targeting the designated genes as well as a control siRNA (InvS3), with the sequence GGG CAA GAC GAG CGG GAA G dTdT, were purchased from Dharmacon RNAi Technologies, Thermo Scientific (Table 1). All siRNAs were used at a concentration of 20 nM for transfection. Cells were transfected with the ratio specified by the manufacturer’s instruction in which 1 μl of siGENOME pools of four individual siRNAs were incubated with 1 μl of Lipofectamine RNAiMAX (Life Technologies) for 15 min before the transfection mix was added to cells. For cDNA transfections, either Lipofectamine LTX (Life Technologies) or Lipofectamine 3000 (Life Technologies) were utilized; 0.5 μg of cDNA were incubated with 0.5 μl of PLUS reagent for 10 min or 1 μl of p3000 reagent for 5 min, subsequently followed by 30 min incubation with 1 μl of Lipofectamine LTX or 15 min incubation with 1 μl of Lipofectamine 3000, respectively.

2.2 Plasmids and chemicals

The βPIX construct was generated by PCR using an isoform of human βPIX (NM_001113513.1) and was N-terminally tagged with Flag or HA in a pCMV5 vector. βPIX deletion constructs were generated by Emad Heidary Arash and αPIX (NM_152801.2) deletion constructs were generated by Monika Podkowa, both of whom utilized PCR-mediated site-directed mutagenesis. Of note, the βPIX GEF-mutant construct in which GEF activity is abrogated via L238R/L239S point mutations, was generated by a two-step PCR method. This method relies on four sets of primers: 1) Forward primer at the beginning of the insert, 2) Reverse primer that includes L238R/L239S point mutations, 3) Forward primer that is reverse complimentary sequence to the aforementioned reverse primer, 4) Reverse primer at the end of the insert. Using these four primers, two separate pieces of cDNAs were amplified and then combined for another around of

PCR that led to generation of the final product. Flag- or HA-tagged constructs for Yap and Taz in pCMV5 were previously described (Varelas et al, 2010a). Siyuan Song generated MDA-MB- 231 cells stably expressing βPIX, in which Flag-tagged βPIX was subcloned into pBABE-puro vector (addgene #1764; Mani et al, 2007), and pBABE-puro empty vector was used as a control. Multiple colonies were picked and those clones that expressed relatively high level of βPIX were selected by anti-Flag immunoblotting and subsequently tested for steady expression capability. The chemical latrunculin A (Tocris Bioscience #3973) was utilized in the study for the purpose of disrupting actin cytoskeleton.

2.3 Immunoblotting (IB) and immunoprecipitation (IP)

Cells were lysed in lysis buffer [50 mM Tris–HCl, 150 mM NaCl, 1 mM EDTA, 0.5% Triton X- 100, 1 mM DTT containing phosphatase and protease inhibitors]. Cell extracts were run on SDS–PAGE gels and standard protocols of immunoblotting were carried out. For immunoprecipitations, cell lysates were subjected to anti-Flag immunoprecipitation and Flag- tagged proteins were immobilized and isolated using protein G-Sepharose. For immunoblotting, the following antibodies were used: anti-Flag M2 (Sigma-Aldrich #F1804; 1:3000 IB and 1:1000 IP), rat anti-HA (Roche #1867423; 1:1000 IB), Yap (Santa Cruz #101199; 1:1000 IB), Yap (Cell Signalling #4912; 1:1000 IB), phospho-Yap (Ser127, Cell Signalling #13008, D9W2I; 1:1000 IB), Taz (BD Pharmingen #560235, 1:1000 IB), Cool1/βPix (Cell Signalling #4515; 1:1000 IB), Cool2/αPix (Cell Signalling #9459; 1:1000 IB), Lats1/2 (phospho-Thr1079/1041, Assay Biotechnology #A8125; 1:1000 IB), Lats1 (Cell Signalling #3477; 1:1000 IB), Lats2 (Bethyl #A300-479A; 1:1000 IB), Mst1 (Cell Signalling #6789; 1:1000 IB), and Mst2 (Cell Signalling #6788; 1:1000 IB).

2.4 Quantitation

Quantity One software was used for quantitation of protein bands from the immunoblot. Volume Rect Tool was used to draw a rectangle around each protein band and Analysis Volume Report yielded a value expressed in pixel counts (CNT) per mm2. For co-immunoprecipitation assays, the intensity of interaction bands were obtained by subtracting the corresponding background

26 value, which then were averaged from three independent experiments and normalized relative to the control. For immunofluorescence microscopy, Yap/Taz localization were categorized into four groups: 1) Strongly nuclear, 2) Weakly nuclear, 3) Similar distribution between the nucleus and the cytoplasm, 4) No nuclear stain. Non-transfected cells that surround transfected cells were used as controls.

2.5 Tead reporter assay

Two Tead reporters were kindly provided by J. Wrana Lab (LTRI, Mount Sinai Hospital, Toronto). The luciferase reporter in the backbone of pGL3 with 10 tandem Tead binding sites (ACATTCCA) was generated by Dr. Alex Gregorieff and referred to as version 1 of Tead reporter (V1TEAD) in this thesis. Dr. Alexander Weiss generated a second Tead reporter by transferring the existing Tead binding sites (V1TEAD) from pGL3 backbone to pGL4 and is referred to as version 2 of Tead reporter (V2TEAD) in this thesis.

NMuMG cells were transfected with siRNAs of interest in 24-well plates at a density of 50,000 cells/well. The next day, cells were transfected with 0.3 μg of the Tead reporter construct (V1TEAD or V2TEAD), 0.05 μg of β-galactosidase and empty pCMV5 vector of 0.15 μg (totaling 0.5 μg of cDNA) using either 1 μl of Lipofectamine LTX (Life Technologies) with pre- incubation of 0.5 μl of PLUS reagent or 1 μl of Lipofectamine 3000 (Life Technologies) with pre-incubation of 1 μl of p3000 reagent. Two days after siRNA transfection, cells were lysed with luciferase lysis buffer [25 mM Tris-phosphate, 2 mM DTT, 2 mM DCTA, 10% glycerol and 1% Triton X-100] and luciferase activity was measured using a luminometer. Relative luciferase activity was obtained from averages of triple replicates that were normalized to β-galactosidase readings.

2.6 Immunofluorescence microscopy

Cells were plated in 4-well Lab-Tek chambers (#154526) and at the time of fixation, treated with 4% paraformaldehyde for 10 min at room temperature. After washing three times with 0.01% PBS-Tween, cells were permeabilized with 0.5% Triton X-100 in PBS for 10 min at room

27 temperature. Samples were washed three times with 0.01% PBS-Tween and then blocked in 2% BSA PBS-Tween for 1 hr. Then, cells were immunostained by incubating with primary antibodies (mouse anti-YAP 1:300, Santa Cruz sc-101199; rabbit anti-Flag 1:500, Sigma-Aldrich F7425; rabbit anti-Lats1/2 1:300, Assay Biotechnology A8125; or anti-Flag M2 1:500, Sigma- Aldrich F1804) in 2% BSA PBS-Tween overnight at 4°C. The next day, samples were washed three times with 0.01% PBS-Tween and treated with the secondary antibodies: goat anti-mouse Alexa Fluor 488 (Life Technologies #A11029, 1:1000 in 2% BSA PBS-Tween), goat anti-rabbit Alexa Fluor 546 (Invitrogen #A11305, 1:1000 in 2% BSA PBS-Tween), or goat anti-rabbit Alex Fluor 647 (Life Technologies #A21244, 1:1000 in 2% BSA PBS-Tween) for 1–2 h at room temperature. Slides were washed three times with 0.01% PBS-Tween and mounted with ProLong Gold Antifade Reagent (Life Technologies #P36035). Cell nuclei were immunostained by DAPI (1:1000 in 2% BSA PBS-Tween) and actin cytoskeleton by Alexa Fluor 568-Phalloidin (Life technologies #12380, 1:200 in 2% BSA PBS-Tween). Cells were visualized under 40X magnification, images were captured using a spinning disc confocal scanner (CSU10, Yokogawa) on Leica DMI6000B microscope, and Volocity software was used for image acquisition and analysis. For quantification of Yap localization transfected with different Flag- tagged βPIX cDNA constructs, a minimum of 30 transfected cells were counted per each condition and nuclear/cytoplasmic localization of Yap was evaluated in transfected cells compared to the surrounding non-transfected cells.

2.7 Quantitative Real-Time PCR

Cells were plated in 12-well dishes and transfected with siRNAs using 2 μl of Lipofectamine 2000 or Lipofectamine RNAiMax reagent (Life Technologies). Cells were lysed two days after transfection and total RNA was purified using PureLink RNA Mini Kit (Life Technologies) and quantified by a spectrophotometer (Eppendorf). cDNA was synthesized using 1 μg of purified RNA using Oligo-dT primers (0.5 μg) and 200 units of RevertAidTM H Minus M-MLV Reverse Transcriptase (Invitrogen, #28025-013). Quantitative real-time PCR was performed with the SYBR Green master mix (Applied Biosystems) using the ABI Prism 7900 HT system (Applied Biosystems) with 100 nM of primers. Relative gene expression was quantified by ∆∆Ct method and normalized to Gapdh. The sequences of the primers used are listed in Table 2.

Table 1: List of siRNAs.

Target gene Genome siRNA Catalog No.

Arhgef7 Mouse siβPix (1) D-063023-17

siβPix (2) D-063023-04

siβPix (3) D-063023-03

siβPix (4) D-063023-02

Arhgef6 Mouse siαPix (1) D-054557-01

siαPix (2) D-054557-02

siαPix (3) D-054557-03

siαPix (4) D-054557-04

Lats1 Mouse siLats1 (1) D-063467-01

siLats1 (2) D-063467-02

siLats1 (3) D-063467-03

siLats1 (4) D-063467-04

Lats2 Mouse siLats2 (1) D-044602-01

siLats2 (2) D-044602-02

siLats2 (3) D-044602-03

siLats2 (4) D-044602-04

LATS1 Human siLATS1 (1) D-004632-01

siLATS1 (2) D-004632-02

siLATS1 (3) D-004632-03

siLATS1 (4) D-004632-04

LATS2 Human siLATS2 (1) D-003865-01

siLATS2 (2) D-003865-02

siLATS2 (3) D-003865-03

siLATS2 (4) D-003865-04

Stk4 Mouse siMst1 (1) D-059385-01

siMst1 (2) D-059385-02

siMst1 (3) D-059385-03

siMst1 (4) D-059385-04

Stk3 Mouse siMst2 (1) D-040440-01

siMst2 (2) D-040440-02

siMst2 (3) D-040440-03

siMst2 (4) D-040440-04

Cdc42 Mouse siCdc42 (1) D-043087-01

siCdc42 (2) D-043087-02

siCdc42 (3) D-043087-03

siCdc42 (4) D-043087-04

Rac1 Mouse siRac1 (1) D-041170-01

siRac1 (2) D-041170-02

siRac1 (3) D-041170-03

siRac1 (4) D-041170-04

Non-targeting Human/Mouse siCTL (InvS3) Custom

Table 2: Sequence of qPCR Primers (mouse).

Target Forward Reverse

Gapdh ACATCAAGAAGGTGGTGAAGCAGG ACGAATTTGGCTACAGCAACAGGG

Arhgef7 AGCTCGAGAGACACATGGAGGATT TCTGCAGCTCAAGCTCTTTCCTCT

Ctgf GGGCCTCTTCTGCGATTTC ATCCAGGCAAGTGCATTGGTA

Ankrd1 TGCGATGAGTATAAACGGACG GTGGATTCAAGCATATCTCGGAA

Cyr61 CGAGGTGGAGTTGACGAGAAACAA CTTTGAGCACTGGGACCATGAAGT

Cdc42 CCCATCGGAATATGTACCAACTG CGGTCGTAGTCTGTCATAATCCT

Rac1 GAGACGGAGCTGTTGGTAAAA ATAGGCCCAGATTCACTGGTT

Lats1 TGCCAGGCCTATTAATGCCACCAT TGCTTGGGTGAGCTTGAGCAAATG

Lats2 TTTATCCACCGGGACATCAAGCCT AGTTGGAAACATCGTCCCAGAGGT

Stk4 TCATTCGGCTACGGAACAAG CGCCTTGATATCTCGGTGTATT

Stk3 TTGACTAAGCAGCCTGAAGAAG TGCAACCACTTGACCAGATT

Chapter 3 Results

3.1 LUMIER validation and characterization of βPix-Yap interaction

Yap/Taz are the key downstream effectors of the Hippo pathway. Thus, to identify novel Yap/Taz binding partners that may potentially function as pathway modulators, our lab conducted a high throughput mammalian-cell based protein-protein interaction screen called LUMIER (Barrios-Rodiles et al, 2005; Miller et al, 2009; Varelas et al, 2010a). In the screen setup, Firefly luciferase-tagged TAZ was utilized as a bait against a library of Flag-tagged prey proteins that are enriched in various signalling domains. The presence of prey-bait interaction was detected by performing a luciferase assay on anti-Flag immunoprecipitates. LUMIER hits were obtained by designating a specified cutoff and analysis of these screen hits revealed a novel interacting protein, Arhgef7 commonly known as βPix, which was selected for a further study.

3.1.1 βPix interacts with Taz and Yap

To confirm the LUMIER interaction of Taz with βPix, co-immunoprecipitation assays were performed in which HEK293T cells were transfected with Flag-tagged TAZ along with HA- tagged βPIX (Fig. 3.1A). Cell lysates were subjected to anti-Flag immunoprecipitation and the association between the two proteins was assessed by anti-HA immunoblotting (Fig. 3.1A). Indeed, Taz interacted with βPix (Fig. 3.1A). Likewise, a switched tagging of proteins with Flag- tagged βPIX and HA-tagged TAZ also demonstrated Taz-βPix interaction (Fig. 3.1B). In a similar manner, Flag-tagged βPIX and HA-tagged YAP were co-transfected in HEK293T cells and anti-Flag immunoprecipitates were subjected to anti-HA immunoblotting, which showed interaction between Yap and βPix (Fig. 3.1B).

Figure 3.1: βPix interacts with Taz/Yap.

(A) HEK293T cells were co-transfected with Flag-tagged TAZ along with HA-tagged βPIX. Cell lysates were subjected to anti-Flag immunoprecipitation (α-Flag IP) and the interaction was detected by anti-HA immunoblotting. Equivalent protein expression levels were confirmed (Totals).

(B) HEK293T cells were co-transfected with Flag-tagged βPIX along with HA-tagged TAZ or YAP. Cell lysates were subjected to α-Flag IP and the interaction was detected by anti-HA immunoblotting. Equivalent protein expression levels were confirmed (Totals).

3.1.2 Domain mapping of Pix and Yap

Structural studies show a great resemblance in domain organization between homologs βPix and αPix, which share a number of conserved domains: src homology 3 (SH3), a tandem dbl homology (DH) and pleckstrin homology (PH) domain, and carboxy-terminal leucine zipper (LZ) domain (Fig. 3.2). αPIX only differs in domain organization by having an extra calponin homology (CH) domain at the N-terminus (Fig. 3.2). Due to the structural similarity between βPix and αPix with the sequence similarity of approximately 70% (Rosenberger & Kutsche, 2006), the homologous β/αPix proteins were expected to display similar binding patterns. Indeed, co-immunoprecipitation experiments demonstrated that Yap also interacted with the βPix homolog, αPix protein (see below Fig. 3.4A). To map the regions in Pix proteins that mediate association with Yap, HEK293T cells were transfected with HA-tagged YAP along with various Flag-tagged deletion constructs of the βPIX or αPIX (Fig. 3.2, 3.3A, 3.4A). Cells were lysed and were subjected to anti-Flag immunoprecipitation and the presence of interaction was detected by anti-HA immunoblotting (Fig. 3.3A, 3.4A).

3.1.2.1 KER of βPix is required for Yap interaction

Since the level of expression differed between the deletion constructs of βPIX, the ratio of interaction bands were quantified by Quantity One software and the relative interaction patterns were plotted by using the averaged values obtained from three independent co- immunoprecipitation assays (Fig. 3.3B). Analysis of βPix-Yap interaction from both the blots and the quantitation revealed that deletion of the N-terminus spanning the SH3 and DH domains (βPIX 272-646) was dispensable for interaction with YAP whereas a deletion of the C-terminal region lacking the last 151 amino acids (βPIX 1-495) resulted in reduced interaction with YAP (Fig. 3.3A, B). This reduced interaction designates the C-terminal region of βPix as a Yap binding site. The C-terminal region is comprised of an internal region enriched in lysine (K) and glutamate (E), which we refer to as the KER (amino acids 496-555), followed by a leucine zipper motif (LZ; amino acids 586-646) that is required for homo- and heterodimerization (Feng et al, 2004). Consistent with literature, dimerization of βPIX was disrupted with the LZ domain- truncated construct (βPIX 1-585) in the co-immunoprecipitation assay where immunoprecipitates

Figure 3.2: A schematic representation of the wild-type and deletion cDNA constructs of βPIX and αPIX.

A schematic representation depicting full-length (FL) and deletion constructs of βPIX and αPIX used for mapping interactions is shown. Positive or negative interactions with YAP are denoted on the right column with a number of plus (+) signs indicating the strength of interaction. A putative Yap binding region of α/βPix is also noted.

Figure 3.3: The KER of βPix is required for interaction with Yap.

A) HEK293T cells were co-transfected with the wild-type or mutant constructs of Flag-tagged βPIX along with HA-tagged YAP. Cell lysates were subjected to α-Flag IP and the presence of YAP was assessed by anti-HA immunoblotting. Expression of totals were confirmed by anti-HA immunoblotting. A dashed line on blots indicates a removal of a sample lane.

(B) Quantitation of YAP-βPIX interaction mapping from three replicate experiments is plotted as the mean ± the SEM.

Figure 3.4: The KER of αPix is required for interaction with Yap.

A) HEK293T cells were co-transfected with the wild-type or mutant constructs of Flag-tagged αPIX along with HA-tagged YAP. Cell lysates were subjected to α-Flag IP and the presence of YAP was assessed by anti-HA immunoblotting. Expression of totals were confirmed by anti-HA immunoblotting.

(B) Quantitation of YAP-αPIX interaction mapping from three replicate experiments is plotted as the mean ± the SEM.

38 of HEK293T cells transfected with either Flag-tagged βPIX wild-type or 1-585 construct along with HA-tagged βPIX were subjected to anti-HA immunoblotting (Fig. 3.5). In the KER, this particular stretch of amino acids has been reported as a binding region for other βPix interacting partners such as Naa10p (Hua et al, 2011) or Git1 (Flanders et al, 2003; Hoefen & Berk, 2006; Chahdi & Sorokin, 2008), hence is also referred to as the Git-binding (GB) domain. Further analysis of the C-terminus revealed that an internal deletion of the KER that retains an intact LZ (ΔKER; lacking amino acid 496-555) abrogated interaction with YAP while βPIX 1-585 construct, in which the LZ domain is deleted, exhibited binding (Fig. 3.3A, B). Thus, these results demonstrate that the KER within the C-terminus of βPix is required for interaction with Yap (see below Fig. 3.6).

3.1.2.2 Corresponding KER of αPix is required for Yap interaction

Domain mapping of the interaction between Yap and the βPix related protein, αPix, revealed a similar binding pattern. Due to a different expression pattern between αPIX constructs, the intensity of interaction bands were quantified as for the βPix domain mapping (Fig. 3.4B). Interaction was observed for a short C-terminal construct spanning the KER and LZ region (αPIX 541-776), demonstrating that the entire N-terminal region including CH, SH3, DH and PH domains is dispensable for Yap interaction (Fig. 3.4A, B). Both αPIX constructs missing the corresponding KER and LZ (αPIX 1-574 and 1-625) decreased interaction, narrowing the C- terminal region as being the Yap binding site (Fig. 3.4A, B). Moreover, αPIX LZ mutant, in which dimerization is disrupted via double point mutations L714R and L721S (Feng et al, 2004), displayed interaction with YAP (Fig. 3.4A, B). Thus, the C-terminal region of αPix excluding the LZ is important for mediating interaction with Yap. Collectively, domain mapping of Yap-Pix interaction demonstrates that the KER is required for interaction between Yap and β/α Pix (Fig. 3.6), and that neither the LZ nor dimerization of Pix is necessary for Yap interaction.

Figure 3.5: The LZ domain is required for βPix dimerization.

HEK293T cells were transfected with Flag-tagged βPIX FL (full length) or ∆LZ mutant along with HA-tagged βPIX. Cell lysates were subjected to α-Flag IP and the interaction was assessed by anti-HA immunoblotting. Expression of totals were confirmed by anti-Flag or anti-HA immunoblotting.

Figure 3.6: The sequence alignment of human β/αPIX, showing amino acid sequence of a possible region of interaction with Yap.

Domain mapping suggests the C-terminal region of Pix, especially the KER region rich in leucine (K) and glutamate (E), is required for interaction with Yap. PH and LZ domains of Pix are noted for reference.

3.2 Functional analysis of Pix in the Hippo pathway

3.2.1 Analysis of βPix function via Tead reporter assay

Since βPix was shown to interact with the downstream effectors Yap/Taz, the effect of βPix on the Hippo pathway was explored using a transcriptional luciferase reporter assay. This assay relies on a reporter construct (Tead reporter), which is sensitive to nuclear Yap/Taz and thus, serves as a functional readout of the Hippo pathway response. Unphosphorylated Yap and Taz remain in nucleus and interact with Tead transcriptional factors to turn on gene transcription. The wild-type (WT) Tead reporter is comprised of multiple tandem Tead binding sites that drive the constitutive expression of the downstream luciferase gene (Fig. 3.7A). Tead binding sites are mutated in the mutant (MT) Tead reporter such that binding is abolished and is used as the negative control in the assay. There are currently two versions of WT Tead reporter at hand: Version 1 of Tead reporter (V1TEAD) that has been extensively used in our lab and version 2 of Tead reporter (V2TEAD) that has been recently generated and gives a better fold change over the MT readings. The Tead reporter assay has been tested in HEK293T and MDA-MB-231 cells in our lab, but has not been validated in mouse mammary epithelial cells. Thus, mouse mammary NMuMG cells were transfected with siControl, siRNA targeting βPix, or siRNA targeting both Lats1/2 and subsequently transfected with either V1TEAD or V2TEAD of WT, or MT Tead reporter along with β-galactosidase (β-gal) on the following day to control for transfection efficiency (Fig. 3.7B, C). Two days after siRNA-mediated knockdown, cells were lysed and luciferase activity was measured using a luminometer (Fig. 3.7B, C). Luminescence intensities obtained from the average of triplicates were normalized to β-gal readings (Fig. 3.7B, C). Both versions of Tead reporter gave a similar outcome in which loss of βPix expressions, either via a pool of four siRNAs or single siRNA #17, increased Tead-driven luciferase activity, indicating an increase in Yap/Taz in the nucleus in the absence of βPix. Depletion of both Lats1 and Lats2 expression exhibited an expected behaviour of increased luciferase activity with knockdown of the activators of the Hippo pathway, validating the efficacy of the Tead reporter assay in NMuMG cell line (Fig. 3.7B). MT Tead reporter showed no increase in activity, indicating that the observed luciferase activity is specifically responsive to Yap/Taz nuclear localization. Hence, these results indicate that βPix is required to inhibit Yap/Taz localization in the nucleus.

Figure 3.7: βPix knockdown promotes accumulation of Yap/Taz in the nucleus.

(A) A schematic of Tead reporter comprised of multiple tandem Tead binding sites that drive the expression of the downstream luciferase gene is shown.

(B) NMuMG cells were transfected with siControl, siβPix, or siLats1/2 and subsequently transfected with version 1 of WT Tead reporter (V1TEAD) along with β-gal on the following day. Forty-eight hours after knockdown, cells were lysed and luciferase activity was measured using a luminometer and obtained values were normalized to β-gal readings. Relative luciferase activity of WT Tead reporter is plotted with black bar as the mean ± the SD.

(C) NMuMG cells were transfected with siControl, siβPix pool or single #17 and subsequently transfected with version 2 of WT or MT Tead reporter (V2TEAD) along with β-gal on the following day. Forty-eight hours after knockdown, cells were lysed and luciferase activity was measured using a luminometer and obtained values were normalized to β-gal readings. Relative luciferase activity of WT Tead reporter is plotted with black bar and MT Tead reporter with white bar, as the mean ± the SD.

3.2.2 αPix is not involved in the Hippo pathway in mouse mammary epithelial cells

The function of the homologous αPix in the Hippo pathway was also explored. However, αPix is not expressed in NMuMG cells as confirmed by immunoblotting (see below Fig. 3.16) and has no effect on Yap/Taz target genes upon siRNA-mediated depletion of αPix (Heidary Arash et al. 2014). This conforms to previous reports that αPix shows limited distribution patterns compared to more widely expressed βPix (Rosenberger & Kutsche, 2006; Staruschenko & Sorokin, 2012). Thus, these results demonstrate that βPix is more important form of Pix proteins that modulates Yap/Taz localization in mouse mammary epithelial cell, NMuMG.

3.3 Analysis of βPix GEF activity in Hippo pathway regulation

3.3.1 βPix functions independent of GEF activity on Cdc42/Rac1

Previous studies demonstrated that the formation of cell junctions at high cell density activates the Hippo pathway and induces cytoplasmic sequestration of Yap/Taz (Zhao et al. 2007; Ota & Sasaki, 2008). In addition to cell density, actin cytoskeleton dynamics play an important role in the Hippo pathway as remodelling of the cytoskeleton regulates Yap/Taz activity, albeit the mechanism of regulation is unclear (Boggiano & Fehon, 2012; Genevet & Tapon, 2011; Schroeder & Halder, 2012). As βPix emerged from the LUMIER screen as an appealing candidate in the regulation of the Hippo signalling, a PhD student in our lab, Emad Heidary Arash, sought to examine whether βPix is under the influence of the aforementioned upstream stimuli of the Hippo pathway. Indeed, he showed that βPix is required downstream of both cell density sensing and actin cytoskeletal rearrangements (Heidary Arash et al. 2014). Specifically, knockdown of βPix in high density or disruption of actin cytoskeleton resulted in enhanced nuclear Yap/Taz and activated Yap/Taz target gene expression (Heidary Arash et al. 2014). Consistent with this, overexpression of βPix induced cytoplasmic Yap/Taz (Heidary Arash et al. 2014). These findings were confirmed in my experiments, as discussed below and altogether demonstrate that βPix is a positive regulator of the Hippo pathway.

βPix is a member of Dbl family of guanine nucleotide exchange factor (GEF) that activates a family of small Rho GTPase, Cdc42 and Rac1, both of which are known modulators of the actin cytoskeleton and focal adhesion formation (Rosenberger & Kutsche, 2006; Staruschenko & Sorokin, 2012). βPix regulates Yap/Taz in response to well-described upstream stimuli of the Hippo pathway, cell-cell contact and actin cytoskeleton rearrangements. Therefore, I set out to test whether βPix GEF activity is required for βPix-mediated regulation of the Hippo pathway.

Overexpression of βPix is expected to enhance cytoplasmic localization of Yap/Taz under low cell density conditions, where Yap/Taz is predominantly nuclear. Consistent with this, transient overexpression of βPIX in sparse cultures of NMuMG cells led to re-distribution of Yap/Taz such that levels of Yap/Taz in the nucleus and cytoplasm were roughly equivalent (Fig. 3.8B). To examine whether βPix GEF activity is obligatory for control of Yap/Taz, the GEF-domain double point mutant (L238R/L239S in the DH domain) that abrogates GEF activity (Manser et al, 1998; Fig. 3.8A) was generated. Notably, transient expression of the GEF mutant construct promoted cytoplasmic localization of Yap/Taz in NMuMG cells at low density, similar to the phenotype induced by overexpressed wild-type βPIX (Fig. 3.8B). To obtain statistical significance, more than 40 cells were analyzed per each experimental condition. Non-transfected cells that surround transfected cells were used as controls. The phenotypes of βPIX-mediated Yap/Taz localization were categorized into four groups: 1) Strongly nuclear, 2) Weakly nuclear, 3) Similar distribution between the nucleus and the cytoplasm, 4) No nuclear stain. Quantitation of Yap/Taz localization revealed a similar trend between the wild-type βPIX and the GEF mutant version in that they both induced cytoplasmic Yap/Taz localization (Fig. 3.8C), indicating that GEF activity is not required for βPix regulatory action on the Hippo pathway.

To further rule out GEF activity in the regulation of Yap/Taz by βPix, the effect of βPix substrate targets, Cdc42 and Rac1, was tested by knockdown. siRNA-mediated depletion of Cdc42, Rac1, or βPix was achieved in NMuMG cells either plated in dense cultures (Fig. 3.9A) or treated with F-actin disrupting agent, Latrunculin A (LatA) (Fig. 3.10), both of which are potent conditions of Hippo signalling activation.

Consistent with previous studies, Yap/Taz was primarily nuclear in sparse cultures (Fig. 3.10), but localized to the cytoplasm at high density in NMuMG cells (Fig. 3.9A). As previously demonstrated, abrogation of βPix expression using a pool of four siRNAs, markedly attenuated

Figure 3.8: βPix GEF activity is dispensable for regulation of Yap/Taz.

(A) The double point mutant version of βPIX (GEF mutant, L238R/L239S in the DH domain) lacks GEF activity. (B) NMuMG cells were transfected with Flag-tagged full-length (FL) or L238R/L239S double point mutant version of βPIX (GEF mutant). Transfected cells are indicated with white arrows. Localization of Flag-βPIX (Texas Red) and Yap/Taz (FITC, green) were visualized by immunofluorescence confocal microscopy. Scale bar, 20 μm. (C) A quantitation of a representative experiment showing Yap/Taz localization quantified from n > 40 cells per condition is plotted. Yap/Taz localization is categorized into four states as indicated.

Figure 3.9: βPix regulates Yap/Taz localization in response to cell density in a GEF-independent manner.

(A, B) βPix knockdown promotes nuclear retention of Yap/Taz at high cell density, while knockdown of Cdc42/Rac1, or both has no effect. NMuMG cells transfected with control siRNA or siRNA targeting βPix, Cdc42, or Rac1 were plated at high cell density.

(A) Localization of Yap/Taz (FITC, green), actin filaments (phalloidin, Texas Red) and nucleus (DAPI, blue) were visualized by immunofluorescence confocal microscopy.

(B) Relative expression of Yap/Taz target genes, Ctgf and Cyr61, and the knockdown efficiency of βPix, Rac1 and Cdc42 were determined by qPCR and plotted as the mean ± the range.

Figure 3.10: βPix regulates Yap/Taz localization in response to actin cytoskeleton rearrangements in a GEF-independent manner.

βPix knockdown promotes nuclear retention of Yap/Taz in LatA-treated condition (indicated with white arrows), while knockdown of Cdc42/Rac1, or both has no effect. NMuMG cells transfected with control siRNA or siRNA targeting βPix, Cdc42, or Rac1were either treated with DMSO or LatA and Yap/Taz localization (FITC, green) was analyzed by immunofluorescence confocal microscopy. Actin filaments (phalloidin, Texas Red) and nucleus (DAPI, blue) were also visualized. Scale bar, 25 μm.

49 cytoplasmic translocation of Yap/Taz at high density (Fig. 3.9A). Real-time quantitative PCR revealed a concomitant increase in the expression of the universal Yap/Taz target genes, Ctgf and Cyr61, upon loss of βPix (Fig. 3.9B). However, loss of Cdc42 or Rac1, either singly or together, had no effect on Yap/Taz localization and activity, exhibiting a similar phenotype to that of siControl (Fig. 3.9A, B). Yap/Taz in siCdc42, siRacl, or siCdc42/Rac1 cells remained cytoplasmic at high cell density (Fig. 3.9A) and this is reflected in the expression of target genes, which showed no significant change compared to that of siControl (Fig. 3.9B). Altogether, these results demonstrate that βPix responds to cell-density-dependent activation of the Hippo pathway by sequestering Yap/Taz in the cytoplasm, while Cdc42 and Rac1 do not respond to cell density.

LatA disrupts the actin cytoskeleton and as previously reported, nuclear Yap/Taz re-distributed to the cytoplasm upon the treatment of LatA at low density in NMuMG cells. (Fig. 3.10). However, in LatA-treated cells in the absence of βPix, Yap/Taz cytoplasmic accumulation was significantly perturbed (Fig. 3.10) and the expression of Yap/Taz target genes, Ctgf and Cyr61, was enhanced concordantly (Heidary Arash et al. 2014). Similar effects of siβPix-mediated nuclear retention of Yap/Taz were observed for other actin disrupting compounds including Blebbistatin, an inhibitor of myosin-II-ATPase, and C3, an inhibitor of Rho GTPase (Heidary Arash et al. 2014). Also, LatA-treated EpH4 cells exhibited attenuation of cytoplasmic Yap/Taz sequestration in βPix-depleted state (Heidary Arash et al. 2014). Thus, the effect of abrogating the expression of Cdc42 and/or Rac1 was next examined in LatA-treated NMuMg cells. Loss of Cdc42 or Rac1, either singly or together, did not alter Yap/Taz localization compared to that of siControl (Fig. 3.10). Upon the treatment of LatA, siCdc42, siRacl, or siCdc42/Rac1 cells displayed cytoplasmic Yap/Taz localization, showing a similar phenotype to that of siControl (Fig. 3.10). Overall, these results show that βPix regulates Yap/Taz in response to LatA-induced actin cytoskeletal remodelling, while Cdc42 and Rac1do not respond to actin cytoskeletal remodelling.

All in all, in both conditions of high cell-cell contact and actin cytoskeleton disruption, loss of βPix promoted nuclear Yap/Taz retention and increased target gene expression as previously seen. Meanwhile, loss of Cdc42 or Rac1, either individually or together, had no effect on Yap/Taz localization and activity, demonstrating that βPix GEF activity is not the means through which βPix imposes a functional control on Yap/Taz.

3.4 βPix and core Hippo kinases

3.4.1 βPix and Lats kinases

3.4.1.1 βPix functions upstream of Lats kinases

The core Lats kinases constitute a crucial part in the Hippo pathway as Lats kinases induce phosphorylation of Yap/Taz, thereby driving Yap/Taz translocation to the cytoplasm (Halder & Johnson, 2011; Yu & Guan, 2013). Emad Heidary Arash sought to investigate Lats kinase activity in βPix-mediated regulation of Yap localization by examining the phosphorylation status of Yap on Ser127, the Lats target site that mediates cytoplasmic sequestration. Indeed, the level of phospho-Yap was reduced upon loss of βPix, demonstrating the requirement of βPix for efficient phosphorylation of Yap (Heidary Arash et al. 2014). To examine whether Lats kinase is required for βPix function, I analyzed βPix-mediated Yap/Taz localization in the absence of Lats kinases by immunofluorescence microscopy. As expected, depletion of Lats1/2 expression using siRNAs enhanced the nuclear accumulation of Yap/Taz (Fig. 3.11), as Yap is no longer phosphorylated by Lats and unphosphorylated Yap translocates to the nucleus. Importantly, loss of Lats1/2 expression prevented the cytoplasmic translocation of Yap/Taz mediated by overexpressed βPIX (Fig. 3.11), demonstrating the requirement of Lats kinases in βPix regulatory actions and that βPix functions upstream of Lats kinases to regulate Yap/Taz localization and activity.

3.4.1.2 βPix does not affect phosphorylation status of Lats kinases at Thr1079/1041

To visualize βPix-dependent Lats kinase activity on Yap, a specific antibody that recognizes the key phosphorylation sites, Thr1079 in Lats1 and Thr1041 in Lats2, was utilized in immunofluorescence microscopy. In mouse mammary epithelial cells, NMuMG and EpH4, Phospho-Lats (P-Lats) was shown to localize to cell periphery. The specificity of P-Lats antibody was confirmed using siLats1/2 transfected cells where it was observed that the P-Lats signal disappeared upon knockdown (Fig. 3.12, 3.13). To visualize the effect of βPix on Lats

Figure 3.11: βPix functions upstream of Lats kinases.

(A) βPix acts upstream of Lats1/2 kinases to regulate Yap/Taz activity. NMuMG cells were transfected with siControl or siLats1/2, and 24 h later with Flag-tagged βPIX. Transfected cells are indicated with white arrows. Localization of Flag-βPIX (Text Red) and Yap/Taz (FITC, green) were analyzed by immunofluorescence microscopy. Scale, 20 μm.

(B) A quantitation of a representative experiment showing Yap/Taz localization quantified from n > 20 cells per condition is plotted. Yap/Taz localization is categorized into three states as indicated.

Figure 3.12: Phosphorylated Lats1/2 kinases at Thr1079/1041 localize to cell periphery.

The specificity of antibody that recognizes phosphorylation sites of Thr1079/1041 on Lats1/2 kinases was tested. NMuMG cells were transfected with control siRNA or siRNA targeting Lats1 and Lats2 (siLats1/2). Phospho-Lats (P-Lats; FITC, green) on peripheral edge of the cells as well as actin filaments (phalloidin, Texas Red) and nucleus (DAPI, blue) were visualized by immunofluorescence confocal microscopy. Scale, 20 μm.

Figure 3.13: Knockdown of βPix does not affect the phosphorylation status at Thr1079/1041 on Lats1/2 kinases.

EpH4 or NMuMG cells were transfected with siControl, siβPix, or siLats1/2. P-Lats at Thr1079/1041 (FITC, green) and nucleus (DAPI, blue) were visualized by immunofluorescence confocal microscopy. Scale, 20 μm.

54 kinase activity, NMuMG or EpH4 cells were transfected with control siRNA, siRNA targeting βPix or Lats1/2 and the level of P-Lats was visualized by immunostaining. To visualize the effect of βPix on Lats kinase activity, NMuMG or EpH4 cells were transfected with control siRNA, siRNA targeting βPix or Lats1/2 and the level of P-Lats was visualized by immunostaining. However, no significant changes were observed upon βPix knockdown in either EpH4 or NMuMG cells (Fig. 3.13) as well as upon βPIX overexpression in NMuMG cells (Fig. 3.14). These observations were surprising as the level of P-Lats was expected to decrease with knockdown of βPix expression and conversely increase with overexpression of βPIX. This data could indicate that Thr1079/1041 phosphorylation may not be essential for activating Lats1/2 kinases in these mouse mammary cell lines.

3.4.2 βPix and Mst kinases

3.4.2.1 βPix does not interact with Mst kinases

Hippo signals flow through the core Mst/Lats kinase cassette to Yap/Taz. Mst kinases directly target and activate Lats kinases via phosphorylation, and we have shown that Lats and Yap interact with the multidomain-containing βPix (Heidary Arash et al. 2014). Thus, these findings raised the possibility that βPix may also bind Mst kinases, thus serving as a scaffold to bring all core components of the Hippo pathway together as to facilitate the signal transduction. To test whether Mst kinases interact with βPix, HEK293T cells transfected with Flag-tagged βPIX along with HA-tagged GIT1, as a positive control, or HA-tagged MST1 were subjected to anti-Flag immunoprecipitation and interaction assessed by anti-HA immunoblotting. While an interaction between βPix and Git1 were observed as expected (Flanders et al, 2003; Hoefen & Berk, 2006; Chahdi & Sorokin, 2008), no association was detected between βPix and Mst1 (Fig. 3.15). Thus, these results suggest that Mst kinases do not participate in a multimeric complex with βPix.

Figure 3.14: Overexpression of βPIX does not affect the phosphorylation status at Thr1079/1041 on Lats1/2 kinases.

NMuMG cells were transfected with Flag-tagged βPIX, which are indicated with white arrows. Localization of Flag-βPIX (FITC, green) and P-Lats at Thr1079/1041 (Cy5, yellow), actin filaments (phalloidin, Texas Red) and nucleus (DAPI, blue) were visualized by immunofluorescence confocal microscopy. Two individual sections of horizontal fields of view are shown. Scale, 17 μm.

Figure 3.15: βPix does not interact with Mst kinases.

HEK293T cells were co-transfected with Flag-tagged βPIX along with HA-GIT1 or HA-MST1. Cell lysates were subjected to α-Flag IP and the interactions were assessed by anti-HA immunoblotting. Expression of totals were confirmed by anti-Flag or anti-HA immunoblotting.

3.4.2.2 Increased expression of Mst by overexpressed βPIX

Interestingly, the total level of transfected MST1 was considerably higher in presence of βPIX (Fig. 3.15). The kinase dead versions of Mst kinases (MST 1/2 KR) also exhibited a similar behaviour with a substantial increase in levels in presence of βPIX, especially MST2KR which showed a more pronounced effect as compared to MST1KR (Fig. 3.16A). To test the physiological significance of the effect of βPix on Mst levels, the expression of βPix was abrogated using siRNAs and the level of endogenous Mst1/2 was monitored in NMuMG cells. On the day of lysis, cells were treated with the F-actin disrupting agent, LatA since we have demonstrated that βPix responds to actin cytoskeleton remodelling, which is one of the well- described upstream stimuli of the Hippo pathway. However, neither knockdown of βPix nor LatA treatment caused a significant change in endogenous Mst1/2 level (Fig. 3.16B). This suggests that Mst stabilization by βPix is unlikely to be physiologically relevant and that actin cytoskeleton disruption does not affect Mst levels. The βPix homolog, αPix, is not expressed in NMuMG cells, thus naturally, αPix knockdown had no effect on Mst level even with the treatment of LatA (Fig. 3.16B).

3.4.2.3 Mst kinases bypass the canonical Hippo pathway

To further explore the involvement of Mst in Yap/Taz regulatory function of βPix through Lats, the expression of Mst along with βPix or Lats was abolished in NMuMG cells and Yap/Taz localization was visualized by immunofluorescence microscopy. As expected, siβPix and siLats1/2 cells showed increased levels of nuclear Yap/Taz at low cell density as unphosphorylated Yap/Taz translocate to the nucleus (Fig. 3.17A). Remarkably, in siMst1/2 transfected cells, no change in nuclear Yap/Taz as compared to that of siControl was observed at low cell density (Fig. 3.17A). At high cell density, Hippo signalling becomes activated and thus, Yap/Taz cytoplasmic localization was observed in siControl cells, whereas Yap/Taz cytoplasmic localization was attenuated in siβPix and siLats1/2 cells (Fig. 3.17A). However, siMst1/2 cells exhibited an odd phenotype at high cell density. Specifically, the cells were abnormal such that some parts of cells remained sparse while in other sections, cells appeared to display a multi- layered phenotype. Nevertheless, in dense regions, cells exhibited nuclear exclusion of Yap/Taz similar to that of siControl at high cell density. These observations using immunofluorescence

Figure 3.16: Increased expression of Mst kinases by βPix is not physiologically relevant.

(A) HEK293T cells were co-transfected with Flag-tagged βPIX along with HA-MST1KR (kinase dead) or HA-MST2KR (kinase dead). Cell lysates were subjected to α-Flag IP and the expression of totals were confirmed by anti-HA immunoblotting.

(B) NMuMG cells were transfected with control siRNA or siRNA targeting αPix or βPix and subsequently treated with either DMSO or LatA. Endogenous levels of Mst1/2 were detected and knockdown of α/βPix were confirmed by immunoblotting. Gapdh immunoblotting shows even loading of lysates.

NMuMG

Figure 3.17: Mst kinases bypass the canonical Hippo pathway in NMuMG cells. (A, B) βPix or Lats1/2 knockdown promotes strong nuclear accumulation of Yap compared to that of Mst1/2 knockdown at low cell density. βPix or Lats1/2 knockdown promotes nuclear retention of Yap while upon Mst1/2 knockdown, Yap remains cytoplasmic at high cell density.

(A) NMuMG cells were transfected with control siRNA or siRNA targeting βPix, Lats1 and Lats2 (siLats1/2), Mst1 and Mst2 (siMst1/2). Yap/Taz (FITC, green) and nucleus (DAPI, blue) were visualized by immunofluorescence confocal microscopy. Scale, 20 μm.

(B) Relative expression of Yap/Taz target genes, Ankrd1, Ctgf and Cyr61, and the knockdown efficiency of βPix, Lats1 and Lats2, and Mst1 and Mst2 determined by qPCR are plotted as the mean ± the range.

(C) NMuMG cells were transfected with control siRNA or siRNA targeting Lats1 and Lats2 (siLats1/2), Mst1 and Mst2 (siMst1/2). Cells lysates were analyzed by immunoblotting using the indicated antibodies. Total levels of Lats1, Lats2, Mst1, Mst2 and Gapdh as loading controls were determined as indicated.

62 microscopy are reflected in quantitative real-time PCR analyses where the level of target gene expression, including Ankrd1, Ctgf, and Cyr61 did not change upon loss of Mst1/2 while these genes were substantially upregulated upon depletion of βPix or Lats1/2 (Fig. 3.17B). A parallel immunoblotting experiment confirmed knockdown of Lats1/2 and Mst1/2 protein (Fig. 3.17C). Thus, these results demonstrate that Mst is dispensible for control of Yap/Taz in NMuMG cells. A similar result of Mst-independent regulation of Yap/Taz was also observed in EpH4 cells, in which Mst knockdown had no effect on Yap/Taz target gene expression (Fig. 3.18A, B, C). Although knockdown was not as efficient and the change in target genes was modest, EpH4 cells exhibited a similar trend as in NMuMG cells. Hence, at least in mouse mammary epithelial NMuMG and EpH4 cells, Mst kinases are not essential for Hippo signalling. This notion raises two possibilities: Lats kinase is under the regulation of other unknown kinases or Lats kinase can receive upstream Hippo signalling in these particular cell lines.

3.5 βPix as a re-coupler of the Hippo signal in metastatic cancer cells

Tumour cells generally display constitutive nuclear Yap/Taz localization, which is associated with oncogenic properties, as tumour-suppressive Hippo pathway is dysfunctional in these transformed cells (Harvey et al, 2013). Since we identified βPix as a positive Hippo pathway regulator, this raised the possibility that βPix could restore Hippo signalling in cancer cells and thus may restrain the tumourigenic Yap/Taz-mediated transcriptional programme. Hence, the triple-negative breast cancer MDA-MB-231 cell, which exhibits nuclear Yap/Taz at sparse density, was utilized to generate βPIX overexpressing stable clones using a vector in which Flag- tagged βPIX was subcloned into pBABE-puro vector (Fig. 3.19A). Analysis of YAP/TAZ localization showed cytoplasmic accumulation of YAP/TAZ in two independently-derived βPIX overexpressing clones as compared to control clones that displayed nuclear localization of YAP/TAZ (Fig. 3.19B). A concomitant decrease in YAP/TAZ target gene expression was also observed in βPIX overexpressing stable clones (Heidary Arash et al. 2014). Thus, these results demonstrate that ectopic expression of βPIX alone is sufficient to inhibit nuclear YAP/TAZ localization and transcriptional activity in this breast cancer cell line. Of note, LATS is still

EpH4

Figure 3.18: Mst kinases bypass the canonical Hippo pathway in EpH4 cells.

(A) EpH4 cells were transfected with control siRNA or siRNA targeting βPix, Lats1 and Lats2 (siLats1/2), Mst1 and Mst2 (siMst1/2). Yap/Taz (FITC, green) and nucleus (DAPI, blue) were visualized by immunofluorescence confocal microscopy. Scale, 20 μm.

(C) EpH4 cells were transfected with control siRNA or siRNA targeting βPix, Lats1 and Lats2 (siLats1/2), Mst1 and Mst2 (siMst1/2). Cells lysates were analyzed by immunoblotting using the indicated antibodies. Total levels of Lats1, Lats2, Mst1, Mst2 and Gapdh as loading controls were determined as indicated.

Figure 3.19: LATS1/2 kinases are required for βPIX-mediated YAP/TAZ inactivation in MDA- MB-231 cells.

(A) Flag-tagged βPIX was subcloned into pBABE-puro vector and empty vector was used as a control (https://www.addgene.org).

(B) MDA-MB-231 cells stably expressing control vector or βPIX were transfected with control siRNA or siRNA targeting LATS1/2, and YAP/TAZ localization (FITC, green) was analyzed by immunofluorescence confocal microscopy. Scale, 25 μm.

(C) Expression level of YAP target gene ANKRD1 was determined by qPCR and is plotted as the relative expression in siLATS1/2 over siControl (CTL).

68 active in MDA-MB-231 cells as loss of LATS1/2 expression led to more pronounced nuclear accumulation of YAP/TAZ (Fig. 3.19C) and an increase in target gene expression (Fig. 3.19D). This means that although signals from upstream stimuli are disconnected from the core Hippo pathway, LATS1/2 are still present and are able to limit YAP/TAZ activity to some extent. Abolishing LATS1/2 expression in βPIX stable clones overcame the effects of βPIX and resulted in strong nuclear localization of YAP/TAZ (Fig. 3.19C) and a corresponding increase in the expression of the target gene ANKRD1 (Fig. 3.19D). This emphasizes the requirement for LATS for βPIX function on YAP/TAZ in MDA-MB-231 cells. In sum, the collective data illustrate that enhanced expression of βPIX can re-connect LATS1/2 to YAP/TAZ and that βPIX thereby serves as a potential tumor suppressor that may restrict pro-tumourigenic Yap/Taz activation in metastatic breast cancer cells.

Chapter 4 Discussions and the future directions

The Hippo signalling pathway governs vital cellular processes such as tissue growth and cell fate, and inactivation of the pathway contributes to tumour formation and associated oncogenic features including unrestrained cell proliferation, migration and EMT (Halder & Johnson, 2011; Ramos & Camargo, 2012; Harvey et al. 2013; Yu & Guan, 2013). The core Hippo kinases, Mst and Lats, lie at the centre of the pathway through which the key downstream effectors Yap/Taz are modulated. To date, multiple upstream components have been uncovered as pathway activators including apical–basal polarity complexes, mechanical cues stemming from actin cytoskeleton dynamics, and signals emanating from G protein-coupled receptors (Genevet & Tapon, 2011; Boggiano & Fehon, 2012; Schroeder & Halder, 2012). However, mechanistic details how these upstream signals are integrated and relayed to the core kinase cassette remain elusive. In an effort to gain better understanding of the Hippo pathway, we identified βPix as a key positive regulator of the core Hippo kinases.

As a novel component of the Hippo pathway, βPix was shown to regulate Yap/Taz localization and activity in response to well-characterized upstream Hippo stimuli including cell-cell contact and actin cytoskeleton remodelling. βPix functions to sequester Yap/Taz in the cytoplasm as loss of βPix expression resulted in retention of Yap/Taz in the nucleus and prolonged activation of a Yap/Taz transcriptional programme in both conditions of high cell density and actin cytoskeleton disruption. In general, these upstream signals are ultimately transmitted to the core Mst/Lats kinase cassette whereby Yap/Taz are regulated. Surprisingly, the seemingly conserved Mst/Lats kinase cascade does not appear to be essential in mouse mammary epithelial cell lines as depletion of both Mst1 and Mst2 expression did not alter the expression of Yap/Taz target genes, consistent with the previous reports of Mst1/2-independent Yap phosphorylation (Yu et al. 2012, 2013; Zhao et al. 2012; Kim et al. 2013). Naturally, Lats kinases were the prime targets of investigation during the course of the project in efforts to delineate the mechanism of βPix- mediated regulation of Yap/Taz.

Due to the collaborative nature of the project, accompanying data produced by a PhD student, Emad Heidary Arash, in our lab offered important evidence along with my data, both of which synergistically directed to us towards the working model of βPix-mediated regulation in the Hippo pathway. He demonstrated that Lats kinases bind βPix in the KER (Heidary Arash et al. 2014), the same region where I showed that Yap interacts with βPix. Of note, the analysis of subcellular localization of endogenous and overexpressed βPix revealed that βPix acts in the cytoplasm and that the LZ domain, which mediates βPix dimerization, is also essential in keeping βPix in the cytoplasm (Kim et al. 2001). Domain mapping experiments showed, however, opposing binding patterns for the LZ deletion mutant (βPIX 1–585), which localized to the nucleus upon transfection; the LZ deletion mutant lost interaction with cytoplasmically localized LATS1 (Heidary Arash et al. 2014) while retained interaction with nuclear-localized YAP. Thus, one can anticipate that the interaction may arise due to the same compartmentalization between the two proteins. Nevertheless, it may not be the case for Lats- βPix interaction since overexpression of the βPIX construct lacking KER domain (∆KER, amino acids 496–555) restored the wild-type-like cytoplasmic localization, but still failed to interact with cytoplasmically localized LATS1 (Heidary Arash et al. 2014). These findings suggest that neither the LZ or βPix dimerization is required for Yap interaction contrary to the necessity of the LZ in Lats interaction with βPix.

The highly conserved KER region resides just upstream of the carboxy-terminal end of βPix and harbours abundant charged residues such Lys and Glu. Although this region does not contain standard protein-protein interaction motifs, several proteins such as Git1 have been shown to interact with this stretch of amino acids (Hoefen & Berk, 2006; Rosenberger & Kutsche, 2006; Staruschenko & Sorokin, 2012). Nonetheless, interaction mapping data designated the KER in βPix as essential binding sites for both Yap and Lats. The KER region in βPix that mediates interaction with Yap and Lats also turns out to be crucial in a functional perspective. Similar to transiently overexpressed wild-type βPIX, the βPIX mutant lacking the KER was localized in the cytoplasm, but failed to reproduce the wild-type like behaviour of inducing Yap/Taz cytoplasmic sequestration (Heidary Arash et al. 2014). Also, the LZ mutant, already localized in the nucleus, was unable to drive cytoplasmic translocation of Yap/Taz (Heidary Arash et al. 2014). Thus, these results indicate that the interaction of βPix with both Yap and Lats is necessary for the regulation of Yap/Taz localization.

Although the corresponding KER region of the homolog αPix similarly mediates interaction with Yap/Taz and Lats, the role of αPix was not applicable in our cell models as αPix is not expressed in mouse mammary epithelial cells. This is consistent with more ubiquitous expression patterns for βPix, as compared to αPix, which is expressed primarily in hematopoetic cells and muscle (Manser et al. 1998; Rosenberger & Kutsche, 2006; Staruschenko & Sorokin, 2012). Hence, more work will be needed to address the role of αPix in the Hippo signalling of αPix-expressing cells or appropriate biological models.

βPix and the closely related αPix function as guanine nucleotide exchange factors (GEFs) towards the RhoGTPases, Cdc42 and Rac1 (Rosenberger & Kutsche, 2006; Staruschenko & Sorokin, 2012). Notably, GEF activity of βPix is found to be dispensable for its function in the Hippo pathway as loss of Cdc42, Rac1 or both had no effect on Yap/Taz localization or transcription of target genes. Indeed, the GEF mutant of βPIX, in which GEF activity is disrupted via double point mutations in the DH domain (Manser et al. 1998), still functioned to promote Yap/Taz sequestration in the cytoplasm, similar to the phenotype induced by the wild- type βPIX. Pix, or Pak-interacting exchanger, also exhibits GEF activity towards Pak (Chan & Manser, 2012). Although, the impact of Pak activity on βPix-mediated Hippo regulation was not directly tested, overexpression of βPIX construct lacking the SH3 domain, through which Pak1 interacts with βPix, still elicited Yap/Taz translocation to the cytoplasm, similar to the phenotype induced by the transfected wild-type βPIX. Collectively, these results show that the putative function of βPix GEF activity towards Cdc42/Rac1 and Pak1 is not the means through which βPix regulates the Hippo pathway activity, advocating the alternative mechanism of βPix function.

A dual binding of Yap and Lats with the multidomain containing βPix as well as GEF- independent mechanism of βPix suggests the idea of scaffolding by βPix that assembles Lats and Yap in close proximity. Several experimental results generated by a PhD student support the concept of βPix scaffolding as it was observed that overexpression of WT βPIX, but not the βPIX KER mutant, enhanced the interaction of LATS1 with YAP (Heidary Arash et al. 2014). In line with this proposed model, abolishing the expression of βPix using either a pool or a single siRNA substantially reduced the interaction of endogenous Yap with Lats1, resulting in decreased Yap/Taz phosphorylation in EpH4 cells (Heidary Arash et al. 2014). As βPix is commonly found as either dimeric, or even trimeric state in vivo (Schlenker & Rittinger, 2009),

72 our findings reinforce the notion that βPix can act as a scaffold that simultaneously recruits both Yap and Lats into a multimeric complex, thereby facilitating Yap phosphorylation. βPix is capable of binding a multitude of proteins such as 14-3-3 proteins, p66Shc, Scribble, Cbl and Git1, some of which form large macromolecular complexes that carry out various cellular processes such as focal adhesion formation, cell migration and G protein-coupled receptor signalling (Flanders et al. 2003; Hoefen & Berk, 2006; Chahdi & Sorokin, 2008). Therefore, it will be interesting to see whether any of the aforementioned βPix-interacting proteins engage in the formation of the Hippo regulatory complex.

In cancer cells, the Hippo signalling is dysfunctional and Yap/Taz are constitutively localized in the nucleus where oncogenic transcriptional programmes are upregulated without constraint (Harvey et al. 2013). Particularly in human breast cancer cells, overexpression of YAP and TAZ promotes various pro-tumourgenic processes such as proliferation, migration, invasion, EMT, acquisition of cancer stem cell (CSC) properties and sustainment of CSC self-renewal (Chan et al. 2008; Lei et al.2008; Zhao et al. 2008; Cordenonsi et al. 2011; Lamar et al. 2012; Harvey et al. 2013; Hiemer et al. 2014). We observed that MDA-MB-231 clones overexpressing βPIX displayed a decreased rate of cell proliferation as well as cell migration (Heidary Arash et al. 2014). Hence, expression of βPIX can enhance the cytoplasmic localization of YAP/TAZ and promote tumour suppressive activity. Remarkably, it was also observed that ectopic expression of βPIX alone in MDA-MB-231 cells was sufficient to constrain nuclear localization and activity of YAP/TAZ and this was dependent on LATS. Thus, these findings advocate βPix as a potential tumour suppressor that acts by re-coupling the core kinase cassette to Yap/Taz, thereby restoring lost Hippo signals in metastatic breast cancer cells.

Mechanistically, cumulative data favour the role of βPix as a scaffolding protein that binds both Lats and its Yap/Taz substrates, thereby stimulating phosphorylation and promoting cytoplasmic localization of Yap/Taz in a GEF-independent manner (Fig. 4.1). All in all, we demonstrate the requirement of Lats kinases for βPix regulatory function of Yap/Taz activity, while negating the involvement of Mst kinases. Multiple lines of evidence support this exclusion of Mst kinases in βPix-mediated control of the Hippo signalling or even in the Hippo pathway itself. βPix does not bind Mst, thus not participating in the congregated assemblies of Yap, Lats and βPix. Also, abolishing Mst1/2 expression in NMuMG or EpH4 cells had no effect on the Hippo target genes.

Figure 4.1: Model of the regulatory mechanism of βPix in the Hippo pathway.

In response to upstream Hippo signals such as high cell density and actin cytoskeleton remodelling, a dimeric βPix functions as a scaffolding protein that assembles both Lats and Yap together, thereby facilitating phosphorylation of Yap/Taz by Lats and resulting in cytoplasmic sequestration of Yap/Taz. GEF activity on the substrates of βPix, Cdc42 and Rac1, does not participate in βPix-mediated regulation of the Hippo pathway.

In addition, circumvention of Mst can be inferred from the phosphorylation status of Yap and Lats. While βPix induces efficient phosphorylation of Yap on Ser127, the Lats target site that elicits cytoplasmic sequestration of Yap, no phosphorylation change was observed in Lats1/2 on Thr1079/Thr1041 in the context of βPix. Lats1/2 contain the two conserved key regulatory phosphorylation sites, Ser909/872 located on the activation segment and Thr1079/Thr1041 situated on the hydrophobic motif (Hergovich, 2013). These phosphorylation events are thought to be regulated through Mob1a/b-mediated autophosphorylation on Ser909/872 and Mst1/2 activation on Thr1079/1041 (Hergovich, 2013). The phosphorylation status of Thr1079/1041, the Mst target site of Lats activation, did not change upon overexpression or knockdown of βPix, emphasizing that Mst kinases are not essential in the Hippo signalling of mouse mammary NMuMG and EpH4 cells. Thus, additional upstream kinases that activate Lats may be present, consistent with previous studies that Mst kinases are dispensable for Lats phosphorylation and activation in selected cell types and biological systems.

The prevailing view has been that the Mst/Lats kinase cassette at the core Hippo pathway is required to regulate Yap/Taz phosphorylation and activity. Yet, the specific requirement of individual pathway components needs to be tested in different cell lines. Indeed, I have demonstrated that the involvement of Mst kinases in Hippo signalling is not universal with regards to mammalian cell lines. This variance also seems to apply to the regulatory aspect of the core Hippo pathway components. Around the time of publication of our βPix paper, a concurrent study also claimed the importance of βPix in the Drosophila Hippo pathway. Harvey’s group reported that βPix acts in partnership with Git to restrict Hippo-dependent tissue growth in Drosophila and that βPix/Git complex acts as a scaffold to promote Hpo dimerization and autophosphorylation (Dent et al. 2015). Similar to our model, βPix was identified as a novel protein that functions as a scaffold to regulate the Hippo pathway. However, βPix was shown to act at different levels of the core Hippo kinases in different species; βPix acts through Hpo (Mst ortholog) in Drosophila while we have shown that βPix goes through Lats (Wts ortholog) in mouse mammary epithelial cells. This observation is very striking considering the conservative nature of the Hippo pathway between Drosophila and mammals. Whether the regulation of βPix through Lats kinases is prevalent in other mammalian cells needs to be further validated.

Several approaches can be taken to refine the current regulatory model of βPix. To further complement the observation that Mst kinases do not participate in the activation of Lats kinases

75 in NMuMG cells, autophosphorylation site of Mst1/2 kinases at Thr183/Thr180 will be tested by immunoblotting (Praskova et al. 2004). The status of autophosphorylation site in Mst kinases is indicative of Mst kinase activity, thus the level of phosphorylation will be monitored in the absence of Lats kinases and βPix. Also, the same experimental approaches can be taken to investigate whether other mammalian cells exhibit a similar pattern of Mst circumvention in Lats activation of the Hippo pathway.

The role of βPix has been demonstrated as a novel Hippo pathway regulator that responds to cell- cell contact and actin cytoskeletal rearrangements, both of which are known upstream regulators of the Hippo pathway. Thus, it will be interesting to see if βPix also responds to GPCR signalling, one of the other upstream Hippo determinants. In MDA-MB-231 breast cancer cells, stimulation with epinephrine resulted in a dose-dependent phosphorylation of Yap and the cAMP-responsive element-binding protein (CREB) (Yu et al. 2012). Also, the treatment of forskolin, which is an activator of adenylyl cyclase that results in cAMP production, effectively increased Yap phosphorylation (Yu et al. 2012), indicating that Gs-coupled GPCR can induce Yap phosphorylation mainly via cAMP and PKA. Therefore, GPCR agonists, epinephrine and forskolin, can be utilized to investigate the function of βPix in the Hippo pathway upon activation by GPCR signalling. If βPix were to indeed respond to GPCR signalling, Yap phosphorylation mediated by epinephrine or forskolin will be reduced upon knockdown of βPix.

In addition, the role of βPix can be further explored in the context of mechanotrasduction, other than actin cytoskeleton remodelling, such as cell geometry, stiffness of the extracellular matrix and cell attachment/detachment. These aforementioned factors regulate Yap/Taz localization and it has been documented that βPix-Pak complex localizes to focal adhesions where focal protein complexes link the extracellular matrix to the actin cytoskeleton via heterodimeric transmembrane receptors, the integrins (Schoenwaelder & Burridge, 1999). Thus, βPix expression will be abrogated to uncover the relationship between the various cellular mechanical forces and βPix-mediated localization of Yap/Taz

Moreover, domain mapping between βPix and Taz can be carried out to see whether similar binding patterns are observed to that of βPix-Yap interaction and functional consequences on Taz by βPix can be explored in the context of Hippo pathway regulation.

References

Adler JJ, Johnson DE, Heller BL, Bringman LR, Ranahan WP, Conwell MD, Sun Y, Hudmon A, Wells CD. (2013). Serum deprivation inhibits the transcriptional co-activator YAP and cell growth via phosphorylation of the 130-kDa isoform of Angiomotin by the LATS1/2 protein kinases. PNAS 110:17368-17373.

Alarcon C, Zaromytidou AI, Xi Q, Gao S, Yu J, Fujisawa S, Barlas A, Miller AN, Manova- Todorova K, Macias MJ, et al. (2009). Nuclear CDKs drive Smad transcriptional activation and turnover in BMP and TGF-beta pathways. Cell 139: 757–769.

Aragona M, Panciera T, Manfrin A, Giulitti S, Michielin F, Elvassore N, Dupont S, Piccolo S (2013). A mechanical checkpoint controls multicellular growth through YAP/TAZ regulation by actin-processing factors. Cell 154:1-13.

Audebert, S., Navarro, C., Nourry, C., Chasserot-Golaz, S., Lecine, P., Bellaiche, Y., Dupont, J.L., Premont, R.T., Sempere, C., Strub, J.M., et al. (2004). Mammalian Scribble forms a tight complex with the betaPIX exchange factor. Curr. Biol. 14: 987–995.

Badouel C, Gardano L, Amin N, Garg A, Rosenfeld R, Le Bihan T, McNeill H. (2009). The FERM-domain protein Expanded regulates Hippo pathway activity via direct interactions with the transcriptional activator Yorkie. Dev Cell 16: 411–420.

Bagrodia, S., Taylor, S.J., Jordon, K.A., Van Aelst, L., Cerione, R.A. (1998). A novel regulator of p21-activated kinases. J. Biol. Chem. 273, 23633–23636.

Baird, D., Feng, Q., Cerione, R.A. (2005). The Cool-2/alpha-Pix protein mediates a Cdc42-Rac signaling cascade. Curr. Biol. 15, 1–10.

Bernards, A., Settleman, J. (2004). GAP control: regulating the regulators of small GTPases. Trends Cell Biol. 14, 377–385.

Boggiano JC, Vanderzalm PJ, Fehon RG. (2011). Tao-1 phosphorylates Hippo/MST kinases to regulate the Hippo-Salvador-Warts tumor suppressor pathway. Dev Cell 21: 888–895.

Bretscher A, Edwards K, Fehon RG. (2002). ERM proteins and merlin: Integrators at the cell cortex. Nat Rev Mol Cell Biol 3: 586–599.

Bryant DM, Mostov KE. (2008). From cells to organs: building polarized tissue. Nat. Rev. Mol. Cell Biol. 9: 887-901.

Cai J, Zhang N, Zheng Y, de Wilde RF, Maitra A, Pan D. (2010). The Hippo signaling pathway restricts the oncogenic potential of an intestinal regeneration program. Genes Dev 24:2383–2388.

Callus BA, Verhagen AM, Vaux DL. (2006). Association of mammalian sterile twenty kinases, Mst1 and Mst2, with hSalvador via C-terminal coiled-coil domains, leads to its stabilization and phosphorylation. FEBS J 273: 4264–4276.

Camargo FD, Gokhale S, Johnnidis JB, Fu D, Bell GW, Jaenisch R, Brummelkamp TR. (2007). YAP1 increases organ size and expands undifferentiated progenitor cells. Curr Biol 17: 2054– 2060.

Chahdi, A. & Sorokin, A. (2008). Protein kinase A-dependent phosphorylation modulates beta1Pix guanine nucleotide exchange factor activity through 14-3-3beta binding. Mol. Cell. Biol. 28, 1679–1687.

Chakraborty S, Khare S, Dorairaj SK, Prabhakaran VC, Prakash DR, Kumar A. (2007). Identification of genes associated with tumorigenesis of retinoblastoma by microarray analysis. Genomics 90: 344–353.

Chan EH, Nousiainen M, Chalamalasetty RB, Schafer A, Nigg EA, Sillje HH. (2005). The Ste20-like kinase Mst2 activates the human large tumor suppressor kinase Lats1. Oncogene 24: 2076–2086.

Chan SW, Lim CJ, Guo K, Ng CP, Lee I, Hunziker W, Zeng Q, Hong W. (2008). A role for TAZ in migration, invasion, and tumorigenesis of breast cancer cells. Cancer Res 68: 2592–2598.

Chan SW, Lim CJ, Chong YF, Pobbati AV, Huang C, Hong W. (2011). Hippo pathway- independent restriction of TAZ and YAP by angiomotin. J Biol Chem 286: 7018–7026.

Chen CL, Gajewski KM, Hamaratoglu F, Bossuyt W, Sansores-Garcia L, Tao C, Halder G. (2010). The apical–basal cell polarity determinant Crumbs regulates Hippo signaling in Drosophila. Proc Natl Acad Sci 107: 15810–15815.

Chen L, Chan SW, Zhang X, Walsh M, Lim CJ, Hong W, Song H. (2010). Structural basis of YAP recognition by TEAD4 in the hippo pathway. Genes Dev 24: 290–300.

Cho E, Irvine KD. (2004). Action of fat, four-jointed, dachsous and dachs in distal-to-proximal wing signaling. Development 131: 4489–4500.

Claing A, Perry SJ, Achiriloaie M, Walker JK, Albanesi JP, Lefkowitz RJ, et al. (2000). Multiple endocytic pathways of G protein-coupled receptors delineated by GIT1 sensitivity. Proc Natl Acad Sci USA 97:1119–24.

Clark K, Langeslag M, Figdor CG, van Leeuwen FN. (2007). Myosin II and mechanotransduction: A balancing act. Trends Cell Biol 17: 178–186.

Cordenonsi M, Zanconato F, Azzolin L, Forcato M, Rosato A, Frasson C, Inui M, Montagner M, Parenti AR, Poletti A, et al. (2011). The Hippo transducer TAZ confers cancer stem cell-related traits on breast cancer cells. Cell 147: 759–772.

Cui CB, Cooper LF, Yang X, Karsenty G, Aukhil I. (2003). Transcriptional coactivation of bone- specific transcription factor Cbfa1 by TAZ. Mol. Cell Biol 23: 1004-1013.

Das Thakur M, Feng Y, Jagannathan R, Seppa MJ, Skeath JB, Longmore GD. (2010). Ajuba LIM proteins are negative regulators of the Hippo signaling pathway. Curr Biol 20: 657–662.

Densham RM, O’Neill E, Munro J, Konig I, Anderson K, Kolch W, Olson MF. (2009). MST kinases monitor actin cytoskeletal integrity and signal via c-Jun N-terminal kinase stress- activated kinase to regulate p21Waf1/Cip1 stability. Mol Cell Biol 29: 6380–6390.

Dent L, Poon C, Zhang X, Degoutin J, Tipping M, Veraksa A, Harvey K. (2015). The GTPase Regulatory Proteins Pix and Git Control Tissue Growth via the Hippo Pathway. Curr Bio 25: 124-130.

Drees F, Pokutta S, Yamada S, Nelson WJ, Weis WI. (2005). α-Catenin is a molecular switch that binds E-cadherin–β-catenin and regulates actin-filament assembly. Cell 123: 903–915.

Dupont S, Morsut L, Aragona M, Enzo E, Giulitti S, Cordenonsi M, Zanconato F, Le Digabel J, Forcato M, Bicciato S, et al. (2011). Role of YAP/TAZ in mechanotransduction. Nature 474: 179–183.

Espanel X, Sudol M. (2001). Yes-associated protein and p53-binding protein-2 interact through their WW and SH3 domains. J Biol Chem 276: 14514–14523.

Feng, Q., Albeck, J.G., Cerione, R.A., Yang, W. (2002). Regulation of the Cool/Pix proteins: key binding partners of the Cdc42/Rac targets, the p21-activated kinases. J. Biol. Chem. 277, 5644– 5650.

Feng, Q., Baird, D., Cerione, R.A. (2004). Novel regulatory mechanisms for the Dbl family guanine nucleotide exchange factor Cool-2/alpha-Pix. EMBO J. 23, 3492–3504.

Feng X, Degese MS, Iglesias-Bartolome R, Vaque JP, Molinolo AA, Rodrigues M, Zaidi MR, Ksander BR, Merlino G, Sodhi A et al. (2014). Hippo-independent activation of YAP by the GNAQ uveal melanoma oncogene through a Trio-regulated Rho GTPase signaling circuitry. Cancer Cell 25:831-845.

Feng Y, Irvine KD. (2007). Fat and expanded act in parallel to regulate growth through warts. Proc Natl Acad Sci 104: 20362–20367.

Fernandez LA, Northcott PA, Dalton J, Fraga C, Ellison D, Angers S, Taylor MD, Kenney AM. (2009). YAP1 is amplified and up-regulated in hedgehog-associated medulloblastomas and mediates Sonic hedgehog-driven neural precursor proliferation. Genes Dev 23: 2729–2741.

Fernandez BG, Gaspar P, Bras-Pereira C, Jezowska B, Rebelo SR, Janody F. (2011). Actin- capping protein and the Hippo pathway regulate F-actin and tissue growth in Drosophila. Development 138: 2337–2346.

Ferrigno O, Lallemand F, Verrecchia F, L’Hoste S, Camonis J, Atfi A, Mauviel A. (2002). Yes- associated protein (YAP65) interacts with Smad7 and potentiates its inhibitory activity against TGF-β/Smad signaling. Oncogene 21: 4879-4884.

Flanders JA, Feng Q, Bagrodia S, Laux MT, Singavarapu A, Cerione RA. (2003). The Cbl proteins are binding partners for the Cool/Pix family of p21-activated kinase-binding proteins. FEBS Lett 550: 119 – 123.

Genevet A, Wehr MC, Brain R, Thompson BJ, Tapon N. (2010). Kibra is a regulator of the Salvador/Warts/Hippo signaling network. Dev Cell 18: 300–308.

Genevet, A., and Tapon, N. (2011). The Hippo pathway and apico-basal cell polarity. Biochem. J. 436: 213–224.

Gladden AB, Hebert AM, Schneeberger EE, McClatchey AI. (2010). The NF2 tumor suppressor, Merlin, regulates epidermal development through the establishment of a junctional polarity complex. Dev Cell 19: 727–739.

Grusche, F.A., Richardson, H.E., and Harvey, K.F. (2010). Upstream regulation of the hippo size control pathway. Curr. Biol. 20: R574–R582.

Guo C, Tommasi S, Liu L, Yee JK, Dammann R, Pfeifer GP. (2007). RASSF1A is part of a complex similar to the Drosophila Hippo/Salvador/Lats tumor-suppressor network. Curr Biol 17: 700-705.

Habbig S, Bartram MP, Muller RU, Schwarz R, Andriopoulos N, Chen S, Sagmuller JG, Hoehne M, Burst V, Liebau MC, et al. (2011). NPHP4, a cilia-associated protein, negatively regulates the Hippo pathway. J Cell Biol 193: 633–642.

Hamaratoglu F, Willecke M, Kango-Singh M, Nolo R, Hyun E, Tao C, Jafar-Nejad H, Halder G. (2006). The tumour-suppressor genes NF2/Merlin and Expanded act through Hippo signalling to regulate cell proliferation and apoptosis. Nat Cell Biol 8: 27–36.

Hao Y, Chun A, Cheung K, Rashidi B, Yang X. (2008). Tumor suppressor LATS1 is a negative regulator of oncogene YAP. J Biol Chem 283: 5496–5509.

Harvey KF, Pfleger CM, Hariharan IK. (2003). The Drosophila Mst ortholog, hippo, restricts growth and cell proliferation and promotes apoptosis. Cell 114: 457–467.

Heallen T, Zhang M, Wang J, Bonilla-Claudio M, Klysik E, Johnson RL, Martin JF. (2011). Hippo pathway inhibits Wnt signaling to restrain cardiomyocyte proliferation and heart size. Science 332: 458–461.

Heidary Arash E, Song KM, Song S, Shiban A, Attisano L. (2014). Arhgef7 promotes activation of the Hippo pathway core kinase Lats. EMBO J. pii: e201490230.

Hergovich A. (2013). Regulation and functions of mammalian LATS/NDR kinases: looking beyond canonical Hippo signalling. Cell & Bioscience 3: 32.

Hisaoka M, Tanaka A, Hashimoto H. (2002). Molecular alterations of h-warts/LATS1 tumor suppressor in human soft tissue sarcoma. Lab Invest 82: 1427–1435.

Ho KC, Zhou Z, She YM, Chun A, Cyr TD, Yang X. (2011). Itch E3 ubiquitin ligase regulates large tumor suppressor 1 stability. Proc Natl Acad Sci 108: 4870–4875.

Hoefen RJ, Berk BC. (2006). The multifunctional GIT family of proteins. J Cell Sci 119: 1469 – 1475

Hong JH, Hwang ES, McManus MT, Amsterdam A, Tian Y, Kalmukova R, Mueller E, Benjamin T, Spiegelman BM, Sharp PA, et al. (2005). TAZ, a transcriptional modulator of mesenchymal stem cell differentiation. Science 309: 1074-1078.

Hong W, Guan KL. (2012). The YAP and TAZ transcription co-activators: Key downstream effectors of the mammalian Hippo pathway. Sem Cell&Dev Bio 23: 785-793.

Hossain Z, Ali SM, Ko HL, Xu J, Ng CP, Guo K et al. (2007). Glomerulocystic kidney disease in mice with a targeted inactivation of Wwtr1. Proc Natl Acad Sci USA 104: 1631–1636.

Hotchin, N.A., Hall, A., (1995). The assembly of integrin adhesion complexes requires both extracellular matrix and intracellular rho/rac GTPases. J. Cell Biol. 131: 1857–1865.

Hua KT, Tan CT, Johansson G, Lee JM, Yang PW, Lu HY, Chen CK, Su JL, Chen PB, Wu YL, Chi CC, Kao HJ, Shih HJ, Chen MW, Chien MH, Chen PS, Lee WJ, Cheng TY, Rosenberger G, Chai CY et al. (2011). N-alpha-acetyltransferase 10 protein suppresses cancer cell metastasis by binding PIX proteins and inhibiting Cdc42/Rac1 activity. Cancer Cell 19: 218 – 231.

Huang J, Wu S, Barrera J, Matthews K, Pan D. (2005). The Hippo signaling pathway coordinately regulates cell proliferation and apoptosis by inactivating Yorkie, the Drosophila homolog of YAP. Cell 122: 421–434.

Huang JM, Nagatomo I, Suzuki E, Mizuno T, Kumagai T, Berezov A, Zhang H, Karlan B, Greene MI, Wang Q. (2012). YAP modifies cancer cell sensitivity to EGFR and surviving inhibitors and is negatively regulated by the non-receptor type protein tyrosine phosphatase 14. Oncogene doi: 10.1038/onc.2012.231.

Ikeda M, Kawata A, Nishikawa M, Tateishi Y, Yamaguchi M, Nakagawa K, Hirabayashi S, Bao Y, Hidaka S, Hirata Y, et al. (2009). Hippo pathway-dependent and -independent roles of RASSF6. Sci Signal 2: ra59.

Ishikawa HO, Takeuchi H, Haltiwanger RS, Irvine KD. (2008). Four-jointed is a Golgi kinase that phosphorylates a subset of cadherin domains. Science 321: 401–404.

Jaffe AB, Hall A. (2005). Rho GTPases: Biochemistry and biology. Annu Rev Cell Dev Biol 21: 247–269.

Jezowska B, Fernandez BG, Amandio AR, Duarte P, Mendes C, Bras-Pereira C, Janody F. (2011). A dual function of Drosophila capping protein on DE-cadherin maintains epithelial integrity and prevents JNK-mediated apoptosis. Dev Biol 360:143-159.

Jia J, Zhang W, Wang B, Trinko R, Jiang J. (2003). The Drosophila Ste20 family kinase dMST functions as a tumor suppressor by restricting cell proliferation and promoting apoptosis. Genes Dev 17: 2514–2519.

Jimenez-Velasco A, Roman-Gomez J, Agirre X, Barrios M, Navarro G, Vazquez I, Prosper F, Torres A, Heiniger A. (2005). Downregulation of the large tumor suppressor 2 (LATS2/KPM) gene is associated with poor prognosis in acute lymphoblastic leukemia. Leukemia 19: 2347- 2350.

Jin H, Sperka T, Herrlich P, Morrison H. (2006). Tumorigenic transformation by CPI-17 through inhibition of a merlin phosphatase. Nature 442:576-579.

Jonasson F, Hardarson S, Olafsson BM, Klintworth GK. (2007). Sveinsson chorioretinal atrophy/helicoid peripapillary chorioretinal degeneration: First histopathology report. Ophthalmology 114: 1541–1546.

Judson RN, Tremblay AM, Knopp P, White RB, Urcia R, Bari CD, Zammit PS, Camargo FD, Wackerhage H. 2012. The Hippo pathway member Yap plays a key role in influencing fate decisions in muscle satellite cells. J Cell Sci doi: 10.1242/jcs.109546.

Karpowicz P, Perez J, Perrimon N. (2010). The Hippo tumor suppressor pathway regulates intestinal stem cell regeneration. Development 137: 4135–4145.

Khokhlatchev A, Rabizadeh S, Xavier R, Nedwidek M, Chen T, Zhang XF, Seed B, Avruch J. (2002). Identification of a novel Ras-regulated proapoptotic pathway. Curr Biol 12: 253–265.Lai ZC,Wei X, Shimizu T, Ramos E, Rohrbaugh M, Nikolaidis N, Ho LL, Li Y. (2005). Control of cell proliferation and apoptosis by mob as tumor suppressor, mats. Cell 120: 675–685.

Kim, S., Kim, T., Lee, D., Park, S.H., Kim, H., Park, D. (2000). Molecular cloning of neuronally expressed mouse betaPix isoforms. Biochem. Biophys. Res. Commun. 272, 721–725.

Kim, T., Park, D. (2001). Molecular cloning and characterization of a novel mouse betaPix isoform. Mol. Cells 11, 89–94.

Kim, S., Lee, S.H., Park, D. (2001). Leucine zipper-mediated homodimerization of the p21- activated kinase-interacting factor, beta Pix. Implication for a role in cytoskeletal reorganization. J. Biol. Chem. 276, 10581–10584.

Kim NG, Koh E, Chen X, Gumbiner BM. (2011). E-cadherin mediates contact inhibition of proliferation through Hippo signaling-pathway components. Proc Natl Acad Sci 108: 11930– 11935.

Ko J, Kim S, Valtschanoff JG, Shin H, Lee JR, Sheng M, et al. (2003). Interaction between liprin-alpha and GIT1 is required for AMPA receptor targeting. J Neurosci, 23: 1667–77.

Koh, C.G., Manser, E., Zhao, Z.S., Ng, C.P., Lim, L. (2001). Beta1PIX, the PAK-interacting exchange factor, requires localization via a coiled-coil region to promote microvilluslike structures and membrane ruffles. J. Cell Sci. 114, 4239–4251.

Komuro A, Nagai M, Navin NE, Sudol M. (2003). WW domain-containing protein YAP associates with ErbB-4 and acts as a co-transcriptional activator for the carboxyl-terminal fragment of ErbB-4 that translocates to the nucleus. J Biol Chem 278: 33334–33341.

Kremerskothen J, Plaas C, Buther K, Finger I, Veltel S, Matanis T, Liedtke T, Barnekow A. (2003). Characterization of KIBRA, a novel WW domain-containing protein. Biochem Biophys Res Commun 300: 862–867.

Kuo JC, Han X, Hsiao CT, Yates JR, Waterman CM. (2011). Analysis of the myosinII- responsive focal adhesion proteome reveals a role for β-Pix in negative regulation of focal adhesion maturation. Nat Cell Bio 13: 383-393.

Kutsche, K., Yntema, H., Brandt, A., Jantke, I., Nothwang, H.G., Orth, U., Boavida, M.G., David, D., Chelly, J., Fryns, J.P., Moraine, C., Ropers, H.H., Hamel, B.C., van Bokhoven, H., Gal, A., (2000). Mutations in ARHGEF6, encoding a guanine nucleotide exchange factor for Rho GTPases, in patients with X-linked mental retardation. Nat. Genet. 26, 247–250.

Lahuna O, Quellari M, Achard C, Nola S, Meduri G, Navarro C, et al. (2005). Thyrotropin receptor trafficking relies on the hScrib–betaPIX–GIT1–ARF6 pathway. EMBO J, 24:1364–74.

Lamar JM, Stern P, Liu H, Schindler JW, Jiang ZG, Hynes RO. (2012). The Hippo pathway target, YAP, promotes metastasis through its TEAD-interaction domain. Proc Natl Acad Sci 109: E2441–E2450.

Lee JH, Kim TS, Yang TH, Koo BK, Oh SP, Lee KP, Oh HJ, Lee SH, Kong YY, Kim JM, et al. (2008). A crucial role of WW45 in developing epithelial tissues in the mouse. EMBO J 27: 1231–1242.

Lee KP, Lee JH, Kim TS, Kim TH, Park HD, Byun JS, Kim MC, Jeong WI, Calvisi DF, Kim JM, et al. (2010). The Hippo–Salvador pathway restrains hepatic oval cell proliferation, liver size, and liver tumorigenesis. Proc Natl Acad Sci 107:8248–8253.

Lee KK, Yonehara S. (2012). Identification of mechanism that couples multisite phosphorylation of Yes-associated protein (YAP) with transcriptional coactivation and regulation of apoptosis. J Biol Chem 287: 9568-78.

Lei QY, Zhang H, Zhao B, Zha ZY, Bai F, Pei XH, Zhao S, Xiong Y, Guan KL. (2008). TAZ promotes cell proliferation and epithelial–mesenchymal transition and is inhibited by the hippo pathway. Mol Cell Biol 28: 2426–2436.

Li, Z., Hannigan, M., Mo, Z., Liu, B., Lu, W., Wu, Y., Smrcka, A.V., Wu, G., Li, L., Liu, M., Huang, C.K., Wu, D., (2003). Directional sensing requires G beta gammamediated PAK1 and PIX alpha-dependent activation of Cdc42. Cell 114, 215–227.

Li Z, Zhao B, Wang P, Chen F, Dong Z, Yang H, Guan KL, Xu Y. (2010). Structural insights into the YAP and TEAD complex. Genes Dev 24: 235–240.

Li W, Cooper J, Zhou L, Yang C, Erdjument-Bromage H, Zagzag D, Snuderl M, Ladanyi M, Hanemann CO, Zhou P et al. (2014). Merlin/NF2 loss-driven tumorigenesis linked to CRL4- mediated inhibition of the Hippo pathway kinases Lats1 and 2 in the nucleus. Cancer Cell 26:48- 60.

Lian I, Kim J, Okazawa H, Zhao J, Zhao B, Yu J, Chinnaiyan A, Israel MA, Goldstein LS, Abujarour R, et al. (2010). The role of YAP transcription coactivator in regulating stem cell self- renewal and differentiation. Genes Dev 24: 1106–1118.

Ling C, Zheng Y, Yin F, Yu J, Huang J, Hong Y, Wu S, Pan D. (2010). The apical transmembrane protein Crumbs functions as a tumor suppressor that regulates Hippo signaling by binding to Expanded. Proc Natl Acad Sci 107: 10532–10537.

Liu CY, Zha ZY, Zhou X, Zhang H, Huang W, Zhao D, Li T, Chan SW, Lim CJ, Hong W, et al. (2010). The hippo tumor pathway promotes TAZ degradation by phosphorylating a phosphodegron and recruiting the SCFb–TrCP E3 ligase. J Biol Chem 285: 37159–37169.

Liu X, Yang N, Figel SA, Wilson KE, Morrison CD, Gelman IH, Zhang J. (2012). PTPN14 interacts with and negatively regulates the oncogenic function of YAP. Oncogene doi: 10.1038/ onc.2012.147.

Loo, T.H., Ng, Y.W., Lim, L., Manser, E., (2004). GIT1 activates p21-activated kinase through a mechanism independent of p21 binding. Mol. Cell. Biol. 24, 3849–3859.

Lu L, Li Y, Kim SM, Bossuyt W, Liu P, Qiu Q, Wang Y, Halder G, Finegold MJ, Lee JS, et al. (2010). Hippo signaling is a potent in vivo growth and tumor suppressor pathway in the mammalian liver. Proc Natl Acad Sci 107: 1437–1442.

Mahoney PA, Weber U, Onofrechuk P, Biessmann H, Bryant PJ, Goodman CS. (1991). The fat tumor suppressor gene in Drosophila encodes a novel member of the cadherin gene superfamily. Cell 67: 853–868.

Mahoney WM, Hong JH, Yaffe MB, Farrance IK. (2005). The transcriptional co-activator TAZ interacts differentially with transcriptional effector factor-1 (TEF-1) family members. Biochem J 15: 217-225.

Makita R, Uchijima Y, Nishiyama K, Amano T, Chen Q, Takeuchi T et al. (2008). Multiple renal cysts, urinary concentration defects, and pulmonary emphysematous changes in mice lacking TAZ. Am J Physiol Renal Physiol 294: F542–F553.

Manabe, R., Kovalenko, M., Webb, D.J., Horwitz, A.R., (2002). GIT1 functions in a motile, multi-molecular signaling complex that regulates protrusive activity and cell migration. J. Cell Sci. 115: 1497–1510.

Mani SA, Yang J, Brooks M, Schwaninger G, Zhou A, Miura N, Kutok JL, Hartwell K, Richardson AL, Weinberg RA. (2007). Mesenchyme Forkhead 1 (FOXC2) plays a key role in metastasis and is associated with aggressive basal-like breast cancers. Proc Natl Acad Sci U S A 104: 10069 – 10074.

Manser, E., Loo, T.H., Koh, C.G., Zhao, Z.S., Chen, X.Q., Tan, L., Tan, I., Leung, T., Lim, L., (1998). PAK kinases are directly coupled to the PIX family of nucleotide exchange factors. Mol. Cell 1, 183–192.

Mao Y, Kucuk B, Irvine KD. (2009). Drosophila lowfat, a novel modulator of Fat signaling. Development 136: 3223–3233.

Mao Y, Mulvaney J, Zakaria S, Yu T, Morgan KM, Allen S, Basson MA, Francis-West P, Irvine KD. (2011). Characterization of a Dchs1 mutant mouse reveals requirements for Dchs1–Fat4 signaling during mammalian development. Development 138: 947–957.

Martin-Belmonte F, Perez-Moreno M. (2012). Epithelial cell polarity, stem cells and cancer. Nat Rev Cancer 12: 23–38.

Matakatsu H, Blair SS. (2004). Interactions between Fat and Dachsous and the regulation of planar cell polarity in the Drosophila wing. Development 131: 3785–3794.

Matakatsu H, Blair SS. (2008). The DHHC palmitoyltransferase approximated regulates Fat signaling and Dachs localization and activity. Curr Biol 18: 1390–1395.

McCartney BM, Kulikauskas RM, LaJeunesse DR, Fehon RG. (2000). The neurofibromatosis-2 homologue, Merlin, and the tumor suppressor expanded function together in Drosophila to regulate cell proliferation and differentiation. Development 127: 1315–1324.

Menendez J, Perez-Garijo A, Calleja M, Morata G. (2010). A tumor-suppressing mechanism in Drosophila involving cell competition and the Hippo pathway. Proc Natl Acad Sci 107: 14651– 14656.

Miller E, Yang J, Deran M, Wu C, Su AI, Bonamy GM, Liu J, Peters EC, Wu X. (2012). Identification of serum-derived sphingosine-1-phosphate as a small molecule regulator of YAP. Chem Biol 19: 955–962.

Mo JS, Yu FX, Gong R, Brown JH, Guan KL. (2012). Regulation of the Hippo–YAP pathway by protease-activated receptors (PARs). Genes Dev 26: 2138–2143.

Morin-Kensicki EM, Boone BN, Howell M, Stonebraker JR, Teed J, Alb JG et al. (2006). Defects in yolk sac vasculogenesis, chorioallantoic fusion, and embryonic axis elongation in mice with targeted disruption of Yap65. Mol Cell Biol 26: 77–87.

Murakami M, Nakagawa M, Olson EN, Nakagawa O. (2005). A WW domain protein TAZ is a critical coactivator for TBX5, a transcription factor implicated in Holt-Oram syndrome. Proc Natl Acad Sci USA 102: 18034–18039.

Murakami M, Tominaga J, Makita R, Uchijima Y, Kurihara Y, Nakagawa O, Asano T, Kurihara H. (2006). Transcriptional activity of Pax3 is co-activated by TAZ. Biochem Biophys Res Commun 339: 533–539.

Nayal A, Webb DJ, Horwitz AF. (2004) Talin: an emerging focal point of adhesion dynamics. Curr Opin Cell Biol, 16: 94–8.

Nguyen HB, Babcock JT, Wells CD, Quilliam LA. (2012). LKB1 tumor suppressor regulates AMP kinase/mTOR-independent cell growth and proliferation via the phosphorylation of Yap. Oncogene doi: 10.1038/onc.2012.431.

Nishio M, Hamada K, Kawahara K, Sasaki M, Noguchi F, Chiba S, Mizuno K, Suzuki SO, Dong Y, Tokuda M, et al. (2012). Cancer susceptibility and embryonic lethality in Mob1a/1b double- mutant mice. J Clin Invest 122: 4505–4518.

Nishioka N, Inoue K, Adachi K, Kiyonari H, Ota M, Ralston A, Yabuta N, Hirahara S, Stephenson RO, Ogonuki N, et al. (2009). The Hippo signaling pathway components Lats and Yap pattern Tead4 activity to distinguish mouse trophectoderm from inner cell mass. Dev Cell 16: 398–410.

Nobes, C.D., Hall, A., (1995). Rho, rac, and cdc42 GTPases regulate the assembly of multimolecular focal complexes associated with actin stress fibers, lamellipodia, and filopodia. Cell 81, 53–62.

Oh H, Irvine KD. (2008). In vivo regulation of Yorkie phosphorylation and localization. Development 135: 1081–1088.

Oka T, Mazack V, Sudol M. (2008). Mst2 and Lats kinases regulate apoptotic function of Yes kinase-associated protein (YAP). J Biol Chem 283: 27534–27546.

Oka T, Remue E, Meerschaert K, Vanloo B, Boucherie C, Gfeller D, Bader GD, Sidhu SS, Vandekerckhove J, Gettemans J, et al. (2010). Functional complexes between YAP2 and ZO-2 are PDZ domain-dependent, and regulate YAP2 nuclear localization and signalling. Biochem J 432: 461–472.

Okada T, Lopez-Lago M, Giancotti FG. (2005). Merlin/NF-2 mediates contact inhibition of growth by suppressing recruitment of Rac to the plasma membrane. J Cell Biol 171:361-371.

Omelchenko T, Rabadan MA, Hernandez-Martinez R, et al. (2014). β-Pix directs collective migration of anterior visceral endoderm cells in the early mouse embryo. Genes Dev 28: 2764- 2777.

Omerovic J, Puggioni EM, Napoletano S, Visco V, Fraioli R, Frati L, Gulino A, Alimandi M. (2004). Ligand-regulated association of ErbB-4 to the transcriptional co-activator YAP65 controls transcription at the nuclear level. Exp Cell Res 294: 469–479.

O’Neill E, Rushworth L, Baccarini M, Kolch W. (2004). Role of the kinase MST2 in suppression of apoptosis by the proto-oncogene product Raf-1. Science. 306: 2267-2270.Pan D. (2010). The hippo signaling pathway in development and cancer. Dev Cell 19: 491–505.

Orr BA, Bai H, Odia Y, Jain D, Anders RA, Ederhart CG. (2011). Yes-associated protein 1 is widely expressed in human brain tumors and promotes glioblastoma growth. J Neuropathol Exp Neurol. 70: 568-577.

Osmani N, Vitale N, Borg JP, Etienne-Manneville S. (2006). Scrib Controls Cdc42 localization and activity to promote cell polarization during astrocyte migration. Curr Biol 16:2395–2405.

Ota M, Sasaki H. (2008). Mammalian Tead proteins regulate cell proliferation and contact inhibition as transcriptional mediators of Hippo signaling. Development. 135: 4059-4069.

Overholtzer M, Zhang J, Smolen GA, Muir B, Li W, Sgroi DC, Deng CX, Brugge JS, Haber DA. (2006). Transforming properties of YAP, a candidate oncogene on the chromosome 11q22 amplicon. Proc Natl Acad Sci 103: 12405–12410.

Paramasivam M, Sarkeshik A, Yates JR 3rd, Fernandes MJ, McCollum D. (2011). Angiomotin family proteins are novel activators of the LATS2 kinase tumor suppressor. Mol Biol Cell 22: 3725–3733.

Park KS, Whitsett JA, Di Palma T, Hong JH, Yaffe MB, Zannini M. (2004). TAZ interacts with TTF-1 and regulates expression of surfactant protein-C. J Biol Chem 279: 17384–17390.

Paris, S., Longhi, R., Santambrogio, P. & de Curtis, I. (2003). Leucine-zipper-mediated homo- and heterodimerization of GIT family p95-ARF GTPase-activating protein, PIX-, paxillin- interacting proteins 1 and 2. Biochem. J. 372: 391–398.

Poernbacher I, Baumgartner R, Marada SK, Edwards K, Stocker H. (2012). Drosophila Pez acts in Hippo signaling to restrict intestinal stem cell proliferation. Curr Biol 22: 389–396.

Polesello C, Huelsmann S, Brown NH, Tapon N. (2006). The Drosophila RASSF homolog antagonizes the hippo pathway. Curr Biol 16: 2459–2465.

Poon CL, Lin JI, Zhang X, Harvey KF. (2011). The sterile 20-like kinase Tao-1 controls tissue growth by regulating the Salvador-Warts-Hippo pathway. Dev Cell 21: 896–906.

Praskova M, Khoklatchev A, Ortiz-Vega S, Avruch J. (2004). Regulation of the MST1 kinase by autophosphorylation, by the growth inhibitory proteins, RASSF1 and NORE1, and by Ras. Biochem J 381: 453–462.

Praskova M, Xia F, Avruch J. (2008). MOBKL1A/MOBKL1B phosphorylation by MST1 and MST2 inhibits cell proliferation. Curr Biol 18: 311–321.

Premont, R.T., Perry, S.J., Schmalzigaug, R., Roseman, J.T., Xing, Y., Claing, A., (2004). The GIT/PIX complex: an oligomeric assembly of GIT family ARF GTPase-activating proteins and PIX family Rac1/Cdc42 guanine nucleotide exchange factors. Cell. Signal. 16, 1001–1011.

Rauskolb C, Pan G, Reddy BV, Oh H, Irvine KD. (2011). Zyxin links fat signaling to the hippo pathway. PLoS Biol 9: e1000624.

Reginensi A, Scott RP, Gregorieff A, Bagherie-Lachidan M, Chung C, Lim DS, Pawson T, Wrana J, McNeill H. (2013). Yap- and Cdc42-dependent nephrogenesis and morphogenesis during mouse kidney development. PLoS Genet 9:e1003380.

Remue E, Meerschaert K, Oka T, Boucherie C, Vandekerckhove J, Sudol M, Gettemans J. (2010). TAZ interacts with zonula occludens-1 and -2 proteins in a PDZ-1 dependent manner. FEBS Lett 584: 4175–4180.

Ren F, Wang B, Yue T, Yun EY, Ip YT, Jiang J. (2010a). Hippo signaling regulates Drosophila intestine stem cell proliferation through multiple pathways. Proc Natl Acad Sci USA, 107:21064- 21069.

Ren F, Zhang L, Jiang J. (2010b). Hippo signaling regulates Yorkie nuclear localization and activity through 14-3-3 dependent and independent mechanisms. Dev Biol 337: 303–312.

Rhee, S., Yang, S.J., Lee, S.J., Park, D., (2004). BetaPix-b(L), a novel isoform of betaPix, is generated by alternative translation. Biochem. Biophys. Res. Commun. 318, 415–421.

Ribeiro PS, Josue F,Wepf A,Wehr MC, Rinner O, Kelly G, Tapon N, Gstaiger M. (2010). Combined functional genomic and proteomic approaches identify a PP2A complex as a negative regulator of Hippo signaling. Mol Cell 39: 521–534.

Ridley AJ, Hall A. (1992). The small GTP-binding protein rho regulates the assembly of focal adhesions and actin stress fibers in response to growth factors. Cell 70, 389–399.

Ridley AJ, Paterson HF, Johnston CL, Diekmann D, Hall A. (1992). The small GTP-binding protein rac regulates growth factor-induced membrane ruffling. Cell 70, 401–410.

Robinson BS, Huang J, Hong Y, Moberg KH. (2010). Crumbs regulates Salvador/Warts/Hippo signaling in Drosophila via the FERM-domain protein Expanded. Curr Biol 20: 582–590.

Romano D, Matallanas D, Weitsman G, Preisinger C, Ng T, Kolch W. (2010). Proapoptotic kinase MST2 coordinates signaling crosstalk between RASSF1A, Raf-1 and Akt. Cancer Res. 70: 1195-1203.

Rosenberger, G., Jantke, I., Gal, A., Kutsche, K., (2003). Interaction of alphaPIX (ARHGEF6) with beta-parvin (PARVB) suggests an involvement of alphaPIX in integrinmediated signaling. Hum. Mol. Genet. 12, 155–167.

Saneyoshi, T., Wayman, G., Fortin, D., Davare, M., Hoshi, N., Nozaki, N. et al. (2008). Activity- dependent synaptogenesis: regulation by a CaM-kinase kinase/CaM-kinase I/betaPIX signaling complex. Neuron, 57: 94–107.

Sansores-Garcia L, Bossuyt W, Wada K, Yonemura S, Tao C, Sasaki H, Halder G. (2011). Modulating F-actin organization induces organ growth by affecting the Hippo pathway. EMBO J 30: 2325–2335.

Saucedo LJ, Edgar BA (2007). Filling out the Hippo pathway. Mol Cell Biol. 8: 613-621.

Schlegelmilch K, Mohseni M, Kirak O, Pruszak J, Rodriguez JR, Zhou D, Kreger BT, Vasioukhin V, Avruch J, Brummelkamp TR, et al. (2011). Yap1 acts downstream of a-catenin to control epidermal proliferation. Cell 144: 782–795.

Schmidt, A., Hall, A., (2002). Guanine nucleotide exchange factors for Rho GTPases: turning on the switch. Genes Dev. 16, 1587–1609.

Schoenwaelder, S.M., Burridge, K., (1999). Bidirectional signaling between the cytoskeleton and integrins. Curr. Opin. Cell Biol. 11, 274–286.

Schroeder, M.C., and Halder, G. (2012). Regulation of the Hippo pathway by cell architecture and mechanical signals. Semin. Cell Dev. Biol. 23: 803–811.

Shaw RL, Kohlmaier A, Polesello C, Veelken C, Edgar BA, Tapon N. (2010). The Hippo pathway regulates intestinal stem cell proliferation during Drosophila adult midgut regeneration. Development 137: 4147–4158.

Sher I, Hanemann CO, Karplus PA, Bretscher A. (2012). The tumor suppressor merlin controls growth in its open state, and phosphorylation converts it to a less-active more-closed state. Dev Cell 22:703-705.

Shin EY, Shin KS, Lee CS, Woo KN, Quan SH, Soung NK, Kim YG, Cha CI, Kim SR, Park D et al. (2002). Phosphorylation of p85 beta PIX, a Rac/Cdc42-specific guanine nucleotide exchange factor, via the Ras/ERK/PAK2 pathway is required for basic fibroblast growth factor- induced neurite outgrowth. J Biol Chem 277:44417–44430.

Shin K, Fogg VC, Margolis B. (2006). Tight junctions and cell polarity. Annu. Rev. Cell Dev. Biol. 22: 207-235.

Silva E, Tsatskis Y, Gardano L, Tapon N, McNeill H. (2006). The tumor-suppressor gene fat controls tissue growth upstream of expanded in the hippo signaling pathway. Curr Biol 16: 2081–2089.

Simons M, Mlodzik M. (2008). Planar cell polarity signaling: From fly development to human disease. Annu Rev Genet 42: 517–540.

Skouloudaki K, Puetz M, Simons M, Courbard JR, Boehlke C, Hartleben B, Engel C, Moeller MJ, Englert C, Bollig F, et al. (2009). Scribble participates in Hippo signaling and is required for normal zebrafish pronephros development. Proc Natl Acad Sci 106: 8579–8584.

Sopko R, Silva E, Clayton L, Gardano L, Barrios-Rodiles M, Wrana J, Varelas X, Arbouzova NI, Shaw S, Saburi S, et al. 2009. Phosphorylation of the tumor suppressor fat is regulated by its ligand Dachsous and the kinase discs overgrown. Curr Biol 19: 1112–1117.

Staley BK, Irvine K.D. (2010). Warts and Yorkie mediate intestinal regeneration by influencing stem cell proliferation. Curr Biol 20:1580-1587.

Strano S, Munarriz E, Rossi M, Castagnoli L, Shaul Y, Sacchi A, Oren M, Sudol M, Cesareni G, Blandino G. (2001). Physical interaction with Yes-associated protein enhances p73 transcriptional activity. J Biol Chem 276: 15164–15173.

Sun G, Irvine KD. (2011). Regulation of Hippo signaling by Jun kinase signaling during compensatory cell proliferation and regeneration, and in neoplastic tumors. Dev Biol 350: 139– 151.

Tagliabracci VS, Engel JL, Wen J, Wiley SE, Worby CA, Kinch LN, Xiao J, Grishin NV, Dixon JE. (2012). Secreted kinase phosphorylates extracellular proteins that regulate biomineralization. Science 336: 1150–1153.

Tapon N, Harvey KF, Bell DW, Wahrer DC, Schiripo TA, Haber DA, Hariharan IK. (2002). salvador promotes both cell cycle exit and apoptosis in Drosophila and is mutated in human cancer cell lines. Cell 110: 467–478.

Tepass U, Theres C, Knust E. (1990). crumbs encodes an EGF-like protein expressed on apical membranes of Drosophila epithelial cells and required for organization of epithelia. Cell 61: 787–799. ten Klooster JP, Jaffer ZM, Chernoff J, Hordijk PL. (2006). Targeting and activation of Rac1 are mediated by the exchange factor beta-Pix. J Cell Biol 172:759–769.

Thiery JP, Acloque H, Huang RY, Nieto MA. (2009). Epithelial–mesenchymal transitions in development and disease. Cell 139: 871–890.

Tian Y, Kolb R, Hong JH, Carroll J, Li D, You J, Bronson R, Yaffe MB, Zhou J, Benjamin T. (2007). TAZ promotes PC2 degradation through a SCFbeta-Trcp E3 ligase complex. Mol Cell Biol 27: 6383–6395.

Udan RS, Kango-Singh M, Nolo R, Tao C, Halder G. (2003). Hippo promotes proliferation arrest and apoptosis in the Salvador/Warts pathway. Nat Cell Biol 5: 914–920.

Totaro A, Paris S, Asperti C, de Curtis I. (2007). Identification of an intramolecular interaction important for the regulation of GIT1 functions. Mol Biol Cell 18. van Aelst, L., D’Souza-Schorey, C. (1997). Rho GTPases and signaling networks. Genes Dev. 11, 2295–2322.

Varelas X, Sakuma R, Samavarchi-Tehrani P, Peerani R, Rao BM, Dembowy J, Yaffe MB, Zandstra PW, Wrana JL. (2008). TAZ controls Smad nucleocytoplasmic shuttling and regulates human embryonic stem-cell self-renewal. Nat Cell Biol 10: 837–848.

Varelas X, Samavarchi-Tehrani P, Narimatsu M, Weiss A, Cockburn K, Larsen BG, Rossant J, Wrana JL. (2010). The Crumbs complex couples cell density sensing to Hippo-dependent control of the TGF-β–SMAD pathway. Dev Cell 19: 831–844.

Vassilev A, Kaneko KJ, Shu H, Zhao Y, DePamphilis ML. (2001). TEAD/TEF transcription factors utilize the activation domain of YAP65, a Src/Yes-associated protein localized in the cytoplasm. Genes Dev 15: 1229–1241.

Visser-Grieve S, Zhou Z, She YM, Huang H, Cyr TD, Xu T, Yang X. (2011). LATS1 tumor suppressor is a novel actin-binding protein and negative regulator of actin polymerization. Cell Res 21: 1513–1516. von Gise A, Lin Z, Schlegelmilch K, Honor LB, Pan GM, Buck JN, Ma Q, Ishiwata T, Zhou B, Camargo FD, et al. (2012). YAP1, the nuclear target of Hippo signaling, stimulates heart growth through cardiomyocyte proliferation but not hypertrophy. Proc Natl Acad Sci 109: 2394–2399.

Wada K, Itoga K, Okano T, Yonemura S, Sasaki H. (2011). Hippo pathway regulation by cell morphology and stress fibers. Development 138: 3907–3914.

Wang W, Huang J, Chen J. (2011). Angiomotin-like proteins associate with and negatively regulate YAP1. J Biol Chem 286: 4364–4370.

Wang W, Huang J, Wang X, Yuan J, Li X, Feng L, Park JI, Chen J. (2012). PTPN14 is required for the density-dependent control of YAP1. Genes Dev 26: 1959–1971.

Watt KI, Judson R, Medlow P, Reid K, Kurth TB, Burniston JG, Ratkevicius A, De Bari C, Wackerhage H. 2010. Yap is a novel regulator of C2C12 myogenesis. Biochem Biophys Res Commun 393: 619–624.

Wehr MC, Holder MV, Gailite I, Saunders RE, Maile TM, Ciirdaeva E, Instrell R, Jiang M, Howell M, Rossner MJ, et al. 2013. Salt-inducible kinases regulate growth through the Hippo signalling pathway in Drosophila. Nat Cell Biol 15: 61-71.

Wells CD, Fawcett JP, Traweger A, Yamanaka Y, Goudreault M, Elder K, Kulkarni S, Gish G, Virag C, Lim C, et al. (2006). A Rich1/Amot complex regulates the Cdc42 GTPase and apical- polarity proteins in epithelial cells. Cell 125: 535–548.

Willecke M, Hamaratoglu F, Kango-Singh M, Udan R, Chen CL, Tao C, Zhang X, Halder G. (2006). The fat cadherin acts through the hippo tumor-suppressor pathway to regulate tissue size. Curr Biol 16: 2090–2100.

Willecke M, Hamaratoglu F, Sansores-Garcia L, Tao C, Halder G. (2008). Boundaries of Dachsous cadherin activity modulate the Hippo signaling pathway to induce cell proliferation. Proc Natl Acad Sci 105: 14897–14902.

Wu S, Huang J, Dong J, Pan D. (2003). hippo encodes a Ste-20 family protein kinase that restricts cell proliferation and promotes apoptosis in conjunction with salvador and warts. Cell 114: 445–456.

Wu S, Liu Y, Zheng Y, Dong J, Pan D. (2008). The TEAD/TEF family protein Scalloped mediates transcriptional output of the Hippo growth-regulatory pathway. Dev Cell 14: 388–398.

Xiao L, Chen Y, Ji M, Dong J. (2011). Kibra regulates Hippo signaling activity via interactions with large tumor suppressor kinases. J Biol Chem. 286: 7788-7796.

Xu MZ, Yao TJ, Lee NP, Ng IO, Chan YT, Zender L, Lowe SW, Poon RT, Luk JM. (2009). Yes-associated protein is an independent prognostic marker in hepatocellular carcinoma. Cancer 115: 4576–4585.

Yagi R, Chen LF, Shigesada K, Murakami Y, Ito Y. (1999). A WW domain-containing yes- associated protein (YAP) is a novel transcriptional co-activator. EMBO J 18: 2551–2562.

Yagi R, Kohn MJ, Karavanova I, Kaneko KJ, Vullhorst D, DePamphilis ML, Buonanno A. (2007). Transcription factor TEAD4 specifies the trophectoderm lineage at the beginning of mammalian development. Development 134:3827-3836.

Yi C, Troutman S, Fera D, Stemmer-Rachamimov A, Avila JL, Christian N, Persson NL, Shimono A, Speicher DW, Marmorstein R, et al. (2011). A tight junction-associated Merlin– angiomotin complex mediates Merlin’s regulation of mitogenic signaling and tumor suppressive functions. Cancer Cell 19: 527–540.

Yin F, Yu J, Zheng Y, Chen Q, Zhang N, Pan D. (2013). Spatial organization of Hippo signaling at the plasma membrane mediated by the tumor suppressor Merlin/NF2. Cell 154(6): 1342-55.

Yu J, Zheng Y, Dong J, Klusza S, Deng WM, Pan D. (2010). Kibra functions as a tumor suppressor protein that regulates Hippo signalling in conjunction with Merlin and Expanded. Dev Cell 18: 288–299.

Yu FX, Mo JS, Guan KL. (2012a). Upstream regulators of the Hippo pathway. Cell Cycle 11: 4097–4098.

Yu FX, Zhao B, Panupinthu N, Jewell JL, Lian I, Wang LH, Zhao J, Yuan H, Tumaneng K, Li H, et al. (2012b). Regulation of the Hippo–YAP pathway by G-protein-coupled receptor signaling. Cell 150: 780–791.

Yu FX, Guan KL. (2013). The Hippo pathway: regulators and regulations. Genes Dev. 27: 355- 71.

Zecca M, Struhl G. (2010). A feed-forward circuit linking wingless, fat–dachsous signaling, and the warts–hippo pathway to Drosophila wing growth. PLoS Biol 8: e1000386.

Zhang H, Webb DJ, Asmussen H, Horwitz AF. (2003). Synapse formation is regulated by the signaling adaptor GIT1. J Cell Biol 161:131–42.

Zhang H, Webb DJ, Asmussen H, Niu S, Horwitz AF. (2005). A GIT1/PIX/Rac/PAK signaling module regulates spine morphogenesis and synapse formation through MLC. J Neurosci, 25: 3379–88.

Zhang L, Ren F, Zhang Q, Chen Y, Wang B, Jiang J. (2008). The TEAD/TEF family of transcription factor Scalloped mediates Hippo signaling in organ size control. Dev Cell 14: 377– 387.

Zhang, Z. M., Simmerman, J. A., Guibao, C. D. & Zheng, J. J. (2008). GIT1 paxillin-binding domain is a four-helix bundle, and it binds to both paxillin LD2 and LD4 motifs. J. Biol. Chem. 283, 18685–18693.

Zhang H, Liu CY, Zha ZY, Zhao B, Yao J, Zhao S, Xiong Y, Lei QY, Guan KL. (2009). TEAD transcription factors mediate the function of TAZ in cell growth and epithelial-mesenchymal transition. J Biol Chem 284: 13355–13362.

Zhang N, Bai H, David KK, Dong J, Zheng Y, Cai J, Giovannini M, Liu P, Anders RA, Pan D. (2010). The Merlin/NF2 tumor suppressor functions through the YAP oncoprotein to regulate tissue homeostasis in mammals. Dev Cell 19: 27–38.

Zhang H, Pasolli HA, Fuchs E. (2011). Yes-associated protein (YAP) transcriptional coactivator functions in balancing growth and differentiation in skin. Proc Natl Acad Sci 108:2270–2275.

Zhao, Z.S., Manser, E., Loo, T.H., Lim, L., (2000). Coupling of PAK-interacting exchange factor PIX to IT1 promotes focal complex disassembly. Mol. Cell. Biol. 20, 6354–6363.

Zhao B, Wei X, Li W, Udan RS, Yang Q, Kim J, Xie J, Ikenoue T, Yu J, Li L, et al. (2007). Inactivation of YAP oncoprotein by the Hippo pathway is involved in cell contact inhibition and tissue growth control. Genes Dev 21: 2747–2761.

Zhao B, Ye X, Yu J, Li L, Li W, Li S, Yu J, Lin JD, Wang CY, Chinnaiyan AM, et al. (2008). TEAD mediates YAP-dependent gene induction and growth control. Genes Dev 22: 1962–1971.

Zhao B, Li L, Lei Q, Guan KL. (2010a). The Hippo–YAP pathway in organ size control and tumorigenesis: An updated version. Genes Dev 24: 862–874.

Zhao B, Li L, Tumaneng K, Wang CY, Guan KL. (2010b). A coordinated phosphorylation by Lats and CK1 regulates YAP stability through SCF(b-TRCP). Genes Dev 24: 72–85.

Zhao B, Li L, Lu Q, Wang LH, Liu CY, Lei Q, Guan KL. (2011). Angiomotin is a novel Hippo pathway component that inhibits YAP oncoprotein. Genes Dev 25: 51–63.

Zhao B, Li L, Wang L, Wang CY, Yu J, Guan KL. (2012). Cell detachment activates the Hippo pathway via cytoskeleton reorganization to induce anoikis. Genes Dev 26: 54–68.

Zhou D, Conrad C, Xia F, Park JS, Payer B, Yin Y, Lauwers GY, Thasler W, Lee JT, Avruch J, et al. (2009). Mst1 and Mst2 maintain hepatocyte quiescence and suppress hepatocellular carcinoma development through inactivation of the Yap1 oncogene. Cancer Cell 16: 425–438.