MATERNAL NUTRITIONAL PLANE AND ENDOGENOUS RETROVIRAL GENE
ELEMENTS, PREGNANCY HORMONES, AND PLACENTAL VASCULARITY AND
ANGIOGENIC FACTORS DURING THE ESTABLISHMENT OF PREGNANCY IN BEEF
CATTLE
A Dissertation Submitted to the Graduate Faculty of the North Dakota State University of Agriculture and Applied Science
By
Kyle James McLean
In Partial Fulfillment of the Requirements for the Degree of DOCTOR OF PHILOSOPHY
Major Department: Animal Sciences Option: Nutritional Physiology
September 2016
Fargo, North Dakota
North Dakota State University Graduate School
Title Maternal Nutritional Plane and Endogenous Retroviral Gene Elements, Pregnancy Hormones, and Placental Vascularity and Angiogenic Factors during the Establishment of Pregnancy in Beef Cattle
By
Kyle James McLean
The Supervisory Committee certifies that this disquisition complies with North Dakota State
University’s regulations and meets the accepted standards for the degree of
DOCTOR OF PHILOSOPHY
SUPERVISORY COMMITTEE:
Dr. Joel Caton Chair
Dr. Lawrence Reynolds
Dr. Carl Dahlen
Dr. Pawel Borowicz
Dr. Eugene Berry
Approved:
November 1, 2016 Dr. Gregory Lardy Date Department Chair
ABSTRACT
In order to meet the projected food demands by 2050, animal agriculture must increase production of animal products on the same or decreased land area through increased efficiency.
Early gestation is one area to increase efficiency in beef production in a twofold manner 1) by increasing the number of calves born due to decreased early embryonic loss and 2) by minimizing detrimental effects due to fetal programming which may decrease offspring growth or reproductive efficiency. Both of which will result in more pounds of beef produced by the same number of cows. Recently, endogenous retroviral elements (ERV), which make up a significant portion of mammalian genomes, have been implicated in vital steps during placentation. The placenta is the source of nutrient, gas, and waste exchange between maternal and fetal circulation which is necessary to support fetal growth. Maternal nutrition influences fetal growth and placental development. Therefore, we hypothesized that ERV envelope genes, syncytin-Rum1 and BERV-K1 , as well as pregnancy specific hormones, PSP-B, and IFN-τ will be differentially expressed during critical time points of early pregnancy and maternal nutrition restriction will alter mRNA expression at critical time points. We developed a technique to ovariohysterectomized beef heifers which provides a large animal model to acquire utero- placental tissues. In year 1, we established basal expression patterns for syncytin-Rum1 and
BERV-K1 , PSP-B, and IFN-τ within utero-placental tissues during the first 50 d of gestation. In year 2, we determined the effects of 40% global nutrient restriction on the mRNA expression of syncytin-Rum1 and BERV-K1 , PSP-B, and IFN-τ on d 16, 34, and 50 of gestation in utero- placental tissues. These data provide novel evidence of differential expression of endogenous retroviruses ( syncytin-Rum1 and BERV-K1), PSP-B, and IFN-τ during early gestation but 40% maternal nutrient restriction had little influence of mRNA expression. However, further work
iii
needs to be completed to elucidate functions, mechanisms, and interactions of these genes during early gestation and their importance to the successful establishment of pregnancy.
iv
ACKNOWLEDGEMENTS
I would like to start off by thanking my committee members, Dr. Caton, Dr. Reynolds,
Dr. Dahlen, Dr. Borowicz, and Dr. Berry, for allowing my imagination to run wild at times but also making these ideas a reality. They were not only supportive and instrumental in the completion of this project and my degree but also extremely flexible and willing to work with me. I would also like to thank Dr. Walden and Dr. Neville for the part they played in the development of the hysterectomy technique. Their support and belief in me and this group were vital to the successful development of this technique.
This section would not be complete without an immense thank you going out to the barn crew at the Animal Nutrition and Physiology Center who spent many hours feeding and taking care of these animals before, during, and after these research projects. As well as, all of the staff members at Hultz Hall, in the offices and labs, the animal science graduate students, and the members at the other NDSU barns who were always will to help when they could. A special thanks needs to go to Jim Kirsch, Sheri Dorsam, and Marsha Kapphahn who were always available to answer questions when I was over my head and/or on a short timeline. Last but certainly not least I would like to special send a thank you to Matthew Crouse. While I gave him a hard time about almost everything, his hard work and wiliness to come in at odd hours to help made this project much, much more enjoyable. Finally, I owe all of my success to the support and guidance of Dr. Caton. He pushed the limits of my knowledge but always set me up to success. I am sure that I am forgetting several people but for those I have mentioned and those who I missed I cannot begin to express my gratitude for all that you have done to help me through my time here at NDSU. I will always remember the times spent here in Fargo and couldn’t have asked for a better opportunity.
v
DEDICATION
I would like to dedicate this dissertation to my mom, dad, and little brother who have supported
me through many, many years of school. I would not be who I am today without them. I will never be able to truly express my gratitude for all they have done. I would also like to dedicate this to my fiancée, Amanda, she was always there to listen and could relate and understand what
I was actually complaining about.
vi
TABLE OF CONTENTS
ABSTRACT ...... iii
ACKNOWLEDGEMENTS ...... v
DEDICATION ...... vi
LIST OF TABLES ...... xi
LIST OF FIGURES ...... xii
LIST OF ABBREVIATIONS ...... xiv
CHAPTER 1. INTRODUCTION ...... 1
CHAPTER 2. LITERATURE REVIEW ...... 4
2.1. Introduction ...... 4
2.2. Retroviruses ...... 6
2.2.1. Syncytia Formation ...... 6
2.2.2. Bovine Retroviral Elements ...... 7
2.2.3. Syncytin in Other Mammals ...... 8
2.2.4. Endogenous Jaagsiekte Sheep Retrovirus ...... 9
2.3. Pregnancy Establishment ...... 10
2.3.1. Interferon-Tau...... 10
2.3.2. Maternal Recognition of Pregnancy ...... 11
2.3.3. Pregnancy Specific Protein-B ...... 13
2.3.4. Roles of Other Hormones ...... 15
2.3.5. Changes in Uterine Tissues ...... 17
2.4. Fetal Development ...... 18
2.4.1. Pre-Implantation ...... 18
2.4.2. Apposition, Implantation, and Adhesion ...... 19
2.4.3. Angiogenesis and Placental Vascularization ...... 20
vii
2.5. Developmental Programming ...... 21
2.5.1. Nutritional Influences on Fetal Growth, Development and Survival ...... 21
2.5.2. Bovine...... 22
2.5.3. Ovine ...... 24
2.5.4. Nutritional Influences on Placental Development ...... 25
2.6. Summary and Conclusions ...... 27
2.7. Literature Cited ...... 28
CHAPTER 3. A NEW SURGICAL TECHNIQUE FOR OVARIOHYSTERECTOMY DURING EARLY PREGNANCY IN BEEF HEIFERS ...... 60
3.1. Abstract ...... 60
3.2. Introduction ...... 61
3.3. Materials and Methods ...... 62
3.3.1. Pre-Surgical Preparation ...... 63
3.3.2. Surgical Procedure...... 66
3.3.3. Post-Operative Care ...... 70
3.3.4. Procedure Assessment ...... 70
3.4. Results and Discussion ...... 71
3.5. Literature Cited ...... 76
CHAPTER 4. ENDOGENOUS RETROVIRUSES ( SYNCYTIN-RUM1 AND BERV-K1 ), INTERFERON-τ, AND PREGNANCY SPECIFIC PROTEIN-B ARE DIFFERENTIALLY EXPRESSED IN MATERNAL AND FETAL TISSUES DURING THE FIRST 50 D OF GESTATION IN BEEF HEIFERS ...... 81
4.1. Abstract ...... 81
4.2. Introduction ...... 82
4.3. Materials and Methods ...... 83
4.3.1. Tissue Collecting and Processing ...... 84
4.3.2. Real-Time Reverse Transcriptase Quantitative PCR ...... 85
viii
4.3.3. Statistical Analysis ...... 86
4.4. Results ...... 86
4.5. Discussion ...... 95
4.6. Literature Cited ...... 101
CHAPTER 5. THE EFFECTS OF NUTRIENT RESTRICTION ON mRNA EXPRESSION OF ENDOGENOUS RETROVIRUSES, INTERFERON-τ, AND PREGNANCY SPECIFIC PROTEIN-B DURING THE ESTABLISHMENT OF PREGNANCY IN BEEF HEIFERS ...... 109
5.1. Abstract ...... 109
5.2. Introduction ...... 110
5.3. Materials and Methods ...... 111
5.3.1. Tissue Collecting and Processing ...... 113
5.3.2. Real-Time Reverse Transcriptase Quantitative PCR ...... 113
5.3.3. Statistical Analysis ...... 114
5.4. Results ...... 115
5.5. Discussion ...... 126
5.6. Literature Cited ...... 133
CHAPTER 6. IMPACTCS OF MATERNAL NUTRITION ON PLACENTAL VASCULARITY AND mRNA EXPRESSION OF ANGIOGENIC FACTORS DURING THE ESTABLISHMENT OF PREGNANCY IN BEEF HEIFERS ...... 143
6.1. Abstract ...... 143
6.2. Introduction ...... 144
6.3. Materials and Methods ...... 145
6.3.1. Tissue Collecting and Processing ...... 146
6.3.2. Real-time Reverse Transcriptase Quantitative PCR ...... 147
6.3.3. Immunohistochemistry ...... 148
6.3.4. Statistical Analysis ...... 148
ix
6.4. Results and Discussion ...... 149
6.5. Literature Cited ...... 158
CHAPTER 7. SUMMARY AND CONCLUSIONS ...... 165
7.1. Literature Cited ...... 168
x
LIST OF TABLES
Table Page
3-1. List of materials needed for the ovariohysterectomy procedure...... 67
4-1. Primer Sequences of syncytin-Rum1, BERV-K1, interferon–τ (IFN- τ), and pregnancy specific protein-B (PSP-B) used for PCR analysis...... 85
4-2. Relative expression patterns for syncytin-Rum1, bovine endogenous retrovirus-K1 (BERV-K1), interferon-τ (IFN-τ), and pregnancy specific protein-B (PSP-B) during early pregnancy in beef heifers...... 92
4-3. Relative fold change of syncytin-Rum1 expression in maternal caruncles (CAR), uterine endometrium (ICAR), and fetal membranes (FM) during the first 50 d of pregnancy in beef heifers 1...... 93
4-4. Relative fold change of bovine endogenous retrovirus-K1 (BERV-K1) expression in maternal caruncles (CAR), uterine endometrium (ICAR), and fetal membranes (FM) during the first 50 d of pregnancy in beef heifers 1...... 94
4-5. Relative fold change of pregnancy specific protein-B 3xpression in maternal caruncles (CAR), uterine endometrium (ICAR), and fetal membranes (FM) during the first 50 d of pregnancy in beef heifers 1...... 94
5-1. Changes in mRNA expression for synctin-Rum1, BERV-K1, pregnancy specific protein-B (PSP-B), and interferon-τ (IFN-τ) in control heifers during the first 50 d of gestation...... 123
5-2. Changes in mRNA expression for synctin-Rum1, BERV-K1, pregnancy specific protein-B (PSP-B), and interferon-τ (IFN-τ) in control heifers during the first 50 d of gestation...... 124
5-3. The effects of nutrition and stage of gestation on reproductive organ measurements. . 127
5-4. Reproductive organ measurements in control heifers during the first 50 d of gestation...... 128
6-1. Changes in mRNA expression for endothelial nitric oxide synthase (eNOS), vascular endothelial growth factor (VEGF), and overall vascularity in control heifers during the first 50 d of gestation...... 156
6-2. Changes in mRNA expression for endothelial nitric oxide synthase (eNOS) and vascular endothelial growth factor (VEGF) amongst tissues within a given day of gestation...... 157
xi
LIST OF FIGURES
Figure Page
3-1. Surgical restraint and ovariohysterectomy harness schematic in cranial, caudal and lateral views...... 64
3-2. Schematic of bovine reproductive tract illustrating the location of ligatures ...... 68
4-1. Expression of syncytin-Rum1 in reproductive tissues during the establishment of pregnancy in beef heifers...... 87
4-2. Expression of bovine endogenous retrovirus-K1 (BERV-K1) in reproductive tissues during the establishment of pregnancy in beef heifers...... 89
4-3. Expression of (IFN-τ) in fetal membranes (FM) during the establishment of pregnancy in beef heifers...... 90
4-4. Expression of pregnancy specific protein-B (PSP-B) in reproductive tissues during the establishment of pregnancy in beef heifers...... 91
4-5. Concentrations on hormones in serum of beef heifers during early gestation...... 95
5-1. Expression of pregnancy specific protein–B (PSP-B) and interferon-τ (IFN-τ) in maternal caruncle (P-CAR) during the establishment of pregnancy in beef heifers. .... 116
5-2. Expression of syncytin-Rum1 and pregnancy specific protein–B (PSP-B) in pregnant uterine horn endometrium (P-ICAR) during the establishment of pregnancy in beef heifers ...... 117
5-3. Expression of bovine endogenous retrovirus-K1 (BERV-K1) and pregnancy specific protein–B (PSP-B) in caruncles of the contralateral uterine horn to the conceptus (NP-CAR) during the establishment of pregnancy in beef heifers...... 118
5-4. The influence of day of pregnancy on mRNA expression levels of pregnancy specific protein–B (PSP-B) in caruncles of the contralateral uterine horn to the conceptus (NP-ICAR) during the first 50 d of pregnancy in beef heifers...... 119
5-5. Expression of interferon-τ (IFN-τ), bovine endogenous retrovirus-K1 (BERV-K1), syncytin-Rum1, and pregnancy specific protein–B (PSP-B) in fetal membranes (FM) during the establishment of pregnancy in beef heifers...... 120
5-6. Concentrations on hormones in serum of beef heifers during early gestation...... 125
xii
6-1. The influence nutritional treatment on mRNA expression of vascular endothelial growth factor (VEGF) in maternal endometrium of the contralateral uterine horn to the conceptus (NP-ICAR) during the first 50 d of pregnancy in beef heifers...... 150
6-2. Expression of endothelial nitric oxide synthase (eNOS) in pregnant maternal caruncle (P-CAR)...... 151
6-3. The influence of nutritional treatment on vascular ratio in maternal tissue dependent on stage of gestation...... 152
6-4. The effects of nutritional plane on vascular volume in fetal membranes from the non-pregnant uterine horn of during the first 50 d of gestation...... 153
xiii
LIST OF ABBREVIATIONS
ACTH ...... Adrenocorticotropic hormone.
ADG ...... Average daily gain.
AI ...... Artificial insemination
BERV–A ...... Bovine endogenous retrovirus–A.
BERV–B ...... Bovine endogenous retrovirus–B.
BERV–K1 ...... Bovine endogenous retrovirus–K1.
BERV–K2 ...... Bovine endogenous retrovirus–K2.
BW ...... Body weight.
˚C...... Degrees celcius.
Ca 2+ ...... Calcium 2+ .
CAR ...... Maternal caruncle. cDNA ...... Complementary deoxyribonucleic acid.
CIDR ...... Control internal drug release.
CL ...... Corpus Luteum. cm ...... Centigram or centigrams.
CON ...... Control diet (~ 0.45 kilograms per day gain).
CP ...... Crude protein.
CRD ...... Completely randomized design.
CRH ...... Cortisol releasing hormone.
CT ...... Cycle threshold. d ...... Day or days.
DAPI ...... 4',6-diamidino-2-phenylindole.
xiv
DM ...... Dry matter.
DMI ...... Dry matter intake.
ERV...... Endogenous retroviral gene element. enJSRV ...... Endogenous Jaagsiekte sheep retroviral elements eNOS ...... Endothelial nitric oxide synthase.
FM ...... Fetal membranes.
FSH ...... Follicle stimulating hormones. g...... Gram or grams.
× g ...... Times gravity.
G:F ...... Gain:Feed.
GLUT 3 ...... Glucose transporter 3.
GLUT 14 ...... Glucose transporter 14.
GnRH ...... Gonadotrophin releasing hormone. h...... Hour or hours.
ICAR ...... Maternal endometrium.
IFN–τ ...... Interferon–τ.
IGF–1 ...... Insulin-like growth factor–1. i.m...... Intramuscular. kg...... Kilogram or kilograms. kg/d ...... Kilograms per day. km ...... Kilometer or kilometers.
L ...... Liter and liters.
LH ...... Luteinizing hormone.
xv
LSMEANS ...... Least square means.
M ...... Molarity. m ...... Meter or meters. mg ...... Milligram or milligrams. mg/kg ...... Milligrams per kilogram. min ...... Minute or minutes. mL ...... Milliliter or milliliters. mL/kg ...... Milliliters per kilogram. mo ...... Month or months. mRNA ...... Messenger ribonucleic acid. n...... Sample size.
Na ...... Sodium.
NDF...... Neutral detergent fiber.
NEFA ...... Non-esterified fatty acids. ng/mL ...... Nanograms per milliliter. nm ...... Nanometer or nanometers.
NP ...... Non–pregnant.
NP–CAR ...... Non–pregnant maternal caruncle.
NPH...... Non–pregnant uterine horn.
NP–ICAR ...... Non–pregnant maternal endometrium.
P ...... Pregnant.
PAG...... Pregnancy associated glycoprotein.
PAG–1...... Pregnancy associated glycoprotein–1.
xvi
PBS ...... Phosphate buffered saline.
P–CAR ...... Pregnant maternal caruncle.
PCR ...... Polymerase chain reaction.
PH ...... Pregnant uterine horn.
P–ICAR ...... Pregnant maternal endometrium.
PSP–60 ...... Pregnancy specific protein–60.
PSP–B ...... Pregnancy specific protein–B.
PGF2α ...... Prostaglandin F2α.
PROC GLM ...... General linear model procedure.
PROC CORR ...... Correlation procedure.
PROC MIXED ...... Mixed models procedure. qPCR ...... Quantitative polymerase chain reaction.
RES ...... Restricted diet 40 % global nutrient restriction of control diets
RNA ...... Ribonucleic acid.
SEM ...... Standard error of the means.
TMR ...... Total mixed ration.
TSC ...... Trophoblast stem cells.
µg ...... Microgram or microgram.
µm ...... Micrometer or micrometers.
VEGF ...... Vascular endothelial growth factor. wk ...... Week or weeks.
xvii
CHAPTER 1. INTRODUCTION
In 2050 the human population is projected to increase from 7.4 billion to over 9 billion people; thus, the world needs to significantly increase its output of meats on the same or less resources (Elliot, 2013; Wu et al., 2014; Reynolds et al., 2015). Efficient livestock production practices are essential to provide the food necessary to feed the future population. In beef cattle, fertilization rates are approximately 90% but only 55% of females remained pregnant by d 30 of gestation (Bridges et al., 2013). Impaired pregnancies are associated with early embryonic losses
(Reynolds et al., 2014) and long-term effects on the offspring (Reynolds and Caton, 2012).
Embryonic development depends on healthy placental formation, but currently there are limited data showing how placental insufficiency occurs in cattle.
Historically, bovine utero-placental and fetal tissues have been collected by either animal slaughter or embryonic flushing techniques. However, fetal tissues can only be obtained via embryo flushing until d 16 of gestation and slaughter approaches are expensive, thus, only limited information exists for utero-placental and fetal development after d 16 of pregnancy in cattle. Most of the 3.7 million heifers born annually are destined for the human food chain.
These heifers present an underutilized opportunity to study pregnancy establishment and embryonic loss in animals that are reproductively sound. Midventral (Wiltbank and Casida,
1956; Copelin et al., 1987) or left lumbar (Wiltbank and Casida, 1956; Hamernik et al., 1985) hysterectomies have been reported in non-pregnant females but no hysterectomy procedures have been established for pregnant animals. Thus, a procedure which allows for the collection of high quality tissues during pregnancy would provide a platform to address critical research questions regarding embryonic survival and enhanced pregnancy outcomes.
1
The developing conceptus needs the placenta for nutrients, respiratory gases, and the ability remove metabolic waste throughout pregnancy (Meschia et al., 1983; Bassil et al., 1995;
Reynolds and Redmer, 1995). Placental development is closely related to fetal growth by facilitating transfer of nutrients, gases, and wastes (Patten, 1964; Ramsey, 1982) and is sensitive to maternal nutrient supply from the earliest stages of pregnancy (Reynolds and Redmer, 1995;
2001). Inadequate maternal nutrient supply leads to poor placental development, resulting in compromised fetal growth (Wu et al., 2006; Caton and Hess, 2010; Funston et al., 2010) or even embryonic loss (Reynolds et al., 2014). One of the placental layers in closest contact with maternal circulation is the syncytiotrophoblast which is responsible for a majority of the nutrient transport for maternal circulation to the fetus. In addition to nutrient and gas exchange, the syncytiotrophoblast will produce hormones and protect the conceptus from a detrimental maternal immune response during early gestation (Moffett and Loke, 2006). In ruminants trophoblast stem cells fuse to form the syncytial plaques, which are multinucleated cells that can contain up to 25 nuclei in sheep (Wooding, 1984) and 8 nuclei in cattle (Wooding and Wathes,
1980).
Syncytium formation is initiated by endogenous retroviral elements ( ERV ) which have been incorporated into the host genome. A significant portion of the genome in made up of ERV;
8% in humans (Kurth and Bannert, 2010), 10% in mice (Jern and Coffin, 2008), and 18% in cattle (Adelson et al., 2009). The Bovidae genome contains 24 ERV families depending on the species (Garcia-Etxebarria and Jugo, 2013). The envelope proteins of syncytin-Rum1, BERVE-A and BERV-K1 are differentially expressed during early gestation (McLean et al., unpublished) may be involved with cell to cell fusion that occurs during early gestation (Cornelis et al., 2013;
Nakaya et al., 2013). In addition, Sharif et al. (2013) argued that ERV function as nutrient
2
sensors during the development of the placenta. Expression may be influenced by maternal plane of nutrition during early gestation and, thus, may interaction with insulin which is also indicative of nutrient status.
Much of our knowledge of placental vascular development and placental formation has been derived from comparative studies using animal models (Assheton. 1905; Bell et al., 1986;
Magness et al., 1998). Fetal growth and development are influenced by vascular development and function of the placenta, which ultimately influenced neonatal growth and survival
(Reynolds and Redmer, 1995; Spencer et al., 2007; Reynolds et al., 2010). Embryonic development depends on the formation of a healthy placenta because placental circulation provides the developing conceptus with an environment that is able to meet the metabolic demands of the fetus throughout pregnancy (Meschia et al., 1983; Bassil et al., 1995; Reynolds and Redmer, 1995). Embryonic losses during early pregnancy are associated with impaired placental vascularization and development (Reynolds et al., 2014).
The current literature has very limited information on the cellular interactions between fetal and maternal tissues and the nutrients needed during the establishment of pregnancy. This is due to the lack of an in vivo animal model that can provide high quality tissues in a repeatable and efficient manner. Data on ERV presence is extremely limited and non-existent for function and mechanisms of action throughout gestation in beef cattle. Therefore, the ovariohysterectomy technique described herein provides the platform to acquire this data and will lay the foundation for the elucidation of ERV function and expression pattern, influences of maternal nutrient plane, and the cellular events that are necessary for the establishment of a successful pregnancy in beef cattle.
3
CHAPTER 2. LITERATURE REVIEW
2.1. Introduction
The 280 d gestation period of cattle leaves 85 d for females to become pregnant in order to maintain a 365 d interval between calves which is instrumental in maintain high efficiency in a cow herd. However, with a 21 d estrous cycle, losing a pregnancy due to early embryonic loss severely diminishes the ability to maintain this annual cycle. Fertilization rates in beef cattle are approximately 90%; however, only 55% of females remained pregnant by d 30 of gestation
(Bridges et al., 2013). Up to 40% of all embryos are lost prior to d 40 of gestation (Thatcher et al., 1994); of that 40%, 80% occurs between d 8 and 16 of gestation (Diskin and Sreenan, 1980).
Embryonic loss is influenced by a host of factors including maternal nutrition, maternal uterine environment, maternal and embryonic hormone secretion, embryonic and extraembryonic tissue development, and probably other cellular mechanisms that are currently unknown. These loses have immense economic and social impacts on the human population. The FAO reports that livestock contribute 15% of total food energy, 25% of dietary protein, and also provide essential micronutrients not easily obtained from plant food products (Elliot, 2010; Reynolds et al., 2015).
Production of animals for food and fiber is a multi-billion dollar industry in the U.S. alone.
Currently, livestock contribute 40% of the global value of agricultural production and support the livelihoods and food security of almost 1 billion people. However, the world needs to significantly increase its output of meats by 2050 and beyond to meet the projected requirements of the rapidly growing population (Elliot, 2010; Reynolds et al., 2015); consequently, efficient and sustainable approaches to livestock production are essential.
Recently, retroviral fragments in the genome of some eutherian (placental) mammals have been reported to play a critical role in development of the feto-maternal interface to
4
promote placental nutrient transport and vascular growth, and consequently conceptus development (Sharif et al., 2013). Syncytins are a family of endogenous, integrated retroviral envelope genes thought to be involved in placental cell-cell fusion (syncytium formation) and immunosuppression, and therefore may be critical for pregnancy establishment (Dupressoir et al., 2011; Cornelis et al., 2013). A syncytin variant, syncytin-Rum1 , has been identified in cattle and sheep (Cornelis et al., 2013). In addition to syncytin-Rum1, four retroviral genes, BERVE-A,
BERVE-B, BERV-K1, and BERV-K2 , have been found in the bovine trophoblast (Koshi et al.,
2012). However, the function and importance of retroviral elements in fetal and placental development is not fully understood.
Placental growth and development are closely related to fetal growth, and both are sensitive to maternal nutrient supply from the earliest stages of pregnancy (Reynolds and
Redmer, 1995; 2001). Placental development occurs early in gestation and supports fetal growth by enabling nutrient, gas, and waste transfer between fetal and maternal circulations (Patten,
1964; Ramsey, 1982). Therefore, embryonic development depends on the formation of a healthy placenta. Embryonic loss during early pregnancy is associated with impaired placental vascularization and development (Reynolds et al., 2014). Inadequate maternal nutrient supply leads to poor placental development, resulting in compromised fetal growth (Wu et al., 2006;
Caton and Hess, 2010; Funston et al., 2010). Impaired pregnancies have also been shown to have long-term effects on the offspring by decreasing offspring efficiency, health, and productivity of the offspring throughout their lives (Wu et al., 2006; Caton and Hess, 2010; Funston et al.,
2010). Therefore the scope of this review will cover the current knowledge of retroviral elements in reproduction, placental and fetal development, and vascular changes during pregnancy.
5
2.2. Retroviruses
The mammalian genome contains thousands of endogenous retroviral gene elements
(ERV), most of which are non-functional; however, those containing open reading frames promote the fusion of stem cells (Dupressoir et al., 2011). Endogenous envelope genes of retroviral origin (Gifford and Tristem, 2003; De Parseval and Heidmann, 2005) comprise a significant portion of the genome; 8% in humans (Kurth and Bannert, 2010), 10% in mice (Jern and Coffin, 2008), and 18% in cattle (Adelson et al., 2009). A class of these known as syncytins contribute to the formation of the syncytiotrophoblast in humans (Blond et al., 2000; Mi et al.
2000), mice (Dupressoir et al., 2005; 2009; 2011), rabbits (Heidmann et al., 2009), and carnivores (Cornelis et al., 2012), and syncytial plaques in ruminants (Cornelis et al., 2013) In addition, Sharif et al. (2013) argues that, in the developing placenta, ERV likely function as nutrient sensors that may be turned on during periods of hypomethylation. Therefore, ERV may be involved in developmental programming events associated with maternal nutrient restriction and in addition may be involved in placental nutrient transport and syncytium formation.
2.2.1. Syncytia Formation
Trophoblast stem cells (TSC) fuse to form the syncytiotrophoblast a tissue layer that functions as an interface between the fetus and dam (Gifford and Tristem, 2003). In humans and rodents, implantation of the embryo occurs through invasion into the uterine endometrium
(Watson and Cross, 2005). Formation of the feto-maternal interface is essential for implantation and normal fetal development. Throughout the rest of gestation the syncytiotrophoblast will function to exchange nutrients and gases between maternal and fetal circulation, i.e. the major functioning layer of the placenta. In addition to nutrient and gas exchange, the syncytiotrophoblast will produce hormones, such as progesterone and placental lactogen
6
(Spencer and Bazer, 2004), and protect the conceptus from the maternal immune responses
(Moffett and Loke, 2006). Three placental types are present in species that exhibit any type of syncytium formation: hemochorial in humans and rodents, endotheliochorial in carnivores, and syndesmochorial in ruminants (Cornelis, 2013). Placental syncytium formation in ruminants is unique among mammals, as syncytial plaques take the place of the syncytiotrophoblast found in other species. Syncytial plaques form within the placentomes of ruminants; however, the exact function of these plaques remains to be elucidated. Syncytial plaques are multi-nucleated cells with up to 25 nuclei in sheep (Wooding, 1984) and 8 nuclei in cattle (Wooding and Wathes,
1980). While it has been shown that syncytium is vitally important for some mammals, little is known in mammals, like ruminants, with unique syncytial structure.
2.2.2. Bovine Retroviral Elements
The Bovidae genome contains 24 ERV families depending on the species (Garcia-
Etxebarria and Jugo, 2013). Syncytin-Rum1 was originally identified in the bovine genome, but an ovine syncytin-Rum1 with 92% sequence homology has also been identified. Both syncytins have cell-cell fusion and immunosuppressive activity (Cornelis et al., 2013). However, 4 genes in addition to syncytin-Rum1 : BERVE-A, BERVE-B, BERV-K1, and BERV-K2 have been shown to be expressed in bovine trophoblast cells (Koshi et al., 2012) and thus may be influential in placental and fetal development. The envelope proteins of BERVE-A and BERV-K1 may be involved with increased binucleation and fusion between maternal and fetal epithelial cells that occurs during early gestation (Koshi et al., 2012). However, BERV-K1 has been reported to have greater fusogenic capabilities than either BERVE-A or syncytinRum-1 (Nakaya et al., 2013) . The classical functions of immune suppression and cell to cell fusion associated with ERV in the placenta along with the presence of ERV in fetal tissues and maternal endometrium are
7
intriguing to possible roles in the establishment of pregnancy. However, relatively little data exist regarding the actual function and importance of ERV in bovine reproduction.
2.2.3. Syncytin in Other Mammals
The human placenta only has one tissue layer that makes up the syncytiotrophoblast
(Dupressior et al., 2011) which is formed in response to two ERV, syncytin-1 and -2, to connect fetal membranes and maternal blood pool (Fisher et al., 1989). Therefore, the syncytiotrophoblast is the site of nutrient transfer, gas exchange, hormone production, and fetal protection from the maternal immune response. Syncytin-1 has been suggested to be the source for the evolutionary differences seen in the human placenta from new world monkeys with its ability to fuse together the cells of the cytotrophoblast (Blond et al., 2000). Similarly, syncytin-2 has shown the ability to bind together cells within the placental tissue but through a different receptor than syncytin-1 (Blaise et al., 2003). Endogenous retroviral elements are present in human placenta but with the issues in acquiring human tissues data is limited on function at key time points. However, the pregnant rodent model has been to elucidate the functions and importance of ERV in pregnancy.
Rodents express two ERV ( syncytin-A and –B) which are differentially expressed in the two distinct layers of the syncytiotrophoblast and are essential for normal development of the placenta (Dupressior et al., 2011). In the mouse, the two retroviral envelope genes are involved with fusion of TSC (Dupressior et al., 2005). Interestingly, syncytin-A and -B, function together in some knockout models and independently in others (Dupressior et al., 2011). Syncytin-A is involved in the fusion of TSC that forms the inner layer of the syncytiotrophoblast. A deficiency in s yncytin-A will alter TSC fusion causing inefficient placental transport, decreased vascularity, and growth retardation. Knockout mice without the syncytin-A gene exhibit abnormal
8
embryogenesis, ultimately terminating pregnancy between d 11.5 and 13.5 of gestation
(Dupressior et al., 2009). Unlike syncytin-A, synctin-B influences the outer layer of the syncytiotrophoblast and is important but not vital gestation to progress to term. In animals with only syncyin-B deficiency gestation continues to term but will result in fetal growth retardation
(Dupressior et al., 2011). Syncytin-A and –B play important roles in normal gestation in rodents.
Thus, the possible roles for ERV, syncytia and normal fetal development in other mammals and humans may provide insight into the roles of ERV in ruminant pregnancies.
2.2.4. Endogenous Jaagsiekte Sheep Retrovirus
A non syncytin ERV, endogenous Jaagsiekte sheep retroviral (enJSRV), has been identified within the placenta of sheep which may also be important in the establishment and development of normal pregnancies. This retroviral gene element is highly related to both the betaretrovirus Jaagsiekte retrovirus and enzootic nasal tumor virus (DeMartini et al., 2003).
Sheep possess ~20 copies of enJSRV elements which have been reported to be influential in the fusion between endometrial and fetal trophoblast cells and the formation of placental tissues
(Dunlap et al., 2005; 2006). Expression of enJSRV is limited to uterine, oviductal, cervical, and vaginal epithelia (Palmarini et al., 2000; 2001). However, different copies of enJSRV are active in different breeds, which suggest that these retroviral elements were incorporated into the genome after or during the evolutionary differentiation of different sheep breeds (Arnaud et al.,
2007; McLean et al., 2014). Due to the differential expression of enJSRV amongst different breeds they have also been used to determine evolutionary progress of sheep (Chessa et al.,
2009). The last known enJSRV to encorporate in the sheep genome was ~200 years ago but with exogenous Jaagsiekte sheep retroviruses still active future enJSRV may still be incorporated into
9
the sheep genome. This indicates that mammals may still be actively incorporating or producing, unbeknownst to them, new retroviral elements with evolutionary advantages.
2.3. Pregnancy Establishment
2.3.1. Interferon-Tau
Interferon-τ (IFN-τ) is a type I interferon with paracrine antiviral, antiproliferative, and immunomodulatory functions (Roberts et al., 1992; Bazer et al., 1996) secreted by the embryonic trophoectoderm (Bazer et al., 1996) to act upon the maternal uterine endometrium. In addition to being the key for pregnancy recognition in ruminants, IFN-τ will stimulate a host of genes with a wide variety of functions. At this time little is known about the importance of interferon stimulated genes; however; some may be influential in the successful establishment of pregnancy and embryonic development. While this protein is highly conserved amongst ruminant species most ruminant species process 4 to 5 gene copies of IFN-τ (Roberts et al., 1992). There have been no IFN-τ genes found within the genome of the horse, pig, llama, dolphin, mouse, rabbit, or human to date (Leaman and Roberts, 1992). Therefore, it is suggested that this interferon class diverged from IFN-ω between 40 and 80 million years ago (Leaman and Roberts, 1992).
Interferon-τ is comprised of 172 amino acids without any introns and was originally thought to be a subclass of omega interferons (Bazer et al., 1997).
The carboxyl terminus of IFN-τ appears to be conserved amongst several interferons and is the source of the anti-viral effects; however, the amino terminus is specific for IFN-τ and is likely where IFN-τ obtained the anti-luteolytic effects (Pontzer et al., 1990; Schalue, 1992). This structural similarity, although not functional, is understandable since most type I interferons, α,
β, ω, τ, κ, δ, and ε, all have a high degree of sequence homology. However, IFN-τ appears to be more conserved between ruminant species than with other type I interferons. In fact, there is
10
greater homology between bovine IFN-τ and ovine IFN-τ than between bovine IFN-τ and bovine
IFN-ω (Roberts et al., 1992). It has been shown that this interaction is necessary, in ruminants, for the maternal recognition of pregnancy, attachment of the conceptus to the uterine endometrium, and normal embryonic development.
2.3.2. Maternal Recognition of Pregnancy
In mammals, maternal recognition of pregnancy hinges on multiple factors but the most important factor is the maintenance of no less than one functional CL in the ovary for progesterone secretion (Bazer et al., 2010). The progesterone concentration must remain elevated within the uterus and systemically for the maintenance of pregnancy. This is a complex process which involves multiple hormones and tissues. In ruminants, this process is initiated by the secretion of IFN-τ from mononucleated fetal trophoblast cells beginning on d 12 in sheep and 14 in cattle and goats ( Bazer et al., 1997). The antagonistic action of IFN-τ influences the pulsatility of prostaglandin F2α (PGF2α). The luteolytic pulses of PGF2α are stimulated from the sequential binding of progesterone, estradiol, and oxytocin and the enzymatic activity of prostaglandin synthase 2 (Bazer et al., 2015).
When a female ruminant is not pregnant the CL will secrete progesterone which stimulates accumulation of arachidonic acid, a precursor to PGF2α and inhibits the expression of estrogen receptor α and receptors for oxytocin within the uterus. As CL maturation occurs progesterone receptors are down-regulated, about d 15 into the estrous cycle, which removes the
“progesterone block” on the reproductive tissues. Thus, the uterus will begin to respond to the secretion of oxytocin from the posterior pituitary and initiate the secretion of PGF2α (~ d 18).
The initial pulse of oxytocin comes from the hypophyseal gland and utilizes protein kinase C to transduce the signal within the uterus to stimulate PGF2α secretion (Silva and Raw, 1993).
11
However, once the first pulse of PGF2α is released, from the uterus, the CL will also secrete oxytocin in a positive feedback mechanism. These pulses of oxytocin and PGF2α will continue until the ovarian stores of oxytocin are depleted (McCracken et al., 1984). There are six functions PGF2α must perform on the ovary to complete luteolysis 1) decrease blood flow to the
CL; 2) down regulate LH receptors; 3) uncouple LH from adenylyl cyclase; 4) activate protein kinase C; 5) initiate an influx of Ca 2+ ; and 6) activate a cytotoxic cascade (Niswender and Nett,
1994). However, when the animal has conceived and there is a developing conceptus present this process must not occur or the pregnancy will be lost. The alterations of PGF2α pulsatility is initiated by IFN-τ (Bazer et al., 2010).
The secretion of IFN-τ from the trophoblast is widely accepted as the ruminant signal for pregnancy recognition (Thatcher et al., 1989; Bazer et al., 1991; Bazer, 1992; Mann et al., 1999;
Spencer and Bazer, 2004; Spencer et al., 2007). When a viable embryo is present and has developed to an elongated blastocyst, the trophoblast of the conceptus will secrete IFN-τ. This can occur as early as d 9 after fertilization (Roberts et al., 1992) reaching maximum concentrations reached around d 14 after conception in sheep (Spencer et al., 2004; Bazer et al.,
2015) and d 16 to 18 after mating in cattle (Mann et al. 1999). The secretion of IFN-τ silences the transcription of the alpha estrogen receptor which then prevents the expression of estrogen dependent oxytocin receptors within the luminal membrane of the uterine endometrium.
However, progesterone must be present in adequate concentrations for IFN-τ to suppress the release of PGF 2α stimulated by oxytocin (Meyer et al., 1995) and maintain pregnancy (Mann and
Lamming, 2001; Green et al., 2005; Mann et al., 2006; Bazer et al., 2015). Interferon- τ secretion does not decrease PGF2α concentrations within the uterus but does inhibit the pulsatile secretions that are necessary for luteolysis (Bazer et al., 2015). There must be no less than five
12
PGF2α pulses within 24 h for complete luteolysis. Interferon-τ also stimulates the secretion of many proteins, like pregnancy specific protein-B (PSP-B), potentially necessary for the establishment of pregnancy (Teixeira et al., 1997; Perry et al., 1999; Binelli et al., 2001; Bazer et al., 2015). The importance of IFN-τ and maternal recognition of pregnancy are well established; however, all functions of IFN-τ in stimulating expression of specific genes and mechanisms of action during the establishment of pregnancy remain to be fully understood.
2.3.3. Pregnancy Specific Protein-B
There have been 21 members of the pregnancy associated glycoprotein (PAG) family
(Green et al., 2000). The assortment of PAG present may provide a multitude of binding sites and perform a variety of functions at and during the formation of the feto-maternal interface
(Green et al., 1998). This glycoprotein family can be split into 2 categories dependent on when ruminants first began production of the protein. The ancient PAGs appear greater than 87 million years ago; whereas the modern PAGs appear less than 52 million years ago (Green et al., 2000;
Hughes et al., 2000). The more ancient PAGs (6 of 21) have been reported to be expressed in all trophoblast cells; however, the more modern PAGs (15 of 21) have been found only in trophoblastic binucleate cells (Green et al., 2000; Hughes et al., 2000; Wooding et al., 2005).
While the ancient PAGs and mononucleated trophoblasts appear to have less interaction with endometrial tissue. The binucleated cells and modern PAGs seem to interact extensively with maternal connective tissue which develops during placental villi formation (Wooding et al.,
2005). However, the exact functions of both types of PAG remain to be elucidated. It has been speculated that PAGs may possibly be involved in proteolytic activation of growth factors and other molecules specific to pregnancy, protection of fetal tissues from maternal immune
13
response, transport of hormones between fetal and maternal tissues, and cell to cell fusion
(Wooding et al., 2005)
The attempt to derive a substance that could be used for early pregnancy detection in the serum of cattle was the driving force behind the discovery of PAGs (Butler et al., 1982; Eckblad et al., 1985; Wooding et al., 2005). Pregnancy associated glycoprotein 1 (PAG-1; Xie et al.,1991;
Zoli et al., 1991;1992), is closely related to and quite possible identical to two other proteins discovered at approximately the same time, PSP-B (Butler et al., 1982) and pregnancy-specific protein 60 (PSP-60; Mialon et al., 1993; 1994). Both PAG-1 and PSP-B belong to the aspartic proteinase family (Xie et al., 1991; Green et al., 1998). However, only PAG-1 has been characterized in terms of carbohydrate and sialic acid content (Xie et al., 1995). Both PSP-B and
PAG-1 have identical genomic sequences; however, due to post-translational modification are not identical proteins and likely perform differing functions on the endometrium and developing placenta.
Both PSP-B and PAG-1 have been successfully used for early pregnancy diagnosis
(Butler et al., 1982; Zoli et al., 1991; Mialon et al., 1993); however, PSP-B is more accurate for pregnancy determination. The half-life for PSP-B is aproxiamtely seven d (Semambo et al.,
1992); whereas the half-life for PAG-1 is approximately three d (Szenci et al., 2003) after embryonic or fetal loss. These residual concentrations of PSP-B and PAG-1 following embryonic loss have hindered use as a method for early pregnancy detection (Humblot et al.,
1988b; Semambo et al., 1992; Szenci et al., 2003). Pregnancy-specific protein B is secreted in detectable quantities as early as d 15 of gestation (Bulter et al., 1982; Sasser et al., 1986); however, concentrations vary greatly until after d 30 (Sasser et al.,1986;Humblot et al., 1988a;
Sasser et al., 1991; Vasques et al., 1995). Binucleate cells form and begin secreting PSP-B
14
around d 17 of gestation (Xie et al., 1991), which suggests that PSP-B may synergize with interferon-τ to maintain pregnancy and to stimulate the secretion of uterine proteins (Austin et al., 1999). Pregnancy specific protein B stimulates the release of prostaglandin E 2 from the uterine endometrium (DelVecchio et al., 1996) as well as prostaglandin E 2 and progesterone from the corpus luteum (DelVecchio et al., 1990; DelVecchio et al., 1995; Weems et al., 1997).
Aside from the use of PAG for early pregnancy detection limited research has been done on mechanisms and functions during gestation in ruminant animals, specifically cattle.
2.3.4. Roles of Other Hormones
Reproductive processes in mammals are controlled by two steroid hormones, progesterone and estradiol. Both of these hormones are derivatives of de novo and exogenous cholesterol and can pass through the cellular membrane and the nuclear membrane to influence transcription after binding to their respective response elements. Progesterone, a 21 carbon molecule, is secreted from the CL to support pregnancy maintenance, suppress estrus behavior, gonadotrophin releasing hormone pulse frequency, systemic LH, and FSH (Bazer et al., 1997).
The uterine endometrium requires progesterone for conceptus growth, implantation, and placental development (Bazer, 1975; Bazer et al., 1979; Spencer and Bazer, 2002; Spencer et al.,
2004). The major function by which progesterone influences estrus behavior is by recruitment of phospholipids stores (Boshier et al., 1987) and stimulation of prostaglandin synthase, which is rate limiting, for the conversion of arachidonic acid to PGF2α (Eggleston et al., 1990). While progesterone is known as the hormone of pregnancy, successful reproduction requires adequate levels of progesterone and estrogen to be present at specific times.
Estrogens require further cleavage down to an 18 carbon molecule and initiate the events for the ovary to ovulate a dominant follicle. Within the uterus, estrogens will up-regulate the
15
oxytocin receptor, increase oxytocin secretion from the neurohypophysis, and aide in mediating the intracellular events leading to PGF2α secretion (Flint and Sheldrick, 1986). Elevated concentrations of estrogen in the absence of progesterone are necessary to initiate standing estrus
(Echternkamp and Hansel, 1971; Henricks et al., 1971; Wettemann et al., 1972). Due to larger follicles producing more estrogen and luteal cells, concentrations of estrogen are related to those of progesterone during the subsequent luteal phase and also during the establishment and maintenance of pregnancy (Miller and Moore, 1976a; b 1983, Moore, 1985; Wilmut et al., 1986).
Pregnancy success is positively related to concentrations of estradiol at the induction of ovulation (Vasconcelos et al., 2001; Perry et al., 2005; Lopes et al., 2007; Geary et al., 2013) and reduced preovulatory estradiol concentrations are also related to receptivity of the uterus and decreased pregnancy rates (Bridges et al., 2010; Atkins et al., 2013; Jinks et al., 2013). Abnormal uterine function, which resulted from a reduced estradiol concentration, increased embryonic mortality between d 15 and 30 of gestation (Bridges et al., 2010). However, preovulatory estradiol concentrations did not influence levels of IFN-τ or conceptus development (Bridges et al., 2012). Follicular size and, thus, estrogen concentrations influence the success of embryonic survival; therefore, hormones such as insulin and IGF-1 may also indirectly influence pregnancy establishment via follicular growth.
Insulin mediates the availability of energy to tissues by altering systemic glucose concentrations. Plasma concentrations of insulin can be used as an indicator of the nutritional status of cattle (Ciccioli et al., 2003; Lents et al., 2005). Similar to concentrations of glucose in plasma, insulin in postpartum beef cows is not indicative of luteal activity (Vizcarra et al., 1998), but plasma glucose and insulin concentration are significant predictors of days to second postpartum ovulation in dairy cows (Francisco et al., 2003). Systemic concentrations of glucose
16
and insulin are reduced, and concentrations of NEFA are elevated, when non-lactating cyclic cows receive inadequate nutrients (Richards et al., 1989) and in dairy cows during early lactation
(Butler and Smith, 1989). Insulin infusion will increase GnRH secretion from the hypothalamus when concentrations of glucose are adequate, indicating insulin facilitates GnRH secretion through regulation of glucose (Arias et al., 1992). The ability of insulin to regulate glucose is altered during nutritional deprivation by decreased glucose clearance and increased concentrations of insulin in serum of cows (Richards et al., 1989).
Insulin will also influence endocrine function of the ovary by increasing the number of follicular thecal (Stewart et al., 1995), and granulosa (Spicer et al., 1993) cells. Insulin and LH are synergistic to increase thecal cell production of progesterone and androstenedione (Stewart et al., 1995) and insulin and glucose are additive to increase steroid production (Stewart et al.,
1995). Insulin stimulates granulosa cells from both large and small follicles to increase progesterone production. Exposure of differentiated granulosa cells from large follicles to increased concentrations of insulin and FSH will enhance production of estradiol (Spicer et al.,
1993). Insulin will stimulate estradiol production in granulosa cells of small follicles even in the absence of IGF-I and FSH (Spicer et al., 1993). The concentrations of insulin may indirectly influence the chance for a successful pregnancy. Insulin may also work in conjunction with progesterone and estrogen, which are vital, to the uterine receptivity, fetal development, and the establishment of pregnancy.
2.3.5. Changes in Uterine Tissues
The uterus must supply the fetus with nutrients even before attachment has occurred. This is accomplished through endometrial gland secretions, known as histotroph (Bazer et al., 1981).
This secretion is restricted to the uterine glands within the intercaruncular endometrium during
17
apposition (~d 20 – 30) but becomes evident in caruncles as gestation develops (Guillomot et al.,
1981; Guillomot and Guay, 1982). The epithelial cells around the uterine lumen typically exhibit cytoplasmic protrusions common to apocrine secretion, which is understandable due to the histotroph providing adequate nutrients to the fetus while minimizing transport distance.
Conceptus apposition initiation becomes apparent when the uterine endometrium increases in vascular permeability and stromal edema (Boshier, 1970). At this time the caruncular surface becomes wrinkled and concave on the surface. After the completion of attachment and during the adhesion process the uterine epithelial cells transition from cuboidal to flat, merely a narrow layer with areas of degeneration and partial syncytium formation (King et al., 1982). The changes in uterine environment due to hormone concentrations and nutrient secretions and overall morphological changes are vital to support fetal and placental development and the establishment of pregnancy.
2.4. Fetal Development
2.4.1. Pre-Implantation
The development of the embryo after fertilization progresses rapidly. After successful fertilization occurs, cell proliferation within the embryo will occur rapidly with cell numbers doubling approximately every 24 h (Winter et al., 1942). By d 4 after fertilization the bovine embryo is transitioning to the morula stage and entering the uterus. The embryo will begin to form a blastocyst after the morula stage and undo go hatching from the zona pellucida. The blastocyst begins to elongate by about d 13 of gestation and rapidly expands for the next 3 or 4 d resulting in a filamentous embryo with a well-defined embryonic disc in the middle. When elongation is complete the embryo will occupy the entire uterine horn ipsilateral to the CL
(Guillomot, 1995). At this stage of gestation the inside of the trophoblast is lined with by the
18
endoderm and yolk sac. The trophoblast at this time is made up of cuboidal cells with structural features of polarized epithelium, numerous apical microvilli, epithelial cytoskeleton proteins, lateral membranes joined via tight junctions, desmosomes, and a basal membrane (Guillomot and
Fléchon, 1990; Guillomot, 1995).
2.4.2. Apposition, Implantation, and Adhesion
In cattle, the elongated, filamentous embryo prepares for attachment to epithelial cells of the uterine endometrium which occurs around d 18 (Betteridge et al., 1980; King et al., 1981).
Before this the embryo can be removed, via flushing, without damage to the trophoblast or uterine endometrium (King et al., 1981). These cell to cell contacts are guaranteed by close positioning of the trophoblast membrane and the microvilli of the uterine endometrial cells by d
19 to 20 in cattle (Leiser, 1975; Wathes and Wooding, 1980). This contact between maternal endometrium and trophoblast begins at the embryonic zone and spreads towards the ends of the extra-embryonic membranes. The distance between the uterine endometrium and developing trophoblast is maintained at 15 to 20 nm (Wathes and Wooding, 1980; Wooding et al., 1994).
Around the time of attachment the embryo is surrounded by the chorionic vesicle via trophoblastic folding giving rise to the amnion (Ramsey, 1982). The trophoblast begins to show ridges similar to the wrinkles on the caruncle or in areas apposing intercaruncular endometrium villi begin to project into the uterine glands (Guillomot et al., 1981; Guillomot and Guay, 1982;
Wooding et al., 1982). These projections appear to aide in the positioning of the embryo in preparation for implantation and provide nutrients to the developing conceptus. However, these projections are replaced in later gestation by areolae around the uterine glands within the endometrium (Wimsatt, 1950). At this time the trophoblast cells lose the rounded appearance and become flat, spindle shaped cells, the microvilli are reduce in length and density (Guillomot et
19
al., 1981; Guillomot and Guay, 1982), and have a major reorganization of polarization (Denker,
1993); all of which aides in attachment and implantation. After attachment has been accomplished there must be extensive adhesion that occurs between the uterine endometrium and the trophoblast. This adhesion is reinforced by the uterine microvilli which penetrate into the folds of the trophoblastic cell membranes. This adhesion is likely accomplished with the aid of glycosylated membrane proteins (Guillomot, 1995).
2.4.3. Angiogenesis and Placental Vascularization
Much of our knowledge of placental vascular development and placental formation has been derived from comparative studies using animal models (Assheton. 1905; Bell et al., 1986;
Magness et al., 1998). Placental formation and vascular development during early gestation are vital to establishment of pregnancy. Placental circulation provides the developing conceptus with a uterine environment that is able to meet its metabolic demands and facilitates nutrient, respiratory gas, and metabolic waste exchange between the maternal and fetal systems throughout pregnancy (Meschia et al., 1983; Bassil et al., 1995; Reynolds and Redmer, 1995).
Placentome number and vascularity increases during the last two trimesters of gestation in association with increased growth (Borowicz et al., 2007). Fetal growth and development are influenced by vascular development and function of the placenta, ultimately influencing neonatal growth and survival (Assheton, 1905; Trudinger et al., 1985; Roberts et al., 1992; North et al.,
1994; Meyer et al., 1995; Reynolds and Redmer, 1995; Harrington et al., 1997; Spencer et al.,
2007; Vonnahme et al., 2007; Grazul-Bilska et al., 2010; Reynolds et al., 2010; Grazul-Bilska et al., 2011; 2013).
20
2.5. Developmental Programming
2.5.1. Nutritional Influences on Fetal Growth, Development and Survival
Factors that influence fetal and placental growth and development include maternal plane of nutrition, number of fetuses, maternal parity and age, maternal and fetal genotype, and maternal stress (Assheton, 1905; Trudinger et al., 1985; North et al., 1994; Reynolds and
Redmer, 1995; Harrington et al., 1997; Vonnahme et al., 2007; Reynolds et al., 2010). A unique circumstance occurred during WWII in the Netherlands known as the Dutch Famine. This severe restriction in food supply limited residents to less than 1000 Calories per day, however people still had children and good records were kept. Analysis of these records sparked interest in the effects of maternal nutrition on human fetal development and risk of disease in adulthood
(Roseboom et al., 2011). The theory of the fetal origin of adult disease was developed from the
Dutch famine data with the impacts varying widely between sexes, time of restriction, and severity of restriction (Barker et al., 1993). Restriction of nutrients in early gestation increased the incidence of brain damage, impaired brain function, and development of anti-social personality disorders (Stein et al., 1972). Nutrient restriction in early gestation also increased the prevalence of heart disease (Painter et al., 2006) and hypertension (Stein et al., 2006). While just a small portion of mass accumulation, the foundation for rapid growth seen later in fetal development and significant differentiation occurs during early gestation.
Nutrient restriction of humans during mid-gestation altered formation of glomeruli, overall kidney function, and airway formation (Lopuhaa et al., 2000). Exposure to restricted nutrients at any time during gestation increased the chance for cardiovascular disease, metabolic disorders, breast cancer, and obesity to develop during adulthood (Painter et al., 2008a). Similar to domesticated livestock, stress to human fetuses influences each sex differently. The Dutch
21
Famine studies indicated that women exposed to nutrient restriction in utero have increased fertility with a greater incident of twins, larger families, and reached puberty at a younger age
(Lumey and Stein, 1997; Painter et al., 2008b). This may be an attempt to overcome increased mortality rates within nutrient restricted environments. In contrast fetal nutrient restriction did not influence male fertility. Nutrient restriction increases neonatal adiposity in both sexes, but male fetuses have a greater incident of this increase resulting in obesity (Ravelli et al., 1976;
Ravelli et al., 1999).
2.5.2. Bovine
Most cow-calf production in the western United States utilizes rangeland forages as a major source of feedstuffs for cattle. These forages experience cyclic periods of growth and dormancy throughout the year. Thus, early in the growing season highly nutritious forages are present; however, as growing season advancing forages become mature, dormant, and overall less nutritious (Powell et al., 1982; McCollum et al., 1985; Adams et al., 1987). Nutrients available from forages do not always match requirements of grazing livestock (Hart, 1991).
Forages are usually dormant during late summer and winter months which often results in inadequate nutrient supply for gestating cows (Caton and Dhuyvetter, 1997). Lack of available nutrients in spring-calving cows occurs during mid to late gestation and in fall-calving cow’s restriction before breeding through the first half of gestation. Supplementation of rumen degradable protein, which can be deficient in dormant forages (Cline et al., 2009), will have a positive associative effect to increase DMI and digestion (Campling, 1970; McCollum and Horn,
1990; Köster et al., 1996), thus, increasing total protein and energy available to the animal. This increase in DMI is typically enough to alleviate deficiencies due to minimal intake of poor forages.
22
Nutrient restriction during early to mid-gestation may not influence birth weight (Martin et al., 2007; Long et al., 2009) or may reduce birth weight (Carstens et al., 1987; Spitzer et al.,
1995; Larson et al., 2009) dependent on time and severity of restriction. Reduced nutrient intake in late gestation increased the weight of the placenta to compensate for less maternal nutrients
(Rasby et al., 1990). In contrast to the increase in placental weight, numbers of cotelydons (Long et al., 2009; Grazul-Bilska et al., 2010) surface density, and number of capillaries within the placentome were decreased after nutrient restriction (Vonnahme et al., 2007). When postnatal nutrition was adequate BW at weaning was not affected by birth weight (Freetly et al., 2000).
Postnatal supplementation, such as creep feeding, or grazing improved forage will increase weaning weights (Funston et al., 2010). However, nutrient restriction has been reported to reduce
(Long et al., 2010c) or not influence (Stalker et al., 2006; Long et al., 2012) organ development depending on time and severity of restriction.
Maternal nutrient restriction during early to mid-gestation (d 30 to 125) will decrease muscle mass and increase adipocyte growth and overall fatness of offspring (Long et al., 2009).
Calves that were nutrient restricted during early to mid-gestation had decreased muscle mass and increased adipocyte diameter at harvest (Long et al., 2012). Nutrient restriction, in utero, may increase (Long et al., 2012) or have no effect (Stalker et al., 2007; Larson et al., 2009) on yield grades of carcasses. The decrease in muscle mass may be due to a decrease in the number of muscle fibers (Long et al., 2010c). Adipose deposition may be increased by a greater concentration of glucose in plasma of restricted vs. adequately fed calves.
Nutrient restriction during late gestation will affect weight and tissue growth more than development and differentiation, due to the immense increase in growth rate that occurs during the last third of gestation (Robinson et al., 1977; Bauman and Currie, 1980). Nutrient restriction
23
during the last trimester can decrease birth weight (Dunn et al., 1969; Corah et al., 1975; Bellows and Short, 1978). Energy restriction during late gestation will also reduce the ability of the offspring to thrive and may even result in reduced BW at weaning (Corah et al., 1975). Similarly with human studies, nutritional restriction during gestation may not influence birth weight but can decrease BW and composition of beef cattle.
2.5.3. Ovine
The ovine model has been used extensively to determine the effect of maternal nutrition on growth and development of the fetus. Birth weight is not influenced when ewes receive inadequate nutrients during early gestation (Wu et al., 2006; Ford et al., 2007; Long et al.,
2010a). However, nutrient restriction during late gestation decreased birth weight of lambs
(Reed et al., 2007) and subsequent milk production of ewes (Tygesen et al., 2007; Swanson et al., 2008; Meyer et al., 2011). Similar to cattle, nutrient restriction influences the composition of skeletal muscle. The number of muscle fibers are decreased when lambs are restricted during early gestation (Zhu et al., 2006). Whereas, nutrient restriction late in gestation decreases the size of each myocyte but does not alter the number of fibers within the muscle (Greenwood et al.,
2000)
Alterations in glucose metabolism occurs in lambs born to both underfed and obese ewes
(Gardner et al., 2005; Ford et al., 2007; Long et al., 2010a; Vonnahme et al., 2010) and is probably associated with changes in pancreatic development and insulin resistance due to early overexposure of tissues to insulin (Ford et al., 2009). Concentrate diets fed to lambs from nutrient restricted ewes exacerbates glucose intolerance and increases the amount of adipose deposition (Ford et al., 2007). Lambs born to obese ewes had restricted development of gastro- intestinal tissue (Long et al., 2010a).
24
Nutrient restriction during early gestation may have a greater influence on peripheral organogenesis but can also alter brain development. Nutrient restricted lambs had a decrease in cortisol concentrations (Bispham et al., 2003) and ability to naturally respond to stress via cortisol release (Long et al., 2010b) but when challenged with ACTH or CRH responses were similar to control lambs. This indicates influences on the hypothalamus and/or pituitary glands rather than adrenal gland dysfunction. Nutrient restricted lambs had decreased concentrations of progesterone in plasma and overall fertility compared with non-restricted animals (Long et al.,
2010b). Limited nutrient intake of humans, cattle, and sheep during gestation will influence the growth of offspring, organ development and endocrine function. The acquisition and understanding of the effects of nutrient restriction, or over nourishment, will allow for more efficient production of livestock and longer, healthier lives for all animals.
2.5.4. Nutritional Influences on Placental Development
The long-term effects of restricted nutrient intake during early gestation may be associated with impaired placental development or poor contact during the establishment of the feto-maternal interface resulting in intrauterine growth retardation (Zhang et al., 2015). The prenatal growth trajectory is sensitive to direct and indirect effects of maternal dietary intake from the earliest stages of embryonic life even though nutrient requirements for conceptus growth are negligible (Robinson et al., 1999; Wallace et al., 2006). Data indicate that production efficiency and health complications throughout life are ‘programmed’ into the offspring during times of poor maternal diet influencing fetal development (Wu et al., 2006; Caton and Hess,
2010; Funston et al., 2010; Reynolds et al., 2010; Reynolds and Caton, 2012). In livestock, low birth weight can be associated with preweaning death, which ranges from 6.6 to 12.0 % for lambs (USDA, 2010) and calves (Azzam et al., 1993; USDA, 2007) in the U.S., and can also
25
influence profitability by reducing weaning weights (Corah et al., 1975) and increasing costs associated with health treatments of unthrifty animals.
Nutrient restriction during late gestation will increase placental weight (Rasby et al.,
1990) but restriction during early gestation will decrease placental weight in cattle (Vonnahme et al., 2007). Unlike cattle, nutrient restriction during early and late gestation does not influence placental weight in sheep. However, maternal undernutrition during mid-gestation has been reported to increase, decrease or have no effect on placental weight in sheep (reviewed in Kelly,
1992; Heasman et al., 1999). Early gestational restriction decreased the number of cotelydons
(Long et al., 2009), as well as capillary surface density, and number of capillaries within the placentome (Vonnahme et al., 2007). Nutrient restriction in ewes will alter placentome formation causing the increase in cotyledon and caruncle contact to occur earlier in gestation (Vonnahme et al., 2006). Increased cotyledonary vascular density during nutrient restriction probably increases the amount of nutrients available to the fetus (Zhu et al., 2007). Decreased vascular density of cotyledons in obese or over nourished ewes may decrease growth rate (Zhu et al., 2009).
Reduced uterine blood flow and increased vascular resistance are associated with fetal growth retardation (Thatcher et al., 1989; Bazer et al., 1991; Bazer, 1992), and reduced placental vascularity is associated with early embryonic mortality (Mann et al., 1999; Spencer and Bazer
2004). Maternal nutrient restriction during early gestation decreased the number of cotyledons in cattle (Long et al., 2009; Grazul-Bilska et al., 2010), as well as capillary surface density and number of capillaries within the placentome (Grazul-Bilska et al., 2013). Reduced uterine blood flow and increased vascular resistance is associated with fetal growth retardation (Trudinger et al., 1985; North et al., 1994; Harrington et al., 1997). Reduced placental vascularity is also associated with early embryonic mortality (Meegdes et al., 1988; Bassil et al., 1995). Alterations
26
in placental vascularity will have momentous influences on the maternal ability to provide adequate nutrients to the developing fetus.
2.6. Summary and Conclusions
In summary, the formation of the placenta is absolutely vital for fetal growth and development. The placenta is one of the first organs to form during gestation and is the site of nutrient, waste and gas exchange between maternal and fetal circulation. To ensure adequate nutrient supply extensive angiogenesis and vascular remodeling must occur. While fetal growth is minimal during early gestation in comparison to fetal growth closer to term. The placental development that occurs is necessary to support the rapid growth rate later in pregnancy. In some mammals the exchange of nutrients occurs across the syncytiotrophoblast which is a multinucleated tissue layer that makes up the closest tissue layer of the placenta to the maternal blood supply. The syncytiotrophoblast is formed by ERV which make up a significant portion of genome in rodents, humans, and cattle. In rodents, ERV are vital to successful pregnancy with termination occurring approximately half way through gestation. The discovery of endogenous retroviral elements within the bovine genome is intriguing because of the different type of syncytial formation during placentation. However, the functions of syncytial plaques in bovine pregnancy are unknown. The classical functions of ERV, mainly syncytin, are cell to cell fusion and immune suppression. In addition to the recognition of pregnancy, the cell to cell fusion function of ERV may be involved in the formation of binucleate cells, trinucleate cells, and multinucleate cell plaques which are known to secrete hormones during early gestation. The expression of ERV may also be influenced by nutritional status and developmental programming events occurring during gestation. While it is intriguing to speculate on the possible functions and interactions that ERV are involved with during the establishment of pregnancy, limited data
27
exist on the presence and assessing the role or roles of ERV during early pregnancy in bovine.
Understanding the mechanisms and pathways in which ERV interact with utero-placental tissues during early gestation may provide essential insight into the cellular events during early gestation and allow for more efficient reproduction in beef cattle.
Therefore, we hypothesize that endogenous retrovirus envelope genes syncytin-Rum1 and
BERV-K1 , PSP-B, and IFN-τ will be differentially expressed during critical time points of early pregnancy (d 16 to 50) and that maternal nutrition restriction will alter expression from basal expression at these critical time points. These data will increase our understanding for the role or roles of ERV in the establishment of pregnancy and may lead to increased efficiencies with assisted reproductive technologies and overall beef production. The increased efficiency of beef production will aide in supplying the needed meat and animal products to feed the increasing global population.
2.7. Literature Cited
Adams, D. C., R. C. Cochran, and P. O. Currie. 1987. Forage maturity effects on rumen
fermentation, fluid flow, and intake in grazing steers. J. Range Manage. 40:404-408. doi:
10.2307/3899597.
Adelson, D. L., J. M. Raison, and R. C. Edgar. 2009. Characterization and distribution of
retrotransposons and simple sequence repeats in the bovine genome. Proc. Natl. Acad.
Sci. USA 106:12855-12860. doi: 10.1073/pnas.0901282106.
Arias, P., M. Rodriguez, B. Szwarcfarb, I. R. Sinay, and J. A. Moguilevsky. 1992. Effect of
insulin on LHRH release by perifused hypothalamic fragments. Neuroendocrinology
56:415-418.
28
Arnaud, F., M. Caporale, M. Varela, R. Biek, B. Chessa, A. Alberti, M. Golder, M. Mura, Y.
Zhang, F. Pereira, J. C. Demartini, K. Leymaster, T. E. Spencer, and M. Palmarini. 2007.
A paradigm for virus-host coevolution: Sequential counter-adaptations between
endogenous and exogenous retroviruses. PLOS Pathogens 3:1716-1729.
doi:10.1371/journal.ppat.0030170.
Assheton, R. 1905. The morphology of the ungulate placenta, particularly the development of
that organ in sheep, and notes upon the placenta of the elephant and hyrax. Phil. Trans.
Royal Soc. (London), Ser. B. 198:143-220. doi: 10.1098/rspb.1905.0033.
Atkins, J. A., M. F. Smith, M. D. MacNeil, E. M. Jinks, F. M. Abreu, L. J. Alexander, and T. W.
Geary. 2013. Pregnancy establishment and maintenance in cattle. J. Anim. Sci. 91:722-
733. doi:10.2527/jas.2012-5368.
Austin, K. J., C. P. King, J. E. Vierk, G. Sasser, and T. R. Hansen. 1999. Pregnancy-specific
protein B induces release of an alpha chemokine in bovine endometrium. Endocrinology
140:542-545.
Azzam, S. M., J. E. Kinder, M. K. Nielsen, L. A. Werth, K. E. Gregory, L. V. Cundiff, and R. M.
Koch. 1993. Environmental effects on neonatal mortality of beef calves. J. Anim. Sci.
71:282-290. doi:10.2527/1993.712282x.
Barker, D. J., C. N. Martyn, C. Osmond, C. N. Hales, and C. H. Fall. 1993. Growth in utero and
serum cholesterol concentrations in adult life. BMJ 307:1524-1527.
Bassil, S., J. P. Magritte, J. Roth, M. Nisolle, J. Donnez, and S. Gordts. 1995. Uterine vascularity
during stimulation and its correlation with implantation in in-vitro fertilization. Hum.
Reprod.10:1497-1501. doi: 10.1093/HUMREP/10.6.1497.
29
Bauman, D. E., and W. B. Currie. 1980. Partitioning of nutrients during pregnancy and lactation:
a review of mechanisms involving homeostasis and homeorhesis. J. Dairy Sci. 63:1514-
1529. doi:10.3168/jds.S0022-0302(80)83111-0.
Bazer, F. W. 1975. Uterine protein secretions: relationship to development of the conceptus. J.
Anim. Sci. 41:1376-1382. doi:10.2134/jas1975.4151376x.
Bazer, F. W. 1992. Mediators of maternal recognition of pregnancy in mammals. Proc. Soc. Exp.
Biol. Med. 199:373-384.
Bazer, F. W., G. Wu, T. E. Spencer, G. A. Johnson, R. C. Burghardt, and K. Bayless. 2010.
Novel pathways for implantation and establishment and maintenance of pregnancy in
mammals. Mol. Hum. Reprod. 16:135-152. doi: 10.1093/molehr/gap095.
Bazer, F. W., R. M. Roberts, D. C. Sharp III, and W. C. Thatcher. 1981. Uterine proteins
synthesized during the progstative period and pregnancy. In: Uterus et Fécondité (Eds. C.
Boury-Heller, P. Mauleon, and Y. Rochet). Masson, Paris pp. 17-32.
Bazer, F. W., R. M. Roberts, S. M. Basha, M. T. Zavy, D. Caton, and D. H. Barron. 1979.
Method for obtaining ovine uterine secretions from unilaterally pregnant ewes. J. Anim.
Sci. 49:1522-1527. doi:10.2134/jas1979.4961522x.
Bazer, F. W., T. E. Spencer and T. L. Ott. 1996. Placental interferons. Am. J. Reprod.Immunol.
35:297-308. doi: 10.1111/j.1600-0897.1996.tb00485.x.
Bazer, F. W., T. E. Spencer and T. L. Ott. 1997. Interferon tau: a novel pregnancy recognition
signal. Am. J. Repro. Immunol. 37:412-420. doi: 10.1111/j.1600-0897.1997.tb00253.x.
Bazer, F. W., W. W. Thatcher, P. J. Hansen, M. A. Mirando, T. L. Ott, and C. Plante. 1991.
Physological mechanism of pregnancy recognition in ruminants. J. Reprod. Fert. 43:39-
47.
30
Bazer, F. W., W. Ying, X. Wang, K. A. Dunlap, B. Zhou, G. A. Johnson, and G. Wu. 2015. The
many faces of interferon tau. Invited Review. Amino Acids. 47:449-460. doi:
10.1007/s00726-014-1905-x.
Bell, A. W., J. M. Kennaugh, F. C. Battaglia, E. L. Makowski, and G. Meschia. 1986. Metabolic
and circulatory studies of fetal lamb at midgestation. Am. J. Physiol. 250:E538-E544.
Bellows, R. A., and R. E. Short. 1978. Effects of precalving feed level on birth weight, calving
difficulty and subsequent fertility. J. Anim. Sci. 46:1522-1528.
doi:10.2527/jas1978.4661522x.
Betteridge, K. J., M. D. Eaglesome, G. C. B. Randall, and D. Mitchell. 1980. Collection,
description, and transfer of embryos from cattle 10-16 days after oestrus. J. Reprod. Fert.
59:205-216. doi:10.1530/jrf.0.0590205.
Binelli, M., P. Subramaniam, T. Diaz, G. A. Johnson, T. R. Hansen, and W. W. Thatcher. 2001.
Bovine interferon-τ stimulates Janus kinase-signal transducer and activator of
transcription pathway in bovine endometrial epithelial cells. Biol. Reprod. 64:654-665.
doi: 10.1095/biolreprod64.2.654.
Blaise, S., N. de Parseval, L. Bénit, and T. Heidmann. 2003. Genomewide screening for
fusogenic human endogenous retrovirus envelopes identifies syncytin 2, a gene
conserved on primate evolution. Proc. Natl. Acad. Sci. USA 100:13013-13018. doi:
10.1073/pnas.2132646100.
Blond, J. L., D. Lavillette, V. Cheynet, O. Bouton, G. Oriol, S. Chapel-Fernandes, B. Mandrand,
F. Mallet, and F. L. Cosset. 2000. An envelope glycoprotein of the human endogenous
retrovirus HERV-W is expressed in the human placenta and fuses cells expressing the
31
type D mammalian retrovirus receptor. J. Virol. 74:3321-3329.
doi: 10.1128/JVI.74.7.3321-3329.2000.
Borowicz, P. P., D. R. Arnold, M. L. Johnson, A. T. Grazul-Bilska, D. A. Redmer, and L. P.
Reynolds. 2007. Placental growth throughout the last two thirds of pregnancy in sheep:
vascular development and angiogenic factor expression. Biol. Reprod. 76:259-267.
doi: 10.1095/biolreprod.106.054684.
Boshier, D. P. 1970. The pontamine blue reaction in pregnant sheep uteri. J. Reprod. Fert.
22:595-596. doi: 10.1530/jrf0.0220595.
Boshier, D. P., R. J. Fairclough, and H. Holloway. 1987. Assessment of sheep blastocyst effects
on neutral lipids in the uterine caruncular epithelium. J. Reprod. Fertil. 79:569-573.
Bridges, G. A., M. L. Day, T. W. Geary, and L. H. Cruppe. 2013. Deficiencies in the uterine
environment and failure to support embryonic development. J. Anim. Sci. 91:3002-3013.
doi:10.2527/jas.2013-5882.
Bridges, G. A., M. L. Mussard, C. R. Burke, and M. L. Day. 2010. Influence of the length of
proestrus on fertility and endocrine function in female cattle. Anim. Reprod. Sci.
117:208-215. doi: 10.1016/j.anireprosci.2009.05.002.
Bridges G. A, M. L. Mussard, J. L. Pate, T. L. Ott, T. R. Hansen, and M. L. Day. 2012. Impact of
preovulatory estradiol concentrations on conceptus development and uterine gene
expression. Anim. Reprod. Sci. 133:16-26. doi: 10.1016/j.anireprosci.2012.06.013.
Butler, W. R., and R. D. Smith. 1989. Interrelationships between energy balance and postpartum
reproductive function in dairy cattle. J. Dairy Sci. 72:767-783.
32
Butler, J. E., W. C. Hamilton, R. G. Sasser, C. A. Ruder, G. M. Hass, and R. J. Williams. 1982.
Detection and partial characterization of two pregnancy-specific proteins. Biol. Reprod.
26:925-933. doi: http://dx.doi.org/10.3168/jds.S0022-0302(89)79169-4.
Campling, R. C. 1970. Physical regulation of voluntary intake. In: A. T. Phillipson (ed.)
Physiology of Digestion and Metabolism in the Ruminant. pp 226-234. Oriel Press, Ltd.,
Newcastle, U.K.
Carstens, G. E., D. E. Johnson, M. D. Holland, and K. G. Odde. 1987. Effects of prepartum
protein nutrition and birth weight on basal metabolism in bovine neonates. J. Anim. Sci.
65:745-751. doi:10.2134/jas1987.653745x.
Caton, J. S. and B. W. Hess. 2010. Maternal plane of nutrition: Impacts on fetal outcomes and
postnatal offspring responses. in: Proc 4th Grazing Livestock Nutrition Conference. West
Sect. Am. Soc. Anim. Sci. 39:104-122.
Caton, J. S., and D. V. Dhuyvetter. 1997. Influence of energy supplementation on grazing
ruminants: Requirements and responses. J. Anim. Sci. 75:533-542.
doi:10.2527/1997.752533x.
Chessa, B., F. Pereira, F. Arnaud, A. Amorim, F. Goyache, I. Mainland, R. R. Kao, J. M.
Pemberton, D. Beraldi, M. Stear, A. Alberti, M. Pittau, L. Iannuzzi, M. H. Banabazi, R.
Kazwala, Y. P. Zhang, J. J. Arranz, B. A. Ali, Z. Wang, M. Uzun, M. Dione, I. Olsaker,
L. E. Holm. U. Saarma, S. Ahmad, N. Marzanov, E. Eythosodottir, M. J. Holland, P.
Ajmone-Marsan, M. W. Bruford, J. Kantanen, T. E. Spencer, and M. Palmarini. 2009.
Revealing the history of sheep domestication using retrovirus integrations. Science.
324:532-536. doi:10.1126/science.1170587.
33
Chuong, E. B., M. A. Rumi Karim, M. J. Soares, and J. C. Baker. 2013. Endogenous retroviruses
function as species-specific enhancer elements in the placenta. Nat. Genet. 45:325-329.
doi: 10.1038/ng.2553.
Ciccioli, N. H., R. P. Wettemann, L. J. Spicer, C. A. Lents, F. J. White, and D. H. Keisler. 2003.
Influence of body condition at calving and postpartum nutrition on endocrine function
and reproductive performance of primiparous beef cows. J. Anim. Sci. 81:3107-3120.
doi:10.2527/2003.81123107x.
Cline, H. J., B. W. Neville, G. P. Lardy, J. S. Caton. 2009. Influence of advancing season on
dietary composition, intake, site of digestion, and microbial efficiency in beef steers
grazing a native range in western North Dakota. J. Anim. Sci. 87:375-383.
doi:10.2527/jas.2007-0833.
Corah, L. R., T. G. Dunn, and C. C. Kaltenbach. 1975. Influence of prepartum nutrition on the
reproductive performance of beef females and the performance of their progeny. J. Anim.
Sci. 41:819-824. doi:10.2527/jas1975.413819x.
Cornelis, G., O. Heidmann, S. A. Degrelle, C. Vernochet, C. Lavialle, C. Letzelter, S. Bernard-
Stoecklin, A. Hassanin, B. Mulot, M. Guillomot, I. Hue, T. Heidmann, and A.
Dupressoir. 2013. Captured retroviral envelope syncytin gene associated with the unique
placental structure of higher ruminants. Proc. Natl. Acad. Sci. USA 110:E828-E837. doi:
10.1073/pnas.1215787110.
Cornelis, G., O. Heidmann, S. Bernard-Stoecklin, K. Reynaud. G. Veron, B. Mulot, A.
Dupressoir, and T. Heidmann. 2012. Ancestral capture of syncytin-Car1, a fusogenic
endogenous retroviral envelope gene involved in placentation and conserved in
Carnivora. Proc. Natl. Acad. Sci. USA 109:E432-E441. doi: 10.1073/pnas.1115346109.
34
DelVecchio, R. P., W. D. Sutherland, and R. G. Sasser. 1995. Effect of pregnancy-specific
protein B on luteal cell progesterone, prostaglandin, and oxytocin production during two
stages of the bovine estrous cycle. J. Anim. Sci. 73:2662-2668.
doi:10.2527/1995.7392662x.
DelVecchio, R. P., W. D. Sutherland, and R. G. Sasser. 1996. Bovine luteal cell production in
vitro of prostaglanding E2, oxytocin, progesterone in response to pregnancy-specific
protein B and prostaglandin F2 alpha. J. Reprod. Fert. 107:131-136. doi:
10.1530/jrf.0.1070131.
DelVecchio, R. P., R. G. Sasser, and R. D. Randel. 1990. Effect of pregnancy-specific protein B
on prostaglandin F2 and prostaglandin E2 by day 16 perfused bovine endometrial tissue.
Prostaglandin 40:271-282.
DeMartini, J. C, J. O. Carlson, D. Leroux, T. Spencer, and M. Palmarini. 2003. Endogenous
retroviruses related to Jaagsiekte sheep retrovirus. Curr. Top. Microbiol. Immunol.
275:117-137.
Denker, H. W. 1993. Implantation: a cell biological paradox. J. Exper. Zool. 266:541-558.
DOI: 10.1002/jez.1402660606.
De Parseval, N. and T. Heidmann. 2005. Human endogenous retroviruses: From infectious
elements to human genes. Cytogenet. Genome Res. 110:318-332. doi:
10.1159/000084964.
Diskin, M. G. and J. M. Sreenan. 1980. Fertilization and embryonic mortality rates in beef
heifers after artificial insemination. J. Reprod. Fertil. 59:463-468. doi:
10.1530/jrf.0.0590463.
35
Dunlap, K. A., M. Palmarini, D. L. Adelson, and T. E. Spencer. 2005. Sheep endogenous
betaretroviruses (enJSRVs) and the hyaluronidase 2 (HYAL2) receptor in the ovine
uterus and conceptus. Biol. Reprod. 73:271-279. doi: 10.1095/biolreprod.105.039776.
Dunlap, K. A., M. Palmarini, M. Varela, R. C. Burghardt, K. Hayashi, J. L. Farmer, and T. E.
Spencer. 2006. Endogenous retroviruses regulate periimplantation placental growth and
differentiation. Proc. Natl. Acad. Sci. USA 103:14390-14395. doi:
10.1073/pnas.0603836103.
Dunn, T. G., J. E. Ingalls, D. R. Zimmerman, and J. N. Wiltbank. 1969. Reproductive
performance of 2-year-old Hereford and Angus heifers as influenced by pre- and post-
calving energy intake. J. Anim. Sci. 29:719-726. doi:10.2527/jas1969.295719x.
Dupressoir, A., C. Vernochet, F. Harper, J. Guegan, P. Dressen, G. Pierron, and T. Heidmann.
2011. A pair of co-opted retroviral envelope syncytin genes is required for formation of
the two-layered murine placental syncytiotrophoblast. Proc. Natl. Acad. Sci. USA
108:E1164-E1173. doi: 10.1073/pnas.1112304108.
Dupressoir, A., C. Vernochet, O. Bawa, F. Harper, G. Pierron, P. Opolon, and T. Heidmann.
2009. Syncytin-A knockout mice demonstrate the critical role in placentation of a
fusogenic, endogenous retrovirus-derived, envelope gene. Proc. Natl. Acad. Sci. USA
106:12127-12132. doi: 10.1073/pnas.0902925106.
Dupressoir, A., G. Marceau, C. Vernochet, L. Benit, C. kanellopoulos, V. Sapin and T.
Heidmann. 2005. Syncytin-A and syncytin-B, two fusogenic placenta-specific murine
envelope genes of retroviral origin in Muridae. Proc. Natl. Acad. Sci. USA 102:725-730.
doi: 10.1073/pnas.0406509102.
36
Echternkamp, S. E. and W. Hansel. 1971. Plasma estrogens, luteinizing hormone, and corticoid
in postpartum cows. J. Dairy Sci. 54:800.
Eckblad, W. P., R. G. Sasser, C. A. Ruder, P. M. Panlasugui, and T. S. Kuczynske. 1985.
Localization of pregnancy-specific protein B (PSPB) in bovine placental cells using a
glucose oxidase-anti-glucose oxidase immunehistochemical stain. Proc. West Sec. Am.
Soc. Anim. Sci. 36:396-397.
Eggleston, D. L., C. Wilken, E. A. Van Kirk, R. G. Slaughter, T. H. Ji, and W. J. Murdoch. 1990.
Progesterone induces expression of endometrial messenger RNA encoding for
cyclooxygenase (sheep). Prostaglandins. 39:675-683.
Elliot, I. Meat output must double by 2050. Feedstuffs. Accessed 1/15/2013:
http://feedstuffsfoodlink.com/story-meat-output-must-double-by-2050-71-66920.
Fisher, S., T. Y. Cui, L. Zhang, L. Hartman, K. Grahl, Z. Guo-Yang, J. Tarpey, and C. Damsky.
1989. Adhesive and degradative properties of human placental cytotrophoblast cells in
vitro. J. Cell Biol. 109:891-902.
Ford, S. P., B. W. Hess, M. M. Schwope, M. J. Nijland, J. S. Gilbert, K. A. Vonnahme, W. J.
Means, H. Han, and P. W. Nathanielsz. 2007. Maternal undernutrition during early to
mid-gestation in the ewe results in altered growth, adiposity, and glucose tolerance in
male offspring. J. Anim. Sci. 85:1285-1294. doi:10.2527/jas.2005-624.
Ford, S. P., L. Zhang, M. Zhu, M. M. Miller, D. T. Smith, B. W. Hess, G. E. Moss, P. W.
Nathanielsz, and M. J. Nijland. 2009. Maternal obesity accelerates fetal pancreatic β-cell
but not α-cell development in sheep: prenatal consequences. Am. J. Phys. Reg. Int. Com.
Phys. 297:R835-R843. doi: 10.1152/ajpregu.00072.2009.
37
Francisco, C. C., L. J. Spicer, and M. E. Payton. 2003. Predicting cholesterol, progesterone, and
days to ovulation using postpartum metabolic and endocrine measures. J. Dairy Sci.
86:2852-2863. doi: http://dx.doi.org/10.3168/jds.S0022-0302(03)73882-X.
Freetly, H. C., C. L. Ferrell, and T. G. Jenkins. 2000. Timing of realimentation of mature cows
that were feed-restricted during pregnancy influences calf birth weights and growth rates.
J. Anim. Sci. 78:2790-2796. doi:10.2527/2000.78112790x.
Funston, R. N., J. L. Martin, D. C. Adams, and D. M. Larson. 2010. Winter grazing system and
supplementation of beef cows during late gestation influence heifer progeny. J. Anim.
Sci. 88:4094-4101. doi: 10.2527/jas.2010-3039.
Garcia-Etxebarria, K., and B. M. Jugo. 2013. Evolutionary history of bovine endogenous
retroviruses in the Bovidae family. BMC Evol. Bio. 13:256-267. doi: 10.1186/1471-
2148-13-256.
Gardner, D. S., K. Tingey, B. W. M. Van Bon, S. E. Ozanne, V. Wilson, J. Dandrea, D. H.
Keisler, T. Stephenson, and M. E. Symonds. 2005. Programming of glucose-insulin
metabolism in adult sheep after maternal undernutrition. Am. J. Phys. Reg. Int. Com.
Phys. 289:R947-R954. doi: 10.1152/ajpregu.00120.2005.
Geary, T. W., M. F. Smith, M. D. MacNeil, M. L. Day, G. A. Bridges, G. A. Perry, F. M. Abreu,
J. A. Atkins, K. G. Pohler, E. M. Jinks, and C. A. Madsen. 2013. TRIENNIAL
REPRODUCTION SYMPOSIUM: Influence of follicular characteristics at ovulation on
early embryonic survival. J. Anim. Sci. 91:3014-3021. doi:10.2527/jas.2012-5887.
Gifford, R. and M. Tristem. 2003. The evolution, distribution and diversity of endogenous
retroviruses. Virus Genes 26:291–315.
38
Grazul-Bilska, A. T., M. L. Johnson, P. P. Borowicz, L. Baranko, D. A. Redmer, and L. P.
Reynolds. 2013. Placental development during early pregnancy in sheep: Effects of
embryo origin on fetal and placental growth and global methylation. Theriogenology
79:94-102. doi: 10.1016/j.theriogenology.2012.09.013.
Grazul-Bilska, A. T., M. L. Johnson, P. P. Borowicz, M. Minten, J. J. Bilski, R. Wroblewski, M.
Velimirovich, L. R. Coupe, and D. A. Redmer. 2011. Placental development during early
pregnancy in sheep: cell proliferation, global methylation, and angiogenesis in the fetal
placenta. Reproduction 141:529-540. doi: 10.1530/REP-10-0505.
Grazul-Bilska, A. T., P. P. Borowicz, M. L. Johnson, M. Minten, J. J. Bilski, R. Wroblewski, D.
A. Redmer, and L. P. Reynolds. 2010. Placental development during early pregnancy in
sheep: vascular growth and expression of angiogenic factors in maternal placenta.
Reproduction 140:165-174. doi: 10.1530/REP-09-0548.
Green, M. P., M. G. Hunter, and G. E. Mann. 2005. Relationships between maternal hormone
secretion and embryo development on day 5 of pregnancy in dairy cows. Anim. Reprod.
Sci. 88:179-189. doi:10.1016/j.anireprosci.2004.12.007.
Green, M. P., S. Xie, X. Quan, B. Bao, X. Gan, N. Mathialagan, J. F. Beckers, and R. M.
Roberts. 2000. Pregnancy-associated bovine and ovine glycoproteins exhibit spatially and
temporally distinct expression patterns during pregnancy. Bio. Reprod. 62:1624-1631.
doi: 10.1095/biolreprod62.6.1624.
Green, M. P., S. Xie, and R. M. Roberts. 1998. Pepsin-related molecules secreted by trophoblast.
Rev. Reprod. 3:62-69. doi: 10.1530/ror.0.0030062.
39
Greenwood, P. L., A. S. Hunt, J. W. Hermanson, and A. W. Bell. 2000. Effects of birth weight
and postnatal nutrition on neonatal sheep: II. Skeletal muscle growth and development. J.
Anim. Sci. 78:50-61. doi:10.2527/2000.78150x.
Guillomot, M. 1995. Cellular interactions during implantation in domestic ruminants. J. Reprod.
Fert. Suppl. 49:39-51.
Guillomot, M. and J. E. Fléchon. 1990. Place de la microscopie dans l’étude des conditions de
l’implantation chez les ruminants. Contraception Fertilité Sexualité 18:875-885.
Guillomot, M., J. E. Fléchon, and S. Wintenberger-Torrès. 1981. Conceptus attachment in the
ewe: an ultrastructural study. Placenta 2:169-182.
Guillomot, M. and P. Guay. 1982. Ultrastructural features of the cell surfaces of the uterine and
trophoblastic epithelia during embryo attachment in the cow. Anat. Rec. 204:315-322.
Harrington, K., R. G. Carpenter, C. Goldfrad, and S. Campbell. 1997. Transvaginal ultrasound of
the uteroplacental circulation in the early prediction of pre-eclampsia and intrauterine
growth retardation. Br. J. Obstet. Gynecol. 104:674–681. doi: 10.1111/j.1471-
0528.1997.tb11977.x.
Hart, R. H. 1991. Developing strategies for integrating forage parameters to meet the nutritional
needs of grazing livestock. Pages 64-69 in Proc. 2 nd Grazing Livest. Nutr. Conf. Okla.
Agric. Exp. Stn. Misc. Publ. 133. Oklahoma State Univ. Stillwater.
Heasman, L., L. Clarke, T. J. Stephenson, and M. E. Symonds. 1999. The influence of maternal
nutrient restriction in early to mid-pregnancy on placental and fetal development in
sheep. Proc. Nutr. Soc. 58:283-288. doi: http://dx.doi.org/10.107/S0029665199000397.
Heidmann, O., C. Vernochet, A. Dupressoir, and T. Heidmann. 2009. Identification of an
endogenous retroviral envelope gene with fusogenic activity and placenta-specific
40
expression in the rabbit: A new “syncytin” in a third order of mammals. Retrovirology
6:107-117. doi: 10.1186/1742-4690-6-107.
Henricks, D. M., D. R. Lamond, J. R. Hill and J. F. Dickey. 1971. Plasma total estrogens and
progesterone concentrations during proestrus and after mating in beef heifers. Abstr.,
Fourth Annu. Meeting Soc. Study Reprod. p. 13.
Humblot, P., S. Camous, J. Martal, J. Charlery, N. Jeanguyot, M. Thibier, and G. Sasser. 1988a.
Diagnosis of pregnancy by radioimmunoassay of a pregnancy-specific protein in the
plasma of dairy cows. Theriogenology 30:257-267. doi: 10.1016/0093-691X(88)90175-6.
Humblot, P., S. Camous, J. Martal, J. Charlery, N. Jeanguyot, M. Thibier, and R. G. Sasser.
1988b. Pregnancy-specific protein B, progesterone concentrations and embryonic
mortality during early pregnancy in dairy cows. J. Reprod. Fert.83:215-223. doi:
10.1530/jrf.0.0830215.
Huffman, E. M., J. H. Kirk, and M. Pappaioanou. 1985. Factors associated with neonatal lamb
mortality. Theriogenology 24:163-171. doi:10.1016/0093-691X(85)90180-3.
Hughes, A. L., J. A. Green, J. M. Garbayo, and R. M. Roberts. 2000. Adaptive diversification
within a large family of recently duplicated, placentally expressed genes. Proc. Natl.
Acad. Sci. USA. 97:3319-3323. doi: 10.1073/pnas.97.7.3319.
Jern, P. and J. M. Coffin. 2008. Effects of retroviruses on host genome function. Annu. Rev.
Genet. 42:709-732. doi: 10.1146/annurev.genet.42.110807.091501.
Jinks, E. M., M. F. Smith, J. A. Atkins, K. G. Pohler, G. A. Perry, M. D. MacNeil, A. J. Roberts,
R. C. Waterman, L. J. Alexander, and T. W. Geary. 2013. Preovulatory estradiol and the
establishment and maintenance of pregnancy in suckled beef cows. J. Anim. Sci.
91:1176-1185. doi:10.2527/jas.2012-5611.
41
Kaufmann, P., T. M. Mayhew, and D. S. Charnock-Jones. 2004. Aspects of human fetoplacental
vasculogenesis and angiogenesis. II. Changes during normal pregnancy. Placenta 25:114-
126.
Kelly, R. W. 1992. Nutrition and placental development. Proc. Nutr. Soc. Aust. 17:203-210.
King, G. J., B. A. Atkinson, and H. A Robertson. 1981. Development of the intercaruncular areas
during early gestation and establishment of the bovine placenta. J. Reprod. Fert. 61:469-
474. doi: 10.1530/jrf.0.0610469.
King, G. J., B. A. Atkinson, and H. A Robertson. 1982. Implantation and early placentation in
domestic ungulates. J. Reprod. Fert. Suppl. 31:17-30.
Koshi, K., Y. Suzuki, Y. Nakaya, K. Imai, M. Hosoe, T. Takahashi, K. Kizaki, T. Miyazawa, and
K. Hashizume. 2012. Bovine trophoblastic cell differentiation and binucleation involves
enhanced endogenous retrovirus element expression. Reprod. Bio. Endo. 10:41-52. doi:
10.1186/1477-7827-10-41.
Köster, H. H., R. C. Cochran, E. C. Titgemeyer, E. S. Vanzant, I. Abdelgadir, and G. St.-Jean.
1996. Effect of increasing degradable intake protein on intake and digestion of low-
quality, tallgrass-prairie forage by beef cows. J. Anim. Sci. 74:2473-2481.
doi:10.2527/1996.74102473x.
Kurth, R., and N. Bannert. 2010. Beneficial and detrimental effects of human endogenous
retroviruses. Int. J. Cancer 126:306-314. doi: 10.1002/ijc.24902.
Larson, D. M., J. L. Martin, D. C. Adams, and R. N. Funston. 2009. Winter grazing system and
supplementation during late gestation influence performance of beef cows and steer
progeny. J. Anim. Sci. 87:1147-1155. doi:10.2527/jas.2008-1323.
42
Leaman, D. W., and R. M. Roberts. 1992. Genes for the trophoblast interferons in sheep, goat,
and musk ox and distribution of related genes among mammals. J. Interferon Res. 12:1-
11.
Leiser, R. 1975. Kontaktaufnahme zwischen trophoblast and unterusephithel während der frühen
implantation beim rind. Anat. Histol Embryol. 4:63-86.
Lents, C. A., R. P. Wettemann, F. J. White, I. Rubio, N. H. Ciccioli, L. J. Spicer, D. H. Keisler,
and M. E. Payton. 2005. Influence of nutrient intake and body fat on concentrations of
insulin-like growth factor-I, insulin, thyroxine, and leptin in plasma of gestating beef
cows. J. Anim. Sci. 83:586-596. doi:10.2527/2005.833586x.
Long, N. M., C. B. Tousley, K. R. Underwood, S. I. Paisley, W. J. Means, B. W. Hess, M. Du,
and S. P. Ford. 2012. Effects of early- to mid-gestational undernutrition with or without
protein supplementation on offspring growth, carcass characteristics, and adipocyte size
in beef cattle. J. Anim. Sci. 90:197-206. doi:10.2527/jas.2011-4237.
Long, N. M., K. A. Vonnahme, B. W. Hess, P. W. Nathanielsz, and S. P. Ford. 2009. Effects of
early gestational undernutrition on fetal growth, organ development, and placentomal
composition in the bovine. J. Anim. Sci. 87:1950-1959. doi:10.2527/jas.2008-1672.
Long, N. M., L. A. George, A. B. Uthlaut, D. T. Smith, M. J. Nijland, P. W. Nathanielsz, and S.
P. Ford. 2010a. Maternal obesity and increased nutrient intake before and during
gestation in the ewe results in altered growth, adiposity, and glucose tolerance in adult
offspring. J. Anim. Sci. 88:3546-3553. doi:10.2527/jas.2010-3083.
Long, N. M., M. J. Nijland, P. W. Nathanielsz, and S. P. Ford. 2010b. The effect of early to mid-
gestational nutrient restriction on female offspring fertility and hypothalamic-pituitary-
adrenal axis response to stress. J. Anim. Sci. 88:2029-2037. doi:10.2527/jas.2009-2568.
43
Long, N. M., M. J. Prado-Cooper, C. R. Krehbiel, U. DeSilva, and R. P. Wettemann. 2010c.
Effects of nutrient restriction of bovine dams during early gestation on postnatal growth,
carcass and organ characteristics, and gene expression in adipose tissue and muscle. J.
Anim. Sci. 88:3251-3261. doi:10.2527/jas.2009-2512.
Longo, L. D. and L. P. Reynolds. 2010. Some historical aspects of understanding placental
development, structure, and function. Int. J. Dev. Biol. 54:237-255. doi:
10.1387/ijdb.082774ll.
Lopes, A. S., S. T. Butler, R. O. Gilbert, and W. R. Butler. 2007. Relationship of pre-ovulatory
follicle size, estradiol concentrations and season to pregnancy outcome in dairy cows.
Anim. Reprod. Sci. 99:34-43. doi:10.1016/j.anireprosci.2006.04.056.
Lopuhaa, C. E., T. J. Roseboom, C. Osmond, D. J. Barker, A. C. Ravelli, O. P. Bleker, J. S. van
der Zee, and J. H. van der Meulen. 2000. Atopy, lung function, and obstructive airways
disease after prenatal exposure to famine. Thorax 55:555-561. doi:
10.1136/thorax.55.7.555.
Lumey, L. H., and A. D. Stein. 1997. In utero exposure to famine and subsequent fertility: The
Dutch Famine Birth Cohort Study. Am. J. Public Health 87:1962-1966.
Magness, R. R. 1998. Maternal cardiovascular and other physiological responses to the
endocrinology of pregnancy. In: The Endocrinology of Pregnancy (Ed. F.W. Bazer).
Humana Press, Totowa, NJ, pp. 507-539.
Mann, G. E. and G. E. Lamming. 2001. Relationship between maternal endocrine environment,
early embryo development and inhibition of the luteolytic mechanism in cows. Reprod.
121:175-180. doi: 10.1530/rep.0.1210175.
44
Mann, G. E., G. E. Lamming, R. S. Robinson, and D. C. Wathes. 1999. The regulation of
interferon-tau production and uterine hormone receptors during early pregnancy. J.
Reprod. Fert. 54:317-328.
Mann, G. E., M. D. Fray, and G. E. Lamming. 2006. Effects of time of progesterone
supplementation on embryo development and interferon-τ production in the cow. Vet. J.
171:500-503. doi:10.1016/j.tvjl.2004.12.005.
Martin, J. L., K. A. Vonnahme, D. C. Adams, G. P. Lardy, and R. N. Funston. 2007. Effects of
dam nutrition on growth and reproductive performance of heifer calves. J. Anim. Sci.
85:841-847. doi:10.2527/jas.2006-337.
McCollum, F. T., M. L. Galyean, L. J. Krysl, and J. D. Wallace. 1985. Cattle grazing blue grama
rangeland I. Seasonal diets and rumen fermentation. J. Range Manage. 38:539-546. doi:
10.2307/3899748.
McCollum, F. T., and G. W. Horn. 1990. Protein supplementation of grazing livestock: A
review. Prof. Anim. Sci. 6:1-16. doi: 10.15232/S1080-7446(15)32251-8.
McCracken, J. A., W. Schramm, and W. C. Okulicz. 1984. Hormone receptor control of pulsatile
secretion of PGF2α from the ovine uterus during luteolysis and its abrogation in early
pregnancy. Anim. Reprod. Sci. 7:31-55.
McLean, K. J., L. P. Reynolds, A. T. Grazul-Bilska, J. S. Haring, and J. S. Caton. 2014. Syncytin
expression in uterine endometrium and fetal membranes during early pregnancy in sheep.
J. Anim. Sci. 92(E-Suppl-2):245.
Meegdes, H. L. M., R. Ingenhoes, L. L. H. Peeters, and N. Exalto. 1988. Early pregnancy
wastage: relationship between chorionic vascularization and embryonic development.
Fertil. Steril. 49:216-220.
45
Meschia, G. 1983. Circulation to female reproductive organs Handbook of Physiology No. Sect.
2, Vol. III, part 1. p 241-269. Shepherd JT & Abboud FM, American Physiological
Society, Bethesda, MD.
Meyer, A. M., J. J. Reed, T. L. Neville, J. F. Thorson, K. R. Maddock-Carlin, J. B. Taylor, L. P.
Reynolds, D. A. Redmer, J. S. Luther, C. J. Hammer, K. A. Vonnahme, and J. S. Caton.
2011. Nutritional plane and selenium supply during gestation affect yield and nutrient
composition of colostrum and milk in primiparous ewes. J. Anim. Sci. 89:1627-1639.
doi:10.2527/jas.2010-3394.
Meyer, A. M., J. S. Caton, B. W. Hess, S. P. Ford, and L. P. Reynolds. 2012. Chapter 13:
Epigenetics and effects on the neonate that may impact feed efficiency. In: Feed
Efficiency in the Beef Industry, pp. 199-224 (Hill R ed.), Wiley-Blackwell, Hoboken, NJ
(ISBN 978-0-470-95952-7).
Meyer, M. D., P. J. Hansen, W. W. Thatcher, M. Drost, L. Badinga, R. M. Roberts, J. Li, T. L.
Ott, and F. W. Bazer. 1995. Extension of corpus luteum life span and reduction of uterine
secretion of prostaglandin F2α of cows in response to recombinant interferon-τ. J. Dairy
Sci. 78:1921-1931. doi:10.3168/jds.S0022-0302(95)76817-5.
Mi, S., X. Lee, X. Li, G. M. Veldman, M. Finnerty, L. Racie, E. LaVallie, X. Tang, P. Edward,
S. Howes, J. Keith, Jr, and J. M. McCoy. 2000. Syncytin is a captive retroviral envelope
protein involved in human placental morphogenesis. Nature 403:785-789.
doi:10.1038/35001608.
Mialon, M. M., G. Renand, S. Camous, J. Martal, and F. Menissier. 1994. Detection of
pregnancy by radioimmunoassay of a pregnancy serum protein (psp60) in cattle. Reprod.
Nutr. Dev. 34:65-72.
46
Mialon, M. M., S. Camous, G. Renand, J. Martal, and F. Menissier. 1993. Peripheral
concentrations of a 60-kDa pregnancy serum protein during gestation and after claving
and in relationship to embryonic mortality in cattle. Reprod. Nutr. Develop. 33:269–82.
Miller, B. G., and N. W. Moore. 1976a. Effects of progesterone and oestradiol on endometrial
metabolism and embryo survival in the ovariectomized ewe. J. Reprod. Fertil. 46:535-
536.
Miller, B. G., and N. W. Moore. 1976b. Progesterone and oestrogen requirements for the
survival of embryos in the ovariectomized ewe. J. Reprod. Fertil. 46:536-537.
Miller, B. G., and N. W. Moore. 1983. Endometrial protein secretion during early pregnancy in
entire and ovariectomized ewes. Reprod. Fertil. 68:137-144. doi: 10.1530/jrf.0.0680137.
Moffett, A., and C. Loke. 2006. Immunology of placentation in eutherian mammals. Nat. Rev.
Immunol. 6:584-594. doi: 10.1038/nri1897.
Moore, N. W., 1985. The use of embryo transfer and steroid hormone replacement therapy in the
study of prenatal mortality. Theriogenology 23:121-129. doi: 10.1016/0093-
691X(85)90077-9.
Nakaya Y., K. Koshi, S. Nakagawa, K. Hashizume, and T. Miyazawa. 2013. Fematrin-1 is
involved in fetomaternal cell-to-cell fusion in Bovinae placenta and has contributed to
diversity of ruminant placentation. J. Virol. 87:10563–10572. doi: 10.1128/JVI.01398-13.
Niswender, G. D., and T. M. Nett. 1994. Corpus luteum and its control in infraprimate species.
pp 781-816. In: The Physiology of Reproduction. eds. E. Knobil and J. D. Neil. Raven
Press, Ltd, New York.
47
North, R. A., C. Ferrier, D. Long, K. Townend, and P. Kincaid-Smith. 1994. Uterine artery
doppler flow velocity waveforms in the second trimester for the prediction of
preeclampsia and fetal growth retardation. Obstet. Gynecol. 83:378-386.
Painter, R. C., S. R. de Rooij, P. M. Bossuyt, T. A. Simmers, C. Osmond, D. J. Barker, O. P.
Bleker, and T. J. Roseboom. 2006. Early onset of coronary artery disease after prenatal
exposure to the Dutch famine. Am. J. Clin. Nutr. 84:322-327.
Painter, R. C., C. Osmond, P. Gluckman, M. Hanson, D. I. Phillips, and T. J. Roseboom. 2008a.
Transgenerational effects of prenatal exposure to the Dutch famine on neonatal adiposity
and health in later life. BJOG 115:1243-1249. doi: 10.1111/j.1471-0528.2008.01822.x.
Painter, R. C., R. G. Westendorp, S. R. de Rooij, C. Osmond, D. J. Barker, and T. J. Roseboom.
2008b. Increased reproductive success of women after prenatal undernutrition. Hum.
Reprod. 23:2591-2595. doi: 10.1093/humrep/den274.
Palmarini, M. A., C. Hallwirth, D. York, C. Murgia, T. de Oliveira, T. Spencer, and H. Fan.
2000. Molecular cloning and functional analysis of thress type D endogenous retroviruses
of sheep reveals a different cell tropism from that of the highly related exogenous
Jaagsiekte sheep retrovirus. J. Virol. 74:8065-8076. doi: 10.1128/JVI.74.17.8065-
8076.2000.
Palmarini, M. A., C. A. Gray, K. Carpenter, H. Fan, F. W. Bazer, and T. E. Spencer. 2001.
Expression of endogenous beta retroviruses in the ovine uterus: effects of neonatal age,
estrous cycle, pregnancy and progesterone. J. Virol. 75:11319-11327.
doi:10.1128/JVI.75.23.11319-11327.2001.
Patten, B. M. 1964. Foundations of Embryology (2nd Ed.). McGraw-Hill, New York.
48
Perry, D. J., K. J. Austin, and T. R. Hansen. 1999. Cloning of interferon stimulated gene 17: the
promoter and nuclear proteins that regulate transcription. Mol. Endocrinol. 13:1197-
1206. doi: 10.1210/mend.13.7.0294.
Perry, G. A., M. F. Smith, M. C. Lucy, J. A. Green, T. E. Parks, M. D. MacNeil, A. J. Roberts,
and T. W. Geary. 2005. Relationship between follicle size at insemination and pregnancy
success. Proc. Natl. Acad. Sci. USA 102:5268-5273. doi: 10.1073/pnas.0501700102.
Pontzer, C. H., T. L. Ott, F. W. Bazer, and H. M. Johnson. 1990. Localization of an antiviral site
on the pregnancy recognition hormone, ovine trophoblast protein 1. Proc Natl. Acad. Sci.
USA. 87:5945-5949. doi:10.1073/pnas.87.15.5945.
Powell, D. J., D. C. Clanton, and J. T. Nichols. 1982. Effect of range condition on the diet and
performance of steers grazing native Sandhills range in Nebraska. J. Range Manage.
35:96-99.
Ramsey, E. M. 1982. The placenta, human and animal. Praeger,New York.
Rasby, R. J., R. P. Wettemann, R. D. Geisert, L. E. Rice, and C. R. Wallace. 1990. Nutrition,
body condition and reproduction in beef cows: fetal and placental development, and
estrogens and progesterone in plasma. J. Anim. Sci. 68:4267-4276. doi:/1990.68124267x.
Ravelli, A. C., J. H. van der Meulen, C. Osmond, D. J. Barker, and O. P. Bleker. 1999. Obesity
at the age of 50 y in men and women exposed to famine prenatally. Am. J. Clin. Nutr.
70:811-816.
Ravelli, G. P., Z. A. Stein, and M. W. Susser. 1976. Obesity in young men after famine exposure
in utero and early infancy. N Engl J Med 295:349-353. doi:
10.1056/NEJM197608122950701.
49
Reed, J. J., M. A. Ward, K. A. Vonnahme, T. L. Neville, S. L. Julius, P. P. Borowicz, J. B.
Taylor, D. A. Redmer, A. T. Grazul-Bilska,L. P. Reynolds, and J. S. Caton. 2007. Effects
of selenium supply and dietary restriction on maternal and fetal body weight, visceral
organ mass, cellularity estimates, and jejunal vascularity in pregnant ewe lambs. J. Anim.
Sci. 85:2721-2733. doi:10.2527/jas.2006-785.
Reynolds, L. P., C. L. Ferrell, J. A. Nienaber, and S. P. Ford. 1985. Effects of chronic
environmental heat-stress on blood flow and nutrient uptake of the gravid bovine uterus
and foetus. J. Agric. Sci., Cambr. 104:289-297. doi: 10.1017/S002185960004394X.
Reynolds, L. P., and D. A. Redmer. 1992. Growth and microvascular development of the uterus
during early pregnancy in ewes. Biol. Reprod. 47:698-708. doi: 10.1095/
biolreprod47.5.698.
Reynolds, L. P., and D. A. Redmer. 1995. Utero-placental vascular development and placental
function. J. Anim. Sci. 73:1839-1851. doi:/1995.7361839x.
Reynolds, L. P., and D. A. Redmer. 2001. Angiogenesis in the placenta. Biol. Reprod. 64:1033-
1040. doi: 10.1095/biolreprod64.4.1033.
Reynolds, L. P., and J. S. Caton. 2012. Role of the pre- and post-natal environment in
developmental programming of health and productivity. Invited review. Molecular and
Cellular Endocrinology, Special Issue ‘Environment, Epigenetics and Reproduction,” M.
K. Skinner editor, 354:54-59. doi: 10.1016/j.mce.2011.11.013.
Reynolds, L. P., M. C. Wulster-Radcliffe, D. K. Aaron, and T. A. Davis. 2015. Importance of
animals in agricultural sustainability and food security. J. Nutr. 145:1377-1379. doi:
10.3945/jn.115.212217.
50
Reynolds, L. P., P. P. Borowicz, C. Palmieri, and A. T. Grazul-Bilska. 2014. Placental vascular
defects in compromised pregnancies: effects of assisted reproductive technologies and
other maternal stressors. In: L. Zhang and C. A. Ducsay editors, Advances in fetal and
neonatal physiology, Advances in experimental medicine and biology vol. 814, Springer
Science Business Media, NY. p. 193-204. doi: 10.1007/978-1-4939-1031-1_17.
Reynolds, L. P., P. P. Borowicz, J. S. Caton, K. A. Vonnahme, J. S. Luther, D. S. Buchanan, S.
A. Hafez, A. T. Grazul-Bilska, and D. A. Redmer. 2010. Utero-placental vascular
development and placental function: An update. Invited review. Internat. J. Develop.
Biol. Special Issue ‘Placental Developmental Biology,” J. S. Hunt and K. L. Thornburg
(eds.) 54:355-366.
Reynolds, L. P., P. P. Borowicz, K. A. Vonnahme, M. L. Johnson, A. T. Grazul-Bilska, D. A.
Redmer, and J. S. Caton. 2005. Animal models of placental angiogenesis. Placenta
26:689-708. doi:10.1016/j.placenta.2004.11.010.
Reynolds, L. P., R. R. Magness, and S. P. Ford. 1984. Uterine blood flow during early pregnancy
in ewes: Interaction between the conceptus and the ovary bearing the corpus luteum. J.
Anim. Sci. 58:423-429. doi:10.2527/jas1984.582423x.
Richards, M. W., R. P. Wettemann, and H. M. Schoenemann. 1989. Nutritional anestrus in beef
cows: concentrations of glucose and nonesterified fatty acids in plasma and insulin in
serum. J. Anim. Sci. 67:2354-2362. doi:10.2527/jas1989.6792354x.
Roberts, R. M., J. C. Cross, and D. W. Leaman. 1992. Interferons as hormones of pregnancy.
Endocr. Rev. 13:432-452. doi: http://dx.doi.org/10.1210/edrv-13-3-432.
51
Robinson, J. J., I. McDonald, C. Fraser, and I. McHattie. 1977. Studies on reproduction in
prolific ewes. I. Growth of the products of conception. J. Agri. Sci. Camb. 88:539-552.
doi: http://dx.doi.org/10.1017/S0021859600037229.
Robinson, J. J., K. D. Sinclair, and T. G. McEvoy. 1999. Nutritional effects on foetal growth.
Animal Science. 68:315-329.
Roseboom, T. J., R. C. Painter, A. F. M. van Abeelen, M. V. E. Veenendaal, and S. R. de Rooij.
2011. Hungry in the womb: What are the consequences? Lessons from the Dutch famine.
Maturitas 70:141-145. doi: 10.1016/j.maturitas.2011.06.017.
Sasser, R. G., C. A. Ruder, K. A. Ivani, J. E. Butler, and W. C. Hamilton. 1986. Detection of
pregnancy by radioimmunoassay of a novel pregnancy-specific protein in serum of cows
and a profile of serum concentrations during gestation. Biol. Reprod. 35:936-942.
doi: 10.1095/biolreprod35.4.936.
Sasser, R. G., B. M. Alexander, and C. A. Ruder. 1991. Pregnancy detection in postpartum cows
by measurement of pregnancy-specific protein B (PSP-B). J. Anim. Sci. 69(Suppl):466.
Schalue, T. K. 1992. Effects of intrauterine infusion of synthetic peptide fragments
corresponding to ovine trophoblast interferon (oTIFN) on oxytocin-induced endometrial
inositol phosphate turnover in ewes. Biol. Reprod. 46(Suppl. 1):70.
Semambo, D. K. N., P. D. Eckersall, R. G. Sasser, and T. R. Ayliffe. 1992. Pregnancy- specific
protein B and progesterone in monitoring viability of the embryo in early pregnancy in
the cow after experimental infection with Actinomyce Pyogenes. Theriogenology 37:741-
748. doi: 10.1016/0093-691X(92)90153-I.
52
Sharif, J., Y. Shinkai, and H. Koseki. 2013. Is there a role for endogenous retroviruses to mediate
long-term adaptive phenotypic response upon environmental inputs? Phil. Trans. R. Soc.
B. 368:20110340-20110353. doi: 10.1098/rstb.2011.0340.
Short, E. C., R. D. Geisert, S. D. Helmer, M. T. Zavy, and R. W. Fulton. 1991. Expression of
antiviral activity and induction of 2, 5’-oligoadenylate synthetase by conceptus secretory
proteins enriched in bovine trophoblast protein-1. Biol. Reprod. 44:261-268.
doi: 10.1095/biolreprod44.2.261.
Silvia, W. J. and R. E. Raw. 1993. Regulation of pulsatile secretion of prostaglandin F2 alpha
from the ovine uterus by ovarian steroids. J. Reprod. Fertil. 98:341-347. doi:
10.1530/jrf.0.0980341.
Spencer, T. E., and F. W. Bazer. 2004. Conceptus signals for establishment and maintenance of
pregnancy. Reprod. Biol. Endo. 2:49.
Spencer, T. E., G. A. Johnson, F. W. Bazer, R. C. Burghardt, and M. Palmarini. 2007. Pregnancy
recognition and conceptus implantation in domestic ruminants: roles of progesterone,
interferons, and endogenous retroviruses. Reprod. Fert. Dev. 19:65-78.
doi:10.1016/j.anireprosci.2004.04.014.
Spencer, T. E., and F. W. Bazer. 2002. Biology of progesterone action during pregnancy
recognition and maintenance of pregnancy. Front. Biosci. 7:d1879-d1898.
Spencer, T. E., G. A. Johnson, F. W. Bazer, and R. C. Burghardt. 2004. Implantation
mechanisms: insights from the sheep. Reproduction 128:657-668. doi:
10.1530/rep.1.00398.
Spicer, L. J., E. Alpizar, and S. E. Echternkamp. 1993. Effects of insulin, insulin-like growth
factor-I, and gonadotropins on bovine granulosa cell proliferation, progesterone
53
production, estradiol production, and(or) insulin-like growth factor I production in vitro.
J. Anim. Sci. 71:1232-1241. doi:10.2527/1993.7151232x.
Spitzer, J. C., D. G. Morrison, R. P. Wettemann, and L. C. Faulkner. 1995. Reproductive
responses and calf birth and weaning weights as affected by body condition at parturition
and postpartum weight gain in primiparous beef cows. J. Anim. Sci. 73:1251-1257.
doi:/1995.7351251x.
Stalker, L. A., D. C. Adams, T. J. Klopfenstein, D. M. Feuz, and R. N. Funston. 2006. Effects of
pre- and postpartum nutrition on reproduction in spring calving cows and calf feedlot
performance. J. Anim. Sci. 84:2582-2589. doi:10.2527/jas.2005-640.
Stalker, L. A., L. A. Ciminski, C. A. Don, T. J. Klopfenstein, and R. T. Clark. 2007. Effects of
weaning date and prepartum protein supplementation on cow performance and calf
growth. Rangel. Ecol. Manage. 60:578-587. doi:10.2111/06-082R1.1.
Stein, A. D., P. A. Zybert, K. van der Pal-de Bruin, and L. H. Lumey. 2006. Exposure to famine
during gestation, size at birth, and blood pressure at age 59 y: evidence from the Dutch
famine. Eur. J. Epidemiol. 21:759-765. doi: 10.1007/s10654-006-9065-2.
Stein, Z., M. Susser, G. Saenger, and F. Marolla. 1972. Nutrition and mental performance:
prenatal exposure to the Dutch famine of 1944-1945 seems not related to mental
performance at age 19. Science 178:708-713.
Stewart, R. E., L. J. Spicer, T. D. Hamilton, and B. E. Keefer. 1995. Effects of insulin-like
growth factor-I and insulin on proliferation and on basal and luteinizing hormone-
induced steroidogenesis of bovine thecal cells: involvement of glucose and receptors for
insulin-like growth factor I and luteinizing hormone. J. Anim. Sci. 73:3719-3731.
doi:10.2527/1995.73123719x.
54
Swanson, T. J., C. J. Hammer, J. S. Luther, D. B. Carlson, J. B. Taylor, D. A. Redmer, T. L.
Neville, L. P. Reynolds, J. S. Caton and K. A. Vonnahme. 2008. Effects of gestational
plane of nutrition and selenium supplementation on mammary development and
colostrum quality in pregnant ewe lambs. J. Anim. Sci. 86:2415-2423.
doi:10.2527/jas.2008-0996.
Szenci, O., J. F. Beckers, J. Sulon, M. M. Bevers, Börzsönyi, L. Fodor, Kovács, and M. A. M.
Taverne. 2003. Effect of induction of late embryonic mortality on plasma profiles of
pregnancy associated glycoprotein 1 in heifers. Vet. J.165:307-313. doi:10.1016/S1090-
0233(02)00180-6.
Teixeira, M. G., K. J. Austin, D. J. Perry, V. D. Dooley, G. A. Johnson, B. R. Francis, and T. R.
Hansen. 1997. Bovine granulocyte chemotactic protein-2 is secreted by the endometrium
in response to interferon-tau (INF-tau). Endocrine 6:31-37. doi: 10.1007/BF02738799.
Thatcher, W. W., C. R. Staples, G. Danet-Desnoyers, B. Oldick, and E. P. Schmitt. 1994.
Embryo health and mortality in sheep and cattle. J. Anim. Sci. 74(Suppl 3):16-30.
doi:10.2527/1994.72suppl_316x.
Thatcher, W. W., P. J. Hansen, T. S. Gross, S. D. Helmer, C. Plante, and F. W. Bazer. 1989.
Antiluteolytic effects of bovine trophoblast protein-1. J. Reprod. Fert. 37:91-99.
Trudinger, B. J., W. B. Giles, and C. M. Cook. 1985. Uteroplacental blood flow velocity-time
waveforms in normal and complicated pregnancy. BJOG 92:39-45.
Tygesen, M. P., M. O. Nielsen, P. Norgaard, H. Ranvig, A. P. Harrison, and A.-H. Tauson. 2007.
Late gestational nutrient restriction: Effects on ewes' metabolic and homeorhetic
adaptation, consequences for lamb birth weight and lactation performance. Arch. Anim.
Nutr. 62:44-59. doi: 10.1080/17450390701780276.
55
USDA. 2007. Cattle and Calves Nonpredator Death Loss in the United States, 2005; USDA-
APHIS-VS, CEAH, National Animal Health Monitoring System, Fort Collins, CO
#N462.0507
USDA. 2010. Sheep and Lamb Nonpredator Death Loss in the United States, 2009.USDA–
APHIS–VS–CEAH. Fort Collins, CO. 591.0511
Vasconcelos, J. L. M., R. Sartori, H. N. Oliveira, J. G. Guenther, and M. C. Wiltbank. 2001.
Reduction in size of the ovulatory follicle reduces subsequent luteal size and pregnancy
rate. Theriogenology 56:307-314. doi:10.1016/S0093-691X(01)00565-9.
Vasques, M. I., M. E. M. Horta, C. C. Marques, R. G. Sasser, and P. Humblot. 1995. Levels of
bPSPB throughout singles and twins pregnancies after AI or transfer of IVM/IVF cattle
embryos. Anim. Reprod. Sci. 38:279-289. doi:10.1016/0378-4320(94)01373-T.
Vizcarra, J. A., R. P. Wettemann, J. C. Spitzer, and D. G. Morrison. 1998. Body condition at
parturition and postpartum weight gain influence luteal activity and concentrations of
glucose, insulin, and nonesterified fatty acids in plasma of primiparous beef cows. J.
Anim. Sci. 76:927-936. doi:10.2527/1998.764927x.
Vonnahme, K. A., B. W. Hess, M. J. Nijland, P. W. Nathanielsz, and S. P. Ford. 2006.
Placentomal differentiation may compensate for maternal nutrient restriction in ewes
adapted to harsh range conditions. J. Anim. Sci. 84:3451-3459. doi:10.2527/jas.2006-
132.
Vonnahme, K. A., J. S. Luther, L. P. Reynolds, C. J. Hammer, D. B. Carlson, D. A. Redmer, and
J. S. Caton. 2010. Impacts of maternal selenium and nutritional level on growth,
adiposity, and glucose tolerance in female offspring in sheep. Dom. Anim. Endo. 39:240-
248. doi:10.1016/j.domaniend.2010.06.005.
56
Vonnahme, K. A., M. J. Zhu, P. P. Borowicz, T. W. Geary, B. W. Hess, L. P. Reynolds, J. S.
Caton, W. J. Means, and S. P. Ford. 2007. Effect of early gestational undernutrition on
angiogenic factor expression and vascularity in the bovine placentome. J. Anim. Sci.
85:2464-2472. doi:10.2527/jas.2006-805.
Wallace, J. M., J. S. Milne, D. A. Redmer, and R. P. Aitken. 2006. Effect of diet composition on
pregnancy outcome in overnourished rapidly growing adolescent sheep. Br. J. Nutr.
96:1060-1068. doi: http://dx.doi.org/10.1017/BJN20061979.
Wathes, D. C., and F. B. P. Wooding. 1980. An electron microscopic study of implantation in the
cow. Am. J. Anat. 159:285-306. doi: 10.1002/aja.1001590305.
Watson, E. D., and J. C. Cross. 2005. Development of structures and transport functions in the
mouse placenta. Physiology (Bethesda) 20:180-193. doi: 10.1152/physiol.00001.2005.
Weems, Y. S., P. J. Bridges, Y. Tanaka, R. G. Sasser, B. R. LeaMaster, D. L. Vincent, and C. W.
Weems. 1997. PGE1 or PGE2 not LH regulates secretion of progesterone in vitro by the
88-90 day ovine corpus luteum of pregnancy. Prostaglandin 53:337-353.
Wettemann, R. P., H. D. Hafs, L. A. Edgerton, and L. V. Swanson. 1972 Estradiol and
progesterone in blood serum during the bovine estrous cycle. J. Anim. Sci. 34:1020-1024.
doi:10.2527/jas1972.3461020x.
Wilmut, I., D. I. Sales, and C. J. Ashworth. 1986. Maternal and embryonic factors associated
with prenatal loss in mammals. J. Reprod. Fertil. 76:851-864. doi: 10.1530/jrf.0.0760851.
Wimsatt, W. A. 1950. New histological observations on the placenta of the sheep. Am. J. Anat.
87:391-458. doi: 10.1002/aja.1000870304.
Winters, L. M., W. W. Green, and R. E. Comstock. 1942. Prenatal development of the bovine.
Minnesota Agric. Exper. Sta., Tech. Bull. 151.
57
Wooding, F. B. P. 1984. Role of binucleate cells in fetomaternal cell fusion at implantation in the
sheep. Am. J. Anat. 170:233-250. doi: 10.1002/aja.1001700208.
Wooding, F. B. P., and D. C. Wathes. 1980. Binucleate cell migration in the bovine placentome.
J. Reprod. Fert. 59:425-430. doi: 10.1530/jrf.0.0590425.
Wooding, F. B. P., G. Morgan, M. R. Brandon, and S. Camous. 1994. Membrane dynamics
during migration of placental cells through trophectodermal tight junctions in sheep and
goats. Cell Tissue Res. 276:387-397.
Wooding, F. B. P., L. D. Staples, and M. A. Peacock. 1982. Structure of trophoblast papillae on
the sheep conceptus at implantation. J. Anat. 134:507-512.
Wooding, F. B. P., R. M. Roberts, and J. A. Green. 2005. Light and electron microscope
immunocytochemical studies of the distribution of pregnancy associated glycoproteins
(PAGs) throughout pregnancy in the cow: possible functional implications. Placenta
26:807-827. doi:10.1016/j.placenta.2004.10.014.
Wu, G., F. W. Bazer, J. M. Wallace, and T. E. Spencer. 2006. BOARD-INVITED REVIEW:
Intrauterine growth retardation: Implications for the animal sciences. J. Anim. Sci.
84:2316-2337. doi:10.2527/jas.2006-156.
Xie, S., B. G. Low, K. K. Kramer, R. J. Nagel, R. V. Anthony, A. P. Zoli, J. F. Beckers, and R.
M. Roberts. 1991. Identification of the major pregnancy-specific antigens of cattle and
sheep as inactive members of the aspartic proteinase family. Proc. Natl. Acad. Sci. USA
88:10247-10251.
Xie, S., J. Green, J. F. Beckers, and R. M. Roberts. 1995. The gene encoding bovine pregnancy-
associated glycoprotein-1, an inactive member of the aspartic proteinase family. Gene.
159:193-197. doi: 10.1016/0378-1119(94)00928-L.
58
Zhang, S., T. R. H. Regnault, P. L. Barker, K. J. Botting, I. C. McMillen, C. M. McMillan, C. T.
Roberts, J. L. Morrison. 2015. Placental adaptation in growth restriction. Nutrients.
7:360-389. doi: 10.3390/nu7010360.
Zhu, M. J., M. Du, B. W. Hess, P. W. Nathanielsz, and S. P. Ford. 2007. Periconceptional
nutrient restriction in the ewe alters MAPK/ERK1/2 and PI3K/Akt growth signaling
pathways and vascularity in the placentome. Placenta 28:1192-1199. doi:
10.1016/j.placenta.2007.05.004.
Zhu, M. J., M. Du, M. J. Nijland, P. W. Nathanielsz, B. W. Hess, G. E. Moss, and S. P. Ford.
2009. Down-regulation of growth signaling pathways linked to a reduced cotyledonary
vascularity in placentomes of over-nourished, obese pregnant ewes. Placenta 30:405-410.
doi: 10.1016/j.placenta.2009.02.001.
Zhu, M. J., S. P. Ford, W. J. Means, B. W. Hess, P. W. Nathanielsz, and M. Du. 2006. Maternal
nutrient restriction affects properties of skeletal muscle in offspring. J. Phys. 575:241-
250. doi: 10.1113/jphysiol.2006.112110.
Zoli, A. P., J. F. Beckers, P. Wouters-Ballman, J. Closset, P. Falmagne, and F. Ectors. 1991.
Purification and characterization of a bovine pregnancy-associated glycoprotein. Biol.
Reprod. 45:1-10. doi: 10.1095/biolreprod45.1.1.
Zoli, A. P., L. A. Guilbault, P. Delahaut, W. B. Ortiz, and J. F. Beckers. 1992.
Radioimmunoassay of a bovine pregnancy-associated glycoprotein in serum: its
application for pregnancy diagnosis. Bio. Reprod. 46:83-92. doi: 10.1095/
biolreprod46.1.83.
59
CHAPTER 3. A NEW SURGICAL TECHNIQUE FOR OVARIOHYSTERECTOMY
DURING EARLY PREGNANCY IN BEEF HEIFERS
3.1. Abstract
We hypothesized that a standing flank ovariohysterectomy procedure could be developed in beef heifers that would provide high quality tissues for addressing critical questions during early pregnancy, while concomitantly providing outstanding livestock stewardship. To test the hypothesis, we: 1) developed a standing flank ovariohysterectomy procedure for use in beef heifers, and 2) implemented this procedure in a cohort of heifers up to d 50 of pregnancy for tissue collections, documentation of post-surgical recovery, and assessment of finishing performance. Ovariectomy and cesarean section protocols are well established in research and veterinary medicine and were used as starting points for procedural development. Crossbred Angus heifers (n = 46; ~ 15 mo of age; BW = 362.3 ± 34.7 kg) were used to develop this new surgical tissue collection technique. Heifers were subjected to the 5- day CO-Synch + CIDR estrous synchronization protocol so ovariohysterectomy occurred at d
16, 22, 28, 34, 40, and 50 of gestation. Key aspects of the standing flank ovariohysterectomy technique included 1) use of local anesthetic for a standing flank incision, 2) locate the uterine and ovarian arteries via blind palpation and ligate them through the broad ligament via an improved clinch knot, 3) cut the ovaries and uterus free from the broad ligament, 4) ligate the cervix and uterine branch of the vaginal artery, and 5) cut through the cervix and remove the reproductive tract. Surgical times, from skin incision to placement of the last suture, were influenced (P = 0.04) by stage of gestation. In pregnant heifers, time decreased from d 22 (120.0
± 12.0 min) to d 40 (79.5 ± 12.0 min); then increased at d 50 (90.5 ± 14.7 min). Using this procedure, we obtained uterine, placental, and embryo/fetal tissues that had experienced limited
60
hypoxia, little or no trauma, and thus were excellent quality for scientific study. All heifers recovered from surgery quickly and were moved to a finishing period. During the finishing period, ovariohysterectomized heifers had a DMI of 13.8 kg, gained 1.99 ± 0.35 kg/d, and had a
G:F of 0.145 over 132-d. The standing flank ovariohysterectomy technique represents a new and viable model to economically obtain high quality tissues for investigating critical biological mechanisms during early pregnancy in beef heifers.
3.2. Introduction
The world needs to significantly increase its output of meats by 2050 on the same or less resources to meet the projected human food demands (Wu et al., 2014; Reynolds et al., 2015). To accomplish this goal, efficient approaches to livestock production are essential. Fertilization rates are approximately 90% in beef cattle; however, at d 30 approximately 55% of had viable embryos following AI (Bridges et al., 2013). Embryonic development depends on healthy placental formation but currently there are no data showing how placental insufficiency occurs in cattle. Impaired pregnancies are associated with early embryonic losses (Reynolds et al., 2014) and long-term effects on the offspring (Reynolds and Caton, 2012).
Historically, bovine utero-placental tissues have been collected by embryo flushing up to d 16, or at slaughter later in gestation. Because slaughter approaches are expensive, only limited information exists for utero-placental development from after d 16 of pregnancy in cattle.
Annually, 3.67 million heifers are fed and harvested (USDA-NASS, 2015). Most heifers destined for feedlots present an opportunity to study pregnancy establishment and embryonic loss, which could aid in developing management procedures to increase the total numbers of offspring produced from the same number of females.
61
Midventral (Wiltbank and Casida, 1956; Copelin et al., 1987) or left lumbar (Wiltbank and Casida, 1956; Hamernik et al., 1985) hysterectomies have been reported in non-pregnant females. However, a procedure which allows for collection of high quality tissues during pregnancy would provide a platform to address critical research questions regarding embryonic survival and enhanced pregnancy outcomes. Therefore, we hypothesized that a standing flank ovariohysterectomy procedure could be developed in bovine heifers that would provide high quality tissues for addressing critical questions during early pregnancy, while concomitantly providing acceptable livestock stewardship.
3.3. Materials and Methods
All animal procedures were conducted with approval from the Institutional Animal Care and Use Committee at North Dakota State University and under the direct supervision of the university attending veterinarian. Crossbred Angus heifers (n = 46; ~ 15 mo of age; BW = 362.3
± 34.7 kg) were transported 229 km from the Central Grasslands Research Extension Center
(Streeter, ND) to the Animal Nutrition and Physiology Center (North Dakota State University,
Fargo, ND). The heifers were housed in group pens with a maximum of 6 heifers/pen. The goal of the experiment was to develop an ovariohysterectomy technique to facilitate high quality tissue collections for use in studying biological mechanisms and events occurring during early pregnancy. Before surgery all heifers were subjected to the 5-day CO-Synch + CIDR estrus synchronization protocol (Bridges et al., 2008). Heifers received 2 mL of gonadotropin releasing hormone (100 µg gonadorelin hydrochloride [Factrel] i.m.; Zoetis; Florham Park, NJ) and a controlled internal drug releasing insert (CIDR) insert (1.38 g of progesterone; Zoetis), followed in five d by CIDR removal and 5 mL of prostaglandin F 2α (250 mg dinoprost tromethamine
[Lutalyse] i.m; Zoetis), followed in 8 h by an additional 5 mL Lutalyse. Estrotect patches
62
(Rockway Inc, Spring Valley, WI) were placed on the tailhead at the time of CIDR removal to aid in the detection of estrus. Heifers were AI bred to a single sire 8 to 14 h after estrus was observed (day of breeding = d 0). Ovariohysterectomies were performed on d 16, 22, 28, 34, 40, and 50 (n = 9, 6, 6, 7, 6, and 5 respectively) of gestation and at d 16 of the estrous cycle for non- bred, non-pregnant controls (NP; n = 7). Pregnancy was confirmed via transrectal ultrasonography on d 22 and again on the d of surgery (d > 22).
3.3.1. Pre-Surgical Preparation
To minimize gut fill during surgery, feed and water were withheld for 24 and 12 h, respectively, before surgery. All items needed for the surgeries are listed in Table 1. The hair in the surgical field, which was on the left paralumbar fossa, was clipped cranially to approximately the 10 th rib, caudally 5 cm past the tuber coxae (most lateral, cranial point of the pelvic ilium, sometimes referred to as the ‘hook’ bone), dorsally to the vertebral column, and ventrally to femorotibial joint (stifle joint) with standard large animal clippers with a 83 and
84AU blades (Oster Shearmaster clippers; Sunbeam Products; Boca Raton, FL). A number 40
Oster blade (Sunbeam Products) was then used to remove hair down to the skin cranially to the
11 th rib, caudally 2.5 cm past the tuber coxae, dorsally 2.5 cm above the transverse processes of the lumbar vertebrae, and ventrally 2.5 cm below the paralumbar fossa. Heifers were clipped 12 h before surgery. On the day of surgery, heifers were placed into a restraining chute (Silencer
Commercial Pro Model; Moly Manufacturing Inc.; Loraine, KS) and given 0.05 mg acepromazine maleate (PromAce Injectable; Zoetis) per kg BW intravenously.
To facilitate animal care and restraint, the heifer was then equipped with a cranial (Fig.
3-1A) and caudal (Fig. 3-1B) support harness (lateral view, Fig. 3-1C) and nylon hobbles on the
63
rear legs. These harnesses are vital to the efficiency of the technique. The caudal harness (Fig.
3-1B) consisted of two continuous loop 1.8 m tow straps (Roundsling; Lift-all; Landisville, PA).
A) B)
C)
Figure 3-1. Surgical restraint and ovariohysterectomy harness schematic in cranial, caudal and lateral views. A) Schematic of the cranial harness B) Schematic of the caudal harness and C) Lateral view of incision site ( ), cranial harness, and caudal harness (Schematic A, B, and C drawn by Faithe Keomanivong and computerized by Jamie Keomanivong).
The left side tow strap began dorsal to the sacral vertebrae, progressed ventrally down the femur and caudal to the tuber coxae, along the medial side of the tibia and dorsal again caudal of the femur to rejoin the other end of the strap. The right side tow strap also began dorsal to the sacral vertebrae, progressed ventrally down the femur and cranial to the tuber coxae, along the medial side of the tibia and dorsal again caudal of the femur to rejoin the other end of the strap. The four ends were connected via a grade-8 U-bolt and a 3 × 10 cm steel plate.
64
The U-bolt was attached to a 5 cm ratchet strap (Lowe’s, Mooresville, NC) which allowed surgical assistants the ability to lift the caudal half of the animal. The cranial harness (Fig. 3-1A) consisted of a single rubber strap 1 cm thick, 18 cm wide, and 1 m long that had an iron triangle
1 cm in diameter bolted into each end. The rubber strap was placed ventral to the 6 th rib and caudal to the fore limbs. The iron triangles were secured via 28 cm cable ties (Lowe’s) and chained to an iron leg spreader dorsal to the first thorasic vertebrae. The leg spreader was attached to a 5 cm ratchet strap (Lowe’s) which allowed surgical assistants the ability to lift the cranial half of the animal. The cranial harness was secured forward by 2.5 cm nylon straps
(Lowe’s) that progressed from the ventral midline cranial to the fore limbs and on each side of the cervical vertebrae. Straps are twisted two or three times around each other dorsal to the cervical vertebrae and then connected to the leg spreader with straps.
The surgical field was then scrubbed with 7.5% povidone-iodine scrub (Betadine;
Creative Science LLC; Ballwin, MO ) and rinsed with 70% isopropyl alcohol (Vetone; Boise,
ID). For local anesthetic block 36 to 42 mL of 2% lidocaine hydrochloride (approximately 4 mg/kg BW; Vetone) was administered with an 18 gauge 3.8-cm-long needle (Medtronic,
Dublin, Ireland) subcutaneously and into the intercostal muscles in an inverted L-pattern starting
5 cm cranial to the tuber coxae and continuing cranially along the transverse processes of the lumbar vertebrae to the 13 th rib, then ventrally along the 13 th rib to the ventral portion of the paralumbar fossa (Turner and McIlwraith, 1982), then as needed to maintain adequate local anesthesia. After administration of the local anesthetic, the surgical site was scrubbed with 7.5% povidone-iodine scrub, rinsed with water, and coated with ethanol and 7.5% povidone-iodine solution and allowed to dry. Anesthetic block (Ko et al., 1989) to the uterine body, uterine horn, and broad ligament was administered just before the initiation of surgery. The block was
65
completed by injection of 5 mL of 2% lidocaine hydrochloride with an 18 gauge, 3.8-cm-long needle (Medtronic) in the epidural space of the tail head between the second and third sacral vertebrae.
3.3.2. Surgical Procedure
Instruments included in the sterilized surgical kits and materials for surgery are listed in
Table 3-1. After pre-surgical preparation, an incision, approximately 18 to 25 cm in length (i.e. wide enough to accommodate the two arms of the surgeon side-by-side) was made in the left paralumbar fossa. The incision began 3 to 5 cm ventral of the transverse processes of the lumbar vertebrae and 3 to 5 cm cranial to the tuber coxae and progressed ventrally at an approximate
25˚ angle cranially and end 3 to 5 cm caudal to the 13 th rib in the ventral region of the paralumbar fossa. The external and internal abdominal oblique, transverse abdominal muscles, and peritoneum were then incised or blunt dissected to gain access to the peritoneal cavity. Once inside the peritoneal cavity the rumen, small intestine, rectum, reproductive tract, and broad ligament were palpated to confirm normal anatomical structures and locations.
The left uterine artery (closest to incision) was located and ligated (Fig. 3-2A) with an improved clinch knot (Fig. 3-2B: http://hdimagegallery.biz/improved+clinch+knot+fishing) using #2 absorbable suture (Vicryl; Ethicon; Somerville, NJ). Suture material was passed through the broad ligament caudal to the uterine artery back through broad ligament cranial to the uterine artery, with either (surgeon preference) a blunted #1, half curve, taper needle
(Integra-Miltex; Plainsboro, New Jersey) or 13-cm hemostats (Integra-Miltex). The ligature was placed (Fig. 3-2A) no further distal to the uterine horn than could be palpated while still in contact with the uterine horn and no more proximal to the uterine horn than the first arterial branch from the main uterine artery. In addition, care was taken so that any branches of the
66
uterine artery were included within the ligature to ensure complete blockage of blood flow. This process was repeated for the right
Table 3-1. List of materials needed for the ovariohysterectomy procedure. Quantity Item Surgeon Attire and Preparation Items 1 Sterile scrub top (various sizes) 1 Sterile surgical gloves 1 E-Z scrub hand brushes with providine Pre -surgical Items 1 Standard large animal clipper (83 and 84AU blades) 1 Small clippers with Number 40 blade 1 Bottle of 7.5% povidone -iodine scrub 1 Spray bottle of 7.5% povidone -iodine solution 1 Spray bottle of 70% isopropyl alcohol 36 mL 2% lidocaine hydrochloride local anesthetic 5 mL 2% lidocaine hydrochloride epidural 0.3 mL Acepromazine maleate 1 3 mL syringe 1 6 mL syringe 3 12 mL syringe 1 Sterile chute drape 4 18 gauge 3.8 cm needles 1 20 gauge 3.8 cm needle 1 L Benz -All germicidal solution Surgical Kit 2 #4 Scalpel handles 1 #20 Scalpel blades 1 Rat tooth forceps 4 Medium hemostats (18 cm) 4 Mosquito hemostats (12.5 cm 2 Crafoord Coarctation Clamp (23.5 cm) 2 Needle holders 1 Double blunt scissors (28 cm) 2 Double blunt scissors (13 cm) 1 Single blunt scissors (13 cm) 3 3/8 circle taper needles (# 1, #2, or # 4) 3 3/8 circle cutting needles (#1, #2, or #4) ¼ roll 3” × 3” or 4” × 4” gauze pads 2 1/2 circle taper needles with blunted end (# 1) Surgical Items 274 cm #2 Vicryl absorbable suture 1 m #1 or #2 heavy polymerized braunamid 10 mL 0.01M Phosphate buffered saline 1 L Sterile saline with 10 mL of glycerol anhydrous and 4 mL penicillin Post -Surgical Items 0.02 mL/kg Benzathine -procaine penicillin G 0.02 mL/kg Flunixin meglumin (for 3 consecutive d) 67
uterine artery, both ovarian arteries, and the cervix. For the cervix, care was taken so that the uterine branch of the vaginal artery on both sides was included within the ligature.
main (middle) uterine a.
A) ovarian a.
B)
Figure 3-2. (A) Schematic of bovine reproductive tract illustrating the location of ligatures. ( atertial ligatures, cervical ligatures), clamp ( 24-cm Crafoord Coarctation Clamp; Integra-Miltex), and uterine incision ( ) during the ovariohysterectomy procedure and (B) Close up schematic of the improved clinch knot around the ovarian artery (knot adapted from http://hdimagegallery.biz/improved+clinch+knot+fishing; schematic A and B drawn by Faithe Keomanivong and computerized by Jamie Keomanivong).
Separation of the broad ligament was initiated by creating an opening large enough for the surgeon to insert two fingers caudal to all ligatures. Once the initial opening was created surgeons were able to completely localize and protect cutting target tissue in their hand. The broad ligament was then completely severed (Integra-Miltex), from the ovaries, uterine horns, and uterine body to include no less than 2 cm of the cervix. Severing of the broad ligament with the double blunt scissors was conducted in a manner so that all other internal organs and tissues
68
were protected from the cutting surfaces. As gestation progressed and blood flow increased, a second ligature was placed distal to the first ligatures on all four uterine and ovarian arteries.
This order of artery ligation and broad ligament separation seemed to minimize tissue edema during completion of surgery by decreasing overall time for tissues removal. Minimizing edema is important because edema presence decreased the ability to palpate the uterine, ovarian, and cervical structures. An improved clinch knot was placed on the cranial end of the cervix (Fig. 3-
2A) and a second improved clinch knot was placed on the caudal end of the uterine body (~ 1 cm apart).
After placement of cervical ligatures, the uterine body was clamped via a 24-cm
Crafoord Coarctation Clamp (Integra-Miltex) which was placed (Fig. 3-2A) cranial to the cervical ligation(s). Clamp placement was as close as possible to the cervical ligation(s), while still allowing for adequate space to complete the incision, and across the entire uterine body. An incision was made between the uterine clamp and the second cranial cervical ligature to separate the uterine body from the cervix (Fig. 3-2A). This incision was made using the 28-cm double blunt scissors (Integra-Miltex) and using the uterine clamp as a guide. The target tissues (ovaries and uterus) were then removed from the peritoneal cavity, placed on a tray, and covered with cheesecloth moistened with 0.01M PBS. Upon removal of the ovaries and uterus, the rumen and intestines were palpated to ensure no damage had occurred, and 1 L of sterile saline (~38.6˚ C) containing 10 mL of glycerol anhydrous (J. T. Baker Chemical Co.; Avantor Performance
Materials; Center Valley, PA) and benzathine-procaine penicillin G (10,000 units/ kg BW;
PenOne Pro; Vetone) was administered into the peritoneal cavity. The peritoneum and abdominal muscles (transverse and oblique) were closed with #2 absorbable suture (Vicryl;
Ethicon) via a continuous Ford interlocking pattern (Knecht et al., 1987). The skin was closed
69
with a #2 polymerized braunamid (Jorgensen; Loveland, CO) via interrupted sutures to ensure incision remained closed even after edema. Incision site and sutures were dressed with Blu-Kote antibiotic wound dressing (H. W. Naylor Co. Morris, NY).
3.3.3. Post-Operative Care
Antibiotics (10,000 units of benzathine-procaine penicillin G/kg BW; PenOne Pro;
Vetone) and analgesics (1.1 mg of flunixin meglumin/kg BW; Prevail Flunixin; Vetone) were administered immediately following surgery. Heifers were then placed in 3 × 3-m, individual recovery pens and provided grass hay and water, ad libitum. Antibiotic (10,000 units of benzathine-procaine penicillin G/kg BW; PenOne Pro; Vetone) was given for two consecutive days following surgery. Heifers remained in their recovery pen for no less than 5 d and no more than 10 d, after which they were returned to group pens. Sutures were removed from the skin 14 d following the surgery. After recovery, all heifers were placed on a high-concentrate diet, which consisted of 50% course rolled corn, 25% dried distillers grains with solubles, 20% corn silage, and 5% trace mineral premix, all on a DM basis. The heifers were given an electronic id tag and fed using an Insentec roughage intake control system (Hokofarm Group, Netherlands) until they reached slaughter weight (~591 kg). Intake was recorded daily, and BW was taken every 28 d so that ADG and efficiency could be determined.
3.3.4. Procedure Assessment
The ovariohysterectomy technique was assessed by statistical analysis of length of surgery, stage of gestation, and experience of the surgeon. There were three primary surgeons with multiple trainee assistants with varying degrees of expertise. Consequently, times reported are likely elevated due to training. However, length of surgery was recorded and because there was no difference between surgeons ( P > 0.05) times, are reported as means ± SEM
70
Observations of adverse side effects and prolonged recovery were also recorded. All statistical analyses were conducted using SAS (SAS Institute Inc.; Cary, NC). Differences between week of surgery or day of gestation and time to completion were evaluated via PROC GLM with significance at P ≤ 0.05. The relationship between week of surgery and time to completion was evaluated using PROC CORR. The success of the surgical procedure was also evaluated by the presence and length of adverse side effects in the ovariohysterectomized heifers, which were recorded but not statistically analyzed because of the exceptionally low incidence.
3.4. Results and Discussion
Length of surgery decreased as the surgeon became more familiar with the protocol.
There was a 35-min decrease between the first 21 heifers (121.5 ± 6.7 min) compared with the last 21 heifers (86.6 ± 6.7 min) that were ovariohysterectomized. The progressive decrease in length of surgery was also evident as a decrease in the time needed to complete the surgery by week. The time to complete surgery by week tended to differ ( P = 0.09) among weeks, decreasing from 136.3 ± 17.3 min on week 1 to 79.0 ± 13.4 min on week 9. There was also an inverse correlation between time to completion and week (r = −0.53; P = 0.0009). The length of surgery was also influenced by day of gestation ( P = 0.04). Time was least in non-bred, non- pregnant controls (69.0 ± 20.8 min). In pregnant heifers, time decreased from d 22 (120.0 ± 12.0 min) to d 40 (79.5 ± 12.0 min). However, the times for d 16 and d 28 may be skewed, as the first surgeries were conducted on d 28, which raised the overall average for that day, and approximately half of the d 16 surgeries were performed at the end of the study.
The time of surgery was influenced by day of gestation and likely by effective animal restraint. As most of this technique was conducted outside of the surgeons’ visual field, tissue edema and associated inflammation were a concern because they made palpation of target
71
structures more difficult, which, in turn, increased the time needed to complete the ovariohysterectomy. With the development of adjustable belt-type harnesses for front and rear legs, effective animal restraint allowed the surgeons to more efficiently complete the procedure and likely decreased the length of the surgery.
Tissues acquired by this technique were of equal or greater quality to those obtained via slaughter procedures (L. P. Reynolds and P. P. Borowicz, North Dakota State University, Fargo,
ND, personal communication). Until the development of our standing flank ovariohysterectomy technique, the only way to observe interactions between the developing conceptus and maternal tissues, after d 16 of gestation, was to slaughter the dam and excise the entire reproductive tract.
However, as described by Cooke et al. (2014) and Bilby et al. (2004), due to the time required to obtain the reproductive tract after exsanguinating the dam, the fetus and reproductive tissues are likely hypoxic. The time to procure sample tissues has been reported to be as little as 15 min post-slaughter (Riding et al., 2008), with tissue preparation and collection occurring thereafter.
In the average commercial abattoir the time from exsanguination to the time at which the reproductive tracts are removed and sampled can be longer than 30 min (K. R. Maddock-Carlin,
North Dakota State University, Fargo, ND, personal communication). Espina and Mueller
(2011) reported that preanalytical variability due to tissue damage from oxidative, hypoxic, and metabolic stress, which can occur within 20 min of blood supply removal, was a major contributor to variability in molecular research outcomes. The tissue samples obtained via the current technique were removed and sampled within minutes after complete ligation of the entire blood supply (i.e. cervical ligation). The reduced time from cessation of blood flow to obtaining the reproductive tract for sampling using the current procedure is therefore a distinct
72
advantage for assessing biological events and mechanisms associated with early pregnancy outcomes.
Before development of our ovariohysterectomy technique, the most common way to acquire fetal tissues before implantation was by embryo flushing. Techniques to flush developing embryos from uteri were established in the late 1970’s (Testart et al., 1975).
However, successful embryo flushes cannot be accomplished after about d 16 of gestation
(Winters et al., 1942; King et al., 1981) due to tissue damage which make laboratory analyses and growth assessments difficult if not impossible. Embryos flushed past day 16 are likely damaged because the embryo can occupy space in both uterine horns at this time of gestation
(Winters et al., 1942; King et al., 1981). The present ovariohysterectomy technique also allowed us to obtain both maternal as well as intact fetal tissues after d 16.
For procurement of tissues after d 16, either slaughter or midventral surgical techniques have been used. Issues associate with slaughter techniques were discussed above. The major repercussion to a midventral surgery is the need for general anesthesia. However, the current technique can be accomplished via local anesthesia of the paralumbar fossa and caudal epidural.
This eliminates issues associated with general anesthesia in ruminants such as dealing with salivation and frequent regurgitation as well as preventing hypoventilation due to excess gas and lung compression (Kohn et al., 1997). The use of local anesthesia also minimizes equipment needs by removing the need for ventilators, intubation equipment, oxygen supply, and fluid therapy during surgery. The current technique also minimizes postoperative care which is more extensive after a general anesthesia surgery including but not limited to regaining consciousness
(mainly dealing with dorsal and lateral recumbency) and resumption of eating and drinking (i.e. gastrointestinal function).
73
All heifers recovered from the surgical procedures exceptionally well. Heifers were considered recovered when they presented with no elevated body temperature, resumed previous DMI and water intake, and moved without discomfort. Most heifers were eating and drinking within 2 h after surgery, with the few exceptions taking no more than 8 h. Sutures were removed from all heifers 14 d post-surgery. Of the 46 heifers that underwent ovariohysterectomies, only two (4.8%) exhibited stiffness in the front limbs due to the harness, which dissipated after 1 to 2 d. One heifer (2.4%) showed signs of vaginal infection 4 wk after surgery; however, with antibiotic treatment no further incidence was seen. There was a 0% death loss associated with this cohort of heifers during technique development and all heifers resumed normal growth. The lack of prolonged recovery and adverse side effects is a major attribute of the procedure and enhances the efficacy of using this ovariohysterectomy technique for early pregnancy research in beef heifers. After the complete recovery from surgery, all heifers were placed on a finishing diet (initial BW = 362.3 ± 34.7 kg) for 132 d. The heifers had a DMI of 13.78 kg/d, gained 1.99 ± 0.35 kg/d with an efficiency of 0.145 kg of gain per kg of feed, and were slaughtered at 625.11 ± 59.8 kg. At slaughter, heifers had quality grades of 27%
Prime, 71% Choice, and 2% Select. Therefore, we demonstrated that heifers undergoing our ovariohysterectomy technique are acceptable candidates to be finished on feedlot diets.
In addition to potential effects on the fetus and uterine environment due to hypoxia, studies which utilize the premature slaughter of reproductively sound heifers are costly. One approach to mitigate these costs has been the use of cull cows (USDA-APHIS, 2010). However, using cull cows may not provide an accurate representation of development in a reproductively sound female as most beef cows are culled for reproductive or production inefficiencies
(USDA-APHIS, 2010). The problems associated with utilizing cull cows are avoidable using
74
our model of performing the ovariohysterectomy protocol on reproductively sound yearling heifers reported in the current paper. Using the current procedure, heifers destined for feedlot finishing can be utilized for early pregnancy research on diets that represent a typical replacement heifer diet and then placed in a feedlot, thus minimizing the cost of tissue acquisition compared with slaughter techniques in which pregnant heifers are slaughtered before reaching market BW. During normal production practices, 3.367 million heifers annually are fed, slaughtered, and placed into the food chain in the U.S. (USDA-NASS, 2015). The heifers destined for the food supply present an excellent opportunity to study, in vivo, the establishment of pregnancy in a normal environment. Thus, our protocol is not only cost effective but utilizes animals efficiently with a high priority for heifer welfare.
In conclusion, the standing flank ovariohysterectomy procedure can be done within many normal cattle working facilities with little modification. Tissues acquired using the standing ovariohysterectomy procedure we have developed are of high quality and exhibit minimal trauma. The quality of these tissues has allowed our group to characterize expression patterns of endogenous retroviruses (McLean et al., 2016), nutrient transporters (Crouse et al., 2015), redefine the distribution of GLUT 3 in reproductive tissues (Osei et al., 2016), determine the existence of GLUT 14 in the maternal tissues (Crouse et al., 2016a), and assess the influences of nutritional restriction on endogenous retroviruses and nutrient transporters (Crouse et al., 2016b;
McLean et al., 2016). The standing ovariohysterectomy procedure thus provides an excellent method to conduct early pregnancy research while maintaining livestock stewardship. High quality tissues can be acquired with minimum cost, and heifers undergoing the ovariohysterectomy can be expected to reach slaughter BW with minimal effects on growth performance. The data acquired using the present ovariohysterectomy procedure will therefore
75
minimize inefficiencies. This procedure represents an excellent model for studying critical events during early gestation in heifers. This model will provide insight into the effects of maternal nutrition, impacts of individual nutrients, nutrient transporters, the role of endogenous retroviral elements, and lead to the elucidation of the underlying mechanisms associated with the establishment and maintenance of pregnancy in beef heifers.
3.5. Literature Cited
Bilby, T. R., A. Guzeloglu, S. Kamimura, S. M. Pancarci, F. Michel, H. H. Head, and W.
W. Thatcher. 2004. Pregnancy and bovine somatotropin in nonlactating dairy cows: I.
ovarian, conceptus, and insulin-like growth factor system responses. J. Dairy Sci.
87:3256-3267. doi:10.3168/jds.S0022-0302(04)73462-1.
Bridges, G. A., L. A. Helser, D. E. Grum, M. L. Mussard, C. L. Gasser, and M. L. Day 2008
Decreasing the interval between the GnRH and PGF 2α from 7 to 5 d and lengthening
proestrus increases timed-AI PR in beef cows. Theriogenology 69:843-851. doi:
10.1016/j.theriogenology.2007.12.011.
Bridges, G. A., M. L. Day, T. W. Geary, and L. H. Cruppe. 2013. TRIENNIAL
REPRODUCTION SYMPOSIUM: Deficiencies in the uterine environment and failure to
support embryonic development. J. Anim. Sci. 91:3002-3013. doi:10.2527/jas.2013-5882.
Cooke, R. F., B. I. Cappellozza, T. A. Guarnieri Filho, C. M. Depner, K. A. Lytle, D. B.
Jump, D. W. Bohnert, R. L. Cerri, and J. L. Vasconcelos. 2014. Effects of calcium salts
of soybean oil on factors that influence pregnancy establishment in Bos Indicus beef
cows. J. Anim. Sci. 92:2239-2250. doi:10.2527/jas.2013-7422.
76
Copelin, J. P., M. F. Smith, H. A. Garverick, and R. S. Youngquist. 1987. Effect of the uterus on
subnormal luteal function in anestrous beef cows. J. Anim. Sci. 64:1506-1511.
doi:10.2134/jas1987.6451506x.
Crouse, M. S., K. J. McLean, L. P. Reynolds, C. R. Dahlen, B. W. Neville, P. P Borowicz, and J.
S. Caton. 2015. Nutrient transporters in bovine utero-placental tissues on days 16 to 50 of
gestation. Proc. West. Sec. Amer. Soc. Anim. Sci. 66:44-47 .
Crouse, M. S. J. S. Caton, K. J. McLean, P. P. Borowicz, L. P .Reynolds, C. R. Dahlen, and A.
K. Ward. 2016a. Isolation and comparison of expression of novel glucose transporters,
GLUT3 and GLUT14, in bovine utero-placental tissues from days 16 to 50 of gestation. J.
Anim. Sci. 94:(Abstr Accepted).
Crouse, M. S., K. J. McLean, M. R. Crosswhite, N. Negrin Pereira, A. K. Ward, L. P. Reynolds,
C. R. Dahlen, B. W. Neville, P. P Borowicz, and J. S. Caton. 2016b. Effects of maternal
nutritional status on nutrient transporter expression in bovine utero-placental tissue on
days 16 to 50 of gestation Proc. West. Sec. Amer. Soc. Anim. Sci. 67: (Accepted).
Dunlop, C. I., and R. F Hoyt Jr. 1997. Anesthesia and analgesia in ruminants. In: D. F. Kohn, S.
K. Wixson, W. J. White, and G. J. Benson editors, Anesthesia and analgesia in laboratory
animals. Academic Press, New York, NY. p. 281-308.
Espina, V., and C. Mueller. 2011. Reduction of preanalytical variability in specimen
procurement for molecular profiling. In: V. Espina and L. A. Liotta editors, Molecular
profiling: methods and protocols. SpringerProtocols, Secaucus, NJ. p. 49-57. doi:
10.1007/978-1-60327-216-2_4.
77
Hamernik, D. L., J. R. Males, C. T. Gaskins, and J. J. Reeves. 1985. Feedlot performance of
hysterectomized and ovariectomized heifers. J. Anim. Sci. 60:358-362.
doi:10.2134/jas1985.602358x.
King, G. J., B. A. Atkinson, and H. A Robertson. 1981. Development of the intercaruncular areas
during early gestation and establishment of the bovine placenta. J. Reprod. Fert. 61:469-
474. doi: 10.1530/jrf.0.0610469.
Knecht, C. D., A. R. Allen, D. J. Williams, and J. H. Johnson. 1987. Suture Patterns. 3 rd ed. In:
D. Pedersen, editor, Fundamental techniques in veterinary surgery. W. B. Saunders Co.
Philadelphia, PA. p. 54-71.
Ko, J. C. H., G. C. Althouse, S. M. Hopkins, L. L. Jackson, L. E. Evans, R. P. Smith. 1989.
Effects of epidural administration of xylazine or lidocaine on bovine uterine motility and
perineal analgesia. Theriogenology 32:779-786. doi:10.1016/0093-691X(89)90466-4.
McLean, K. J., M. S. Crouse, M. R. Crosswhite, N. Negrin Pereira, A. K. Ward, C. R. Dahlen, L.
P. Reynolds, P. P Borowicz, B. W. Neville, and J. S. Caton. 2016. The effects of
nutritional restriction on endogenous retroviruses and placentation during the first 50 d of
gestation in beef heifers. J. Anim. Sci. 94(Suppl. 2):143(Abstr).
Osei, J., M. S. Crouse, K. J. McLean, J. A. Flaten, P. P. Borowicz, L. P. Reynolds, J. S. Caton,
and C. R. Dahlen. 2016. Development of an immunohistochemical technique to
determine presence and localization of glucose transporter GLUT3 in bovine utero-
placental tissues from days 16 to 50 of gestation. Proc. West. Sec. Amer. Soc. Anim. Sci.
67: (Abstr; Accepted).
Reynolds, L. P., and J. S. Caton. 2012. Role of the pre- and post-natal environment in
developmental programming of health and productivity. Invited review . Molecular and
78
Cellular Endocrinology, Special Issue ‘Environment, Epigenetics and Reproduction,” M.
K. Skinner editor, 354:54-59. doi: 10.1016/j.mce.2011.11.013.
Reynolds, L. P., M. C. Wulster-Radcliffe, D. K. Aaron, and T. A. Davis. 2015. Importance of
animals in agricultural sustainability and food security. J. Nutr. 145:1377-1379. doi:
10.3945/jn.115.212217
Reynolds, L. P., P. P. Borowicz, C. Palmieri, and A. T. Grazul-Bilska. 2014. Placental vascular
defects in compromised pregnancies: effects of assisted reproductive technologies and
other maternal stressors. In: L. Zhang and C. A. Ducsay editors, Advances in fetal and
neonatal physiology, Advances in experimental medicine and biology vol. 814, Springer
Science Business Media, NY. p. 193-204. doi: 10.1007/978-1-4939-1031-1_17.
Riding, G. A., S. A. Lehnert, A. J. French, and J. R. Hill. 2008. Conceptus-related measurements
during the first trimester of bovine pregnancy. Vet. J. 175:266-272.
doi:10.1016/j.tvjl.2007.01.022 .
Testart, J., C. Godard-Siour, and F. du Mesnil du Buisson. 1975. Transvaginal transplantation of
an extra egg to obtain twinning in cattle. Theriogenology 4:163-168. doi:10.1016/S0093-
691X(75)80006-9.
Turner, S. A., and C. W. McIlwraith. 1982. Techniques in Large Animal Surgery. Lea & Febiger
editors, Philadelphia, PA.
USDA-APHIS. 2010. Part IV: Reference of beef cow-calf management practices in the United
States, 2007-08, USDA APHIS:VS:CEAH. Fort Collins, CO #N512-1008
USDA-NASS. 2015. Cattle Inventory. USDA APHIS:VS:CEAH. Fort Collins, CO ISSN: 1948-
9099.
79
Wiltbank, J. N. and L. E. Casida. 1956. Alteration of ovarian activity by hysterectomy. J. Anim.
Sci. 15:134-140. doi:10.2134/jas1956.151134x.
Winters, L. M., R. E. Comstock, and W. W. Green. 1942. Prenatal development of the bovine.
In. 1942 Minnesota Technical Bulletin 151. Univ. of Minnesota, Minn. p. 1-50.
Wu, G., F.W. Bazer, and H.R. Cross. 2014. Land-based production of animal protein: impacts,
efficiency, and sustainability. Ann NY Acad Sci. 1328:18-28. doi: 10.1111/nyas.12566.
80
CHAPTER 4. ENDOGENOUS RETROVIRUSES ( SYNCYTIN-RUM1 AND BERV-K1 ),
INTERFERON-τ, AND PREGNANCY SPECIFIC PROTEIN-B ARE DIFFERENTIALLY
EXPRESSED IN MATERNAL AND FETAL TISSUES DURING THE FIRST 50 D OF
GESTATION IN BEEF HEIFERS
4.1. Abstract
We hypothesized that the endogenous retroviruses ( ERV : syncytin-Rum1 and BERV-
K1 ), interferon-τ (IFN- τ), and pregnancy specific protein-B (PSP-B) would be differentially expressed whereas progesterone and insulin concentrations in maternal blood would remain steady during early gestation. To test this hypothesis Angus crossbred heifers (n = 46; ~ 15 mo of age; BW = 363 ± 35 kg) were fed native grass hay, supplemented with cracked corn to gain
0.3 kg/d, and given ad libitum access to water. All heifers were subjected to a 5-d CO-Synch +
CIDR estrous synchronization protocol and AI (breeding = d 0). Ovariohysterectomies were performed on d 16, 22, 28, 34, 40, and 50 of gestation and at d 16 of the estrous cycle for non- pregnant ( NP ) controls. Utero-placental tissues (maternal caruncle [CAR ]; maternal intercaruncular endometrium [ICAR ]; and fetal membranes, [FM , chorion on d 16, chorioallantois on d 22-50]) were collected from the uterine horn ipsilateral to the corpus luteum
(CL). Tissues were flash frozen and stored at -80˚C. Expression of mRNA was evaluated using qPCR. In CAR, syncytin-Rum1 expression was greater ( P < 0.01) on d 50 (81.5-fold) compared with NP controls or any other day of early pregnancy. In contrast, syncytin-Rum1 expression in
I-CAR only tended ( P = 0.09) change across days of early pregnancy and did not differ (P =
0.27) in FM tissues. In CAR, the expression of BERV-K1 was not different ( P > 0.79) at d 16 and 22, was intermediate at d 28, 34, and 40, and was greatest on d 50 (108-fold increase compared with NP). Expression of BERV-K1 in FM was increased (P < 0.01) compared with NP
81
controls on d 28, 34, and 50, but at d 40 did not differ from NP controls. The mRNA expression of IFN-τ in FM at d 22 was greater ( P < 0.01) than all other days of gestation. In CAR expression of PSP-B increased ( P < 0.001) dramatically on d 40 (20,000-fold) and d 50 (86,000- fold) compared with NP heifers ( P < 0.01). In ICAR, expression of PSP-B was greater ( P <
0.05) on d 28 and 40 (fold increases of 113 and 102, respectively, compared with NP). Insulin concentrations were not differ ( P = 0.53) but progesterone was greater ( P < 0.01) on d 16, 22,
28, 34, and 40 compared with NP and d 50 of gestation. These data confirm differential ERV,
IFN-τ, and PSP-B expression during critical time points of early gestation in utero-placental tissues.
Key words: bovine, early pregnancy, endogenous retroviruses, hormones, maternal recognition
4.2. Introduction
Placental formation during early gestation is vital to the establishment and maintenance of pregnancy. The developing conceptus requires a fully functional placenta for exchange of nutrients, respiratory gases, and metabolic wastes throughout pregnancy (Meschia et al., 1983;
Bassil et al., 1995; Reynolds and Redmer, 1995). In ruminants, trophoblast stem cells fuse to form the syncytial plaques, which are multinucleated cells that can contain up to 25 nuclei in sheep (Wooding, 1984) and 8 nuclei in cattle (Wooding and Wathes, 1980). In addition to nutrient and gas exchange, the syncytiotrophoblast produces hormones, including progesterone needed for maintenance of a functional corpus luteum ( CL ; Bazer et al., 1991), interferon-τ
(IFN- τ) for pregnancy recognition (Spencer et al., 2007), and pregnancy specific protein-B
(PSP-B). The syncytiotrophoblast will also protect the conceptus from the maternal immune system during early gestation (Moffett and Loke, 2006).
82
The Bovidae genome contains 24 endogenous retroviral gene elements ( ERV ) depending on the species (Garcia-Etxebarria and Jugo, 2013). Five ERV are expressed in bovine trophoblast cells: syncytin-Rum1 (Cornelis et al., 2013), BERVE-A, BERVE-B, BERV-K1, and BERV-K2
(Koshi et al., 2012) The envelope proteins of syncytin-Rum1, BERVE-A and BERV-K1 may be involved with cell-to-cell fusion that occurs in bovine trophoblast during early gestation
(Cornelis et al., 2013; Nakaya et al., 2013). In addition, Sharif et al. (2013) argued that ERV function as nutrient sensors during the development of the placenta, and thus may interact with insulin, which is also indicative of animal nutrient status. Thus, we hypothesized that the endogenous retroviruses ( syncytin-Rum1 and BERV-K1 ), IFN- τ, and PSP-B would be differentially expressed, whereas progesterone and insulin concentrations would remain steady during early gestation.
4.3. Materials and Methods
All animal procedures were conducted with approval from the Institutional Animal Care and Use Committee at North Dakota State University (A14053). Commercial Angus crossbred heifers (n = 46; ~ 15 mo of age; BW = 362.3 ± 34.7 kg) were transported 229 km from Central
Grasslands Research Extension Center (Streeter, ND) to the Animal Nutrition and Physiology
Center (North Dakota State University, Fargo, ND). The heifers were housed in pens with 6 heifers per pen and fed daily at 0800 h. Heifers were maintained on a native grass hay diet, supplemented with cracked corn to gain 0.3 kg/d gain, and granted ad libitum access to water.
All heifers were subject to 5-d CO-Synch + CIDR estrus synchronization protocol and AI to a single Angus sire (day of breeding = d 0; Bridges et al., 2008). Heifers were ovariohysterectomized on d 16, 22, 28, 34, 40, or 50 (n = 9, 6, 6, 7, 6, and 5 respectively) of gestation and at d 16 of the estrus cycle for non-bred, non-pregnant controls (NP; n = 7). During
83
surgery left and right uterine arteries, left and right spiral arteries, and the cervix were ligated, and then the uterus removed. Uterine contents were held in place with a 24 cm Crafoord
Coarctation Clamp (Integra-Miltex; Plainsboro, NJ), placed just cranial to the cervical ligatures, during and after removal from the body cavity. Following surgery heifers were kept in individual pens during recovery and stitches were removed 14 d after surgery (McLean et al.,
2016a). Pregnancy was confirmed via transrectal ultrasonography d 22 and again on the d of surgery (d > 28).
4.3.1. Tissue Collecting and Processing
Immediately upon removal from the body cavity, tissues were trimmed of excess broad ligament, fat, and non-reproductive tissues. Utero-placental tissues (maternal caruncle [CAR ]; maternal endometrium, intercaruncular, [ICAR ], and fetal membranes, [FM ; chorioallantois, d
22 and later]) were obtained from the uterine horn containing the conceptus, as previously described (Grazul-Bilska et al., 2010). There were no FM collected until d 22 due to insufficient development of tissues for adequate collection, extraction, and analysis on d 16. After collection, all tissues were snap frozen in liquid nitrogen cooled isopentane (Sigma-Aldrich; St.
Louis, MO) and stored at -80°C.
Blood samples were taken via jugular venipuncture on d 16, 22, 28, 34, 40, and 50 of gestation until the heifer underwent ovariohysterectomy. Non-bred, non-pregnant control heifers were sampled on d 16 of the estrous cycle. Blood samples was collected in 10 mL vacutainer tubes (Becton Dickinson Healthcare; Franklin Lakes, NJ), allowed to clot, and stored at 4˚C until processing. Samples were centrifuged for 30 min at 3,000 × g and 4˚C after which serum was removed and stored at -20˚C. Concentrations of progesterone and insulin in serum were determined using an Immulite 1000 (Siemens, Los Angeles, CA).
84
4.3.2. Real-Time Reverse Transcriptase Quantitative PCR
The RNA was extracted and purified via an RNeasy Mini Kit (Qiagen, Valencia, CA).
The concentration of RNA extracted was determined using Take3 module of a Synergy H1
Microplate Reader (BioTek, Winooski, VT). A total of 1 µg of RNA was used for cDNA synthesis via a QuantiTect Reverse Transcription Kit (Qiagen). Primer sequences (Table 4-1) were obtained from previous literature for syncytin-Rum1 (Cornelis et al., 2013), BERV-K1
(Nakaya et al., 2013), IFN-τ (Hickman et al., 2013), and PSP-B (Patel et al., 2004).
Table 4-1. Primer Sequences of syncytin-Rum1, BERV-K1, interferon–τ (IFN- τ), and pregnancy specific protein-B (PSP-B) used for PCR analysis 1. GenBank Gene of Primer Size Sequence 2 Accession Interest Direction (bp) Number Syncytin Forward TGGTATGACTATCTTGCTGGCTTC 2464 NM_001305454 -Rum1 Reverse TGGGCTGTGAGTAGTTCTAAT BERV - Forward GGAAATCACGATGTCCT 2142 NM_001245951 K1 Reverse GGAGAGGAGGCGCTTACCTG Forward CAGGACAGAAAGACTTTGG IFN-τ 1313 NM_001015511 Reverse GTGCTCTGTGTAGAAGAGGTTG Forward TCCAGCCTGTTCTACACACGTT PSP-B 1295 NM_174411 Reverse AGGTGATCCTGAAGGTCTTATTGG 1 Primer sequences were obtained from Cornelis et al., 2013 (syncytin -Rum1 ), Nakaya et al., 2013 (BERV-K1 ), Hickman et al., 2013 (IFN-τ), and Patel et al., 2004 (PSP-B). 2 All sequences are presenting from 5’ to 3’.
Primer validation for optimum cDNA concentration and primer efficiency for each tissue type was completed before qPCR analysis. The concentration of 1:100 was determined optimal to minimize excessive use of cDNA and remain between 15 and 30 CT. Gene expression was analyzed using a 7500 Fast Real-Time PCR System (Applied Biosystems, Grand Island, NY) with SYBR Green Master Mix (Bio-Rad Laboratories, Hercules, CA). Gene expression for maternal tissues was calculated using the ΔΔCT method (Livak and Schmittgen, 2001) with β- actin as the reference gene and the average of NP expression as the control (set to 1) within each tissue. Fetal membrane gene expression was calculated using the same methods with the
85
exception that the average of d 22 FM expression as the control (set to 1) within each gene.
Across tissue gene expression was calculated using the ΔΔCT method (Livak and Schmittgen,
2001) with β-actin as the reference gene and the average of ICAR expression as the control (set to 1) within each tissue. Gene expression of syncytin-Rum1 , BERV-K1 , IFN-τ, and PSP-B across d was done separately from analysis of syncytin-Rum1 , BERV-K1 , IFN-τ, and PSP-B expression across tissues within a given d of gestation in order to determine what tissues had greater mRNA expression.
4.3.3. Statistical Analysis
Statistical analyses were conducted via the GLM procedure of SAS version 9.4 (SAS
Inst. Inc., Cary, NY), with individual heifer as the experimental unit. During pregnancy, relative pattern of mRNA expression for syncytin-Rum1 , BERV-K1 , IFN-τ, and PSP-B in CAR, ICAR, and FM was determined via the REG procedure of SAS . Best fit was determined from the regression analyses for linear, quadratic, cubic, exponential by which had the smallest P value and the greatest r2. Concentrations of progesterone and insulin were analyzed as repeated measures using the MIXED procedure of SAS with day as the variable and cow as the subject for a repeated measure. Progesterone was analyzed with a Compound Symmetry covariance structure. Insulin was analyzed with a Toeplitz covariance structure. Means were separated using the LSMEANS statement of SAS with differences determined at a P-values ≤ 0.05.
4.4. Results
Expression of syncytin-Rum1 in CAR was greater ( P < 0.01; Fig. 4-1A) by 81.5 fold on d
50 compared with NP controls and all other days of gestation. In ICAR, Syncytin-Rum1 expression tended ( P = 0.09; Fig. 4-1B) to increase until d 28 and then decrease as pregnancy
86
progressed from d 28 to 50. The expression of syncytin-Rum1 in FM during the first 50 d of gestation did not change over time (P = 0.27; Fig. 4-1C).
100 F-test: P = 0.003 b 5 F-test: P = 0.09 90 Reg: P = 0.002 4.5 Reg: P > 0.19 80 R2 = 0.47 4 70 3.5 in CAR 60 in ICAR 3 50 2.5 40 2 a 30 a a 1.5 20 a a a 1 syncytin-Rum1 syncytin-Rum1 Relative fold change of change fold Relative Relative fold change of change fold Relative 10 syncytin-Rum1 0.5 0 0 NP 16 22 28 34 40 50 NP 16 22 28 34 40 50 Gestation, d Gestation, d A B
4.5 F-test: P = 0.27 4 Reg: P = 0.03 R2 = 0.92 3.5
in FM 3 2.5 2 1.5 1 syncytin-Rum1 syncytin-Rum1
Relative fold change of change fold Relative 0.5 0 22 28 34 40 50 Gestation, d C
Figure 4-1. Expression of syncytin-Rum1 in reproductive tissues during the establishment of pregnancy in beef heifers. A) syncytin-Rum1 in maternal caruncles (CAR), B) syncytin-Rum1 in uterine endometrium (ICAR), and C) syncytin-Rum1 in fetal membranes (FM). Data presented as a 2^ -ΔΔCT fold change normalized to β-Actin and the average of non-pregnant (NP; maternal tissues) or d 22 FM (fetal tissues). Expression pattern line (- - -) when regression ( P < 0.05); regression analysis does not include NP heifers. Means without a common superscript differ ( P < 0.05). The expression of BERV-K1 was not different ( P > 0.79) at d 16 and 22 compared with
NP control heifers. The mRNA levels of BERV-K1 in CAR were intermediate at d 28, 34, and 40 87
and greater ( P < 0.01) on d 40 and 50 compared with NP, d 16, and d 22 heifers; whereas d 28 and 34 were intermediate. In addition, d 50 was greater ( P < 0.01) compared with d 28 and 34
(Fig. 4-2A). In ICAR, BERV-K1 was less ( P = 0.003) on d 16 and 22 compared with d 40 and 28 and greatest (P = 0.003) ond 28 with a 12.9 fold increase but then returned to NP levels (Fig. 4-
2B) during the first 50 d of gestation. In FM, the expression of BERV-K1 increased ( P = 0.001) from d 22 to d 34 with a 27.4 fold increase compared with d 22 heifers, while d 28 was intermediate. Expression of BERV-K1 in FM decreased from d 34 to 40 and increased again at d
50, The d 50 increase in mRNA expression of BERV-K1 in FM represents a 32.3 fold increase compared with d 22 FM ( P = 0.001; Fig. 4-2C).
The maternal recognition signal in ruminants, IFN-τ, was not detected in maternal tissues,
CAR and ICAR; thus, only FM statistical analysis was conducted. The mRNA expressions of
IFN-τ at d 22, which was used as baseline for all FM tissues, was greater (P < 0.01) than all other days of gestation (Fig. 4-3). Expression levels of PSP-B increased dramatically with d 40 and 50 being 20,000 and 86,000 fold, respectively, greater than NP heifers in CAR (Fig. 4-4A). Due to the magnitude of relative fold change on d 40 and 50 in CAR for PSP-B they were removed and the same analysis was conducted to determine if differences existed early in gestation (d 16, 22,
28, and 34) compared with NP heifers. Relative expression of PSP-B was increased ( P < 0.001) on d 22 and 34 (3,876 and 5,368 fold, respectively) but was not different ( P > 0.10) on d 16 and
28 compared with NP heifers. In ICAR, expression of PSP-B was greater ( P < 0.05) on d 28 and
40 compared with NP with fold increases of 113 and 102, respectively, and d 22, 34, and 50 were intermediate(Fig. 4B). Expression of PSP-B in FM tissue was similar ( P = 0.33) across all days evaluated (Fig. 4C).
88
140 F-test: P = 0.01 c 16 F-test: c P = 0.003 120 Reg: P < 0.001 14 R2 = 0.84 bc Reg: 100 12 P = 0.009 10 R2 = 0.23 bc in CAR
80 in ICAR ab ab 8 60 ab ab a 6 40 a ab a 4 a BERV-K1 BERV-K1
BERV-K1 BERV-K1 a 20 Relative fold change of change fold Relative Relative fold change of change fold Relative 2 0 0 NP 16 22 28 34 40 50 NP 16 22 28 34 40 50 Gestation, d Gestation, d A) B) F-test: P = 0.001 40 c 35 Reg: P = 0.01 R2 = 0.89 c 30 bc 25 in FM 20 ab 15
BERV-K1 BERV-K1 10 a
Relative fold change of change fold Relative 5 0 22 28 34 40 50 Gestation, d C) Figure 4-2. Expression of bovine endogenous retrovirus-K1 (BERV-K1) in reproductive tissues during the establishment of pregnancy in beef heifers. A) BERV-K1 in maternal caruncles (CAR), B) BERV-K1 in uterine endometrium (ICAR), and C) BERV-K1 in fetal membranes (FM). Data presented as a 2^ -ΔΔCT fold change normalized to β-Actin and the average of non- pregnant (NP; maternal tissues) or d 22 FM (fetal tissues). Expression pattern line (- - -) when regression ( P < 0.05); regression analysis does not include NP heifers. Means without a common superscript differ ( P < 0.05).
89
0.9 0.8 b F-test: P < 0.001 Reg: P < 0.001 0.7 R2 = 0.73 0.6 0.5 0.4 0.3 a 0.2 a 0.1 a a 0
Relative fold change of IFN-τ of in change fold FM Relative IFN-τ 22 28 34 40 50 Gestation, d
Figure 4-3. Expression of (IFN-τ) in fetal membranes (FM) during the establishment of pregnancy in beef heifers. Data presented as a 2^ -ΔΔCT fold change normalized to β-Actin and the average of d 22 FM (fetal tissues). Expression pattern line (- - -) when regression ( P < 0.05); regression analysis does not include NP heifers. Means without a common superscript differ ( P < 0.05).
Regression analysis for expression of syncytin-Rum1 , BERV-K1 , IFN-τ, and PSP-B across days of gestation was used to determine an overall expression pattern during the first 50 d of pregnancy (Table 4-2). In CAR, syncytin-Rum1 (P = 0.002), BERV-K1 (P < 0.001), and PSP-B
(P < 0.001) all had exponential expression patterns during the first 50 d of gestation. Expression patterns for BERV-K1 (P = 0.009), and PSP-B (P < 0.001) in ICAR were also exponential; however, syncytin-Rum1 expression in ICAR had no ( P > 0.19) pattern of expression. In FM, a linear pattern ( P = 0.03) was observed in syncytin-Rum1 expression but a cubic pattern was found for BERV-K1 (P = 0.01). The pattern of expression for IFN-τ in FM was exponential ( P <
0.001) but there was only a tendency for an exponential pattern of expression for PSP-B (P >
0.08; Table 4-2).
90
100000 160 F-test: c P = 0.05 b 90000 F-test: P < 0.001 140 Reg: b 80000 Reg: P < 0.001 120 P < 0.001 70000 2 R = 0.93 2 60000 100 R = 0.50 ab ab
in CAR in ab 50000 ICAR in 80 40000 60 30000 b
PSP-B a 20000 PSP-B 40 a a a Relative fold change of change fold Relative a 10000 a a of change fold Relative 20 0 0 NP 16 22 28 34 40 50 NP 16 22 28 34 40 50 Gestation, d Gestation, d A) B)
80 70 F-test: 60 P = 0.33 Reg: 50 P > 0.08 in FM in 40 30
PSP-B 20
Relative fold change of change fold Relative 10 0 22 28 34 40 50 Gestation, d C)
Figure 4-4. Expression of pregnancy specific protein-B (PSP-B) in reproductive tissues during the establishment of pregnancy in beef heifers. A) PSP-B in maternal caruncles (CAR), B) PSP- B in uterine endometrium (ICAR), and C) PSP-B in fetal membranes (FM). Data presented as a 2^ -ΔΔCT fold change normalized to β-Actin and the average of non-pregnant (NP; maternal tissues) or d 22 FM (fetal tissues). Expression pattern line (- - -) when regression ( P < 0.05); regression analysis does not include NP heifers. Means without a common superscript differ ( P < 0.05).
91
Table 4-2. Relative expression patterns for syncytin-Rum1, bovine endogenous retrovirus-K1 (BERV-K1), interferon-τ (IFN-τ), and pregnancy specific protein-B (PSP-B) during early pregnancy in beef heifers. Equation for the Best Fit Regression Gene 1 P-value R2 Model 2,3 Syncytin -Rum1 CAR (Fig. 1A) y = 1.6298e 0.4125x 0.002 0.47 FM (Fig. 1C) y = 0.504x + 0.61 0.03 0.92 BERV -K1 CAR (Fig. 2A) y = 8.4859e 0.3567x < 0.001 0.84 ICAR (Fig. 2B) y = 0.9091e 0.2619x 0.009 0.23 FM (Fig. 2C) y = 3.8167x 3 – 35.62x 2 +102.79x – 68.984 0.01 0.89 IFN -τ FM (Fig. 3) y = 3.8167e -1.374 x < 0.001 0.73 PSP-B CAR (Fig. 4A) y = 32.007e 1.1099x < 0.001 0.93 ICAR (Fig. 4B) y = 4.967e 0.4691x < 0.001 0.50 1Tissue expression in maternal caruncles (CAR), uterine endometrium (ICAR), and fetal membranes (FM). 2Regression analysis does not include non-pregnant heifers. 3Equation variables are y = gene and x = day .
For comparison of gene expression amongst tissues on a given day the expression of syncytin-Rum1 , BERV-K1 , IFN-τ, and PSP-B was normalized to the average in ICAR tissues. In maternal tissues, CAR and ICAR had similar mRNA expression of syncytin-Rum1 from d 16 to
40 and in NP tissues ( P > 0.32; Table 4-3). However, at d 50 syncytin-Rum1 mRNA expression in CAR was greater than ICAR (P < 0.05) and increased ( P < 0.0001) by 190.3 fold over NP baseline (Table 4-3). Expression of syncytin-Rum1 mRNA was greater in FM compared with
ICAR (P < 0.002) and CAR ( P < 0.004) from on d 22, 28, and 34 of gestation. At d 40 syncytin-
Rum1 in CAR and FM tissues were similar ( P = 0.34) compared with ICAR. However, at d 50 syncytin-Rum1 expression in CAR was greater ( P = 0.01) compared with ICAR and FM tissues
(Table 4-3).
92
Table 2-3. Relative fold change of syncytin-Rum1 expression in maternal caruncles (CAR), uterine endometrium (ICAR), and fetal membranes (FM) during the first 50 d of pregnancy in beef heifers 1. Tissue Type Gestation, d SEM P-value CAR ICAR FM NP 2 5.1 1.5 - 2.8 0.67 16 2.4 2.2 - 0.5 0.77 22 1.2 a 0.6 a 4.8 b 0.8 <0.01 28 1.9 a 1.5 a 11.0 b 1.4 <0.01 34 14.1 a 6.8 a 128.5 b 11.7 <0.01 40 13.9 1.5 23.6 7.5 0.10 50 190.3 b 1.1 a 71.7 a 28.6 <0.01 a,b means within rows without a common superscript differ ( P < 0.05). 1Data normalized to β-Actin and the average for normalized ICAR for 2^ -ΔΔCT values 2NP: non -pregnant controls ovariohysterectomized at d 16 of luteal cycle.
While establishing expression patterns in utero-placental tissues for BERV-K1 across days provides valuable information as to when BERV-K1 may be important, comparing expression among tissue types may provide insight into the functions of BERV-K1 during early pregnancy. There were no differences between tissues ( P > 0.36; Table 4-4) in BERV-K1 on d 16 and 22 in pregnant heifers and NP expression. On d 28 of gestation expression of BERV-K1 in
FM was greater ( P < 0.01) than that of maternal tissues CAR and ICAR. Expression of BERV-K1 in fetal membranes remained elevated ( P < 0.04) on d 34, 40, and 50 of gestation (45.01, 16.04, and 62.55, respectively; Table 4-4) compared with maternal tissues. When comparing PSP-B expression among tissues, there were no differences in maternal tissues in NP or d 16 of gestation or among CAR, ICAR, or FM on d 28, 34, or 40 of gestation. On d 22 and 50, however, PSP-B expression was increased in CAR with a fold increase of 10.27 and 143.98, respectively (Table 4-5) compared to NP.
93
Table 4-4. Relative fold change of bovine endogenous retrovirus-K1 (BERV-K1) expression in maternal caruncles (CAR), uterine endometrium (ICAR), and fetal membranes (FM) during the first 50 d of pregnancy in beef heifers 1. Tissue Type Gestation, d SEM P-value CAR ICAR FM NP 2 0.47 2.33 - 1.03 0.48 16 3.06 1.32 - 0.60 0.06 22 1.90 1.44 8.37 1.10 0.36 28 0.98 a 1.33 a 6.73 b 3.87 <0.01 34 10.06 a 1.44 a 45.01 b 6.27 <0.01 40 5.63 a 2.29 a 16.04 b 4.27 0.04 50 21.04 a 1.26 a 62.55 b 11.12 <0.01 a,b means within rows without a common superscript differ ( P < 0.05). 1Data normalized to β-Actin and the average for normalized ICAR for 2^ -ΔΔCT values 2NP: non -pregnant controls ovariohysterectomized at d 16 of luteal cycle.
Table 4-5. Relative fold change of pregnancy specific protein-B expression in maternal caruncles (CAR), uterine endometrium (ICAR), and fetal membranes (FM) during the first 50 d of pregnancy in beef heifers 1. Tissue Type Gestation, d SEM P-value CAR ICAR FM NP 2 0.01 6.84 - 4.44 0.55 16 29.67 9.93 - 8.5 0 0.12 22 10.27 b 3.16 a 1.69 a 2.41 0.05 28 1.47 1.45 1.11 0.46 0.83 34 4.98 1.1 0 10.3 0 3.01 0.13 40 11.1 0 2.58 2.73 2.45 0.05 50 143.98 b 1.23 a 8.91 a 13.84 <0.01 a,b means within rows without a common superscript differ ( P < 0.05). 1Data normalized to β-Actin and the average for normalized ICAR for 2^ -ΔΔCT values 2NP: non -pregnant controls ovariohysterectomized at d 16 of luteal cycle.
Concentrations of progesterone (Fig. 4-5A) on d 0 and 50 (1.8 ± 1.8 and 3.6 ± 1.0 ng/mL; respectively) were decreased ( P < 0.01) compared with all other days (7.4 ± 0.6 ng/mL).
Concentrations of insulin were similar (P = 0.53) among all days of gestation evaluated (Fig.
5B).
94
10 P < 0.01 2.5 9 b b P = 0.53 b b 8 b 2 7 6 1.5 5 a ng/mL 4 IU/mL 1 3 a 2 0.5 Concentration in serum, in serum, Concentration
1 in serum, Concentration 0 0 NP 16 22 28 34 40 50 NP 16 22 28 34 40 50 Gestation, d Gestation, d A) B) Figure 4-5. Concentrations on hormones in serum of beef heifers during early gestation. A) Concentrations of circulating progesterone in serum of beef heifers B) Concentrations of circulating insulin in serum of beef heifers. Hormones are reported as a pooled mean from heifers (n = 3, 38, 30, 25, 18, 11, and 5 for non-pregnant (NP), d 16, 22, 28, 34, 40, and 50; respectively) on each d. Means without a common superscript differ ( P < 0.05). 4.5. Discussion
The establishment of basal mRNA expression during the first 50 d of gestation is entirely novel for the ER V, BERV-K1 . McLean et al., (2016b) reported across tissue and day expression during early gestation but did not establish basal expression patterns. These data are necessary to determining begin understanding the roles ERV in pregnancy success. As stated earlier, we hypothesized that the endogenous retroviruses ( syncytin-Rum1 and BERV-K1 ), IFN-τ, and PSP-B would be differentially expressed while progesterone and insulin concentrations would remain steady during early gestation. In keeping with our hypothesis, we found BERV-K1 began to increase near d 28; whereas, syncytin-Rum1 expression was only different at d 50 of gestation in
CAR but both exhibited exponential patterns of expression from d 16 to 50 of gestation. This coincides with the time period when Winters et al. (1942) reported the greatest amount of multinucleated cells and syncytial plaque formations. The early increase of BERV-K1 over syncytin-Rum1 may be due to the increased cell to cell fusion capabilities of BERV-K1 , which
95
agrees with data from Nakaya et al., (2013). Cornelis et al. (2013), Nakaya et al. (2013) and our data presented here indicate that ruminants have at least two ERV, syncytin-Rum1 and BERV-K1 .
This finding is similar to rodent’s syncytin-A and –B (Dupressoir et al., 2011) and the human placenta syncytin-1 and -2 (Fisher et al., 1989). While syncytin-A and –B and syncytin-1 and -2 are homologous genes it is currently unknown if syncytin-Rum1 and BERV-K1 are also homologous to the mouse and human genes. Knockout mice for syncytin-A exhibit abnormal embryogenesis, ultimately terminating gestation between d 11.5 and 13.5 of gestation
(Dupressoir et al., 2009). While termination of rodent gestation occurs later in pregnancy, comparatively, than the timeframe in this study; these data may be taken to imply that these
BERV-K1 and syncytin-Rum1 are important to placentation, placentome formation, and successful pregnancy in beef cattle. However, more work remains to be completed to determine roles for BERV-K1 and syncytin-Rum1 during gestation.
The increased mRNA expression occurred in ICAR earlier (d 28) during pregnancy than in CAR for BERV-K1 . The increase in ICAR occurred at the end of the adhesion phase of implantation, which further supports previous data that demonstrated BERV-K1 has increased expression during early gestation and fusogenic functions (Koshi et al., 2012; Nakaya et al.,
2013). Thus, the role of BERV-K1 in placental formation is likely in cotyledon formation and subsequent syncytial plaque development. However, the presence of syncytin-Rum1 and BERV-
K1 in maternal tissues is not in agreement with previous data for syncytin genes in cattle
(Cornelis et al., 2013) or BERV-K1 expression in trophoblast cells (Koshi et al., 2012). The increase earlier in gestation of BERV-K1 expression compared with syncytin-Rum1 may indicate a greater role for BERV-K1 for cell to cell fusion not only between trophoblast cells of the fetus but also in syncytial plaque formation and the combination of maternal and fetal cells. These data
96
may also support previous data (Imakawa et al., 2015) that suggested BERV-K1 is replacing syncytin-Rum1 as the main catalyst in placental cell to cell fusion.
Endogenous retroviral elements contribute to the formation of the syncytiotrophoblast in humans (Blond et al., 2000; Mi et al. 2000), mice (Dupressoir et al., 2005; 2009; 2011), rabbits
(Heidmann et al., 2009), carnivores (Cornelis et al., 2012), Afrotherian tenrecs (Cornelis et al.,
2014), marsupials (Cornelis et al., 2015), and syncytial plaques in ruminants (Cornelis et al.,
2013). Formation of syncytial plaques in ruminants, which consist of both fetal and maternal cells, is unique among eutherian mammals and makes expression of ERV in maternal tissues, as reported here, understandable. The classical functions of immunosuppressive and cell to cell fusion and ERV expression in fetal tissues and maternal endometrium is intriguing to potential roles in the establishment of pregnancy such as maternal recognition and uterine immunotolerance and overall placental development.
Although means were not different from d 22 to 50 of gestation the linear increase in mRNA expression of syncytin-Rum1 in FM could be aiding in cell to cell fusion occurring during placental development, which is rapidly occurring during this time (Winters et al., 1942).
Expression pattern of BERV-K1 was cubic in nature with peaks at d 34 and 50. These data agree with characteristic functions of immune suppression and cell to cell fusion of mRNA expression associated with the syncytin gene family (Dupressoir et al., 2011) and fusogenic functions of
BERV-K1 (Nakaya et al,. 2013) as well as known events during early gestation such as maternal recognition, embryonic adhesion with the uterine endometrium, and placentation. Placental development is necessary for the transfer of nutrients responsible for the rapid fetal growth that must occur during late gestation.
97
The secretion of IFN-τ from the trophoblast is widely accepted as the ruminant signal for pregnancy recognition and inhibition of luteolysis (Thatcher et al., 1989; Bazer et al., 1991;
Bazer, 1992; Mann et al., 1999; Spencer and Bazer, 2004; Spencer et al., 2007). The secretion of
IFN-τ must occur before the initiation of luteolysis on d 18 of the estrous cycle. After which concentrations of IFN-τ decreased dramatically back to basal levels which is in agreement with data from the current research where IFN-τ mRNA expression at d 22 was greater ( P < 0.01) compared with all other days of gestation and exhibited a negative exponential pattern of expression in FM. Interferon-τ stimulates the production of many other proteins such as: ubiquitin-like interferon stimulated gene 15, myxovirus resistance 1, and 2ꞌ-,5ꞌ-oligoadenylate synthetase 1, which may be necessary for the establishment of pregnancy (Teixeira et al., 1997;
Perry et al., 1999; Binelli et al., 2001; Bazer et al., 2015). Another such protein, PSP-B, is produced in detectable quantities as early as d 15 of gestation (Bulter et al., 1982; Sasser et al.,
1986); however, concentrations vary greatly until after d 30 (Sasser et al.,1986; Humblot et al.,
1988a; Sasser et al., 1991; Vasques et al., 1995). The limited secretion of PSP-B early in gestation agrees with our data in which we observed had mRNA expression of PSP-B during the first 34 d of gestation.
The exponential expression of PSP-B may indicate a greater prevalence in placental development as gestation progresses and may be stimulated by IFN-τ and ERV. However, secondary functions may be to aide IFN-τ and ERV in fetal protection during implantation via immune suppression (Wooding et al., 2005). In addition, expression pattern for PSP-B in CAR was exponential with a mean fold change of 18,000 compared with NP. Pregnancy associated glycoproteins (PAGs ) from binucleated cells seem to interact extensively with maternal connective tissue which develops during placental villi formation (Wooding et al., 2005). It has
98
been speculated that PAGs, such as PSP-B, may possibly be involved in proteolytic activation of growth factors and other molecules specific to pregnancy, protection of fetal tissues from maternal immune response, transport of hormones between fetal and maternal tissues, and cell to cell fusion (Wooding et al., 2005). Our data presented here confirms expression of PSP-B during pregnancy, which would support Wooding et al. (2005) suggested roles of PSP-B in cell to cell fusion during placentation. Combined these data may also indicate an interaction with ERV to promote the cell to cell fusion needed for syncytial plaques formation and placental development to support fetal growth throughout gestation.
Progesterone must also be present in adequate concentrations, 1 ng/mL, for IFN-τ to suppress the release of PGF 2α stimulated by oxytocin (Meyer et al., 1995) to maintain pregnancy
(Mann and Lamming, 2001; Green et al., 2005; Mann et al., 2006; Bazer et al., 2015). Our data clearly demonstrates elevated circulating progesterone concentrations (>5 ng/mL) in pregnant heifers on all days except for d 50. Pregnant cattle will not only maintain a functional CL but also have greater progesterone levels compared with non-pregnant cattle (Henricks et al., 1971;
Humblot et al., 1988b; 2001). The drop in progesterone, regardless of treatment, on d 50 is intriguing, while the placenta does take over progesterone secretion from the CL in sheep and horses this does not occur in cattle (reviewed in Hoffmann and Schuler, 2002). Our data could be interpreted to mean that at d 50 the CL has begun to share progesterone secretion with the placenta starting as early as d 40 but the synthesis of progesterone within the placenta at remains to be completely elucidated (reviewed in Hoffmann and Schuler, 2002).
The time points assessed in this study, d 16, 34, 50 of gestation are influential to the expression of syncytin-Rum1 , BERV-K1 , IFN-τ, and PSP-B and may be important for the establishment of pregnancy. On d 16 the fetus must maintain a functional CL and as such this has
99
been termed the period of maternal recognition. Day 34 is the approximate end of adhesion when the fetus has successfully completed implantation. Finally, d 50 is towards the end of embryogenesis and during rapid placentation when formation of bi- and multinucleated cells is at its peak. The differences in mRNA expression amongst tissues also provides insight into the functions of syncytin-Rum1 , BERV-K1 , IFN-τ, and PSP-B most of which remain to be completely understood.
In conclusion, the mRNA expression of syncytin-Rum1 , BERV-K1 , IFN-τ, and PSP-B was differentially present in utero-placental tissues during the first 50 d of gestation. We established
3 times, d 16, 34, and 50, during early gestation which had differences in gene expression and should be a focus of research in the future. Expression of IFN-τ was increased during the time of maternal recognition (~d 16). Level of BERV-K1 was increased in ICAR on d 28, which coincides with fetal adhesion and the completion of implantation (~d 30; Winters et al., 1942;
Guillomot, 1995). Gene expression syncytin-Rum1 , BERV-K1 and PSP-B in CAR was increased on d 50 supporting roles in cell to cell fusion and placental development. This research also established basal expression patterns for syncytin-Rum1 , BERV-K1 , IFN-τ, and PSP-B which can be used in future research to determine the influence of treatments on pregnancy. While these data provide evidence for differential expression the functions and interactions between syncytin-
Rum1 , BERV-K1 , IFN-τ, and PSP-B remain to be elucidated and should be the focus in future studies to determine the importance in fetal and placental development and the establishment of pregnancy.
100
4.6. Literature Cited
Bassil, S., J. P. Magritte, J. Roth, M. Nisolle, J. Donnez, and S. Gordts. 1995. Uterine vascularity
during stimulation and its correlation with implantation in in-vitro fertilization. Hum.
Reprod.10:1497–1501. doi: 10.1093/HUMREP/10.6.1497.
Bazer, F. W. 1992. Mediators of maternal recognition of pregnancy in mammals. Proc. Soc. Exp.
Biol. Med. 199:373-384.
Bazer, F. W., W. W. Thatcher, P. J. Hansen, M. A. Mirando, T. L. Ott, and C. Plante. 1991.
Physological mechanism of pregnancy recognition in ruminants. J. Reprod. Fert. 43:39-
47.
Bazer, F. W., W. Ying, X. Wang, K. A. Dunlap, B. Zhou, G. A. Johnson, and G. Wu. 2015. The
many faces of interferon tau. Invited Review. Amino Acids. 47:449-460. doi:
10.1007/s00726-014-1905-x.
Binelli, M., P. Subramaniam, T. Diaz, G. A. Johnson, T. R. Hansen, and W. W. Thatcher. 2001.
Bovine interferon-τ stimulates Janus kinase-signal transducer and activator of
transcription pathway in bovine endometrial epithelial cells. Biol. Reprod. 64:654-665.
doi: 10.1095/biolreprod64.2.654.
Blond, J. L., D. Lavillette, V. Cheynet, O. Bouton, G. Oriol, S. Chapel-Fernandes, B. Mandrand,
F. Mallet, and F. L. Cosset. 2000. An envelope glycoprotein of the human endogenous
retrovirus HERV-W is expressed in the human placenta and fuses cells expressing the
type D mammalian retrovirus receptor. J. Virol. 74:3321-3329.
doi: 10.1128/JVI.74.7.3321-3329.2000.
Bridges, G. A., L. A. Helser, D. E. Grum, M. L. Mussard, C. L. Gasser, and M. L. Day 2008
Decreasing the interval between the GnRH and PGF 2α from 7 to 5 d and lengthening
101
proestrus increases timed-AI PR in beef cows. Theriogenology 69:843-851. doi:
10.1016/j.theriogenology.2007.12.011.
Butler, J. E., W. C. Hamilton, R. G. Sasser, C. A. Ruder, G. M. Hass, and R. J. Williams. 1982.
Detection and partial characterization of two pregnancy-specific proteins. Biol. Reprod.
26:925-933. doi: 10.1095/biolreprod26.5.925.
Cornelis, G., C. Vernochet, Q. Carradec, S. Souquere, B. Mulot, F. Catzeflis, M. A. Nilsson, B.
R. Menzies, M. B. Renfree, G. Pierron, U. Zeller, O. Heidmann, A. Dupressoir, and T.
Heidmann. 2015. Retroviral envelope gene captures and syncytin exaptation for
placentation in marsupials. Proc. Natl. Acad. Sci. U S A. 112:E487-496. doi:
10.1073/pnas.1417000112.
Cornelis, G., C. Vernochet, S. Malicorne, S. Souquere, A. C. Tzika, S. M. Goodman,
F. Catzeflis, T. J. Robinson, M. C. Milinkovitch, G. Pierron, O. Heidmann, A.
Dupressoir, and T. Heidmann. 2014. Retroviral envelope syncytin capture in an
ancestrally diverged mammalian clade for placentation in the primitive Afrotherian
tenrecs. Proc. Natl. Acad. Sci. U S A. 111:E4332-341. doi: 10.1073/pnas.1412268111.
Cornelis, G., O. Heidmann, S. A. Degrelle, C. Vernochet, C. Lavialle, C. Letzelter, S. Bernard-
Stoecklin, A. Hassanin, B. Mulot, M. Guillomot, I. Hue, T. Heidmann, and A.
Dupressoir. 2013. Captured retroviral envelope syncytin gene associated with the unique
placental structure of higher ruminants. Proc. Natl. Acad. Sci. USA. 110:E828-E837. doi:
10.1073/pnas.1215787110.
Cornelis, G., O. Heidmann, S. Bernard-Stoecklin, K. Reynaud. G. Veron, B. Mulot, A.
Dupressoir, and T. Heidmann. 2012. Ancestral capture of syncytin-Car1, a fusogenic
102
endogenous retroviral envelope gene involved in placentation and conserved in
Carnivora. Proc. Natl. Acad. Sci. USA. 109:E432-E441. doi: 10.1073/pnas.1115346109.
Dupressoir, A., C. Vernochet, F. Harper, J. Guegan, P. Dressen, G. Pierron, and T. Heidmann.
2011. A pair of co-opted retroviral envelope syncytin genes is required for formation of
the two-layered murine placental syncytiotrophoblast. Proc. Natl. Acad. Sci. USA
108:E1164-E1173. doi: 10.1073/pnas.1112304108.
Dupressoir, A., C. Vernochet, O. Bawa, F. Harper, G. Pierron, P. Opolon, and T. Heidmann.
2009. Syncytin-A knockout mice demonstrate the critical role in placentation of a
fusogenic, endogenous retrovirus-derived, envelope gene. Proc. Natl. Acad. Sci. USA
106:12127-12132. doi: 10.1073/pnas.0902925106.
Dupressoir, A., G. Marceau, C. Vernochet, L. Benit, C. kanellopoulos, V. Sapin and T.
Heidmann. 2005. Syncytin-A and syncytin-B, two fusogenic placenta-specific murine
envelope genes of retroviral origin in Muridae. Proc. Natl. Acad. Sci. USA 102:725-730.
doi: 10.1073/pnas.0406509102.
Fisher, S., T. Y. Cui, L. Zhang, L. Hartman, K. Grahl, Z. Guo-Yang, J. Tarpey, and C. Damsky.
1989. Adhesive and degradative properties of human placental cytotrophoblast cells in
vitro. J. Cell Biol. 109:891–902.
Garcia-Etxebarria, K., and B. M. Jugo. 2013. Evolutionary history of bovine endogenous
retroviruses in the Bovidae family. BMC Evol. Bio. 13:256-267. doi: 10.1186/1471-
2148-13-256.
Grazul-Bilska, A. T., P. P. Borowicz, M. L. Johnson, M. A. Minten, J. J. Bilski, R. Wroblewski,
D. A. Redmer, and L. P. Reynolds. 2010. Placental development during early pregnancy
103
in sheep:vascular growth and expression of angiogenic factors in maternal placenta.
Reproduction. 140:165-174. doi: 10.1530/REP-09-0548.
Green, M. P., M. G. Hunter, and G. E. Mann. 2005. Relationships between maternal hormone
secretion and embryo development on day 5 of pregnancy in dairy cows. Anim. Reprod.
Sci. 88:179-189. doi:10.1016/j.anireprosci.2004.12.007.
Heidmann, O., C. Vernochet, A. Dupressoir, and T. Heidmann. 2009. Identification of an
endogenous retroviral envelope gene with fusogenic activity and placenta-specific
expression in the rabbit: A new “syncytin” in a third order of mammals. Retrovirology
6:107-117. doi: 10.1186/1742-4690-6-107.
Henricks, D. M., D. R. Lamond, J. R. Hill and J. F. Dickey. 1971. Plasma progesterone
concentrations before mating and in early pregnancy in the beef heifer. J. Anim. Sci.
33:450-454. doi:10.2527/jas1971.332450x.
Hickman, C. F., M. Clinton, A. Ainslie, C. J. Ashworth, and J. A. Rooke. 2004 Heat shock
induces interferon-tau gene expression by in vitro produced bovine blastocysts. Am. J.
Reprod. Immuno. 70:177-181. doi:10.1111/aji.12131.
Hoffmann, B., and G. Schuler. 2002. The bovine placenta; a source and target of steroid
hormones: observations during the second half of gestation. Dom. Anim. Endo. 23:309-
320. http://dx.doi.org/10.1016/S0739-7240(02)00166-2.
Humblot, P. 2001. Use of pregnancy specific proteins and progesterone assays to monitor
pregnancy and determine the timing, frequencies, and sources of embryonic mortality in
ruminants. Theriogenology. 56:1417-1433. doi:10.1016/S0093-691X(01)00644-6.
104
Humblot, P., S. Camous, J. Martal, J. Charlery, N. Jeanguyot, M. Thibier, and G. Sasser. 1988a.
Diagnosis of pregnancy by radioimmunoassay of a pregnancy-specific protein in the
plasma of dairy cows. Theriogenology 30:257– 67. doi: 10.1016/0093-691X(88)90175-6.
Humblot, P., S. Camous, J. Martal, J. Charlery, N. Jeanguyot, M. Thibier, and R. G. Sasser.
1988b. Pregnancy-specific protein B, progesterone concentrations and embryonic
mortality during early pregnancy in dairy cows. J. Reprod. Fert.83:215-223. doi:
10.1530/jrf.0.0830215.
Imakawa, K., S. Nakagawa, and T. Miyazawa. 2015. Baton pass hypothesis: successive
incorporation of unconserved endogenous retroviral genes for placentation during
mammalian evolution. Genes to Cells 20:771-788.
Koshi, K., Y. Suzuki, Y. Nakaya, K. Imai, M. Hosoe, T. Takahashi, K. Kizaki, T. Miyazawa, and
K. Hashizume. 2012. Bovine trophoblastic cell differentiation and binucleation involves
enhanced endogenous retrovirus element expression. Reprod. Bio. Endo. 10:41-52. doi:
10.1186/1477-7827-10-41.
Livak, K. J. and T. D. Schmittgen. 2001. Analysis of relative gene expression data using real-
time quantitative PCR and the 2 -ΔΔCT Method. Methods 25:402-408.
doi:10.1006/meth.2001.1262.
Mann, G. E. and G. E. Lamming. 2001. Relationship between maternal endocrine environment,
early embryo development and inhibition of the luteolytic mechanism in cows.
Reproduction 121:175-180. doi: 10.1530/rep.0.1210175.
Mann, G. E., M. D. Fray, and G. E. Lamming. 2006. Effects of time of progesterone
supplementation on embryo development and interferon-τ production in the cow. Vet. J.
171:500-503. doi:10.1016/j.tvjl.2004.12.005.
105
McLean, K. J., C. R. Dahlen, P. P. Borowicz, L. R. Reynolds, M. R. Crosswhite, B. W. Neville,
S. D. Walden, and J. S. Caton. 2016a. Technical note: A new surgical technique for
ovariohysterectomy during early pregnancy in beef cattle. J. Anim. Sci. (Submitted, JAS
# E-2016-0761).
McLean, K. J., M. S. Crouse, M. R. Crosswhite, D. N. Black, C. R. Dahlen, P. P. Borowicz, L.
R. Reynolds, A. K. Ward, B. W. Neville, and J. S. Caton. 2016b. Rapid
Communication: Expression of an endogenous retroviral element, syncytin-Rum1, during
early gestation in beef heifers. J. Anim. Sci. 94:1-5. doi: 10.2527/jas2016-0793.
Meschia, G. 1983. Circulation to female reproductive organs Handbook of Physiology No. Sect.
2, Vol. III, part 1. p 241-269. Shepherd JT & Abboud FM, American Physiological
Society, Bethesda, MD.
Meyer, M. D., P. J. Hansen, W. W. Thatcher, M. Drost, L. Badinga, R. M. Roberts, J. Li, T. L.
Ott, F. W. Bazer. 1995. Extension of corpus luteum lifespan and reduction of uterine
secretion of prostaglandin F2α of cows in response to recombinant interferon-τ. J. Dairy
Sci. 78:1921-1931. doi:10.3168/jds.S0022-0302(95)76817-5.
Mi, S., X. Lee, X. Li, G. M. Veldman, M. Finnerty, L. Racie, E. LaVallie, X. Tang, P. Edward,
S. Howes, J. Keith, Jr, and J. M. McCoy. 2000. Syncytin is a captive retroviral envelope
protein involved in human placental morphogenesis. Nature 403:785-789.
doi:10.1038/35001608.
Moffett, A. and C. Loke. 2006. Immunology of placentation in eutherian mammals. Nat. Rev.
Immunol. 6:584-594. doi: 10.1038/nri1897.
106
Nakaya Y, K. Koshi, S. Nakagawa, K. Hashizume, and T. Miyazawa. 2013. Fematrin-1 is
involved in fetomaternal cell-to-cell fusion in Bovinae placenta and has contributed to
diversity of ruminant placentation. J. Virol. 87:10563–10572. doi: 10.1128/JVI.01398-13.
Patel, O. V., O. Yamada, K. Kizaki, T. Takahashi, K. Imai, and K. Hashizume. 2004.
Quantitative analysis throughout pregnancy of placentomal and interplacentomal
expression of pregnancy-associated glycoproteins-1 and -9 in the cow. Mol. Reprod. Dev.
67:257-263. doi: 10.1002/mrd.20017.
Perry, D. J., K. J. Austin, and T. R. Hansen. 1999. Cloning of interferon stimulated gene 17: the
promoter and nuclear proteins that regulate transcription. Mol. Endocrinol. 13:1197-
1206. doi: 10.1210/mend.13.7.0294.
Reynolds, L. P. and D. A. Redmer. 1995. Utero-placental vascular development and placental
function. J. Anim. Sci. 73:1839-1851. doi:/1995.7361839x.
Sasser, R. G., C. A. Ruder, K. A. Ivani, J. E. Butler, and W. C. Hamilton. 1986. Detection of
pregnancy by radioimmunoassay of a novel pregnancy-specific protein in serum of cows
and a profile of serum concentrations during gestation. Biol. Reprod. 35:936-942.
doi: 10.1095/biolreprod35.4.936.
Sasser, R. G., B. M. Alexander, and C. A. Ruder. 1991. Pregnancy detection in postpartum cows
by measurement of pregnancy-specific protein B (PSP-B). J. Anim. Sci. 69(Suppl):466.
Sharif, J., Y Shinkai, and H. Koseki. 2013. Is there a role for endogenous retroviruses to mediate
long-term adaptive phenotypic response upon environmental inputs? Phil. Trans. R. Soc.
B. 368:20110340-20110353. doi: 10.1098/rstb.2011.0340.
Spencer, T. E., and F. W. Bazer. 2004. Conceptus signals for establishment and maintenance of
pregnancy. Reprod. Biol. Endo. 2:49.
107
Spencer, T. E., G. A. Johnson, F. W. Bazer, R. C. Burghardt, and M. Palmarini. 2007. Pregnancy
recognition and conceptus implantation in domestic ruminants: roles of progesterone,
interferons, and endogenous retroviruses. Reprod. Fert. Dev. 19:65-78.
doi:10.1016/j.anireprosci.2004.04.014.
Teixeira, M. G., K. J. Austin, D. J. Perry, V. D. Dooley, G. A. Johnson, B. R. Francis,and T. R.
Hansen. 1997. Bovine granulocyte chemotactic protein-2 is secreted by the endometrium
in response to interferon-tau (IFN-tau). Endocrine 6:31-37. doi: 10.1007/BF02738799.
Thatcher, W. W., P. J. Hansen, T. S. Gross, S. D. Helmer, C. Plante, and F. W. Bazer. 1989.
Antiluteolytic effects of bovine trophoblast protein-1. J. Reprod. Fert. 37:91-99.
Vasques, M. I., M. E. M. Horta, C. C. Marques, R. G. Sasser, and P. Humblot. 1995. Levels of
bPSPB throughout singles and twins pregnancies after AI or transfer of IVM/IVF cattle
embryos. Anim. Reprod. Sci. 38:279–89. doi:10.1016/0378-4320(94)01373-T.
Winters, L. M., R. E. Comstock, and W. W. Green. 1942. Prenatal development of the bovine.
In. 1942 Minnesota Technical Bulletin 151. Univ. of Minnesota, Minn. p. 1-50.
Wooding, F. B. P. 1984. Role of binucleate cells in fetomaternal cell fusion at implantation in the
sheep. Am. J. Anat. 170:233-250. doi: 10.1002/aja.1001700208.
Wooding, F. B. P. and D. C. Wathes. 1980. Binucleate cell migration in the bovine placentome.
J. Reprod. Fert. 59:425-430. doi: 10.1530/jrf.0.0590425.
Wooding, F. B. P., R. M. Roberts, and J. A. Green. 2005. Light and electron microscope
immunocytochemical studies of the distribution of pregnancy associated glycoproteins
(PAGs) throughout pregnancy in the cow: possible functional implications. Placenta
26:807–27. doi:10.1016/j.placenta.2004.10.014.
108
CHAPTER 5. THE EFFECTS OF NUTRIENT RESTRICTION ON mRNA
EXPRESSION OF ENDOGENOUS RETROVIRUSES, INTERFERON-τ, AND
PREGNANCY SPECIFIC PROTEIN-B DURING THE ESTABLISHMENT OF
PREGNANCY IN BEEF HEIFERS
5.1. Abstract
We hypothesize that syncytin-Rum1 , bovine endogenous retrovirus-K1 (BERV-K1 ), pregnancy specific protein-B (PSP-B) and interferon-τ (IFN-τ) will be differentially expressed during early pregnancy (d 16 to 50) and will be influenced by plane of maternal nutritionhat endogenous retrovirus envelope genes, pregnancy specific protein-B (PSP-B), and interferon-τ
(IFN-τ) will be differentially expressed during early pregnancy (d 16 to 50) and will be influenced by plane of maternal nutrition. Commercial Angus crossbred heifers (n = 49; ~ 16 mo of age; BW = 325 ± 29 kg) were maintained on a TMR and supplemented with dried distillers grains with solubles. Non-pregnant, non-bred control ( NP-NB ) heifers (n = 6) were ovariohysterectomized on d 16 following a 5-d CO-Synch + CIDR estrus synchronization protocol. All remaining heifers were subject to 5-d CO-Synch + CIDR estrus synchronization protocol and AI to a single Angus sire (day of breeding = d 0). On the day of breeding, heifers were randomly assigned to dietary treatments. One half were assigned to control diet ( CON ) targeted to gain 0.45 kg/d and the remaining half were assigned to restricted diet ( RES ), which received 60% of control diets. Heifers were subjected to ovariohysterectomy on d 16, 34, or 50 of gestation. Utero-placental tissues were obtained from the uterine horn ipsilateral ( P) and contralateral ( NP ) to the CL and separated into maternal caruncle (CAR); maternal endometrium, inter-caruncle, (ICAR) and fetal membrane ( FM ). After collected, all tissues were snap frozen in liquid nitrogen cooled isopentane and stored at -80°C. There were no
109
interactions between stage of gestation and nutritional treatment for syncytin-Rum1 or PSP-B (P
> 0.22). Expression of BERV-K1 was influenced by a treatment × stage of gestation interaction
(P = 0.03) in NP-CAR. On d 50, heifers fed the CON diet had greater expression compare with
CON heifers on d 16 and 34 and RES heifers at all sampling time points. There was a treatment
× stage of gestation interaction (P < 0.01) for IFN-τ in FM tissue. Where d 16 expression of
IFN-τ was greater ( P < 0.01) compared with d 34 and 50 but RES tissues had greater (P < 0.01) expression on d 16 than CON FM. In P-CAR, PSP-B expression increased ( P < 0.01) by 18,000 fold on d 50 compared with NP-NB heifers. In P-ICAR, expression of syncytin-Rum1 in P-
ICAR was greater ( P = 0.01) on d 16 with a 14.14 fold increase compared with relative expression on d 34 and 50; whereas, PSP-B was increased ( P < 0.01) on d 34 and 50 compared with d 16. In conclusion, maternal nutrient restriction only influenced BERV-K1 and IFN-τ but syncytin-Rum1 , BERV-K1 , PSP-B, and IFN-τ were differential expressed in both maternal and fetal tissues at critical time points during the first 50 d of gestation in beef heifers.
Key words: beef heifers, early pregnancy, endogenous retroviruses, nutrient restriction
5.2. Introduction
Placental development is closely related to fetal growth by facilitating transfer of nutrients, gases, and wastes (Patten, 1964; Ramsey, 1982) and is sensitive to maternal nutrient supply from the earliest stages of pregnancy (Reynolds and Redmer, 1995; 2001). Inadequate maternal nutrient supply leads to poor placental development, resulting in compromised fetal growth (Wu et al., 2006; Caton and Hess, 2010; Funston et al., 2010) or even embryonic loss
(Reynolds et al., 2014). Insulin has been used as an indicator of nutrient supply (Ciccioli et al.,
2003; Lents et al., 2005) and thus may interact with reproductive tissues during times of nutrient restriction to influence placental development. The corpus luteum (CL) produces adequate
110
progesterone to maintain the pregnancy (Bazer et al., 1991). The syncytiotrophoblast and syncytium will function as the feto-maternal interface to exchange nutrients, produce hormones and protect the conceptus from the maternal immune responses (Moffett and Loke, 2006).
Syncytium formation is initiated by endogenous retroviral elements ( ERV ) which have been incorporated into the host genome. A significant portion of the genome in made up of
ERV; 8% in humans (Kurth and Bannert, 2010), 10% in mice (Jern and Coffin, 2008), and 18% in cattle (Adelson et al., 2009). The Bovidae genome contains 24 ERV families depending on the species (Garcia-Etxebarria and Jugo, 2013). The envelope proteins of syncytin-Rum1 and bovine endogenous retrovirus-K1 (BERV-K1 ) are differentially expressed during early gestation and have also been implicated as nutrient sensors (Sharif et al., 2013). Thus, ERV expression may be influenced by maternal plane of nutrition during early gestation. Therefore, we hypothesize that syncytin-Rum1 , BERV-K, pregnancy specific protein-B (PSP-B) and interferon-τ (IFN-τ) will be differentially expressed during early pregnancy (d 16 to 50) and will be influenced by plane of maternal nutrition.
5.3. Materials and Methods
All animal procedures were conducted with approval from the Institutional Animal Care and Use Committee at North Dakota State University (A14053 and A16049). Commercial
Angus crossbred heifers (n = 49; ~ 16 mo of age; BW = 325 ± 29 kg) were transported 229 km from Central Grasslands Research Extension Center (Streeter, ND) to the Animal Nutrition and
Physiology Center (North Dakota State University, Fargo, ND). The heifers were housed in pens with 6 heifers per pen and individually fed daily in an electronic head gate facility
(American Calan; Northwood, NH) at 0800 h. All heifers were subject to 5-d CO-Synch +
CIDR estrus synchronization protocol (Bridges et al., 2008) and pregnant heifers were AI to a
111
single Angus sire (day of breeding = d 0). Non-pregnant, non-bred control ( NP-NB ) heifers (n =
6) were ovariohysterectomized on d 16 of the synchronized estrous cycle. Heifers were fed a
TMR (48.4% DM, 5.3% CP, 29.4% NDF, 6.8% Ash), supplemented with dried distillers grains with solubles (87.5% DM, 31.3% CP, 53.4% NDF, 8.2% Ash), and granted ad libitum access to water. On the day of breeding, heifers were randomly assigned to dietary treatments in a 2 × 3 factorial arrangement of nutritional plane × stage of gestation. One half were assigned to a control diet ( CON ) targeted to gain 0.45 kg/d and the remaining half were assigned to a restricted diet ( RES ), which received 60% of control diets. Heifers were subjected to ovariohysterectomy on d 16, 34, and 50 of gestation, as previously described (McLean et al.,
2016a). The NP-NB heifers and only heifers’ ovariohysterectomized on d 16, 34, and 50 fed
CON diet were used to address comparisons of pregnancy status and establishment.
Presence of a fetal heartbeat was confirmed via transrectal ultrasonography d 28 and again on the d of surgery (d 34 or 50). During surgery left and right uterine arteries, left and right spiral arteries, and the cervix were ligated, and then the uterus removed. Uterine contents were held in place with a 24 cm Crafoord Coarctation Clamp (Integra-Miltex; Plainsboro, NJ), placed just cranial to the cervical ligatures, during and after removal from the body cavity(McLean et al., 2016a). Upon removal of the uterus peritoneum and muscle layers were closed with #2 absorbable suture (Vicryl; Ethicon; Somerville, NJ) and the skin was closed with
#2 polymerized braunamid (Jorgensen; Loveland, CO). Following surgery heifers were returned to control diets, kept in individual pens for approximately 7 d, and external stitches were removed 14 d after surgery.
112
5.3.1. Tissue Collecting and Processing
Immediately upon removal from the body cavity, the reproductive tract was trimmed of excess broad ligament, fat, and non-reproductive tissues. Gravid uterus, individual and total ovarian, and CL weights were taken, as well as, CL measurements for CL area before fixation, freezing, and storage. Utero-placental tissues were obtained, as previously described (Grazul-
Bilska et al., 2010), from the uterine horn ipsilateral (containing the embryo) to the CL
(pregnant uterine horn; P), maternal caruncle (P-CAR); maternal endometrium, inter-caruncle,
(P-ICAR). Tissues obtained in the uterine horn contralateral (opposite the embryo) to the CL
(non-pregnant horn; NP ), maternal caruncle (NP-CAR); maternal endometrium, inter-caruncle,
(NP-ICAR). Fetal membranes ( FM ) were collected on d 16, 34, and 50. After collected, all tissues were snap frozen in liquid nitrogen cooled isopentane (Sigma-Aldrich; St. Louis, MO) and stored at -80°C.
Blood samples were taken via jugular venipuncture on d 0, 16, 34, and 50 of gestation until the heifers were ovariohysterectomized. Non-bred, non-pregnant control heifers were sampled on d 16 of the estrous cycle. Blood samples were collected in 10 mL vacutainer tubes
(Becton Dickinson Healthcare; Franklin Lakes, NJ), allowed to clot, and stored at 4˚C until processing. Samples were centrifuged for 30 min at 3,000 × g and 4˚C after which serum was removed and stored at -20˚C. Concentrations of progesterone and insulin in serum were determined using an Immulite 1000 (Siemens, Los Angeles, CA).
5.3.2. Real-Time Reverse Transcriptase Quantitative PCR
The RNA was extracted and purified via an RNeasy Mini Kit (Qiagen, Valencia, CA).
The concentration of RNA extracted was determined using Take3 module of a Synergy H1
Microplate Reader (BioTek, Winooski, VT). A total of 1 µg of RNA was used for cDNA
113
synthesis via a QuantiTect Reverse Transcription Kit (Qiagen). Primer sequences (Table 4-1) were obtained from previous literature for syncytin-Rum1 (Cornelis et al., 2013), BERV-K1
(Nakaya et al., 2013), IFN-τ (Hickman et al., 2013), and PSP-B (Patel et al., 2004). Primer validation for optimum cDNA dilution and primer efficiency for each tissue type was completed before qPCR analysis. Gene expression was analyzed for CT using a 7500 Fast Real-Time PCR
System (Applied Biosystems, Grand Island, NY) with SYBR Green Master Mix (Bio-Rad
Laboratories, Hercules, CA). Gene expression for maternal tissues was calculated using the
ΔΔCT method (Livak and Schmittgen, 2001) with β-actin as the reference gene and the average
ΔCT of NP-NB expression for each gene as the control (set to 1) within each tissue. Fetal membrane gene expression was calculated using the ΔΔCT method (Livak and Schmittgen,
2001) with β-actin as the reference gene and of the ΔCT for uterine endometrium of each individual gene as the control (set to 1). Across tissue gene expression was calculated using the
ΔΔCT method (Livak and Schmittgen, 2001) with β-actin as the reference gene and the average
ΔCT of NP-ICAR expression as the control (set to 1) within each day of gestation. Gene expression of syncytin-Rum1 , BERV-K1 , IFN-τ, and PSP-B across d was done separately from analysis of syncytin-Rum1, BERV-K1 , IFN-τ, and PSP-B expression across tissues within a given d of gestation.
5.3.3. Statistical Analysis
Statistical analyses for gene expression of syncytin-Rum1 , BERV-K1 , IFN-τ, and PSP-B and gross tissue measurements were conducted as a 2 × 3 factorial with individual heifer as the experimental unit via the GLM procedure of SAS version 9.4 (SAS Inst. Inc., Cary, NY). Model terms included stage of gestation (d 16, 34, or 50), maternal nutritional plane (control or restricted), and their interaction. Contrast statements were conducted for heifers fed CON diets
114
because no NP-NB heifers received the RES diet, to determine differences between NP-NB vs. pregnant heifers, d 16 (pre-attachment) vs. d 34 and 50 of pregnancy (post-attachment), and d 34 vs. d 50 of pregnancy. Contrast statements were not used for evaluation of restricted heifers because no NP heifers received the RES diet. Across tissue analysis was conducted via contrast statements to determine differences of gene expression on a given day: pregnant uterine horn vs. non-pregnant uterine horn, pregnant uterine horn vs. fetal membranes, non-pregnant uterine horn vs. fetal membranes, and caruncular tissue vs. endometrium. Data for concentrations of progesterone and insulin were analyzed using the MIXED procedure of SAS with day as the variable and cow as a repeated measure. The covariance structure was determined by which structure exhibited lowest AIC, AICC, and BIC and met convergence criteria. Progesterone was analyzed with a Huynh-Feldt covariance structure. Insulin was analyzed with an unstructured covariance structure. Means were separated using the LSMEANS statement of SAS with differences determined at a P-values ≤ 0.05.
5.4. Results
In P-CAR, there were no interactions between stage of gestation and nutritional treatment for syncytin-Rum1 , BERV-K1 , PSP-B, or IFN-τ (P > 0.49), so the main effects of day of gestation and nutritional treatment will be presented. Pregnancy specific protein-B increased
(P < 0.01) by 18,000 fold as gestation progressed in P-CAR (Fig. 5-1A). Maternal P-CAR expression of IFN-τ tended ( P = 0.07) to be increased at d 50 over non-bred, non-pregnant heifers by 9 fold. Nutritional treatment also influenced IFN-τ mRNA expression with RES heifers having lower ( P = 0.05) IFN-τ expression compared with CON fed heifers (Fig. 5-1B).
Expression of syncytin-Rum1 tended ( P = 0.10) to be greater at d 50 (17.7 ± 3.8) compared with d 16 and 34, in P-CAR (6.9 and 7.9 ± 3.9, respectively).
115
Day × Nutrition; P = 0.84 Day × Nutrition; P = 0.66 Day; P < 0.01 Day; P = 0.08 Nutrition; P = 0.98 Nutrition; P = 0.05 25,000 9 a c 8 20,000 7 6 15,000 5 in P-CAR in in P-CAR 4 b 10,000 3 b INF-τ 2 PSP-B 5,000 1 Relative fold change of change fold Relative Relative fold change of change fold Relative a 0 0 Control Restricted 16 34 50 Nutritional Treatment Gestation, d A B
Figure 5-1. Expression of pregnancy specific protein–B (PSP-B) and interferon-τ (IFN-τ) in maternal caruncle (P-CAR) during the establishment of pregnancy in beef heifers. A) the effect of d of gestation on mRNA of PSP-B and B) the influence of nutritional plane on IFN-τ expression in P-CAR. Data presented as a 2^ -ΔΔCT fold change normalized to β-Actin and the average of NP-NB. a, b, c Means without a common superscript differ ( P < 0.05).
In P-ICAR, there were no interactions between plane of nutrition and day of gestation or any effects of nutritional treatment on expression of for syncytin-Rum1 , IFN-τ or PSP-B (P >
0.12). There tended ( P = 0.08) to be a stage of gestation × nutritional plane interaction for
BERV-K1 expression which did not differ for RES heifers (6.2 ± 3.4) but decreased on d 34 (3.0
± 3.8) compared with d 16 and 50 (14.9 and 14.5 ± 4.0) in CON heifers. Both syncytin-Rum1 and PSP-B were influenced by stage of gestation. Expression of syncytin-Rum1 was greater ( P =
0.01) on d 16 compared with d 34 and d 50 (Fig. 5-2A). Expression of Pregnancy specific protein-B was greater ( P < 0.01; Fig. 5-2B) on d 34 and 50 compared with d 16. Stage of gestation did not influence ( P = 0.58) IFN-τ expression in P-ICAR.
116
Day × Nutrition; P = 0.09 Day × Nutrition; P = 0.08 Day; P = 0.01 Day; P < 0.01 Nutrition; P = 0.12 18 Nutrition; P = 0.89 b 450 16 400 b 14 350 12
in P-ICAR a 300 10 b 8 a 250 in P-ICAR in 6 200 4 150
PSP-B PSP-B 100 a
Relative fold change of change fold Relative 2 syncytin-Rum1 syncytin-Rum1 0 of change fold Relative 50 16 34 50 0 16 34 50 Gestation, d Gestation, d
A B
Figure 5-2. Expression of syncytin-Rum1 and pregnancy specific protein–B (PSP-B) in pregnant uterine horn endometrium (P-ICAR) during the establishment of pregnancy in beef heifers. A) syncytin-Rum1 in P-ICAR and B) PSP-B in P-ICAR. Data presented as a 2^ -ΔΔCT fold change normalized to β-Actin and the average of NP-NB. a, b Means without a common superscript differ (P < 0.05).
In NP-CAR there was a plane of nutrition × stage of gestation effect ( P = 0.03) on
BERV-K1 expression with CON heifers on d 50 having greater expression than all other treatment day combinations evaluated (Fig. 5-3A). There were no interactions between stage of gestation and nutritional treatment for syncytin-Rum1 or PSP-B (P > 0.22). Expression of PSP-B was greater (P < 0.01) on d 34 compared with d 16 but was not different than d 50 in NP-CAR
(Fig. 5-3B). Neither stage nor nutritional treatment influenced syncytin-Rum1 or IFN-τ (P >
0.11) in NP-CAR.
117
Day × Nutrition; P = 0.03 Day × Nutrition; P = 0.34 Day; P = 0.10 Day; P < 0.01 Nutrition; P = 0.08 Nutrition; P = 0.17 160 450 b 140 400 b 120 350 100 300
inNP-CAR 80 250 200 60 a a 40 a a a 150 a 100 a 20 PSP-B inNP-CAR BERV-K1 BERV-K1
Relative fold change of change fold Relative 50 0 of change fold Relative 0 16 34 50 16 34 50 Gestation, d Gestation, d A B
Figure 5-3. Expression of bovine endogenous retrovirus-K1 ( BERV-K1 ) and pregnancy specific protein–B (PSP-B) in caruncles of the contralateral uterine horn to the conceptus (NP-CAR) during the establishment of pregnancy in beef heifers. A) BERV-K1 in NP-CAR where white bars outlined in black represent control heifers and gray bars represent restricted heifers and B) the effects of stage of gestation on mRNA of PSP-B in NP-CAR. Data presented as a 2^ -ΔΔCT fold change normalized to β-Actin and the average of NP-NB. a, b Means without a common superscript differ ( P < 0.05).
In NP-ICAR, expression of syncytin-Rum1 or BERV-K1 was not impacted by ( P > 0.14)
Stage of gestation, plane of nutrition, or their interaction. In addition, no interactions between stage of gestation and nutritional treatment were present for PSP-B, or IFN-τ (P > 0.22),
However, nutritional plane tended ( P = 0.09) to influence IFN-τ expression with greater expression in CON heifers (5.35 ± 1.34) compared with RES heifers (2.07 ± 1.34). In addition, expression of PSP-B was greater ( P = 0.02) on d 34 and 50 compared with d 16 in NP-ICAR
(Fig. 5-4).
118
Day × Nutrition; P = 0.41 Day; P = 0.02 Nutrition; P = 0.48 200 b 180 b 160 140 120 100 80 60 a 40 PSP-B inNP-ICAR
Relative fold change of change fold Relative 20 0 16 34 50 Gestation, d
Figure 5-4. The influence of day of pregnancy on mRNA expression levels of pregnancy specific protein–B (PSP-B) in caruncles of the contralateral uterine horn to the conceptus (NP- ICAR) during the first 50 d of pregnancy in beef heifers. Data presented as a 2^ -ΔΔCT fold change normalized to β-Actin and the average of NP-NB. a, b Means without a common superscript differ (P < 0.05).
In FM, there were no stage of gestation × plane of nutrition interactions (P > 0.38) for the expression of syncytin-Rum1 , BERV-K1 , or PSP-B; however, and interaction was present for
IFN-τ (P < 0.01). Fetal membrane expression of IFN-τ on d 16 was greater than all other days and RES heifers were greater compared to CON heifers (Fig. 5-5A). The mRNA expression levels of BERV-K1 in FM were greater ( P < 0.01) on d 34 compared with d 50, which was greater ( P < 0.01) than d 16(Fig. 5-5B). Expression of syncytin-Rum1 was greater ( P = 0.03) in
FM at d 50 compared with d 16 and 34 (Fig. 5-5C). The expression levels of PSP-B were greater ( P < 0.01) at d 34 and 50 compared with d 16 (Fig. 5-5D).
119
Day × Nutrition; P < 0.01 Day × Nutrition; P = 0.38 Day; P < 0.01 Day; P < 0.01 Nutrition; P < 0.01 7,000 4,000 Nutrition; P = 0.47 c 6,000 c 3,500 5,000 3,000 2,500 b 4,000 b in FM in FM 2,000 3,000 1,500 2,000
INF-τ INF-τ 1,000
1,000 BERV-K1 a a a a 500 a 0 Relative fold change of change fold Relative
Relative fold change of change fold Relative 0 16 34 50 16 34 50 Gestation, d Gestation, d A B
Day × Nutrition; P = 0.96 Day × Nutrition; P = 0.82 Day; P = 0.03 Day; P < 0.01 Nutrition; P = 0.82 1.2 Nutrition; P = 0.84 600 b b 500 b 1
in FM 400 0.8 300 FM in 0.6 a 0.4 200 a 100 PSP-B 0.2 a Relative fold change of change fold Relative
syncytin-Rum1 syncytin-Rum1 0 0 Relative fold change of change fold Relative 16 34 50 16 34 50 Gestation, d Gestation, d C D
Figure 5-5. Expression of interferon-τ (IFN-τ), bovine endogenous retrovirus-K1 ( BERV-K1 ), syncytin-Rum1 , and pregnancy specific protein–B (PSP-B) in fetal membranes (FM) during the establishment of pregnancy in beef heifers. A) the interaction of nutrition and stage of gestation on IFN-τ expression, white bars with black outline represent control heifers and gray bars represent restricted heifers B) BERV-K1 mRNA levels during early gestation C) syncytin-Rum1 expression as gestation progresses, and D) PSP-B expression by day of gestation. Data presented as a 2^ -ΔΔCT fold change normalized to β-Actin and a uterine endometrium sample. a, b, c Means without a common superscript differ ( P < 0.05).
Contrast statements were used in CON heifers to compare NP vs. pregnant heifers, d 16 vs. d 34 and 50 of pregnancy, and d 34 vs. d 50 of pregnancy (Table 5-1). There were no differences ( P > 0.11) in P-CAR between NP-NB and pregnant heifers, pre-attachment (d 16)
120
and post-attachment (> d 34) pregnancy, or on d 34 and d 50 for syncytin-Rum1 and IFN-τ. The
ERV, BERV-K1 , tended ( P = 0.09) to be lower in NP-NB compared with pregnant heifers and
PSP-B was different for all comparisons ( P < 0.01; Table 5-1). In P-ICAR, expression of syncytin-Rum1 was greater ( P = 0.02) in pregnant and BERV-K1 and PSP-B tended ( P = 0.06) to be greater in pregnant compared with NP-NB heifers (Table 5-1). In pregnant heifers, PSP-B greater (P < 0.01) on d 34 making pre-attachment (d 16) compared with post-attachment (> d
34) pregnancy and d 34 compared with d 50 heifers different in P-ICAR. Syncytin-Rum1 expression in pre-attachment embryos (d 16) was greater (P < 0.01) compared with post- attachment embryos (d 34 and 50), in P-ICAR. Expression of BERV-K1 and syncytin-Rum1 was greater ( P = 0.04) on d 50 compared with d 34, in P-ICAR. Interferon-τ tended ( P = 0.10) to be increased on d 16 compared with d 34 and 50 (Table 5-1). Contrast comparisons revealed that
PSP-B was different ( P < 0.01) among all comparisons driven by the increased expression on d
50, in NP-CAR (Table 5-1). The ERV, syncytin-Rum1 and BERV-K1 , were different ( P < 0.05) and IFN-τ tended to differ ( P = 0.09) between d 34 and 50 of gestation in NP-CAR (Table 5-1).
Interferon-τ and syncytin-Rum1 tended ( P < 0.09) to differ between NP-NB and pregnant heifers; whereas BERV-K1 and PSP-B tended ( P < 0.08) to be differentially expressed on d 50 and 34, respectively, in NP-ICAR (Table 5-1).
As stated in the methods, across tissue analysis on each day was completed for each gene via contrast comparisons of non-pregnant (contralateral to CL) uterine horn vs. pregnant
(ipsilateral to CL) uterine horn, pregnant uterine horn vs. fetal membrane, non-pregnant uterine horn vs. fetal membranes, and CAR vs. ICAR (Table 5-2). In NP-NB heifers, there were no differences ( P > 0.38) between the uterine horn ipsilateral to the CL and the uterine horn contralateral to the CL, for expression of syncytin-Rum , BERV-K1 , PSP-B, and IFN-τ.
121
The ERV, syncytin-Rum and BERV-K1 , were not different on d 16 ( P > 0.18); however,
PSP-B was increased ( P = 0.04) in the pregnant vs. non-pregnant uterine horn. Expression of
PSP-B was also increased ( P = 0.03) in the pregnant uterine horn compared with fetal membranes. Interferon-τ was greater ( P < 0.01) in FM compared with both pregnant and non- pregnant uterine horn expression (Table 5-2). Interestingly, IFN-τ was greater ( P < 0.01) in
ICAR compared with CAR on d 16. In d 34 heifers, BERV-K1 was greater ( P < 0.01) in FM compared with both pregnant and non-pregnant uterine horns. Whereas, syncytin-Rum1 expression was greater ( P = 0.02) in the pregnant uterine horn compared with the non-pregnant uterine horn. There was a tendency ( P = 0.07) in the pregnant uterine horn for increased expression of syncytin-Rum1 compared with FM.
Expression of PSP-B was greater ( P < 0.01) in the pregnant uterine horn and FM compared with the non-pregnant uterine horn on d 34. Caruncular tissues also had greater ( P =
0.03) expression of PSP-B compared with ICAR on d 34. Interferon-τ mRNA was greater ( P <
0.02) in the uterine pregnant horn compared with NP uterine horn and FM on d 34 of gestation.
Expression of IFN-τ was increased ( P = 0.02) in ICAR compared with CAR on d 34. There was no difference ( P > 0.37) in syncytin-Rum1 , BERV-K1 , or IFN-τ on d 50 (Table 5-2). There was a tendency for BERV-K1 to be greater ( P = 0.08) in the pregnant uterine horn and for IFN-τ to be greater ( P = 0.06) in the NP uterine horn compared with FM. Pregnancy specific protein-B was greater ( P < 0.01) in the pregnant uterine horn compared to both the NP uterine horn and FM.
Expression of PSP-B was greater ( P < 0.01) in CAR compared with ICAR.
122
Table 5-1. Changes in mRNA expression for synctin-Rum1, bovine endogenous retrovirus-K1 ( BERV-K1 ), pregnancy specific protein–B (PSP-B), and interferon-τ (IFN-τ) in control heifers during the first 50 d of gestation. Contrast P-value 3 NP- NP-NB d 16 d 34 Tissue 1 d 16 d 34 d 50 SEM NB 2 vs. vs. vs. P d 34 and 50 d 50 P-CAR BERV-K1 4.5 367.7 155.9 387.2 47.1 0.09 0.59 0.30 Syncytin-Rum1 3.9 12.3 9.4 20.7 6.1 0.16 0.71 0.21 PSP-B 3.7 61.4 3,861.1 18,686.0 1,194.2 <0.01 <0.01 <0.01 IFN-τ 2.0 7.1 3.7 12.1 3.5 0.20 0.84 0.11 P-ICAR BERV-K1 1.2 14.5 3.0 14.9 4.0 0.06 0.27 0.04 Syncytin-Rum1 2.0 18.0 3.2 11.5 2.8 0.02 <0.01 0.04 PSP-B 2.1 7.5 429.9 92.5 73.5 0.06 0.01 <0.01
123 IFN-τ 1.8 2.3 0.7 1.3 0.6 0.64 0.10 0.47 NP-CAR BERV-K1 4.1 24.9 8.6 116.3 28.3 0.19 0.28 0.01 Syncytin-Rum1 4.6 13.7 2.5 33.4 10.7 0.36 0.74 0.05 PSP-B 6.2 0.4 10.5 178.1 17.7 0.01 <0.01 <0.01 IFN-τ 0.9 1.6 0.3 2.8 0.9 0.58 0.93 0.06 NP-ICAR BERV-K1 1.0 10.6 1.6 16.7 5.9 0.24 0.83 0.08 Syncytin-Rum1 3.1 0.2 1.7 0.5 1.1 0.09 0.46 0.45 PSP-B 1.9 7.3 146.2 84.4 47.3 0.18 0.07 0.37 IFN-τ 26.2 6.7 0.6 8.8 7.6 0.06 0.82 0.41 1 Tissues were separated into caruncle ipsilateral to the CL (P-CAR), endometrium ipsilateral to the CL (P-ICAR), caruncle contralateral to the CL (NP-CAR), and endometrium contralateral to the CL (NP-ICAR). 2 Average values for normalized NP-NB were used in data analysis as baseline. 3Contrasts compared gene expression in non-pregnant vs. pregnant heifers, d 16 vs. d 34 and 50 of gestation, and d 34 vs. d 50 of gestation.
Table 5-2. Changes in mRNA expression for synctin-Rum1 , bovine endogenous retrovirus-K1 ( BERV -K1 ), pregnancy specific protein–B (PSP-B), and interferon-τ (IFN-τ) in control heifers during the first 50 d of gestation. Contrast P-value 4 P- P- NP- NP- NPH PH NPH CAR Tissue 1 FM SEM CAR ICAR CAR ICAR 2 vs. vs. vs. vs. PH FM FM ICAR NP-NB 3 BERV-K1 0.1 0.4 0.1 0.7 - 0.17 0.47 - - <0.01 Syncytin-Rum1 0.1 0.7 0.1 1.6 - 0.50 0.38 - - 0.05 PSP-B 2.1 2.7 3.3 2.6 - 1.61 0.75 - - 0.95 IFN-τ 1.5 2.0 1.0 2.0 - 1.00 0.80 - - 0.42 d 16 BERV-K1 1.8 1.2 1.0 2.5 < 0.01 0.67 0.67 0.18 0.10 0.54 Syncytin-Rum1 5.4 21.0 27.1 2.6 0.7 11.68 0.85 0.43 0.35 0.74 PSP-B 5.2 5.5 0.6 4.0 1.0 1.45 0.04 0.03 0.49 0.24
124 IFN-τ 0.8 5.5 0.9 4.7 89.5 12.37 0.98 < 0.01 < 0.01 < 0.01 d 34 BERV-K1 2.9 0.6 0.4 2.1 4.0 0.88 0.73 0.01 <0.01 0.91 Syncytin-Rum1 9.4 25.4 4.5 4.7 5.7 5.23 0.02 0.07 0.86 0.16 PSP-B 18.9 5.2 0.5 1.8 9.9 2.01 < 0.01 0.51 <0.01 0.03 IFN-τ 2.3 5.6 0.6 2.6 < 0.01 0.97 0.02 < 0.01 0.20 0.02 d 50 BERV-K1 2.6 0.3 0.6 2.0 0.6 0.47 0.52 0.08 0.27 0.34 Syncytin-Rum1 3.5 3.8 1.9 3.5 3.0 1.09 0.40 0.44 0.93 0.37 PSP-B 105.4 7.1 15.6 2.5 11.4 4.14 < 0.01 < 0.01 0.78 < 0.01 IFN-τ 7.8 7.8 4.0 2.1 1.2 5.20 0.44 0.27 0.06 0.19 1Tissues were separated into caruncle ipsilateral to the CL (P-CAR), endometrium ipsilateral to the CL (P-ICAR), caruncle contralateral to the CL (NP-CAR), and endometrium contralateral to the CL (NP-ICAR). 2Average values for normalized NP-ICAR were used as baseline value during across tissue analyses. 3Non-bred, non-pregnant control heifers (NP-NB). 4Contrasts compared gene expression in non-pregnant horn (NPH) vs. pregnant horn (PH), pregnant horn vs. fetal membranes (FM), pregnant horn vs. fetal membranes, and caruncle (CAR) vs. endometrium (ICAR). Values for CAR and ICAR were combined for PH and NPH comparisons.
Circulating concentrations of progesterone were influenced by a day of gestation × nutritional treatment interaction ( P < 0.01; Fig. 5-6A)Progesterone concentration in CON heifers was greater at d 34 compared with d 16 and 50 ( P < 0.01; Fig. 5-6A), whereas, progesterone in RES heifers was similar on d 16 and 34 but lower ( P < 0.01) on d 50. However, insulin was not influenced by stage of gestation, nutritional treatment, or their interaction ( P >
0.48; Fig. 5-6B).
Day × Nutrition; P < 0.01 Day × Nutrition; P = 0.61 Day; P < 0.01 Day; P = 0.99 Nutrition; P < 0.01 9 4 Nutrition; P = 0.48 8 c b 3.5 7 b b 3 6 b 5 2.5 4 a 2 3 1.5 1
2 IU/mL in serum, in serum, ng/mL in serum, 1 0.5 0 of Concentration insulin 0
Concentration of progesterone of Concentration progesterone 16 34 50 16 34 50 Gestation, d Gestation, d A) B)
Figure 5-6. Concentrations on hormones in serum of beef heifers during early gestation. A) Concentrations of circulating progesterone in serum of beef heifers B) Concentrations of circulating insulin in serum of beef heifers. White bars with a black outline represent control means and gray bars represent restricted means. Hormones are reported as a pooled mean from heifers (n = 59, 33, and 22 for d 16, 34, and 50; respectively) on each d. a, b, c Means without a common superscript differ ( P < 0.05).
There was no day of gestation × nutritional treatment interaction ( P > 0.19) for any utero-placental tissue measurements except total ovarian weight; thus only main effects will be discussed from here on. Total ovarian weight tended ( P = 0.09) to be influenced by an interaction between stage of gestation and nutrition. Restricted heifers had lighter total ovarian weight on d 16 compared with d 34 or 50; whereas CON heifer total ovarian weight was lighter
125
on d 34 compared with d 16 and 50 (Table 5-3). The individual ovary and CL weights and CL area were not influenced by stage of gestation or nutritional treatment ( P > 0.14). Gravid uterine weight increased ( P < 0.01) as gestation progressed with d 50 having the greatest weight in both
CON and RES heifers (452.2 and 432.0 ± 19.2 g; Table 5-3). The weights for the gravid uterus, total ovary and left ovary (Table 5-4) were greater ( P < 0.04) in pregnant heifers compared with
NP-NB heifers. Gravid uterine weights were not different ( P > 0.10) between d 16 and NP-NB
(137.3 and 145.7 ± 15.6 g, respectively); however, uterine weight was increased ( P < 0.01) on d
34 and greater on d 50 compared with NP-NB, d 16, and d 34 (Table 5-4).
5.5. Discussion
Factors that influence fetal and placental growth and development include maternal plane of nutrition, number of fetuses, maternal parity and age, maternal and fetal genotype, and maternal stress (Reynolds and Redmer, 1995; Vonnahme et al., 2007; Reynolds et al., 2010).
The long-term effects of restricted nutrient intake during early gestation may be associated with impaired placental development or poor contact during the establishment of the feto-maternal interface resulting in intrauterine growth retardation (Zhang et al., 2015). Sharif et al. (2013) argued that ERV in the developing placenta likely function as nutrient sensors that may be turned on during periods of hypomethylation which occur very early in gestation. The interaction between day of gestation and nutritional plane for BERVE-K1 expression may further indicate a role of ERV in nutrient sensing during placental development.
Bovine endogenous retrovirus-K1 has been reported to have greater fusogenic capabilities than either BERVE-A or syncytinRum-1 (Nakaya et al., 2013) . This may explain why
BERVE-K1 was increased in NP-CAR as the placental development spread into the contralateral uterine horn which may indicate a greater role in cell to cell fusion and the formation of
126
Table 5-3. The effects of nutrition and stage of gestation on reproductive organ measurements. Control Restricted P-value Stage Tissue SEM d 16 d 34 d 50 d 16 d 34 d 50 Stage Trt × Trt Uterine 137.3 ab 199.5 c 452.2 d 128.5 a 185.6 bc 432.0 d 19.2 <0.01 0.36 0.96 Weight, g Total Ovarian 10.0 8.9 11.7 6.6 11.0 10.3 1.2 0.09 0.37 0.09 Weight, g Right Ovarian 4.7 4.5 6.2 2.6 5.0 5.4 1.1 0.23 0.41 0.56 Weight, g Left Ovarian 4.4 4.7 6.7 5.9 6.0 4.9 1.1 0.79 0.66 0.19
127 Weight, g CL
2.8 3.8 3.6 3.0 3.0 3.0 0.3 0.34 0.14 0.34 Weight, g CL Area, 285.3 329.1 349.8 281.7 249.6 281.4 46.3 0.79 0.20 0.65 mm 2 a,b,c,d Means without a common superscript differ ( P < 0.05).
Table 5-43. Reproductive organ measurements in control heifers during the first 50 d of gestation. Contrast P -value 4 P- NP-NB d 16 d 34 Tissue NP-NB d 16 d 34 d 50 SEM value vs. vs. vs. P d 34 and 50 d 50 Uterine 145.7 137.3 199.5 452.2 15.6 <0.01 <0.01 <0.01 <0.01 Weight, g Total Ovarian 7.4 10.0 8.9 11.7 1.0 0.03 0.03 0.82 0.05 Weight, g Right Ovarian 6.3 4.7 4.5 6.2 1.4 0.70 0. 46 0.76 0.37 Weight, g Left Ovarian 2.9 4.4 4.7 6.7 0.9 0.05 0.04 0.23 0.16
128 Weight, g CL
3.0 2.8 3.8 3.6 0.3 0.15 0.29 0.04 0.70 Weight, g 1Contrasts compared gene expression in non-pregnant vs. pregnant heifers, d 16 vs. d 34 and 50 of gestation, and d 34 vs. d 50 of gestation.
syncytial plaques. Thus, the function of BERVE-K1 may be similar to syncytin-A. Mouse knockout models for syncytin-A altered trophoblast stem cell fusion causing inefficient placental transport, decreased vascularity, and growth retardation ultimately terminating gestation between d 11.5 and 13.5 (Dupressior et al., 2009).
Similar to rodents and humans our data has determined that cattle have at least two ERV, syncytin-Rum1 and BERV-K1 , that are differentially expressed in reproductive tissues during the establishment of pregnancy. However, in contrast to previous findings (Dupressior et al., 2011;
Koshi et al., 2012; Cornelis et al., 2013) the above data indicate that maternal tissues do express mRNA for ERV and at times during early pregnancy have increased mRNA expression. This is in agreement with previous data for syncytin-Rum1 , BERV-K1 (McLean et al., 2016b), and syncytin-1 (Li et al., 2011). The conflicting results from these data and others may be due to the method of tissue acquisition (slaughter, ovariohysterectomy, or cell cultures), species specific differences, or the specific days of gestation in which the tissues were taken. These data may indicate that BERVE-K1 and syncytin-Rum1 may function through different receptors and cells like syncytin-2 and syncytin-1 (Blaise et al., 2003) or different fetal tissue layers like syncytin-A and syncytin-B (Dupressoir et al., 2011). While differing expression levels are intriguing the limited knowledge of function and pathways in which ERV influence the formation of the placenta and fetus and the establishment of pregnancy hinder the elucidation of the importance of
ERV during early gestation. This should first be addressed by confirming the formation of biologically functional proteins by ERV mRNA. Then research should be conducted to elucidate the exact cells and cell products the ERV proteins are influencing and producing; which can be done either in vitro via cell culture or in in vivo by new gene knockout methods.
129
The incorporation of an immune response element into maternal recognition by ruminant animals could implicate ERV further in their role during the establishment of pregnancy.
Viruses have long been known to stimulate cytokine secretion during the early immune response. Therefore, ERV may stimulate the trophoblast to secrete IFN-τ as an initial step to the classical immunosuppression function vital to the establishment of pregnancy. However, this remains to be elucidated. Our data presented here confirm increased expression of syncytin-
Rum1 in the endometrium of the uterine horn containing the fetus during the time of maternal recognition (d 16). Thus, ERV may perform important functions during the establishment of pregnancy and maternal recognition in cattle but further research needs to be done.
The secretion of IFN-τ from the trophoblast is widely accepted as the ruminant signal for pregnancy recognition (Thatcher et al., 1989; Bazer et al., 1991; Bazer, 1992; Mann et al., 1999;
Spencer and Bazer, 2004; Spencer et al., 2007). The interaction between IFN-τ, PGF2α, and progesterone is necessary for the maternal recognition of pregnancy, attachment of the conceptus to the uterine endometrium, and normal embryonic development (Bazer, 1975; Bazer et al.,
1979; Spencer and Bazer, 2002; Spencer et al., 2004). Nutritional restriction influenced IFN-τ mRNA expression in P-CAR with CON fed heifers having greater IFN-τ compared with RES heifers. While expression of IFN-τ from maternal tissues is not presumed to be influential in early gestation; IFN-τ is present in maternal tissues, both P-CAR and P-ICAR. Fetal membrane expression of IFN-τ was dependent on both stage of gestation and nutritional plane. On d 16,
IFN-τ expression was greater compared with all other days and RES heifers were greater compared to CON heifers. The expression of IFN-τ in P-CAR was influenced by nutritional treatment and IFN-τ expression in FM was increased in RES heifers more during the time of maternal recognition (~d 16) compared with CON heifers. These data may indicate that 40%
130
maternal nutrient restriction can initiate a compensatory mechanism to still successfully establish pregnancy in altered embryos, possible smaller or slower growing embryos.
The uterine endometrium requires progesterone for conceptus growth, implantation, and placental development (Bazer, 1975; Bazer et al., 1979; Spencer and Bazer, 2002; Spencer et al.,
2004). Our data confirmed adequate (> 1 ng) progesterone from a functional CL in all heifers, pregnant and non-pregnant, regardless of nutritional treatment or stage of gestation. However, circulating concentrations of progesterone displayed an interaction between stage of gestation and plane of nutrition without any changes in CL or ovary weights. Our data agrees with previous data that progesterone concentration must remain elevated within the uterus and systemically for the maintenance of pregnancy (Meyer et al., 1995; Mann and Lamming, 2001;
Green et al., 2005; Mann et al., 2006; Bazer et al., 2015).
Expression of PSP-B (also known as PAG-1) was increased in all maternal tissue as gestation progressed in the current study. The pregnancy associated glycoproteins (PAGs) have been found only in binucleate trophoblast cells (Green et al., 2000; Hughes et al., 2000; Wooding et al., 2005). Interestingly, our results had greater PSP-B expression in maternal tissues compared with FM. The PAGs have been reported to interact extensively with maternal connective tissue which develops during placental villi formation (Wooding et al., 2005). Our data may suggest that maternal connective tissue expression PSP-B during placental villi formation. It has been theorized that PAGs may possibly be involved in proteolytic activation of growth factors and other molecules specific to pregnancy, protection of fetal tissues from maternal immune response, transport of hormones between fetal and maternal tissues, and cell to cell fusion (Wooding et al., 2005). The most intimate contact in the placenta is between maternal caruncles and fetal cotyledons. The increased expression of PSP-B in both P-CAR and NP-CAR
131
may provide the evidence to support a role in immune protection and further implicate PSP-B in cell to cell fusion within the placentome. However, more work is needed to fully support this concept.
While limited effects were seen due to nutritional restriction in the current study this may be due to several factors: 1) 40% global restriction is not severe enough to influence measurements of the current study, 2) 50 d or less is not long enough for restriction to influence the factors measured in this project, or 3) this time period is too early to see major large scale differences that may be more evident later in gestation. The third factor agrees with previous literature for nutrient restriction during early to mid-gestation which may (Carstens et al., 1987;
Spitzer et al., 1995; Larson et al., 2009) or may not influence birth weight (Martin et al., 2007;
Long et al., 2009) dependent on time and severity of restriction. Lamb birth weight was also not influenced when ewes receive inadequate nutrients during early gestation (Wu et al., 2006; Ford et al., 2007; Long et al., 2010).
In conclusion, 50 d of 40% nutrient restriction may not be severe or long enough of a restriction to have a major influences on expression of syncytin-Rum1 , BERV-K1 , or PSP-B in utero-placental tissues. However, maternal nutritional plane did influence IFN-τ expression in both maternal and fetal tissues, BERV-K1 expression in the uterine horn opposite to the site of attachment, circulating concentrations of progesterone. Our previous data and this work confirmed differential expression of syncytin-Rum1 , BERV-K1 , PSP-B, and IFN-τ in both maternal and fetal tissues during the first 50 d of gestation. These differences in expression levels are at critical time points during the establishment of pregnancy, specifically, maternal recognition (d 16), completion of fetal adhesion (d 34) and rapid placental development (d 50).
While exact functions during early gestation remain to be elucidated ERV, PSP-B, and IFN-τ
132
may work sequentially or synergistically to complete vital steps for the successful establishment of pregnancy in beef heifers.
5.6. Literature Cited
Adelson, D. L., J. M. Raison, and R. C. Edgar. 2009. Characterization and distribution of
retrotransposons and simple sequence repeats in the bovine genome. Proc. Natl. Acad.
Sci. USA 106:12855-12860. doi: 10.1073/pnas.0901282106.
Bazer, F. W. 1975. Uterine protein secretions: relationship to development of the conceptus. J.
Anim. Sci. 41:1376-1382. doi:10.2134/jas1975.4151376x.
Bazer, F. W. 1992. Mediators of maternal recognition of pregnancy in mammals. Proc. Soc. Exp.
Biol. Med. 199:373-384.
Bazer, F. W., R. M. Roberts, S. M. Basha, M. T. Zavy, D. Caton, and D. H. Barron. 1979.
Method for obtaining ovine uterine secretions from unilaterally pregnant ewes. J. Anim.
Sci. 49:1522-1527. doi:10.2134/jas1979.4961522x.
Bazer, F. W., W. W. Thatcher, P. J. Hansen, M. A. Mirando, T. L. Ott, and C. Plante. 1991.
Physological mechanism of pregnancy recognition in ruminants. J. Reprod. Fert. 43:39-
47.
Bazer, F. W., W. Ying, X. Wang, K. A. Dunlap, B. Zhou, G. A. Johnson, and G. Wu. 2015. The
many faces of interferon tau. Invited Review. Amino Acids. 47:449-460. doi:
10.1007/s00726-014-1905-x.
Blaise, S., N. de Parseval, L. Bénit, and T. Heidmann. 2003. Genomewide screening for
fusogenic human endogenous retrovirus envelopes identifies syncytin 2, a gene
conserved on primate evolution. Proc. Natl. Acad. Sci. USA 100:13013–13018. doi:
10.1073/pnas.2132646100.
133
Bridges, G. A., L. A. Helser, D. E. Grum, M. L. Mussard, C. L. Gasser, and M. L. Day 2008
Decreasing the interval between the GnRH and PGF 2α from 7 to 5 d and lengthening
proestrus increases timed-AI PR in beef cows. Theriogenology 69:843-851. doi:
10.1016/j.theriogenology.2007.12.011.
Carstens, G. E., D. E. Johnson, M. D. Holland, and K. G. Odde. 1987. Effects of prepartum
protein nutrition and birth weight on basal metabolism in bovine neonates. J. Anim. Sci.
65: 745-751. doi:10.2134/jas1987.653745x.
Caton, J. S. and B. W. Hess. 2010. Maternal plane of nutrition: Impacts on fetal outcomes and
postnatal offspring responses. in: Proc 4th Grazing Livestock Nutrition Conference. West
Sect. Am. Soc. Anim. Sci. 39:104-122.
Ciccioli, N. H., R. P. Wettemann, L. J. Spicer, C. A. Lents, F. J. White, and D. H. Keisler. 2003.
Influence of body condition at calving and postpartum nutrition on endocrine function
and reproductive performance of primiparous beef cows. J. Anim. Sci. 81: 3107-3120.
doi:10.2527/2003.81123107x.
Cornelis, G., C. Vernochet, Q. Carradec, S. Souquere, B. Mulot, F. Catzeflis, M. A. Nilsson, B.
R. Menzies, M. B. Renfree, G. Pierron, U. Zeller, O. Heidmann, A. Dupressoir, and T.
Heidmann. 2015. Retroviral envelope gene captures and syncytin exaptation for
placentation in marsupials. Proc. Natl. Acad. Sci. U S A. 112:E487-496. doi:
10.1073/pnas.1417000112.
Cornelis, G., C. Vernochet, S. Malicorne, S. Souquere, A. C. Tzika, S. M. Goodman,
F. Catzeflis, T. J. Robinson, M. C. Milinkovitch, G. Pierron, O. Heidmann, A.
Dupressoir, and T. Heidmann. 2014. Retroviral envelope syncytin capture in an
134
ancestrally diverged mammalian clade for placentation in the primitive Afrotherian
tenrecs. Proc. Natl. Acad. Sci. U S A. 111:E4332-341. doi: 10.1073/pnas.1412268111.
Cornelis, G., O. Heidmann, S. A. Degrelle, C. Vernochet, C. Lavialle, C. Letzelter, S. Bernard-
Stoecklin, A. Hassanin, B. Mulot, M. Guillomot, I. Hue, T. Heidmann, and A.
Dupressoir. 2013. Captured retroviral envelope syncytin gene associated with the unique
placental structure of higher ruminants. Proc. Natl. Acad. Sci. USA 110:E828-E837. doi:
10.1073/pnas.1215787110.
Cornelis, G., O. Heidmann, S. Bernard-Stoecklin, K. Reynaud. G. Veron, B. Mulot, A.
Dupressoir, and T. Heidmann. 2012. Ancestral capture of syncytin-Car1, a fusogenic
endogenous retroviral envelope gene involved in placentation and conserved in
Carnivora. Proc. Natl. Acad. Sci. USA 109:E432-E441. doi: 10.1073/pnas.1115346109.
Dupressoir, A., C. Vernochet, F. Harper, J. Guegan, P. Dressen, G. Pierron, and T. Heidmann.
2011. A pair of co-opted retroviral envelope syncytin genes is required for formation of
the two-layered murine placental syncytiotrophoblast. Proc. Natl. Acad. Sci. USA
108:E1164-E1173. doi: 10.1073/pnas.1112304108.
Dupressoir, A., C. Vernochet, O. Bawa, F. Harper, G. Pierron, P. Opolon, and T. Heidmann.
2009. Syncytin-A knockout mice demonstrate the critical role in placentation of a
fusogenic, endogenous retrovirus-derived, envelope gene. Proc. Natl. Acad. Sci. USA
106:12127-12132. doi: 10.1073/pnas.0902925106.
Dupressoir, A., G. Marceau, C. Vernochet, L. Benit, C. kanellopoulos, V. Sapin and T.
Heidmann. 2005. Syncytin-A and syncytin-B, two fusogenic placenta-specific murine
envelope genes of retroviral origin in Muridae. Proc. Natl. Acad. Sci. USA 102:725-730.
doi: 10.1073/pnas.0406509102.
135
Ford, S. P., B. W. Hess, M. M. Schwope, M. J. Nijland, J. S. Gilbert, K. A. Vonnahme, W. J.
Means, H. Han, and P. W. Nathanielsz. 2007. Maternal undernutrition during early to
mid-gestation in the ewe results in altered growth, adiposity, and glucose tolerance in
male offspring. J. Anim. Sci. 85: 1285-1294. doi:10.2527/jas.2005-624.
Funston, R. N., J. L. Martin, D. C. Adams, and D. M. Larson. 2010. Winter grazing system and
supplementation of beef cows during late gestation influence heifer progeny. J. Anim.
Sci. 88:4094-4101. doi: 10.2527/jas.2010-3039.
Garcia-Etxebarria, K., and B. M. Jugo. 2013. Evolutionary history of bovine endogenous
retroviruses in the Bovidae family. BMC Evol. Bio. 13:256-267. doi: 10.1186/1471-
2148-13-256.
Grazul-Bilska, A. T., P. P. Borowicz, M. L. Johnson, M. Minten, J. J. Bilski, R. Wroblewski, D.
A. Redmer, and L. P. Reynolds. 2010. Placental development during early pregnancy in
sheep: vascular growth and expression of angiogenic factors in maternal placenta.
Reproduction 140:165-174. doi: 10.1530/REP-09-0548.
Green, M. P., M. G. Hunter, and G. E. Mann. 2005. Relationships between maternal hormone
secretion and embryo development on day 5 of pregnancy in dairy cows. Anim. Reprod.
Sci. 88:179-189. doi:10.1016/j.anireprosci.2004.12.007.
Green, M. P., S. Xie, X. Quan, B. Bao, X. Gan, N. Mathialagan, J. F. Beckers, and R. M.
Roberts. 2000. Pregnancy-associated bovine and ovine glycoproteins exhibit spatially and
temporally distinct expression patterns during pregnancy. Bio. Reprod. 62:1624-1631.
doi: 10.1095/biolreprod62.6.1624.
Heidmann, O., C. Vernochet, A. Dupressoir, and T. Heidmann. 2009. Identification of an
endogenous retroviral envelope gene with fusogenic activity and placenta-specific
136
expression in the rabbit: A new “syncytin” in a third order of mammals. Retrovirology
6:107-117. doi: 10.1186/1742-4690-6-107.
Hickman, C. F., M. Clinton, A. Ainslie, C. J. Ashworth, and J. A. Rooke. 2004 Heat shock
induces interferon-tau gene expression by in vitro produced bovine blastocysts. Am. J.
Reprod. Immuno. 70:177-181. doi:10.1111/aji.12131.
Hughes, A. L., J. A. Green, J. M. Garbayo, and R. M. Roberts. 2000. Adaptive diversification
within a large family of recently duplicated, placentally expressed genes. Proc. Natl.
Acad. Sci. USA. 97:3319-3323. doi: 10.1073/pnas.97.7.3319.
Jern, P., and J. M. Coffin. 2008. Effects of retroviruses on host genome function. Annu. Rev.
Genet. 42:709-732. doi: 10.1146/annurev.genet.42.110807.091501.
Koshi, K., Y. Suzuki, Y. Nakaya, K. Imai, M. Hosoe, T. Takahashi, K. Kizaki, T. Miyazawa, and
K. Hashizume. 2012. Bovine trophoblastic cell differentiation and binucleation involves
enhanced endogenous retrovirus element expression. Reprod. Bio. Endo. 10:41-52. doi:
10.1186/1477-7827-10-41.
Kurth, R., and N. Bannert. 2010. Beneficial and detrimental effects of human endogenous
retroviruses. Int. J. Cancer 126:306-314. doi: 10.1002/ijc.24902.
Larson, D. M., J. L. Martin, D. C. Adams, and R. N. Funston. 2009. Winter grazing system and
supplementation during late gestation influence performance of beef cows and steer
progeny. J. Anim. Sci. 87: 1147-1155. doi:10.2527/jas.2008-1323.
Lents, C. A., R. P. Wettemann, F. J. White, I. Rubio, N. H. Ciccioli, L. J. Spicer, D. H. Keisler,
and M. E. Payton. 2005. Influence of nutrient intake and body fat on concentrations of
insulin-like growth factor-I, insulin, thyroxine, and leptin in plasma of gestating beef
cows. J. Anim. Sci. 83: 586-596. doi:10.2527/2005.833586x.
137
Livak, K. J., and T. D. Schmittgen. 2001. Analysis of relative gene expression data using real-
time quantitative PCR and the 2 -ΔΔCT Method. Methods 25:402-408.
doi:10.1006/meth.2001.1262.
Long, N. M., K. A. Vonnahme, B. W. Hess, P. W. Nathanielsz, and S. P. Ford. 2009. Effects of
early gestational undernutrition on fetal growth, organ development, and placentomal
composition in the bovine. J. Anim. Sci. 87:1950-1959. doi:10.2527/jas.2008-1672.
Long, N. M., L. A. George, A. B. Uthlaut, D. T. Smith, M. J. Nijland, P. W. Nathanielsz, and S.
P. Ford. 2010. Maternal obesity and increased nutrient intake before and during gestation
in the ewe results in altered growth, adiposity, and glucose tolerance in adult offspring. J.
Anim. Sci. 88: 3546-3553. doi:10.2527/jas.2010-3083.
Mann, G. E., and G. E. Lamming. 2001. Relationship between maternal endocrine environment,
early embryo development and inhibition of the luteolytic mechanism in cows. Reprod.
121:175-180. doi: 10.1530/rep.0.1210175.
Mann, G. E., G. E. Lamming, R. S. Robinson, and D. C. Wathes. 1999. The regulation of
interferon-tau production and uterine hormone receptors during early pregnancy. J.
Reprod. Fert. 54:317-328.
Mann, G. E., M. D. Fray, and G. E. Lamming. 2006. Effects of time of progesterone
supplementation on embryo development and interferon-τ production in the cow. Vet. J.
171:500-503.
Martin, J. L., K. A. Vonnahme, D. C. Adams, G. P. Lardy, and R. N. Funston. 2007. Effects of
dam nutrition on growth and reproductive performance of heifer calves. J. Anim. Sci. 85:
841-847. doi:10.2527/jas.2006-337.
138
McLean, K. J., C. R. Dahlen, P. P. Borowicz, L. R. Reynolds, B. W. Neville, S. D. Walden, and
J. S. Caton. 2016a. Technical note: A new surgical technique for ovariohysterectomy
during early pregnancy in beef cattle. J. Anim. Sci. (Submitted, JAS # E-2016-0761).
McLean, K. J., M. S. Crouse, M. R. Crosswhite, D. N. Black, C. R. Dahlen, P. P. Borowicz, L.
R. Reynolds, A. K. Ward, B. W. Neville, and J. S. Caton. 2016b. Rapid
Communication: Expression of an endogenous retroviral element, syncytin-Rum1, during
early gestation in beef heifers. J. Anim. Sci. 94:1-5. doi: 10.2527/jas2016-0793.
Meyer, M. D., P. J. Hansen, W. W. Thatcher, M. Drost, L. Badinga, R. M. Roberts, J. Li, T. L.
Ott, F. W. Bazer. 1995. Extension of corpus luteum life span and reduction of uterine
secretion of prostaglandin F2α of cows in response to recombinant interferon-τ. J. Dairy
Sci. 78:1921-1931. doi:10.3168/jds.S0022-0302(95)76817-5.
Mi, S., X. Lee, X. Li, G. M. Veldman, M. Finnerty, L. Racie, E. LaVallie, X. Tang, P. Edward,
S. Howes, J. Keith, Jr, and J. M. McCoy. 2000. Syncytin is a captive retroviral envelope
protein involved in human placental morphogenesis. Nature 403:785-789. doi:
10.1038/35001608.
Moffett, A., and C. Loke. 2006. Immunology of placentation in eutherian mammals. Nat. Rev.
Immunol. 6:584–594. doi: 10.1038/nri1897.
Nakaya, Y., K. Koshi, S. Nakagawa, K. Hashizume, and T. Miyazawa. 2013. Fematrin-1 is
involved in fetomaternal cell-to-cell fusion in Bovinae placenta and has contributed to
diversity of ruminant placentation. J. Virol. 87:10563–10572. doi: 10.1128/JVI.01398-13.
Patel, O. V., O. Yamada, K. Kizaki, T. Takahashi, K. Imai, and K. Hashizume. 2004.
Quantitative analysis throughout pregnancy of placentomal and interplacentomal
139
expression of pregnancy-associated glycoproteins-1 and -9 in the cow. Mol. Reprod. Dev.
67:257-263. doi: 10.1002/mrd.20017.
Patten, B. M. 1964. Foundations of Embryology (2nd Ed.). McGraw-Hill, New York.
Ramsey, E. M. 1982. The placenta, human and animal. Praeger, New York.
Reynolds, L. P., and D. A. Redmer. 1995. Utero-placental vascular development and placental
function. J. Anim. Sci. 73:1839-1851. doi:/1995.7361839x.
Reynolds, L. P., and D. A. Redmer. 2001. Angiogenesis in the placenta. Biol. Reprod. 64:1033-
1040. doi: 10.1095/biolreprod64.4.1033.
Reynolds, L. P., P. P. Borowicz, C. Palmieri, and A. T. Grazul-Bilska. 2014. Placental Vascular
Defects in Compromised Pregnancies: Effects of Assisted Reproductive Technologies
and Other Maternal Stressors. In: Advances in Fetal and Neonatal Physiology (Zhang L
& Ducsay CA, eds.), Advances in Experimental Medicine and Biology 814, Springer
Science Business Media, NY. (ISBN 978-1-4939-1031-1). doi: 10.1007/978-1-4939-
1031-1_17.
Reynolds, L. P., P. P. Borowicz, J. S. Caton, K. A. Vonnahme, J. S. Luther, D. S. Buchanan, S.
A. Hafez, A. T. Grazul-Bilska, and D. A. Redmer. 2010. Utero-placental vascular
development and placental function: An update. Invited review. Internat. J. Develop.
Biol. Special Issue ‘Placental Developmental Biology,” J. S. Hunt and K. L. Thornburg
(eds.) 54:355-366.
Sharif, J., Y Shinkai, and H. Koseki. 2013. Is there a role for endogenous retroviruses to mediate
long-term adaptive phenotypic response upon environmental inputs? Phil. Trans. R. Soc.
B. 368:20110340-20110353. doi: 10.1098/rstb.2011.0340.
140
Spencer, T. E., and F. W. Bazer. 2004. Conceptus signals for establishment and maintenance of
pregnancy. Reprod. Biol. Endo. 2:49.
Spencer, T. E., G. A. Johnson, F. W. Bazer, R. C. Burghardt, and M. Palmarini. 2007. Pregnancy
recognition and conceptus implantation in domestic ruminants: roles of progesterone,
interferons, and endogenous retroviruses. Reprod. Fert. Dev. 19:65-78. doi:
10.1071/RD06102.
Spencer, T. E., and F. W. Bazer. 2002. Biology of progesterone action during pregnancy
recognition and maintenance of pregnancy. Front. Biosci. 7:d1879-d1898.
Spencer, T. E., G. A. Johnson, F. W. Bazer, and R. C. Burghardt. 2004. Implantation
mechanisms: insights from the sheep. Reproduction 128:657-668. doi:
10.1530/rep.1.00398.
Spitzer, J. C., D. G. Morrison, R. P. Wettemann, and L. C. Faulkner. 1995. Reproductive
responses and calf birth and weaning weights as affected by body condition at parturition
and postpartum weight gain in primiparous beef cows. J. Anim. Sci. 73: 1251-1257.
doi:/1995.7351251x.
Thatcher, W. W., P. J. Hansen, T. S. Gross, S. D. Helmer, C. Plante, and F. W. Bazer. 1989.
Antiluteolytic effects of bovine trophoblast protein-1. J. Reprod. Fert. 37:91-99.
Vonnahme, K. A., M. J. Zhu, P. P. Borowicz, T. W. Geary, B. W. Hess, L. P. Reynolds, J. S.
Caton, W. J. Means, and S. P. Ford. 2007. Effect of early gestational undernutrition on
angiogenic factor expression and vascularity in the bovine placentome. J. Anim. Sci.
85:2464-2472. doi:10.2527/jas.2006-805.
Wooding, F. B. P., R. M. Roberts, and J. A. Green. 2005. Light and electron microscope
immunocytochemical studies of the distribution of pregnancy associated glycoproteins
141
(PAGs) throughout pregnancy in the cow: possible functional implications. Placenta
26:807-827. doi:10.1016/j.placenta.2004.10.014.
Wu, G., F. W. Bazer, J. M. Wallace, and T. E. Spencer. 2006. BOARD-INVITED REVIEW:
Intrauterine growth retardation: Implications for the animal sciences. J. Anim. Sci.
84:2316-2337. doi:10.2527/jas.2006-156.
Zhang, S., T. R. H. Regnault, P. L. Barker, K. J. Botting, I. C. McMillen, C. M. McMillan, C. T.
Roberts, J. L. Morrison. 2015. Placental adaptation in growth restriction. Nutrients.
7:360-389. doi: 10.3390/nu7010360.
142
CHAPTER 6. IMPACTCS OF MATERNAL NUTRITION ON PLACENTAL
VASCULARITY AND mRNA EXPRESSION OF ANGIOGENIC FACTORS DURING
THE ESTABLISHMENT OF PREGNANCY IN BEEF HEIFERS
6.1. Abstract
We hypothesized that maternal nutrient restriction starting at the time of breeding would influence placental vascular development and gene expression of angiogenic factors during the first 50 d of gestation in first parity beef heifers. Commercial Angus crossbred heifers (n = 49;
~16 mo of age; BW = 324.5 ± 28.8 kg) were maintained on a TMR and supplemented with dried distillers grains with solubles. All heifers were subject to 5-d CO-Synch + CIDR estrous synchronization protocol, AI to a single Angus sire, and randomly assigned to dietary treatments.
One half were assigned to control diet ( CON ) targeted to gain 0.45 kg/d and the remaining half were assigned to restricted diet ( RES ), which received 60% of control diets. Heifers were subjected to ovariohysterectomy on d 16, 34, or 50 of gestation. Utero-placental tissues were obtained from the uterine horn ipsilateral ( P) and contralateral ( NP ) to the CL and separated into maternal caruncle ( CAR) ; maternal endometrium, inter-caruncle, ( ICAR) and fetal membrane
(FM ). After collected, all tissues were snap frozen and stored at -80°C. There were no treatment
× stage of gestation interactions ( P > 0.13) on vascular endothelial growth factor (VEGF ) or endothelial nitric oxide synthase (eNOS) Heifers on CON treatment had greater ( P = 0.03) expression of VEGF compared with RES heifers in NP-ICAR. On d 50 expression of eNOS was increased ( P = 0.05) compared with d 16 in P-CAR. Expression of eNOS mRNA was decreased
(P = 0.04) on d 16 compared with d 34 and 50 in CON heifer contrast comparison. Gene expression of eNOS was increased ( P < 0.001) in the pregnant uterine horn compared with the
NP uterine horn on d 34 and 50. Expression of eNOS from contrast comparison was also
143
increased ( P < 0.003) on d 34 and 50 in the P uterine horn compared with FM. The vascular ratio
(vascular volume/ tissue volume) in maternal tissues was influenced by nutritional plane dependent on stage of gestation ( P = 0.01) with the RES heifers having a greater vascular ratio on d 16 whereas CON heifers had a greater vascular ratio on d 34. In the non-pregnant uterine horn, there was also an increase ( P = 0.02) in vascular volume of fetal tissues from CON heifers compared with fetal tissues from RES heifers. We conclude that maternal nutrient restriction did alter both vascularity and angiogenic factor mRNA expression in utero-placental tissues during the establishment of pregnancy in first parity beef heifers.
Key words: angiogenesis, bovine, early pregnancy, vascularity
6.2. Introduction
Much of our knowledge of placental vascular development and placental formation has been derived from comparative studies using animal models (Assheton. 1905; Bell et al., 1986;
Magness et al., 1998). Placental development occurs early in gestation and supports fetal growth by enabling nutrient, gas, and waste transfer between fetal and maternal circulations (Patten,
1964; Ramsey, 1982). Therefore, embryonic development depends on the formation of a healthy placenta. Embryonic loss during early pregnancy is associated with impaired placental vascularization and development (Reynolds et al., 2014). Placental growth and development are closely related to fetal growth, and both are sensitive to maternal nutrient supply from the earliest stages of pregnancy (Reynolds and Redmer, 1995; 2001). Inadequate maternal nutrient supply leads to poor placental development, resulting in compromised fetal growth. Impaired pregnancies have also been shown to have long-term effects on the offspring by decreasing health and productivity of the offspring throughout their lives (Wu et al., 2006; Caton and Hess,
2010; Funston et al., 2010).
144
Placental circulation provides the developing conceptus with a uterine environment that is able to meet its metabolic demands throughout pregnancy (Meschia et al., 1983; Bassil et al.,
1995; Reynolds and Redmer, 1995). Extensive changes in vascular volume, surface area and density, and vascular ratio (vascular volume/tissue volume) occur during mid gestation in the uterus and late gestation in fetal tissues of sheep (Borowicz et al., 2007). However, angiogenesis begins during early gestation to support fetal growth and the identification of potential regulators which include the vascular endothelial growth factor ( VEGF ) family and endothelial nitric oxide synthase (eNOS ; Borowicz et al., 2007; Grazul-Bilska et al., 2011) was completed in an attempt to understand angiogenesis during pregnancy. Thus, we hypothesized that maternal nutrient restriction initiated at the time of breeding would influence vascular development and mRNA expression of angiogenic factors during the first 50 d of gestation in first parity beef heifers.
6.3. Materials and Methods
All animal procedures were conducted with approval from the Institutional Animal Care and Use Committee at North Dakota State University (A16049). Commercial Angus crossbred heifers (n = 49; ~ 16 mo of age; BW = 324.5 ± 28.8 kg) were transported 229 km from Central
Grasslands Research Extension Center (Streeter, ND) to the Animal Nutrition and Physiology
Center (North Dakota State University, Fargo, ND). The heifers were housed in pens with 6 heifers per pen and individually fed daily in an electronic head gate facility (American Calan;
Northwood, NH) at 0800 h. Heifers were maintained on a TMR (48.4% DM, 5.3% CP, 29.4%
NDF, 6.8% Ash), supplemented with dried distillers grains with solubles (87.5% DM, 31.3%
CP, 53.4% NDF, 8.2% Ash), and granted ad libitum access to water. All heifers were subject to
5-d CO-Synch + CIDR estrus synchronization protocol and AI to a single Angus sire (day of breeding = d 0; Bridges et al., 2008). On the day of breeding, heifers were randomly assigned to
145
dietary treatments. One half of the heifers were assigned to control treatment ( CON ) targeted to gain 0.45 kg/d and the remaining heifers were assigned to restricted treatment ( RES ), which received 60% of control diets. Heifers were subjected to ovariohysterectomy on d 16, 34, or 50, as previously described (McLean et al., 2016). Thus, experimental design for the pregnancy analysis was a 2 × 3 factorial design. Non-bred, non-pregnant control heifers ( NP ; n = 6) were ovariohysterectomized on d 16 of the luteal cycle following the synchronization cycle. The NP heifers and heifers’ ovariohysterectomized on d 16, 34, and 50 fed CON diet were used in a
CRD to address comparisons of pregnancy status and establishment.
Pregnancy was confirmed via trans-rectal ultrasonography d 28 and again on the d of surgery (d > 28). During surgery left and right uterine arteries, left and right spiral arteries, and the cervix were ligated, and then the uterus removed. Uterine contents were held in place with a
24 cm Crafoord Coarctation Clamp (Integra-Miltex; Plainsboro, NJ), placed just cranial to the cervical ligatures, during and after removal from the body cavity. Following surgery heifers were kept in individual pens during recovery and returned to control diets. Stitches were removed 14 d after surgery (McLean et al., 2016).
6.3.1. Tissue Collecting and Processing
Immediately upon removal from the body cavity, tissues were trimmed of excess broad ligament, fat, and non-reproductive tissues. Weight of the gravid uterus, individual ovaries and
CL were taken before fixation, freezing, and storage. Three dissection pins were placed through the uterine horn containing the fetus ~1 cm apart beginning at the uterine bifurcation. Stadie-
Riggs microtome blades (Thomas Scientific; Swedesboro, NJ) were used to cut three uterine sections for fixation in neutral buffered formalin (Thermo Fisher Scientific; Waltham, MA), carnoy’s solution (Thermo Fisher Scientific), OCT (Thermo Fisher Scientific). Utero-placental
146
tissues were obtained, as previously described (Grazul-Bilska et al., 2010), from the uterine horn ipsilateral to the CL (pregnant uterine horn), maternal caruncle (P-CAR); maternal endometrium, inter-caruncle, (P-ICAR). Tissues obtained in the uterine horn contralateral to the
CL (non-pregnant horn), maternal caruncle (NP-CAR); maternal endometrium, inter-caruncle,
(NP-ICAR). Fetal membranes ( FM ) were collected on d 16, 34, and 50. After collected, all tissues were snap frozen in liquid nitrogen cooled isopentane (Sigma-Aldrich; St. Louis, MO) and stored at -80°C.
6.3.2. Real-time Reverse Transcriptase Quantitative PCR
The RNA was extracted and purified via an RNeasy Mini Kit (Qiagen, Valencia, CA).
The concentration of RNA extracted was determined using Take3 module of a Synergy H1
Microplate Reader (BioTek, Winooski, VT). A total of 1 µg of RNA was used for cDNA synthesis via a QuantiTect Reverse Transcription Kit (Qiagen). Primer sequences were obtained from previous literature for endothelial nitric oxide synthase (eNOS ; Wang et al., 2006) and
VEGF (Einspanier et al., 2002). Primer validation for optimum cDNA concentration and primer efficiency for each tissue type was completed before qPCR analysis. Gene expression was analyzed for CT using a 7500 Fast Real-Time PCR System (Applied Biosystems, Grand Island,
NY) with SYBR Green Master Mix (Bio-Rad Laboratories, Hercules, CA). Gene expression of mRNA was analyzed using the ΔΔCT method with β-actin as the reference gene (Livak and
Schmittgen, 2001). Expression of all genes across d was done separately from analysis of gene expression across tissues within a given d of gestation. Analysis of maternal mRNA expression between d was normalized to β average of expression in NP. Data obtained from FM, FMC, and
FMIC were normalized to the expression in uterine endometrium of each individual gene. For
147
comparison of expression between tissues, expression of each gene was set relative to its average expression NP-ICAR.
6.3.3. Immunohistochemistry
Tissue sections fixed in neutral buffered formalin were used for immunohistochemistry using rabbit anti-CD 34 (Abcam; Cambridge, MA) as a marker for vascularity (Borowicz et al.,
2007). Fixed blocks were embedded via a tissue processor (Leica Biosystems Inc.; Buffalo
Grove, IL) Slides were cut 11 µm thick for 3-D analysis of vascularity. Sections were deparafinized in xylene (VWR; Radnor, PA) and antigen retrieval was done in Na-citrate for 3 min above 121˚C. Antigen blocking was done in 10% normal goat serum (Vector Laboratories;
Burlingame, CA) for 1 h at room temperature. Tissue section and primary CD 34 monoclonal antibody (Abcam) was incubated together for 2 h at room temperature. Secondary CF 633 goat anit-rabbit antibody (Abcam) was incubated on tissue sections for 1 h at room temperature.
Finally, nuclear staining for background was done with DAPI for 5 min at room temperature.
Images were taken with an LSM 700 observer Z1 microscope (Carl Ziess AG; Oberkochen,
Germany). Analysis of photographs was done via Imaris software (Oxford Instrument Co;
Abingdon, United Kingdom) to determine vascular volume with uterine sections 100 × 50 × 10
µm for maternal tissues and 50 × 50 × 10 µm for fetal tissues. Vascular ratio was calculated by dividing vascular volume by the entire tissue volume within each image.
6.3.4. Statistical Analysis
Statistical analyses for gene expression of eNOS and VEGF and vascularity measurements were conducted as a 2 × 3 factorial with individual heifer as the experimental unit via the GLM procedure of SAS version 9.4 (SAS Inst. Inc., Cary, NY). Model terms included stage of gestation (d 16, 34, or 50), maternal nutritional plane (control or restricted), and their
148
interaction. Contrast statements were conducted for heifers fed CON diets because no NP-NB heifers received the RES diet, to determine differences between NP-NB vs. pregnant heifers, d
16 (pre-attachment) vs. d 34 and 50 of pregnancy (post-attachment), and d 34 vs. d 50 of pregnancy. Contrast statements were not used for evaluation of restricted heifers because no NP heifers received the RES diet. Across tissue analysis was conducted via contrast statements to determine differences of gene expression on a given day: pregnant uterine horn vs. non-pregnant uterine horn, pregnant uterine horn vs. fetal membranes, non-pregnant uterine horn vs. fetal membranes, and caruncular tissue vs. endometrium. Means were separated using the LSMEANS statement of SAS with differences determined at a P-values ≤ 0.05.
6.4. Results and Discussion
Placental formation and vascular development during early gestation are vital to establishment of pregnancy. Fetal growth and development are influenced by vascular development and function of the placenta, ultimately influencing neonatal growth and survival
(Reynolds and Redmer, 1995; Vonnahme et al., 2007; Reynolds et al., 2010). In this study we hypothesized that maternal nutrient restriction at the time of breeding would influence vascular development and mRNA expression of angiogenic factors during the first 50 d of gestation in first parity beef heifers. These data are unique in determining vascular development and expression of angiogenic factors ( eNOS and VEGF ) during the first 50 d of gestation. There were no maternal nutrition × by stage of gestation interactions ( P > 0.13) in gene expression of
VEGF or eNOS in P-CAR, P-ICAR, NP-CAR, NP-ICAR, or FM. There was no effect ( P > 0.29) of stage of gestation or nutritional treatment in P-CAR, P-ICAR, NP-CAR, or FM for VEGF .
The lack of differences in FM does not agree with results from Grazul-Bilska et al. (2011) whom reported increases in VEGF expression within chorioallantoic tissue from d 16 to 30 after
149
mating in sheep. There was a tendency ( P = 0.08) for greater VEGF expression at d 50 (0.63 ±
0.13) compared with d 16 and d 34 (0.35 and 0.19 ± 0.13, respectively) in NP-ICAR.
Additionally, heifers on the CON diet had greater (P = 0.03) expression of VEGF compared with the RES heifers (Fig. 6-1) in NP-ICAR. Borowicz et al., (2007) reported VEGF expression increased during mid-gestation in P-CAR of sheep, which did not occur in the present study.
While time of gestation was different, the change in expression of NP uterine horn may be indicative of VEGF as a mechanism for uterine preparation for placental vascularity.
9 a Stage × Nutrition P = 0.13 8 Stage of Gestation P = 0.06 7 Nutritional Plane P = 0.03 6 5 b
inNP-ICAR 4 3 2 VEGF VEGF
Relative fold change of change fold Relative 1 0 Control Restricted Nutritional Treatment
Figure 6-1. The influence nutritional treatment on mRNA expression of vascular endothelial growth factor (VEGF) in maternal endometrium of the contralateral uterine horn to the conceptus (NP-ICAR) during the first 50 d of pregnancy in beef heifers. Data presented as a 2^ - ΔΔCT fold change normalized to β-Actin and the average of NP. a,b Means without a common superscript differ ( P < 0.05).
The establishment of placental circulation must occur so that the uterine environment is able to meet its metabolic demands of the fetus during pregnancy (Meschia et al., 1983; Bassil et al., 1995; Reynolds and Redmer, 1995). Reduced placental vascularity is also associated with early embryonic mortality (Meegdes et al., 1988; Bassil et al., 1995). Nutrient restriction in ewes alters placentome formation causing the increase in cotyledon and caruncle contact to occur earlier in gestation (Vonnahme et al., 2006). Our data may indicate that VEGF i s an 150
angiogenic factor influenced by maternal nutritional plane. The influence of VEGF expression in NP-ICAR may indicate that nutritional restriction beginning at the day of breeding my influence vasculature development in the contralateral uterine horn. This may influence the ability of the extra-embryonic membranes to spread into the contralateral uterine horn and also fetal growth by influencing the uterine and placental ability to provide nutrients to the fetus in that horn. There was no effect ( P > 0.14) of nutritional plane or stage of gestation in P-ICAR,
NP-CAR, NP-ICAR, or FM in eNOS expression. Expression of eNOS on d 50 expression was greater than ( P = 0.05) d 16, while d 34 was intermediate (Fig. 6-2) in P-CAR.
30 Stage × Nutrition P = 0.75 b Stage of Gestation P = 0.05 25 Nutritional Plane P = 0.55 20 ab 15 in P-CAR a 10 b eNOS 5 Relative fold change of change fold Relative 0 16 34 50 Gestation, d
Figure 6-2. Expression of endothelial nitric oxide synthase (eNOS) in pregnant maternal caruncle (P-CAR). Data presented as a 2^ -ΔΔCT fold change normalized to β-Actin and the average of NP-NB. a,b Means without a common superscript differ ( P < 0.05).
This increase in expression is in agreement with data from early gestation in ovine CAR
(Grazul-Bilska et al., 2011) and with the lack of change in eNOS expression reported in FM
(Borowicz et al., 2007). However, eNOS expression in P-CAR was not different (P = 0.55) between heifers fed CON or RES diets which indicates that eNOS , while important in placental vascularity, is not a likely mechanism driving the effects of maternal nutritional plane on placental vascular development during the time of gestation evaluated in this study. Alterations 151
in placental vascularity will have momentous influences on the maternal ability to provide adequate nutrients to the developing fetus.
Measurements of vascular volume or the ratio of vascular area divided by total area
(vascular ratio) were not different ( P > 0.14) in fetal or maternal tissues taken from the pregnant uterine horn amongst days or between nutritional treatments. In the non-pregnant horn, there was no difference ( P > 0.12) in the vascular ratio for fetal tissues. However, the vascular ratio in maternal tissues was influenced by a nutritional plane dependent ×stage of gestation interaction
(P = 0.01; Fig. 6-3) with vascular ratio in RES heifers greater on d 16 whereas CON heifers were greater on d 34.
Stage × Nutrition P = 0.01 14 3 Stage of Gestation P = 0.88 b Nutritional Plane P = 0.44 12 b ab 10 a a a 8 6 4 2 0 Vascular ratio in the non-pregnant in non-pregnant the ratio Vascular
uterine horn of maternal maternal tissues,uterine of µm horn 16 34 50 Stage of Gestation
Figure 6-3. The influence of nutritional treatment on vascular ratio in maternal tissue dependent on stage of gestation. White bars with black outline represent control heifers and gray bars represent restricted heifers Vascular ratio was calculated by dividing overall volume of tissue by vascular volume. a,b Means without a common superscript differ ( P < 0.05).
There tended ( P = 0.09) to be an interaction between stage of gestation and nutritional treatment for vascular volume in maternal tissues with CON heifers had increased volume (4329
152
µm 3) on d 34 compared with d 16 and 50 (3,372 and 3,527 µm 3; respectively); whereas RES hefiers were decreased (3,416 µm 3) on d 34 compared with d 16 and 50 (3,372 and 3,527 µm 3; respectively). There was also an increase ( P = 0.02) in vascular volume within the fetal tissues of the non-pregnant horn from CON heifers compared with fetal tissues from RES heifers (Fig.
6-4).
3,500 Stage × Nutrition P = 0.07 3 a Stage of Gestation P = 0.33 3,000 Nutritional Plane P = 0.02 2,500 2,000 b 1,500 1,000 500 0 Vascular volume in the non-pregnant volume in non-pregnant the Vascular uterine horn of fetal fetal uterine of membranes, µm horn Control Restricted Nutritional Treatment
Figure 6-4. The effects of nutritional plane on vascular volume in fetal membranes from the non-pregnant uterine horn of during the first 50 d of gestation. a,b Means without a common superscript differ ( P < 0.05).
Nutrient restriction may have limited the spread of the conceptus into the contralateral uterine horn as a maternal compensatory mechanism to ensure adequate nutrient supply for fetal growth. This may help to explain why nutrient restriction during early to mid-gestation may not influence birth weight in cattle (Martin et al., 2007; Long et al., 2009) and sheep (Wu et al.,
2006; Ford et al., 2007; Long et al., 2010). However in some instances nutrient restriction during early to mid-gestation may reduce calf birth weight (Carstens et al., 1987; Spitzer et al.,
1995; Larson et al., 2009); this was dependent on time and severity of restriction. The ability of 153
maternal systems to compensate for the lack of nutrients may dictate whether or not effects on the fetus and utero-placental tissues occur. One mechanism to ensure adequate nutrient supply may be alterations in angiogenesis and blood flow. The adjustment in blood flow is supported by Fig. 6-3 where the vascular ratio was increased earlier in gestation, d 16, in RES heifers compared with d 34 in CON heifers. Reduced nutrient intake in late gestation increased the weight of the placenta to compensate for less maternal nutrients (Rasby et al., 1990); however, during the first 50 d of gestation the placenta is still developing and restriction compensation by increasing weight is an unlikely mechanism.
Pregnant heifers tended ( P < 0.06; Table 6-1) to have greater expression of VEGF in P-
CAR and P-ICAR compared to NP-NB heifers. However, in NP-ICAR expression of VEGF in
NP-NB heifers tended ( P < 0.06) to be greater than pregnant heifers. Expression of VEGF also tended ( P < 0.10) to be a greater on d 50 of gestation compared with d 34 in NP-CAR and NP-
ICAR (Table 6-1). In P-CAR, expression of eNOS was less ( P < 0.01; Table 6-1) NP-NB heifers compared with pregnant heifers. The mRNA of eNOS level on d 16 was also less ( P = 0.04;
Table 6-1) compared with d 34 and 50. The CON heifers were not different ( P > 0.15) in P-
ICAR and NP-CAR for eNOS mRNA expression (Table 6-1). Gene expression of eNOS tended
(P = 0.08) to be different between d 34 and 50 in NP-ICAR. No differences ( P > 0.19) for either the vascular volume or the vascular ratio in the pregnant horn. Non-pregnant vascular volume tended ( P = 0.10) to be greater on d 34 compared with d 50 (Table 6-1). However, in the non- pregnant uterine horn the vascular ratio tended ( P < 0.10) to be different for all of the contrast comparisons (Table 6-1) with NP-NB heifers and heifers on d 34 of gestation having greater vascular volumes.
154
To further determine function and role of VEGF and eNOS in the establishment of pregnancy, an analysis for gene expression between tissues on a given day was conducted via contrast comparisons. There was a tendency ( P = 0.08 Table 6-2) for VEGF to be greater in the non-pregnant compared with the pregnant uterine horn of NP-NB heifers. Expression of VEGF was greater ( P = 0.01) in the ICAR compared with CAR (Table 6-2) in NP-NB heifers. On d 16, fetal membranes had greater ( P = 0.01) expression of VEGF compared with non-pregnant uterine horn. Whereas, the pregnant horn expression of VEGF tended ( P = 0.08) to be different from fetal membranes and there tended ( P = 0.06) to be a difference between CAR and ICAR
(Table 6-2). On d 34, pregnant horn expression ( P = 0.003) and fetal membranes ( P = 0.02) were greater than the non-pregnant uterine horn. However, on d 50 pregnant uterine horn expression of VEGF only tended to be greater than the non-pregnant uterine horn ( P = 0.08) or fetal membranes ( P = 0.10). There was no difference ( P > 0.14) between the pregnant or non- pregnant uterine horn for eNOS expression in NP-NB heifers or on d 16 of gestation. There was no difference between Car and ICAR ( P > 0.24) in NP-NB heifers or on d 34 or 50 of gestation.
However, on d 16 ICAR had greater ( P = 0.04) expression of eNOS compared with CAR (Table
6-2). On d 34 and 50 expression of eNOS was greater ( P < 0.001) in the pregnant uterine horn compared with the non-pregnant uterine horn. The pregnant uterine horn also had greater expression of eNOS compared with fetal membranes on d 34 ( P = 0.003) and d 50 ( P < 0.001;
Table 6-2).
The prenatal growth trajectory is sensitive to direct and indirect effects of maternal dietary intake from the earliest stages of embryonic life even though nutrient requirements for conceptus growth are negligible (Robinson et al., 1999; Wallace et al., 2006). While just a small portion of mass accumulation occurs during early gestation the foundation for rapid growth later
155
Table 6-14. Changes in mRNA expression for endothelial nitric oxide synthase (eNOS), vascular endothelial growth factor (VEGF), and overall vascularity in control heifers during the first 50 d of gestation. Contrast P-value 4 d 16 NP-NB d 34 Tissue 1 NP-NB 2 d 16 d 34 d 50 SEM vs. vs. vs. d 34 and P d 50 50 VEGF P-CAR 1.3 15.7 5.4 17.3 4.9 0.06 0.46 0.11 P-ICAR 1.1 22.4 5.2 18.5 5.9 0.06 0.14 0.12 NP-CAR 1.2 1.7 0.5 1.9 0.6 0.86 0.50 0.08 NP-ICAR 17.1 6.2 2.2 12.5 4.2 0.05 0.83 0.10 eNOS P-CAR 2.2 8.5 17.1 21.1 3.7 <0.01 0.04 0.47 P-ICAR 1.7 5.7 1.7 4.3 1.5 0.23 0.15 0.21 NP-CAR 1.4 0.6 0.4 1.1 0.4 0.16 0.84 0.22
156 NP-ICAR 2.2 2.2 0.5 6.2 2.3 0.77 0.66 0.08 5
Vascularity Volume P Horn 3,945 4,275 3,906 3,624 474 0.99 0.44 0.65 NP Horn 4,377 3,677 4,666 3,527 473 0.45 0.46 0.10 Vascularity Ratio 6 P Horn 9.3 10.5 9.0 8.3 1.0 0.99 0.19 0.59 NP Horn 10.4 7.4 10.2 8.1 0.9 0.06 0.10 0.08 1Tissues were separated into caruncle ipsilateral to the CL (P-CAR), endometrium ipsilateral to the CL (P- ICAR), caruncle contralateral to the CL (NP-CAR), and endometrium contralateral to the CL (NP-ICAR). 2Average values for normalized NP-NB were used in data analysis as baseline. 3P value for the protected F test for analysis of gene by day of gestation. 4Contrasts compared gene expression in non-pregnant vs. pregnant heifers, d 16 vs. d 34 and 50 of gestation, and d 34 vs. d 50 of gestation. 5Volume is the vascular volume in a uterine section 100 × 50 × 10 µm. 6Is the vascular volume divided by the total volume of the tissue section within a uterine section 100 × 50 × 10 µm.
Table 6-2. Changes in mRNA expression for endothelial nitric oxide synthase (eNOS) and vascular endothelial growth factor (VEGF) amongst tissues within a given day of gestation. Contrast P-value 4 NPH PH NPH CAR Tissue 1 P-CAR P-ICAR NP-CAR NP-ICAR 2 FM SEM vs. vs. vs. vs. PH FM FM ICAR VEGF NP-NB 3 0.1 0.3 0.1 1.3 - 0.2 0.08 - - 0.01 d 16 5.6 10.8 1.3 3.2 20.9 5.3 0.25 0.08 0.01 0.06 d 34 10.7 8.6 0.4 1.2 10.1 3.1 0.003 0.92 0.02 0.99 d 50 2.5 7.5 1.7 2.7 2.4 1.6 0.08 0.10 0.90 0.11 eNOS NP-NB 0.3 0.9 0.6 0.8 - 0.3 0.78 - - 0.24 d 16 2.3 5.5 0.2 5.6 0.02 1.9 0.53 0.14 0.31 0.04 d 34 8.2 7.1 0.2 1.7 1.8 1.5 <0.001 0.003 0.59 0.69
157 d 50 3.0 1.9 0.3 0.9 0.4 0.5 <0.001 <0.001 0.71 0.75 1 Tissues were separated into caruncle ipsilateral to the CL (P-CAR), endometrium ipsilateral to the CL (P-ICAR), caruncle contralateral to the CL (NP-CAR), and endometrium contralateral to the CL (NP-ICAR). 2Average values for normalized NP-ICAR were used as baseline value during across tissue analyses. 3Non-bred, non-pregnant control heifers (NP-NB). 4Contrasts compared gene expression in non-pregnant horn (NPH) vs. pregnant horn (PH), pregnant horn vs. fetal membranes (FM), pregnant horn vs. fetal membranes, and caruncle (CAR) vs endometrium (ICAR). Values for CAR and ICAR were combined for PH and NPH comparisons.
is supported by the vascular developments during the first 50 d. These data included within may be indicative of the roles for VEGF and eNOS during the establishment of pregnancy and the development of placenta growth and vascularization that must occur to support fetal growth and development.
In conclusion, while limited effects were seen in vascularity or angiogenic factors measured ( eNOS and VEGF expression) in the pregnant uterine horn; nutrient restriction influenced the non-pregnant horn where nutrient restriction decreased both VEGF expression and overall vascular volume. Nutrient restriction decreased VEGF expression and overall vascular volume while the vascular ratio was also influenced by nutritional plane but dependent on stage of gestation. As pregnancy progressed both eNOS and VEGF expression were greater in the pregnant horn while eNOS also greater in FM which may aid in fetal vascular interaction with uterine endometrium outside of the placentome. Therefore, we conclude that limited effects of vascularity occurs before d 50 of gestation within the pregnant horn due to nutrient restriction but decreased vascular development in the uterine horn contralateral to the embryo in beef heifers.
6.5. Literature Cited
Assheton, R. 1905. The morphology of the ungulate placenta, particularly the development of
that organ in sheep, and notes upon the placenta of the elephant and hyrax. Phil. Trans.
Royal Soc. (London), Ser. B. 198:143-220. doi: 10.1098/rspb.1905.0033.
Bassil, S., J. P. Magritte, J. Roth, M. Nisolle, J. Donnez, and S. Gordts. 1995. Uterine vascularity
during stimulation and its correlation with implantation in in-vitro fertilization. Hum.
Reprod.10:1497-1501. doi: 10.1093/HUMREP/10.6.1497.
158
Bell, A. W., J. M. Kennaugh, F. C. Battaglia, E. L. Makowski, and G. Meschia. 1986. Metabolic
and circulatory studies of fetal lamb at midgestation. Am. J. Physiol. 250:E538-E544.
Borowicz, P. P., D. R. Arnold, M. L. Johnson, A. T. Grazul-Bilska, D. A. Redmer, and L. P.
Reynolds. 2007. Placental growth throughout the last two thirds of pregnancy in sheep:
vascular development and angiogenic factor expression. Biol. Reprod. 76:259-267.
doi: 10.1095/biolreprod.106.054684.
Bridges, G. A., L. A. Helser, D. E. Grum, M. L. Mussard, C. L. Gasser, and M. L. Day. 2008
Decreasing the interval between the GnRH and PGF 2α from 7 to 5 d and lengthening
proestrus increases timed-AI PR in beef cows. Theriogenology 69:843-851. doi:
10.1016/j.theriogenology.2007.12.011.
Carstens, G. E., D. E. Johnson, M. D. Holland, and K. G. Odde. 1987. Effects of prepartum
protein nutrition and birth weight on basal metabolism in bovine neonates. J. Anim. Sci.
65: 745-751. doi:10.2134/jas1987.653745x.
Caton, J. S. and B. W. Hess. 2010. Maternal plane of nutrition: Impacts on fetal outcomes and
postnatal offspring responses. in: Proc 4th Grazing Livestock Nutrition Conference. West
Sect. Am. Soc. Anim. Sci. 39:104-122.
Einspanier, R., M. Schönfelder, K. Müller, M. Stojkovic, M. Kosmann, E. Wolf, and D. Schams.
2002. Expression of the vascular endothelial growth factor and its receptors and effects of
VEGF during in vitro maturation of bovine cumulus-oocyte complexes (COC). Mol.
Reprod. Dev. 62:29-36. doi: 10.1002/mrd.10068.
Ford, S. P., B. W. Hess, M. M. Schwope, M. J. Nijland, J. S. Gilbert, K. A. Vonnahme, W. J.
Means, H. Han, and P. W. Nathanielsz. 2007. Maternal undernutrition during early to
159
mid-gestation in the ewe results in altered growth, adiposity, and glucose tolerance in
male offspring. J. Anim. Sci. 85: 1285-1294. doi:10.2527/jas.2005-624.
Funston, R. N., J. L. Martin, D. C. Adams, and D. M. Larson. 2010. Winter grazing system and
supplementation of beef cows during late gestation influence heifer progeny. J. Anim.
Sci. 88:4094-4101. doi: 10.2527/jas.2010-3039.
Grazul-Bilska, A. T., M. L. Johnson, P. P. Borowicz, M. Minten, J. J. Bilski, R. Wroblewski, M.
Velimirovich, L. R. Coupe, and D. A. Redmer. 2011. Placental development during early
pregnancy in sheep: cell proliferation, global methylation, and angiogenesis in the fetal
placenta. Reproduction 141:529-540. doi: 10.1530/REP-10-0505.
Grazul-Bilska, A. T., P. P. Borowicz, M. L. Johnson, M. Minten, J. J. Bilski, R. Wroblewski, D.
A. Redmer, and L. P. Reynolds. 2010. Placental development during early pregnancy in
sheep: vascular growth and expression of angiogenic factors in maternal placenta.
Reproduction 140:165-174. doi: 10.1530/REP-09-0548.
Larson, D. M., J. L. Martin, D. C. Adams, and R. N. Funston. 2009. Winter grazing system and
supplementation during late gestation influence performance of beef cows and steer
progeny. J. Anim. Sci. 87: 1147-1155. doi:10.2527/jas.2008-1323.
Livak, K. J. and T. D. Schmittgen. 2001. Analysis of relative gene expression data using real-
time quantitative PCR and the 2 -ΔΔCT Method. Methods 25:402-408.
doi:10.1006/meth.2001.1262.
Long, N. M., K. A. Vonnahme, B. W. Hess, P. W. Nathanielsz, and S. P. Ford. 2009. Effects of
early gestational undernutrition on fetal growth, organ development, and placentomal
composition in the bovine. J. Anim. Sci. 87:1950-1959. doi:10.2527/jas.2008-1672.
160
Long, N. M., L. A. George, A. B. Uthlaut, D. T. Smith, M. J. Nijland, P. W. Nathanielsz, and S.
P. Ford. 2010. Maternal obesity and increased nutrient intake before and during gestation
in the ewe results in altered growth, adiposity, and glucose tolerance in adult offspring. J.
Anim. Sci. 88: 3546-3553. doi:10.2527/jas.2010-3083.
Magness, R. R. 1998. Maternal cardiovascular and other physiological responses to the
endocrinology of pregnancy. In: The Endocrinology of Pregnancy (Ed. F.W. Bazer).
Humana Press, Totowa, NJ, pp. 507-539.
Martin, J. L., K. A. Vonnahme, D. C. Adams, G. P. Lardy, and R. N. Funston. 2007. Effects of
dam nutrition on growth and reproductive performance of heifer calves. J. Anim. Sci. 85:
841-847. doi:10.2527/jas.2006-337.
McLean, K. J., C. R. Dahlen, P. P. Borowicz, L. R. Reynolds, B. W. Neville, S. D. Walden, and
J. S. Caton. 2016. Technical note: A new surgical technique for ovariohysterectomy
during early pregnancy in beef cattle. J. Anim. Sci (Submitted, JAS # E-2016-0761).
Meegdes, H. L. M., R. Ingenhoes, L. L. H. Peeters, and N. Exalto. 1988. Early pregnancy
wastage: relationship between chorionic vascularization and embryonic development.
Fertil. Steril. 49:216–220.
Meschia, G. 1983. Circulation to female reproductive organs Handbook of Physiology No. Sect.
2, Vol. III, part 1. p 241-269. Shepherd JT & Abboud FM, American Physiological
Society, Bethesda, MD.
Meyer, M. D., P. J. Hansen, W. W. Thatcher, M. Drost, L. Badinga, R. M. Roberts, J. Li, T. L.
Ott, F. W. Bazer. 1995. Extension of corpus luteum life span and reduction of uterine
secretion of prostaglandin F2α of cows in response to recombinant interferon-τ. J. Dairy
Sci. 78:1921-1931. doi:10.3168/jds.S0022-0302(95)76817-5.
161
Patten, B. M. 1964. Foundations of Embryology (2nd Ed.). McGraw-Hill, New York.
Ramsey, E. M. 1982. The placenta, human and animal. Praeger, New York.
Rasby, R. J., R. P. Wettemann, R. D. Geisert, L. E. Rice, and C. R. Wallace. 1990. Nutrition,
body condition and reproduction in beef cows: fetal and placental development, and
estrogens and progesterone in plasma. J. Anim. Sci. 68: 4267-4276.
doi:/1990.68124267x.
Reynolds, L. P. and D. A. Redmer. 1995. Utero-placental vascular development and placental
function. J. Anim. Sci. 73:1839-1851. doi:/1995.7361839x.
Reynolds, L. P. and D. A. Redmer. 2001. Angiogenesis in the placenta. Biol. Reprod. 64:1033-
1040. doi: 10.1095/biolreprod64.4.1033.
Reynolds, L. P., and J. S. Caton. 2012. Role of the pre- and post-natal environment in
developmental programming of health and productivity. Invited review. Molecular and
Cellular Endocrinology, Special Issue ‘Environment, Epigenetics and Reproduction,”
MK Skinner (ed.) 354:54-59. doi: 10.1016/j.mce.2011.11.013.
Reynolds, L. P., P. P. Borowicz, C. Palmieri, and A. T. Grazul-Bilska. 2014. Placental Vascular
Defects in Compromised Pregnancies: Effects of Assisted Reproductive Technologies
and Other Maternal Stressors. In: Advances in Fetal and Neonatal Physiology (Zhang L
& Ducsay CA, eds.), Advances in Experimental Medicine and Biology 814, Springer
Science Business Media, NY. (ISBN 978-1-4939-1031-1). doi: 10.1007/978-1-4939.
Reynolds, L. P., P. P. Borowicz, J. S. Caton, K. A. Vonnahme, J. S. Luther, D. S. Buchanan, S.
A. Hafez, A. T. Grazul-Bilska, and D. A. Redmer. 2010. Utero-placental vascular
development and placental function: An update. Invited review. Internat. J. Develop.
162
Biol. Special Issue ‘Placental Developmental Biology,” J. S. Hunt and K. L. Thornburg
(eds.) 54:355-366.
Roberts, R. M., J. C. Cross, and D. W. Leaman. 1992. Interferons as hormones of pregnancy.
Endocr. Rev. 13:432-452. doi: http://dx.doi.org/10.1210/edrv-13-3-432.
Robinson, J. J., K. D. Sinclair, and T. G. McEvoy. 1999. Nutritional effects on foetal growth.
Animal Science. 68:315-329.
Spitzer, J. C., D. G. Morrison, R. P. Wettemann, and L. C. Faulkner. 1995. Reproductive
responses and calf birth and weaning weights as affected by body condition at parturition
and postpartum weight gain in primiparous beef cows. J. Anim. Sci. 73: 1251-1257.
doi:/1995.7351251x.
Wallace, J. M., J. S. Milne, D. A. Redmer, and R. P. Aitken. 2006. Effect of diet composition on
pregnancy outcome in overnourished rapidly growing adolescent sheep. Br. J. Nutr.
96:1060-1068. doi: http://dx.doi.org/10.1017/BJN20061979.
Vonnahme, K. A., B. W. Hess, M. J. Nijland, P. W. Nathanielsz, and S. P. Ford. 2006.
Placentomal differentiation may compensate for maternal nutrient restriction in ewes
adapted to harsh range conditions. J. Anim. Sci. 84: 3451-3459. doi:10.2527/jas.2006-
132.
Vonnahme, K. A., M. J. Zhu, P. P. Borowicz, T. W. Geary, B. W. Hess, L. P. Reynolds, J. S.
Caton, W. J. Means, and S. P. Ford. 2007. Effect of early gestational undernutrition on
angiogenic factor expression and vascularity in the bovine placentome. J. Anim. Sci.
85:2464-2472. doi:10.2527/jas.2006-805.
Wang, Y., Y. Wang, Q. Yang, J. T. Yan, C. Zhao, K. Cianflone, and D. W. Wang. 2006. Effects
of bezafibrate on the expression of endothelial nitric oxide synthase gene and its
163
mechanisms in cultures bovine endothelial cells. Atherosclerosis 187:265–273.
doi: 10.1016/j.atherosclerosis.2005.09.008.
Wu, G., F. W. Bazer, J. M. Wallace, and T. E. Spencer. 2006. BOARD-INVITED REVIEW:
Intrauterine growth retardation: Implications for the animal sciences. J. Anim. Sci.
84:2316-2337. doi:10.2527/jas.2006-156.
164
CHAPTER 7. SUMMARY AND CONCLUSIONS
The standing flank ovariohysterectomy procedure can be done within many normal cattle working facilities with little modification. Tissues acquired using the standing ovariohysterectomy procedure we have developed are of high quality and exhibit minimal trauma. The quality of these tissues has allowed our group to characterize expression patterns of endogenous retroviruses (McLean et al., 2016), nutrient transporters (Crouse et al., 2015), redefine the distribution of GLUT 3 in reproductive tissues (Osei et al., 2016), determine the existence of GLUT 14 in the maternal tissues (Crouse et al., 2016a), and assess the influences of nutritional restriction on endogenous retroviruses and nutrient transporters (Crouse et al., 2016b;
McLean et al., 2016). The standing ovariohysterectomy procedure thus provides an excellent method to conduct early pregnancy research while maintaining livestock stewardship. High quality tissues can be acquired with minimum cost, and heifers undergoing the ovariohysterectomy can be expected to reach slaughter BW with minimal effects on growth performance. The data acquired using the present ovariohysterectomy procedure will therefore minimize inefficiencies in tissue acquisition, reduce the number of animals needed to understand cellular interactions from changes due to hypoxia, and increase overall animal stewardship in early pregnancy research in beef cattle. This procedure represents an excellent model for studying critical events during early gestation in heifers. This model will provide insight into the effects of maternal nutrition, impacts of individual nutrients, nutrient transporters, the role of endogenous retroviral elements, and lead to the elucidation of the underlying mechanisms associated with the establishment and maintenance of pregnancy in beef heifers.
The mRNA expression of syncytin-Rum1 , BERV-K1 , IFN-τ, and PSP-B was differentially present in utero-placental tissues during the first 50 d of gestation. We established 3 times, d 16,
165
34, and 50, during early gestation which had differences in gene expression and should be a focus of research in the future. Expression of IFN-τ was increased during the time of maternal recognition (~d 16). Level of BERV-K1 was increased in ICAR on d 28, which coincides with fetal adhesion and the completion of implantation (~d 30). Gene expression syncytin-Rum1 ,
BERV-K1 and PSP-B in CAR was increased on d 50 supporting roles in cell to cell fusion and placental development. This research also established basal expression patterns for syncytin-
Rum1 , BERV-K1 , IFN-τ, and PSP-B which can be used in future research to determine the influence of treatments on pregnancy. While these data provide evidence for differential expression the functions and interactions between syncytin-Rum1 , BERV-K1 , IFN-τ, and PSP-B remain to be elucidated and should be the focus in future studies to determine the importance in fetal and placental development and the establishment of pregnancy.
Nutrient restriction of 40% for 50 d may not be severe or long enough of a restriction to have a major influence on expression of syncytin-Rum1 , BERV-K1 , PSP-B or IFN-τ in utero- placental tissues. Our previous data and this work confirmed differential expression of syncytin-
Rum1 , BERV-K1 , PSP-B and IFN-τ in both maternal and fetal tissues during the first 50 d of gestation. These differences in expression levels are at critical time points during the establishment of pregnancy, specifically, maternal recognition (d 16), completion of fetal adhesion (d 34) and rapid placental development (d 50). While exact functions during early gestation remain to be elucidated ERV, PSP-B, and IFN-τ may work sequentially or synergistically to complete vital steps for the successful establishment of pregnancy in beef heifers.
While limited effects were seen in vascularity or angiogenic factors measured ( eNOS and VEGF ) in the pregnant uterine horn; nutrient restriction influenced the non-pregnant horn
166
where nutrient restriction decreased both VEGF expression and overall vascular volume.
Nutrient restriction decreased VEGF expression and overall vascular volume while the vascular ratio was also influenced by nutritional plane but dependent on stage of gestation. As pregnancy progressed both eNOS and VEGF were increased in the pregnant horn while eNOS also increased in FM which may aid in fetal vascular interaction with uterine endometrium outside of the placentome. Therefore, we conclude that limited effects of vascularity occurs before d 50 of gestation within the pregnant horn due to nutrient restriction but decreased vascular development in the uterine horn contralateral to the embryo in beef heifers.
The future directions of this work should focus on further elucidation of the functions performed by both syncytin-Rum1 and BERV-K1 separately during the establishment of pregnancy. While these data implicate ERV during crucial times of early gestation, these data are simply mRNA expression and confirmation of a protein which can perform biological functions is necessary. Research should also look into the possibility that ERV yet to be found may be present and functional. More angiogenic factors should be investigated to complete understand what initiates the vascularity and blood flow changes that occur during gestation. Although nutrient restriction in the current research had limited effects on gene expression, nutrient restriction does influence development and should research should continue to elucidate the impacts of maternal diet, both global diet and specific nutrients, on early gestation. The data from this research are novel and provide a foundation for future studies which will allow for a more complete understanding of fetal development, the events of early gestation, and the establishment of a successful pregnancy.
167
7.1. Literature Cited
Crouse, M. S., K. J. McLean, L. P. Reynolds, C. R. Dahlen, B. W. Neville, P. P Borowicz, and J.
S. Caton. 2015. Nutrient transporters in bovine utero-placental tissues on days 16 to 50 of
gestation. Proc. West. Sec. Amer. Soc. Anim. Sci. 66:44-47 .
Crouse, M. S. J. S. Caton, K. J. McLean, P. P. Borowicz, L. P .Reynolds, C. R. Dahlen, and A.
K. Ward. 2016a. Isolation and comparison of expression of novel glucose transporters,
GLUT3 and GLUT14, in bovine utero-placental tissues from days 16 to 50 of gestation. J.
Anim. Sci. 94:(Abstr Accepted).
Crouse, M. S., K. J. McLean, M. R. Crosswhite, N. Negrin Pereira, A. K. Ward, L. P. Reynolds,
C. R. Dahlen, B. W. Neville, P. P Borowicz, and J. S. Caton. 2016b. Effects of maternal
nutritional status on nutrient transporter expression in bovine utero-placental tissue on
days 16 to 50 of gestation Proc. West. Sec. Amer. Soc. Anim. Sci. 67: (Accepted).
McLean, K. J., M. S. Crouse, M. R. Crosswhite, D. N. Black, C. R. Dahlen, P. P. Borowicz, L.
R. Reynolds, A. K. Ward, B. W. Neville, and J. S. Caton. 2016. Rapid Communication:
Expression of an endogenous retroviral element, syncytin-Rum1, during early gestation
in beef heifers. J. Anim. Sci. 94:1-5. doi: 10.2527/jas2016-0793.
Osei, J., M. S. Crouse, K. J. McLean, J. A. Flaten, P. P. Borowicz, L. P. Reynolds, J. S. Caton,
and C. R. Dahlen. 2016. Development of an immunohistochemical technique to
determine presence and localization of glucose transporter GLUT3 in bovine utero-
placental tissues from days 16 to 50 of gestation. Proc. West. Sec. Amer. Soc. Anim. Sci.
67: (Abstr; Accepted).
168