Virginia Commonwealth University VCU Scholars Compass
Theses and Dissertations Graduate School
2013
Characterization of the neurotrophic factor Brain-Derived Neurotrophic Factor (BDNF) in intestinal smooth muscle cells
Mohammad Alqudah Virginia Commonwealth University
Follow this and additional works at: https://scholarscompass.vcu.edu/etd
Part of the Physiology Commons
© The Author
Downloaded from https://scholarscompass.vcu.edu/etd/3095
This Dissertation is brought to you for free and open access by the Graduate School at VCU Scholars Compass. It has been accepted for inclusion in Theses and Dissertations by an authorized administrator of VCU Scholars Compass. For more information, please contact [email protected].
Characterization of the neurotrophic factor Brain-Derived
Neurotrophic Factor (BDNF) in intestinal smooth muscle cells
A thesis submitted in partial fulfillment of the requirements for the degree of Doctor of
Philosophy at Virginia Commonwealth University
By
Mohammad A Al Qudah B.S in Dentistry, Jordan University of Science and Technology, Jordan, 2005
Director: John R. Grider, Ph.D. Professor, Department of Physiology
Virginia Commonwealth University Richmond, Virginia April, 2013
ACKNOWLEDGMENT
All the praises and thanks are to God (Allah) for giving me the endurance and the perseverance to complete this work successfully. “And my success is not but through Allah.
Upon him I have relied, and to him I return” (Quran 11: 88).
Then, I want to express my thanks and my deepest appreciation for all who helped, guided and supported me throughout this journey. First, my utmost respect and gratitude go to two of my professors who have guided my entire study, my supervisor Prof John Grider who displayed unyielding inspiration, guidance and support during the course of my entire academic journey. Dr. Grider is the person who every graduate student would want as his or her mentor.
He gives me a lifetime model for intelligence, patience, diligence and erudition. No word can even express my heartily thanks to Prof Grider. I would also thank Dr. Murthy whose valuable suggestions and encouragements helped me to finish this work.
I extend my sincere thanks for my committee members, Dr. Akbarali, Dr.Vijay, and
Dr.Ghosh for their time, continuous support and suggestions that nourished my research project.
I am in great obligation to thank Dr. Sunila for her invaluable and unyielding support and encouragements. I am in debited to Dr. Sunila for most of the basic and essential techniques
I have learned. I would like also to thank all the people who made the lab a wonderful place to work in; Othman, Sayak, Andy, Senthil, Divya, Ancy, Reem, Derek, Norm, Rick, Shane,
Chunmei,Chao, Zack, Jaron and Rhizue.
ii
I am humbled and profoundly grateful to Dr. Lueis Defelice as I got acceptance to VCU graduate school while he was the program director. My thanks also go to Dr. Logothetis, our departmental chair and all the administrative and technical staff members of the Physiology department for their kind help.
I am grateful to Jordan University of Science and Technology for their financial support for the whole period of my Ph.D. study.
Being away from home country, I owe great appreciation for my friends in Richmond who were source of fun, joy and support. I wish that our friendship will go beyond our shared times in Richmond.
I would like to say sincere heartfelt thanks to my parents for their faith in me, which was my driving force. They kept all their sorrows secret to keep their son’s mind free from concerns during his study overseas. Their continuous encouragements and prayers were crucial for this achievement.
Finally yet most importantly, I would love to thank my dear wife Hanan, who has suffered and celebrated every step in this long journey. Her love, help and encouragement allowed me to finish this episode of my life successfully. I am so very lucky to have you and our wonderful Salma and Adam in my life.
iii
TABLE OF CONTENT
Acknowledgment ...... ii
Table of Content ...... iv
List of Tables ...... ix
List of Figures ...... x
List of Abbreviations...... xiii
Abstract ...... xvii
CHAPTER 1 INTRODUCTION AND BACKGROUND……………………………………..1
1.1 Introduction……………………………………………………………………...……….1
1.1.2 History………………………………………………………………………………1
1.1.3 Neurotrophin synthesis…………………………………………………………….3
1.1.4 Neurotrophin receptors……………………………………..……………………. 4
1.1.5 BDNF is unique among neurotrophins………………………...…………………5
1.1.5.1 BDNF regulation…………………………………………………………6
1.1.5.2 BDNF in neural disease and inflammation………….….……………...8
1.1.5.3 BDNF in the gut………………………………………...………….…….9
1.1.5.3.a BDNF in normal gut……………………………………….…..9
1.1.5.3.b BDNF in diseased gut……………….………………...….…..11
iv
1.2 Gastrointestinal tract overview……………………….…………………………..12
1.2.1 Gut anatomy………………………………………………………………13
1.2.2 Cells of the epithelium……………………………………………………14
1.2.3 Enteric nervous system (ENS)………………………………………….14
1.2.3.1 Classification of ENS neurons……………………….………15
1.2.3.1a Morphological and Chemical coding……………….………15
1.2.3.1b Electrophysiological classification………………………….16
1.2.3.1c Functional classification………………………………………16
1.2.4 Interstitial cells of Cajal (ICC)…………………………………………17
1.2.5 Smooth muscle cells………………………………………………………18
1.2.6 Peristalsis…………………………………………………………………19
1.2.7 Smooth muscle contaction………………………………………………19
1.2.7a Contraction in circular smooth muscle cells………………….20
1.2.7b Longitudinal Smooth Muscle Contraction…….………………20
SIGNIFICANCE…………………………………………………………..……………………22
Hypothesis and specific aims………………………………………….…….……………….23
CHPTER 2 MATERIALS AND METHODS…………………………….…………………25
2.1 Materials…………………………………………………………….………………25
2.2 Methods…………………………………………………………….……………….26
2.2.1Tissue collection……………………………………….…………………..26
2.2.2 Preparation of dispersed intestinal smooth muscle cells………………26
2.2.3 Preparation of cultured intestinal smooth muscle cells……………….27
2.2.4 Preparation of muscle strips……………………………………………28
v
2.2.4.1 Experimental design and dataanalysis for tension
experiments………………………………………………...29
2.2.5 Histology and immunohistochemistry………………………………….30
2.2.6 Protein extraction……………………………………………………….30
2.2.7 Western immonoblotting………………………………………………..31
2.2.8 In-Cell western Assay (ICW Assay) for BDNF protein detection……..34
2.2.9 Enzyme-linked immunosorbent assay (ELISA)………………………..35
2.2.10 RT-PCR………………………………………………………………..36
2.2.11 Radioligand binding assay……………………………………………37
CHAPTER 3 RESULTS……………………………………………………………………...41
3.1 Localization of BDNF in intestinal smooth muscle layers……….………………41
3.1.1 BDNF Immunohistochemistry………….…………………………….….41
3.1.2 Western blot analysis of BDNF…………………………………………41
3.1.3 qRT-PCR measurement of BDNF gene expression…………………....42
3.2 Modulators of BDNF in Longitudinal Smooth Muscle Cells (SMCs)………….51
3.2.1 Effect of PACAP-38 on BDNF Expression in Primary longitudinal
muscle cells……………………………………………………………….51
3.2.2 Effect of substance P (SP) on BDNF Expression in Primary longitudinal
muscle cells……………………………………………………………….52
3.3 Longitudinal Smooth Muscle Cells Secrete BDNF ……………………..………..61
3.3.1 Longitudinal SMCs Constitutively Secrete BDNF……………………..61
3.3.2 Stimulation of Longitudinal SMCs with PACAP and SP……………..61
vi
3.3.2.1 The effect of PACAP on BDNF secretion in longitudinal
SMCs…………………………………………………………………………….62
3.3.2.2 The effect of SP on BDNF secretion in longitudinal SMCs...62
3.4 Role of Calcium (Ca+2) in the Effect of SP on BDNF in Longitudinal SMCs….72
3.4.1 SP-induced BDNF protein expression proceeds through intracellular
Ca+2 elevation……..……………………………………...………………72
3.4.2 Intracellular Ca+2 Elevation is Essential for SP-induced BDNF
Secretion…………………………………………………………………72
3.4.3 Effect of SP on BDNF mRNA expression……………………………..73
3.5 The role of BDNF in agonists- induced contraction of rabbit longitudinal muscle
strips……………………………………………………………………………… 82
3.5.1 Carbachol Induces Concentration-Dependnet Contraction ……….….82
3.5.2 Effect of BDNF on Basal Tone…………………………………………...82
3.5.3 Effect of BDNF on peak contraction induced by Carbachol………….82
3.5.4 Effects of BDNF on contraction of LM strips induced by SP…………83
3.6 Effect of TrkB inhibition on BDNF enhancement of CCh-induced contraction.94
3.6.1 Effect of TrkB inhibition on CCh peak contraction…………………...94
3.6.2 Effect of TrkB inhibition on BDNF enhanced CCh-induced
contraction…………………………………………………………….94
3.6.3 Effect of TrkB activation on carbachol peak contraction………….. 94
3.7 The signaling pathways involved in the effect of BDNF on carbachol-induced
contraction………………………………………………………………………100
3.7.1 Effect of MAPK inhibition………………………………………………..…..100
vii
3.7.1a MAPK effect on basal activity……………………………………...…100
3.7.1b MAPK effect on CCh peak contraction………………………………101
3.7.1c MAPK effect on BDNF-enhanced cholinergic contraction…………101
3.7.2 Effect of PLC-γ inhibition…………………………………………………….108
3.7.2a Effect on basal tone…………………………………………………..108
3.7.2b Effect of PLC-γ on CCh-induced peak contraction…………………108
3.7.2c Effect of PLC-γ on BDNF-enhanced cholinergic contraction……...108
3.7.3 Effect of AKT inhibition…………..…………………………………………….109
CHAPTER 4 Discussion………………….………………………………...………………..118
4.1 Localization of BDNF in intestinal muscle tissues………………………………118
4.2 BDNF Secretion……………………………………………….….………………. 119
4.3 BDNF Modulation in Longitudinal SMCs………………………………………119
4.3.1 Regulation of BDNF protein in intestinal longitudinal SMCs culture.120
4.3.2 Induction of BDNF release in intestinal longitudinal SMCs cultures.122
4.4 Effect of BDNF on longitudinal SMCs contraction induced by carbachol (CCh)
and SP……………………………………………………………………………..125
4.4.1 Effect of BDNF on CCh peak contraction………………..…………... 125
4.4.2 The signaling pathways involved in BDNF effect on contraction induced
by CCh…………………………………………………...……………...127
4.5 Proposed model for BDNF in longitudinal SMCs…………………..…………...130
List of References………………………………………………………………….…………..133
Vita……………………………………………………………………………………………..143
viii
LIST OF TABLES
Table 1. Real-time and RT-PCR primer sequences………………...……………...……….32
Table 2. Primary antibodies………………………………………....…………………....….39
ix
LIST OF FIGURES
Figure 1. Selective expression of BDNF in longitudinal muscle
layer……………………………….…………………………………….43
Figure 2. Primary cultures of rabbit intestinal SMCs showing selective
BDNF staining………………………………………….…………...….45
Figure 3. BDNF expression is more in the longitudinal muscle than the
circular muscle layer……………………..………………….…………47
Figure 4. Quantitative real-time polymerase chain reaction (qRT-PCR) was
used to measure mRNA levels of BDNF in longitudinal versus
circular intestinal muscle layer………………...……………………..49
Figure 5. 24 hrs PACAP induces upregulation of BDNF protein……………..53
Figure 6. PACAP induces upregulation of BDNF protein content in SMC
after 48 h treatment…….………………………....……………………55
Figure 7. SP induced upregulation of BDNF protein content in SMC after
24 h treatment…………………………….……………….……….….57
Figure 8. SP induced upregulation of BDNF protein content in SMC
following 48 hrs treatment………………..……………………………59
Figure 9 BDNF Release from cultured intestinal smooth muscle cells by
PACAP……………………………………………………………..……64
x
Figure 10. BDNF Release from cultured intestinal smooth muscle cells by 48 hrs
treatment with PACAP………………………………………….……..66
Figure 11. BDNF release from cultured intestinal smooth muscle cells
(24 hrs SP stimulation)……………...………………………………….68
Figure 12. BDNF Release from cultured intestinal smooth muscle cells (48 hrs
SP stimulation)………………………………………….….…...………70
Figure 13. SP-induced BDNF expression in intestinal smooth muscle cells (SMC)
2+ is dependent on intracellular Ca elevation determined by standard
Western blot………………………….……………………..………...…74
Figure 14. SP-induced BDNF expression in intestinal smooth muscle cells
2+ (SMCs) is dependent on intracellular Ca elevation determined by in
cell
western…………………………………………………….…………….76
Figure 15. BAPTA-AM inhibits SP-induced BDNF secretion in cultured
intestinal smooth muscle cells. ……………………....………………...78
Figure 16. Induction of BDNF mRNA by SP is blocked by chelating intracellular
2+ Ca in cultured intestinal smoothmuscle…….………..……………...80
Figure 17. Control contractile response to carbachol……….………………...... 84
Figure 18. Effect of BDNF on Basal Tone……………………….…….………… 86
Figure 19. Contractions of Repeated Measurements………………...…………..88
Figure 20. Effect of BDNF on CCh-induced contraction...... 90
Figure 21. Effect of BDNF on intestinal LM strips contraction induced by SP..92
xi
Figure 22 Role of TrkB in BDNF mediated enhancement of intestinal LM
contraction induced by CCh. ………………………………...……….96
Figure 23. TrkB activation by selective agonists enhances the contraction
induced by CCh……………………………………………..………….98
Figure 24. Effect of ERK1/2 inhibition of basal tone……………...... 102
Figure 25. Effect of ERK1/2 inhibition of BDNF–enhanced CCh-induced
contraction…………………………………………………………….104
Figure 26. ERK1/2 phosphorylation in rabbit LM strips ..……………………106
Figure 27. Effect of U73122 inhibition on Basal Tone…………………………110
Figure 28. Effect of PLC-γ inhibition on BDNF-enhanced CCh-induced
contraction………..……………………………………………………112
Figure 29. BDNF activates PLC γ in rabbit LM…………………………...……114
Figure 30. Effect of AKT inhibition on BDNF-enhanced CCh-induced
contraction………..……………………………………………………116
Figure 31. Schematic model of BDNF interactions in intestinal longitudinal
SMCs………………………….………………………………………..131
xii
List of Abbreviations
BDNF………………………………………….…………..Brain-derived neurotrophic factor
NGF……………………………………………………………...………….Nerve growth factor
NT……………………………………………………...…………………………..Neurotrophin
TrkB…………………………………………………………… tropomysin-related kinases B
P75NTR…………………………………………………………… P75 neurotrophin receptor
PC…………………………………………………………………………… protein convertases
PACAP…………………..………………...Pituitary adenylate cyclase-activating polypeptide
SP ……………………………………………………………………………………...Sbstance P
ER ………………………………………………………………………..endoplasmic reticulum
SR ………………………………………………………………………. sarcoplasmic reticulum
TGN………………………………………………………………………... trans-Golgi network
CREB……………………………………………… cAMP response element-binding protein
DCV………………………….………………………………………………. dense core vesicles
IBD ………………………………………………..…………..the inflammatory bowel disease
UC ……………………………………………………………………………….ulcerative colitis
CD ………………………………………………………………………………...crohn’s disease
ENS…………………………………………………………………… Enteric nervous system
IPAN……………………………………………………… intrinsic primary afferent neurons
5-HT…………………………………………………………………………………...Serotonin
xiii
AC…………………………………………………………………………….Adenylate cyclase
ACh………………………………………………………………………………..Acetylcholine
CCh……………………………………………………………………………………Carbachol
BAPTA…………………………1,2-bis(o-aminophenoxy)ethane-N,N,N',N'-tetraacetic acid bp………………………………………………………….…………………………….base pair
CaM………………………………………………………………………………….Calmodulin
CaMKII……………………………………………………..Calmodulin-dependent kinase II cAMP………………………………………………………...Cyclic adenosine monophosphate cDNA…………………………………………………...Complementary deoxyribonucleic acid cGMP………………………………………………………...Cyclic guanosine monophosphate
CGRP………………………………………………………...…Calcitonin gene related peptide
CT……………………………………………….………………………………Cycle threshold
DMEM…………………………………………………….Dulbecco's Modified Eagle Medium
EGTA…………………………………………………………...Ethylene glycol tetraacetic acid
GAPDH………………………………………...Glyceraldehyde 3-phosphate dehydrogenase
GI ……………………………………………………………………………….Gastrointestinal hr…………………………………………………………………………………………….Hour
HEPES……………………....………..N-2-hydroxyethylpiperazine-N‟ 2-ethanesulfonic Acid
SMB ……………………………………………………………………...Smooth Muscle Buffer
FBS ………………………………………………….…………………... Fetal bovine serum
ELISA………………………………………………… Enzyme-linked immuno sorbent assay
ANOVA……………………………………………………………………. analysis of variance
PBS………………………………………………………………….. Phosphate buffered saline
xiv
ICW……………………………………………………………………………...IN Cell Western
SMC………………………………………………………………………... Smooth Muscle Cell
LM…………………………………………………………………………. Longitudinal Muscle
CICR……………………………………………….. Calcium Influx Induced Calcium Release
NMDA …………………………………………………………………….N-methyl-D-aspartate
ICC……………………………………………………………………...Interstitila cells of cajal
ICC-DMP……………………………………………………………Deep muscular plexus ICC
ICC-IM……………………………………………………...……………….Intramuscular ICC
ICC-MY……………………………………………….………………………….Myenteric ICC
IP3…………………………………………….…………………………...Inositol trisphosphate
PIP2 …………………………………………………….Phosphatidylinositol 4,5-bisphosphate
DAG……………………………………………………………………………… diacyl glycerol
MLC………………………………………………………………………….Myosin light chain
MLCK………………………………………………………………...Myosin light chain kinase
MLCP…………………………………………………………..Myosin light chain phosphatase mRNA…………………………………………………………….Messenger Ribonucleic acid
NKA……………………………………………………………………………….Neurokinin A
NO………………………..…………………………………………………………...Nitric oxide
NOS………………………………………………………………………..Nitric oxide synthase
PCR…………………………………………………………………..Polymerase chain reaction
PI3K………………………………………………………………….Phosphoinositide 3-kinase
PKA…………………………………………………………………………….Protein kinase A
PLA2…………………………………………………………………………...Phopholipase A2
xv
PLC…………………………………………………………………………….Phospholipase C
MAPK……………………………………………………… Mitogen-activated protein kinases
ERK …………………………………………………… Extracellular signal-regulated kinases qRT-PCR………………………………………………...………………………Real time-PCR
SDS-PAGE……………………..Sodium dodecyl sulfate polyacrylamide gel electrophoresis
SEM…………...…………………………………………………….Standard error of the mean
TBS-T………………….……………………………………….Tris-Buffered Saline Tween-20
VIP……………………………………………………..…………Vasoactive intestinal peptide
VPAC2………………………………………………..Vasoactive pituitary adenylate cyclase 2
xvi
Abstract
CHARACTERIZATION OF THE NEUROTROPHIC FACTOR BRAIN DERIVED
NEUROTROPHIC FACTOR (BDNF) IN INTESTINAL SMOOTH MUSCLE CELLS
By Mohammad A. Al Qudah, Ph.D.
A thesis submitted in partial fulfillment of the requirements for the degree of Doctor of
Philosophy at Virginia Commonwealth University. Virginia Commonwealth University, 2013
Major Director: John R. Grider
Professor, Department of Physiology
Brain-derived neurotrophic factor (BDNF) belongs to the neurotrophin family of secreted proteins, which include in addition to BDNF, nerve growth factor (NGF) and neurotrophin 3-6
(NT-3-6). BDNF mediates its functions by activating two cell surface receptors, pan- neurotrophin receptor (P75NTR) and tropomyosin-related kinase B (TrkB) and their downstream intracellular cascades. BDNF is best known for its role in neuronal survival, regulation of neuronal differentiation, migration and activity-dependent synaptic plasticity. However, BDNF is widely expressed in non-neuronal tissues as well. The localization and the function of BDNF in intestinal smooth muscle cells (SMCs) are not well defined. Thus, the main purpose of the present study was the identification and characterization of BDNF in intestinal SMCs. Using
biochemical and molecular techniques, we have demonstrated in this study that BDNF is synthesized and released in rabbit intestinal longitudinal SMCs cultures. Furthermore, gut neuropeptides, Pituitary Adenylate Cyclase Activating Peptide (PACAP) and substance P (SP) increased BDNF expression and release in SMCs cultures after 24 hrs and 48 hrs incubation. We have also shown that intracellular Ca2+ levels are essential for SP stimulation of BDNF expression and secretion. Lastly, we have demonstrated that exogenous BDNF enhanced carbachol (CCh)-induced contraction of isolated longitudinal muscle strips, and this was inhibited by preincubation with TrkB inhibitor K252a and PLC inhibitor U73122 sugesting that
BDNF sensitize longitudinal SMCs to CCh by activating PLC pathway, which is normally absent in those muscle cells. These results provide new insight into the mechanisms of neurotrophin
(BDNF) modulation of gut function, which may lead to new therapeutic avenues for treatment of gastrointestinal disorders, and explain some of the pathological changes associated with inflammation such as hypercontractility associated with gut infection or IBD.
xviii
CHAPTER 1
INTRODUCTION AND BACKGGOUND
1.1 Introduction
Neurotrophins are a family of closely related dimeric peptides that were initially
identified as neuronal survival factors secreted from target tissues. To date, they are
implicated in a myriad of functions in the central and peripheral nervous systems,
including regulation of neuronal differentiation, migration and activity-dependent
synaptic plasticity. Four members of the mammalian neurotrophin family have been
identified; nerve growth factor (NGF), brain derived neurotrophic factor (BDNF),
neurotrophin-3 (NT-3) and neurotrophin-4/5 (NT-4/5). These members share a number of
structural and chemical properties, including more than 50% sequence homology in the
primary sequence, approximately similar molecular weights, three disulfide bonds that
form a cysteine knot and isoelectric points ranging from 9- 10 [1-3].
1.1.2 History
NGF is the first-discovered member of the neurotrophins family [4]. Rita Levi-
Montalcini together with Stanley Cohen received the noble prize in 1986 for the discovery and isolation of NGF, which was identified as a very powerful growth factor for sensory and sympathetic ganglia [5]. To-date, NGF is essential for the functional integrity of the cholinergic
1
neurons in the central nervous system and for the development and maintenance of the sensory nerves of the peripheral nervous system [5]. Moreover, NGF controls neurotransmitter and neuropeptide synthesis and release in both the central and peripheral neurons [6]. In addition to the pivotal role of NGF in the nervous system, there is a growing body of evidence implicating
NGF and other neurotrophins family members in many other body organs. For example, NGF and its receptor have been identified in cell subpopulations of primary and secondary lymphoid organs and have assigned different functions in regulating immune cells and involved immune pathologies [7].
BDNF is the second member of neurotrophin family to be discovered after NFG by the work of Yves-Alain Barde in 1982 [8]. The invention of the polymerase chain reaction (PCR) assay made it possible to clone other substances closely related to NGF with distinct albeit overlapping effects on neuronal survival. The extremely low abundance of those relatives hindered the researcher's ability to purify enough substance for amino acids sequencing. With the heroic effort of Brade and coworkers a distinct protein was purified from pig brain and was shown to promote the survival of subpopulations of neurons different from that supported by
NGF [9]. They named the novel substance, brain derived neurotrophic factor (BDNF). BDNF protein has been extensively studied and well characterized. BDNF has a complex gene structure with four 5’ untranslated exons (I–IV) that are associated with unique promoters and one common 3' exon that encodes the mature BDNF protein. The alternate splicing of these exons with the use of two separate polyadenylation sites, can generate at least eighteen unique BDNF transcripts [10]. The complex gene structure of BDNF accounts for region-specific basal and stimulus-evoked expression of BDNF protein during development and postnatal life [11]. BDNF protein has been implicated in many physiological and pathophysiological aspects of central and
2 peripheral nervous system. It has been shown to be essential for neuronal development, differentiation, maturation and survival. Moreover BDNF plays a pivotal role in axonal outgrowth, synaptic plasticity and memory formation [12].
Based on sequence homology and functional speculations two other mammalian neurotrophin members have been identified. Neurotrophin-3 was purified and cloned in 1990 by the work of Maisonpierre et al, two years later neurotrophin-4 was described by Hallbook and coworkers[9]. Despite the close structural similarities between neurotrophin family members, each neurotrophin has a distinct profile of functions on subpopulations of neurons in the peripheral and central nervous system. NT-3 has a direct effect on proliferation, survival, or differentiation of hippocampal progenitor cells in vivo. Moreover, it is involved in the mechanism of antidepressants at least through its activation of TrkB [13]. On the other hand,
NT-4/5 and BDNF share the same receptor (TrkB) but they exhibit distinct distribution and functions during development [14]. There are two additional neurotrophin family members that are identified, neurotrophin 6 in the platyfish Xiphophorus maculatum and neurotrophin 7 in the zebrafish and the carp [15]. So far no mammalian orthologs of these NTs have been identified.
1.1.3 Neurotrophin synthesis
All neurotrophins are synthesized as pre-pro-neurotrophins, which are subsequently processed and then secreted as mature proteins. The pre-sequence serves as a signal peptide to direct the nascent neurotrophin synthesis to the rough endoplasmic reticulum (ER) and to sequester the polypeptide chain into the (ER). Once the peptide is sequestered in the ER, the signal peptide is directly cleaved off. At this point the resulting pro-neurotrophins can form non- covalently associated homodimers and to a lesser extent heterodimers in the ER. Here pro-
3 neurotrophins can undergo additional post-translational modifications on their way through the
Golgi apparatus and the trans-Golgi network (TGN). These include, N-linked glycosylation in the pro-domain, sulfatation of these N-linked oligosaccharides and cleaving of the pro-domain to yield the mature NTs The TGN is an important sorting location for intracellular neurotrophins, where two distinct types of secretory vesicles are generated and filled with neurotrophins based on the mechanism of their secretion. The two main mechanisms of neurotrophin secretion are the constitutive and the regulated pathways. In the constitutive pathway of secretion, neurotrophins are packed in small diameter granules (50-100 nm) and are continuously released in a Ca+2 independent fashion in the absence of any triggering stimulus. In contrast, vesicles generated in the regulated pathway are larger (100-300 nm), bud from the TGN, and fuse with plasma membrane only in a Ca+2 dependent manner in response to a triggering event [16].
It is noteworthy that conversion of pro-NT to mature NT is not a prerequisite for NT secretion. It has been shown that pro-NT is secreted from cell lines overexpressing NT [17] and can be converted to its mature form extracellulary by the action of plasmin and matrix metalloproteases. Interstingly, pro-NTs are biologically active, they bind efficiently to
P75NTR receptor and mediate opposing effects to those mediated by mature neurotrophins.
These observations add another layer of regulation to neurotrophin function.
1.1.4 Neurotrophin receptors
Neurotrophins perform their physiological functions by binding to two distinct classes of cell surface receptors. The first class includes the three members of the tropomysin-related kinases (Trk), a subfamily of receptor tyrosine kinase. The Trk receptor has three domains; an extracellular domain, a single transmembrane domain and an intracellular domain that contains
4 the catalytic tyrosine kinase domain. Trk receptors are only activated by the mature neurotrophins where each neurotrophin family member binds specifically with one Trk receptor.
NGF interacts with TrkA, BDNF and NT-4 interact with TrkB, and NT-3 interacts with TrkC.
NT-3 binds to TrkA and TrkB as well, but with less affinity. Neurotrophin binding to their cognate receptor induces receptor dimerization that results in kinase activation, subsequent receptor autophosphorylation on multiple tyrosine residues creates specific binding sites for intracellular adaptor proteins that are intermediates in intracellular signaling cascades. and the major pathways resulting from this activation are Ras, Rac, PI3-kinase, and PLCˠ1 and their downstream signaling cascades. Activation of Ras promotes the normal neuronal differentiation and survival through stimulation of mitogen-activated protein (MAP) kinase cascades. PI3- kinase activates Akt, which accounts for many neuronal functions such as cell survival and axonal growth. Finally, PLC-ˠ1 activation controls many functions including activity dependent synaptic plasticity [1, 2].
The second class of neurotrophin receptors is the P75 neurotrophin receptor (P75NTR) which belongs to the tumor necrosis superfamily. P75NTR contains an extracellular domain that consists of four cysteine-rich regions, a single transmembrane domain and a death cytoplasmic domain. All neurotrophins interact with P75NTR with the same low affinity. P75NTR influences the affinity and the specificity of neurotrophins to Trk receptors by forming heterodimers with
Trk receptors [1].
1.1.5 BDNF is unique among neurotrophins
Among the four members of neurotrophins, BDNF has shown unique
characteristics and behaviors that made it attractive for researchers and a focus of myriad
topics of investigations. The uniqueness of BDNF comes primarily from its acute or
5
rapid action in enhancing synaptic transmission and plasticity in the adult nervous system
[18, 19]. This function has been intensely investigated and linked with many
physiological and pathological processes, most importantly long-term potentiation and
memory formation [20]. Moreover, the intracellular sorting and secretion of BDNF is
different from that of other neurotrophins. BDNF is sorted to the regulated pathway of
secretion and secreted in an activity-dependent manner whereas NGF and NT4 are
secreted constitutively without activity or stimulus dependent release [10, 16, 21].
1.1.5.1 BDNF regulation
BDNF gene expression is highly regulated, with tight temporal, spatial and stimulus- specific expression. In neurons, BDNF levels are dynamically regulated in adulthood at multiple layers of regulation. These include in part the regulation of BDNF gene expression, BDNF protein processing and intracellular trafficking that function to intricately regulate the expression and release of BDNF.
The use of an alternate 5’ exon spliced of different promoters to a common 3' coding exon that contains the entire open reading frame for the BDNF protein along with presence of two polyadenylation sites, generates multiple BDNF mRNA transcripts [10]. The generation of multiple mRNA transcripts is differentially regulated in a stimulus-specific manner, such as neural activity. For example, Ca2+ influx regulated-BDNF expression is regulated through transactivation of exon III promoter in cortical neurons; the transcription factor CaRF activates transcription of exon III under the control of a calcium response element (CaRE1) [22].
Moreover,CREB phosphorylation, which can be achieved by diverse physiological triggers, also controls axon III transcription [9].
6
In addition to BDNF regulation at the level of mRNA transcription, BDNF level can also be altered at protein level. BDNF is primarily synthesized as preproBDNF in the ER. After cleavage of the signal peptide, the proBDNF is translocated to the Golgi apparatus for sorting to either the constitutive or the regulated secretory vesicles. The BDNF sorting process is highly regulated and dependent on diverse factors that are cell specific. Among these factors are the subcellular localization of protein convertases (PCs) and their pH-optimum, consensus sequences in the pro and mature domains, post translational modifications and sorting receptors [17, 23]. In most cell types BDNF is sorted to the regulated secretory pathway, in the trans-Golgi apparatus
BDNF is less sensitive for cleavage by PCs specific for the constitutive secretion such as furin
[24]. Moreover, a single nucleotide polymorphism in the BDNF gene in which a valine is substituted to methionine in the prodomain of BDNF was found to dramatically reduce the regulated secretion [25]. It was found that targeting signal in the prodomain of BDNF surrounding the met substitution is involved in the efficient sorting to the regulated secretory vesicles. Furthermore, the interaction of specific amino acids encompassing the met substitution in BDNF proregion with the intraluminal domain of the Golgi resident sorting receptor sortilin accounts for the optimal trafficking of BDNF to the regulated pathway of secretion [26]. In addition to the sorting motif in proBDNF, the mature BDNF sequence also influences sorting.
The three dimensional structure of mature BDNF contains a conserved sorting motif consisting of IIe16, Glu18, II105 and Asp106 with their side chains accessible on the protein surface.
BDNF sorting to the regulated secretory pathway involves the electrostatic binding of the acidic residues of this sorting motif with the basic residues of the sorting receptor carboxypeptedaes E
[27].
7
Another layer of BDNF regulation is via altering the conversion of proBDNF to mature
BDNF. ProBDNF can be converted to mature BDNF in the trans- Golgi apparatus by the action of members of the subtilisin-kexin family of endoproteases such as furin, or in the immature secretory vesicles by PCs. In cell specific manner, proBDNF may be converted to mature BDNF extracellularly by plasmin through the tissue plasminogen activator dependent activation of plasminogen [10].
1.1.5.2 BDNF in neural disease and inflammation
With the well established role of BDNF in learning and memory processes, alteration in
BDNF system components have been linked to a group of diseases that share to a varying degree a common clinical symptom of memory loss. These pathological conditions include for example, schizophrenia, depression [28], Alzheimer’s disease [29], Parkinson’s disease [30] and eating disorders [31]. A single nucleotide polymorphism in the BDNF gene in which a valine is substituted for methionine in the prodomain of BDNF was found to dramatically reduce the regulated secretion of BDNF [32]. This genetic disorder has been found to be associated with all the diseases mentioned above [33].
There is a burgeoning body of evidence implicating BDNF in the inflammatory processes in different parts of the body. Numerous reports have shown increased BDNF expression at some stages of the inflammatory process. In airway inflammation, there is up regulation of BDNF mRNA and protein levels [34]. The role of BDNF in mediating different aspects of allergic asthma has been suggested, particularly airway hyperresponsiveness. In this regard, smooth muscle cells appear to be the main target for BDNF in its contribution to airway hyperreactivity
[35, 36]. Nevertheless, BDNF and other neurotrophins may have a role in the regeneration
8 process rather than the induction of inflammation. This might be seen in the reported role of
BDNF in enhancing the healing process in periodontitis [37].
1.1.5.3 BDNF in the gut
The role of neurotrophins in the survival and development of the gastrointestinal tract has been well documented [38]. Here the focus is on the physiological and pathophysiological role of the neurotrophin, brain derived neurotrophic factor, in gut function, which is a topic of current intense investigation. In comparison to the huge wealth of knowledge of the function of BDNF in the central and peripheral nervous system, little is known about BDNF function in the mature gut.
1.1.5.3.a BDNF in normal gut
The presence of BDNF and its receptors in the mature gastrointestinal tract has been demonstrated in several species including human, mouse and rat [39-41]. Despite the importance of these studies especially in supporting a role of BDNF in the adult gut, they were general characterizations and they did not provide detailed localization of BDNF system. A number of studies show that BDNF is present in mucosal cells of endocrine type and that TrkB receptor is present on the same or adjacent mucosal cells, indicating the possibility of autocrine/paracrine manners of action. Few recent studies have focused on the detailed localization of BDNF and its components in the gut and what functions it might have in the mature gut [40, 42]. For example, studies by Grider et al. have identified BDNF in mucosal enteroendocrine cells, intrinsic primary afferent neurons and extrinsic primary afferent neurons. In addition to this localization, they implemented BDNF functionally in the peristaltic reflex. They have shown that endogenous
9
BDNF strengthens peristaltic reflex by acting in autocrine/ paracrine fashion to augment the release of CGRP and 5-HT and thus augmenting the sensory limb of the reflex. Intriguingly, this observation was confirmed using a BDNF+/− heterozygous knockout mice, where the peristaltic reflex and release of serotonin and CGRP during the peristaltic reflex induced by mucosal stimulation were significantly reduced [42]. Moreover, BDNF enhanced the rate of colonic pellet propulsion, while its immunoneutralization reduced the rate of pellet propulsion in rat colon.
These results provided a clear direct evidence of acute BDNF effect on gut function. BDNF is stored in distinct dense core vesicles ( DCV) and it is copacked with other neuropeptide neurotransmitters such as SP and CGRP in the same DCV [43]. In another study conducted by
Grider’s lab, BDNF stimulates substance P release from enteric synaptosomes by acting on presynaptic TrkB receptors [44]. This pattern of BDNF storge provides an understanding of the differential release upon stimulation. In line with these experiments, BDNF produced from mucosal and gut neuronal cells has been shown to enhance the agonist induced calcium signaling and synaptic transmission [40]. Exposing cultured enteric neurons with BDNF alone did not induce any changes in intracellular Ca+2 level. However, BDNF enhanced intracellular
Ca+2 induced by SP and CGRP. These recent research results support previous observations that reported an excitatory role of BDNF in the gut. Consistent with these examples , recombinant methionyl human BDNF (Hr-Met-BDNF) was tried to treat amyotrophic lateral sclerosis and diabetic neuropathy in human subjects and the main side effects were increased gut motility, diarrhea and increased bowel urgency [45, 46]. In rats, exogenous BDNF can stimulate gut myoelectric activities [47]. Presence of BDNF in gut smooth muscle cells has been documented in a few studies [41], but no one has characterized the BDNF system in gut smooth muscle cells.
In addition to the excitatory effect of BDNF on the sensory part of gut motility signaling, it could
10 play an important role in the motor side of the motility reflex. One recent report published since start of this thesis project has also found that BDNF enhances the contraction of intestinal muscle strips from mice in response to contractile SP and CGRP[48].
1.1.5.3.b BDNF in diseased gut
The previous section summarizes the anatomical and physiological observation of BDNF in the gut. In addition to these findings in normal animals, BDNF has been described in different pathological states of the gastrointestinal tract. One of the main diseases that affects the gut is the inflammatory bowel disease (IBD) which comprises two different diseases, ulcerative colitis
(UC) and crohn’s disease (CD). Several studies reported differential changes of neurotrophins profile during the course of the disease in several animal models of IBD and in human CD and
UC tissue samples[49]. BDNF has been implemented in several aspects of colitis including the induction of the disease and the symptoms accompany it, such as pain. One study demonestrated that BDNF immunoreactivty is decreased in UC patients compared to control patients [50]. On contrary, Grider et al showed that BDNF level increased in several cell types in UC animal model. Up regulation of BDNF in colon tissue was time and region- specific with the increase being most in the muscle layer of proximal colon. The increase of BDNF early in UC correlates with the massive neuronal loss that happens early in the disease. The changes of BDNF level suggest that BDNF might regulate neuronal loss and recovery during the time course of UC.
Moreover, BDNF expression in colon was increased in Patients with IBD [51]. Strong evidence implemented BDNF in the inflammation-induced sensory hypersensitivity via modulating the sensitivity of primary afferents [52]. Immunoneutralization of BDNF in UC animal models significantly reduce the hyperalgesia associated with the inflammation [53]. On the other hand, exogenous BDNF significantly enhances the pain related to inflamed colon. BDNF(+/-) mice
11 showed lower sensitivity in the colon of UC model compared to BDNF(+/-) mice [51]. These studies suggest that BDNF may contribute to visceral hypersensitivity in patients with IBD.
In addition to its role in IBD, BDNF has an essential role in energy homeostasis and its deregulation resulted in eating disorders. BDNF heterozygous mice exhibited hyperphagia and develop an age-dependent obesity [54]. The same phenotype was associated with humans with
BDNF haploinsufficiency. Intracerebroventricular BDNF infusion resulted in upregulation of hypothalamic 5-hydroxyindoleacetic acid/serotonin (5-HIAA/5-HT) ratio, associated with severe appetite suppression and weight loss [55]. Moreover, BDNF represent a key molecule that governs the proper communications between the gut and the brain. For example, alteration of the gut microbiota resulted in increased hippocampal BDNF expression [56]. The gut-brain axis provides an explanation how GI tract disordes can influence psychiatric and emotional disorders in which BDNF plays a major role [57].
1.2 Gastrointestinal tract overview
The gastrointestinal (GI) tract is a complex and cooperative network of numerous organs.
It fulfills the functions of ingestion and digestion of food, absorption of nutrients, excretion of waste and host defense. The muscular tissues in the wall of the tract provide the force necessary to transit food from one segment to the next or to stir the contents of the gut for proper digestion, absorption. The muscularis layer of the gut wall contains smooth muscle cells that generate spontaneous electrical rhythmicity and contractions driven by intrinsic pacemakers. This intrinsic electrical activity is generated by neighbouring interstitial cells of cajal (ICC). Multiple layers of regulatory mechanisms working in harmony to produce these highly sophisticated motor
12 patterns. These include, interactions between neurons of enteric nervous system, interstitial cells, and smooth muscle. Hormonal influences and paracrine factors modulate motor activities during normal responses [58].
1.2.1 Gut anatomy
The gut wall is composed of four layers that have structural and functional variations along the length of the alimentary canal. The innermost layer is the mucosa which is made up of three layers, the epithelium, the lamina propria and the muscularis mucosa. The mucosa is responsible for the terminal digestion of the ingested material via secreted brush border enzymes and for conveying the absorbed nutrients. Outward radially to the mucosa is the submucosa, which is composed of connective tissue, lymphatics, blood vessels and nerve tissues. This layer has the submucosal enteric plexus which are also neurons from the autonomic nervous system.
The third layer is the muscularis propria, which composed of an inner thick, circular smooth muscle and outer thin, longitudinal muscle cell layers. The orientation of the long axis of the muscle cells relative to the lumen gives these layers their names. The myenteric nerve plexus separates the circular from the longitudinal muscle layers and controls their muscular activity.
The outermost layer of the gut is the serous membrane; the serosa is composed of connective tissue that wraps up the gut tube and protects it from friction with other organs.
The cellular identity and characteristics vary between of each layer of the GI tract. The main cell types in each layer are discussed here, with emphasis on the muscularis propria and the enteric nervous system, which are responsible for the coordinated contractile movements of the gut.
13
1.2.2 Cells of the epithelium
The GI tract contains a complex, rapidly proliferating and continuously differentiating epithelium. The epithelium is distinctly different in various regions of the tract. Several cell types contribute to the epithelium, including cells devoted to secretion, production of hormones and absorption. In the intestine for example, the epithelium arranged in a structural and functional units called the crypts and villi. The stem cells in the crypts are the source of the major terminally differentiated cell types, the absorptive enterocyte, the mucus- secreting goblet cell, enteroendocrine cell, and paneth cells. In addition to these main cell types, the epithelium is rich in immune and lymphatic cells that make an essential defense barrier against most pathogens
[59].
1.2.3 Enteric nervous system (ENS)
The ENS is the second largest accumulation of neuronal cells in the body, second to the brain. The nerve cells of the ENS have cell bodies positioned in two ganglionated plexuses. The submucous plexus is located between the circular smooth muscle layer and the connective tissues of the innermost submucosal layer. The myenteric plexus lies between the inner circular smooth muscle and the outer longitudinal smooth muscle layers throughout the alimentary tract [60]. The
ENS has several distinct characteristics that enable it to regulate gastrointestinal functions, these include, the plurichemical neurotransmission profiles, i.e. different neurotransmitters coding with co-existence of transmitters, the axonal projections in oral or anal directions, the full repertoire of synaptic transmission, i.e. fast and slow excitatory and inhibitory potentials and the pronounced modulation by non-neuronal mediators [61].
14
1.2.3.1 Classification of ENS neurons
Neurons of the ENS can be classified according to morphological, chemical coding, electrical and functional criterion. No one classification is sufficient to describe a specific neuron. But one neuron should be described using different or all the measures of classification.
1.2.3.1a Morphological and Chemical coding
Morphologically, enteric neurons are divided on the basis of the different shapes and lengths of their dendrites into Dogiel type I to type VII and giant neurons [62]. Type I neurons have a single axon and short lamellar dendrites, whereas type II neurons have multiple long processes arising from a large smooth cell body [63]. Dogiel type I neurons are characterized by a number of electrophysiological and chemical features. In guinea pig, these neurons function as motor and interneurons and they have S electrophysiological properties. On the other hand,
Dogiel type II neurons are located both in the myentric and submucous plexus. At least in the guinea-pig small intestine, type II neurons have the electrophysiological characteristics of AH neurons and many of these neurons function as primary afferents [64]. Types III to VII are variously described in different species and regions [65]. According to chemical coding ENS neurons usually express a combination of different neurotransmitters, such as acetylcholine, tachykinins, nitric oxide synthesis, pituitary adynylate cyclase-activating peptide and vasoactive intestinal polypeptide. The chemical identity of a neuron depends of the function of that neuron, and can identify a neuron with specific morphology or a specific function. For example, excitatory motor neurons are immunoreactive for both the synthesizing enzyme for ACh (choline acetyltransferase) and for tachykinins while the inhibitory motor neurons are immunoreactive for
VIP, PACAP and nitric oxide synthase (NOS) [62, 66].
15
1.2.3.1b Electrophysiological classification
Based on electrical behavior of neurons of the ENS two types of neurons can be identified, synaptic (S) and afterhyperpolarization neurons (AH). Synaptic type neurons are usually of Dogiel type I neurons, while the afterhyperpolarization type are Dogiel type II. S/type
I neurons are characterized by having relative low resting membrane potential, higher input resistance, repetitive spike discharge, no prolonged hyperpolarizing afterpotentials and sensitivity of their somal spikes to tetrodotoxin. On the other hand, AH/ type II neurons are distinguished by their high resting membrane potential, lower input resistance than S/type I cells, having one or two spike discharge, prolonged afterhyperpolarizing potentials, and tetrodotoxin- resistant action potentials [67].
1.2.3.1c Functional classification
Finally, ENS neurons are classified functionally into motor neurons, interneurons and sensory neurons [68, 69]. Motor neurons are S/type I neurons. They are subdivided into muscle motor neurons, secretomotor neurons and neurons innervating entero-endocrine cells. In this category, muscle motor neurons innervate the circular and the longitudinal muscle layers and the muscularis mucosa. Motor neurons to each area include excitatory and inhibitory neurons that release neurotransmitters to induce contraction and relaxation respectively [70]. Interneurons are both synaptic and afterhyperpolarization types and most often Dogiel type I neurons. They are subdivided into ascending and descending interneurons. The ascending interneurons receive fast synaptic inputs and form a chain of ascending excitation and also receive nicotinic and slow synaptic inputs from enteric afferent neurons. They project orally and synapse with the excitatory muscular motor neurons [70]. The descending interneurons are more diverse with mixed
16 chemical coding. They send projections anally to make synapses with the inhibitory motor neurons [66]. Sensory neurons are the third class of functional neurons and, they composed of dense fibers of extrinsic and intrinsic primary afferent neurons (IPANs). The extrinsic afferent neurons have their cell bodies outside the gut wall (vagal and spinal afferents), whereas the
IPANs have their cell bodies within the gut wall. They work together and with enteroendocrine cells to respond to chemical, mechanical stimuli in the gut lumen [70] and to convey these stimuli to other neurons of the ENS. Sensory neurons have a wide range of cell surface receptors that are activated via different molecules such as 5 HT [66].
1.2.4 Interstitial cells of Cajal (ICC)
ICC were first described in 1889 by Cajal, S.R. as primitive neurons. The finding that
ICC express the tyrosine kinase receptor (c-Kit) more than hundred years after their discovery, allows the mesenchyma to be identified as the origin of ICC [71]. In addition to c-kit expression,
ICC are characterized by an important ultrastructural features including numerous mitochondria, abundant intermediate filaments, few ribosomes, rough and smooth endoplasmic reticula, and a very close contacts with nerve varicosities and the formation of many gap junction with each other and with smooth muscle cells [72].
ICC cells are classified depending on their location in the gut wall to the following subtypes, ICC-MY in the myenteric plexus, ICC-IM within the longitudinal and circular muscular layers, ICC-DMP in the deep muscularis plexus, ICC-SMP in the submucosal plexus, and ICC-SS in the subserosal layer [73]. Depending on their locations ICC have been assigned different functions. ICC-MY are proposed to pace the slow wave and to regulate slow wave
17 propagation in the stomach and intestine, ICC-IM and ICC-SMP have been implicated in neurotransmission of neuronal input to muscle cells [74].
1.2.5 Smooth muscle cells
Smooth muscle cells are located in the circular and longitudinal muscle layers and in the muscularis mucosa layer of the GI tract wall. They are responsible for contractility of the gut to perform mixing and propulsion of intaluminal contents, thus enabling efficient digestion of food, progressive absorption of nutrients, and evacuation of residues. These functions are controlled by the inherent properties of gut smooth muscle cells, such as the ability to maintain tone and to undergo phasic contraction as well as their interaction with nerves and ICC [75].
Smooth muscle cells are spindle-shaped with 400 μm length and 5 to 15μm width.
Compared to other muscle types, smooth muscle cells are distinguished by lack of the visible cross-striations. The plasma membrane of smooth muscle cell is characterized by clusters of basket-shaped invaginations called caveolae. These caveolae are separated from each other via electron-dense structures called dense bands [76]. Contractile filaments and dense bodies fill most of the cytoplasm of smooth muscle cell. Dense bodies connect thin and thick filament in a way similar to Z line in skeletal muscle. Smooth muscle cell contains three types of filaments, thin actin filaments, thick myosin filaments and intermediate filaments. Intermediate filaments connect dense bodies in the cytoplasm to dense bands on the cell membrane [75].
18
1.2.6 Peristalsis
Peristalsis is a distinct involuntary movements of the longitudinal and circular muscles that propels ingested food caudally through the GI tract. It was first described by Bayliss and
Starling back in 1899 as a distinct pattern of movement entirely mediated by the ENS in response to a bolus, where contraction is evoked oral to the bolus and a relaxation is evoked distal to the bolus [77]. The peristaltic reflex can be initiated by distention of the gut wall or by mechanical and chemical stimulation of the mucosa. The sensory neurons responsible for the muscle stretch- mediated reflex are extrinsic afferents with their cell bodies in the dorsal root ganglion, and with axonal projections to the enteric neurons within the wall of the intestine. The sensory neurons activated by mucosal stimulation are wholly intrinsic with cell bodies located in the ENS. Both sets of distinct neurons (i.e. stretch and mucosal- activated) converge on the same population of enteric motor neurons mediating the peristaltic reflex [78].
The peristaltic reflex comprises two phases, oral ascending phase during which the circular muscle contracts and the longitudinal muscle relaxes and an aboral descending phase during which the circular muscle relaxes and the longitudinal muscle contracts [79].
The plurichemical coding of enteric motor neurons explains the reciprocal phases of the reflex.
Oral ascending motor neurons are excitatory neurons with Ach, SP and neurokinin A chemical coding. Whereas the caudad descending motor neurons are inhibitory and contain VIP, NO and
PACAP [80].
1.2.7 Smooth muscle contaction
Activation of actin-activated myosin ATPase and thus initiation of actomyosin cross bridge cycle initiates smooth muscle contraction. Phosphorylation of 20-kDa regulatory light chain of myosin II (MLC20) on serine residue at position 19 is essential to start the actomyosin
19 cross bridge cycle and thus muscle contraction. Elevation of free intracellular Ca+2 level induces activation of Ca2+/calmodulin dependent MLCK which phosphorylates MLC20 that leads to muscle contraction. Muscle contraction and MLC20 phosphorylation is maintained even after the decline in intracellular Ca+2 level and MLCK activity. MLC20 is phosphorylated by kinases other than Ca+2 dependent MLCK. Moreover, the phosphorylation level can be maintained by the inhibition of myosin light chain phosphatase (MLCP) which is committed to the dephosphorylation of MLC20. The balance between MLCK and MLCP governs the phosphorylation state of MLC20 and thus muscle tone. Both MLCK and MLCP are under tight regulation in smooth muscle cells [81].
1.2.7a Contraction in circular smooth muscle cells
In circular smooth muscle cells, binding of agonists to cell surface receptors (e.g., muscarinic m3 receptors) induce activation of Gq, which leads to hydrolysis of phosphatidylinositol 4,5-bisphosphate (PIP ) by activating phospholipase C (PLC)-β1. PIP2 2 hydrolysis generates two effector enzymes; the cytoplasmic soluble messenger inositol 1,4,5- trisphosphate (IP3) and the membrane bound diacylglycerol (DAG). IP3 binds to its high affinity receptors IP3 receptors/Ca2+ channels on the sarcoplasmic reticulum (SR) and induces
Ca+2 mobilization which eventually causes muscle contraction [82].
1.2.7b Longitudinal Smooth Muscle Contraction
In both circular and longitudinal muscle cells the rise in cytosolic Ca+2 is the essential physiological process for initial contraction and it takes place in response to ligand-receptor activation. Longitudinal smooth muscle cells induce the increase in intracellular Ca+2 level
20 differently than circular muscle cells. Muscle cells from the longitudinal layer contain a small amount of PIP2 and generate little IP3. In addition their SR does not express IP3 receptors/Ca2+ channels but they have ryanodine receptors [83]. Those ryanodine receptors have a high affinity for Ca+2 and cyclic ADP ribose [84]. Ca+2 influx is a necessary step for Ca+2 mobilization and consequent contraction in longitudinal muscle [82]. Receptors stimulation induce activation of cytoplasmic phospholipase A2 (cPLA2), which in turn liberates arachidonic acid from membrane lipids. Arachidonic acid activates chloride channels that leads to membrane depolarization which opens voltage gated Ca+2 channels. Cytosolic Ca+2 activates ryanodine receptors and induces
Ca+2 release. Moreover, Ca+2 entry activates cyclic ADP ribose formation which further induce more Ca+2 through rayanodine channels [85]. All the signaling pathways converge downstream of intracellular Ca+2 elevation in both muscle layers.
21
SIGNIFICANCE
A great wealth of literature has focused on BDNF in the central and peripheral nervous system. It has been reported to play essential roles in neuronal survival, differentiation, regulation of neurite growth, synaptic plasticity, synaptic strength, neurotransmitters modulation and neuronal phenotypic expression. In addtion to these well established roles in the nervous system, BDNF has a strong current therapeutic potential for several neurological disorders, including amyotrophic lateral sclerosis (ALS), depression, peripheral neuropathy, Parkinson’s disease and Alzheimer’s disease. There is a growing understanding of BDNF function outside the nervous system. For example, BDNF plays an important role in the immune system, cardiovascular system, respiratory system and in the gastrointestinal system. The present project is based on an extension of the published and preliminary data from our lab on the function of
BDNF on the gut. Giving the reported role of BDNF in strengthening the sensory limb of the peristaltic reflex, an understanding of the physiological effect of BDNF on all aspects of the gut motility especially on gut smooth muscle cells will open new avenues for the discovery of new pharmacological agents to treat gut motility disorder and further understanding of the role of
BDNF in pathological processes such as IBD. A therapeutic agent based on BDNF mechanism of action, might induce gut motility physiologically without the deleterious side effects seen with most of the available promotility agents.
22
Hypothesis and specific aims
Based on the established effect of BDNF in the nervous system and results elsewhere in the body (airways and gut) along with preliminary results, the hypothesize is that the neuropeptides released from motor neurons act on smooth muscle cells to release BDNF. BDNF in return acts in paracrine fashion pre-junctionally to further stimulate the release of neuropeptides [86, 87], and acts in autocrine manner to strengthen the effect of neurotransmitters on smooth muscle. Altogether, BDNF action in this regard is to enhance the signaling involved in smooth muscle contraction and relaxation. specific aim 1: To identify the localization of BDNF in intestinal smooth muscle layers and to determine its basal expression and secretion in these muscle layers.
Hypothesis: intestinal smooth muscle cells contribute to gut BDNF pool by being a site of synthesis and release of this neurotrophic factor. specific aim 2: Identify the secretory pathways, mediators, and the receptors that regulate expression and secretion of BDNF from intestinal smooth muscle cells.
Hypothesis: BDNF is synthesized in activity dependent manner in response to extracellular triggers. Gut neuropeptides like SP and PACAP modulate the synthesis and secretion of BDNF in smooth muscle cells.
23
specific aim 3: To determine the potential role of BDNF in smooth muscle contraction.
Hypothesis: BDNF as a modulating factor enhances the agonist-induced contraction. These agonists include the main contractile agonist, acetylcholine and SP.
24
CHPTER 2
MATERIALS AND METHODS
2.1 Materials
Collagenase CLS type II and soybean trypsin inhibitor were obtained from Worthington, reehold, NJ; Western blotting, Dowex AG-1 X 8 resin (100-200 mesh in formate form), chromatography material and protein assay kit, Tris-HCl Ready Gels were obtained from Bio-
3 Rad Laboratories, [ H]Scopolamine were obtained from PerkinElmer Life Sciences (Boston,
MA); methoctramine (muscarinic m2 receptor antagonist) and 4-DAMP (muscarinic m3 receptor antagonist) Sigma-Aldrich, (St. Louis, MO); U73122 (PLC inhibitor), PD98059 (ERK1/2 inhibitor) and LY294002 (Akt inhibitor) were obtained from Enzo Life Sciences, Inc., NY;
Substance P, Bachem Americas, Inc., CA; K252a (TrkB inhibitor) was obtained from
(Calbiochem, Cambridge, MA) BDNF ligand and ELISA kit were obtained from Promega
Corporation, WI; Antibodies: BFNF, GAPDH, TrkB, P75NTR, were obtained from Santa Cruz biotechnology, Santa Cruz, CA; RNAqueousTM kit was obtained from Ambion, Austin, TX;
PCR reagents were obtained from Applied Biosystems, Roche; SuperScriptTM II Reverse
Transcriptase was obtained from Invitrogen, CA; Dulbecco‟s 25 modified Eagle‟s medium
(DMEM) was obtained from Fisher Scientific. All other chemicals were obtained from Sigma,
St. Louis, MO.
25
New Zealand white rabbits (weight: 4-5 lbs) were purchased from RSI Biotechnology,
Clemmons, NC and killed by injection of euthasol (100 mg/kg), as approved by the Institutional
Animal Care and Use Committee of the Virginia Commonwealth University. The animals were housed in the animal facility administered by the Division of Animal Resources, Virginia
Commonwealth University. All procedures were conducted in accordance with the Institutional
Animal Care and Use Committee of the Virginia Commonwealth University.
2.2 Methods:
2.2.1Tissue collection
Rabbits were euthanized by Euthasol injection (100mg/kg body weight) into the ear vein.
The small intestine was dissected out, emptied of contents, and placed on cold smooth muscle buffer (SMB) of the following composition (NaCl 120 mM, KCl 4 mM, KH2PO4 2.6 mM,
CaCl2 2.0 mM, MgCl2 0. 6 mM, HEPES (N-2-hydroxyethylpiperazine-N‟ 2-ethanesulfonic acid) 25 mM, glucose 14 mM, and essential amino mixture 2.1% (pH 7.4) [85-87]. 2-3 cm sections of the intestine were removed and mounted onto glass rod, the fat and mesenteric attachments were removed and the longitudinal muscle was separated from the circular layer by radial abrasion with Kime wipe. Intestinal smooth muscle strips handled in this way were used for digestion to prepare smooth muscle cultures.
2.2.2 Preparation of dispersed intestinal smooth muscle cells
Smooth muscle cells from intestinal longitudinal and circular muscle layers were isolated by sequential enzymatic digestion of muscle strips, filtration, and centrifugation as described previously [88]. Muscle strips were incubated for 15 min at 31°C in 30 ml of smooth muscle
26 buffer containing 0.1% collagenase (type II) and 0.1% soybean trypsin inhibitor. The tissues were continuously gassed with 100% oxygen during the whole isolation process. The partly digested tissues were washed with 100 ml of enzyme-free smooth muscle buffer and reincubated for 10 min to allow spontaneous dispersion of muscle cells. Cells were harvested by filtration through 500 μM Nitex mesh and centrifuged twice at 350 g for 10 min.
2.2.3 Preparation of cultured intestinal smooth muscle cells
The dispersed smooth muscle cells were resuspended in Dulbecco’s Modified Eagle’s
Medium (DMEM) containing penicillin (200 U/ml), streptomycin (200 μg/ml), gentamycin (100
μg/ml), amphotericin B (2.5 μg/ml), and 10% fetal bovine serum (FBS) (DMEM-10). The muscle cells were plated at a concentration of 5 X 105 cells/ml and incubated at 37°C. DMEM-
10 medium was replaced every 3 days for 2–3 wk until confluence was attained. The muscle cells in confluent primary cultures were trypsinized (0.5 mg trypsin/ml) to remove them from the culture dish, replated at a concentration of 2.5 X 105 cells/ml, and cultured under the same conditions. All experiments were done on cells in first and second passage. The purity of the cultures were determined by staining with monoclonal antibody HM19/2 for smooth muscle- specific γ-actin. Cultured smooth muscle cells were starved in serum-free medium (DMEM-0) for expression, release and pharmacological treatment experiments.
Cultured cells were treated with 10 nM and 100 nM of SP or PACAP for 24 hrs and 48 hrs. For 48 hrs treatment, the medium was changed on the seconed day with fresh SP and
PACAP to avoid peptides degradation and unwanted cumulative effects. For control experiments, cultures were treated with DMEM-0. After the incubation periods, the cultured medium supernatents were collected and stored at -80° for subsequent ELISA experiments to
27 detect BDNF release. The treated cultured cells were collected by two different ways first using
Triton X-100-based lysis bufer plus protease and phosphotase inhibitors and stored at -80 C˚ for subsequent Western blotting or by trypsinization and centrifugation for PCR analysis.
2.2.4 Preparation of muscle strips
Intestinal muscle strips designated for tension recording were prepared in the following way; the intestine was removed quickly after sacrificing the animal, and it was cleaned from contents and placed in a warmed (37 °C) oxygenated Krebs solution with the following constituents (in mM): 118 NaCl, 4.75 KCl, 1.19 KH2PO4, 1.2 MgSO4, 2.54 CaCl2, 25 NaHCO3,
11 mM glucose (pH 7.4). Segments of whole wall, 2-3 cm long were freed of fat and mesenteric attachments. The longitudinal layer was peeled off carefully using wet Kime wipes and held in oxygenated Krebs buffer until use for tension recording.
Muscle strips were tied in the direction of the longitudinal muscle layer at both ends with surgical silk- one end to a simple loop for attachment to a glass hook, the other end to a length of silk tied to a brass ring. The strips were then placed in a vertical orientation with the loop secured to a glass hook and the brass ring to a Model FT03C Force Transducer (Grass Technologies,
Quincy, MA). An organ bath (Radnoti, Monrovia, CA) was raised to submerge the strip in 5 or 2 mL of continuously oxygenated and warmed Krebs solution. The bath fluid was changed several times during equilibration and several times after each reagent. Force recordings were amplified by a 15A12 model amplifier (contained within a Model 15LT Amplifier System), relayed to a
PVA-16 Polyview Adaptor (Grass Instruments, Quincy, MA).
28
2.2.4.1 Experimental design and data analysis for tension experiments
The strips were allowed to equilibrate at 1 g tension for at least 1 h before any experiment.
Exposure to test drugs, inhibitors, carbachol and SP was done in organ bath with concentrations determined from literature and in our preliminary studies and are stated in the results section.
Each strip served as control for its own treatment.
Each experiment was conducted in the following manner, two strips were assigned for each experimental condition. Control strips were received a first dose of either CCh or SP for 3 min, then washed a total of 3 times with 15 min interval. A seconed dose of CCh or SP was applied after that and a second cycle of 3 times washing was applied. For BDNF-treated strips,
BDNF was applied following 1 hr equilibration then the strips were exposed to CCh or SP for 3 min.The strips which assigned for antagonist treatments, the antagonist was added to the bath 15 min before CCh and BDNF.
Results were analyzed using the polyview software program, where basal tone was measured as the mean tension during a 3 minute period following at least 30 min of equilibration
(control conditions) or 15 min of inhibitor incubation (basal recording obtained in interval proceeding carbachol or BDNF administration). Peak contraction was measured as peak to peak
(P-P) contraction during the two minute period following agonist administration in grams. These numerical values were compared between treatment conditions and controls. The appropriate stastistical tests (Paired t-tests or ANOVA test) were carried out in GraphPad (GraphPad
Software, La Jolla, CA). A probability of p<0.05 was considered significant. Values are reported as mean ± SEM.
29
2.2.5 Histology and immunohistochemistry
Intestinal sections were immunostained using on-slide technique. Smooth muscle cells were seeded in slide wells and immunostained. Intestinal samples were obtained directly after sacrifice of the animals. 3-5 cm long pieces were cleaned with SMB and placed in 4% paraformaldehyde fixative solution overnight at 4°. Then, the pieces were moved to 30% sucrose in .1 M PBS solution for 1-3 days at 4° and routinely embedded in paraffin. Cross sections (8 mm) were cut and mounted on gelatin-coated microscope slides. The slides were warmed at 37° for 1 hr and permeabilized with 0.3% Triton X-100 in 0.1 M PBS slousion for 20 min. For cultured cells, the slide wells were fixed with 4% paraformaldehyde for 20 min at room tempreasure. Both preparations were incubated for 1 h at room temperature with blocking solution containing 3% normal donkey serum (Jackson ImmunoResearch, West Grove, PA) in PBST (0.3% Triton X-
100 in 0.1 M PBS, pH 7.4). The sections then were incubated with primary antibody diluted in
PBST containing 5% normal donkey serum overnight at 4 °C. For BDNF antibody we used
BDNF antibody from (Santa Cruz, CA) in 1:500 dilution. After rinsing (3 × 10 min with 0.1 mol
L) 1 PBS), the sections were incubated with fluorescence- conjugated species-specific secondary antibody Alexa 594 for 2 h at room temperature. The slides then were thoroughly washed and covered with Citifluor. To evaluate for nonspecific binding, we incubated the control sections as described above but without the primary antibody. Western blot analysis was carried out to test for specificity of the anti body for BDNF.
2.2.6 Protein extraction
Cultured smooth muscle cells were homogenized with solubilization buffer of the following composition, 50 mM Tris-HCL, 150 mM NaCL, 1 mM EDTA, 1% Triton X-100, 100 mM NaF.
30
Protease inhibitor cocktail and phosphatase inhibitor cocktail (100 μg/ml PMSF, 10 μg/ml aprotinin, 10 μg/ml leupeptin, 30 mM sodium fluoride and 3 mM sodium vanadate) were added to this buffer. After sonication for 15 second and centrifugation at 2000 g for 10 min at 4˚C, the protein concentrations in the supernatant was determined using a Dc protein assay kit from Bio-
Rad (a colorimetric assay to detect protein concentration after detergent solubilization based on
Lowry assay).
2.2.7 Western immonoblotting
Equal amounts of proteins were separated by SDS/PAGE electrophoresis using 10% and
15% (w/v) acrylamide resolving gel. The separated proteins were electrophoretically transferred onto a nitrocellulose membrane. The membrane was blocked by incubation with 5% (w/v) non- fat dried milk / TBS-T (tris-buffered saline, pH 7.6 plus 0.1% Tween-20) for 1h at room temperature with gentle shaking. Then the membrane was incubated for 25 hr at 4°C with different primary antibodies diluted in TBS-T 1% (w/v) non-fat dried milk (Table1). After washing with TBS-T (3×5 min), the membrane was incubated with horseradish-peroxidase- conjugated matching secondary antibody (1: 2000) in TBS-T with gentle shaking at room temperature for 1h. After the membrane was washed with TBS-T (3×5 min), the immunoreactive blot was visualized by SuperSignal Femto maximum sensitivity substrate kit.
To ensure equal amount of protein loading, in each blot the same membrane was stripped and re-blotted against a housekeeping protein such as actin or GAPDH Densitometric quantification of protein bands were done using the software FluoroChem 8800. The average bands intensity were normalized to that of the control of the same lane.
31
Table 1. Primary antibodies. Primary antibodies and their catalogue number, company of production, product size and dilution ratio.
32
Table 1: Antibody Catalog # Product size Company Dilusion Species (kDA) name BDNF (N-20) 12112 14 Santa cruz 1:500 Rabbit
BDNF AB1513P 14 Millipore 1:500 Sheep
TrkB (H-181) sc-8316 95-145 Santa cruz 1:1000 Rabbit
PLC- 1249 sc-81 155 kDa. Santa cruz 1:1000 Rabbit
P-PLC-(pY783.27) sc-136186 155 kDA Santa cruz 1:1000 Mouse
P-ERK1/2(137F5) 4695 40/42 kDa Cell signaling 1:1000 Rabbit
AKT 9272S 60 kDa Cell signaling 1:1000 Rabbit
P-AKT (Ser473) 4051 60 kDa Cell signaling 1:1000 Mouse (587F11) Β-actin AC1978 42 Sigma 1:10000 Mouse
GAPDH(6C5) G0110 37 Santa Cruz 1:1000 Mouse
33
2.2.8 In-Cell western Assay (ICW Assay) for BDNF protein detection
ICW assay is a quantitative immunofluorescence assay that is alternative to classical western blotting and ELISA. It was used to examined the intracellular singalling pathways that governs
BDNF synthesis. ICW is conducted in microplates (96- or 384-well format). The technique is composed of the following steps in brief; primary smooth muscle cells were cultured in 96 well plates, treated with SP and/or PACAP or DMEM 0 alone for 24 hrs. The supernatants were aspirated and the cells fixed immediately with Fixing Solution (3.7% formaldehyde in 1X PBS) for 20 minutes at room temperature (RT) without shaking. To permeabilize, the cells were washed five times with 1X PBS containing 0.1% Triton® X-100 for 5 minutes per wash.150 μL of Odyssey® Blocking Buffer was added to each well to block cells for 1.5 hours at room temperature with moderate shaking. 50 μL of Odyssey® Blocking Buffer were added to each well designated as control well and 50 μL of the BDNF primary antibody in Odyssey Blocking
Buffer to the rest of the wells. Incubation with primary antibody was done for 2.5 hours at room temperature or overnight at 4°C with gentle agitation. Plates were washed five times with 1X
PBS + 0.1% Tween® 20 for 5 minutes at RT with gentle shaking. 50 μL of Odyssey secondary antibody were added to each well for 1 hour at room temperature with gentle shaking. The plate was washed five times with 1X PBS + 0.1% Tween® 20 for 5 minutes at room temperature with moderate shaking. ICW provides advantage over traditional western by allowing more accurate normalization of cell number across the whole plate. The simultaneous staining of cells with DRAQ5 and Sapphire700 Stains accounts for the high normalization accuracy. In this technique the wells assigned as control only were incubated with Odyssey secondary while the rest of wells were incubated with Odyssey secondary and DRAQ5 (1:2000) and Sapphire700
34
(1:1000) staines. The plates were scanned with detection in both 700 and 800 nm channels using an Odyssey®.
2.2.9 Enzyme-linked immunosorbent assay (ELISA)
BDNF protein in frozen culture supernatants were measured via a sandwich ELISA using the Promega (Promega Corporation,WI) BDNF Emax immunoassay according to the manufacturer’s directions. Samples were divided into two groups to determine which group yield higher detectable amount of protein. In one group, the samples were first acidified to pH < 3.0 with 1 N HCL for 15 min and then neutralized to 7.6. Samples in the second group were not acidified. The antibody is specific for BDNF with less than 3% cross reactivity with NGF, NT-3 and NT-4. The limit for detection of this kit is 4pg/ml and the range is 4 pg/ml to 500 pg/ml.
Polystyrene ELISA plates were coated with anti-BDNF mAb (1:1000) by adding 100 μl of the antibody to each well and overnight incubation at 4° without shaking. On next day the plate was washed vigorously with TBST and blocked by adding 200 μl of Block & Sample 1X Buffer to each well using a multichannel pipettor and incubated for one hour at room temperature without shaking. 100 μl of BDNF standard or samples was added in duplicate and incubated for two hours at room temperature. The plate was washed five times and 100 μl anti-Human BDNF pAb
(1:500) were added to each well and incubated at room temperature for one hour. After five times washing of the plate with TBST, 100μl of diluted Anti-IgY HRP Conjugate (1:200) were added to each well and the plate incubated for another one hour at room temperature with shaking. Then the plate was washed five times and 100μl of room-temperature TMB One
Solution was added to each well using a multichannel pipettor and incubated for 10 minutes with shaking. 100μl of 1N hydrochloric acid were added to wells in the same order in which substrate was added to stop the reaction. The plate was scanned using a plate reader to the record
35 the absorbance at 450 nm with 30 minutes of stopping the reaction. Concentrations in the samples was calculated from the standard curve
2.2.10 RT-PCR
Total RNA from cultured smooth muscle cells was extracted using
Ultraspec™ RNA isolation kit. To eliminate DNA contamination total RNA was further treated with TURBO DNase in the presence with RNase inhibitor. 1 μg of the total RNA was reversely transcribed by SuperScript™ II containing 50 mM Tris-HCL, 75 mM KCL, 3 mM MgCl2, 10 mM dithiothreitol, .5 mM deoxynucleoside triphosphates, 2.5 μM random hexamers and 200 units of reverse transcriptase in a 20 ul reaction volume. Quantitative real-time PCR was performed for BDNF with a Taqman probe mixed with PCR Master-Mix for 40 cycles (95 C˚ for
15 sec, 60 C˚ for 1 min) on a 7300 real-time PCR system (Applied Biosystems, Foster City, CA,
USA). Quantitative real-time PCR of the same sample was performed for β-actin or GAPDH expression as internal control for normalization. Primers sequences are included in table 2.
Reactions for real time PCR were done in triplicate. Only one PCR product was generated by each primer set. StepOne™ Real-Time PCR System software was used to calculate the fluorescent threshold value. The possibility of primer- dimer formation was excluded by the lack of peak signal in control wells containing water.
Quantification of gene expression was done using the relative qRT-PCR method. The signal of BDNF transcript in a treatment group was related to that of the control group. To calculate the relative expression ratio, delta delta CT values were used. CT value is the cycle number at which the fluorescence generated within a reaction crosses the threshold. In this
36 model, the target gene expression is normalized to the expression of non-regulated housekeeping genes (i.e. the expression of this housekeeping gene is not affected by the treatment) [89, 90].
Delta delta CT method
ΔΔCT = (C − C ) − (C – C ) T, Tag T, HKG Treatment T, Tag T, HKG Control
−ΔΔCT R = 2
Where, HKG is the housekeeping gene and Tag, the evaluated gene.
GAPDH was selected as housekeeping gene . After normalization BDNF mRNA in response to
SP treatment was expressed as fold-change in mRNA expression relative to that obtained from control samples.
2.2.11 Radioligand binding assay
Cultured longitudinal smooth muscle cells were divided into a control group and BDNF- treated group, (10 nM BDNF for 24 hours) and radioligand binding assays were conducted using
3 [ H] scopolamine [91]. Muscle cells were collected at room temperature using PBS having 10
μM EDTA and centrifuged for 10 min at 350 x g. Muscle cells were resuspended in HEPES buffer (pH 7.4) including 1% fetal bovine serum. For total binding, triplicate aliquots (0.5 ml) of cell suspension (106 cells/ml) were incubated for 15 min with 1 nM [3H]scopolamine. For total
M3 or M2 receptor binding the cell aliquots were incubated with 1 nM [3H] scopolamine in the presence of methoctramine or 4-DAMP respectively. For non-specific binding, excess of acetylcholine was added to the aliquots. Unbounded [3H] scopolamine and acetylcholine were washed thoroughly by rapid filtration under reduced pressure through 5-μm polycarbonate
Nucleopore filters followed by washing the filters four times with 3 ml of ice-cold HEPES
37 buffer containing 0.2% bovine serum albumin. To calculate the specific binding the value of non-specific binding was subtracted from that of total binding.
38
Table 2. Real-time and RT-PCR primer sequences. Primers for amplification of different genes from smooth muscle tissue. Β-actin, GAPDH; Glyceraldehyde 3-phosphate dehydrogenase, BDNF; Brain- derived neurotrophic factor.
39
Table 2:
Primer Forward 5’ 3’ Reverse 3’ 5’ Size set (bp)
Β-actin CCCTCCATCGTGCACCGCAA CTCGTCTCGTTTCTGCGCCGT 100
GAPDH GCCTGGAGAAAGCTGCTAAGTATG CCTCGGATGCCTGCTTCA 60
BDNF TATGAGGGTCGGGCGCCACT TCCCGCCCGACATGTCCACT 20
40
CHAPTER 3 RESULTS
3.1 Localization of BDNF in intestinal smooth muscle layers
3.1.1 BDNF Immunohistochemistry
We used rabbit anti-BDNF polyclonal antibody (SC546; rabbit; 1:500; red) to study the immunohistochemical localization of BDNF in the intestine. In normal mice tissue, BDNF was present in different intestinal layers (mucosa, submucosa and the muscular tissue) (Fig. 1).
Interestingly, BDNF staining was more intense in the outer longitudinal muscular layer, whereas the inner circular muscle layer was much less immunostained for BDNF. Similar results were obtained in sections of rabbit and human intestine (data not shown). This suggests that the intestinal longitudinal smooth muscle cells (SMCs) could physiologically contribute to the pool of BDNF in the GI tract.
BDNF localization in longitudinal SMCs was confirmed using rabbit primary SMCs cultures. Specific BDNF staining was detected in cultured longitudinal SMCs cultures stained with BDNF antibody produced in sheep (1:400 dilutions) (Fig.2).
3.1.2 Western blot analysis of BDNF
To further confirm the immunohistological BDNF findings, western blot analysis of
BDNF was done on total protein extracts from both rabbit longitudinal and circular muscle layer.
41
Using both rabbit and sheep polyclonal anti BDNF antibodies, we detected specific immunoreactive bands corresponding to the correct molecular weight of mature BDNF (14 kDA). The expression of BDNF protein was detected in both longitudinal and circular muscle layer (Fig.3A). Comparing the densities of protein bands in the two regions revealed a significantly higher expression of BDNF in longitudinal compared to circular muscle layer
(longitudinal is 2.7-fold higher than circular layer, p< 0.001, n=8) (Fig.3B). These results are consistent with the intense immunostaining of BDNF in the longitudinal muscle layer (Fig1).
Moreover, western blot analysis of cell lysates from primary longitudinal smooth muscle cells (SMCs) demonstrated basal expression of BDNF protein (Fig.5, 6, 7 &8). Another layer of verification of the presence of BDNF in longitudinal SMCs was the detection of BDNF using the high sensitive imaging technique, In Cell Western (Fig. 14).
3.1.3 qRT-PCR measurement of BDNF gene expression
Total RNA isolated from longitudinal and circular muscle layer was converted to cDNA and subjected to amplification with specific primers for BDNF and GAPDH. Quantitative real- time polymerase chain reaction (qRT-PCR) was used to measure RNA levels of BDNF and
GAPDH was used as internal control. Consistent with the protein level detected by western blot
(Fig.2), BDNF mRNA was expressed in both muscle layers and the expression was significantly higher (two fold) in the longitudinal compared to the circular layer, p<0.01, n=5) (Fig.4).
42
Figure 1: Selective expression of BDNF in longitudinal muscle layer.
Immunohistochemical staining of BDNF demonstrated higher levels in longitudinal muscle layer. Middle panel 2; mouse intestine co-stained with antibody to BDNF (SC546; rabbit;1:500; red) and serotonin (Immunostar20079; goat; 1:400; green) (100X magnification). Right panel 3: mouse intestine stained with same BDNF antibody; magnification 200X. Similar results were obtained in sections of rabbit and human intestine (data not shown). No staining was noted in the absence of the primary antibody (Left panel1).
43
Figure 1:
44
Figure 2: Primary cultures of rabbit intestinal SMCs showing selective BDNF staining.
Upper left panel, rabbit SMS stained with Alexa Fluor® 488 Donkey Anti-Sheep antibody alone serves as negative control (200X magnification). Upper right panel, rabbit SMCs stained with
BDNF antibody (sheep; 1:400). Lower panel left and right are the same as upper panel but with higher magnification (400X magnification). Bar 200 μm.
45
Figure 2
46
Figure 3: BDNF expression is more in the longitudinal muscle than the circular muscle layer.
(A) Representative western blot of BDNF protein in rabbit intestine tunica muscularis
(longitudinal (RBL) versus circular(RBC)), β-actin was used as loading control. (B)
Densitometric analysis of the western blot of BDNF. Relative abundance of BDNF compared with β-actin. **P< 0.05.
47
Figure 3:
48
Figure 4: Quantitative real-time polymerase chain reaction (qRT-PCR) was used to measure mRNA levels of BDNF in longitudinal versus circular intestinal muscle layer.
BDNF mRNA expression is higher in longitudinal compared to circular muscle layer. Data were compared based on GAPDH amplification and expressed as fold change (longitudinal 1 versus circular .57 ± .09), P value = 0.01, n=5.
49
Figure 4
50
3.2 Modulators of BDNF in Longitudinal Smooth Muscle Cells (SMCs)
There are many endocrine, paracrine and neurotransmitter agents that might modulate expression and release of BDNF from intestinal smooth muscle cells. I will focus on those agents with known physiological link to BDNF such as Pituitary Adenylate Cyclase Activating Peptide
(PACAP) and sunstance P (SP). PACAP and SP are among the main relaxant and contractile neuropeptides respectively released from neurons that innervate smooth muscle cells. Several reports have documented the strong interplay between those two neuropeptides and BDNF synthesis and release elsewhere in the body [35, 92, 93] however when these studies were begun there was no evidence for BDNF in gut smooth muscle or changes in BDNF levels in response to
SP ro PACAP.
3.2.1 Effect of PACAP-38 on BDNF Expression in Primary longitudinal muscle cells
The effect of PACAP on BDNF protein level in primary smooth muscle cells was evaluated after 24 and 48 hrs incubation. Longitudinal smooth muscle cells were treated with
PACAP-38 (10 & 100 nM) for 24 and 48 hrs. PACAP exists in two forms: the full 38 amino acid form PACAP-38, and a truncated C-terminal form PACAP-27. Since both produce identical effects, the full form PACAP-38 was used. Hereafter, PACAP will be used to indicate PACAP-
38 After treatment, total protein was extracted and western blot analysis for BDNF was performed. Both doses of PACAP significantly up-regulated BDNF protein expression following
24 hrs incubation (Fig. 5A). 10 & 100 nM PACAP almost doubled the BDNF protein content in primary smooth muscle cells but there was no significant difference in the amount of BDNF
51 induced by the two doses ( bands densities of control: 522±38; 10 nM PACAP:1061±77: 100 nM
PACAP: 978± 36 respectively, P< 0.001, n=7 (Fig. 5B)).
PACAP (10 & 100 nM) after 48 hrs incubation increased BDNF protein content (Fig.
6A). Again, PACAP 100 nM did not produce any further significant difference in BDNF content above that induced by 10 nM PACAP. Comparing the densities of protein bands in control,
PACAP 10 and 100 nM demonstrated that PACAP 10 nM for 48 hrs incubation is the optimal dose and time for BDNF up-regulation (Fig. 6B, P< 0.0001, n=6).
3.2.2 Effect of substance P (SP) on BDNF Expression in Primary longitudinal muscle cells
Western blot analysis of primary longitudinal SMC for BDNF revealed baseline existence of BDNF. 24 hrs treatment with (10 & 100 nM) SP significantly augmented the level of BDNF (Fig. 7) (P=0.005, n=5). 10 & 100 nM showed no significant difference in the ability to increase BDNF level after 24hrs incubation, indicating that 10nM SP could be the dose that gives the maximal response.
48 hrs exposure to SP (10&100 nM) demonstrated significantly increased BDNF level in primary SMC (P< 0.0001, n=5) (Fig. 8). As in 24 hrs incubation, SP 10nM gave the best response. Comparing the band densities of 24 and 48 hrs treatments showed no significant difference in BDNF level.
52
Figure 5: 24 hrs PACAP induces upregulation of BDNF protein.
Western blot analysis of BDNF was performed on SMC lysates after 24 hrs treatment with
PACAP 10 & 100 nM. (A) Representative western blot of BDNF (14 kDa) and B-actin (44kDa) in SMS, control versus PACAP-treated cells. (B) Summary graph showing the density of western bands as determined by the densitometry. Data are expressed as mean values ±SEM, n=7.
53
Figure5:
54
Figure 6: PACAP induces upregulation of BDNF protein content in SMC after 48 h treatment.
Western blot analysis of BDNF was performed on SMC lysates after 48 hrs treatment with
PACAP 10 & 100 nM. (A) Representative western blot of BDNF (14 kDa) and B-actin (44kDa) in SMS, control versus PACAP-treated cells. (B) Summary graph showing the density of western bands as determined by the densitometry. Data are expressed as mean values ±SEM, n=6.
55
Figure 6:
56
Figure 7: SP induced upregulation of BDNF protein content in SMC after 24 h treatment.
Western blot analysis of BDNF was performed on SMC lysates after 24 hrs treatment with SP 10
& 100 nM. (A) Representative western blot of BDNF (14 kDa) and B-actin (44kDa) in SMS, control versus SP-treated cells. (B) Summary graph showing the density of western bands as determined by the densitometry. Data are expressed as mean values ±SEM, n=5.
57
Figure 7:
58
Figure 8: SP induced upregulation of BDNF protein content in SMC following 48 hrs treatment.
Western blot analysis of BDNF was performed on SMC lysates after 48 hrs treatment with SP 10
& 100 nM. (A) Representative western blot of BDNF (14 kDa) and B-actin (44kDa) in SMS, control versus SP-treated cells. (B) Summary graph showing the density of western bands as determined by the densitometry. Data are expressed as mean values ±SEM, n=6.
59
Figure 8:
60
3.3 Longitudinal Smooth Muscle Cells Secrete BDNF
3.3.1 Longitudinal SMCs Constitutively Secrete BDNF
To evaluate whether longitudinal SMCs at rest can secrete BDNF, primary SMCs were cultured for 24 and 48 hrs. The BDNF secretion to the supernatants of SMCs was examined using ELISA. We observed a very low constitutive BDNF secretion (in DMEM-0) that was in the lower limit of the ELISA kit detection range (Fig.9, 10, 11&12).
3.3.2 Stimulation of Longitudinal SMCs with PACAP and SP
BDNF is mainly secreted in the regulated pathway of secretion. Extracellular stimulating agent is necessary for BDNF regulated secretion [94, 95]. The regulated secretion of BDNF depends of the generation of second messengers, mainly, Ca+2 and cyclic adenosine monophosphate (cAMP) in other tissues [96, 97]. In order to identify the mediators which regulate BDNF secretion in longitudinal SMCs, we tested the impact of the neuropeptides typically involved in BDNF secretion in neuronal tissues and which have functional roles in intestinal smooth muscle. These neuropeptides tested were PACAP and SP.
Pituitary adenylate cyclase-activating polypeptide (PACAP) belongs to a family of peptides that include vasoactive intestinal peptide (VIP), secretin, glucagon and growth hormone-releasing hormone. PACAP binds to three receptors, PAC1-R, VPAC1-R and VPAC2-
R [98]. PACAP is known to activate several intracellular pathways including the cAMP, cGMP and the Calcium Induced Calcium Release (CICR) pathway [99]. PACAP controls the synthesis and release of BDNF in primary cultures of cortical neurons and astrocytes [92, 100]. In this
61 section, we tested the effect of PACAP on BDNF secretion in primary cultures of longitudinal
SMCs.
3.3.2.1 The effect of PACAP on BDNF secretion in longitudinal SMCs
To study the effect of PACAP on the secretion of BDNF, primary longitudinal SMCs cultures were treated with PACAP (10 & 100 nM) for 24 and 48 hrs. The quantity of BDNF in the supernatants then was determined by commercially available ELISA kit. PACAP (10 & 100 nM) incubation for 24 hrs significantly increase BDNF secretion (P<0.05, n=6) (Fig. 9). 10 nM
PACAP induced the maximal response and there was no further increase in BDNF with PACAP
100 nM. 48 hrs incubation with PACAP (10 & 100 nM) induced significant increase in BDNF release (P<0.05, n=4) (Fig. 10). Comparing the release finding from 24 hrs and 48 hrs PACAP treatment showed that 24 hrs with 10 nM PACAP was the dose and time that induce maximal
BDNF release (15.5 ± 1.4 pg/ml versus 11.9 ± 1.2 pg/ml) (Fig. 9 & 10).
3.3.2.2 The effect of SP on BDNF secretion in longitudinal SMCs
Substance P (SP) is a member of the tachykinin family of neuropeptides. In addition to
SP, this family include, neurokinin A (NKA) and neurokinin B (NKB) which interact with three
GPCRs designated NK1, NK2 or NK3 receptor [101]. In smooth muscle cells SP is capable of activating PLC and the subsequent elevation of intracellular Ca+2.
To test ability of SP to induce BDNF secretion cultured primary longitudinal SMCs were incubated with SP (10 & 100 nM) for 24 and 48 hrs. The cultured medium was then collected and BDNF level was quantified by ELISA. 24 hrs incubation with SP significantly augmented the release of BDNF (Fig. 11), (6.1± .4 pg/ml control to 11.4±1 pg/ml 10 nM SP, P<0.05, n=5).
High dose of SP (100 nM) did not produce any further secretion (Fig. 11). 48 hrs treatment with
62
SP induced significant increase of BDNF secretion but it was lower than that induced by 24 hrs
(Fig.11 &12).
63
Figure 9: BDNF Release from cultured intestinal smooth muscle cells by PACAP
Quantitative determination of BDNF release from cultured intestinal smooth muscle cells using
ELISA. 24 hrs incubation with PACAP 10&100 nM increased BDNF release. Data are mean values ± SEM from at least three animals, asterisks represent significance of at least P<.05.
64
Figure 9:
65
Figure 10: BDNF Release from cultured intestinal smooth muscle cells by 48 hrs treatment with PACAP.
Quantitative determination of BDNF release from cultured intestinal smooth muscle cells using
ELISA. 48 hrs incubation with PACAP 10&100 nM increased BDNF release. DATA are mean values ± SEM from at least three animals, Asterisks represent significance of at least P<.05.
66
Figure 10:
67
Figure 11: BDNF release from cultured intestinal smooth muscle cells (24 hrs SP stimulation)
SP induces BDNF release from cultured SMC. Primary SMC were treated with 10 and 100 nM
SP for 24 h and the cultured medium was subjected to ELISA analysis for BDNF. Data expressed as mean values ± SEM of at least three different experiments.*P<0.05.
68
Figure 11:
69
Figure 12: BDNF Release from cultured intestinal smooth muscle cells (48 hrs SP stimulation)
SP induces BDNF release from cultured SMC. Primary SMC were treated with 10 and 100 nM
SP for 48 h and the cultured medium was subjected to ELISA analysis for BDNF. Data expressed as mean values ± SEM of at least three different experiments. *P<0.05.
70
Figure 12:
71
3.4 Role of Calcium (Ca+2) in the Effect of SP on BDNF in Longitudinal SMCs
3.4.1 SP-induced BDNF protein expression proceeds through intracellular Ca+2 elevation
Since there are many more SP/Ach containing neurons innervating the longitudinal muscle layer that there are PACAP containing neurons, the SP-induced BDNF release was studied further. In order to elucidate the signal transduction pathway involved in SP-induced
BDNF expression, we tested the role of intracellular Ca+2, which is the main second messenger downstream of SP activation of its neurokinin receptors. Western blot analysis with BDNF antibody was demonstrated that blockade of Ca2+ signaling by the addition of 1 µM 1.2-bis-(O- aminophenoxy)-ethane-N,N,N¢,N¢-tetraacetic acid (BAPTA-AM) to chelate intracellular calcium. In primary SMCs cultures treated with SP 10 nM for 24 hrs, BAPTA-AM totally abolished SP-induced BDNF expression (Fig. 13).
The role of Ca+2 in SP-induced BDNF expression was further confirmed by in cell western (ICW) assay (Fig. 14). Addition of 1 µM BAPTA-AM to SMCs cultures treated with SP at 10 nM for 24 hrs completely inhibited the upregulation of BDNF protein induced by SP.
These results demonstrate the importance of intracellular Ca+2 elevation for SP to stimulate
BDNF in rabbit intestinal longitudinal SMCs.
3.4.2 Intracellular Ca+2 Elevation is Essential for SP-induced BDNF Secretion
A hallmark of BDNF regulated secretion is the dependence on increase in intracellular
Ca+2 level. The surge in intracellular Ca+2 level could be due to Ca+2 influx or mobilization from internal stores depending on the cell type. It is worth noting that the increase in intracellular calcium in smooth muscle cells derived from the circular muscle layer is from internal stores whereas in smooth muscle cells derived from longitudinal muscle it is from influx. BAPTA-AM
72 is a high affinity calcium chelator and is capable to eliminate Ca+2 regardless of its source. We used BAPTA-AM to assess the role of Ca+2 in SP-induced BDNF release just as we did above for BDNF expression. Consistent with the previous results, SP (10 nM) for 24 hrs significantly increased BDNF release. Addition of BAPTA-AM to primary SMCs cultures incubated with SP
(10nM) for 24 hrs caused BDNF secretion to return to near its control level (Fig.15).
3.4.3 Effect of SP on BDNF mRNA expression
The effect of SP on BDNF gene expression was evaluated by treating primary SMCs cultures with 10nM BDNF for 24hrs. Quantitative RT-PCR demonstrated that, compared with untreated control, SP at the indicated dose significantly upregulated BDNF mRNA expression by
1.5 times (Fig. 16). Next, we examined the role Ca+2 in SP-induced BDNF mRNA upregulation.
Addition of BAPTA-AM to SMCs treated with SP at 10 nM for 24hrs totally abolished SP- induced BDNF mRNA expression (Fig. 16).
73
Figure 13: SP-induced BDNF expression in intestinal smooth muscle cells (SMC) is
2+ dependent on intracellular Ca elevation determined by standard Western blot.
Upper panel: representative western blot of SMC lysates showing upregulation of BDNF level by 24 h treatment with10 nM SP. 1 µM BAPTA-AM abolished the effect of SP. Lower panel:
Densitometry analysis of western blots for BDNF indicating that SP 10 nM significantly increased BDNF protein level. BAPTA-Am completely abolished the effect of SP on BDNF level. Values represent the mean ± SEM, *P<.05, n=3.
74
Figure 13:
75
Figure 14: SP-induced BDNF expression in intestinal smooth muscle cells (SMCs) is
2+ dependent on intracellular Ca elevation determined by in cell western.
In-cell western were performed on cells treated for 24 hours with either 10 nM SP alone or with
1 µM BABTA-AM .Values represent the mean ± SEM, n=3. Values were normalized to account for differences in cell number from well to well by staining with non-specific dyes (sapphire 700
& DRAQ5). Asterisks represent significance of at least P<0.05.
76
Figure 14:
77
Figure 15: BAPTA-AM inhibits SP-induced BDNF secretion in cultured intestinal smooth muscle cells.
Cells were treated for 24 hours with either 10 nM SP alone or with BAPTA-AM versus DMEM-
0 alone. Values represent the mean ± SEM, n=3. Asterisks are significance of at least P<0.05
78
Figure 15:
79
2+ Figure 16: Induction of BDNF mRNA by SP is blocked by chelating intracellular Ca in cultured intestinal smooth muscle.
Cells were stimulated with 10 nM SP in the presence and absence of 1uM BAPTA-AM for 24 hours. Total RNA was extracted and reverse-transcribed. Transcript levels were measured by qRT-PCR. Values represent the mean ± SEM, n=3.
80
Figure 16:
81
3.5 The role of BDNF in agonists- induced contraction of rabbit longitudinal muscle strips To determine if there is a functional effect of the increase in BDNF in longitudinal smooth muscle, the effect of BDNF on rabbit LM strips contraction induced by carbachol and SP was investigated. First, the contraction induced by carbachol and SP was verified in LM strips from rabbit intestine. Second, the strips were incubated with 10 nM BDNF and the changes of
CCh and SP-induced contraction were investigated. Third, the role of TrkB and the signaling pathways downstream of its activation were tested using selective pharmacological inhibitors and molecular assays to measure those signaling molecules.
3.5.1 Carbachol Induces Concentration-Dependent Contraction
In rabbit intestinal LM, carbachol caused dose-dependent contraction (100 nM-100 μM)
(Fig. 17). The cumulative contractile responses were .84 ± .07 grams at 100 nM, 1.1 ± .08 grams at 1 μM, 1.4 ± .09 grams at 10 μM, 1.5 ± .08 grams at 100 μM (P<.05, n=33). Data represent mean values ± SEM.
3.5.2 Effect of BDNF on Basal Tone
Exogenous BDNF did not significantly change basal tone following 1hr incubation.
Administration of 10 nM BDNF alone resulted in no significant change in basal tone from 0.82 ±
0.025 grams to 0.92 ± .035 grams, P>0.05, n=at least 18, summary of the data is depicted in figure 18.
3.5.3 Effect of BDNF on peak contraction induced by Carbachol
CCh at 10 μM was used to test the effect of all agents and inhibitors on CCh-induced contraction. Contraction after test agent administration was compared to 10 μM CCh peak
82 contraction and values were expressed as percentage. Incubation of rabbit LM strips with 10 nM
BDNF for 1hr significantly enhanced the contraction induced by 10 μM CCh (Fig.20). The contraction of LM was increased by 188% ± 5.9% after pretreatment with BDNF, n=7, P<
0.001. LM contraction induced by 10 μM CCh did not changed after 1 hr incubation with Krebs buffer only (the control Strip), Initial 1.51 ± 0.156 g versus after 1hr 1.56 ± 0.15 g, n=15, P>0.05
(fig. 19).
3.5.4 Effects of BDNF on contraction of LM strips induced by SP
SP caused contraction of rabbit LM in dose dependent manner (10 nM to 1 μM), (data not shown). Contraction of LM induced by 1 uM SP after 10 nM BDNF pretreatment for 1 hr was compared to that induced by 1 μM SP before incubation. 10 nM BDNF incubation for 1 hr did not enhance the contraction induced by 1 μM SP. The recorded change in tension was changed from 1 ± 0.07 gram to 1.1 ± 0.1 gram, P>0.05 (Fig. 21)
83
Figure 17: Control contractile response to carbachol. CCh induces a dose-dependent contraction of rabbit LM strips. (A) Representative Dose- response curve to CCh (10-7 -10-4 M). (B) CCh induces contraction of rabbit LM in dose dependent manner. Summary graph of all responses, Data are expressed as mean values ± SEM, n=33.
84
Figure 17
85
Figure 18: Effect of BDNF on Basal Tone
Representative trace showing the effect of 10 nM BDNF administration on basal tone recorded from polyview (upper panel). Incubation of the strips with 10 nM BDNF for 1 hr resulted in no significant change of basal tone (.82 ±0.025 grams to .92 ± .03 grams, n= 16). Data summary are shown in lower panel as mean ± SEM.
86
Figure 18
87
Figure19: Contractions of Repeated Measurements. Repeated peak recorded tension in strips was the same in response to CCh 10 µM. Initial 1.51 ±
0.156 g versus 1.56 ± 0.15 g, n=15. No significance noted.
88
Figure 19:
89
Figure 20: Effect of BDNF on CCh-induced contraction
(A)Upper panel, representative traces indicate 10 uM CCh-induce contraction was unchanged by incubation. The strip was treated with 10 µM CCh (left), washed three times and incubated for 1 hours and then 10 uM CCh was repeated (right panel). Lower panel, representative traces indicate 10uM CCh-induce contraction before and after incubation with 10nM BDNF for one hour. (C) Summary graph shows that BDNF pretreatment significantly increase the contraction induced by 10 uM BDNF. Values are means ± SEM percent of CCh-induced contraction, n=7,
***p<0.001.
90
Figure 20:
91
Figure 21: Effect of BDNF on intestinal LM strips contraction induced by SP
Incubation of LM strips for 1 hr with 10 µM of BDNF did not significantly change the contraction induced by 1 µM SP. Data are mean values ± SEM, n=7.
92
Figure 21:
93
3.6 Effect of TrkB inhibition on BDNF enhancement of CCh-induced contraction
The physiological effect of BDNF is mediated by two cell surface receptors, TrkB and
P75NTR. Both receptors are expressed by longitudinal SMCs. Therefore, the effect of BDNF on cholinergic-induced contraction could be attributed to either or both receptors. To test the role of
TrkB, we used K252a, an agent that selectively inhibits Trk kinase activity [102], which totally abolished the enhancement of CCh-induced contraction due to BDNF pretreatment in this study
(Fig. 22).
3.6.1 Effect of TrkB inhibition on CCh peak contraction
Blockade of TrkB with K252a (1 µM) had no significant effect on peak contraction of
10μM CCh. Peak contraction following K252a incubation for 1 hr was 19% ± 8% lower than control peak contraction, but that reduction was not statistically significant, P>0.05 (Fig. 22).
3.6.2 Effect of TrkB inhibition on BDNF enhanced CCh-induced contraction
Administration of 1 µM K252a 15 min before BDNF exposure markedly prevented
BDNF-induced enhancement of contraction due to 10 μM of carbachol (Fig.22). Peak contraction following TrkB inhibition in the presence of BDNF was similar to control peak contraction of CCh alone. (P >0.05 between control contraction and contraction after K252a and
BDNF)
3.6.3 Effect of TrkB activation on carbachol peak contraction
Trk B activation via two specific Trk B agonists significantly increased contraction by carbachol to a level similar to that seen by BDNF (Fig. 23). Administration of LM 22A4 and 7,8-
Dihydroxyflavone 60 min before challenging with carbachol enhanced the contraction by 78%
94 and 61% respectively, P<0.05 (Fig. 23). These data indicate that the effect of BDNF is mediated through activation of TrkB, even though we cannot exclude the contribution of P75NTR activation since no selective P75NTR antagonists exists at the time these studies were done.
95
Figure 22: Role of TrkB in BDNF mediated enhancement of intestinal LM contraction induced by CCh.
1 uM K252a for 15 min did not significantly affect the contraction induced by 10 uM CCh.
Incubation of LM strips with 10 nM of BDNF resulted in significant augmentation of contraction induced by 10 uM CCh. BDNF resulted in 88% increase in contraction relative to CCh alone. 1 uM K252a for 15 min before BDNF introduction resulted in a contraction that was not significantly different from that elicited by 10 uM CCh alone. Data represent the percent of contraction relative to CCh. Values denote means ± SEM from at least three animals. **P < .005.
96
Figure 22:
97
Figure 23: TrkB activation by selective agonists enhances the contraction induced by CCh.
Activation of TrkB with selective synthetic agonists led to significant increase in contraction induced by 10 µM CCh. Application of 1 µM of either LM 22A4 or 7, 8-Dihydroxyflavone for
60 min augmented CCh induceded contraction. Data represent percentage of control CCH contraction.*P<0.05, n=6.
98
Figure 23
99
3.7 The signaling pathways involved in the effect of BDNF on carbachol-induced contraction In general, at least three signaling pathways (MAPK, PLC-γ and PI3K) are responsible for BDNF mediated signal transduction in a variety of tissues [103]. To deduce the signaling pathways involved in BDNF effect on cholinergic-induced contraction in rabbit LM, we used pharmacological inhibitors to block the key enzymes in these pathways in intestinal LM strips.
Furthermore, we measured the level of activated enzymes in response to BDNF in muscle strips utilizing specific antibodies to these enzymes.
3.7.1 Effect of MAPK inhibition
Incubation of LM strips with 10 μM PD98059 (an ERK1/2 specific inhibitor) for 15 min was used to assess the role of MAPK in BDNF effect of CCh-induced contraction. ERK1/2 inhibition was tested in respect to basal tone, CCh peak contraction and CCh peak contraction in the presence of BDNF. P-ERK1/2 level was studied via western blot.
3.7.1a MAPK effect on basal activity
Inhibition of MAPK activity with 10 uM PD98059 for 15 min incubation resulted in no significant change in basal tone of rabbit LM strips. Administration of PD98059 resulted in change of basal tone from 0.81 ± 0.03 grams to 0.78 ± 0.06 grams, P>0.05, n=8. Summary of this data is displayed in figure 24.
100
3.7.1b MAPK effect on CCh peak contraction
Incubation of the strips with PD98059 for 15 min had no significant effect on 10 μM CCh peak contraction. Peak contraction following ERK1/2 inhibition was 97.6 % ± 13.6% of the control peak contraction, n=at least 6 (Fig. 25).
3.7.1c MAPK effect on BDNF-enhanced cholinergic contraction
When PD98059 was administrated 15 min before BDNF exposure, CCh peak contraction was similar to the contraction produced without PD98059 application, p>0.05. Mean CCh contractions values were viewed as percentage of control contraction, contraction following 1 hr
BDNF incubation was 193% ± 22% of the control value, n=9, P<0.005. Pretreatment with
PD98059 before BDNF incubation led to contraction 183% ± 19% of the control value, n=8,
P<0.05. Summary of the DATA is depicted in figure 25. These findings indicated that the effect of BDNF on CCh-induced contraction does not proceed through MAPK activation.
To test the effect of BDNF on ERK1/2 activation in intestinal smooth muscle, we measured the level of P-ERK1/2 in rabbit LM by western blot analysis with antibody specific to
P-ERK1/2, and GAPDH was used to normalize against experimental variations. BDNF treatment of rabbit LM for 1 hr did not affect the amount of P-ERK1/2 as demonstrated in in figure 26.
101
Figure 24: Effect of ERK1/2 inhibition of basal tone
Administration of 10 μM PD98059 for 15 min resulted in no significant inhibition of basal tone.
Mean tension values of control strips versus PD98059 incubated strips are 0.82 ± 0.03 grams versus 0.75 ± 0.06 grams, P>0.05, n=8.
102
Figure 24 :
103
Figure 25: Effect of ERK1/2 inhibition of BDNF–enhanced CCh-induced contraction
Administration of 10 uM PD98059 for at least 10 min did not significantly inhibit contraction induced by 10 uM CCh (CCh contraction 100% versus CCh plus PD98059 97% ± 15%, P>0.05).
10 uM PD98059 introduced 10 min before BDNF administration did not significantly reduce the increase in contraction in response to BDNF 1 hr incubation. (CCh 100%; CCh plus BDNF
193% ± 22% CCh, BDNF plus PD98059 183% ± 19%, n=8 from at least three rabbits). *P< .05,
**P<005.
104
Figure 25:
105
Figure 26: ERK1/2 phosphorylation in rabbit LM strips
BDNF failed to activate ERK1/2 protein in LM. (A) Western blot analysis of ERK1/2 in rabbit
LM treated with 10 nM BDNF for 1h showed no difference between treatment and control groups. GAPDH was used as the loading control. (B) Summary data indicating that BDNF did not significantly activate ERK1/2 in rabbit LM strips, n=3. DATA are mean values ± SEM.
106
Figure 26:
107
3.7.2 Effect of PLC-γ inhibition Incubation of strips with 1-10 μM U73122 (a PLC specific inhibitor) for 15 min was used to assess the role of PLC-γ in BDNF enhancement of CCh-induced contraction. PLC- γ inhibition was tested in respect to basal tone, CCh peak contraction and CCh peak contraction in the presence of BDNF. P-PLC- γ level was studied via western blot.
3.7.2a Effect on basal tone
To study the role of PLC- γ on intestinal rabbit LM basal activity, 1-10 μM U73122 was administrated for 15 min and the basal tension amplitude was compared to that before U73122 exposure. Basal tone mean value was not significantly different being 0.83 ± .03 grams before
U73122 and 0.81 ± 0.08 grams after U73122. The data is derived from at least three rabbits and the p value was greater than 0.05 (Fig. 27). These results indicate that PLC- γ has no significant effect on LM basal tone.
3.7.2b Effect of PLC-γ on CCh-induced peak contraction
The effect of PLC inhibition was tested on CCh peak contraction. 10-μM U73122 incubation for 15 min led to no significant change in CCh peak contraction. CCh peak contraction following U73122 incubation is 117% ± 14% of the control peak contraction before
U73122 (P>0.05), for at least three different rabbits. Summary of data are displayed in figure 28.
3.7.2c Effect of PLC-γ on BDNF-enhanced cholinergic contraction
Administration of U73122 15 min before BDNF exposure significantly inhibited the enhancement of CCh peak contraction due to BDNF (Fig. 28). BDNF enhanced the CCh peak contraction by 88%, but when the strips were exposed to10-μM U73122 the peak contraction
108 values were comparable to those obtained with CCh alone. P value was at least less than 0.05.
These findings demonstrate that BDNF exerts its effect on CCh-induced contraction through activation of PLC-γ. Next, we examined the activation of PLC- γ by BDNF in rabbit LM.
Western blot analysis of P-PLC-γ indicated the 10 nM BDNF resulted in robust phosphorylation of PLC-γ following 1hr incubation (Fig. 29). Phosphorylation of PLC-γ by BDNF strengthens the role of PLC-γ in mediating BDNF effect on LM contraction.
3.7.3 Effect of AKT inhibition To test the role of AKT in BDNF augmentation of CCh peak contraction, 10 μM LY294002, a selective PI3K inhibitor was introduced to the organ baths 15 min before BDNF incubation. The contraction in respose to 10 μM CCh was compared before and after LY294002. AKT inhibition led to no significant change in BDNF ability to augment CCh-induced contraction (Fig. 30). P>
0.05, n =3.
109
Figure 27: Effect of U73122 inhibition on Basal Tone
Administration of 10 uM of U73122 had no significant effect on basal tone (.82 ± .03 grams versus .82 ± .08, n=12).
110
Figure 27:
111
Figure 28: Effect of PLC-γ inhibition on BDNF-enhanced CCh-induced contraction
Incubation of LM strips with U73122 alone had no significant effect on contraction induced by
10 uM CCh. U73122 15 min before BDNF administration significantly reduce the effect of
BDNF on CCh-induced contraction ( BDNF induced increase in contraction reduced from 98% to 11% above control (i.e. contraction induced by 10 uM CCh alone )). Values are means ±
SEM, n=7, * P< .05, **P<001.
112
Figure 28:
113
Figure 29: BDNF activates PLC γ in rabbit LM.
Western blot analysis of BDNF in Rabbit LM strips, (A) 10nM BDNF treatment of LM strips for 1 h resulted in a robust PLC-γ phosphorylation. (B) Summary graph of densitometry analysis showing that BDNF significantly activates PLC-γ in LM strips. Data are mean values ±
SEM, N=3, **P<0.005
114
Figure 29:
115
Figure 28: Effect of AKT inhibition on BDNF-enhanced CCh-induced contraction
Incubation of LM strips with LY294002 15 min before BDNF administration had no significant effect on the augmentatory effect of BDNF on contraction induced by 10 uM CCh. Values are means ± SEM, n=3, * P> 0.05.
116
Figure 30:
117
CHAPTER 4 Discussion
4.1 Localization of BDNF in intestinal muscle tissues
Neurotrophins are a well-known protein family in the nervous system that regulates diverse neuronal functions such as survival, differentiation, migration and activity-dependent synaptic plasticity. As a target derived neurotrophic factor, it is not surprising that neuronal target tissues like skin, cardiac, skeletal and smooth muscle also secrete neurotrophins [104,
105]. Neurotrophins derived from such targets could modulate the innervation to these tissues.
Moreover, there is increasing recognition that neurotrophins and their receptors are expressed in non-neuronal tissues that are not essentially associated with innervation. In this regards, neurotrophins have been described in a variety of smooth muscles such as airways, bladder and blood vesicles [105-107]. In this study, we have identified BDNF in intestinal smooth muscle tissues from mice, rabbit (Fig.1& 2) and human (Data are not shown).
BDNF localization in rabbit intestinal smooth muscle cells is identified using different experimental approaches. BDNF protein is detectable in rabbit intestinal muscle by specific
BDNF immunostaining, different western blotting techniques (ECL, Licore and ICW) and
ELISA. We have demonstrated that BDNF level was higher in longitudinal compared to circular muscle layer in mice, rabbit and human. The BDNF protein presence in longitudinal muscle
(LM) layer from rabbit intestine was confirmed in primary SMCs cultures by western analysis
118
and ELISA. Moreover, BDNF mRNA level was higher in rabbit longitudinal muscle
(Fig. 3)than circular muscle.
Currently, the explanation for the difference between BDNF level in longitudinal versus circular intestinal muscle has not been investigated and hence is unknown. However, it could be due to differences in the development of the two muscle layers [108].
4.2 BDNF Secretion
This the first study to demonstrate that LM cell cultures of the intestine secrete BDNF constitutively. Quantitative ELISA measurements demonstrated that at rest LM cell cultures secrete low levels of BDNF into the culture medium (Fig. 9, 10 & 11). Identification of SMCs as an paracrine organ that produces and secretes substances (like BDNF) is not a new paradigm.
Previous reports have demonstrated that intestinal smooth muscle cells synthesize and secrete humoral factors such as collagen, insulin-like growth factor and cytokines [109-112]. Several reports have documented synthesis and secretion of neurotrophins in vascular and lung SMCs
[107, 113]. The constitutive secretion of BDNF from intestinal LM could regulate the normal functional status of this muscle layer. The BDNF level could be modulated by physiological or pathological stimuli and thus could participate in SMCs contractility, inflammation level and tissue remodeling.
In this study, we also have identified both BDNF receptors, TrkB and P75NTR in rabbit
LM cells (Data not shown). This finding raises the possibility that BDNF released in the vicinity of LM cells could have an autocrine or paracrine effect on smooth muscle cells and their innervating neurons.
119
4.3 BDNF Modulation in Longitudinal SMCs
This is the first study to investigate BDNF in intestinal SMCs. We have demonstrated that PACAP and SP induce the synthesis and release of BDNF in intestinal longitudinal SMCs cultures. The inducible release of BDNF reflects the nature of BDNF protein, which is secreted via the regulated pathway of secretion [17, 114].
The interaction between PACAP/SP and BDNF has been reported in several studies and in different tissues. In cultured neurons, the protective effect of PACAP was mediated through
BDNF, where PACAP induced the expression of BDNF [115]. Moreover, PACAP upregulted
BDNF mRNA in cortical neurons [92]. Several reports have coupled BDNF and SP, for example, BDNF increased SP expression in GI tract inflammation and both peptides were reported to be increased in different inflammation models [116, 117]. On the other hand, PACAP and SP are among the main relaxant and contractile neuropeptides respectively released from neurons that innervate smooth muscle cells making them excellent candidates for BDNF modulation in longitudinal SMCs.
4.3.1 Regulation of BDNF protein in intestinal longitudinal SMCs cultures
The inducible effect of PACAP on BDNF protein content in rabbit longitudinal SMCs cultures was measured using western blot technique. In our experimental approach, PACAP 38 treatment at 10 nM and 100 nM produced marked increase in BDNF protein content after 24- hour incubation. There was no difference between the two doses in their ability to induce BDNF protein suggesting that 10 nM PACAP is the concentration that gives the maximal response.
Moreover, daily incubation for 48 hours with both concentrations maintained the elevated levels
120 of BDNF protein compared to control. The 48 hour levels were a little higher than that obtained with 24 hours. Consistent with these finding, several reports have demonstrated the effect of
PACAP 38 on BDNF [92, 100]. Reichenstein et al. have reported that PACAP 38 at 10 nM and
100 nM increased BDNF mRNA in rat primary cortical neurons. The up-regulation of BDNF protein after PACAP exposure could represent the activation of transcriptional mechanisms, translational and/or post-translational regulation of BDNF production.
BDNF protein levels were also up-regulated by SP in intestinal longitudinal primary
SMCs cultures. 10 nM and 100 nM SP produced significant increase in BDNF content following
24 hrs treatments. Treatment with both concentrations for 48 hrs also enhanced BDNF protein levels compared to cells incubated with DMEM-0 alone. The effect of SP on BDNF protein levels could reflect the activation of neurokinin receptors in intestinal SMCs by SP and the subsequent elevation of intracellular Ca2+ levels. We demonstrated that pretreatment of SMCs with BAPTA-AM prevented BDNF protein up-regulation in response to SP, indicating that an intracellular increase in calcium was responsible for SP-induced BDNF protein production. The change in BDNF levels is presumably caused in part by alteration of de novo synthesis, as inferred from altered levels of BDNF mRNAs. Furthermore, intracellular Ca2+ was important for the induction of BDNF mRNA in SMCs because the chelation of cytosolic Ca2+ by BAPTA abolished the effect of SP on BDNF mRNA levels. The importance of intracellular Ca2+ for
BDNF gene transcription is well documented, it is essential for cAMP-response element (CRE) binding protein (CREB) phosphorylation. Intracellular Ca2+ leads to Ca2+-calmodulin-dependent protein kinases (CaMKs) activation, which in turn phosphorylates CREB. Phosph-CREB binds to a critical Ca2+ response element (CRE) within the BDNF gene and activates BDNF transcription [118, 119].
121
The interactions between neurotrophins and SP have been the subject of many research studies [42, 44, 120, 121]. SP has been implicated directly as a mediator neurogenic control of inflammation and the associated hypersensitivity [122-124]. In inflammation models, there is increase in SP, neurotrophins, and cytokines [51, 116, 117]. In this regard, BDNF and other neurotrophins has been demonstrated to induce SP up-regulation in different tissues [125, 126].
To our knowledge, this is the first report to show the opposite interaction that SP induces BDNF expression in SMCs cultures from rabbit intestine. Similar results were reported in airway smooth muscle cells, where SP at 10 nM induced up-regulation of BDNF [120]. The prolonged exposure of normal SMCs cultures to SP could mimic one of the conditions of a state of inflammation induced by SP. Whether up-regulation of BDNF in prolonged SP-incubated intestinal SMCs represents normal or diseased states needs further investigation. One interesting possibility is that our finding that SP increases BDNF coupled with the published observation that BDNF increases SP expression [26, 27] sets up the possibility of a positive feedback loop to cause a strong elevation of both peptides. Increase in both BDNF and SP would further sustain the inflammatory state and might perhaps explain some of the pathological effects of intestinal inflammation.
4.3.2 Induction of BDNF release in intestinal longitudinal SMCs cultures
We have provided evidence in this study that BDNF protein secretion is enhanced by
PACAP and SP treatments in rabbit longitudinal SMCs cultures. PACAP 10 nM and 100 nM increased the secretion of BDNF in SMCs cultures after 24 and 48 hrs as indicated by ELISA
BDNF measurements. The BDNF ELISA used here is very specific for BDNF with cross reactivity less than 3% with other neurotrophins. BDNF secretion after 48 hrs incubation with
122 both concentrations was less than that measured after 24 hrs incubation. The reduction in BDNF secretion could be due to BDNF protein degradation or formation of clusters of BDNF with other components in the cell culture medium evading quantification by ELISA. This explanation was documented in several reports due to the basic nature of BDNF (PI 9.1) which makes it very sticky [127, 128]. As stated earlier, PACAP in nanomolar concentrations activates BDNF expression [92, 100, 129], so the release of BDNF in response to PACAP in intestinal SMCs could be release of either newly formed or prestored BDNF. In intestinal SMCs, PACAP is able to activate cAMP, cGMP and intracellular Ca2+ [130] and BDNF is known to be secreted in response to intracellular Ca2+ elevation and to stimuli that activate AC and generate cAMP [23,
131].
We have demonstrated that SP can also induce BDNF secretion in rabbit longitudinal
SMCs. In this study, treatment with 10 nM and 100 nM induced BDNF secretion after 24 hrs incubation as shown by ELISA quantification. The BDNF secretion via the two SP concentrations was significantly higher than the control but there was no difference between the concentrations indicating that 10 nM SP induced the maximal BDNF secretion. This finding is in agreement with other reports that SP at nanomolar concentrations can work as a growth factor and its affect at higher doses is weakened [120, 132, 133]. SP incubation for 48 hrs maintained the elevated levels of BDNF in cultured medium supernatants compared to control; however, they were lower in comparison to results obtained after 24 hrs. This observation is in common to the effect of PACAP after 48 hrs incubation on BDNF secretion, making it tempting to speculate that the BDNF protein nature could be the reason for the this observation. That is, it may be partly degraded with time in culture.
123
Since SP-containing neurons are more common than PACAP containing neurons, especially in the longitudinal muscle layer, we focused on the question of how SP regulates
BDNF in rabbit longitudinal SMCs cultures. Our data demonstrated that SP enhanced BDNF mRNA, protein content and secretion. Thus, we presume that the increase in BDNF secretion represented a component of both newly synthesized protein in addition to preformed BDNF in
SMCs. Intriguingly, the effect of SP on BDNF mRNA, protein synthesis and secretion all require elevation of intracellular Ca2+. The dependence of BDNF secretion on intracellular Ca2+ elevation is well documented in literature. In neurons, BDNF release induced by membrane depolarization depends on Ca2+ influx through voltage gated calcium channels and Ca2+ mobilization from internal stores [17, 23]. Therefore, we can speculate that SP activates its neurokinin receptors on intestinal SMCs resulting intracellular Ca2+ elevation, which is the hallmark of BDNF regulated release. The source of intracellular Ca2+ and the downstream effectors require further investigation. Even though, the extracellular source of Ca2+ is expected to have critical role, as these are longitudinal SMCs. In longitudinal SMCs, entry of Ca2+ is an obligatory step for cytosolic Ca2+ elevation [81].
In conclusion, our data demonstrates that BDNF, a well-characterized growth factor that supports a plethora of neuronal functions, can be produced by rabbit longitudinal SMCs and this production is up regulated by gut neuropeptides such as PACAP and SP. The significance of this could be in improving our understanding of SMCs function in health and disease. For example,
BDNF could modulate innervation to smooth muscle and/or contractility in response to contractile agonists. This latter possibility was chosen for further investigation as presented in the following sections.
124
4.4 Effect of BDNF on longitudinal SMCs contraction induced by carbachol (CCh) and SP
In this study, we provide evidence demonstrating a functional role of BDNF in gut motility. BDNF enhanced SMCs contraction induced by CCh but not SP. The effect of BDNF most probably is through TrkB activation and the subsequent PLC-γ phosphorylation.
CCh and SP initiate contraction in longitudinal and circular SMCs by increasing intracellular Ca2+. The mechanism for increasing intracellular Ca2+ varies between the two cell types for the intial contraction which is what was measured in the current study. In circular
SMCs, G protein–coupled agonists initiate contraction even in the absence of extracellular Ca2+.
Receptors activation leads to PLC phosphorylation that liberates diacylglycerol (DAG) and the diffusible Ca2+-mobilizing messenger, inositol 1, 4, 5-trisphosphate (IP3). While in longitudinal
SMCs, extracellular Ca2+ is essential for contraction initiation, where Ca2+ influx represent the trigger for Ca2+ mobilization for internal stores. G protein–coupled agonists in LM activate cytoplasmic phospholipase A2, which in turn liberates arachidonic acid from membrane lipids.
Arachidonic acid activates chloride channels, which induce membrane depolarization, and hence calcium channels opening. Ca2+ influx induces cyclic ADP ribose formation and stimulates both
Ca2+- and cyclic ADP ribose-induced Ca2+ release from internal stores [81].
4.4.1 Effect of BDNF on CCh peak contraction
We demonstrated that BDNF enhances the peak contraction induced by CCh in rabbit intestinal LM strips. Early in this study, we demonstrated that intestinal LM produces BDNF.
The function of BDNF in the gut is poorly documented. Recently, a few studies reported the excitatory role of BDNF in gut motility. For example, patients with amyotrophic lateral sclerosis and diabetic neuropathy who received Hr-Met-BDNF experienced increased gut motility,
125 diarrhea and increased bowel urgency [45, 46] .Moreover, exogenous BDNF stimulated the myoelectric activities of rat intestine [134] and the enhanced the peristaltic reflex induced by mucosal stimulation in mice [42].
In this study, the effect of CCh on isolated rabbit LM strips was verified first. As expected, CCh (10-7 – 10-4) induces dose-dependent contractions in rabbit intestinal LM strips as shown in figure 17. After that, we selected CCh 10-5, a submaximal dose, to test the effect of
BDNF on CCh peak contraction. BDNF alone failed to change significantly the basal tone of the strips. On the other hand, our data provide evidence that 10 nM BDNF robustly enhances the
CCh peak contraction following 1 hr incubation, suggesting that the primary role of BDNF is to sensitize SMCs to CCh. The modulatory function of BDNF is a well-described behavior in many systems, for example exogenous BDNF alone did not initiate the peristaltic reflex but enhanced the reflex induced by mucosal stimulation [42]. Moreover, BDNF enhanced depolarization- induced release of GABA, dopamine, and 5-HT in rat brain striatal slices, but it had no effect on transmitter release when added alone [135]. Our finding is consistent with the reported excitatory effect of BDNF in gut motility [42, 46, 134] and does not conflict with the absence of influence of BDNF on acetylcholine-induced contraction in mice whole mount strips from ileum reported by Chen et al. [48]. The differences in species, strips preparation, drug concentrations and incubation time could explain the difference in interpretation of the two studies. In our experimental setting, each strip serves as its own control, which eliminates the measured variations between strips. Furthermore, the strips data were analyzed in respect to the peak contraction only.
The augmented contraction of intestinal LM strips incubated with BDNF in response to
CCh can explain the increased contractility of muscle layers associated with inflammation of the
126
GI tract. Inflammation is associated with structural and functional changes in the contractile apparatus of GI tract that leads to altered motor function [136, 137]. Intestinal smooth muscle hypercontractility is a characteristic of different models of gut inflammation [137-139]. CCh- induced intestinal smooth muscle contraction was significantly increased after gut inflammation
[138, 140]. Akiho et al. [138] demonstrated that infection and the subsequent gut inflammation increased muscarinic receptor affinity to CCh in mice longitudinal muscle cells. In line with these findings, airway smooth muscle cell hyper-responsiveness is a hallmark of lung inflammation. Moreover, BDNF upregulation contributes to airway reactivity in pathophysiological states associated with airway inflammation [120]. In this context, BDNF has been shown to be up-regulated in GI tract inflammation and in response to inflammatory cytokines [52, 116]. Therefore, the reported hypercontractility to CCh in BDNF incubated muscle strips shown in the present study can explain the altered motor function, which accompanies gut inflammation. Nevertheless, the interaction between other inflammatory cytokines and BDNF in CCh-induced contraction needs further investigation since the response to inflammation and the potential mediators is likely to be complex and multifactorial.
4.4.2 The signaling pathways involved in BDNF effect on contraction induced by CCh
The present study indicates that BDNF augments CCh-induced LM contraction by activating TrkB receptors, most probably on SMCs membrane. Furthermore, TrkB activation leads to PLC-γ phosphorylation and subsequently sensitizing SMCs to CCh.
BDNF acts via its high affinity TrkB receptor tyrosine kinase. We demonstrated both
BDNF and TrkB expression in longitudinal muscle layer of rabbit intestine. Inhibition of TrkB using Trk specific inhibitor K252a prevented BDNF effect on CCh peak contraction in LM
127 strips. Immunoneutralization of TrkB with anti TrkB antibody also abolished the effect of
BDNF. Furthermore, recently reported TrkB selective agonists (LM 22A4 and 7,8-
Dihydroxyflavone) [141, 142] were introduced to the organ bath 15 min before CCh exposure and resulted in augmentation of peak contraction similar to that seen with BDNF (see figure 22).
These results support the conclusion that BDNF augments CCh-induced contraction by activating TrkB. In line with this finding, several reports indicate that BDNF mediates its biological effect through TrkB receptor activation. For example, BDNF and 7, 8-
Dihydroxyflavone enhanced cholinergic neurotransmission via activation of TrkB in mice diaphragm muscle [143]. Moreover, BDNF augments intracellular Ca 2+ rise in response to Ach in airways smooth muscle cells by activating TrkB receptor [120].
It is noteworthy that inhibition of TrkB signaling via K252a had no effect on LM strips basal activity and CCh peak contraction in the absence of BDNF, suggesting a small contribution of the endogenous BDNF.
The present study demonstrates that BDNF acts to augment CCh peak contraction in rabbit intestine specifically by activating PLC-γ, a downstream effector of TrkB. A specific PLC inhibitor that is commonly used to block PLC activation in gut SMCs, U73122 (1-10 µM), abolished the augmentation effect of BDNF on CCh-induced contraction. Whereas, inhibiting
MAP kinase with (10 µM) PD98059 had no effect. In support of this conclusion, BDNF treatments of LM strips robustly induce PLC-γ phosphorylation. PLC inhibition with (.1-10 µM)
U73122 had no effect on CCh-induced contraction in the absence of BDNF, this is consistent with the lack of PLC-β activation in response to CCh activation of muscarinic receptors in intestinal longitudinal muscles [81]. Moreover, the lack of effect of U73122 on contraction by
CCh alone indicates that its effect on BDNF enhancement of contraction is specific to PLC-γ.
128
Thus the effect of BDNF on CCh-induced contraction here could reflect the activation of PLC, a mechanism that is usually absent in intestinal longitudinal muscle. In this regard, we can speculate that BDNF acts on SMCs to activate TrkB and subsequent PLC-γ activation, leading to
IP3 generation, which binds to IP3 receptors and triggers internal Ca2+ release.
The role of AKT pathway in BDNF enhanced CCh-induced contraction was examined.
Although BDNF induced slight phosphorylation of AKT in LM strips, AKT inhibition by
LY294002 had no significant effect on BDNF induced enhancement of LM strip contraction by
CCh. This result is also inferred from the effect of U73122 which completely abolished the effect of BDNF on CCh-induced contraction.
Another mechanism BDNF can contribute to CCh hyper-responsiveness is by upregulating muscarinic receptors insertion to the membrane. Here, our preliminary data suggests that BDNF enhances total CCh binding to SMCs. Total binding assay indicates that
3 BDNF treatments of intestinal longitudinal SMCs led to increase in specific radioligand ([ H]
Scopolamine) binding to surface M3 and M2 receptors ( data not shown). Similar effect of
BDNF on N-methyl-D-aspartate (NMDA) glutamate receptor was reported. BDNF treatments increased the abundance of NMDA receptor subunits in cultured hippocampal neurons, that correlated with the receptors activity [144]. Furthermore, BDNF regulates membrane insertion of
AMPA receptors and nicotinic receptors [145, 146]. Whether BDNF enhances M3 or M2 membrane abundance or both of them needs further investigations.
In conclusion, BDNF induces SMCs hypercontractility in response to CCh. The effect of
BDNF is the result of TrkB activation and the subsequent phosphorylation of PLC-γ. These results provide new insight into the mechanisms of neurotrophin (BDNF) modulation of gut function, which may lead to new therapeutic avenues for treatment of gastrointestinal disorders,
129 and explain some of the patholological changes associated with inflammation such as hypercontractility associated with gut infection or IBD.
4.5 Proposed model for BDNF in longitudinal SMCs
Our finding indicates that intestinal longitudinal SMCs express basal level of BDNF.
Furthermore, SP and PACAP upregulate BDNF content and can induce its secretion in a mechanism that involves regulation of intracellular Ca2+ level. In turn, secreted BDNF acts in autocrine manner to enhance SMCs responses to CCh by activating TrkB and the subsequent phosphorylation of PLC-γ. CCh induced Ca influx and BDNF induced PLC-γ activation and subsequent release of stored Ca could synergistically elevate intracellular Ca2+ and produce more contraction. This would interact with the BDNF induced increase the release of neurotransmitter form the surrounding neurons in paracrine fashion. The net effect is enhanced contraction of longitudinal muscle
130
Figure 30: Schematic model of BDNF interactions in intestinal longitudinal SMCs.
In intestinal longitudinal SMCs, enteric neurons release SP or PACAP. Both neuropeptides act via their receptors on SMCs to elevate intracellular Ca2+ resulting in BDNF synthesis and release. Secreted BDNF activates TrkB on SMCs to potentiate their contractile response to Ach in a mechanism that involves PLC-γ phosphorylation.
131
Figure 30:
132
List of References
133
List of References
1. Skaper, S.D., The biology of neurotrophins, signalling pathways, and functional peptide mimetics of neurotrophins and their receptors. CNS Neurol Disord Drug Targets, 2008. 7(1): p. 46-62. 2. Reichardt, L.F., Neurotrophin-regulated signalling pathways. Philos Trans R Soc Lond B Biol Sci, 2006. 361(1473): p. 1545-64. 3. Seidah, N.G., et al., Cellular processing of the nerve growth factor precursor by the mammalian pro-protein convertases. Biochem J, 1996. 314 ( Pt 3): p. 951-60. 4. Shirley, D.M., S.A. Williams, and P.M. Santos, Brain‐Derived Neurotrophic Factor and Peripheral Nerve Regeneration: A Functional Evaluation. The Laryngoscope, 2009. 106(5): p. 629-632. 5. Aloe, L., et al., Nerve growth factor: from the early discoveries to the potential clinical use. Journal of Translational Medicine, 2012. 10(1): p. 239. 6. Verge, V., et al., Differential influence of nerve growth factor on neuropeptide expression in vivo: a novel role in peptide suppression in adult sensory neurons. The Journal of neuroscience, 1995. 15(3): p. 2081-2096. 7. Vega, J.A., et al., Neurotrophins and the immune system. Journal of anatomy, 2003. 203(1): p. 1-19. 8. Barde, Y.A., D. Edgar, and H. Thoenen, Purification of a new neurotrophic factor from mammalian brain. The EMBO journal, 1982. 1(5): p. 549. 9. Binder, D.K. and H.E. Scharfman, Brain-derived neurotrophic factor. Growth Factors, 2004. 22(3): p. 123-31. 10. Greenberg, M.E., et al., New insights in the biology of BDNF synthesis and release: implications in CNS function. The Journal of neuroscience, 2009. 29(41): p. 12764- 12767. 11. Nair, A., et al., Stressor-specific regulation of distinct brain-derived neurotrophic factor transcripts and cyclic AMP response element-binding protein expression in the postnatal and adult rat hippocampus. Neuropsychopharmacology, 2006. 32(7): p. 1504-1519. 12. Bramham, C.R. and E. Messaoudi, BDNF function in adult synaptic plasticity: the synaptic consolidation hypothesis. Progress in neurobiology, 2005. 76(2): p. 99-125. 13. Pae, C.-U., et al., Does neurotropin-3 have a therapeutic implication in major depression? International Journal of Neuroscience, 2008. 118(11): p. 1515-1522. 14. Runge, E., et al., Neurotrophin-4 Is More Potent than Brain-Derived Neurotrophic Factor in Promoting, Attracting and Suppressing Geniculate Ganglion Neurite Outgrowth. Developmental neuroscience, 2012. 34(5): p. 389-401.
134
15. Heinrich, G. and T. Lum, Fish neurotrophins and Trk receptors. International journal of developmental neuroscience: the official journal of the International Society for Developmental Neuroscience, 2000. 18(1): p. 1. 16. Lessmann, V., K. Gottmann, and M. Malcangio, Neurotrophin secretion: current facts and future prospects. Prog Neurobiol, 2003. 69(5): p. 341-74. 17. Lessmann, V., K. Gottmann, and M. Malcangio, Neurotrophin secretion: current facts and future prospects. Progress in neurobiology, 2003. 69(5): p. 341. 18. Lu, B. and A. Chow, Neurotrophins and hippocampal synaptic transmission and plasticity. Journal of neuroscience research, 1999. 58(1): p. 76-87. 19. Gooney, M., et al., BDNF-induced LTP in dentate gyrus is impaired with age: analysis of changes in cell signaling events. Neurobiology of aging, 2004. 25(10): p. 1323-1331. 20. Diógenes, M.J., et al., Enhancement of LTP in Aged Rats is Dependent on Endogenous BDNF. Neuropsychopharmacology, 2011. 21. Brigadski, T., M. Hartmann, and V. Lessmann, Differential vesicular targeting and time course of synaptic secretion of the mammalian neurotrophins. J Neurosci, 2005. 25(33): p. 7601-14. 22. Tao, X., et al., A calcium-responsive transcription factor, CaRF, that regulates neuronal activity-dependent expression of BDNF. Neuron, 2002. 33(3): p. 383-395. 23. Leßmann, V. and T. Brigadski, Mechanisms, locations, and kinetics of synaptic BDNF secretion: an update. Neuroscience research, 2009. 65(1): p. 11-22. 24. Mouri, A., H. Nomoto, and S. Furukawa, Processing of nerve growth factor: The role of basic amino acid clusters in the pro-region. Biochemical and biophysical research communications, 2007. 353(4): p. 1056-1062. 25. Egan, M.F., et al., The BDNF val66met polymorphism affects activity-dependent secretion of BDNF and human memory and hippocampal function. Cell, 2003. 112(2): p. 257-270. 26. Chen, Z.Y., et al., Sortilin controls intracellular sorting of brain-derived neurotrophic factor to the regulated secretory pathway. The Journal of neuroscience, 2005. 25(26): p. 6156-6166. 27. Lou, H., et al., Sorting and activity-dependent secretion of BDNF require interaction of a specific motif with the sorting receptor carboxypeptidase e. Neuron, 2005. 45(2): p. 245- 255. 28. Angelucci, F., S. Brene, and A. Mathe, BDNF in schizophrenia, depression and corresponding animal models. Molecular psychiatry, 2005. 10(4): p. 345-352. 29. Nagahara, A.H., et al., Neuroprotective effects of brain-derived neurotrophic factor in rodent and primate models of Alzheimer’s disease. Nature medicine, 2009. 15(3): p. 331. 30. Howells, D., et al., Reduced BDNF mRNA expression in the Parkinson's disease substantia nigra. Experimental neurology, 2000. 166(1): p. 127-135. 31. Collier, D. and J. Treasure, The aetiology of eating disorders. The British Journal of Psychiatry, 2004. 185(5): p. 363. 32. Egan, M.F., et al., The BDNF val66met polymorphism affects activity-dependent secretion of BDNF and human memory and hippocampal function. Cell, 2003. 112(2): p. 257-69. 33. Chao, M.V., R. Rajagopal, and F.S. Lee, Neurotrophin signalling in health and disease. Clin Sci (Lond), 2006. 110(2): p. 167-73.
135
34. Braun, A., et al., Brain derived neurotrophic factor (BDNF) contributes to neuronal dysfunction in a model of allergic airway inflammation. British journal of pharmacology, 2004. 141(3): p. 431-440. 35. Meuchel, L.W., et al., Neurokinin-Neurotrophin Interactions in Airway Smooth Muscle. American Journal of Physiology-Lung Cellular and Molecular Physiology, 2011. 36. Braun, A., et al., Neurotrophins: a link between airway inflammation and airway smooth muscle contractility in asthma? International archives of allergy and immunology, 2000. 118(2-4): p. 163-165. 37. KIYOTA, M., et al., Effect of Brain-derived Neurotrophic Factor on Periodontal Tissue Regeneration. 2006. 38. Chalazonitis, A., Neurotrophin-3 in the development of the enteric nervous system. Progress in brain research, 2004. 146: p. 243-263. 39. Lucini, C., et al., Localisation of neurotrophin-containing cells in higher vertebrate intestine. Anatomy and embryology, 2002. 205(2): p. 135-140. 40. Boesmans, W., et al., Brain-derived neurotrophic factor amplifies neurotransmitter responses and promotes synaptic communication in the enteric nervous system. Gut, 2008. 57(3): p. 314. 41. Hoehner, J., et al., Localization of neurotrophins and their high-affinity receptors during human enteric nervous system development. Gastroenterology, 1996. 110(3): p. 756-767. 42. Grider, J.R., et al., Brain-derived neurotrophic factor augments peristalsis by augmenting 5-HT and calcitonin gene-related peptide release. Gastroenterology, 2006. 130(3): p. 771-780. 43. Salio, C., et al., Costorage of BDNF and neuropeptides within individual dense‐core vesicles in central and peripheral neurons. Developmental neurobiology, 2007. 67(3): p. 326-338. 44. Grider, J.R., K.S. Murthy, and J.F. Kuemmerle, Stimulation of substance P (SP) release from myenteric synaptosomes by BDNF is mediated by p42/44 MAP kinase. Gastroenterology, 2001. 120(5): p. A308-A308. 45. A controlled trial of recombinant methionyl human BDNF in ALS: The BDNF Study Group (Phase III). Neurology, 1999. 52(7): p. 1427-33. 46. Wellmer, A., et al., A double‐blind placebo‐controlled clinical trial of recombinant human brain‐derived neurotrophic factor (rhBDNF) in diabetic polyneuropathy. Journal of the Peripheral Nervous System, 2001. 6(4): p. 204-210. 47. Chai, N.L., et al., Effects of neurotrophins on gastrointestinal myoelectric activities of rats. WORLD JOURNAL OF GASTROENTEROLOGY, 2003. 9(8): p. 1874-1877. 48. Chen, F., et al., Brain-derived neurotrophic factor Enhances the Contraction of Intestinal Muscle Strips Induced by SP and CGRP in Mice. Regulatory Peptides, 2012. 49. Di Mola, F., et al., Nerve growth factor and Trk high affinity receptor (TrkA) gene expression in inflammatory bowel disease. Gut, 2000. 46(5): p. 670-679. 50. Johansson, M., Ö. Norrgård, and S. Forsgren, Study of expression patterns and levels of neurotrophins and neurotrophin receptors in ulcerative colitis. Inflammatory bowel diseases, 2007. 13(4): p. 398-409. 51. Joo, Y.-E., Increased Expression of Brain-derived Neurotrophic Factor in Irritable Bowel Syndrome and Its Correlation With Abdominal Pain (Gut 2012; 61: 685-694). Journal of neurogastroenterology and motility, 2013. 19(1): p. 109-111.
136
52. Xia, C.M., et al., Up-regulation of brain-derived neurotrophic factor in primary afferent pathway regulates colon-to-bladder cross-sensitization in rat. Journal of Neuroinflammation, 2012. 9(1): p. 30. 53. Delafoy, L., et al., Interactive involvement of brain derived neurotrophic factor, nerve growth factor, and calcitonin gene related peptide in colonic hypersensitivity in the rat. Gut, 2006. 55(7): p. 940-945. 54. Monteleone, P. and M. Maj, Dysfunctions of leptin, ghrelin, BDNF and endocannabinoids in eating disorders: Beyond the homeostatic control of food intake. Psychoneuroendocrinology, 2013. 55. Rosas-Vargas, H., J.D. Martínez-Ezquerro, and T. Bienvenu, Brain-derived neurotrophic factor, food intake regulation, and obesity. Archives of medical research, 2011. 42(6): p. 482-494. 56. Bercik, P., et al., The intestinal microbiota affect central levels of brain-derived neurotropic factor and behavior in mice. Gastroenterology, 2011. 141(2): p. 599-609. e3. 57. Collins, S.M., M. Surette, and P. Bercik, The interplay between the intestinal microbiota and the brain. Nature Reviews Microbiology, 2012. 58. Sanders, K.M., et al., Regulation of gastrointestinal motility—insights from smooth muscle biology. Nature Reviews Gastroenterology and Hepatology, 2012. 59. Rubin, D.C. and J.C. Langer, Small intestine: anatomy and structural anomalies. Atlas of Gastroenterology, Fourth Edition, 2009: p. 289-294. 60. Brookes, S.J.H., Classes of enteric nerve cells in the guinea‐pig small intestine. The Anatomical Record, 2000. 262(1): p. 58-70. 61. Schemann, M., Control of gastrointestinal motility by the" gut brain"-the enteric nervous system. Journal of pediatric gastroenterology and nutrition, 2005. 41: p. S4-S6. 62. Furness, J., Types of neurons in the enteric nervous system. Journal of the autonomic nervous system, 2000. 81(1): p. 87-96. 63. Brookes, S.J., Classes of enteric nerve cells in the guinea‐pig small intestine. The Anatomical Record, 2000. 262(1): p. 58-70. 64. Nurgali, K., Plasticity and ambiguity of the electrophysiological phenotypes of enteric neurons. Neurogastroenterology & Motility, 2009. 21(9): p. 903-913. 65. Brehmer, A., F. Schrödl, and W. Neuhuber, Morphological classifications of enteric neurons--100 years after Dogiel. Anatomy and embryology, 1999. 200(2): p. 125-135. 66. Hansen, M.B., The enteric nervous system I: organisation and classification. Pharmacology & toxicology, 2003. 92(3): p. 105-113. 67. Wood, J., Enteric neurophysiology. American Journal of Physiology-Gastrointestinal and Liver Physiology, 1984. 247(6): p. G585-G598. 68. Mao, Y., B. Wang, and W. Kunze, Characterization of myenteric sensory neurons in the mouse small intestine. Journal of neurophysiology, 2006. 96(3): p. 998-1010. 69. Furness, J., et al. Identification of component neurons and organisation of enteric nerve circuits. in Falk symposium. 2000: Dordrecht; London; Kluwer Academic; 1999. 70. Costa, M., S. Brookes, and G. Hennig, Anatomy and physiology of the enteric nervous system. Gut, 2000. 47(suppl 4): p. iv15-iv19. 71. Maeda, H., et al., Requirement of c-kit for development of intestinal pacemaker system. Development, 1992. 116(2): p. 369-375.
137
72. Huizinga, J.D., et al., Interstitial cells of Cajal as targets for pharmacological intervention in gastrointestinal motor disorders. Trends in Pharmacological Sciences, 1997. 18(4): p. 393-403. 73. Garcia-Lopez, P., et al., Updating old ideas and recent advances regarding the Interstitial Cells of Cajal. Brain research reviews, 2009. 61(2): p. 154-169. 74. Al-Shboul, O., The importance of interstitial cells of cajal in the gastrointestinal tract. Saudi Journal of Gastroenterology, 2013. 19(1): p. 3. 75. Bitar, K.N., Function of gastrointestinal smooth muscle: from signaling to contractile proteins. The American journal of medicine, 2003. 115(3): p. 15-23. 76. Gabella, G., Structure of muscles and nerves in the gastrointestinal tract. Physiology of the gastrointestinal tract, 1987. 1: p. 197-241. 77. Bayliss, W. and E. Starling, The movements and innervation of the small intestine. The Journal of physiology, 1899. 24(2): p. 99-143. 78. Grider, J. and J. Jin, Distinct populations of sensory neurons mediate the peristaltic reflex elicited by muscle stretch and mucosal stimulation. The Journal of neuroscience, 1994. 14(5): p. 2854-2860. 79. Grider, J.R., Neurotransmitters mediating the intestinal peristaltic reflex in the mouse. Journal of Pharmacology and Experimental Therapeutics, 2003. 307(2): p. 460-467. 80. Grider, J. and A. Foxx-Orenstein, Mediators and regulation of peristalsis. Current opinion in gastroenterology, 1999. 15(1): p. 22. 81. Murthy, K.S., Signaling for contraction and relaxation in smooth muscle of the gut. Annu. Rev. Physiol., 2006. 68: p. 345-374. 82. Murthy, K., J. Grider, and G. Makhlouf, InsP3-dependent Ca2+ mobilization in circular but not longitudinal muscle cells of intestine. American Journal of Physiology- Gastrointestinal and Liver Physiology, 1991. 261(6): p. G937-G944. 83. Kuemmerle, J., K. Murthy, and G. Makhlouf, Agonist-activated, ryanodine-sensitive, IP3-insensitive Ca2+ release channels in longitudinal muscle of intestine. American Journal of Physiology-Cell Physiology, 1994. 266(5): p. C1421-C1431. 84. Kuemmerle, J.F. and G.M. Makhlouf, Agonist-stimulated cyclic ADP ribose. Journal of Biological Chemistry, 1995. 270(43): p. 25488-25494. 85. Kuemmerle, J.F., K.S. Murthy, and G.M. Makhlouf, Longitudinal smooth muscle of the mammalian intestine. Cell biochemistry and biophysics, 1998. 28(1): p. 31-44. 86. Park, H. and M.-m. Poo, Neurotrophin regulation of neural circuit development and function. Nature Reviews Neuroscience, 2012. 14(1): p. 7-23. 87. Kuczewski, N., C. Porcher, and J.L. Gaiarsa, Activity‐dependent dendritic secretion of brain‐derived neurotrophic factor modulates synaptic plasticity. European Journal of Neuroscience, 2010. 32(8): p. 1239-1244. 88. Teng, B.Q., et al., Expression of endothelial nitric oxide synthase in human and rabbit gastrointestinal smooth muscle cells. American Journal of Physiology-Gastrointestinal and Liver Physiology, 1998. 275(2): p. G342. 89. Schmittgen, T.D. and K.J. Livak, Analyzing real-time PCR data by the comparative CT method. Nature protocols, 2008. 3(6): p. 1101-1108. 90. Schmittgen, T.D. and B.A. Zakrajsek, Effect of experimental treatment on housekeeping gene expression: validation by real-time, quantitative RT-PCR. Journal of biochemical and biophysical methods, 2000. 46(1): p. 69-81.
138
91. Murthy, K.S. and G.M. Makhlouf, Differential coupling of muscarinic m2 and m3 receptors to adenylyl cyclases V/VI in smooth muscle. Journal of Biological Chemistry, 1997. 272(34): p. 21317-21324. 92. Reichenstein, M., M. Rehavi, and A. Pinhasov, Involvement of pituitary adenylate cyclase activating polypeptide (PACAP) and its receptors in the mechanism of antidepressant action. Journal of molecular neuroscience, 2008. 36(1): p. 330-338. 93. Thompson, M., et al., Neurotrophins In Hyperoxia-Induced Enhancement Of Airway Smooth Muscle [Ca2+] i. Am J Respir Crit Care Med, 2010. 181: p. A5307. 94. Kolarow, R., T. Brigadski, and V. Lessmann, Postsynaptic Secretion of BDNF and NT-3 from Hippocampal Neurons Depends on Calcium–Calmodulin Kinase II Signaling and Proceeds via Delayed Fusion Pore Opening. The Journal of neuroscience, 2007. 27(39): p. 10350-10364. 95. Goodman, L.J., et al., Regulated release and polarized localization of brain-derived neurotrophic factor in hippocampal neurons. Molecular and Cellular Neuroscience, 1996. 7(3): p. 222-238. 96. Boulanger, L. and M. Poo, Gating of BDNF-induced synaptic potentiation by cAMP. Science, 1999. 284(5422): p. 1982-1984. 97. Cheng, P.L., et al., Self-amplifying autocrine actions of BDNF in axon development. Proceedings of the National Academy of Sciences, 2011. 108(45): p. 18430-18435. 98. Kidane, A.H., E.W. Roubos, and B.G. Jenks, Pituitary adenylate cyclase-activating polypeptide regulates brain-derived neurotrophic factor exon IV expression through the VPAC1 receptor in the amphibian melanotrope cell. Endocrinology, 2008. 149(8): p. 4177-4182. 99. Murthy, K., et al., Characterization of PACAP receptors and signaling pathways in rabbit gastric muscle cells. American Journal of Physiology-Gastrointestinal and Liver Physiology, 1997. 272(6): p. G1391. 100. Pellegri, G., P.J. Magistretti, and J.L. Martin, VIP and PACAP potentiate the action of glutamate on BDNF expression in mouse cortical neurones. European Journal of Neuroscience, 2009. 10(1): p. 272-280. 101. De Schepper, H.U., et al., Functional characterisation of tachykinin receptors in the circular muscle layer of the mouse ileum. Regulatory Peptides, 2005. 130(3): p. 105-115. 102. Zhou, P., et al., Polarized signaling endosomes coordinate BDNF-induced chemotaxis of cerebellar precursors. Neuron, 2007. 55(1): p. 53-68. 103. Minichiello, L., TrkB signalling pathways in LTP and learning. Nature Reviews Neuroscience, 2009. 10(12): p. 850-860. 104. Sariola, H., The neurotrophic factors in non-neuronal tissues. Cellular and Molecular Life Sciences, 2001. 58(8): p. 1061-1066. 105. Prakash, Y., et al., Neurotrophins in lung health and disease. Expert review of respiratory medicine, 2010. 4(3): p. 395-411. 106. Ochodnicky, P., et al., Neurotrophins as regulators of urinary bladder function. Nature Reviews Urology, 2012. 107. Schäper, C., et al., Nerve growth factor synthesis in human vascular smooth muscle cells and its regulation by dexamethasone. Regulatory Peptides, 2009. 157(1): p. 3-7. 108. Kurahashi, M., et al., Platelet‐derived growth factor signals play critical roles in differentiation of longitudinal smooth muscle cells in mouse embryonic gut. Neurogastroenterology & Motility, 2008. 20(5): p. 521-531.
139
109. Graham, M.F., et al., Corticosteroids increase procollagen gene expression, synthesis, and secretion by human intestinal smooth muscle cells. Gastroenterology, 1995. 109(5): p. 1454-1461. 110. Zimmermann, E., et al., IGF-I induces collagen and IGFBP-5 mRNA in rat intestinal smooth muscle. American Journal of Physiology-Gastrointestinal and Liver Physiology, 1997. 273(4): p. G875-G882. 111. Van Assche, G., et al., Neurotransmitters modulate cytokine-stimulated interleukin 6 secretion in rat intestinal smooth muscle cells. Gastroenterology, 1999. 116(2): p. 346- 353. 112. Kuemmerle, J.F. and H. Zhou, Insulin-like growth factor-binding protein-5 (IGFBP-5) stimulates growth and IGF-I secretion in human intestinal smooth muscle by Ras- dependent activation of p38 MAP kinase and Erk1/2 pathways. Journal of Biological Chemistry, 2002. 277(23): p. 20563-20571. 113. Kemi, C., et al., Differential regulation of neurotrophin expression in human bronchial smooth muscle cells. Respiratory research, 2006. 7(1): p. 18. 114. Chen, Z.-Y., et al., Sortilin controls intracellular sorting of brain-derived neurotrophic factor to the regulated secretory pathway. The Journal of neuroscience, 2005. 25(26): p. 6156-6166. 115. Frechilla, D., et al., BDNF mediates the neuroprotective effect of PACAP-38 on rat cortical neurons. Neuroreport, 2001. 12(5): p. 919-923. 116. Johansson, M., et al., New aspects concerning ulcerative colitis and colonic carcinoma: Analysis of levels of neuropeptides, neurotrophins, and TNFalpha/TNFreceptor in plasma and mucosa in parallel with histological evaluation of the intestine. Inflammatory bowel diseases, 2008. 14(10): p. 1331-1340. 117. Aziz, Q., Pharmacology of inflammatory pain: Central changes. IBD AND IBS: NOVEL MECHANISMS AND FUTURE PRACTICE, 2009. 118. Tao, X., et al., Ca< sup> 2+ Influx Regulates< i> BDNF Transcription by a CREB Family Transcription Factor-Dependent Mechanism. Neuron, 1998. 20(4): p. 709- 726. 119. West, A.E., et al., Colloquium Paper: Calcium regulation of neuronal gene expression. Science Signalling, 2001. 98(20): p. 11024. 120. Meuchel, L.W., et al., Neurokinin-neurotrophin interactions in airway smooth muscle. American Journal of Physiology-Lung Cellular and Molecular Physiology, 2011. 301(1): p. L91-L98. 121. Lin, Y.-T., et al., Up-regulation of dorsal root ganglia BDNF and trkB receptor in inflammatory pain: an in vivo and in vitro study. Journal of Neuroinflammation, 2011. 8(1): p. 126. 122. Karagiannides, I. and C. Pothoulakis, Substance P, obesity, and gut inflammation. Current Opinion in Endocrinology, Diabetes and Obesity, 2009. 16(1): p. 47-52. 123. Weinstock, J.V., The role of substance P, hemokinin and their receptor in governing mucosal inflammation and granulomatous responses. Front Biosci, 2004. 9: p. 1936- 1943. 124. Brain, S.D., Sensory neuropeptides: their role in inflammation and wound healing. Immunopharmacology, 1997. 37(2): p. 133-152.
140
125. Vries, A.d., et al., The role of sensory nerve endings in nerve growth factor‐induced airway hyperresponsiveness to histamine in guinea‐pigs. British journal of pharmacology, 2009. 134(4): p. 771-776. 126. Biggs, J.E., et al., Is BDNF sufficient for information transfer between microglia and dorsal horn neurons during the onset of central sensitization? Molecular pain, 2010. 6(1): p. 44. 127. Warnecke, A., et al., Stable release of BDNF from the fibroblast cell line NIH3T3 grown on silicone elastomers enhances survival of spiral ganglion cells< i> in vitro and< i> in vivo. Hearing Research, 2012. 128. Nawa, H., J. Carnahan, and C. Gall, BDNF protein measured by a novel enzyme immunoassay in normal brain and after seizure: partial disagreement with mRNA levels. European Journal of Neuroscience, 2006. 7(7): p. 1527-1535. 129. Kidane, A.H., E.W. Roubos, and B.G. Jenks, PACAP regulates BDNF exon IV expression through the VPAC1 receptor in the amphibian melanotrope cell. Endocrinology, 2008. 130. Murthy, K., et al., Interplay of VIP and Nitric Oxide in the Regulation of Neuromuscular Function in the Guta. Annals of the New York Academy of Sciences, 1996. 805(1): p. 355-362. 131. Patterson, S.L., et al., Some forms of cAMP-mediated long-lasting potentiation are associated with release of BDNF and nuclear translocation of phospho-MAP kinase. Neuron, 2001. 32(1): p. 123-140. 132. Castagliuolo, I., et al., Protective effects of neurokinin‐1 receptor during colitis in mice: role of the epidermal growth factor receptor. British journal of pharmacology, 2009. 136(2): p. 271-279. 133. Lallemend, F., et al., Substance P protects spiral ganglion neurons from apoptosis via PKC‐Ca2+‐MAPK/ERK pathways. Journal of neurochemistry, 2003. 87(2): p. 508-521. 134. Chai, N.-L., et al., Effects of neurotrophins on gastrointestinal myoelectric activities of rats. WORLD JOURNAL OF GASTROENTEROLOGY, 2003. 9(8): p. 1874-1877. 135. Goggi, J., et al., Modulation of neurotransmitter release induced by brain-derived neurotrophic factor in rat brain striatal slices in vitro. Brain research, 2002. 941(1): p. 34-42. 136. Bercik, P., et al., Immune-mediated neural dysfunction in a murine model of chronic Helicobacter pylori infection. GASTROENTEROLOGY-BALTIMORE THEN PHILADELPHIA-, 2002. 123(4): p. 1205-1215. 137. Mizutani, T., et al., Persistent gut motor dysfunction in a murine model of T‐cell‐induced enteropathy. Neurogastroenterology & Motility, 2010. 22(2): p. 196-e65. 138. Akiho, H., et al., Cytokine modulation of muscarinic receptors in the murine intestine. American Journal of Physiology-Gastrointestinal and Liver Physiology, 2007. 293(1): p. G250-G255. 139. Kinoshita, K., et al., Role of TNF‐α in muscularis inflammation and motility disorder in a TNBS‐induced colitis model: clues from TNF‐α‐deficient mice. Neurogastroenterology & Motility, 2006. 18(7): p. 578-588. 140. Radojevic, N., et al., Characterization of enteric functional changes evoked by in vivo anti-CD3 T cell activation. American Journal of Physiology-Regulatory, Integrative and Comparative Physiology, 1999. 276(3): p. R715-R723.
141
141. Jang, S.-W., et al., A selective TrkB agonist with potent neurotrophic activities by 7, 8- dihydroxyflavone. Proceedings of the National Academy of Sciences, 2010. 107(6): p. 2687-2692. 142. Andero, R., et al., Effect of 7, 8-dihydroxyflavone, a small-molecule TrkB agonist, on emotional learning. American Journal of Psychiatry, 2011. 168(2): p. 163-172. 143. Mantilla, C.B. and L.G. Ermilov, The novel TrkB receptor agonist 7, 8‐dihydroxyflavone enhances neuromuscular transmission. Muscle & nerve, 2012. 45(2): p. 274-276. 144. Caldeira, M.V., et al., BDNF regulates the expression and traffic of NMDA receptors in cultured hippocampal neurons. Molecular and Cellular Neuroscience, 2007. 35(2): p. 208-219. 145. Zheng, Z., B. Sabirzhanov, and J. Keifer, Oligomeric amyloid-β inhibits the proteolytic conversion of brain-derived neurotrophic factor (BDNF), AMPA receptor trafficking, and classical conditioning. Journal of Biological Chemistry, 2010. 285(45): p. 34708- 34717. 146. Millar, N.S. and P.C. Harkness, Assembly and trafficking of nicotinic acetylcholine receptors (Review). Molecular membrane biology, 2008. 25(4): p. 279-292.
142
VITA
CONTACT INFORMATION:
Mohammad Abdelkarim Al Qudah Jordan University of Science and Technology B.O Box: 3030 Irbid 22110 Jordan Tel: 00962-2-7201000 Ext. 23676 [email protected]
EDUCATION:
Ph.D. in Physiology, Virginia Commonwealth University (2013)
B.S. in Dental Surgery, Jordan University of Science and Technology (2005)
HONORS AND AWARDS:
Ramsey Award (2010), first year student in the PhD program with highest academic standing, department of physiology and biophysics-VCU. Charles C. Clayton Award (2012), outstanding rising second year graduate student in the biomedical sciences, school of medicine-VCU. Member of the Honor Society of Phi Kappa Phi.
TEACHING EXPERIENCE:
Anatomy Lab Teaching Assistant, Jordan University of Science and Technology (2005- 2009) Human Physiology Lab Teaching Assistant, Virginia Commonwealth University (2011)
143