A Gabaergic Projection from the Central Nucleus of the Amygdala to the Ventrolateral Periaqueductal Gray: Functional Implications and Modulation by Orexin

A GABAergic projection from the central nucleus of the amygdala to the ventrolateral periaqueductal gray: functional implications and modulation by orexin

Nicholas Olsen

A thesis in fulfilment of the requirements for the degree of

Doctor of Philosophy

UNSW

School of Medical Sciences

Faculty of Medicine

August 2013

Table of Contents Acknowledgements, Copyright & Permissions ...... 11

Abbreviations ...... 12

Chapter 1 Literature review...... 13

1.1 Part 1: Recent history of the role of the central nucleus of the amygdala in the expression of conditioned fear ...... 13

1.1.1 Early evidence of excitatory descending projections from the CeA ...... 16

1.1.2 Recent evidence demonstrates that most CeA neurons are GABAergic ...... 17

1.1.3 Glutamatergic neurons in the CeA? ...... 19

1.1.4 Functional implications: Separate projection neurons in the CeA may project to different efferent targets ...... 21

1.1.5 Despite evidence that CeA output neurons were mostly GABAergic, the activation of CeM neurons during conditioned fear continued to be hypothesised...... 22

1.1.6 Conditioned fear to a discrete stimulus is associated with phasic activation of the CeM ...... 24

1.1.7 It is currently unclear whether long-duration (sustained) re-exposure to a feared context is associated with increased activity of CeM neurons...... 24

1.2 Part 2: The role of the CeA in various forms of conditioned and unconditioned fear and stress ...... 25

1.2.1 The CeA may not be involved, or inversely associated with behavioural and physiological signs of fear and anxiety in some situations...... 25

1.2.2 Active and passive coping responses are organised in the CeA ...... 27

1.2.3 Active conditioned fear responses are strongly correlated with activity in the CeM: The VLPAG and the LPAG ...... 27

1.2.4 The medial prefrontal cortex selects active and passive coping responses...... 28

1.2.5 Can the CeM trigger both active and passive coping responses? ...... 29

1.2.6 How does activation of a presumed GABAergic CeA-PAG projection mediate freezing? ...... 30

1.2.7 The CeA-PAG-RVM pathway ...... 30

1.2.8 The role of the central extended amygdala in cardiovascular responses to conditioned fear ...... 32

1.2.9 The CeA-VLPAG pathway is not necessary for unconditioned fear and freezing ...... 34

1.2.10 Freezing responses to a contextual CS involves neuroanatomical pathways distinct from those involved in fear to a discrete CS ...... 35

1.2.11 Different roles of the BNST and CeA in long duration contextual conditioning versus short duration, discrete conditioned stimuli ...... 36

1.2.12 Reciprocal inhibition between the BNST and CeA...... 37

1.2.13 Could inhbition of the CeM enhance freezing to a sustained CS? ...... 37

1.2.14 Fos expression and activated projections to the VLPAG during conditioned fear to context ...... 38

1.2.15 Hypothesis of a neural network mediating conditioned fear to context ...... 39

1.2.16 Orexin appears to selectively activate CeM neurons ...... 41

1.3 Part 3: The role of orexin in active and passive coping, conditioned fear and anxiety ...... 43

1.3.1 Active and passive coping ...... 43

1.3.2 Conditioned fear involves components of both active-coping and passive-coping ...... 44

1.3.3 The VLPAG and PeF/LH mediate different components of the conditioned fear response ...... 45

1.3.4 Brief review of orexin ...... 46

1.3.5 Orexin and orexin-containing neurons are key substrates of active defensive responses ...... 47

1.3.6 Orexin enhances motor and sympathetic activity ...... 48

1.3.7 Orexin activates multiple arousal systems ...... 48

1.3.8 The orexin system is recruited for active coping ...... 49

1.3.9 Orexin and passive coping ...... 50

1.3.10 Orexin, anxiety and mood ...... 51

1.3.11 Orexin activates the HPA axis and enhances anxiety via CRF pathways ...... 52

1.3.12 The role of orexin in conditioned fear ...... 52

1.3.13 Is the pattern of orexin neuron activation similar or different in separate emotional states associated with arousal? ...... 54

1.4 Part 4: Summary, Hypotheses and Aims ...... 55

1.4.1 Summary ...... 55

1.4.2 General aims and hypotheses of this thesis ...... 57

1.4.3 Specific aims and approaches of this thesis ...... 58

Chapter 2 The projection from the CeA to the VLPAG is GABAergic, and does not display Fos expression after sustained re-exposure to a feared context...... 59

2.1 Introduction ...... 59

2.2 Methods ...... 61

2.3 Results ...... 66

2.3.1 GAD67 and VGLUT1 expression in VLPAG projecting amygdala neurons ...... 66

2.3.2 Conditioned Fear-evoked Fos expression in VLPAG-projecting amygdaloid neurons ...... 76

2.4 Discusssion ...... 82

2.4.1 Methodological considerations ...... 82

2.4.2 Most VLPAG-projecting neurons in the CeA are GABAergic, and lack VGLUT1 and VGLUT2 mRNA...... 83

2.4.3 Other amygdaloid projections to the VLPAG ...... 84

2.4.4 Neurochemical organisation of the amygdala...... 85

2.4.5 Few VLPAG-projecting neurons in the CeA expressed Fos after contextual fear...... 86

2.4.6 VLPAG-projecting neurons in the MeV were activated by conditioned fear to context ...... 88

2.4.7 Differential modulation of CeA activity in different forms of fear, anxiety, stress and antinociception ...... 90

2.4.8 How does activation of the CeM induce freezing? ...... 91

2.4.9 Could inhibition of CeM-VLPAG neurons also induce freezing? ...... 92

2.5 Conclusion ...... 93

Chapter 3 Behavioural and physiological responses to microinjection of orexin-A in the CeA of conscious, freely moving rats ...... 94

3.1 Introduction ...... 94

3.2 Methods ...... 96

3.3 Results ...... 98

3.3.1 Category 1 - Sites of injection centred bilaterally in the CeA ...... 99

3.3.2 Category 2 - Sites of injection centred bilaterally in the CeA or within 0.5 mm ...... 104

3.3.3 Category 3 - Sites of injection in which at least one site was centred within the CeA ...... 108

3.4 Discussion ...... 111

3.4.1 Methodological considerations ...... 111

3.4.2 Locomotor activity ...... 112

3.4.3 Heart rate, blood pressure and tail temperature ...... 115

3.4.4 Tail temperature ...... 118

3.4.5 Arousal and wakefulness ...... 118

3.4.6 Coupling of anxiety and arousal with locomotor activity and sympathoexcitation ...... 120

3.5 Conclusion ...... 120

Chapter 4 Behavioural and physiological responses to microinjection of orexin-A in the CeA of rats re-exposed to a feared context ...... 123

4.1 Introduction ...... 123

4.2 Methods ...... 124

4.3 Results ...... 127

4.3.1 Category 1 - Sites of injection bilaterally centred in the CeA ...... 128

4.3.2 Category 2 - Sites of injection in which at least one site was centred in the CeA ...... 135

4.4 Autonomic balance in conditioned fear to a context versus return to homebox 141

4.5 Discussion ...... 145

4.5.1 Methodological considerations ...... 146

4.5.2 Interpretation 1: Activation of CeM neurons by orexin may have a direct inhibitory effect on conditioned fear responses ...... 147

4.5.3 Interpretation 2: Orexin-A injection in the CeA may have impaired extinction or enchanced reconsolidation ...... 150

4.5.4 Extinction ...... 150

4.5.5 Brief review of reconsolidation ...... 151

4.5.6 Evidence of orexin as a critical mediator of consolidation and reconsolidation 151

4.5.7 Where is the memory trace? ...... 153

4.5.8 Plastic changes in the BLA and CeA are necessary for fear acquisition and consolidation to both contextual and discrete cues ...... 153

4.5.9 Similarities and differences in fear memory traces to contextual and discrete cues ...... 155

4.5.10 Orexin in the CeA may facilitate (re)consolidation through multiple mechanisms ...... 156

4.5.11 Effect of arousal on consolidation...... 160

4.5.12 Locomotor and cardiovascular effects of orexin ...... 161

4.5.13 The effects of orexin were state dependent ...... 161

4.5.14 Anxiolysis or active coping? ...... 162

4.5.15 Autonomic balance in conditioned fear to a context ...... 162

4.6 Conclusion ...... 163

Chapter 5 Behavioural and physiological responses to microinjection of orexin-A in the VLPAG of conscious, freely moving rats ...... 165

5.1 Introduction ...... 165

5.2 Methods ...... 167

5.3 Results ...... 170

5.3.2 Category one - Sites of injection bilaterally centred inside, or within 0.5 mm ventral of the VLPAG ...... 170

5.3.3 Category 2: Sites of injection in which at least one site was centred within the VLPAG ...... 174

5.3.4 Category 3: Injections bilaterally centred within the VLPAG/LDTg/DR, and sites of injection in with at least one site was centred in the VLPAG ...... 177

5.3.5 Category 4: Sites of injection in which one site was located in the LPAG ...... 180

5.4 Discussion ...... 184

5.4.1 The general effects of orexin in the CeM-VLPAG-RVM pathway are consistent with known functions of the orexin system ...... 185

5.4.2 Possible mechanism of action ...... 186

5.4.3 Methodological considerations ...... 187

5.4.4 Effect on arousal ...... 189

5.5 Conclusion ...... 189

Chapter 6 General Discussion ...... 191

6.1 The role of the CeM in conditioned fear to a short-duration versus long-duration CS ...... 191

6.2 Could activation and inhibition of the CeM be associated with conditioned fear responses? ...... 194

6.3 Microinjection of orexin in the CeA increases active coping responses ...... 196

6.4 GABAergic CeM neurons may project mainly to VLPAG output neurons ...... 196

6.5 Orexin may inhibit extinction or facilitate reconsolidation via the CeA ...... 199

Chapter 7 Future directions: Testable hypotheses arising from this thesis ...... 199

Chapter 8 The orexin system is implicated in various pathological states ...... 201

8.1 Orexin antagonists could prevent and treat PTSD ...... 201

8.2 Inhibition of the orexin system is linked to obesity, depression and chronic PTSD ...... 202

8.3 How is the orexin system suppressed in depression and chronic PTSD? ...... 203

8.4 The orexin system in stress-induced reinstatement of drug seeking ...... 203

8.5 Melancholic depression ...... 204

References ...... 207

Appendix ...... 243

Acknowledgements

I would firstly like to thank Associate Professor Pascal Carrive (Department of Anatomy, School of Medical Sciences, Faculty of Medicine, University of New South Wales) for his guidance, patience, enthusiasm about science which was always contagious, and encouraging me to pursue my interests and ideas. Thanks also for generously spending time inserting telemetric probes, suggestions and editing of the thesis, and for always taking the time to speak with me to discuss things, even on your weekends or when you were busy. That meant a lot. I especially enjoyed our discussions about the emotional brain.

I would like to thank and acknowledge the assistance of Professor Ann Goodchild and Dr Natasha Kumar for the use of their molecular laboratory at ASAM at Macquarie University, and in demonstration and assistance with the in situ hybridisation study. Also, thanks to all of the friendly, welcoming and helpful people at ASAM for their kind assistance in the lab. It was a pleasure to work there.

Thanks to Associate Professor Kevin Keay and Professor Richard Bandler at Sydney University for interesting lectures and group discussions about emotional coping while I was an undergraduate. Thanks to my co-supervisor, Professor Gavan McNally (School of Psychology, Faculty of Science, University of New South Wales) for helpful and interesting discussions about learning and memory.

Thanks to Dr Leanne Luong and Dr Daniel Vianna for assistance in inserting telemetric probes, as well as being a great source of information and experience with lab work. I really enjoyed the time we spent together in and out of the lab. Thanks to Bruno Dampney and Dr Irfan Beig for being such nice lab mates in the short time we worked together.

Thanks to Mariz Manansala for help with graphics, formatting and making me smile everyday.

Thanks to Andrew Collins, Dylan Bailey, Ben Pike and Dr Barry Davey for being great sources of humour, encouragement and wisdom.

Finally, thanks to Toby, my parents and grandparents for all of their love and support. Correspondence: [email protected]

Permission to reproduce Figures 1.1, 1.2 and 1.5 must be sought from the publishers of these materials. Figure 1.1 originally appeared in: Davis, M. (1992) in The Amygdala: Neurobiological Aspects of Emotion, Memory, and Mental Dysfunction (Aggleton, J. P., ed.), pp. 255-306, John Wiley-Liss and Sons 1992. Permission was granted to use this figure in this thesis by Wiley and Sons (© 1992 John Wiley-Liss and Sons). This permission does not include the right to grant others permission to photocopy or otherwise reproduce this material except for accessible versions made by non-profit organizations serving the blind, visually impaired and other persons with print disabilities (VIPs). Permission to reproduce Figure 1.1 was also granted by Trends in Neuroscience (© 1994 Elsevier Science Ltd), where it was adapted. Permission to reproduce Figure 1.2 was granted by The Journal of Neuroscience (© 1994). Permission to reproduce Figure 1.5 was granted by Neroscience (© 2002 Elsevier). 11

Abbreviations

a.u. arbitrary units MCH Melanin-concentrating hormone Aco Anterior cortical amygdala Medial nucleus of the amygdala, MeD dorsal division ANOVA Analysis of variance Medial nucleus of the amygdala, MeV ventral division BAT Brown adipose tissue mPFC Medial prefrontal cortex BF Basal forebrain mPFC Medial prefrontal cortex BLA Basolateral amygdala MPO Medial preoptic area BMA Basomedial amygdala NPO Nucleus pontis oralis BNST Bed nucleus of the stria terminalis NRA Nucleus retroambiguus BP Blood pressure NTS Nucleus of the solitary tract CeA Central nucleus of the amygdala ORX1 Orexin 1 receptor CeC Central nucleus of the amygdala, ORX2 capsular division Orexin 2 receptor CeL Central nucleus of the amygdala, PAG lateral division Periaqueductal gray CeM Central nucleus of the amygdala, PeF medial division Perifornical hypothalamus CRF Corticotropin-releasing factor PNC Caudal pontine reticular nucleus CS Conditioned stimulus/stimuli PrL Prelimbic cortex CSF Cerebrospinal fluid PTSD Post traumatic stress disorder CTB Cholera toxin, subunit B Paraventricular nucleus of the PVH hypothalamus DMH Dorsomedial hypothalamus PVT Paraventricular thalamus DR Dorsal Raphe RMTg Rostromedial tegmental nucleus DVC Dorsal vagal complex RVLM rostral ventrolateral medulla GAD65 Glutamic acid decarboxylase 65 RVM kDa isoform Rostral ventromedial medulla GAD67 Glutamic acid decarboxylase 67 SI kDa isoform Substantia innominata HR Heart rate st Stria terminalis IC Intercalated cells LC Locus Coeruleus Ttail LA Lateral amygdala Tail temperature LDTg Laterodorsal tegmental nucleus VGLUT1 Vesicular glutamate transporter 1 LH Lateral hypothalamus VGLUT2 Vesicular glutamate transporter 2 LPAG Lateral periaqueductal gray VLPAG Ventrolateral periaqueductal gray LPB Lateral parabrachial nucleus VTA Ventral tegmental area MAP Mean arterial pressure

Chapter 1 Literature review

1.1 Part 1: Recent history of the role of the central nucleus of the amygdala in the expression of conditioned fear

For many years the amygdala has been known to be involved in a variety of emotional behaviours (Bucy and Kluver, 1955) and conditioned behavioural responses (Blanchard and Blanchard, 1972; Coover et al., 1973; Kellicutt and Schwartzbaum, 1963; Pellegrino, 1968). Further, stimulation of the basolateral (BLA) and central amygdala (CeA) has long been known to produce behavioural and cardiovascular responses that were similar to the ‘defense response’ elicited by hypothalamic stimulation which included alerting and arousal, a pressor or depressor response, bradycardia and tachycardia (Reis & Oliphant, 1964), pupil dilation, pilo-erection and muscle vasodilation in the cat, cessation of spontaneous activity, vigilance, sniffing, chewing, swallowing, crouching with flattened ears, fear and defensive anger, growling, hissing and flight (Fernandez de Molina and Hunsperger, 1959; Heinemann et al., 1973b; Hilton and Zbrozyna, 1963; Kaada et al., 1954). The fact that these responses were so similar to those obtained by stimulation of the hypothalamus and periaqueductal gray (PAG), and that lesions of the hypothalamus and PAG blocked the effects of amygdala stimulation (Hunsperger, 1956a, 1956b), led Fernandez de Molina & Hunsperger (1959) to suggest that the hypothalamus and PAG mediated these behavioural responses to amygdala stimulation via its projection through the stria terminalis. Hilton and Zbrozyna (1963) showed that the functional-anatomical pathway from the amygdala to the hypothalamus could also be mediated through the ventral amygdalofugal pathway.

However, to the best of our knowledge, the first study which proposed the basic functional anatomical network (which is still generally accepted) linking the role of the central nucleus of the amygdala in conditioned emotional responses with its effects on autonomic function was in 1979, by Kapp and colleagues (Kapp et al., 1979). This group demonstrated that the central nucleus of the amygdala mediated the conditioned bradycardia response to a tone that was previously paired with shock in the rabbit. Importantly, lesions of the CeA did not affect baseline heart rate, suggesting a specific role in conditioned emotional responses. The authors were aware that the CeA - especially its medial division (CeM) - was the only part of the amygdala that projected to the dorsal vagal complex (DVC) (Hopkins and Holstege, 1978), which provided an anatomical pathway for the CeA to induce bradycardia, which was known to be mediated by the vagus nerve (Fredericks et al., 1974). The authors also suggested that the basolateral amygdala, which was well known to elicit cardiovascular features of the defense response upon stimulation, as well as being necessary for conditioned fear responses, probably mediated these effects through its projection to the CeA, since only the CeA projected to known 13 structures involved in generating bradycardia: the hypothalamus and vagomotor centres in the medulla via the ventral amygdalofugal pathway (Hopkins and Holstege, 1978; Krettek and Price, 1978). Thus, fear memories triggered in the basolateral complex could affect neural activity in the CeA, which affected activity in the brainstem, leading to physiological changes. This basic circuit is still generally accepted, however there is strong evidence for an inhibitory interface between the basolateral complex (BLA) and CeM (Collins and Paré, 1999; Herry et al., 2008; Rosenkranz et al., 2006; Tye et al., 2011).

This research by Kapp and colleagues was soon followed by the publication of another classic paper (Pascoe and Kapp, 1985) showing that brainstem-projecting neurons in the CeA were inhibited by presentation of a conditioned stimulus (CS) in rabbits. These results were surprising at the time because previous research by the same group had shown that electrical stimulation of the CeM - which contains the most brainstem-projecting neurons (Danielsen et al., 1989; Hopkins and Holstege, 1978; Petrovich and Swanson, 1997; Rizvi et al., 1991; Veening et al., 1984) - reliably produced cardioinhibitory and depressor responses in anaesthetised rabbits (Kapp et al., 1982), similar to the bradycardia observed in the conditioned fear response. However, this response was not evoked by stimulation of the CeL or CeC. Selective stimulation of the CeM also reliably and simultaneously evoked bradycardia and behavioural arrest - which would now be described as freezing - in conscious rabbits (Applegate et al., 1982). This study (Pascoe and Kapp, 1985) also reported the surprising finding that only non brainstem-projecting neurons were correlated with heart rate. These cells formed two classes: those in which spiking frequency was negatively associated with heart rate (HR), and spiking frequency was increased by CS exposure; and those in which spiking frequency was positively correlated with HR but were inhibited by the CS. Three other class of CeA neurons were identified, all of which were activated by the CS. It was suggested that these cells may mediate their effects on cardiovascular responses via projections to the hypothalamus.

In the mid to late 1980’s, LeDoux and colleagues published a series of papers which advanced a major conceptual leap forward: that the activation of the CeA mediated multiple components of the conditioned fear response through diverging, separate, direct projections to the hypothalamus and midbrain (Iwata and LeDoux, 1988; Iwata et al., 1987, 1986b; LeDoux et al., 1988). Specifically, the terminal field of CeA projections in the lateral hypothalamus (LH) was lesioned, and this prevented pressor responses to a CS, but had no effect on freezing behaviour. In contrast, lesioning the periaqueductal gray (PAG) strongly reduced the freezing response, but had no effect on blood pressure (LeDoux et al., 1988). LeDoux et al. also showed that conditioned fear in rats (unlike rabbits) involved a strong sympathetic activation as well as parasympathetic activation (Iwata and LeDoux, 1988), and that the dominant cardiovascular

14 effects were tachycardia and pressor response (Iwata and LeDoux, 1988; Iwata et al., 1987, 1986b). Finally, this group concluded their 1987 paper with the following point: “…the electrical stimulus [of the CeA] is activating the same autonomic efferent pathway as the conditioned stimulus” (Iwata et al., 1987). This was in contrast to the conclusion reached by Pascoe and Kapp (1985) that CeA output neurons to the brainstem are inhibited by the CS in the rabbit.

The work by LeDoux and colleagues was supported and extended by many other groups (for review see Davis, 1992a) which crystallised the notion that activation of the CeA mediated all the effects known to occur in the conditioned fear response through separate, direct, diverging projects. This was neatly captured in a now-famous diagram (Fig. 1.1; Davis 1992c). Further, based on research in his laboratory on fear-potentiated startle, Davis claimed in a highly cited review that “Activation of the central nucleus of the amygdala may be both necessary and sufficient to facilitate [fear-potentiated] startle through a direct connection to the nucleus reticularis pontis caudalis” and “The current hypothesis is that the conditioned stimulus activates the central nucleus of the amygdala” (Davis, 1992b). Finally, after an extensive review of the literature, Davis wrote “…behaviors seen during fear may result from activation of a single area of the brain [the amygdala, especially its central nucleus], which then projects to a variety of target areas, each of which is critical for specific symptoms of fear” (Davis, 1992a). These claims drew on extensive research by other groups showing that electrical and chemical stimulation of the amygdala reproduced the behavioural and physiological signs of fear (reviewed in Davis, 1992a).

Figure 1.1 Separate projections of the amygdala mediate different components of conditioned fear responses. Adapted with permission from Davis (1992c; © 1992 Wiley-Liss and Sons) and Davis et al. (1994; © 1994 Elsevier science Ltd). 15

1.1.1 Early evidence of excitatory descending projections from the CeA

Since CeA output neurons were thought to be activated in conditioned fear, and activation of downstream targets of the CeA was required for the expression of symptoms of fear (Davis et al., 1982; Miserendino and Davis, 1993; Sun and Guyenet, 1986; Zhang et al., 1990), it stood to reason that CeA neurons projecting to the hypothalamus and brainstem (located mainly in the CeM) would contain excitatory neurotransmitters. Furthermore, stimulation of the CeA was found to have an excitatory effect on neurons in the dorsal vagal complex, which receives dense projections from the CeA (Cox et al., 1986). In almost all neurons in the nucleus of the solitary tract (NTS) and DMV, the effect of CeA stimulation was excitatory (91/93 neurons) although the authors claimed that some inhibitory effects may have been missed due to low tonic activity of neurons in the DVC.

Around this time, some reports emerged of glutamatergic cells in the CeA. It was found that the in most divisions of the CeA, especially the lateral division (CeL) a moderate to dense distribution of cells were labelled with a glutamate antibody (McDonald et al., 1989). Interestingly, neuropil was more densely labelled for glutamate in the medial CeA than other parts of the CeA, suggesting a stronger glutamatergic input to CeA output neurons. Further, a retrograde tracing study of projections to the rostral ventrolateral (RVLM) from the CeM combined with glutamate immunohistochemistry revealed that 10-14 % of RVLM-projecting CeM neurons contained glutamate (Takayama and Miura, 1991).

Reports also emerged of GABAergic immunoreactive neurons in the CeA, whilst others found little or no evidence of GABAergic cells in the CeA. Utilising immunohistochemistry, one study reported that 40% of neurons in the CeL were GABAergic (Sun et al., 1994), however, this study and others which used the same technique reported few or no GABAergic cells in the CeM (McDonald and Augustine, 1993; Nitecka and Ben-Ari, 1987; Saggu and Lundy, 2008; Sun and Cassell, 1993; Sun et al., 1994). It was also demonstrated that the CeL contained GABAergic neurons which, when stimulated, induced a feed-forward inhibition of the CeM (Nose et al., 1991). However, one report showed that terminals from CeM projection neurons formed mostly symmetrical (presumed inhibitory) contacts on dendrites of C1 neurons in the RVLM (Cassell and Gray, 1989a) which provided some of the first evidence that neurons of the CeM contained GABA.

Research on neuropeptides had by this stage revealed that many CeA neurons - including those projecting to the brainstem - expressed and often co-expressed several different neuropeptides such as substance P, galanin, neurotensin, enkephalin, corticotropin-releasing factor (CRF), somatostatin, neuropeptide Y and vasointestinal peptide (Cassell and Gray, 1989b; Gray and

Magnuson, 1992, 1987; Gray et al., 1984; Honkaniemi, 1992; McDonald, 1989; Shimada et al., 1989; Veening et al., 1984). Some of the above findings were reviewed by Davis, Rainnie, & Cassell (1994) in a very influential paper (494 citations on web of science). The authors claimed that CeM output neurons were excitatory, utilising glutamate as a neurotransmitter, which was co-released with neuropeptides.

1.1.2 Recent evidence demonstrates that most CeA neurons are GABAergic

One month before this review was published, a study by (Pitkänen and Amaral, 1994) demonstrated using in situ hybridisation for glutamic acid decraboxylase (GAD65 and GAD67) mRNA in the monkey, that “virtually all of the central nucleus neurons contain mRNAs for GAD” and that the central amygdala contains a greater density of GABAergic neurons than any other nuclei in the amygdala. This study also described very few GABA immunoreactive neurons in the CeA, however other regions of the amygdala displayed similar levels of GAD mRNA positive neurons and GABA immunoreactive neurons (Fig. 1.2). The authors explained this lower level of GABA immunoreactivity was due to a much greater distance of axonal transport, since CeA projection neurons - especially in the medial division - project more extensively and further than other amygdaloid nuclei. These findings explained the relatively low numbers of GABAergic neurons identified in the CeM in research which utilised immunohistochemistry (Boissard et al., 2003; McDonald and Augustine, 1993; Nitecka and Ben-Ari, 1987; Saggu and Lundy, 2008; Sun and Cassell, 1993; Sun et al., 1994).

More recent work using electron microscopy (Jia et al., 2005; Jolkkonen et al., 2002; Jongen- Rêlo and Amaral, 1998; Nakamura et al., 2009; Oka et al., 2008; Pickel et al., 1996, 1995; Saha, 2005; Saha et al., 2002, 2000; Tsubouchi et al., 2007, 2007; Tsumori et al., 2010, 2006a, 2006b; Van Bockstaele et al., 1998, 1996; Yasui et al., 2004) and in situ hibridisation (Day et al., 1999; Myers et al., 2013; Niu et al., 2012; Oka et al., 2008; Poulin et al., 2008; Swanson and Petrovich, 1998; Wallén-Mackenzie et al., 2009) has corroborated the observation that most (around 90%) projection and local-circuit neurons in the CeA are GABAergic.

There are varying reports of the proportion of CeA neurons which are GABAergic versus glutamatergic or unlabelled. (Pitkänen and Amaral, 1994), Poulin et al. (2008) and Swanson & Petrovich (1998) observed an extremely dense distribution of GAD mRNA positive neurons in the CeA, which according to the cell density alone seems to suggest that CeA neurons are almost-exclusively GABAergic. However, to our knowledge, no study has counted the number of GAD mRNA neurons whilst co-labelling for a neuronal marker such as NeuN. There are also differences in the proportion of CeA terminals which make asymmetric (presumably excitatory and glutamatergic (Peters and Palay, 1996; Peters et al., 1991)) or symmetric (presumably

17 inhibitory (Cohen et al., 1977; Saha et al., 2000) and GABAergic (Pickel et al., 1988)) synaptic contacts with efferent targets. Interestingly, these differences appear to depend on the particular anatomical target of CeA efferents, as well as whether neuropeptides are co-expressed or not.

In a combined retrograde labelling/in situ hybridisation study, it was found that 69% of CeA neurons projecting to the LPAG were GABAergic (Oka et al., 2008). However, electron microscopy revealed that almost all (148/152) of CeA axons formed symmetric synapses onto LPAG neurons, suggesting that this pathway is almost entirely (> 97%) GABAergic. Further, 12% of these neurons made symmetrical contact onto glutamatergic LPAG neurons projecting to the nucleus retroambiguus (NRA) which controls vocalisation (Holstege, 1992).

Almost all CeA axon terminals in the nucleus of the solitary tract (NTS) make symmetric contacts on dendrites (Jia et al., 1997; Pickel et al., 1996, 1995; Saha et al., 2002, 2000), and are GABAergic. CeA terminals in the RVLM appear to form mainly symmetric synapses (Cassell and Gray, 1989a) however one study showed that they formed a mixture of asymmetric and symmetric synapses (Saha et al., 2005) on terminals in the RVLM, some of which are presympathetic neurons. Another study reported that 94% of CeA axons in the NTS and 90% in the ventrolateral medulla were immunoreactive for GABA (Jia et al., 1997), whilst another found that about 80% of CeA-RVLM neurons were GABAergic (Bowman et al., 2013).

The projection from the CeA to the parastrial nucleus of the bed nucleus of the stria terminalis (BNST) arises from the CeL, and is almost entirely GABAergic (Tsubouchi et al., 2007). Only 2 terminals formed asymmetric synapses onto dendrites or soma, whereas 99 formed symmetric synapses. This projection forms the first half of a disynaptic relay to the paraventricular hypothalamus (PVH).

Van Bockstaele and colleagues found mostly symmetric, but also some asymmetric synapses formed by CeA terminals onto neurons in the locus coruleus (LC) and pericoruleus (peri-LC) (Van Bockstaele et al., 1996). However, further research on the same projection by the same group found that a sub-group of CeA terminals which contained CRF and dynorphin (about 42% of CeA-LC projection neurons (Reyes et al., 2011) that terminated on either tyrosine hydroxylase (TH) or unlabelled dendrites, were twice as likely (62% vs 34%) to be asymmetric compared to symmetric (Reyes et al., 2011; Van Bockstaele et al., 1998), consistent with the excitatory effect of conditioned fear (Carrive, Kehoe, Macrae, & Paxinos, 1997; Ishida et al., 2002) and CRF from CeA terminals (Bouret et al., 2003; Curtis et al., 2002, 1997; Page and Abercrombie, 1999) on noradrenergic neurons in the LC. Interestingly, stimulation of the CeA causes multiphasic activation of 90% of neurons in the LC, and CRF antagonists injected in the LC have been shown to completely or partly abolish these short-latency responses (Bouret et al.,

2003), which strongly suggests that CRF plays the role of a fast excitatory neurotransmitter in projections of the CeA.

Multiple reports demonstrate that almost all axons projecting from the CeA to the LH are GABAergic, and almost all projections form symmetrical synapses onto neurons in the LH - however, occasionally axons lacking GABA immunoreactivity could be found and these formed asymmetric synapses (Nakamura et al., 2009; Tsumori et al., 2006a). Another study found that 10% of CeA axodendritic synapses in the LH were asymmetric (Tsumori et al., 2006b). Interestingly, many CeA projections - the vast majority of which were symmetrical and immunoreactive for GAD - have been shown to synapse onto orexin- and melanin-concentrating hormone (MCH) neurons (Nakamura et al., 2009; Sakurai et al., 2005; Yoshida et al., 2006). This is interesting because orexin neurons may be considered ‘output neurons’. Orexin neurons (especially around the perifornical area) are both presympathetic and premotor neurons and project directly to the spinal cord (Kerman et al., 2007), as well as projecting to multiple systems throughout the brain to increase arousal, wakefulness, motivated behaviour, locomotor activity and sympathetic activity in the case of orexin - in fact orexin may be necessary for the normal expression of the sympathomotor components of active defensive responses (Iigaya et al., 2012). Many MCH neurons (especially in the LH) are also presympathetic and premotor neurons and appear to be sympathoinhibitory (Egwuenu et al., 2012; Kerman et al., 2007). CeA neurons have also been shown to form symmetric contacts with NTS-projecting neurons in the LH (Tsumori et al., 2006a). Stimulation of this region of the LH which projects to the NTS produces bradycardia and depressor responses (Allen and Cechetto, 1992).

The projection to the parabrachial nucleus appears to be mostly GABAergic. It was found that 80% of CeA terminals formed symmetric synapses that were immunoreactive for GABA, and that 20% of CeA terminals lacked GAD and made asymmetric synaptic contacts (Jia et al., 2005). Consistent with a possibly lower level of GABAergic innervation of the parabrachial (PB) nucleus from CeA afferents, an in situ hybridisation study combined with retrograde tracing from the PB and the spinal and motor nuclei of the trigeminal nerve found that 50% of CeM-PB and 30% of CeL-PB neurons projection neurons contained GAD67 (Jongen-Rêlo & Amaral, 1998) in the macacque. Finally, 78% of CeA neurons projecting to retrorubral field neurons were immunoreactive for GAD, however almost all synapses were symmetrical (Tsumori et al., 2010).

1.1.3 Glutamatergic neurons in the CeA?

Similarly, earlier studies which reported glutamatergic neurons in the CeA (McDonald et al., 1989; Takayama and Miura, 1991) may have been superseded due to advances in labelling for

Figure 1.2 Comparison of the number of cells found to contain GAD65 mRNA, GAD67 mRNA or GABA immunoreactivity in different amygdaloid nuclei. Adapted with permission from Pitkänen and Amaral (1994). Abbreviations: AB - accessory basal nucleus; AHA - amygdalahippocampalarea; COa - anterior cortical nucleus; COp - posterior cortical nucleus; NLOT - nucleus of the lateral olfactory tract; PAC3 and PAC - subdivisions of the periamygdaloid cortex; PL - paralaminar nucleus. glutamatergic cells, which detect vesicular glutamate transporters (VGLUT1 and VGLUT2) with in situ hybridisation rather than intracellular metabolic glutamate, which is involved in the synthesis of GABA and protein, and is also found in GABAergic cells (Saha et al., 2005). Recent studies using in situ hybridisation for the detection of VGLUT1 and VGLUT2 found no glutamatergic neurons in the CeA of the rat, despite many other regions displaying robust expression of VGLUT1 & 2 (Kiss et al., 2013; Kudo et al., 2012; Niu et al., 2012; Oka et al., 2008; Poulin et al., 2008; Wallén-Mackenzie et al., 2009). However, it has been reported that many CeA neurons express VGLUT3 (Zhao et al., 2012), and photomicrographs of sections of the amygdala appear to show a dense expression of cells labelled with VGLUT3 mRNA in the CeA (Fremeau et al., 2002) - however another study reported an absence of VGLUT3 mRNA labelled cells in the amygdala (Herzog et al., 2004). Thus, it is presently unclear whether CeA neurons contain VGLUT3.

Some recent studies reported that 25% of projection neurons from the CeA to the nucleus pontis oralis (NPO) in rats are glutamatergic (Fung et al., 2011; Zhang et al., 2012). These findings were obtained using immunoreactivity for VGLUT2 antibodies combined with anterograde labelling in rats (Zhang et al., 2012) and retrograde labelling in guinea pigs (Fung et al., 2011). These results are consistent with findings showing that CeA stimulation causes fast-onset excitatory postsynaptic potentials (EPSPs) in the nucleus pontis oralis (NPO) in anaethetised rats (Xi et al., 2011; Zhang et al., 2012). This research appears to contrast with findings by Oka et al (2008) and Poulin et al (2008) that no glutamatergic neurons exist in the CeA, but may be

20 consistent with electron microscope findings which show small numbers (about 3 - 20%) of asymmetric terminals made by CeA neurons (see above).

Whilst controversy remains as to whether CeA neurons express glutamate, modern techniques such as RT-PCR reveal that the proportion of CeM and CeL output neurons expressing neuropeptides may be much higher than previously believed (Gray and Magnuson, 1992; Veening et al., 1984) - for example, out of 21 identified CeM-VLPAG neurons, 12 contained CRF, 4 contained substance P and 3 contained neurotensin (Chen et al., 2009) – higher than previous estimates. Similarly, (Reyes et al., 2011) found that about 42% of LC-projecting CeA neurons contained CRF and dynorphin. Interestingly, most of the CRF efferents to the LC emerge from the CeM and CeC (Retson and Van Bockstaele, 2013), in contrast to earlier reports, which mainly found CRF-containing brainstem-projecting neurons in the CeL (Gray and Magnuson, 1992; Veening et al., 1984). This study also found that 11 - 25% of CeM neurons projecting to the LC or dorsal raphe contained dynorphin or CRF (Retson and Van Bockstaele, 2013).

Interestingly, there are numerous reports of separate cell groups in the CeM which have different projections (Fritz et al., 2005; Thompson and Cassell, 1989; Viviani et al., 2011). It was shown by Fritz et al. (2005) that projections from the CeM to the caudal pontine reticular nucleus (PNC) - a critical structure in the fear potentiated startle response - and to the substantia innominata (SI) arose from different cells in the CeM. Furthermore, Vivani et al. (2011), elegantly demonstrated that the CeM contains one class of neurons projecting to the PAG which is inhibited by oxytocin, and another projecting to the DVC which is insensitive to oxytocin. Interestingly, the CeM contains different cell populations projecting to the medulla. One pathway projects to the ventrolateral medulla, and another to the dorsal vagal complex (Thompson and Cassell, 1989).

Interestingly, nociceptin/orphanin FQ has an antinociceptive effect when injected in the CeA (Shane et al., 2001), and hyperpolarises CeM-VLPAG neurons containing neurotensin and CRF, whilst nocistatin is also thought to exert an antinociceptive effect in the CeA (though this has not been shown), and activates CeM-VLPAG neurons containing substance P (Chen et al., 2009). Thus, descending antinociception may be mediated by the inhibition of some VLPAG- projecting CeM neurons (Chieng and Christie, 2010), and activation of others.

1.1.4 Functional implications: Separate projection neurons in the CeA may project to different efferent targets

What may be the function of separate descending pathways from the CeM, which may contain different neurotransmitters and peptides? This question requires more research but one may be 21 tempted to speculate that the CeA could discretely control different components of fear responses through different projections, depending on the requirements in the environment. This seems possible as different projections may be under the control of different peptides (Viviani et al., 2011). The CeA may be able to differentially activate pressor and depressor, tachycardia and bradycardia, and active or passive coping responses through different parallel pathways to the medulla and hypothalamus, depending on the requirements of the situation. Another interpretation is that the CeA may activate a mixture of excitatory and inhibitory projections to different structures to produce an integrated, consistent fear response.

These results indicate the possibility that diverging CeA efferent pathways may be either excitatory or inhibitory, suggesting that discrete cell groups within the CeM and CeL may differentially control separate components of the conditioned fear response through their separate projections to structures involved in mediating these responses, possibly by utilising different neurotransmitters and neuropeptides. Further research is required to determine: i) whether all CeA neurons are GABAergic and whether any contain glutamate, ii) which CeA efferent pathways contain excitatory versus inhibitory peptides, iii) which CeA projections neurons are common to different structures, and which are different; iv) what are the different afferents of these subpopulations; and v) which neurochemicals differentially activate or inhibit these putative separate subpopulations of projection neurons.

1.1.5 Despite evidence that CeA output neurons were mostly GABAergic, the activation of CeM neurons during conditioned fear continued to be hypothesised.

Perhaps surprisingly, given that CeM output neurons were found to be mostly GABAergic instead of glutamatergic, the basic model whereby conditioned stimuli activaye CeM neurons to produce the behavioural and autonomic components of fear was not changed (Paré et al., 2004). However, a large body of evidence had grown (reviewed in Davis, 2000) which indicated that electical and chemical stimulation of the CeA and the CeM - for example by activating neuropeptide receptors exclusively expressed in the medial division of the CeA such as the vasopressin receptor (Roozendaal et al., 1993b, 1992b) - could reproduce or enhance some components of conditioned fear. Further, numerous studies demonstrated that inhibition of the CeA produced anxiolytic effects (Davis, 2000).

Moreover, a mechanism had been identified which provided a clear example of how a mainly inhibitory CeA output could lead to activation of output neurons in an efferent target structure. Chemical or electrical stimulation of the central nucleus of the amygdala (CeA) induced an early (~ 13 ms) opioid-dependent inhibition of one class of neurons characterised by a high baseline firing rate in the ventrolateral (VLPAG) and lateral PAG (LPAG) (da Costa Gomez and Behbehani, 1995). This inhibition was followed by a later (~ 22 ms) excitation of a second class 22 of cells which had a lower baseline firing rate. This suggested that tonically active inhibitory interneurons in the ventrolateral and lateral PAG may be inhibited by CeA activation, thus disinhibiting other (presumably output) neurons. Interestingly, the activation of PAG neurons was usually not opioid-dependent, suggesting that inhibition of tonically active PAG neurons is not the sole mechanism involved in the activation of PAG output neurons by CeA stimulation.

It was also suggested that the delayed excitation of PAG neurons may have been due to a synaptic relay in the hypothalamus (da Costa Gomez and Behbehani, 1995). Another possibile synaptic relay may be the BNST. Interestingly, the timing of excitatory responses was roughly consistent with the timing of CeA-evoked activation of the brainstem via the stria terminalis (Nagy and Paré, 2008). Further, most brainstem projections from the BNST are GABAergic (Kudo et al., 2012; Poulin et al., 2009), and exhibit tonic activity (Jennings et al., 2013). Another mechanism by which the CeA could activate the output or effector neurons in its descending targets and thus lead to behavioural and physiological correlates of fear, may be through the co-release of neuropeptides such as CRF, substance P and neurotensin by CeA terminals. This had been suggested previously (Davis et al., 1994) and is consistent with many more recent studies (Allen and Cechetto, 1995; Birnbaum and Davis, 1998; Borelli et al., 2013; Bouret et al., 2003; Bowers et al., 2003; Drew et al., 2009; Fendt et al., 1997; Mitchell et al., 2009; Swiergiel et al., 1992).

In any case, this study (da Costa Gomez and Behbehani, 1995) revealed physiological evidence for an inhibitory, monosynaptic projection from the CeA to tonically active neurons in an efferent target of the CeM, consistent with CeA neurons being predominantly GABAergic. More recently, some evidence has been presented which contradicts this model, insofar as GABAergic CeA neurons directly synapse onto some glutamatergic PAG neurons projecting to the nucleus retroambiguus (NRA) in the PAG, mostly located in lateral column (Oka et al., 2008). The functional implications of this pathway are so far unknown, but raise the possibility that activation of the CeA may inhibit glutamatergic PAG output neurons.

Some reports questioned the necessity of the CeA in conditioned fear. Lesions of the CeA did not impair the expression of conditioned avoidance (Koo et al., 2004; Roozendaal et al., 1993a) and fibre-sparing lesions of the CeA after conditioning caused only a small to moderate reduction in freezing to a discrete CS (Koo et al., 2004), and bilateral amygdala lesion had no effect on the expression of fear potentiated startle in the monkey (Antoniadis et al., 2007). Further, auditory conditioned fear was not associated with an increased cerebral blood flow in the CeA (Holschneider et al., 2006).

1.1.6 Conditioned fear to a discrete stimulus is associated with phasic activation of the CeM

Since 2010, a series of papers emerged which answered this fundamental question. These reports show that conditioned fear to a discrete stimulus is associated with phasic activation (Ciocchi et al., 2010; Duvarci et al., 2011) - but tonic inhibition (Ciocchi et al., 2010) - of CeM neurons projecting to the brainstem (Ciocchi et al., 2010; Duvarci et al., 2011). This phasic activation is significantly correlated with freezing (Ciocchi et al., 2010; Duvarci et al., 2011), whereas tonic inhibition of CeM neurons is negatively correlated with freezing, however this correlation did not reach statistical significance (Ciocchi et al., 2010). Similarly, activation or disinhibition of the CeM in rodents enhances freezing (Ciocchi et al., 2010; Li et al., 2013; Roozendaal et al., 1992b) whilst inhibition prevents it (Ciocchi et al., 2010; Haubensak et al., 2010; Li et al., 2013). In accordance with these findings, GABAergic antagonism of the CeA with bicuculline or semicarbazide - which would presumably have the effect of disinhibiting CeM neurons - spontaneously induced freezing behaviour in rats (Nobre and Brandão, 2011). Further, Fos expression in the CeM is strongly correlated with freezing behaviour induced by conditioned fear to a tone (Knapska and Maren, 2009). These studies provide strong evidence that i) the CeM is phasically activated during conditioned fear to a discrete stimulus; ii) the balance of activity between CeLoff and CeLon neurons determines whether CeM activation coupled with freezing occurs; iii) phasic activation of the CeM is sufficient to induce freezing in freely moving rats.

It is unknown why these findings differed from those obtained by Pascoe & Kapp (1985), but may be due to species differences, or because rabbits are lagomorphs which display bradycardia during exposure to a CS whereas rats display tachycardia and a pressor response (Carrive, 2006; Iwata and LeDoux, 1988). Further, cells in the CeM of lagomorphs are composed mainly (95%) of late-firing neurons, whereas in rodents the vast majority are low-threshold burst neurons (Chieng et al., 2006; Dumont et al., 2002).

1.1.7 It is currently unclear whether long-duration (sustained) re-exposure to a feared context is associated with increased activity of CeM neurons.

So far, to the best of our knowledge, no study has provided direct evidence that the CeM is activated during the sustained re-exposure to a fear conditioned context. Two recent studies explored this question indirectly by selectively activating CeM-projecting CeL neurons with by injecting an oxytocin agonist (Viviani et al., 2011) and optogentic evoked axonal release of oxytocin (Knobloch et al., 2012) before re-exposing for a long duration to a feared context. In both cases, freezing was strongly attenuated, which was argued to be due to the feed-forward GABAergic inhibition of CeM neurons.

An alternative explanation of these findings is that oxytocin activated GABAergic (Li et al., 2012; Myers et al., 2013) CeL neurons projecting to the BNST (Dong et al., 2001a; Petrovich and Swanson, 1997; Roder and Ciriello, 1993; Sun and Cassell, 1993), leading to its inhibition. This could be responsible for the reduction in freezing since the BNST mediates conditioned responses to long duration, contextual fear (Davis et al., 2010; Jennings et al., 2013; Luyten et al., 2012, 2011; Resstel et al., 2008; Sullivan et al., 2004; Walker et al., 2009; Zimmerman and Maren, 2011). This explanation is consistent with studies which suggested that the CeM may not be involved or is inhibited during sustained, contextual fear (Davis et al., 2010; Koo et al., 2004; Luyten et al., 2012; Pitts and Takahashi, 2011; Walker et al., 2009). The notion that CeM neurons may not be activated in sustained contextual fear and may be inhibited will be reviewed in more detail towards the end of the next part of this review, and is one of the hypotheses put forward in this thesis.

1.2 Part 2: The role of the CeA in various forms of conditioned and unconditioned fear and stress

1.2.1 The CeA may not be involved, or inversely associated with behavioural and physiological signs of fear and anxiety in some situations

It has been proposed that activation of CeA output is necessary and sufficient to evoke freezing or other behavioural and physiological signs of fear (Ciocchi et al., 2010; Davis, 1992a). An alternative hypothesis that has occasionally been proposed is that CeA output neurons may be tonically active, and inhibited during stress, panic, anxiety, descending antinociception or conditioned fear to context (Chieng and Christie, 2010; Chieng et al., 2006; Dayas and Day, 2002; Feinstein et al., 2013; Gilpin and Roberto, 2012; Gilpin, 2012; Olsen, 2007; Pascoe and Kapp, 1985; Thomas et al., 2013). The rationale for this idea is that inhibition of GABAergic CeA output neurons would disinhibit downstream structures, thus activating them. Strong evidence, and proof of principle that this mechanism occurs in some cases, comes from Pascoe & Kapp (1985) which demonstrated CeA output neurons are inhibited during conditioned fear in the rabbit.

This hypothesis seems plausible given that brainstem-projecting CeM neurons show tonic activity in the order of 1- 10 Hz (Ciocchi, 2009; Ciocchi et al., 2010; Collins and Paré, 1999; Huber et al., 2005; Lu et al., 1997; Pascoe and Kapp, 1985; Rosenkranz et al., 2006; Thomas et al., 2013; Viviani et al., 2011) or higher (Mosher et al., 2010). Additionally, Fos expression in the CeM is negatively correlated with freezing and positively correlated with avoidance in active-avoidance paradigms (Martinez et al., 2013; Savonenko et al., 1999) and tonic activity of the CeM is reduced during conditioned fear (Ciocchi, 2009; Ciocchi et al., 2010; Pascoe and Kapp, 1985). Reduced tonic CeM activity is significantly associated with fear generalisation 25

(i.e. freezing indiscriminately to both CS+ and CS-) (Ciocchi, 2009; Ciocchi et al., 2010). Interestingly, a reduction in tonic CeM activity of 5-6 Hz was associated with equivalent levels of freezing to CS+ as CS- (Ciocchi, 2009). Reduced tonic activity of the CeM could conceivably also occur in the contextual component of conditioned fear.

Whilst fear training and testing was carried out in different contexts in this study (Ciocchi et al., 2010), contextual fear may have generalised from the training to testing context, which has previously been described to occur, even in radically different contexts, but in a different strain of mice (C57Bl/6N rather than C57Bl/6J) (Radulovic et al., 1998a). Whilst the reduction in tonic CeM activity was not significantly associated with freezing (Ciocchi et al., 2010), it would be interesting to see whether this relationship would be significant in long-duration, foreground contextual conditioning. Freezing induced by withdrawal of CeM activity during long-duration contextual freezing may allow the animal to freeze and remain vigilant, whilst also capable of increasing the magnitude of the fear response by phasic CeM activation to the immediate onset of additional threat discrete stimulus which may appear (Campeau et al., 1997; Davis et al., 1997). Consistent with this notion, it has been demonstrated that lower tonic activity of CeM neurons is significantly associated with a greater signal to noise ratio of phasic activation in response to a discrete CS+ (Ciocchi, 2009; Ciocchi et al., 2010).

Fascinatingly, recent evidence demonstrates that CeM activity is significantly higher when the animal is in the closed arm, rather than the open arm of the elevated plus maze (EPM) (Thomas et al., 2013), in line with the notion that inhibition of the CeM may be associated with increased anxiety. If inhibition of activity in the CeM reflected more generalised anxiety, it may be expected that activation of it may be anxiolytic. Indeed, bicuculline administered in the CeA - which would presumably disinhibit CeM neurons - produced a clear anxiolytic effect in the EPM, whilst muscimol at the same injection sites induced an anxiogenic effect (Zarrindast et al., 2008). Similarly, lesions of the amygdala impaired conditioned fear responses, but had an anxiolytic effect (though this was not statistically significant) in the EPM (Treit et al., 1993). Another study reported that bicuculline injected in the CeA non-significantly enhanced social interaction (associated with anxiolysis), but an anxiogenic effect was triggered when it was injected in the BLA (Sanders and Shekhar, 1995). On the other hand, bicuculline injected in the CeA has also been shown to spontaneously induce freezing (Nobre and Brandão, 2011), and activation of the CeA generally seems to be associated with fear responses (see Davis, 2000 for review).

These studies point to a paradoxical role of the CeM insofar as its activation may be associated with both freezing and lower levels of anxiety. One possible explanation of this is that anxiety and inhibition of the CeM may be secondary to activation of stuctures such as the BNST 26

(Walker et al., 2009, 2003) - a structure which sends massive GABAergic projections selectively to the CeM (discussed below). Alternatively, both activation and inhibition of the CeM may somehow lead to increased anxiety.

1.2.2 Active and passive coping responses are organised in the CeA

Interestingly, there appears to be a class of cells in the CeL which promote active fear responses such as locomotion and exploration, associated with increased cortical activity, and another which promotes passive responses such as freezing (Gozzi et al., 2010). CeL cells mediating active response may achieve this through a direct GABAergic projection (Bourgeais et al., 2001; Grove, 1988; Jolkkonen et al., 2002) to non-cholinergic (presumed GABAergic interneurons) in the substantia innominata/basal forebrain (SI/BF). Cholinergic cells in the SI/BF were suggested to be crucial to active responses, since atropine switched the behavioural state back to passive fear (freezing) and blocked the increase in cortical arousal after activation of ‘active’ CeL neurons. Active and passive responses may be differentially modulated in the CeA, distinct from a fear-on versus fear-off switch.

This raises the question of whether CeLoff and CeLon (Ciocchi et al., 2010; Haubensak et al., 2010; Li et al., 2013) neurons represent a balance between active and passive responses to fear as well as a fear-off /fear-on switch. Interestingly, lesion of the CeA rescued active avoidance responding - a conditioned fear response - in rats which froze instead of escaping (Choi et al., 2010). The dominant effect of the CeA may be to inhibit active responses and promote passive fear responses. This idea was proposed 15 years ago (Bohus et al., 1996; Roozendaal et al., 1993a, 1992a, 1997). If this hypothesis is correct, the CeA may not mediate conditioned fear responses per se, but mediate passive (freezing, immobility) conditioned fear responses in certain circumstances (e.g. in an inescapable environment).

1.2.3 Active conditioned fear responses are strongly correlated with activity in the CeM: The VLPAG and the LPAG

On the other hand, increased Fos expression in the CeM after a conditioned active avoidance paradigm is strongly and significantly associated with active-escape responses (Martinez et al., 2013), and negatively associated with freezing (Martinez et al., 2013; Savonenko et al., 1999). In fact, high levels of Fos expression in the CeM predicts which rats are good active responders (i.e. show more active escape responses relative to freezing in response to a CS) relative to poor responders more than any other structure analysed in the brain (Martinez et al., 2013). Furthermore, stimulation of the whole CeA seems to produce an active defense response more reliably than freezing (Davis, 2000; Stock et al., 1981). This may be because CeA stimulation would also activate the CeL, including cells which generate active coping responses (Gozzi et 27 al., 2010), but is also consistent with the notion that the CeM may also be capable of mediating active responses. Furthermore, activation of CeM projection neurons with vasopressin leads to immobility/freezing and bradycardia in ‘low avoidance’ rats, but does not increase freezing in ‘high avoidance’ rats (Roozendaal et al., 1992b). These findings suggest that activation of the CeM may, in some circumstances such as an escapable environment, promote active coping responses and inhibit passive coping responses. If this hypothesis is correct it would raise the question of how activation of the CeM could lead to both active and passive coping responses.

One possible answer is that the CeM projects densely to the both the VLPAG and LPAG (Oka et al., 2008; Rizvi et al., 1991), which mediate passive and active coping responses respectively (Bandler and Shipley, 1994; Bandler et al., 2000). Interestingly, electrical or chemical activation of the CeA seems to result in activation of output neurons in both columns (da Costa Gomez and Behbehani, 1995). This could lead to either passive or active coping responses, which may be determined by other forebrain afferents of the PAG, such as the medial prefrontal cortex (mPFC), which may reflect environmental factors such as escapability (see below), as well as individual and strain genetic differences (Koolhaas et al., 2010).

There is strong evidence of mutual inhibition between the VLPAG and other columns (Behbehani, 1995; De Oca et al., 1998; Jansen et al., 1995; Lino-de-Oliveira et al., 2002), which may facilitate rapid shifts between integrated active and passive coping responses. Interestingly, conditioned fear to an inescapable context, which is associated with freezing, is linked to a strong increase in Fos expression the VLPAG, and moderate increase in Fos expression in the LPAG (Carrive et al., 1997). Conversely, in rats bred for shorter latency to attack an intruder (an index of aggression), agonistic encounters with another rat induce marked aggressive behaviour which was associated with an increased ratio of Fos expression in the LPAG relative to the VLPAG (Haller et al., 2006). Further, this was strongly correlated with Fos expression in the CeA, which appeared to also be expressed in the CeM. In contrast, rats which displayed less aggression had more Fos expression in VLPAG than the LPAG despite the stressor inducing a pronounced increase in both structures (Haller et al., 2006). These findings support the notion that CeA activation leads to activation of both the VLPAG and LPAG, and that the dominant response (active or passive) depends on the balance of activity between the lateral and ventrolateral columns, and this balance may be determined by other factors.

1.2.4 The medial prefrontal cortex selects active and passive coping responses

One candidate structure which may determine the balance of VLPAG/LPAG activity in conditioned fear and other stressful situations may be the mPFC. The mPFC processes factors such as the escapability of the environment, which the amygdala may be ‘blind’ to (Sierra-

Mercado et al., 2011; Sotres-Bayon and Quirk, 2010). Indeed, the mPFC is particularly sensitive to information regarding whether an environment is escapable or inescapable, and is involved in translating memories of the escapability of environments that have previously been encountered into active or passive coping responses as required, by descending projections to the brainstem (Amat et al., 2006, 2005; Baratta et al., 2009; Burgos-Robles et al., 2009; Corcoran and Quirk, 2007; Warden et al., 2012).

Interestingly, the presence of glutamate in the VLPAG is necessary for freezing or immobility at rest of during conditioned fear (Walker & Carrive, 2003; Zhang, Bandler, & Carrive, 1990), and this input probably does not originate in the CeA or BNST, as these structures contain few glutamatergic neurons (Oka et al., 2008; Poulin et al., 2009, 2008). Activity in the prelimbic cortex (PrL), however, is remarkably tightly correlated with freezing behaviour (Burgos-Robles et al., 2009) and with VLPAG activity during contextual fear (González-Pardo et al., 2012). Furthermore, the PrL is necessary for freezing in response to conditioned fear (Corcoran and Quirk, 2007). These effects are presumably due at least in part to its strong direct projection to the VLPAG (An et al., 1998; Floyd et al., 2000; Vertes, 2004). Indeed, VLPAG-projecting neurons in the PrL are strongly and selectively activated by conditioned fear to context (Olsen, 2007).

1.2.5 Can the CeM trigger both active and passive coping responses?

Another possibility is that the CeM itself may be able to selectively recruit active or passive responses through separate descending projections, similar to the CeL (Gozzi et al., 2010). As previously mentioned, there may be separate cell groups in the CeM which have different projections (Fritz et al., 2005; Thompson and Cassell, 1989; Viviani et al., 2011). Thus, projections to the lateral and ventrolateral PAG arise from different cells in the CeM. This would be consistent with work showing that the VLPAG and LPAG are densely and topographically innervated by adjacent regions of the prefrontal cortex and hypothalamus involved in passive and active coping responses respectively (An et al., 1998; Floyd et al., 2000). Perhaps the CeM also contains separate active and passive behavioural modules projecting to the LPAG and VLPAG respectively.

Another possibility is that the CeM may send collateralised projections to the LPAG and VLPAG and have a modulatory or mild stimulatory effect on LPAG and a strong stimulatory effect on the VLPAG. This would normally generate freezing through increasing the VLPAG/LPAG activity balance, and is consistent with the behavioural effects of CeM stimulation. It might be further speculated that a limited activation of the LPAG during conditioned fear could be recruited by the CeM to facilitate ‘active’ components of the

29 conditioned fear response such as pressor, tachycardic and sympathoexcitatory responses, and allow fast switching from passive to active coping behaviours.

Finally, one explanation for the passive-coping responses observed after CeM stimulation (Ciocchi et al., 2010; Roozendaal et al., 1993b, 1992b) is that these responses are found in selectively bred strains of rodents commonly used in research. These animals were often bred for lower aggression and this trait strongly co-varies with increased passivity, and may not represent the variety of responses found in wild animals (Koolhaas et al., 2010).

1.2.6 How does activation of a presumed GABAergic CeA-PAG projection mediate freezing?

The VLPAG is an essential structure in mediating the freezing immobility, antinociceptive and bradycardic components of the conditioned fear response to both contextual and discrete CS (Campeau et al., 1997; Carrive et al., 1997b; De Oca et al., 1998; Knapska and Maren, 2009; LeDoux et al., 1988; Morgan and Carrive, 2001; Walker and Carrive, 2003; Zhang et al., 1990). It is likely that freezing is mediated by activation of VLPAG output neurons (Morgan and Whitney, 2000; Vianna et al., 2008; Walker and Carrive, 2003), which may be secondary to inhibition of interneurons (da Costa Gomez and Behbehani, 1995). However, the presence of glutamate in the VLPAG is also necessary for freezing to occur during conditioned fear (Walker and Carrive, 2003).

Microinjection of GABA agonists in the VLPAG prevent freezing (De Luca-Vinhas et al., 2006; Walker and Carrive, 2003) and local injections of glutamate agonists in the freely moving animal produce immobility (Morgan and Carrive, 2001; Zhang et al., 1990). Interestingly, there is probably tonic glutamatergic tone in the VLPAG, since local injection of the glutamate antagonist kynurenic acid produced constant, uncontrollable movement (Walker and Carrive, 2003) in conjunction with increased HR and mean arterial pressure (MAP). This may represent tonic activity in the passive coping system. Precisely how the VLPAG controls freezing immobility is presently unclear. It is suspected that the VLPAG controls freezing through its projection to the rostromedial tegmental nucleus (RMTg) (Barrot et al., 2012; Jhou et al., 2009b) and in particular to the rostral ventromedial medulla (RVM).

1.2.7 The CeA-PAG-RVM pathway

Whilst it has not been formally demonstrated that the VLPAG-RVM projection is necessary for freezing, it is suspected given that a descending glutamatergic projection from the VLPAG to the RVM mediates immobility and freezing in conjunction with an established role of this pathway in antinociception (da Silva and Menescal-de-Oliveira, 2007; da Silva et al., 2013;

Morgan and Carrive, 2001; Morgan et al., 2008; Morgan and Whitney, 2000; Vianna et al., 2008; Walker and Carrive, 2003). The RVM projects directly to the ventral horn of the spinal cord as well as the dorsal horn and intermediolateral column, and polysynaptic tracers injected in sympathectomised, major skeletal muscles retrogradely label many cells in the RVM (Allen and Cechetto, 1994; da Silva et al., 2013; Jansen et al., 1995; Kerman, 2008; Kerman et al., 2003), revealing a likely anatomical substrate of immobility and freezing behaviour mediated by the RVM (Morgan and Whitney, 2000; Vianna et al., 2008). Further, the RVM is innervated by dense descending projections from the VLPAG (Cameron et al., 1995; Hermann et al., 1997; Loyd et al., 2007; Reichling and Basbaum, 1991; Vagg et al., 2008; van Bockstaele et al., 1991).

This pathway is also critically involved in antinociception, and the analgesic effect of systemic morphine is thought to be mediated partly in the VLPAG by the inhibition of inhibitory interneurons, leading to the activation of output neurons projecting to the RVM (Behbehani, 1995; Behbehani et al., 1990; Depaulis et al., 1987; Loyd et al., 2007; Morgan et al., 2008). Antinociception is also triggered by conditioned fear (Helmstetter and Fanselow, 1987; Helmstetter and Landeira-Fernandez, 1990). Interestingly, conditioned antinociception, but not freezing, is dependent upon mu receptors in the VLPAG (Helmstetter and Fanselow, 1987; Helmstetter and Landeira-Fernandez, 1990). Thus, these responses are pharmacologically dissociable. However, there are also overlapping mechanisms - for example glutamate injected in the VLPAG and RVM induces both immobility (Morgan and Carrive, 2001; Morgan and Whitney, 2000) and antinociception (Bellgowan and Helmstetter, 1998; Morgan and Whitney, 2000). Similarly, activation of VLPAG output neurons is also thought to be important in the bradycardia observed during conditioned fear (Vianna et al., 2008; Walker and Carrive, 2003).

The dense projection from the VLPAG to the RVM consists of a mixture of GABAergic and glutamatergic neurons (Morgan et al., 2008). GABAergic, spinally projecting neurons in the raphe (ON cells) receive a projection from the VLPAG that is primarily GABAergic, whilst non-GABAergic (presumably glutamatergic) spinally projection neurons (OFF cells) in the raphe receive an equal contribution of GABAergic and glutamatergic innervation from the VLPAG (Morgan et al., 2008). Antinociception is mediated in the raphe by inhibition of ON cells, and excitation of OFF cells. Thus, morphine-induced antinociception - which occurs by inhibition of tonically active GABAergic interneurons in the VLPAG (Depaulis et al., 1987; Osborne et al., 1996) - is thought to induce antinociception by disinhibition of both GABAergic and glutamatergic VLPAG-RVM projecting neurons (Morgan et al., 2008). Interestingly, glutamate agonists injected in the RVM induce a stronger antinociception than locally injected morphine (which only inhibits ON cells with no direct effect on OFF cells). This suggests that

31 the VLPAG is a specialised structure in the brain in mediating antinociception through dual control of ON and OFF cells in the raphe through different inhibitory or excitatory projections to these different cell types. Blockade of glutamate receptors in the raphe, and activation of GABA receptors inhibits freezing and immobility (Vianna et al., 2008), whilst glutamate agonists (Morgan and Whitney, 2000) injected in the raphe produces immobility. Together, this research suggests that the presense of glutamate (and activation of ON cells) is important for the induction of freezing. Much of this glutamatergic input is likely to come from the VLPAG, in accordance with its dense projections to the RVM.

1.2.8 The role of the central extended amygdala in cardiovascular responses to conditioned fear

Lesions of the CeA have been shown to attenuate pressor and bradycardia in response to conditioned stimuli (Iwata et al., 1986a; Kapp et al., 1979; Roozendaal et al., 1990) and bradycardic responses to aversive social stimuli in rats (Roozendaal et al., 1990). Injection of excitatory amino acids in the CeA in conscious rats has been shown to elicit pressor and tachycardic responses in the rat (Iwata et al., 1987), which was thought to reflect the sympathetic component of the conditioned fear response in rats. However, this study (Iwata et al., 1987) used a large dose (0.5 M; 0.5 µl) which would have spread to nearby structures. Another study showed that a similar dose (1M; 0.2 µl) of excitatory amino acids in the CeA had no effect on these parameters in conscious rats (Gelsema et al., 1987), but injections in the BNST triggered depressor effects and increased muscle vascular conductance (Gelsema et al., 1993). Similarly, injection of bicuculline into the CeA also appears to have no effect on blood pressure and heart rate in conscious, freely moving animals, but a strong pressor and tachycardic response can be elicted by injections of bicuculline centred in the basolateral amygdala (Sanders and Shekhar, 1991; Soltis et al., 1997), or in the central nucleus or BNST of anaesethetised rats (Zhang et al., 2009). Evidence suggests that the BNST may not be involved in cardiovascular responses to fear of a discrete CS (LeDoux et al., 1988), however it is required for pressor and tachycardic responses to a sustained, contextual CS (Resstel et al., 2008).

The perifornical and lateral hypothalamus (PeF/LH) drives the sympathetic pressor and tachycardic responses to conditioned fear to both a short-duration and sustained CS (Furlong and Carrive, 2007; Iwata et al., 1986b; LeDoux et al., 1988). This structure contains the largest number of neurons projecting to the thoracic spinal cord that expressed Fos after contextually conditioned fear (Carrive and Gorissen, 2008), and lesions of this area almost completely abolish all pressor and tachycardia elicited by conditioned fear but not to other stressors such as restraint (Furlong and Carrive, 2007; Iwata et al., 1986b; LeDoux et al., 1988). However, precisely how the CeA and BNST recruit these neurons is unknown.

Importantly, both the CeL and CeM project to the lateral and perifornical hypothalamus, as well as the BNST (Nakamura et al., 2009; Niu et al., 2012; Sakurai et al., 2005; Yoshida et al., 2006). The CeL projects heavily to the dorsomedial hypothalamus (DMH), PeF and LH (Yoshida et al., 2006), whilst the CeM projects mainly to the LH (Yoshida et al., 2006). Since CeA projections to the PeF/LH are GABAergic (Nakamura et al., 2009), presympathetic and premotor (Carrive and Gorissen, 2008; Kerman, 2008) neurons in the PeF/LH may be activated by withdrawal of GABAergic input from the CeA. This may occur through the inhibition of CeM neurons in sustained conditioned fear, or by the inhibition of CeLOFF neurons, which are inhibited during conditioned fear to a discrete CS (Ciocchi et al., 2010; Haubensak et al., 2010). This is consistent with the results of Pascoe and Kapp (1985), which showed that one class of CeA neurons - which did not project to the brainstem but may have projected to the hypothalamus - were inhibited after presentation of the CS, yet these were positively correlated with heart rate; whilst another class of CeA neurons were activated, but this activity was positively correlated with heart rate. This neatly parallels the opposing unit activity of cells in the PeF/LH during fear conditioning (Kopytova, 1980). Activation of GABAergic CeA neurons could also inhibit tonically active inhibitory interneurons, which suppress the activity of orexin neurons (Alam et al., 2005; Karnani et al., 2013). Finally, activation of CeA projections containing neurotensin (Allen and Cechetto, 1995) and CRF (Gray, 1993; Honkaniemi, 1992; Shimada et al., 1989) could lead to the activation of presympathetic hypothalamic neurons (Furutani et al., 2013; Winsky-Sommerer et al., 2004).

The function of the massive projection from the CeA to the dorsal vagal complex (Danielsen et al., 1989; Hopkins and Holstege, 1978; Saha et al., 2000) is suspected to be involved in bradycardia (Viviani et al., 2011), or in inhibiting or resetting the baroreflex to allow higher blood pressure, especially in the acute, early stage of a conditioned fear response (Saha, 2005; Saha et al., 2000; Schlör et al., 1984). Another possibility is that the CeA may differentially inhibit the baroreflex in the NTS to permit higher MAP whilst simultaneously generating bradycardia through its projection to the dorsal motor nucleus of the vagus nerve. This projection may also be important in other physiological homeostatic processes such as gastric control (Zhang et al., 2003).

Interestingly, the CeA projects to neurons in the RVLM, and makes symmetrical (but some asymmetrical) synaptic contacts on catecholaminergic neurons activated by hypotensive challenge (Cassell and Gray, 1989a; Saha et al., 2005). Since these projections are mainly GABAergic (Bowman et al., 2013), this suggests that activation of some CeA neurons would inhibit presympathetic neurons in the RVLM, which may decrease sympathetic activation. Indeed, stimulation of the CeA has been shown to inhibit most RVLM neurons involved in

33 cardiovascular control (Gelsema et al., 1989). However, this interpretation seems to contradict the observation of a pressor response in conditioned fear. Another possibility is that some CeA neurons are tonically active, and inhibited during conditioned fear, for example CeLOFF neurons. However, most input from the CeA to the RVLM is from the CeM (Bowman et al., 2013). This suggests two further possibilities: i) that CeM activity in neurons projecting to the RVLM may be inhibited during conditioned fear; or ii) that the CeM may inhibit the RVLM to modulate the pressor response during the freezing response, and this inhibition could be removed when switching from freezing to an active defense response.

The cardiovascular effects evoked by activation or inhibition of discrete subdivisions of the CeA have so far received little attention. Stimulation of the CeM causes bradycardia in both conscious and anaesthetised rabbits, and a depressor response in anaesthetised rabbits (Applegate et al., 1982; Kapp et al., 1982), and these responses were minimal in other parts of the CeA. Few studies (to our knowledge) have shown specific effects of CeM activation on cardiovascular responses in rats. Activation of CeL neurons during sustained, contextually conditioned fear impaired bradycardia, but interestingly had no effect on blood pressure (Viviani et al., 2011). The authors argued that this may have been mediated through inhibition of the CeM, but could also have been mediated by a direct projection from the CeL to the LH (Niu et al., 2012; Tsumori et al., 2006a; Yoshida et al., 2006) or DVC (Danielsen et al., 1989). Injection of vasopressin in the CeA, which selectively activates CeM neurons (Huber et al., 2005; Lu et al., 1997; Veinante and Freund-Mercier, 1997), causes bradycardia in conscious rats (Roozendaal et al., 1993b, 1992b). This result suggests that CeM activation does not mediate the increased HR during conditioned fear, and in fact may decrease HR. These results are consistent with anatomical pathways linking the CeM to the lateral part of the hypothalamus - which contains MCH cells and DVC-projecting neurons which mediate depressor and cardioinhibitory passive coping responses (Allen and Cechetto, 1992; Egwuenu et al., 2012; Floyd et al., 2001; Goto and Swanson, 2004; Kayaba et al., 2003; Kerman et al., 2007) - whilst the CeL also projects to the PeF (Yoshida et al., 2006) which mediates active coping, pressor and tachycardic responses (ibid).

1.2.9 The CeA-VLPAG pathway is not necessary for unconditioned fear and freezing

Whilst the CeA-VLPAG pathway is critical in mediating freezing in conditioned fear to a discrete CS, this pathway is not necessary in unconditioned fear. In fact, there is some evidence that the amygdala may exert a protective effect against panic attacks. Interestingly, exposure to

35% CO2 in humans with bilateral amygdala lesions reliably induces panic attacks with a strong sympathetic component, whilst only 25% of controls experience panic attacks, and controls who did experience them displayed an attenuated sympathetic response compared with patients with 34 amygdala damage (Feinstein et al., 2013). The authors suggested that the amygdala may tonically or phasically inhibit panic reactions, since CeA output is GABAergic.

Furthermore, lesion of the CeA does not reduce freezing to a predator or a context associated with a predator (Martinez et al., 2011) or its odor (Dielenberg et al., 2001; Fendt et al., 2003), or unconditioned footshock (Antoniadis and McDonald, 2001), and lesion of the VLPAG does not prevent freezing after stimulation of the dorsal PAG (Vianna et al., 2001). Other structures may mediate unconditioned freezing, such as the dorsal PAG, cuneiform nucleus, median raphe, rostral medial tegmentum and ventral tegmental area (VTA) (Borelli et al., 2006; Brandão et al., 2005, 2003; Jhou et al., 2009a; Vianna et al., 2003). Interestingly, unconditioned fear induced by predator odor is associated with freezing and marked dorsal PAG activation - but not amygdala or VLPAG - activation, as revealed by fMRI in the rat (Kessler et al., 2012) and reduced activation of the VTA and accumbens. There is a suggestion that RMTg could inhibit unconditioned and conditioned freezing by inhibiting the VTA and substantia nigra, and withdrawal of dopamine (Barrot et al., 2012; Jhou et al., 2009a, 2009b). Interestingly, the CeM projects to both of these dopaminergic structures (Conzales and Chesselet, 1990; El-Amamy and Holland, 2007; Fudge and Haber, 2000), raising the possibility that this pathway may also partly mediate freezing in conditioned fear.

1.2.10 Freezing responses to a contextual CS involves neuroanatomical pathways distinct from those involved in fear to a discrete CS

The VLPAG is innervated by notably dense projections from the bed nucleus of the stria terminalis (H.-W. Dong and Swanson, 2006; Dong and Swanson, 2006b, 2004; Dong et al., 2001b, 2000; Gray and Magnuson, 1992; Holstege et al., 1985) and perifornical/lateral hypothalamus (Behbehani et al., 1988; Floyd et al., 2001; Zardetto-Smith et al., 1988). Whilst the BNST does not seem to contribute to behavioural responses to a discrete CS (Davis et al., 2010; LeDoux et al., 1988) it appears to be necessary in the expression responses to sustained re-exposure to a feared context (Luyten et al., 2011; Resstel et al., 2008; Sullivan et al., 2004; Walker and Davis, 1997; Walker et al., 2003; Zimmerman and Maren, 2011), and this is mediated by projections to the brainstem (Jennings et al., 2013). The PeF/LH is not necessary for freezing responses to a discrete CS (Iwata et al., 1986b; LeDoux et al., 1988) however it appears to be necessary for freezing responses to a sustained, contextual CS (Carrive et al., 1999; Furlong and Carrive, 2007). These findings suggest that freezing responses may be mediated by pathways from the BNST and PeF/LH to the VLPAG during sustained, contextual, but not discrete conditioned fear. Interestingly, the CeA may not be necessary for this response (see below).

1.2.11 Different roles of the BNST and CeA in long duration contextual conditioning versus short duration, discrete conditioned stimuli

Recent evidence suggests that whilst the CeA is crucial in conditioned fear to a short duration, discrete CS, it may not be important for the expression of fear to contextual and long duration cues, although some controversy remains (Knobloch et al., 2012; Viviani et al., 2011). Early studies showed that lesions of the CeA and other amygdaloid nuclei markedly reduced freezing to a fear conditioned context (Kim et al., 1993; Phillips and LeDoux, 1992). This finding was repeated more recently (Sullivan et al., 2004), however the authors created electrolytic lesions of the CeA, which may have destroyed fibers of passage from the BLA to the BNST. In contrast, fibre sparing lesions of the CeA were associated with no change (Koo et al., 2004) or a non-significant increase in freezing in a 10 min re-exposure to a conditioned context (Pitts and Takahashi, 2011). Extensive evidence has been reviewed by Davis and colleagues (Davis et al., 2010; Walker et al., 2009) who suggested that the CeM is involved in phasic but not sustained or long-duration conditioned fear, whilst the opposite was the case for the BNST. Further, activity in the BNST and CeM appear to be inversely associated (Walker, Miles, & Davis, 2009).

Unlike the CeA, the BNST is not necessary for fear responses to short duration or discrete fear cues (Davis et al., 2010; LeDoux et al., 1988; Sullivan et al., 2004; Zimmerman and Maren, 2011), however it is necessary for the expression of fear responses to a contextual, sustained CS (Davis et al., 2010; Luyten et al., 2012, 2011; Resstel et al., 2008; Sullivan et al., 2004; Zimmerman and Maren, 2011). Further, a PET study in the rat found that contextually conditioned fear was associated with a very strong increase in activity in the BNST, with a reduction in the lateral, basolateral and basomedial amygdala, and no change in the CeA (Luyten et al., 2012). Interestingly, cobalt chloride or glutamate antagonists injected in the BNST selectively prevent freezing and fear potentiated startle to long duration (Walker et al., 2009) and contextual (Luyten et al., 2011; Sullivan et al., 2004; Zimmerman and Maren, 2011) cues but increase freezing and fear potentiated startle to short duration conditioned stimuli (FPS) (Davis et al., 2010; Zimmerman and Maren, 2011). Local infusion of muscimol has a similar effect in that it potentiates FPS to a discrete CS (Meloni et al., 2006). This suggests that during conditioned fear to discrete CS, some glutamatergic activity in the BNST enhances conditioned responses to a sustained but suppresses them to a discrete CS. These glutamatergic afferents may arise from the hippocampus, prelimbic cortex and basolateral amygdala which send strong glutamatergic projections (Crane et al., 2003; Dong et al., 2001a; Myers et al., 2013; Radley and Sawchenko, 2013) and are necessary for contextual fear expression (Corcoran and Quirk, 2007; Corcoran et al., 2005; Davis et al., 2010; Herry et al., 2008; Kim et al., 1993; Liu et al., 2012; Phillips and LeDoux, 1992; Wiltgen et al., 2006). 36

1.2.12 Reciprocal inhibition between the BNST and CeA

Why is inhibition of the BNST associated with an increase in freezing (Zimmerman and Maren, 2011) or fear potentiated startle (Davis et al., 2010) to short duration cues but a decrease to long duration cues? It has been suggested that the sustained or tonic conditioned fear system mediated by the BNST may inhibit the phasic or short duration conditioned fear system mediated by the CeM (Walker et al., 2009). Thus, inhibition of inhibitory BNST-CeM neurons would increase the activation of the CeM, and this would enhance conditioned responses to a discrete CS. This concept is consistent with anatomical studies which shows that most divisions of the BNST project to the CeA, and those that do project densely and selectively to the CeM, as this projection mostly avoids the CeL and CeC (H.-W. Dong and Swanson, 2006, 2004; Dong and Swanson, 2006a, 2006b, 2004; Dong et al., 2001b, 2000; Holstege et al., 1985). Further, the vast majority of these projections are probably GABAergic (Kudo et al., 2012; Myers et al., 2013; Poulin et al., 2009). Conversely, the CeM and CeL project densely to many structures in the BNST, particularly in the anterolateral group (Dong et al., 2001a). These projections have been shown to be GABAergic (Li et al., 2012; Myers et al., 2013). Thus there is mutual inhibition between the CeA and BNST. This is consistent with other findings showing that activity in the BNST and CeA are often inversely associated (Yassa et al., 2012).

Assuming that the BNST mediates more diffuse forms of anxiety (Davis et al., 2010; Walker et al., 2009, 2003), whilst the CeM mediates more phasic fear-like responses, it might be expected that it is involved in mediating anxiety in the elevated plus maze (EPM). This has recently been demonstrated (Kim et al., 2013), and as previously mentioned, CeM unit activity is reduced (but not below about 4 Hz) in the open arm of the EPM relative to the closed arm (Thomas et al., 2013). This inhibition may reflect a greater activation of the BNST, which may then inhibit the CeM. Perhaps a similar mechanism is involved in long duration conditioned fear.

1.2.13 Could inhbition of the CeM enhance freezing to a sustained CS?

If BNST-CeM neurons are activated during re-exposure to a sustained CS, this would presumably inhibit CeM neurons. Since it is suspected that CeM-VLPAG neurons are GABAergic (Oka et al., 2008; Swanson and Petrovich, 1998) and may project to glutamatergic output neurons in the PAG (Oka et al., 2008), putative inhibition of these CeM-VLPAG neurons in sustained fear may lead to a disinhibition of neurons in the VLPAG, and thus freezing behaviour. Inhibition of the CeM would also inhibit the reciprocal inhibitory projection from the CeM to the BNST, but would not inhibit the CeL, which may promote the sustained fear system (Davis et al., 2010). In other words, the inhibition of the CeM by the BNST during long- duration exposure to a CS may be a mechanism to increase freezing. This would allow the CeA

37 to respond phasically to further threats (Campeau et al., 1997; Ciocchi, 2009; Ciocchi et al., 2010; Davis et al., 1997), whilst the BNST mediates a tonic state of anxiety. Indeed, a low tonic activity in the CeM is associated with a greater signal-to-noise ratio of phasic CeM responses to further exposures to the CS+ (Ciocchi, 2009). This has been suggested to allow a greater sensitivity to potential threats in generating alerting responses, but come at the cost of stimulus discrimination (Ciocchi, 2009).

1.2.14 Fos expression and activated projections to the VLPAG during conditioned fear to context

A previous study in our laboratory (Olsen, 2007) found that re-exposure to a fear-conditioned context for 30 min elicited only a small increase in Fos expression in the CeA and other nuclei of the amygdala, and in particular, very little co-localisation of Fos with VLPAG-projecting neurons. Conditioned fear to context was also associated with only a slight increase in Fos/VLPAG projecting neurons in the bed nucleus of the stria terminalis (BNST), despite enormous numbers of retrogradely-labelled cells in the extended amygdala. These results were consistent with those of a very similar study (Scicli et al., 2004) which showed that conditioned fear to a context over 30 min does not increase Fos expression in the CeM but increases it in the CeL. This activity may reflect activation of the sustained fear system (Davis et al., 2010).

These findings are in accordance with the results of many studies which reported relatively low levels of Fos expression in the CeM and CeA generally following conditioned fear and psychological and physical stressors (reviewed in (Day et al., 2008; Kovács, 1998) - although one more recent study showed a strong increase in Fos in the CeM which was highly correlated with freezing (Knapska and Maren, 2009), but interesting negative associations have also been reported in fear avoidance paradigms (Martinez et al., 2013; Savonenko et al., 1999). It is unknown why Fos expression is not substantially increased in the CeM by conditioned fear to a discrete CS (Kovács, 1998), which has been clearly demonstrated to be phasically activated by a CS (Ciocchi et al., 2010; Duvarci et al., 2011). One possible explanation is that whilst freezing and exposure to a discrete CS is strongly correlated to phasic CeM activation, it is negatively (but non-significantly) associated with tonic CeM activity (Ciocchi et al., 2010). Thus, the lower tonic activity of CeM neurons during re-exposure sessions may counteract the phasic increase that occurs with CS presentation. Such a mixture of tonic inhibition and phasic activation may not be sufficient to induce Fos since ‘strong and sustained’ activation of neurons is required for Fos expression (Li and Dampney, 1994). In any case, it must be emphasised that a lack of Fos expression does not indicate an absence of neural activity (Dampney and Horiuchi, 2003), and that these negative results should be interpreted with caution. Nevertheless, the lack of Fos expression in the CeM after conditioned fear to context (Olsen, 2007; Scicli et al., 2004) is also

38 consistent with the hypothesis that the activity of CeM neurons is reduced or unchanged during conditioned fear to context. This hypothesis is consistent with the idea of (Walker et al., 2009) that the phasic fear system (represented by CeM activity) is inhibited during long duration, contextual fear, and this may actually increase freezing.

We previously found a lack of fear-activated VLPAG-projecting neurons in the BNST, however, many BNST neurons that did not project to the VLPAG expressed Fos (Olsen, 2007). Inhibition of brainstem-projecting BNST neurons could enhance freezing since both the CeM and most parts of the BNST are GABAergic and project to the VLPAG. Indeed, inhibition of GABAergic VTA-projecting neurons in the BNST has been shown to occur in long-duration re- exposure to a feared context, along with excitation of glutamatergic brainstem projections, and this contributes to the expression of fear (Jennings et al., 2013). These neurons probably also project to the VLPAG, as the same, singular fibre bundle which projects from the BNST to the VTA continues to the VLPAG (Holstege et al., 1985). Inhibition of GABAergic brainstem- projecting neurons may reflect a general mechanism of function in the extended amygdala during long-duration, contextual fear.

1.2.15 Hypothesis of a neural network mediating conditioned fear to context

One plausible hypothesis is that during conditioned fear to context, neurons in the CeM are inhibited. This inhibition may be driven by increased activity in the BNST, which sends immense projections to the CeM but largely avoid the CeL and CeC (H.-W. Dong and Swanson, 2006, 2004; Dong and Swanson, 2006a, 2006b, 2004; Dong et al., 2001b, 2000; Holstege et al., 1985). These fibres reach the amygdala through two pathways - the ansa peduncularis, coursing through the substantia innominata, and the stria terminalis. It is important to note that these pathways to the amygdala and brainstem diverge from within the BNST, and most fibres projecting to the amygdala generally terminate there (ibid). The brainstem-projecting fibres course ventrally from the BNST, and some form another pathway through the internal capsule (ibid). It is possible that many neurons in the BNST projecting to the amygdala are distinct from brainstem-projecting neurons, and may be restricted, intrinsic intra-extended-amygdala projections. These may be analogous to some CeL neurons, which only project the BNST, extended amygdala and CeM (Veinante and Freund-Mercier, 2003). It is important to note that most cells in the BNST, including projection neurons, are GABAergic (Kudo et al., 2012; Myers et al., 2013; Poulin et al., 2009). We propose that GABAergic, brainstem-projecting neurons in the BNST are inhibited during long-duration, contextual fear (Jennings et al., 2013), but GABAergic projections from the BNST to the CeM may be activated (Walker et al., 2009), although at least one class of CeL neuron is known to be inhibited during sustained, contextually conditioned fear (Knobloch et al., 2012; Viviani et al., 2011). 39

This hypothesised circuit is consistent with findings that inhibition of the BNST increases conditioned fear responses to a phasic CS, which is very likely to be mediated by disinhibition of CeM, as the BNST does not mediate responses to a phasic CS (Davis et al., 2010; Meloni et al., 2006; Walker et al., 2009; Zimmerman and Maren, 2011). Crucially, inhibition of the BNST in these studies reduced conditioned fear responses to a sustained CS, which strongly suggests that the inhibition of the BNST in these studies was not due to inhibition of GABAergic brainstem-projecting neurons, which would increase fear expression (Jennings et al., 2013). These findings are consistent with a model where one population of BNST neurons is activated during sustained fear - which may project to the CeM - and another distinct population which projects to the brainstem is inhibited in sustained fear (Jennings et al., 2013). This is consistent with reports that at least two distinct populations of GABAergic (Poulin et al., 2009) structures in the BNST are inversely associated with anxiety. Specifically, activity in the the oval nucleus is associated with increased anxiety, whilst activity in the anterodorsal nucleus is associated with reduced anxiety (Kim et al., 2013).

Figure 1.3 Hypothesised model of conditioned fear to a sustained, contextually conditioned stimulus. Note that two separate populations of GABAergic neurons in the BNST are hypothesised to project to the CeM and brainstem, and that these projections are respectively activated and inhibited in sustained fear. Whilst PrL is part of mPFC, it is duplicated here for simplicity. See Fig. 6.2 for further details. Symbols: Up arrows - cells activated; down arrows - cells inhibited; +: an excitatory or potentiating effect. Abbreviations: BNST - bed nucleus of the stria terminalis; CeL - central nucleus of the amygdala, lateral division; CeM - central nucleus of the amygdala, medial division; CRF - corticotropin releasing factor; mPFC - medial prefrontal cortex; PrL - prelimbic cortex; VLPAG - ventrolateral periaqueductal gray. 40

1.2.16 Orexin appears to selectively activate CeM neurons

If CeM neurons are inhibited in conditioned fear to a context or long-duration CS, then it might be expected that pharmacological activation of CeM neurons during long-duration conditioned fear to context would result in a reduction in conditioned fear responses. We attempted to determine the behavioural and physiological effects of selective pharmacological stimulation of the CeM would have on freely moving rats, and rats exposed over a long duration to a context previously associated with footshock.

The pharmacological agent that was adopted to selectively stimulate the medial division of the CeA was orexin-A. This was chosen because orexin strongly activates CeM neurons in vitro (Bisetti et al., 2006; Johnson et al., 2012a), and orexin fibres and terminals have been shown to densely innervate the CeM but largely avoid the CeL and CeC (Baldo et al., 2003; Fadel and Deutch, 2002b; Peyron et al., 1998), consistent with observations that we have made independently (Fig. 1.4, 1.5) - but see (Schmitt et al., 2012). Accordingly, the expression of ORX1 receptors in the CeA appears to be confined to the medial division (Lu et al., 2000; Marcus et al., 2001). Evidence suggests that the ORX2 receptor is also expressed in the CeM (Bisetti et al., 2006), although anatomical studies have not yet confirmed this. Interestingly, microinjection of orexin has been shown to increase anxiety and increase locomotor activity (Avolio et al., 2011). The latter finding may be surprising given that activation of the CeM is thought to induce freezing and inhibit activity (Ciocchi et al., 2010). According to the putative model we have presented, it was hypothesised that orexin-A injected in the CeA would increase CeM activity, which would decrease freezing to a long-duration, contextual CS.

Figure 1.4 Orexin-A immunoreactive fibres in the rat amygdala. A: Photomicrograph (4 x) of orexin-A fibres and boutons are distributed in the medial CeA but largely avoid the lateral and capsular divisions. B: Photomicrograph (10 x) of the same section. Note the dense distribution of fibres and terminals in the CeM relative to the CeL. (Olsen and Carrive, unpublished observations). Abbreviations: BLA - basolateral amygdala; CeC - central nucleus of the amygdala, capsular division; CeL - central nucleus of the amygdala, lateral division; CeM - central nucleus of the amygdala, medial division;MeAD - medial amygdala, dorsal division; st - stria terminalis; STIA - bed nucleus of the stria terminalis, intraamygdala division 42

Figure 1.5 Orexin-A immunoreactive fibres (red) innervate the CeM but mainly avoid TH positive terminals (green) in the CeL. Adapted with permission from Fadel & Deutch (2002). Abbreviations: can - central nucleus of the amygdala 1.3 Part 3: The role of orexin in active and passive coping, conditioned fear and anxiety

1.3.1 Active and passive coping

Passive coping is a general class of co-ordinated behavioural and physiological responses to aversive stimuli, associated with immobility and reduced activity, disengagement from the environment, social and behavioural withdrawal, reduced cerebral blood flow and metabolism, reduced arousal, muscle vasoconstriction, bradycardia and hypotension (Bandler and Shipley, 1994; Bandler et al., 2000; Carrive, 1993, 1993; Ennis et al., 1991; Gozzi et al., 2010; Mancia et al., 1972; Van Bockstaele et al., 2001). Stimuli which induce this response tend to be inescapable or uncontrollable, such as deep somatic pain arising from the viscera or skeletal musculature, as opposed to superficial cutaneous pain, which is more likely to be escapable (Bandler et al., 2000; Carrive, 1993; Keay and Bandler, 2001). Passive coping is generally the most adaptive responses to inescapable aversive stimuli, or when an animal needs to avoid detection, preserve energy and recover from injury (Bandler and Shipley, 1994; Carrive, 1993,

1993; Fanselow, 1994; Keay and Bandler, 2001; Schadt and Hasser, 2004) as well as fight illness (Hart, 1988; Tkacs and Li, 1999), to reduce inhalation of smoke and noxious odours (Kumada et al., 1977; McRitchie and White, 1974) and recover from exercise and stressful situations (Lovick, 1993; Walker & Carrive, 2003). Passive coping responses are more likely in animals which have a history of inescapable stress (Amat et al., 2008; Overmier and Seligman, 1967; Seligman and Maier, 1967).

Active coping is a cluster of co-ordinated responses which are generally occur during engagement with the environment (Bandler et al., 2000), and consist of locomotor activity, increased cerebral perfusion and arousal, tachycardia, hypertension, skeletal muscle vasodilation, renal vasoconstriction, brown adipose tissue (BAT)-mediated thermogenesis and increased respiration (Bandler and Shipley, 1994; Carrive and Bandler, 1991; Carrive, 1993; Ennis et al., 1991; Gozzi et al., 2010; Keay and Bandler, 2001; Nakai and Maeda, 1994; Nakai et al., 1997; Zhang et al., 2006a, 2009, 2010). The classic defence response involves all of the above components (Abrahams et al., 1964, 1960; Hilton, 1982; Yardley and Hilton, 1986). Other examples include escape behaviour and active avoidance. Active coping responses are more likely when a stressor is controllable, escapable and if the animal has a history of active coping responses which have been successful (Amat et al., 2005; J. Amat, Aleksejev, Paul, Watkins, & Maier, 2010; José Amat, Paul, Zarza, Watkins, & Maier, 2006), and in animals with a genetic predisposition for active coping (Koolhaas et al., 2010). Individual and strain differences, neurotransmitters, sex- and stress-hormones are also critical factors in the adoption of either passive or active coping styles or strategies (Koolhaas et al., 2010).

1.3.2 Conditioned fear involves components of both active-coping and passive-coping

Some aversive stimuli evoke integrated behavioural and physiological responses which have both active and passive components. Conditioned fear elicits features of both active and passive coping. Conditioned fear is associated with passive coping responses in the form of freezing (LeDoux et al., 1988; Walker and Carrive, 2003) and bradycardia in rats (Carrive, 2006; Iwata and LeDoux, 1988; Kapp et al., 1979; Nijsen et al., 1998), rabbits (Kapp et al., 1979) and humans (Hermans et al., 2013), but not mice (Stiedl et al., 2004). Conditioned freezing and bradycardia appear to be tightly coupled - and may both be under the control of a single structure (Carrive, 2006; Hermans et al., 2013; Kerman, 2008; Viviani et al., 2011). The bradycardia is vagally mediated (Carrive, 2006; Nijsen et al., 1998), and may serve to both reduce the energy expenditure by the myocardium, and improve coronary blood flow (Miki and Yoshimoto, 2010; Reid et al., 1985; Stiedl et al., 2004). This may be thought of as a preparatory function, and could be abolished by an inhibition of vagal motorneurons after switching from freezing to active responses. This would allow for increased cardiac output to meet the 44 metabolic demands of fight or flight response. Vascular conductance has, to our knowledge, not been investigated in conditioned fear, but the freezing response elicited by other stressors is not associated with muscular vasodilation (Mancia et al., 1972; Yoshimoto et al., 2010). The immobility and bradycardia response to an aggressive con-specific cat leads to vasoconstriction of the iliac artery (Mancia et al., 1972). As noted by Yoshimoto et al., (2010), if the animal switches its behavioural state from freezing to fight or flight behaviour, there would be an immediate surge of blood to the hindlimb due to a pre-existing renal and visceral vasoconstriction combined with vasodilation of the iliac artery. Freezing and bradycardia could thus be envisaged as possessing preparatory functions to promote potentiated fight or flight responses (Miki and Yoshimoto, 2010; Stiedl et al., 2004).

Conditioned fear also elicits features of active coping: sympathetically mediated net tachycardia - which is the dominant cardiac response to conditioned fear in rodents (Carrive, 2006; Inagaki et al., 2004, 2004; LeDoux et al., 1988; Nijsen et al., 1998; Stiedl et al., 2004; Walker and Carrive, 2003), although bradycardia is the dominant cardiac response in the rabbit (Kapp et al., 1979). Conditioned fear is also associated with increased blood pressure (LeDoux et al., 1988; Walker and Carrive, 2003), peripheral vasoconstriction (Vianna and Carrive, 2005), arousal and vigilance, (Davis and Whalen, 2001; Whalen, 1998), non-BAT mediated thermogenesis (Marks et al., 2009), and muscle tension as measured by increased EMG in dorsal neck muscles (Cassella et al., 1986; Steenland and Zhuo, 2009). Freezing has been associated with resetting of the baroreflex to allow higher blood pressure in parallel with increased renal sympathetic nerve activity but no change in lumbar sympathetic nerve activity (Miki and Yoshimoto, 2010), however this response has not been tested in conditioned fear.

1.3.3 The VLPAG and PeF/LH mediate different components of the conditioned fear response

Arguably the most important structures in co-ordinating the expression of passive and active components of the conditioned fear response are the VLPAG and PeF/LH respectively. These structures simultaneously co-ordinate separate behavioural and physiological responses during conditioned fear. Interestingly, these areas are amongst a very small number of structures which contain neurons that are both somatomotor and sympathomotor neurons (Kerman, 2008), and presympathetic neurons in these structures - especially the PeF/LH - are activated in conditioned fear to context (Carrive and Gorissen, 2008). The caudal VLPAG is preferentially activated by aversive psychological and physiological challenges which demand a passive rather than active coping response such as deep pain (Bandler et al., 2000; Carrive, 1993; Keay and Bandler, 2001), illness (Tkacs and Li, 1999) and recovery from stress or exercise (Lovick, 1993; Walker & Carrive, 2003). The VLPAG mediates freezing immobility, antinociceptive and bradycardic

45 components of the conditioned fear response (Bellgowan and Helmstetter, 1998; Carrive et al., 1997b; De Oca et al., 1998; LeDoux et al., 1988; Walker and Carrive, 2003; Zhang et al., 1990). Interestingly, temporary inactivation of the VLPAG in freely moving rats resulted in constant behavioural activity, MAP and HR, similar to the effect of temporary inactivation before conditioned fear to context.

The PeF/LH plays a complementary role to the VLPAG in mediating conditioned fear (Walker and Carrive, 2003). The PeF and LH are crucial in mediating pressor, tachycardic, arousal and muscle tone responses observed in sustained conditioned fear of a context (Carrive, Bowen, & Walker, 1999; Furlong & Carrive, 2007) or a discrete CS (Iwata et al., 1986b; LeDoux et al., 1988). Interestingly, the PeF/LH mediates freezing in sustained, contextual fear, but not in conditioned fear to a discrete CS. This dual control of behaviour and autonomic arousal by the PeF may be due to single neurons in the PeF/LH that are positioned to activate sympathetic and locomotor activity simultaneously (Jansen et al., 1995; Kerman, 2008; Kerman et al., 2007; Krout et al., 2003). Alternatively, the PeF/LH may function as a synaptic relay from the extended amygdala to the VLPAG during contextual fear. Indeed we previously found that conditioned fear was associated with more Fos expression in these projections than any other afferent structure of the VLPAG (Olsen, 2007). Activation of the LH with glutamate or electrical stimulation causes short-latency activation of VLPAG neurons and pronounced antinociception in the tail flick test (Behbehani et al., 1988) but the function of these projections on behaviour is unclear.

Walker and Carrive (2003) proposed that the VLPAG functions as a ‘brake’ during conditioned fear, superimposing immobility and opposing locomotor activity that would otherwise be triggered by activation of the PeF/LH - since activation of the PeF/LH normally increases locomotor activity in parallel with sympathoexcitation. Thus, while neurons in the PeF/LH generally mediate increases in locomotion, it is possible that the projection to the VLPAG may act to modulate freezing, as well as induce antinociception.

1.3.4 Brief review of orexin

Orexin (also known as hypocretin) is a neuropeptide expressed exclusively in the dorsomedial, perifornical and lateral hypothalamus. It was discovered independently by two groups only relatively recently in 1998 (de Lecea et al., 1998; Sakurai et al., 1998), yet has already been demonstrated to be a neuropeptide of critical and even central importance to remarkably diverse functions essential for survival and reproduction. It exists in two forms, orexin-A and orexin-B (Sakurai et al., 1998). Both ligands bind with equal affinity to the orexin-2 receptor (ORX2R) but orexin-A binds with over 10 times greater affinity to the orexin-1 receptor (ORX1R)

(Ammoun et al., 2003). Orexin is co-released with glutamate (Rosin et al., 2003) and usually co-expressed with neurotensin (Furutani et al., 2013). The peptide is critically involved in arousal and wakefulness (Adamantidis et al., 2007; Boutrel et al., 2010; Carter et al., 2009; Sasaki et al., 2011), attention (Fadel and Burk, 2010) stress and the defence response (see below), cardiorespiratory and sympathetic nervous system function (see below), reward & drug seeking and conditioned place preference (Harris and Aston-Jones, 2006; Harris et al., 2007, 2005), energy expenditure and thermoregulation (Kotz et al., 2008; Morrison et al., 2012; Nixon et al., 2012; Zhang et al., 2010), male sexual behaviour (Muschamp et al., 2007) and synaptic plasticity & memory (Akbari et al., 2007, 2006, 2011, 2008; Borgland et al., 2006; Deadwyler et al., 2007; Jaeger et al., 2002; Mair and Hembrook, 2008; Selbach et al., 2010, 2004; Telegdy and Adamik, 2002; Yang et al., 2013).

Orexin neurons project extensively throughout the whole CNS apart from the cerebellum (Sakurai and Mieda, 2011). The most prominent anatomical projections of the orexin system are to other arousal systems - namely the serotonergic, noradrenergic, cholinergic, dopaminergic and histaminergic cell groups (Date et al., 1999; Fadel and Deutch, 2002a; Nambu et al., 1999; Peyron et al., 1998; Takakusaki et al., 2005); and functional studies have indicated that orexin activates all of these arousal systems (Arrigoni et al., 2010; Brown et al., 2002; Date et al., 1999; Eriksson et al., 2001; Fadel and Burk, 2010; Hagan et al., 1999; Tao et al., 2006). Other notably dense fibre and receptor distributions are found in the hypothalamus, extended amygdala (especially BNST and CeM), septum, thalamus - (especially its paraventricular nucleus), PAG, substantia nigra pars compacta, RVLM and nucleus of the solitary tract (Date et al., 1999; Fadel and Deutch, 2002a; Marcus et al., 2001; Nambu et al., 1999; Peyron et al., 1998; Schmitt et al., 2012). These studies also reported moderate projections to the cortex and a light to moderate projection to the hippocampus.

1.3.5 Orexin and orexin-containing neurons are key substrates of active defensive responses

Orexin is synthesised exclusively in neurons located in the dorsal tuberal hypothalamus, or orexin field. This area overlaps with the classic defense region of the hypothalamus. The orexin system is necessary for the normal expression of all of the physiological and behavioural active defense responses: tachycardia and hypertension, stress-induced analgesia, skeletal muscle vasodilation, tachypnea, renal sympathetic nerve activity, baroreceptor reflex shifting, increased locomotor activity and arousal (Iigaya et al., 2012; Johnson et al., 2010; Kayaba et al., 2003; Watanabe et al., 2005; Zhang et al., 2010, 2006a, 2006b). Interestingly, orexin release in the amygdala is heightened during anger in humans (Blouin et al., 2013).

1.3.6 Orexin enhances motor and sympathetic activity

Orexin activates pre-sympathetic neurons in multiple structures (Geerling et al., 2003) such as the RVLM (Huang et al., 2010; Shahid et al., 2012) and RVM (Berthoud et al., 2005; Ciriello et al., 2003; Luong and Carrive, 2012; Zheng et al., 2005) leading to enhanced HR, MAP and sympathetic nerve activity. It also directly activates somatic motorneurons and sympathetic preganglionic neurons (Kerman et al., 2007; Peever et al., 2003; van den Top et al., 2003; Yamuy et al., 2010; Young et al., 2005) through direct projetions to the spinal cord. Intrathecal and i.c.v. injection of orexin strongly increases HR, MAP, muscle tone, respiration, systemic catecholamine and glucose release (Luong, 2012; Nakamura et al., 2000; Samson et al., 1999; Shirasaka et al., 1999). Crucially, a substantial number of orexin neurons are amongst a small number of cells in the brain which are both sympathomotor and somatomotor neurons (SMSNs). One study showed that about 30% of orexin neurons send collateralised dual-synaptic projections to sympathectomised skeletal muscles and adrenal gland (Kerman et al., 2007). In a similar study, half of all orexin neurons in the LH were found to monosynaptically project to the primary motor cortex and dual-synaptically project to the stellate ganglion (Krout et al., 2003). Thus, many orexin neurons could be considered ‘command neurons’ which mediate feed- forward, coupled increases in somatomotor and sympathomotor activity.

Orexin neurons are strongly activated during locomotor activity rather than quiescent wakefulness. It has been suggested that locomotor activity is one of the primary functions of orexin neurons (Kodama et al., 2005; Lee et al., 2005; Luong, 2012; Mileykovskiy et al., 2005; Nixon and Smale, 2004; Torterolo et al., 2003; Wu et al., 2002). The number of Fos/orexin neurons is 15 times higher in rats which are involved in active movement versus rats which are awake but quiescent (Torterolo et al., 2003). Orexin potently increases movement when microinjected into multiple brain structures (España et al., 2001; Hagan et al., 1999; Kotz et al., 2008, 2006) including the CeA (Avolio et al., 2011); although microinjections in the BNST (Lungwitz et al., 2012), substantia innominata, medial septum and medial preoptic area (España et al., 2001) have little or no effect on locomotor activity. Especially strong increases in activity and arousal are also seen after injection in the lateral, 3rd and 4th ventricles (España et al., 2001; Luong, 2012; Samson et al., 2010), which may be due to a secondary increase in dopaminergic activity (Nakamura et al., 2000). Interestingly, injection of orexin in cervical and upper thoracic spinal cord (T2-T3) increases both locomotor activity and wakefulness (Luong, 2012).

1.3.7 Orexin activates multiple arousal systems

Orexin activates pyramidal neurons in the mPFC (Li et al., 2010a), which are involved in selecting active and passive coping responses (Amat et al., 2005; Warden et al., 2012). Orexin

48 neurons also project to and activate noradrenergic (Hagan et al., 1999; Tose et al., 2009; Walling et al., 2004) histaminergic (Siegel, 2009) and cholinergic arousal systems (Arrigoni et al., 2010; España et al., 2001; Fadel and Burk, 2010). Activation of these systems increases cerebral blood flow (Nakai et al., 1997) and general cortical and hippocampal activation associated with arousal, active coping, memory and attention (Gozzi et al., 2010; Harris and Aston-Jones, 2006; Jaeger et al., 2002; Jones, 2008; Wu et al., 2002b). The orexin system is involved in reward seeking and goal-directed behaviour via its projections to the VTA (Aston- Jones et al., 2010; Harris et al., 2005; McGregor et al., 2011).

1.3.8 The orexin system is recruited for active coping

In addition to its involvement in active defense responses, the orexin system is thought to be a key neural substrate for active coping generally (see Kerman et al. 2007). Rats displaying social dominance, less anxiety and increased operant responding for food (Davis et al., 2009) - traits associated with active coping (Koolhaas et al., 2010) - show elevated levels of ORX1 receptor mRNA in the mPFC. Orexin concentrations in the CSF of dogs is elevated after social activity (Wu et al., 2011). Similarly, concentrations in the human lateral and basolateral amygdala are at their highest during positive emotions and social interaction (Blouin et al., 2013). Electrophysiological evidence shows that the firing rate of orexin neurons is greatest during exploration of a novel environment (Mileykovskiy et al., 2005). Further, the number of orexin neurons expressing Fos was found to be greatest after exploration of a novel environment relative to a range of other challenges (Furlong et al., 2009), whilst systemic administration of the dual orexin antagonist almorexant strongly attenuates locomotor activity, MAP and HR during exploration (Furlong et al., 2009). Importantly, the same dose of almorexant failed to attenuate locomotor and cardiovascular responses to cold stress, despite high levels of physical activity. Almorexant also failed to attenuate cardiovascular responses during restraint. These results suggest, firstly, that orexin is not essential for locomotor activity in all situations (see (Georgescu et al., 2003); and that the orexin system is not responsible for behavioural and cardiovascular responses to all forms of stress, but is selectively recruited during situations which demand engagement with the environment (Furlong et al., 2009). Consistent with this notion, over twice as many orexin neurons are activated by conditioned lever pressing for food compared to the presentation of food; similarly, active avoidance of shock activates about twice as many orexin neurons as inescapable shock (McGregor et al., 2011), demonstrating a stronger orexin involvement in seeking or active coping behaviour than the experiences of reward or punishment. Interestingly, stimuli which elicit components of both active and passive coping such as conditioned fear appear to recruit the orexin system at moderate levels (Furlong, 2006; Furlong et al., 2009; Luong, 2012).

1.3.9 Orexin and passive coping

Multiple studies have reported that the orexin system is suppressed during passive coping responses such as after chronic social defeat and in depression (Brundin et al., 2009, 2007a, 2007b; Johnson et al., 2010; Lutter et al., 2008; Rotter et al., 2011), and levels of orexin in the CSF of depressed patients is significantly negatively correlated with vegetative symptoms of depression such as slowness of movement and difficulty in initiating activities (Brundin et al., 2007b). The orexin system is also suppressed during other forms of passive coping such as sickness behaviour (Grossberg et al., 2011), inescapable pain and physical immobilisation/restraint (Blouin et al., 2013; Furlong, 2006; Furlong et al., 2009; Martins et al., 2004; McGregor et al., 2011).

On the other hand, a recent study demonstrates strong evidence for orexin in mediating passive coping responses in states of fear and stress (Chen et al., 2013). This study showed that levels of preproorexin mRNA is correlated with immobility during conditioned fear and novelty. Conversely, immobility during conditioned fear was significantly attenuated by a dual-orexin antagonist. This treatment also significantly enhanced locomotor activity in an open field in rats previously exposed to footshock. Similarly, another study showed that an ORX1 antagonist was associated with enhanced baseline locomotor activity (Johnson et al., 2012c). These findings suggest that in some cases, orexin promotes passive coping at the expense of active coping. Furthermore, microinjection of orexin into specific structures leads to features of passive coping. Low doses of orexin in the nucleus ambiguus and NTS triggers bradycardia and bradycardia with a depressor response respectively (Ciriello and de Oliveira, 2003; de Oliveira et al., 2003), and injections of orexin in the paraventricular thalamus (PVT) significantly reduce locomotor activity and increase levels of freezing (Li et al., 2010b, 2009). ORX1 receptors in the central amygdala (Arendt et al., 2013) and generally in the brain (Scott et al., 2011) is associated with immobility in the forced swim test. Moreover, freezing responses to disinhibition of the DMH/PeF in conjunction with sodium lactate (a model of hypercapnic panic attack) are abolished by an ORX1 receptor antagonist (Johnson et al., 2010). However, this model of hypercapnic panic is also associated with features of active coping such as enhanced HR, MAP and locomotor activity, and these responses are strongly attenuated or abolished by an ORX1 antagonist or prepro-orexin siRNA injected in the perifornical hypothalamus (Johnson et al., 2012b, 2012c, 2010). Thus, there appears to be a dual effect of orexin in mediating both increased locomotor activity as well as increased freezing responses. In general, it appears that orexin enhances locomotor activity in unstressed animals, but may enhance immobility secondary in states of anxiety or stress, although there are exceptions to this (Avolio et al., 2011)

1.3.10 Orexin, anxiety and mood

The relationship between orexin and mood and anxiety is unclear and is slowly being revealed. Many studies report apparently conflicting results regarding the role of orexin in depression (reviewed in Nollet & Leman, 2013a) and anxiety. These results appear to depend on the particular site of action of orexin, which orexin receptors are involved, and how anxiety is measured. For example, orexin has an anxiogenic effect in the PVT (Li et al., 2010b, 2010c), CeA (Avolio et al., 2011) and BNST (Johnson et al., 2010; Lungwitz et al., 2012), but apparently anxiolytic effects in the mPFC (Davis et al., 2009). Different tests of anxiety may lead to different interpretations of the effect of orexin on anxiety. One study showed that systemic administration of a dual orexin antagonist (almorexant) reduced fear-potentiated startle, however systemic administration of a dual-orexin receptor antagonist did not affect behaviour in the elevated plus maze (Steiner et al., 2012), consistent with other studies which showed that ORX1 antagonism (Rodgers et al., 2013) or deletion of either orexin-1 or orexin-2 receptors had no effect in the EPM (Scott et al., 2011). On the other hand, exogenous application of orexin in the BNST, CeA and PVT increases anxious behaviour in the EPM (Avolio et al., 2011; Li et al., 2010c; Lungwitz et al., 2012). One interpretation of these findings offered by Rodgers et al. (2013) is that orexin does not mediate baseline levels of anxiety, but mediates anxiety in heightened states of arousal such as in panic and conditioned fear. Indeed, inhibition of orexin signalling strongly attenuates multiple behavioural signs of anxiety induced in models of panic, such as decreased time in an open field, avoidance, reduction of social interaction and freezing (Johnson et al., 2012a, 2010).

Interestingly, activation of orexin neurons by caloric restriction reduces immobility in the forced swim test (Lutter et al., 2008), suggesting an overall antidepressant effect of orexin neurons and increase in active coping. However, mice lacking orexin do not show an increase or decrease in immobility in the forced swim test. This observation led Scott et al. (2011) to suggest that orexin-1 and orexin-2 receptors have a pro-depressive and anti-depressive effect respectively which oppose each other, culminating in no net effect. Concentrations of orexin in CSF are higher in suicidal patients with panic symptoms (Johnson et al., 2010), however they are lower in patients with post traumatic stress disorder (PTSD) (Strawn et al., 2010). It is unknown why panic and PTSD are associated with high and low levels of orexin respectively. It was argued (Johnson et al., 2012a) that phasic stress may activate orexin neurons and chronic stress might inhibit them. Consistent with this, one study showed that chronic stress led to an epigenetic suppression of orexin expression (Lutter et al., 2008), however it has also been shown that chronic stress increases the number of activated orexin neurons in the DMH and PeF (Nollet et al., 2011). The latter finding may be due to an increased recruitment or orexin neurons to compensate for lower orexin expression. However it is important to note that in the former 51 study, rats were subjected to repeated (10 days) of social defeat, which was associated with submissive posture; whilst the forms of stress in the latter study were milder: (e.g. restraint, replacing bedding with water, cage tilt), and this form of repeated stress elicited shorter attack latency (i.e. these rats became more aggressive rather than less aggressive). These results are consistent with the notion that orexin neurons are activated by stressors which evoke active coping responses and inhibited by those which induce passive coping responses.

1.3.11 Orexin activates the HPA axis and enhances anxiety via CRF pathways

A reciprocal relationship exists between the orexin and CRF systems. Specifically, CRF directly activates orexin neurons, over 60% of which express CRF receptors (Winsky-Sommerer et al., 2004) and CRF-receptor knock-out mice display attenuated activation of orexin neurons in response to stress (Winsky-Sommerer et al., 2004). Conversely, orexin administered in the lateral ventricle activates almost all CRF neurons in the paraventricular hypothalamus (PVN) and half of the CRF neurons in the CeA (Sakamoto et al., 2004). Injection of orexin in the PVT, or i.c.v. enhances CRF expression in parvocellular PVN neurons and activates the HPA axis, culminating in a 3 to 7 fold increase in glucocorticoid concentrations, associated with signs of anxiety (Al-Barazanji et al., 2001; Heydendael et al., 2011; Ida et al., 2000) that are blocked by i.c.v. administration of CRF- and dynorphin antagonists (Ida et al., 2000; Li et al., 2010c).

1.3.12 The role of orexin in conditioned fear

Narcoleptic patients with cataplexy do not show amygdala activation during presentation of a CS+ relative to a CS- (Ponz et al., 2010). Because this illness is associated with fewer orexin neurons and less orexin expression (Mignot et al., 2002; Peyron et al., 2000; Thannickal et al., 2000), this suggests that orexin neurons may play an important role in conditioned fear; and this may be due to orexinergic projections to the amygdala (Fig. 1.4, 1.5; Baldo et al., 2003; Fadel and Deutch, 2002; Peyron et al., 1998; Schmitt et al., 2012).

Further evidence for a role of orexin in conditioned fear was obtained by systemic administration of dual orexin receptor antagonists. An earlier study using almorexant showed that this treatment moderately reduced freezing and ultrasonic vocalisations in a 30 min re- exposure to a fear conditioned context (Furlong et al., 2009), however this did not attain statistical significance. Almorexant was, however, significantly associated with a substantial reduction of the pressor response as well as the cardiac sympathetic response, revealed when atropine was co-administered to block vagal outflow. Another study using almorexant showed that this treatment attenuated the expression of fear-potentiated startle (Steiner et al., 2012). A more recent study showed that the dual orexin receptor antagonist TCS-1102 significantly reduced immobility during conditioned fear (Chen et al., 2013). Additionally, a strong 52 correlation was found between levels of prepro-orexin mRNA and immobility during re- exposure to this context.

An important question is how orexin mediates immobility. One possibility is via projections to the PVT (Li et al., 2010b, 2009). Another possibility is that the orexin system could potentiate conditioned fear responses through its projections to the amygdala. This could explain the impaired amygdala activation in conditioned fear (Ponz et al., 2010), and would predict that subjects with higher basal orexin tone may display heightened fear responses. Within the amygdala, orexin might be expected to modulate conditioned fear through its selective projections to the medial CeA, where it activates CeM neurons (Bisetti et al., 2006; Johnson et al., 2012a) which normally induces freezing (Ciocchi et al., 2010; Duvarci et al., 2011) - although microinjection of orexin in this structure paradoxically increases locomotor activity (Avolio et al., 2011). Another possibility is through projections to the VLPAG (Burgess et al., 2013; Peyron et al., 2000) where it reduces inhibitory postsynaptic currents (IPSCs) in RVM- projecting neurons in vitro (Ho et al., 2011) and leads to antinociception, probably via these projections to the RVM (Azhdari Zarmehri et al., 2011; Ho et al., 2011). Importantly, activation of the VLPAG-RVM pathway is thought to be necessary for freezing in conditioned fear (Morgan and Whitney, 2000; Vianna et al., 2008; Walker and Carrive, 2003).

Orexin neurons show enhanced Fos expression after conditioned fear to context (Chen et al., 2013; Furlong et al., 2009; Luong, 2012). Interestingly, some studies have shown that the level of Fos expression after sustained (40 min) re-exposure to a feared context is lower than several other conditions such as novelty, forced exercise and wakefulness at night, but greater than restraint (Furlong et al., 2009; Luong, 2012). One explanation for this is that the number of activated orexin neurons may be tightly regulated to an optimal, moderate level during conditioned fear. This would have the advantage of promoting arousal, tachycardia, increased blood pressure, muscle tone, immobility and amygdala activation (Ponz et al., 2010) without the effects of excessive orexin release, which might result in active behaviours such as locomotor activity, grooming, exploration, engagement with the environment and seeking behaviour – all of which could out-compete the freezing response. Since orexin neurons are innervated by a direct GABAergic projection from the CeA and BNST (Nakamura et al., 2009; Sakurai et al., 2005; Yoshida et al., 2006), orexin neurons could be tightly regulated by both inhibition and disinhibition by these structures. Thus, they could be activated at moderate levels during freezing, but strongly activated when an aversive situation becomes escapable or demands a fight or flight response. Alternatively, perhaps orexin neurons with projections to structures involved in anxiety, arousal and immobility are activated in conditioned fear, whilst orexinergic projections to structures involved in locomotor activity are suppressed. Indeed, there are

53 separate populations of orexin neurons with different functions (Harris and Aston-Jones, 2006). One speculative possibility is that separate populations of orexin neurons are involved in locomotor activity and immobility.

1.3.13 Is the pattern of orexin neuron activation similar or different in separate emotional states associated with arousal?

The balance of inhibition and disinhibition of orexin neurons could be optimised in fear and anxiety by massive GABAergic projections from the CeA and BNST. At face value it seems very likely that the expression of anxiety and fear is a major function of these projections, given the well-known functional properties of the CeA and BNST. Therefore, through these pathways, the activity of orexin neurons may be expected to be responding (indirectly, but specifically) to contextual or discrete fear-conditioned cues when they occur. Thus, the enhanced arousal observed in conditioned fear may be partly secondary to enhanced activity of orexin neurons driven directly by the extended amygdala. However, it is possible that in addition to this, orexin neurons may also be recruited by other arousal systems - e.g. cholinergic and serotonergic (Sakurai et al., 2005) - during states of fear. This may also occur in other motivational states associated with arousal such as novelty. According to this interpretation, some of the excitation of orexin neurons observed in conditioned fear may be considered to be non-specific to fear (excited by the activation of other arousal systems) and some of it would presumably be specific to fear, due to very dense, direct projections from the extended amygdala.

An important observation germane to this discussion is that the percentage of orexin neurons expressing Fos is lower after animals are re-exposed to a footshock box where they were previously shocked, relative to when re-exposed to a footshock box where they were not shocked (Furlong, 2006). This could be interpreted in several ways, for example in a ‘bottom- up’ way, as orexin neurons are more likely to be active when an animal is moving, which is less likely in the conditioned fear group which were inactive due to freezing. Another (top-down) interpretation, which I favour, is that fear may have a partially inhibitory (relative to re- exposure) and partially excitatory (relative to rest in homecage) effect on orexin neurons, and the subsequent balance of activity of orexin neurons per se is likely to be unique and specific to fear, reflecting the response demanded by the environment (in the case of fear, freezing rather than movement but with elevated cardiovascular parameters such as HR, BP and muscle vasodilation). Such an optimised balance of excitation and inhibition would be expected to arise from forebrain afferents such as the CeA, BNST and mPFC. Similarly, orexin neurons may be recruited at various, optimised levels for separate emotional and motivational states according to the behavioural and physiological requirements of that state; and this would be expected to be

54 reflected in the activity of forebrain afferents responding to the environment, or more caudal afferents reflecting the homeostatic requirements of the animal.

1.4 Part 4: Summary, Hypotheses and Aims

1.4.1 Summary

It is suspected that most CeM neurons are GABAergic. There is conflicting evidence as to whether the CeA also contains glutamatergic neurons, however there is some evidence that the proportion of CeM projection neurons that are GABAergic or form symmetric versus asymmetric synapses varies depending on the anatomical target of the CeA. Further, there may be separate cells in the CeM which project to different structures. Most (97%) CeA terminals in the LPAG form symmetric synapses, suggesting that almost all of these are GABAergic. However, it is unknown if the projection from the CeA to the caudal VLPAG is also GABAergic, and if any of it is glutamatergic.

The CeM is phasically activated (but tonically inhibited) by conditioned fear to a discrete CS in rats, but the opposite effect occurs in rabbits. Phasic activation of the CeM is significantly correlated with freezing, but tonic activity of the CeM is also negatively correlated with freezing - although this is not significant - in conditioned fear to a discrete CS (Ciocchi et al., 2010). It is possible that this relationship may become significant in foreground contextually conditioned fear, which does not involve discrete, short duration CS’s. Further, some studies show that CeM activation is correlated with active avoidance responses (Martinez et al., 2013) and negatively correlated with freezing (Martinez et al., 2013; Savonenko et al., 1999). It is not clear how phasic and tonic activity in CeM could have opposite effects on freezing. If the CeA-VLPAG projection is GABAergic and tonically active to maintain the VLPAG in an inhibited state, one possibility is that this projection becomes excitatory with high frequency bursts of phasic activity, which would be sufficient for peptide release (Vilim et al., 1996; Whim and Lloyd, 1989; Zupanc, 1996), specifically CRF, which is present in 40-50% of brainstem projecting CeA neurons (Chen et al., 2009; Reyes et al., 2011), evokes a short-latency excitatory effect on output neurons in efferent targets of the CeA (Bouret et al., 2003; Bowers et al., 2003), and mediates fear responses in these structures (Borelli et al., 2013; Fendt et al., 1997; Swiergiel et al., 1992).

The BNST mediates conditioned fear to sustained and contextually conditioned stimuli through direct projections to the brainstem (Jennings et al., 2013), but does not mediate responses to short-duration stimuli, whilst the opposite appears to be the case for the CeM (Koo et al., 2004; Pitts and Takahashi, 2011; Walker et al., 2009). Conditioned fear to a sustained CS might involve inhibition of the CeM/phasic fear system through activation of GABAergic BNST 55 neurons, which project densely to the CeM. If the CeM-VLPAG projection is indeed GABAergic and tonically active, then inhibition of CeM neurons may increase freezing by disinhibition of VLPAG output neurons. Inhibition of the CeM would also inhibit the reciprocal GABAergic inhibitory feedback to the BNST (see section 1.2.15; Fig. 1.3). Accordingly, inhibition of the CeM would be expected to enhance conditioned fear responses to a sustained CS.

Surprisingly few studies that we are aware of have examined the cardiovascular effects of selectively activating CeM neurons in conscious animals. The available evidence suggests that activation of the CeM leads to bradycardia in conscious animals (Applegate et al., 1982; Roozendaal et al., 1993b, 1992a), which is associated with a depressor response in anaesthetised rabbits (Kapp et al., 1982). This is consistent with anatomical evidence showing that the CeM sends GABAergic projections directly to sympathoexciatory presympathetic neurons in the RVLM (Saha et al., 2005) and orexin neurons (Nakamura et al., 2009; Sakurai et al., 2005; Yoshida et al., 2006), which are strongly associated with increased HR and MAP. However, no studies that we know of have recorded blood pressure after selective activation of the CeM in conscious rodents. Thus, there currently appears to be no direct evidence that selective activation of the CeM replicates the dominant cardiac sympathoexcitation leading to pressor and tachycardic responses that is observed in conditioned fear in rodents (Iwata and LeDoux, 1988).

Finally, orexin neurons may contribute to conditioned fear responses. It appears that the extent of activation of the orexin system may be limited or optimised during sustained conditioned fear to context, possibly through GABAergic projections from the central extended amygdala. Activation of orexin neurons may be critical in mediating the increase in heart rate, blood pressure and muscle tone that occurs in conditioned fear. Orexin neurons project heavily to, and activate neurons in the CeM. Orexin in the amygdala may be necessary for normal amygdala responses to conditioned fear (Ponz et al., 2010) and thus the normal expression of conditioned fear responses. One study showed that orexin injected in the CeA increased anxiety and increased locomotor activity in the elevated plus maze (Avolio et al., 2011). This is interesting because previous studies show that orexin activates the same individual CeM neurons that are activated by vasopressin (Bisetti et al., 2006). Vasopressin action in the CeA potentiates immobility during conditioned fear to a short-duration contextual CS, but has no effect at rest (Roozendaal et al., 1993b, 1992a). Therefore it is unclear whether orexin in the CeA would, through its excitatory action on CeM-VLPAG output neurons, increase freezing in resting conditions and in sustained conditioned fear or have the opposite effect, i.e. increase activity and reduce freezing. The effect of orexin in the CeA could further reveal the functional properties of the CeA-VLPAG projection.

There is also a moderate to dense projection of orexin fibres to the VLPAG (Peyron et al., 2000), and orexin and its co-transmitters glutamate and neurotensin have an antinociceptive effect in this structure (Azhdari Zarmehri et al., 2011; Behbehani et al., 1988; Bellgowan & Helmstetter, 1998; Ho et al., 2011), further, neurons in this area of the hypothalamus constitute the greatest number of activated VLPAG afferents during conditioned fear to context (Olsen, 2007). It is unknown if orexin release in the VLPAG induces immobility and bradycardia in accordance with orexin having a general depolarising effect and antinociceptive effect in the VLPAG, which shares some pharmacological features with immobility. This would be consistent with immobility produced by microinjections of orexin in the paraventricular thalamus, and bradycardia when injected in certain structures such as the NTS and nucleus ambiguus. Alternatively, orexin injected in the VLPAG may increase locomotor activity in accordance with its general effect in increasing active coping responses and locomotion, as is observed after injections in ventricles, spinal cord and in multiple brain structures. Importantly, it would be expected that orexin would have a similar effect in the VLPAG as in the CeA, to produce a consistent effect of orexin on the CeM-VLPAG pathway.

1.4.2 General aims and hypotheses of this thesis

The primary general aim of this thesis was to attempt to address the question of whether VLPAG-projecting neurons in the CeM are either GABAergic or glutamatergic, and whether they are inhibited or activated during conditioned fear. We hypothesised i) that these neurons are GABAergic; ii) that CeM neurons would not be activated by sustained conditioned fear to context; and iii) that pharmacological activation of CeM neurons would inhibit freezing during sustained conditioned fear to context, in accordance with the notion that CeM neurons are inhibited in this form of conditioned fear.

The second, complementary general aim was to determine the behavioural and physiological consequences of orexin-A in the CeA and VLPAG in freely moving animals and in conditioned fear. We hypothesised that orexin in the CeA would promote active responses (increased activity, HR, MAP, reduced freezing), consistent with previous findings after microinjection of orexin in the CeA (Avolio et al., 2011), and consistent with the general effect of orexin in the central nervous system. If our hypotheses are correct, namely: intra-CeA injections of orexin increases activity, CeM-VLPAG neurons are GABAergic, and inhibition of these neurons in sustained fear promotes freezing as we have hypothesised, it would suggest that CeM neurons directly project to VLPAG output neurons. Further, it would suggest that in some cases, activation of CeM neurons could lead to active instead of passive responses, consistent with some research (Martinez et al., 2013). Finally, the same behavioural and physiological effects of

57 orexin in the CeA would be expected to be observed in the VLPAG, to promote a consistent action of orexin on the CeA-PAG-RVM pathway.

1.4.3 Specific aims and approaches of this thesis

The first specific aim of this thesis was to determine whether the projection from the CeM to VLPAG is glutamatergic or GABAergic, and whether VLPAG-projecting neurons in the CeA are activated by conditioned fear to context. This is addressed in chapter 2.

The second specific aim of this thesis was to determine the behavioural (locomotor activity and freezing) and physiological (heart rate, blood pressure and tail temperature) effects of selectively stimulating CeM output neurons with orexin (orexin-A) in both freely moving rats in a safe environment (homecage), and in rats re-exposed for a sustained period in a feared context. Importantly, orexin fibres and receptors are found in the CeM but not CeL or CeC, and orexin has previously been shown to activate CeM neurons (Bisetti et al., 2006). This is addressed in chapters 3 and 4.

The final specific aim was to determine the effect of microinjection of orexin-A in the VLPAG on immobility, locomotor activity, heart rate, blood pressure and tail temperature. This is addressed in chapter 5.

Chapter 2 The projection from the CeA to the VLPAG is GABAergic, and does not display Fos expression after sustained re-exposure to a feared context.

2.1 Introduction

Previously, output neurons of the CeA were thought to co-release glutamate with neuropeptides (Davis et al., 1994; McDonald et al., 1989; Takayama and Miura, 1991). However, recent studies have reported that all divisions of the CeA are densely packed with neurons containing GAD65 or GAD67 mRNA, and these appear to constitute the vast majority of CeA neurons, including projection neurons (Bowman et al., 2013; Day et al., 1999; Myers et al., 2013; Niu et al., 2012; Oka et al., 2008; Pitkänen and Amaral, 1994; Poulin et al., 2008; Swanson and Petrovich, 1998) and the majority of CeA neurons projecting to its efferent targets contain GABA and form symmetrical (presumed inhibitory) synapses on neurons in these structures (Cassell and Gray, 1989a; Jia et al., 2005; Jolkkonen et al., 2002; Jongen-Rêlo and Amaral, 1998; Nakamura et al., 2009; Oka et al., 2008; Pickel et al., 1996, 1995; Saha et al., 2000; Saha, 2005; Saha et al., 2002; Tsubouchi et al., 2007, 2007; Tsumori et al., 2010, 2006a, 2006b; Van Bockstaele et al., 1998, 1996; Yasui et al., 2004). Further, the glutamatergic markers VGLUT1 and VGLUT2 were not found in the CeA, despite dense expression in other parts of the amygdala (Kudo et al., 2012; Niu et al., 2012; Oka et al., 2008; Poulin et al., 2008; Wallén- Mackenzie et al., 2009). Finally, chemical and electrical stimulation of the CeA leads to short- latency inhibition of VLPAG neurons in presumed interneurons, followed by excitation in other cells (da Costa Gomez and Behbehani, 1995), suggesting the synaptic release of an inhibitory neurotransmitter or neuropeptide by CeA terminals onto VLPAG neurons.

Nevertheless, several recent reports provide evidence that some of these CeA neurons may be glutamatergic. One study found that, in guinea pigs, 24% of CeA neurons projecting to the nucleus pontis oralis (NPO) were immunoreactive against VGLUT2, a finding that was replicated in the rat, where 26% of NPO-projecting neurons were VGLUT2 immunoreactive. These putative glutamatergic neurons were suggested to be responsible for short-latency EPSPs recorded in the NPO after stimulation of the CeA (Xi et al., 2012, 2011). Furthermore, many CeA neurons appear to express VGLUT3 (Fremeau et al., 2002; Zhao et al., 2012). Interestingly, VGLUT3 has been found to be expressed in some GABAergic neurons (Fremeau et al., 2002; Stensrud et al., 2013; Stornetta et al., 2005), and there is strong evidence that this transporter mediates the co-release of glutamate with GABA at symmetrical synapses (Fremeau et al., 2002; Kudo et al., 2012; Stensrud et al., 2013; Stornetta et al., 2005). Finally, whilst the majority of CeA projection neurons form symmetric synapses on target neurons in efferent structures, asymmetric synapses have also been reported in the parabrachial nucleus, lateral

59 hypothalamus, RVLM and locus coeruleus (Jia et al., 2005; Reyes et al., 2011; Saha et al., 2005; Tsumori et al., 2006b). Interestingly, whilst most CeA terminals make symmetric synapses on neurons near or within the locus coeruleus (Van Bockstaele et al., 1996), those containing CRF and dynorphin which target noradrenergic cells predominantly form asymmetric synaptic contacts (Reyes et al., 2011). In summary, most projections of the CeA appear to be GABAergic - however there is some variability in reports examining the proportion of inhibitory and excitatory CeA projections in its different efferent targets (see literature review). Therefore, the relative proportions of excitatory and inhibitory projections of the CeA should be examined in detail.

Recent work has revealed that activation of the CeM is sufficient to spontaneously induce freezing behaviour (Ciocchi, 2009; Ciocchi et al., 2010; Nobre and Brandão, 2011), and is necessary for conditioned fear to a discrete conditioned stimulus (CS) (Ciocchi et al., 2010; Duvarci et al., 2011; Haubensak et al., 2010; Li et al., 2013). The CeM mediates freezing through its dense projection (Rizvi et al., 1991) to the VLPAG (P. Carrive et al., 1999; Carrive et al., 1997b; De Oca et al., 1998; LeDoux et al., 1988; Walker and Carrive, 2003). However, activation of glutamatergic RVM-projecting VLPAG neurons is thought to be necessary for freezing in conditioned fear (Morgan and Carrive, 2001; Morgan and Whitney, 2000; Vianna et al., 2008; Walker and Carrive, 2003). Thus, to elucidate the circuit mediating freezing in conditioned fear, it is first necessary to determine the proportion of GABAergic and glutamatergic neurons in the CeA-VLPAG projection. We hypothesised that this projection would be mostly GABAergic, in line with previous studies (da Costa Gomez and Behbehani, 1995; Nakamura et al., 2009; Oka et al., 2008; Pitkänen and Amaral, 1994; Poulin et al., 2008; Swanson and Petrovich, 1998). This data has been presented previously in abstract and poster form (Australian Neuroscience Society, 2009, 2010; FENS, 2010).

In the second experiment, we investigated whether the same CeM neurons which are activated in conditioned fear to a discrete CS are also activated during a long-duration re-exposure to a feared context. It was previously thought that both the CeA and BNST were both necessary for conditioned fear responses to a contextual (or long-duration) CS (Kim et al., 1993; Phillips and LeDoux, 1992; Sullivan et al., 2004) however more recent findings suggest that the BNST, but not the CeA is necessary for conditioned fear responses to long-duration and contextually conditioned stimuli (Davis et al., 2010, 1997; Koo et al., 2004; Luyten et al., 2012, 2011; Pitts and Takahashi, 2011; Resstel et al., 2008; Walker and Davis, 1997; Walker et al., 2009; Zimmerman and Maren, 2011). It has even been suggested that the BNST may inhibit the CeM during long-duration or contextual fear (Walker et al., 2009). If CeM-VLPAG projection neurons are GABAergic, exhibit spontaneous activity (Ciocchi et al., 2010; Huber et al., 2005;

Lu et al., 1997; Pascoe and Kapp, 1985; Rosenkranz et al., 2006; Thomas et al., 2013; Viviani et al., 2011) and project to glutamatergic PAG output neurons (Oka et al., 2008), then inhibition of the CeM may activate VLPAG output neurons, thus contributing to the freezing response. Similarly GABAergic brainstem-projecting BNST neurons are inhibited in contextual fear (Jennings et al., 2013). Thus, it was hypothesised that VLPAG-projecting neurons in the CeA would not express Fos after re-exposure to a fear-conditioned context.

2.2 Methods

2.2.1 Subjects The subjects were experimentally naive male Wistar rats (400–550 g, n = 6, experiment 1; n = 10, experiment 2) obtained from the colony of specific pathogen-free rats maintained by the University of New South Wales. They were housed in individual plastic home boxes (65 × 40 × 22 cm) during the whole duration of the experiment. All procedures were approved by the Animal Ethics Committee of the University of New South Wales, and conformed to the rules and guidelines on animal experimentation in Australia.

2.2.2 Retrograde tracing The rats were anaesthetized with an intraperitoneal injection of a mixture of ketamine (100 mg ⁄ kg) and xylazine (50 mg ⁄ kg) followed by a subcutaneous injection of the non-steroidal analgesic Carprofen (5 mg ⁄ kg). They were then mounted in a stereotaxic frame and were iontophoretically injected with cholera toxin subunit B (CTB; 0.1%; List Biological Laboratories) in the VLPAG (0.6 mm anterior, 5.6 mm ventral and 2.8 mm lateral to lambda at an angle of 20 degrees) through a 20 µm glass micropipette (2 - 2.3 µA positive pulses; 7 s on/off cycles for 40 min) after which the micropipette remained in place for a further 5 min. Pressure injections (200 nl of 0.1% CTB, low salt) were administered over a 5 min period, after which the micropipette remained in place for a further5 min. The animals were maintained for 2 weeks to allow for retrograde transport of the tracer.

2.2.3 Experiment 1: Combined in situ hybridization and immunohistochemistry Rats were deeply anaesthetised with sodium pentobarbital (120 mg/kg i.p.) and transcardially perfused with 150 ml ice cold saline for 4 min followed by 250 ml ice cold fixative solution (4% paraformaldehyde/0.1 M phosphate buffer, pH 7.4) over 15 min under RNase free conditions. Brains were removed and postfixed in the same solution for 12 - 16 h at 4 °C. Coronal sections of the brain at the level of the amygdala (40 μm thick) were cut into four series with a vibrating microtome (Leica Microsystems) under RNAse free conditions.

Non-radioactive antisense and sense (control) riboprobes incorporating digoxigenin-11-UTP (Roche Applied Science) were transcribed in vitro (Epicentre Biotechnologies) from PCR- generated, purified cDNA fragment templates with T7 and SP6 RNA polymerase promoters. Riboprobes for GAD67, VGLUT1 and VGLUT2 were custom synthesized and validated as described previously (Burke et al., 2008; Stornetta and Guyenet, 1999) (table 1). Free floating tissue sections were processed for in situ hybridization using digoxigenin conjugated riboprobes targeting mRNA transcripts for either GAD67 (n = 6), VGLUT2 (n = 3) or VGLUT1 (n = 2) (each in a separate series) together with multi-fluorescence immunohistochemistry, in accordance with a protocol which has been described previously (Burke et al., 2008; Li et al., 2005; Seyedabadi et al., 2006). Briefly, sections were placed in a pre-hybridisation solution for 2 h at 58 °C. The riboprobe was then added at a concentration of 200 ng/ml and sections were incubated at 58 °C overnight. Sections were washed and primary antibodies against digoxigenin [alkaline phosphatase-conjugated anti-digoxigenin, raised in rabbit (1:1000; DAKO, Denmark)] and CTB (1:4000; raised in goat; List Biological Laboratories) were added and incubated for 48 hours. Additionally, for some of the series, antibodies against either tyrosine hydroxylase (TH; 1:10,000, raised in mouse; Sigma-Aldrich) or NeuN (1:2500; raised in mouse, Chemicon, Boronia Victoria, Australia) were also added at this point. After washing, the sections were re- incubated with fluorsecent secondary antibodies: alexafluor 594 conjugated donkey anti-goat (1:500; Invitrogen) for CTB, and FITC conjugated rabbit anti-mouse (1:500; Jackson ImmunoResearch), for TH or NeuN. The sections were washed again and the target mRNA was visualised by a chromogenic alkaline phosphatase dependent reaction using nitroblue tetrazolium (NBT) and 5-bromo-4-chloro-3-indolyl phosphate (BCIP) (Roche) as substrates, which produced a dark purple precipitate. Finally, the sections were mounted onto slides with Prolong Antifade (Invitrogen).

2.2.4 Analysis

Digital images of the ipsilateral amygdala were taken with a 20x objective on an Olympus DP70 fluorescent microscope using fluorescent filters to visualise CTB, TH and NeuN labelling, and bright field settings for the in situ hybridisation reaction product. Images were taken with different levels of focus so as to capture clear images of cells throughout each section. The images were imported as different layers in Adobe Photoshop CS4. Fluorescent images were placed on a layer directly above layers containing bright field images, and the opacity of the top (fluorescent) images were reduced until an optimal overlap between fluoresecent and brightfield images was revealed. Criteria for classifying CTB-labelled neurons were the presence of red fluorescent label occupying at least the whole outline of the cytoplasm of a clearly recognisable neuron-like shape, aided by features such as the proximal dendrite. If such a shape could be 62 recognised in any of the fluorescent images, it would be counted as a CTB-labelled neuron. The criteria for classifying GAD67, VGLUT1 or VGLUT2 mRNA-labelled neurons were that at least half of the outline of a neuron clearly contained deposits of the dark blue reaction product, in a pattern that recognisably conformed to the shape of a neural cytoplasm. Note that GAD67-, VGLUT1- and VGLUT2 mRNA-labelled neurons were not counted. The criteria for classifying CTB/GAD67mRNA co-labelled neurons were that at least half of a cell was clearly labelled with fluorescent label, directly overlapping the in situ hybridisation reaction product, and that at least one fluorescent and at least one bright field image depicted a clear outline of a cell. Images were configured such that the whole amygdala was reconstructed by a composite of overlapping images. The delineations of subdivisions of the amygdala were drawn over the composite image in Adobe Photoshop, according to the the sterotaxic and chemoarchitectonic atlases of Paxinos and collaborators (Paxinos and Watson, 2007; Paxinos et al, 2009) and TH-immunoreactive fibres were used to assist the identification of the lateral division of the CeA as described previously (Chieng et al., 2006; Fadel and Deutch, 2002a). Neurons labelled with CTB, or double labelled with CTB-GAD67 or CTB-VGLUT2 were plotted on the Photoshop images

GenBank Size of the Primer Sequence (5'–3')a accession fragmentb number

GGATCCATTTAGGTGACACTATAGA VGluT1-F 894 bp U07609 AGagatcagcaaggtgggactg

GAATTCTAATACGACTCACTATAGG VGluT1-R GAGAagaaggagagagggctggtc

GGATCCATTTAGGTGACACTATAGA VGluT2-F 886 bp NM_053427 AGtcaatgaaatccaacgtcca

GAATTCTAATACGACTCACTATAGG VGluT2-R GAGAcaagagcacaggacaccaaa

GGATCCATTTAGGTGACACTATAGA GAD67-F 812 bp NM_017007 AGttatgtcaatgcaaccgc

GAATTCTAATACGACTCACTATAGG GAD67-R GAGAcccaacctctctatttcctc

Table 2.1 Primers used for PCRF, Forward; R, reverse. aCapital letters are attached sequences. T7 (reverse primer) or SP6 (forward primer) promoter sequences are underlined. bThe size of the fragment includes 56 bp attached sequences 63 and then counted in each subdivision of the amygdala. Cells in the basal nucleus of Meynert, substantia innominata, extended amygdala and anterior amygdala area were excluded from analysis. Double labelled cells in each division of the amygdala were calculated as a percentage of total CTB labelled cells in each brain and these percentages were then averaged across the different brains. One brain which contained a representative distribution of labelling for CTB, CTB-GAD67 and CTB-VGLUT2 was selected, and these cells were plotted on coronal sections of the atlas of Paxinos and Watson (2007). Images of NeuN reactivity were used to make a qualitative estimate of the proportion of cells in the CeA that were also positive for GAD67.

2.2.5 Experiment 2: Fos immunoreactivity in amygdaloid afferents of the VLPAG after conditioned fear to a context

This experiment consisted of analysing the number of number of CTB containing neurons in the amygdala subsequent to an injection of CTB in the VLPAG; as well as CTB containing neurons that also displayed Fos-like immunoreactivity subsequent to either resting in their homebox or re-exposure to a fear-conditioned context. Analysis was performed with an Olympus light microscope on sections processed in a previous experiment (Olsen, 2007). In the previous experiment, double labelled (Fos-CTB) neurons in the whole amygdala (and other brain structures) were pooled without regard to which subdivisions of the amygdala they were found in, and these were expressed as a percentage of the total number of double labelled cells found in the whole brain. In the re-analysis performed in the present experiment, the number of CTB- Fos immunoreactive neurons in each subdivision of the amygdala was counted and expressed as a percentage of the total number of CTB neurons in the amygdala.

2.2.6 Fear conditioning and testing

One week after injection of CTB in the VLPAG (see above), rats were placed in footshock chambers which had been pre-cleaned with 0.5% acetic acid. The rats received four unsignaled shocks (1 mA, 1 sec) over 40 min, at an interval varying between eight and twelve minutes. The first shock was administered after 5 min, and the final shock before 35 min. Rats were returned to their home cages immediately after the conditioning session. This procedure occurred four times over a period of five days. Four or five days after the final conditioning session, rats were re-exposed to the footshock chamber for 40 min and did not receive any shocks. Time spent freezing (defined as the absence of movement while assuming a tense posture) was recorded and the number of ultrasonic vocalisations (22 KHz) was recorded with an ultrasonic bat detector (Mini-3, Ultrasound Advice). Rats were returned to their home cages upon completion of testing. Rats in the control group (rest) were also fear conditioned but did were not re-exposed to the footshock chamber. 64

2.2.7 Histology

Two hours after being placed in the footshock chamber, rats were deeply anaesthetised with pentobarbitone (120 mg/kg, ip) and perfused transcardially, initially with heparinised saline and then a fixative solution of 4% paraformaldehyde in 0.1 M phosphate buffer (PB; pH 7.4). The brains were carefully removed and postfixed for 4 hr in the fixative solution, and then immersed in a cryoprotectant solution of 20% sucrose in 0.1 M PB for 2 days at 4°C. The cerebellum was removed and brains were sliced into 40 μm coronal sections and collected as free floating sections in 0.1 M PB in four series. The sections from the first two series were then washed in the following sequence: i) 0.1 M PB, 15 min; ii) 50 % ethanol, 30 min; iii) 1% H2O2 in 50% ethanol, 30 min; iv) 5% normal horse serum (NHS) in 0.1 M PB, 30 min. Sections were then incubated in a solution containing a primary Fos antibody (raised in rabbit against amino acids 2-17 of human and mouse c-fos gene; 1:4000 for series one or 1:8000 for series two; Santa Cruz Biotechnology) and a primary CTB antibody (1:24,000; raised in goat; List Biological Laboratories) in phosphate buffer horse serum (PBH; 5% NHS and 0.2% Triton x-100 in 0.1 M PB) for 2 days at 4°C. Sections were then washed (hereafter in 0.1 M PB) and incubated in biotinylated donkey anti-rabbit (1:1000, Jackson Immunoresearch) for 1 day at 4°C. After washing, sections were incubated in extravidin peroxidase (1:1000, Sigma) for 2 hr and then Fos was revealed by reacting the sections with diaminobenzine (DAB) in the presence of nickel (to form a black reaction product) and glucose oxidase (Llewellyn-Smith et al., 1992). Sections were then washed and incubated in biotinylated donkey anti-goat (1:1000, Jackson Immunoresearch) for 1 day followed by washing and then incubation in extravidin peroxidase (1:1000, Sigma) for 2 hr and finally reacted with DAB alone (to form a brown reaction product) using the same glucose oxidase method. The sections were then washed, mounted, dehydrated, cleared and coverslipped.

2.2.8 Analysis

The number of CTB and CTB-Fos immunoreactive cells in each subdivision of the amygdala was counted and the number of double labelled cells reported as a percentage of all CTB neurons in the amygdala. The results of experiments 1 and 2 were combined such that the percentage of CTB neurons in each subdivision of the amygdala was expressed as a percentage of the total number of CTB-containing neurons in the amygdala.

2.3 Results

2.3.1 Experiment 1: GAD67 and VGLUT1 expression in VLPAG projecting amygdala neurons

2.3.1.1 Injection sites and retrograde labelling in the amygdala

The CTB injection sites of the six animals used in this experiment are shown on Fig. 2.1. The centers of the iontophoretic injections were located in the caudal VLPAG. Except for two animals in which there was some spread into the LPAG, the CTB injections were restricted to the VLPAG.

Retrogradely labelled cells were found throughout the rostro-caudal extent of the amygdala, predominantly on the ipsilateral side and in the central (CeA) and medial (MeA) nuclei (Figs. 2.2, 2.5, 2.6). The total number of retrogradely labelled neurons counted varied between 120 and 597 with a mean of 495 cells. A dense continuous band of CTB labelled neurons could be seen extending from the bed nucleus of the stria terminalis through the substantia innominata and extended amygdala to the CeA. Very dense CTB labelling was observed in the medial division of the CeA (CeM; Figs. 2.2, 2.5, 2.6, 2.10) which accounted for 45% of all CTB cells counted in the entire amygdala (Fig. 2.6). The two other subdivisions of the CeA, the lateral (CeL) and capsular (CeC) were only moderately labelled (7% each of all cells counted in the amygdala; Figs. 2.2, 2.5, 2.6, 2.10). Moderate to dense labelling was also observed in the dorsal (13%) and ventral divisions (11%) of the medial amygdala (MeD and MeV respectively, Figs. 2.5, 2.6) and most of this labelling was in the anterior parts of these divisions. Moderate labelling was found in the basomedial amygdala (BMA, 9%). CTB labelling was occasionally observed in the basolateral complex (4% of total), intraamygdaloid division of the bed nucleus of the stria terminalis (STIA; 3%), anterior cortical amygdala (ACo; 3%) and in the striatum (CPu, 1%), just dorsolateral to the CeA (regrouped as “others” on Fig. 2.6).

2.3.1.2 Distribution of GAD67 mRNA labelled neurons

The amygdala contained many cells labelled with GAD67 mRNA, present in all subdivisions (Figs. 2.3 - 2.6). Labelled cells were very densely distributed in a continuous band throughout the striatum and CeA (Figs. 2.3, 2.4). Qualitative analysis of GAD67 double labelling with NeuN in this structure revealed that GAD67 was present in almost all neurons labelled with NeuN. Within the CeA, cells in the CeL were more intensely labelled for GAD67 (that is, appeared to contain more reaction product) than the CeM or CeC (Fig. 2.3), however the proportion of retrogradely-labelled cells containing GAD67 mRNA did not seem to differ (Figs. 2.6, 2.8). There was also a very high density of GAD67 mRNA positive neurons in the intercalated nuclei, and these neurons were intensely labelled for GAD67 (Figs. 2.3, 2.4). At 66

Figure 2.1 Reconstructed images of the locations of CTB microinjections in the VLPAG. The areas in black represent the core of the injection of CTB, and the areas shaded in gray represent the extent of the spread of the tracer. The numbers in red represent the identities of the rat corresponding to each injection, and the numbers in black represent the distance from Bregma in millimeters. Some injection sites were displayed on the same figures for brevity. The photomicrograph shows an injection of CTB restricted to the VLPAG (case 9). Abbreviations: aq - cerebral aqueduct; CnFD - cuneiform nucleus, dorsal part; CnFV - cuneiform nucleus, ventral part; DMPAG - dorsomedial periaqueductal gray; DR - dorsal raphe; DTgP - dorsal tegmental nucleus, pericentral part; LDTg - laterodorsal tegmental nucleus; LPAG - lateral periaqueductal gray; mlf - medial longitudinal fasciculus; VLPAG - ventrolateral periaqueductal gray 67

rostral levels, there was a high density of GAD67 cells in the anterior amygdala area and substantia innominata (Fig. 2.3). Labelling in the MeA was also dense, but less than in the CeA (Figs 2.3, 2.4). There were less GAD67 mRNA positive cells in the ventral division (MeV) compared to the dorsal division (MeD) of the medial amygdala. Moderate labelling was found in the cortical and basomedial divisions, and light to moderate labelling was observed in the basolateral complex.

2.3.1.3 Distribution of VGLUT1 and VGLUT2 mRNA labelled neurons

VGLUT1 and VGLUT2 labelling was not found within the central or intercalated nuclei, however some cells were occasionally located on the boundaries of these structures. The distribution of the glutamatergic markers VGLUT1 and VGLUT2 was complementary and somewhat mutually exclusive, such that each amygdaloid subdivision - with the exceptions of the central and intercalated nuclei - contained neurons positive for either VGLUT1 or VGLUT2 mRNA, but rarely both (Fig. 2.3). Neurons containing VGLUT1 mRNA were found in abundance in the basolateral complex, and moderately in both the anterior and posterior cortical nuclei, as well as the posterior - but not anterior - basomedial amygdala. Neurons containing VGLUT1 mRNA were not found in the MeA. Cells labelled with VGLUT1 were not found to co-localise with neurons labelled with CTB in the present study, and thus were excluded from analysis. However, it is likely that most BLA projection neurons contained VGLUT1, as the majority (89%) did not express GAD67, and none expressed VGLUT2 mRNA (Fig. 2.3). VGLUT2 mRNA positive cells were found in moderate to high density in the medial amygdala, with the ventral division displaying a greater density of VGLUT2-labelled cells than the dorsal division. The MePD - located immediately dorsal to the MeAD at intermediate and caudal levels of the amygdala - displayed fewer VGLUT2-labelled cells than the MeAD. A high density of VGLUT2 mRNA positive neurons was also observed in the BMA and anterior cortical amygdala (Fig. 2.3).

2.3.1.4 Distribution of GAD67mRNA-CTB double labelled neurons

Both CTB and CTB-GAD67 mRNA containing neurons were analysed. The majority (66%) of cells retrogradely labelled with CTB in the whole amygdala also contained GAD67 mRNA (Figs. 2.6, 2.8). In the CeA, which is the main source of amygdaloid VLPAG afferents, almost all (90%) of CTB-labelled neurons were GAD67 positive (Figs. 2.5 - 2.7). This figure ranged from 82 to 95% (Fig. 2.7A). The CeA accounted for 80% of all CTB-GAD67 double-labelled cells in the amygdala, and most of these were located in the CeM (76% of all CTB-GAD67 co- labelled cells in the CeA), with minor contributions from CeL and CeC (13% and 11% of all CTB-GAD67 co-labelled cells in CeA, respectively). The vast majority of VLPAG-projecting,

Bregma - 2.2

Figure 2.2 Retrograde labelling in the amygdala. CTB-containing cells (in red) in the amygdala of rat 21 (Fig. 2.1). Note the presence of CTB-labelled cells in the basal nucleus of Meynert. These cells form a continuous band through the substantia innominata/extended amygdala to the BNST. Distances from Bregma in mm. Abbreviations: CeM - central nucleus of the amygdala, medial division; MeAD - medial amygdala, dorsal division; SI/B - substantia innominata/basal nucleus of Meynert; st - stria terminalis

Figure 2.3 In situ hybridisation Photomicrographs of the amygdala showing: A, B: in situ hybridisation for GAD67 mRNA. Note that the CeA appears as a continuation of a dense band of GAD67-containing neurons extending through the striatum, and a greater density of reaction product in the CeL. Also note particularly dense GAD67 mRNA labelling in the intercalated cells, anterior amygdala area (AAA), BMA and MeAD. C: in situ hybridisation for VGLUT1 mRNA. Cells containing VGLUT1 were densely distributed in the BLA and BLV and lightly labelled in the BMA and ACO. D, E: in situ hybridisation for VGLUT2 mRNA. Many cells containing VGLUT2 mRNA were found in the MeAV, MeAD and BMA. C, D, E: The distribution of neurons containing VGLUT1 appears to be mostly complementary to the distribution of VGLUT2 containing neurons. VGLUT1,but not VGLUT2, was present in the BLA and BLV; whereas VGLUT2, but not VGLUT1 was present in the MeA. Many more neurons in the BMA and ACo contained VGLUT2 than VGLUT1. The BMA contained relatively few VGLUT2 neurons at posterior levels (E). Finally, note the complete absence of VGLUT1 and VGLUT2 in the CeA. Distances from bregma in millimetres. Abbreviations:AAA - anterior amygdala area; ACo - anterior cortical amygdala; BLA - basolateral amygdala; BLV - basolateral amygdala, ventral division; BMA - basomedial amygdala CeM - central nucleus of the amygdala, medial division; CeC - central nucleus of the amygdala, capsular division; CeL - central nucleus of the amygdala, lateral division; IC - intercalated cells; MeAD - medial nucleus of the amygdala, dorsal part; MeAV - medial nucleus of the amygdala, ventral part; ot - optic tract; STIA - bed nucleus of the stria terminalis, intra-amygdala division; st - stria terminalis 70

Figure 2.4 A1: Brightfield photomicrograph of cells containing GAD67 mRNA in the amygdala. Note the density of GAD67 mRNA labelling in the CeA, MeAD and intercalated cell masses; A2 & A3: Brightfield photomicrographs of cells containg GAD67 mRNA within the CeA; B1: Cells containg GAD67 mRNA within within the CeM B2: CTB immunofluorescence indicating VLPAG-projecting cells in the same field of the CeM as B1. B3: Merge of B1 and B2. White arrows: Cells positive for both GAD67 mRNA and CTB; Black arrow: A cell positive for CTB but not GAD67 mRNA. Abbreviations: BLA - basolateral amygdala; CeM - central nucleus of the amygdala, medial division; CeC - central nucleus of the amygdala, capsular division; CeL - central nucleus of the amygdala, lateral division; IC - intercalated cells; MeAD - medial nucleus of the amygdala, dorsal part; ot - optic tract; st - stria terminalis 71

neurons in the CeM (92%) and CeL (92%) contained GAD67 mRNA, whilst slightly fewer CTB-containing neurons in the CeC co-labelled for GAD67 (79%) (Figs. 2.6, 2.8). In the MeA35% of CTB labelled cells also contained GAD67 mRNA, which corresponded to 13% of all CTB-GAD67 co-labelled cells in the amygdala. Most of these double labelled cells were in the MeD, where 54% of CTB cells contained GAD67 mRNA. Fewer VLPAG-projecting neurons in the MeV co-labelled with GAD67 (15% of all CTB labelled cells). In the BMA, 23% of cells labelled for CTB alsocontained GAD67 mRNA, accounting for 3% of all CTB-GAD67 co-labelled cells in the amygdala. Most (75%) CTB neurons in the STIA contained GAD67 mRNA, and this contributed to 3% of the total number of CTB-GAD67 neuron (data not shown). Some (11%) VLPAG-projecting neurons in the basolateral complex were found to be double-labelled with GAD67 mRNA. Finally, 15% of VLPAG-projecting neurons in the ACo contained GAD67 mRNA.

2.3.1.5 Distribution of CTB-VGLUT2 double labelled neurons

Three of the brains processed to detect GAD67 mRNA were also processed for VGLUT2 mRNA on alternate sections (cases 21, 24 and 25; Fig. 2.1). The number of CTB-containing neurons was counted in structures containing CTB-VGLUT2 cells, but not in structures which lacked double labelled cells. Based on the percentages of retrograde labelling previously counted (section 3) combined with the percentage of CTB neurons that were double labelled in structures containing double labelled cells (MeA, BMA, Aco), it was estimated that about 22% of all retrogradely labelled neurons in the amygdala contained VGLUT2 mRNA. This figure (22%) was determined by averaging all (n = 6) brains, similar to the figure (21%) obtained from the average of only those brains that were also processed for VGLUT2 (n = 3).

The CeA was totally devoid of CTB-VGLUT2 double labelled cells. The majority of CTB- VGLUT2 co-labelled cells in the amygdala (62 ± 4%) were located in the MeA, in which (63 ± 4%) of VLPAG-projecting cells contained VGLUT2 mRNA (Figs. 2.6, 2.8). These CTB- VGLUT2 cells represented a greater proportion of all CTB cells in the MeA than CTB-GAD67 cells (35%, n = 6; 37 ± 7%, n = 3) (Figs. 2.6, 2.8). Within the MeA, a similar percentage of all CTB-VGLUT2 double labelled cells in the amygdala were found in the MeV (33 ± 5%) and MeD (28 ± 2%). Most (76 ± 2%) VLPAG-projecting cells in the MeV contained VGLUT2 mRNA, whilst about half of the VLPAG-projecting cells in the MeD contained VGLUT2 mRNA (53 ± 4%). The BMA contributed 27 ± 0.3% of all amygdaloid VGLUT2 afferents to the VLPAG, and the majority (60 ± 5%) of CTB neurons in this structure were found to contain VGLUT2 mRNA. Finally, the ACo contributed 11 ± 4% of all amygdaloid CTB-VGLUT2 neurons, and most (62 ± 0.4%) of CTB-containing neurons in the structure contained VGLUT2.

Figure 2.5 Distribution of double-labelled CTB-GAD67 neurons (filled circles, left panels), double labelled CTB-VGLUT2 neurons (filled circles, right panels) and CTB (open circles, both panels) obtained from a single rat following an injection of CTB in the VLPAG (rat 21; top ). 73

Figure 2.5 Continued

Figure 2.6 The mean number of neurons labelled with CTB following injection in the VLPAG, or double-labelled with CTB-GAD67 and CTB-VGLUT2 expressed as a percentage of all CTB-labelled neurons in the amygdala. Error bars represent SEM. Abbreviations: CeA - central nucleus of the amygdala; MeA - medial amygdala; BM - basomedial amygdala; CeM - central nucleus of the amygdala, medial division; CeL - central nucleus of the amygdala, lateral division; central nucleus of the amygdala, capsular division; MeD - medial amygdala, dorsal divisions; MeD - medial amygdala, ventral divisions A B VLPAG

Figure 2.7 A: Scatter plot of the distribution of the proportion of VLPAG-projecting CeA neurons that contained GAD67 mRNA. Closed circles represent cases where CTB was injected in the VLPAG (Fig. 2.1). The open circle represents a case where the injection of CTB was placed immediately lateral to the caudal VLPAG, indicated in B.

Figure 2.8 The mean percentage (± SEM) of cells containing CTB in each structure that were double- labelled with either GAD67 (black bars; n = 6) or VGLUT2 (white bars; n = 3). Abbreviations: CeA - central nucleus of the amygdala; MeA - medial amygdala; BM - basomedial amygdala; CeM - central nucleus of the amygdala, medial division; CeL - central nucleus of the amygdala, lateral division; central nucleus of the amygdala, capsular division; MeD - medial amygdala, dorsal divisions; MeD - medial amygdala, ventral divisions 75

2.3.2 Experiment 2: Conditioned Fear-evoked Fos expression in VLPAG-projecting amygdaloid neurons

The results of this study were previously analysed according to a different method and reported (Olsen, 2007; see appendix). In the previous experiment, only CTB-Fos neurons (and not single labelled neurons) were counted throughout the whole brain; whereas in the present study, total numbers of CTB and CTB-Fos neurons (but not single labelled Fos neurons) were counted in each subnucleus of the amygdala.

To briefly summarise the findings of the previous report, animals in the conditioned fear group displayed robust levels of freezing comparable to previous reports from this laboratory (P. Carrive et al., 1999; Carrive, 2006; Carrive et al., 1997b; Walker and Carrive, 2003). The structures displaying the greatest number of double-labelled cells in the conditioned fear group relative to the rest group were the perifornical, lateral, paraventricular, dorsomedial, anterior and posterior hypothalamus, prelimbic and infralimbic cortex, the ventrolateral part of the tegmentum, dorsal raphe, substantia nigra and ventral tegmental area. However, surprisingly, few double labelled cells were found in the amygdala and BNST, which each represented only about 1% of all brain sources of double labelled cells. Further, the increased number of Fos- CTB co-labelled neurons seen in these structures in conditioned fear was not significantly greater than in the rest group.

2.3.2.1 Distribution of retrograde labelling

The pattern of retrograde labelling was broadly similar to that in experiment 1 (Fig. 2.9), with the main difference being the greater proportion of labelling in the CeM, and less in the MeV and MeAD in the fear group in experiment 2. The majority of projections from the amygdala to the VLPAG originated in the CeM (58% of all projections from the amygdala). The CeL and CeC each contained 6% of all amygdaloid projections to the VLPAG. The MeAD (10%), MeV (5%) and the BMA (9%) also sent moderate projections. There were also a small number of projections arising in the ACo (2%), STIA (2%) and the BLA (1%).

2.3.2.2 Distribution of Fos labelling

Whilst we did not quantify single labelled Fos-positive neurons in the CeA, it was immediately evident, and consistently observed that there was a very low level of Fos expression in the CeM in both fear and rest, and a low to moderate level of Fos expression in the CeL in fear but not in rest.

2.3.2.3 Fos-CTB Double labelling

Double labelling was only occasionally observed in the amygdala. Only 1.1% of retrogradely- labelled amygdaloid cells expressed Fos during conditioned fear (n = 5), compared to 1.0% at rest (n = 5). The CeA contained the greatest absolute number of VLPAG-projecting neurons which expressed Fos (Fig. 2.10). An average of 7 ± 2 Fos-CTB neurons were found in the CeA, out of 15 ± 4 Fos-CTB neurons in the whole amygdala in the conditioned fear group; whereas 4 ± 1 Fos-CTB neurons were found in the CeA out of 6 ± 1 amygdala CTB-Fos neurons in the rest group. However, despite containing the greatest absolute number of Fos-CTB co-labelled cells, the CeA was the structure with the lowest proportion of Fos-CTB relative to total CTB per structure, with only 0.7% (range: 0.2 - 2%) of CTB neurons in the CeA found to be co- labelled with Fos in the fear group, compared to 1.3% in controls (Fig. 2.11). Within the CeA, the proportion of CTB neurons co-labelled with Fos in the fear group was 0.6% in the CeM, 1.6% in the CeL divisions, and 1.3% in the capsular division (Fig. 2.11).

In the rest group, 1.2% of CTB neurons were co-labelled with Fos in the CeM, 1.6% in the CeL and 1.5% in the CeC (Fig. 2.11). In the MeAD, 3.9% of CTB neurons expressed Fos during fear, and 2.3% expressed Fos at rest; in the MeV, 13.6% of CTB neurons expressed Fos during fear, and 0.2% expressed Fos at rest. In the BMA, 2.1% of CTB neurons expressed Fos during fear, and none expressed Fos at rest. An ordinary two-way ANOVA with Holm-Sidak multiple comparisons tests revealed that the MeV was the only structure in the amygdala which contained a significantly greater proportion of Fos-expressing VLPAG-projecting neurons in fear than in rest (p < 0.0001) (Fig. 2.11). Dunnet’s multiple comparisons test also revealed that the MeV contained a significantly greater proportion of CTB-labelled cells immunoreactive for Fos than any other structure in the fear group. However, since only 13.6% of VLPAG- projecting cells in the MeV expressed Fos during fear, and the MeV accounts for only 5-11% of all amygdaloid input to the VLPAG, the MeV is probably not a major source of activated VLPAG afferents during conditioned fear to context (Fig. 2.10). Indeed, the whole amygdala accounted for merely 0.9% of all fear-activated projections to the VLPAG (Olsen, 2007) - see appendix.

Figure 2.9 Reconstructed images of injections of CTB in the VLPAG in rats in the conditioned fear group (n = 5; top panel) and the rest group (n = 5; bottom panels). The areas in black represent the core of the injection of CTB, and areas shaded in gray represent the extent of the spread of the tracer. Each case is accompanied by its respective identification number. Numbers below the figure represent the distance from Bregma in millimetres.

B Figure 2.10 A: Photomicrograph (4 x) of the amygdala of a rat (case E12, Fig. 2.9) re-exposed to a feared context 2 h prior to being euthenased. Dual immunohistochemical labelling of cells with CTB (red/brown reaction product) and Fos (black dots) can be observed. Note the dense and mostly specific labelling of the medial part of the cental nucleus with CTB - although some retrogradely-labelled cells can be observed in the CeL. CTB-labelled cells are also observed in the BMA, MeAD, MeAV and ACo. Fos-containing nuclei are present in moderate levels in the BLA, MeAV, MeAD, ACo and BMA. B: Photomicrograph with enhanced magnification (10x) of the same section. Note the almost complete absence of Fos-positive nuclei in the CeM, and complete lack of double-labelled cells. Fos-positive nuclei can be observed in the adjacent MeAD. Abbreviations: ACo - anterior cortical amygdala; BLA - basolateral amygdala; BMA - basomedial amygdala; CeC - central nucleus of the amygdala, capsular division; CeL - central nucleus of the amygdala, lateral division; CeM - central nucleus of the amygdala, medial division; IC - intercalated cells; MeAD - medial nucleus of the amygdala, dorsal division; MeAV - medial nucleus of the amygdala, ventral division; ot - optic tract; st - stria terminalis 79

Bregma - 1.92

Figure 2.11 Photomicrographs of the ventromedial part of the amygdala depicting cells labelled for CTB (red) and Fos (black). Distances from Bregma in mm. A: Representative photomicrograph of Fos expression in the ventromedial amygdala of a rat re-exposed to a feared context 2 h prior to being euthenased (E16). Fos-CTB labelled cells (black arrows) and CTB-labelled cells (white arrows) are also present. B: Representative photomicrograph of Fos expression in the ventromedial amygdala of a rat euthenased at rest. Note the absence of Fos-positive nuclei. Abbreviations: BMA - basomedial amygdala; MeAD - medial amygdala, dorsal division; MeAV - medial amygdala, ventral division; ot - optic tract; st - stria terminalis 80

Figure 2.12 Comparison of the distribution of retrograde labelling in the amygdala following injections of CTB in the VLPAG in experiment 1 (Fig. 2.1; striped bars, n = 6) and experiment 2 (Fig. 2.9; “fear” group, black bars, n =5; “rest” group, white bars, n =5). The number of CTB-labelled cells in each structure is expressed as a percentage (± SEM) of all CTB-labelled neurons in the amygdala. Abbreviations: CeA - central nucleus of the amygdala; MeA - medial amygdala; BM - basomedial amygdala; CeM - central nucleus of the amygdala, medial division; CeL - central nucleus of the amygdala, lateral division; central nucleus of the amygdala, capsular division; MeD - medial amygdala, dorsal divisions; MeD - medial amygdala, ventral divisions

Figure 2.13 The number of double labelled cells in each structure expressed as a percentage of the total number of CTB-labelled neurons in the amygdala. No significant differences were found in the fear group, whereas the percentage of double labelled cells in the CeA in the rest group was significantly greater than in the BMA or MeV. Abbreviations: CeA - central nucleus of the amygdala; MeA - medial amygdala; BM - basomedial amygdala; CeM - central nucleus of the amygdala, medial division; CeL - central nucleus of the amygdala, lateral division; central nucleus of the amygdala, capsular division; MeD - medial amygdala, dorsal divisions; MeD - medial amygdala, ventral divisions

Figure 2.14 Percentages (± SEM) of cells retrogradely labelled from the VLPAG that displayed Fos immunoreactivity after re-exposure to a feared context (black bars, n = 5) or rest (white bars; n = 5). A significantly greater proportion of VLPAG-projecting cells in the MeV contained Fos after fear than at rest, or in any other structure. Almost no double-labelled cells were found in the BMA and MeV in the rest group. Abbreviations: CeA - central nucleus of the amygdala; MeA - medial amygdala; BM - basomedial amygdala; CeM - central nucleus of the amygdala, medial division; CeL - central nucleus of the amygdala, lateral division; central nucleus of the amygdala, capsular division; MeD - medial amygdala, dorsal divisions; MeD - medial amygdala, ventral divisions 2.4 Discusssion

We have shown that the projection from the amygdala to the VLPAG is mainly GABAergic, and that almost all (90%) of projections arising in the CeA are GABAergic and lack VGLUT1 and VGLUT2 mRNA, suggesting that they are not glutatmergic. Other amygdaloid structures such as the medial and basomedial nuclei send light to moderate, mainly glutamatergic, projections to the VLPAG. Further, only a very small proportion of amygdaloid projections to the VLPAG - especially in the CeA - expressed Fos after conditioned fear to context. Based on these findings and others, we propose that during conditioned fear to context, GABAergic projections from the CeA to the VLPAG are inhibited, which may disinhibit VLPAG output neurons and induce freezing.

2.4.1 Methodological considerations

The distribution of VGLUT3 was not assessed in the present study. A dense distribution of cells containing VGLUT3 has previously been reported in the CeA (Zhao et al., 2012), however some of the sampling analysis in that study appears to have been performed in the caudate/putamen rather than the CeA. Photomicrographs in another report (Fremeau et al., 2002) appear to show a dense signal of VGLUT3 mRNA in the amygdala, including the CeA. Interestingly, VGLUT3 is expressed in vesicular membranes with VGAT in many GABAergic neurons, and strong evidence suggests that the VGLUT3 transporter mediates glutamate co-

release with GABA at symmetrical synapses (Fremeau et al., 2002; Herzog et al., 2004; Kudo et al., 2012; Stensrud et al., 2013; Stornetta et al., 2005). This raises the possibility that some of the GAD67 mRNA-labelled cells in the CeA observed in the present study may have also contained VGLUT3 and been capable of co-releasing glutamate. However, a previous study reported an absence of VGLUT3 mRNA labelled cells in the amygdala (Herzog et al., 2004), although VGLUT3 labelled axons and terminals were observed in the BMA and BLA. Thus, it remains unclear if VGLUT3 is expressed in cells in the CeA. Further research is required to address this question.

GABAergic cells were identified with GAD67 mRNA in the present study. This isoenzyme labels most cells in the CeA, but slightly fewer than GAD65 mRNA (Pitkänen and Amaral, 1994). Interestingly, we observed a stronger density of the GAD67 mRNA signal in the CeL than the CeM (Fig. 2.3), consistent with images of GAD67 labelling in a previously report (Niu et al., 2012), whereas the opposite pattern has been observed with GAD65 mRNA (Poulin et al., 2008). Thus, some GABAergic cells, especially in the CeM, may have been missed in the present study.

Another considerable limitation of the present study is that the control group in experiment 2 were rats resting in their home cages. Thus, there was no control for the handling procedure, wakefulness and arousal, the conditioning procedure or being placed re-exposed to the context. Interestingly, a context-context control has been shown to be associated with greater Fos expression in all amygdaloid nuclei relative to re-exposure to a feared context, discrete CS or conditioned inhibition, as well as significantly increasing Fos expression in all amygdala nuclei relative to homecage control (Campeau et al., 1997).

2.4.2 Most VLPAG-projecting neurons in the CeA are GABAergic, and lack VGLUT1 and VGLUT2 mRNA.

The results of the present study demonstrate that most of the input from the amygdala to the VLPAG originates in the CeA - especially its medial division, although some cells were observed in the lateral and capsular divisions (Figs. 2.5, 2.6, 2.8, 2.10, 2.12), consistent with previous reports (An et al., 1998; Gray and Magnuson, 1992; Hopkins and Holstege, 1978; Oka et al., 2008; Price and Amaral, 1981; Rizvi et al., 1991). The present study also revealed that almost all (92% of CeM neurons) contained GAD67 mRNA whilst none contained VGLUT1 or VGLUT2 mRNA, suggesting that this projection may be exclusively GABAergic (Figs. 2.3 - 2.6, 2.8). This is in line with many studies showing a dense distribution of CeA neurons containing GAD65, GAD67, or vesicular GABA transporters (Bowman et al., 2013; Burgess et al., 2013; Day et al., 1999; Kudo et al., 2012; Myers et al., 2013; Oka et al., 2008; Pitkänen and Amaral, 1994; Poulin et al., 2008; Swanson and Petrovich, 1998; Wallén-Mackenzie et al., 83

2009) and an absence of VGLUT1 and VGLUT2 labelling in the CeA (Kiss et al., 2013; Kudo et al., 2012; Niu et al., 2012; Oka et al., 2008; Poulin et al., 2008; Wallén-Mackenzie et al., 2009). However, VGLUT2-immunoreactive neurons in the CeA have occasionally been reported (Fung et al., 2011; Xi et al., 2011; Zhang et al., 2012).

The results of the present study are also consistent with previous research which showed that VLPAG-projecting CeA neurons in particular are mainly GABAergic. The synaptic contacts formed by CeA axons onto neurons in the LPAG/VLPAG were almost always (97%) symmetrical - although only 69% of CeA neurons retrogradely labelled from the VLPAG were found to contain GAD67 mRNA (Oka et al., 2008); and that injections of retrograde tracer in the VLPAG/lateral pontine tegmentum label cells in the CeA, most of which (over 90%) were co-labelled with vesicular GABA transporter (VGAT) (Burgess et al., 2013). However, to the best of our knowledge, this is the first study which has examined GABAergic and glutamatergic CeA projections solely to the VLPAG.

The existence of GABAergic brainstem projections of the CeA is consistent with electrophysiological studies showing that electrical or chemical stimulation of the CeA induces short-latency, feed-forward inhibition of cells in the PAG (da Costa Gomez and Behbehani, 1995) and parabrachial nucleus (Huang et al., 2003).

2.4.3 Other amygdaloid projections to the VLPAG

We observed light to moderate projections from the MeA and anterior BMA, and light projections from the BLA and ACo, STIA. Previous studies have described light projections from the MeA, BMA, BLA and ACo to the PAG (Canteras et al., 1995; Novaes and Shammah- Lagnado, 2011; Oka et al., 2008; Pardo-Bellver et al., 2012; Paredes et al., 2000; Petrovich et al., 1996), and most VLPAG-projecting cells in these structures did not label for GAD67 mRNA (Oka et al., 2008). Interestingly, very few retrogradely-labelled cells were found in these structures subsequent to a single injection of CTB located immediately lateral to the caudal VLPAG (case 12; Figs. 2.7.B, 2.12) which appears to have mainly targeted the most anterior part of the lateral parabrachial nucleus (LPB) and lateral pontine tegmentum (LPT). This is consistent with anterograde labelling studies using Phaseolus vulgaris leucoagglutinin, which showed that projections from the MeA, BMA and ACo course dorsally and caudally through a medial tract, passing through the VTA and central linear nucleus of the raphe to the PAG and dorsal raphe (Lee et al., 2007), and do not project to other parts of the tegmentum or brainstem generally (Canteras et al., 1995; Novaes and Shammah-Lagnado, 2011; Pardo-Bellver et al., 2012; Petrovich et al., 1996).

We found that the MeD contained roughly equal numbers of GABAergic and glutamatergic projections to VLPAG, whilst projections from the MeV, BMA and ACo were mainly glutamatergic (Figs. 2.6, 2.8). This was broadly consistent with the general, relative distribution of GABAergic and glutamatergic cells in these structures (Kiss et al., 2013; Kudo et al., 2012; Niu et al., 2012; Oka et al., 2008; Poulin et al., 2008; Wallén-Mackenzie et al., 2009).However, we observed 60% and 62% of CTB neurons in the BMA and ACo respectively contained VGLUT2, whilst 23% and 15% contained GAD67. Thus about 20% of CTB neurons in these structures were not co-labellled. This figure (20%) probably reflects false negatives in VGLUT2 labelling. Indeed, another study showed that about 80% of BMA and ACo neurons projecting to the lateral hypothalamus contained VGLUT2 and 20% contained GAD67 (Niu et al., 2012).

2.4.4 Neurochemical organisation of the amygdala

Neurons labelled with VGLUT1 were not found to co-localise with retrogradely-labelled neurons in the present study, however it is likely that a very small number would have co- expressed VGLUT1, since projections from the BLA are mainly glutamatergic. Interestingly, a few (11%) VLPAG-projecting neurons in the basolateral complex contained GAD67 mRNA. This was surprising given that GABAergic neurons in the BLA are thought to resemble cortical interneurons and not have long axonal projections (Poulin et al., 2008; Sah et al., 2003).

The distribution of cells labelled with VGLUT1, VGLUT2 and GAD mRNA in the amygdala were consistent with reports recent studies (Day et al., 1999; Niu et al., 2012; Oka et al., 2008; Pitkänen and Amaral, 1994; Poulin et al., 2008; Swanson and Petrovich, 1998). VGLUT1 expression was restricted to the basolateral complex, posterior division of the BMA and posterior cortical amygdala, whilst VGLUT2 was not observed in these structures. Conversely, dense VGLUT2 expression was found in the ventromedial part of the amygdala - namely the MeV, ACo, anterior BMA and a moderate number of VGLUT2-positive cells were found MeAD, whilst fewer VGLUT2 neurons were found in the MePD, which appeared to contain a greater density of cells labelled for GAD67 (Figs. 2.3E; 2.4A3). Very few VGLUT2-positive neurons were found in the posterior BMA (Fig. 2.3E)These observations suggest that the amygdala can be differentiated into three broad categories based on its neurochemical and hodological properties: The cortical amygdala, containing VGLUT1; the ventromedial amygdala, containing VGLUT2; and the striatal amygdala (CeA) containing GABAergic neurons. This model differs somewhat from that proposed by Swanson and Petrovich (Swanson and Petrovich, 1998; Swanson, 2003), which argued that both the CeA and MeA was a continuation of the striatum. However, it has been demonstrated in the present study and elsewhere that all parts of the MeA contain large numerous glutamatergic neurons, unlike the striatum. The distribution of VGLUT2 in the ventromedial amygdala resembles the

“corticomedial” division proposed by Price and colleagues (Price et al., 1987) (see (Swanson, 2003). Furthermore, all areas of the ventromedial amygdala have moderate GABAergic and glutamatergic projections to the hypothalamus and PAG (Canteras et al., 1995; Niu et al., 2012; Oka et al., 2008; Pardo-Bellver et al., 2012; Petrovich et al., 1996), whereas the cortical amygdala sends very few fibres to these regions (Hopkins and Holstege, 1978; McDonald and Culberson, 1986; Ono et al., 1985) - although the posterior BMA does project to the hypothalamus (Petrovich et al., 1996). Further, projections of the cortical amygdala are thought to be solely glutamatergic - although we found that some projections arising in the BLA labelled for GAD67 mRNA.

2.4.5 Few VLPAG-projecting neurons in the CeA expressed Fos after contextual fear

Very few Fos-CTB neurons were found in the CeA. The number of single-labelled Fos- immunoreactive cells was not quantified in the present study, however qualitative analysis showed very low levels of Fos expression in the CeM and low to moderate levels of Fos expression in cells in the CeL, consistent with a previous study which utilised a similar protocol (Scicli et al., 2004). However, less than 1% of all VLPAG-projecting neurons in the CeA expressed Fos after conditioned fear in the present study, suggesting that contextual fear activates local circuit rather than brainstem-projecting CeL neurons.

Critically, the relative absense of Fos-immunoreactive cells in the CeM in the present study does not necessarily imply that cells in these structures were not activated. Many previous studies have reported that very few cells in the CeM express Fos after a variety of stressors (Dayas et al., 2001) or after conditioned fear to a discrete or contextual stimulus (Beck and Fibiger, 1995; Campeau et al., 1997; Day et al., 2008; Holahan and White, 2004; Knapska et al., 2007; Kovács, 1998; Pezzone et al., 1992; Radulovic et al., 1998b; Savonenko et al., 1999; Schettino and Otto, 2001; Scicli et al., 2004; Skórzewska et al., 2008). Further, some studies have reported negative correlations between Fos expression in the CeM and freezing behaviour (Martinez et al., 2013; Savonenko et al., 1999), which, whilst non-significant, were strong effects (r = -0.41 to -0.49).

These findings are in contrast to strong evidence of phasic activation of CeM neurons triggered by presentation of a discrete, short-duration CS (Ciocchi, 2009; Davis et al., 2010; Duvarci et al., 2011; Walker and Davis, 1997; Walker et al., 2009). This short-duration or phasic nature of the response of CeA neurons to a discrete CS was correctly predicted 15 years ago (Campeau et al., 1997; Davis et al., 1997) and was suggested to allow the organism to retain the capability to respond phasically to the detection of further threats as well as to account for the lack of Fos expression in the CeA, which is thought to require “strong and sustained” activation (Dampney 86

et al., 1995; Li and Dampney, 1994). Furthermore, tonic activity in the CeM is reduced by about 40% during conditioned fear to a tone, which is probably due to greater tonic inhibition by

CeLoff neurons (Ciocchi, 2009; Ciocchi et al., 2010), and this process is associated with fear generalisation (Ciocchi, 2009; Ciocchi et al., 2010). This greater tonic inhibition of the CeM may during conditioned fear also partly account for the low numbers of cells expressing Fos in the CeM after conditioned fear to a discrete CS. Furthermore, as reviewed by (Day et al., 2008), other stimuli known to activate the CeM such as footshock do not reliably elevate Fos expression in this structure. Thus, the low levels of Fos observed in the CeA in the present study should be interpreted with caution.

On the other hand, some studies show a robust elevation in Fos-positive nuclei in the CeM after footshock (Milanovic et al., 1998; Radulovic et al., 1998b), appetitive conditioning (Knapska et al., 2006) and conditioned fear to a discrete CS (Knapska and Maren, 2009). Furthermore, rats that displayed enhanced avoidance behaviour in an active-avoidance task showed greater Fos expression in the CeM (Martinez et al., 2013). Interestingly, freezing has been negatively correlated with Fos expression in active avoidance paradigms (Martinez et al., 2013; Savonenko et al., 1999).

Thus CeM neurons are ‘capable’ of Fos expression in response to emotionally valenced stimuli. Further, the number of cells in the CeM that expressed Fos has been highly correlated with freezing (Knapska and Maren, 2009). Moreover, a moderate number of cells in the CeL have been shown to express Fos after long-duration contextual fear (Scicli et al., 2004), however it is unknown if these are CeLon or CeLoff cells, or whether Fos expression is related to post- conditioning activity of CeL CRF-expressing neurons (Pitts and Takahashi, 2011). Moreover, the CeL has limited brainstem projections (Petrovich and Swanson, 1997), and mainly projects to other areas of the extended amygdala and hypothalamus.

If neurons in the CeM are phasically activated by presentation of discrete conditioned stimuli (Ciocchi et al., 2010; Duvarci et al., 2011), and the lack of Fos expression in the CeM after conditioned fear is indeed due to such a time-limited and phasic rather than sustained activation (Campeau et al., 1997; Dampney and Horiuchi, 2003; Davis et al., 1997; Li and Dampney, 1994), then it could reasonably be argued that the low levels of Fos- immunoreactive cells found in the CeM after re-exposure to a feared context (Scicli et al., 2004) suggest that CeM neurons were not activated in a sustained fashion, and were either phasically activated, inhibited or unchanged after re-exposure to the feared context. Howerver, we suggest it is unlikely that CeM neurons were phasically activated by the context alone, since this form of conditioned fear does not consist of any sudden changes in the environment, nor demands any sudden behavioural or physiological responses. Indeed, behavioural and physiological responses to 87

contextual fear are gradual and consistent over long durations (chapter 4). Thus it may be expected that this would be reflected at the neural level. Therefore, we suspect that the lack of Fos in the CeM in the present study is due to either inhibition or no change in the activity of the CeM during conditioned fear to context, consistent with our hypothesis.

The observation that few VLPAG-projecting CeA neurons expressed Fos is consistent with a growing body of evidence which suggests that the BNST, not the CeM, mediates the cardiovascular and behavioural responses to long-duration or contextual fear conditioned stimuli (Davis et al., 2010, 1997; Jennings et al., 2013; Koo et al., 2004; Luyten et al., 2012, 2011; Pitts and Takahashi, 2011; Resstel et al., 2008, 2008; Scicli et al., 2004; Walker and Davis, 1997; Walker et al., 2009; Zimmerman and Maren, 2011). In fact, there is some evidence that neural activity in the BNST may inhibit cells in the CeM (Davis et al., 2010; Meloni et al., 2006; Walker et al., 2009; Zimmerman and Maren, 2011) - see (Walker et al., 2009). There is an anatomical substrate for this putative inhibition, as the BNST sends dense, mainly GABAergic (Poulin et al., 2009) projections to the CeA which exclusively target its medial subdivision (Dong et al., 2001; Dong & Swanson, 2004a, 2004b, 2006a, 2006b; Dong et al., 2000; Dong & Swanson, 2006).

2.4.6 VLPAG-projecting neurons in the MeV were activated by conditioned fear to context

In the present study, the only structure found to contain a significantly greater number of Fos- CTB labelled cells in the fear relative to the rest group was the MeV (P < 0.0001), whilst non- significant increases were found in the BMA and MeAD. These results are consistent with previous reports which found that the MeA - including the MeV - is the only, or one of few amygdaloid structures containing significantly more cells which expressed Fos after re-exposure to a feared contextual or discrete CS (Campeau et al., 1997; Milanovic et al., 1998; Pezzone et al., 1992) including an olfactory CS (Schettino and Otto, 2001). Infusions of glutamatergic antagonists in the MeA blocked fear potential startle and context potentiated startle, but had no effect on fear learning, whilst infusions in the BLA reduced fear learning and fear-potentiated but not context-potentiated startle (Walker et al., 2005) and another study showed that lesions of the MeA reduced the freezing to a fear-conditioned context (Holahan and White, 2002). Thus, the MeA may be a critical structure mediating the expression, but not the learning of conditioned fear responses - however this structure receives little attention in the literature on conditioned fear.

Activation of the MeA has been shown to induce non-opioid VLPAG-mediated antinociception (Oliveira and Prado, 2001), and lesion of the MeD may reduce stress induced antinociception (Werka, 1997). The direct projection from the MeA to VLPAG may be partly responsible for 88

these effects, in addition to a polysynaptic circuit that relays in the ventromedial hypothalamus (Canteras et al., 1995). Unconditioned stressors such as restraint or forced swim test strongly increase Fos expression in the MeA (including MeV), but only mildly in the CeA (Davern and Head, 2011; Dayas and Day, 2002; Dayas et al., 2001, 1999) and activation of the MeA, but not CeA, is strongly associated with increased blood pressure and HPA-axis activation in response to these forms of stress (Davern and Head, 2011; Dayas et al., 1999), consistent with moderate, partly glutamatergic projections to pressor regions of the hypothalamus (Canteras et al., 1995; Niu et al., 2012; Ono et al., 1985; Pardo-Bellver et al., 2012; Sakurai et al., 2005; Yoshida et al., 2006). Interestingly, restraint strongly enhances Fos expression in the MeA, whilst only moderately increasing it in the CeA. However, restraint was not associated with Fos expression in brainstem-projecting CeA neurons. Furthermore, lesions of the MeA strongly attenuated the recruitment of medullary noradrenergic cells (A1 and A2) by restraint, however lesions of the CeA increased Fos expression in these noradrenergic subpopulations, suggesting inhibition of CeA projection neurons targeting interneurons near A1 and A2 cells (Dayas and Day, 2002). Inhibition of GABAergic brainstem-projecting CeA neurons may also account for the results observed in the present study.

The MeV contains mainly glutamatergic neurons (Figs. 2.3, 2.5, 2.6, 2.8). Interestingly, the MeV contained almost no double-labelled cells in the rest group. Similarly, in the BMA, which also contains mainly glutamatergic VLPAG projections (VGLUT2, 60%; GAD67, 23%), no double labelled cells were found in the rest group. In contrast, a greater percentage of cells in the CeA expressed Fos in the rest group than the fear group, however this difference was not significant. These observations are consistent with the notion that in the extended amygdala, GABAergic brainstem-projecting neurons are inhibited during contextual fear, whilst glutamatergic brainstem-projecting neurons are activated.

In support of this notion, recordings of VTA-projecting BNST neurons during long-duration re- exposure to a feared context revealed that 63% of GABAergic BNST-VTA neurons are strongly inhibited, whilst only 8% were activated. Conversely, 23% of glutamatergic VTA projections were activated whilst 11% were inhibited (Jennings et al., 2013). The BNST-VTA projection mainly (90%) GABAergic (Kudo et al., 2012) and does not target dopaminergic cells. Thus, inhibition of GABAergic BNST-VTA neurons may partly mediate the freezing response to a contextual CS, by disinhibiting GABAergic interneurons in the VTA, and reducing dopaminergic cell activity in the VTA (Barrot et al., 2012; Jennings et al., 2013). Indeed, photostimulation of these GABAergic BNST-VTA neurons reduced freezing to footshock (Jennings et al., 2013).

Interestingly, this projection from the BNST to the VTA courses through a singular fibre tract which continues through the VTA to the VLPAG, which it densely and selectively innervates (see (Holstege et al., 1985). Further, the same areas of the BNST which project to the VTA also project to the VLPAG (Dong and Swanson, 2003, 2006b, 2004). These observations strongly suggest that these same BNST-VTA projections which were recorded (Jennings et al., 2013) would have collaterals in the VLPAG, and thus the BNST likely mediates freezing to a feared context, at least in part, by the inhibition of GABAergic VLPAG projecting neurons. This is consistent with the observations that the BNST only accounted for 1% of all Fos-VLPAG- projecting neurons double-labelled neurons in the brain in the fear group in the previous analysis we performed on this data (Olsen, 2007), and that most parts of the BNST contain GABAergic rather than glutamatergic projection and local-circuit neurons (Kudo et al., 2012; Myers et al., 2013; Poulin et al., 2009). Inhibition of GABAergic brainstem-projecting neurons may reflect a general mechanism of the extended amygdala function in mediating conditioned fear responses to context, and anxiety generally.

2.4.7 Differential modulation of CeA activity in different forms of fear, anxiety, stress and antinociception

Neural activity in the CeA, and specifically the CeM, is not associated with all forms of fear and anxiety. The CeM is phasicaly activated during conditioned fear to a discrete CS, and this mediates freezing (Ciocchi et al., 2010; Duvarci et al., 2011). However, activity in the CeM appears to be negatively correlated with other forms of anxiety, stress and possibly pain. Interestingly, lesions of the amygdala reduced fear of a shock probe, but reduced open arm time and entries in the elevated plus maze (Treit et al., 1993). Whilst this anxiogenic effect in this study was non-significant, it was of a reasonably large effect size. Injections of benzodiazepines in the CeA has no effect on performance in the EPM, whilst injections in the BLA have an anxiolytic effect (Green and Vale, 1992). Fascinatingly, recordings of the activity of CeM neurons during performance on the elevated plus maze revealed that the activity of CeM neurons was significantly greater when the rat was in the closed arms than open arms, despite this being considered a much more anxiety-provoking experience (Thomas et al., 2013). In accordance with this finding, injections of muscimol in the CeA had an anxiogenic effect, and injection of bicuculline in the CeA , which presumably disinhibits CeM neurons, led to an anxiolytic effect in the elevated plus maze (Zarrindast et al., 2008). Interestingly, the same treatment (bicuculline in the CeA) has been found to induce spontaneous freezing behaviour (Nobre and Brandão, 2011). These findings point to a possible, paradoxical conclusion that activity in the CeM induces freezing behaviour but may also be anxiolytic. Another interpretation is that inhibition of the CeM is an epiphenomenon of BNST and septal activity,

which could inhibit the CeM through dense GABAergic projections (Poulin et al., 2009; Thomas et al., 2013; Walker et al., 2009).

Other forms of anxiety also appear to be negatively correlated with activity in the CeM. Lesions of the CeA rescue passive avoidance in rats which freeze rather than escape in a conditioned avoidance paradigm (Choi et al., 2010), suggesting that active avoidance (arguably a conditioned emotional response) is mediated by inhibition of the CeM (Moscarello and LeDoux, 2013). Further, as described elsewhere in this thesis, the CeM is thought to be uninvolved, or possibly inhibited during contextual fear (Davis et al., 2010; Walker et al., 2009) and inhibited during restraint (Dayas and Day, 2002). Finally, some evidence suggests that inhibition of some VLPAG-projecting CeM neurons may mediate descending antiociception (Chieng and Christie, 2010; Shane et al., 2001), an important component of defensive behaviours and the conditioned fear response (Fanselow, 1986; Helmstetter and Fanselow, 1987). Thus, anxiety and fear may be represented by inhibition and activation of CeM neurons, respectively.

2.4.8 How does activation of the CeM induce freezing?

Since activation of the CeM is associated with spontaneous freezing behaviour (Ciocchi et al., 2010; Nobre and Brandão, 2011) and freezing to a discrete CS (Ciocchi et al., 2010; Duvarci et al., 2011; Knapska and Maren, 2009), this raises the question of how activation of the CeM leads to freezing, given that these neurons projecting to the VLPAG are GABAergic and activation of output neurons of the VLPAG is thought to be required for freezing (Morgan and Carrive, 2001; Morgan and Whitney, 2000; Walker and Carrive, 2003). One possibility is that activation of the CeM inhibits tonically active neurons in the VLPAG, thus disinhibiting output neurons, consistent with earlier findings (da Costa Gomez and Behbehani, 1995). Another possibility is that CeM neurons directly synapse onto VLPAG output neurons, and strong, phasic activation of the CeM occurs at a sufficient frequency (Whim and Lloyd, 1989) to induce release of neuropeptides such as CRF onto output neurons in the efferent targets of the CeA. This hypothesis is supported by evidence showing that the CeA contains many CRF-containing brainstem projections (Chen et al., 2009; Curtis et al., 2002; Gray and Magnuson, 1992; Retson and Van Bockstaele, 2013; Reyes et al., 2011; Valentino et al., 2001; Van Bockstaele et al., 1998). Whilst earlier reports found that most brainstem projecting neurons which contained CRF were located in the CeL (Gray and Magnuson, 1992; Veening et al., 1984), which has much lighter projections, more modern and sensitive techniques such as RT-PCR reveal that about half of VLPAG-projecting CeM neurons appear to contain CRF (Chen et al., 2009) whilst modern immunohistochemistry reveals similar proportions of brainstem-projecting neurons contain CRF in all divisions of the CeA (Retson and Van Bockstaele, 2013; Reyes et al., 2011).

CRF microinjection in brainstem efferents of the CeA such as the PAG, pontine reticular nucleus and LC is excitatory (Borsody and Weiss, 1996; Bowers et al., 2003; Curtis et al., 1997; Fendt et al., 1997) and potentiates correlates of fear responses (Butler et al., 1990). Stimulation of the CeA activates neurons in the locus coeruleus (LC), and this can be completely blocked by CRF antagonists injected in the LC (Bouret et al., 2003). Furthermore, i.c.v. injections of CRF increases freezing during contextual fear, whilst CRF antagonists inhibit it (Skórzewska et al., 2009, 2008). Local administration of CRF in the VLPAG strongly potentiates freezing and fear- potentiated startle responses (Borelli et al., 2013), probably by activating descending output neurons (Bowers et al., 2003) and CRF antagonists injected in the locus coeruleus potently inhibits freezing to a contextual CS (Swiergiel et al., 1992), and the source of most of this CRF input to the LC is the CeA and BNST (Van Bockstaele et al., 2001). Interestingly, infusion of a CRH antagonist in the pontine reticular nucleus has been shown to almost completely block fear potentiated startle (Fendt et al., 1997), and CRH microinjected into this nucleus potentiates this response (Birnbaum and Davis, 1998) suggesting that the excitatory effect of CeA stimulation on cells this area (Xi et al., 2011) is due to CRF release.

Thus, the PAG neurons excited by electrical or chemical stimulation of the CeA as described by Da Costa Gomez and Behbehani (1995) may have been activated by CRF. Interestingly, the short-latency inhibition of PAG neurons with high tonic activity was opioid-receptor dependent, which may have been due to enkephalin released by CeA projections (Shaikh et al., 1991) which is upregulated in the CeA by re-exposure to a feared context (Petrovich et al., 2000). However, the delayed-onset excitation in other PAG cells with lower tonic activity was not opioid-receptor dependent. Further, CeA axons also terminate on glutamatergic PAG output neurons (Oka et al., 2008). These findings suggest that activation of PAG neurons by CeA stimulation is not solely due to inhibition of local inhibitory interneurons. Instead, excitation of these PAG cells may have instead been due to amygdaloid CRF (Bowers et al., 2003) or possibly through a dual GABAergic (Kudo et al., 2012; Myers et al., 2013; Poulin et al., 2009; Tsubouchi et al., 2007) synaptic relay such as the in BNST (Nagy and Paré, 2008). Interestingly, electrical stimulation of the CeA induced the opposite pattern of activation of cells in the LC - that is, early phase activation, shown to be partly or fully mediated by CRF - followed by long-lasting inhibition, which may have been due to GABA released by CeA terminals (Bouret et al., 2003).

2.4.9 Could inhibition of CeM-VLPAG neurons also induce freezing?

Inhibition of spontaneously active (Ciocchi et al., 2010; Collins and Paré, 1999; Huber et al., 2005; Lu et al., 1997; Pascoe and Kapp, 1985; Rosenkranz et al., 2006; Thomas et al., 2013; Viviani et al., 2011) GABAergic VLPAG-projecting CeA neurons would presumably disinhibit

VLPAG neurons. However it is unknown whether CeA projections synapse primarily onto interneurons or output neurons. A previous electrophysiological study (da Costa Gomez and Behbehani, 1995) provided strong evidence for the former. However, GABAergic CeA neurons have also been shown to directly synapse onto glutamatergic PAG output neurons (Oka et al., 2008). Whilst most of these cells were found in the LPAG and projected to the NRA, this finding demonstrates proof of principle that CeA neurons synapse onto glutamatergic PAG output neurons. Further studies are required to determine whether CeA neurons also terminate onto glutamatergic RVM-projecting VLPAG neurons, which are thought to mediate the freezing, bradycardia and antinociception secondary to VLPAG activation (Morgan and Carrive, 2001; Morgan et al., 2008; Morgan and Whitney, 2000; Vianna et al., 2008; Walker and Carrive, 2003).

2.5 Conclusion

We have demonstrated that projections from the CeA to the VLPAG are almost all GABAergic, and very few of these projections were immunoreactive for Fos after re-exposure to a feared context. In fact, even fewer Fos immunoreactive cells were found in the CeA after fear relative to rest - although this was not significant. Conversely, VLPAG projecting neurons in the ventromedial part of the amygdala, which are mainly glutamatergic, are activated during contextual fear. These results are consistent with i) the notion that the CeM is uninvolved, or inhibited in long-duration, contextual fear (Davis et al., 2010; Walker et al., 2009); and ii) the notion that in the extended amygdala, long-duration, contextual fear responses are associated with inhibition of GABAergic brainstem-projecting neurons and activation of glutamatergic brainstem-projecting neurons (Jennings et al., 2013). This may induce freezing behaviour through direct projections to VLPAG output neurons. If this model is correct, strong, phasic excitation of CeM neurons (for example by a discrete CS) could induce freezing by the release of neuropeptides such as CRF in the VLPAG, whilst the inhibition of tonic CeM activity could induce freezing by the suppression of GABA release in the VLPAG.

Chapter 3 Behavioural and physiological responses to microinjection of orexin-A in the CeA of conscious, freely moving rats

3.1 Introduction

It has been demonstrated that activation of the CeM induces freezing (Ciocchi et al., 2010; Li et al., 2013; Nobre and Brandão, 2011) and bradycardia (Applegate et al., 1982; Kapp et al., 1982; Roozendaal et al., 1993b, 1992b). Further, CeM activity is correlated with freezing and the conditioned fear response to a phasic CS (Ciocchi et al., 2010; Duvarci et al., 2011; Knapska and Maren, 2009). In chapter 2, we showed that the projection from the CeA to the VLPAG is almost entirely GABAergic, and not glutamatergic. Thus, activation of CeM neurons may inhibit tonically active interneurons in the VLPAG (da Costa Gomez and Behbehani, 1995), which may release output neurons from inhibition to induce freezing (Vianna et al., 2008; Walker and Carrive, 2003). Alternatively, CeM neurons may project directly to VLPAG output neurons (Oka et al., 2008), and high frequency stimulation (Vilim et al., 1996; Whim and Lloyd, 1989; Zupanc, 1996) of CeM neurons by a phasic CS would induce CRF release (Chen et al., 2009; Reyes et al., 2011), which would induce fast activation of output neurons in the efferent targets of the CeA (Bouret et al., 2003; Bowers et al., 2003), culminating in the expression of fear responses (Borelli et al., 2013; Fendt et al., 1997; Swiergiel et al., 1992).

If CeM neurons produce freezing by inhibition of tonically active inhibitory interneurons in the VLPAG, injections of pharmacological agents which selectively activate CeM neurons might be expected to increase immobility and freezing. However, vasopressin - which selectively activates neurons in the medial division of the CeA (Huber et al., 2005; Lu et al., 1997; Veinante and Freund-Mercier, 1997) and is the only division of the CeA which contains vasopressin receptors (Huber et al., 2005; Veinante and Freund-Mercier, 1997) - injected in the CeA tended to increase activity in freely moving rats (Roozendaal et al., 1993b), but increased freezing during conditioned fear (Roozendaal et al., 1992b), suggesting a possible state- dependent effect of CeM activity in producing activity or immobility. Similarly, orexin terminals (Baldo et al., 2003; Fadel and Deutch, 2002b) and receptors (Lu et al., 2000; Marcus et al., 2001) are much more densely distributed in the CeM than in the CeL or CeC. Further, orexin activates the same CeM neurons (Bisetti et al., 2006; Johnson et al., 2012a) that are depolarised by vasopressin (Bisetti et al., 2006). Interestingly, orexin injected in the CeA strongly enhances locomotor activity in rats place in the EPM (Avolio et al., 2011). Furthermore, CeM activity is strongly associated with active behaviours and negatively associated with freezing in conditioned avoidance paradigms (Martinez et al., 2013). These results suggest that activation of the CeM may in some cases lead to enhanced active coping and active responses and reduced freezing. This would support the notion that CeM neurons directly

project to VLPAG output neurons. This would allow for a dual control system whereby a moderate activation of CeM neurons could enhance locomotor activity and inhibit freezing by GABA release onto VLPAG output neurons; whereas strong, phasic activation of the CeM could evoke excitatory peptide release, culminating in freezing. Further, CeM neurons show tonic activity (Ciocchi et al., 2010; Huber et al., 2005; Lu et al., 1997; Pascoe and Kapp, 1985; Rosenkranz et al., 2006; Thomas et al., 2013; Viviani et al., 2011). Thus, inhibition of CeM neurons could also enhance freezing by withdrawal of GABAergic input to VLPAG output neurons.

On the hand, injection of orexin in some structures such as the paraventricular thalamus (Li et al., 2010b, 2009) reduces locomotor activity and increases freezing. Orexin receptors also mediate freezing and increased locomotor activity in models of hypercapnic panic attacks (Johnson et al., 2010), freezing and cardiovascular responses in conditioned fear (Chen et al., 2013; Furlong et al., 2009) and orexin-1 receptors in the CeA are associated with immobility in the forced swim test (Arendt et al., 2013). Therefore, it is possible that the CeA may be an additional structure where orexin may induce immobility. Further, since injection of vasopressin in the CeA in freely moving rats induced bradycardia and non-significantly increased locomotor activity, it is possible that the same effect will occur when orexin is injected in the same structure, since the same CeM neurons that are activated by orexin are also activated by vasopressin (Bisetti et al., 2006).

However, as mentioned above, orexin injected in the CeA induces a strong increase in locomotor activity as well as anxiety (Avolio et al., 2011)- both of which would presumably be associated with tachycardia. To our knowledge, the effects of orexin injected in the CeA on cardiovascular responses have not been tested in freely moving rats, but injection of orexin in multiple structures, ventricles and the spinal cord strongly enhances cardiovascular responses. Furthermore, orexin generally enhances locomotor activity when injected in many structures in the brain (España et al., 2001; Kotz et al., 2006), and in all ventricles and the spinal cord (Luong, 2012; Nakamura et al., 2000; Samson et al., 2010).

Finally, we are not aware of any study which has examined the effect of selectively activating CeM neurons on blood pressure in conscious animals, however bradycardia has been reported (Applegate et al., 1982; Roozendaal et al., 1993b, 1992b).

Therefore, we sought to determine the effect of orexin injected in the CeA on cardiovascular and behavioural activity in freely moving rats in their homecages. It was hypothesised that this would increase activity and thus HR, consistent with a previous report (Avolio et al., 2011); as well as a general effect of orexin in promoting active behaviours and cardiac sympathetic

responses (see lit. review), and a hypothesised direct GABAergic projection from CeM neurons to VLPAG output neurons.

3.2 Methods

3.2.1 Subjects

The subjects were 16 naive male Wistar rats (350 - 550 g) purchased from Monash Animal Services (Melbourne, Australia). The animals were housed in individual home boxes (65 × 40 × 22 cm) with ad libitum food and water. The room in which they were housed and tested was maintained at a constant temperature of 22 - 25 °C and kept on a normal 12:12 h light/dark cycle. All procedures were approved by the Animals Ethics Committee of the University of New South Wales and conformed to the rules and guidelines on animal experimentation in Australia.

3.2.2 Radio-telemetric probe implantation Rats were first implanted with radio-telemetric probes (PA-C40, Data Sciences International, St. Paul, MN, USA) for recording of arterial pressure, heart rate, and locomotor activity. The surgery was performed in aseptic conditions under isoflurane anaesthesia. The rats were pretreated with the analgesic carprofen (Rimadyl, 5 mg/kg, s.c.) and received antibiotics (Benicillin, 0.3 ml, i.p.) at the end of the surgery. The probes were implanted in the peritoneal cavity, with the catheter sitting in the descending aorta at the level of the iliac bifurcation, as previously described (Carrive, 2000). During the recovery period (1 week), the animals were handled every day to habituate to the experimenter.

3.2.3 Guide cannulae implantation The guide cannulae were implanted 1 week after the radio-telemetric probes. The surgery was done under the same anaesthetic, analgesic, and aseptic regimen as the radio-telemetric probe implantations. Once anaesthetised, the animal’s head was secured in a stereotaxic frame in the flat skull position. The scalp was cut and the skull exposed. Three small holes were drilled for the screws (3 mm, Plastics One, Roanoke, VA, USA). The screws were set with the screw head approximately 1 mm above the skull surface. Two more holes were drilled for the bilateral implantation of guide cannulae (26 G, Plastics One, Roanoke, VA, USA), which were implanted 1 mm above the target regions, aimed at the medial division of the central nucleus of the amygdala (CeM). The coordinates were AP + -2.1, ML + 3.8, DV – 7.5 mm relative to Bregma, according to the stereotaxic atlas of Paxinos and Watson (2005). The guide cannulae were finally anchored to the screws with dental cement. Animals were allowed to recover for at least 1 week before testing began.

3.2.4 Drug and testing Each site of injection was tested with two doses of orexin-A (3 pmol and 30 pmol, Tocris BioScience) and physiological saline (vehicle solution). The three injections were made in a counterbalanced order. Each animal was tested every second day. The procedure for the injection was as follows: Baseline recordings of HR, MAP, activity and TTail were taken for 30 min, during which the animal spent most of its time at rest, immobile with its eyes closed. After this period, the animal was gently removed from its home box and restrained with a soft cloth wrapped around its body. An injection cannula (33 G, Plastics One), connected to a 5 µl Hamilton syringe, was inserted into the guide cannula and the injection was made. The volume was 0.4 µl and was injected over 30 s. The cannula was left in place for a further 30 s. The injection cannula was then removed and the animal returned to its home box where recording continued for a further 90 min. To minimize the number of rats and optimise the use of the telemetric probes, we used up to three sets of injection cannulae of different lengths (1.0 mm, 1.5 mm and 2 mm beyond the tip of guide cannula). This allowed testing of up to three sites per animal.

3.2.5 Infrared thermography The surface temperature of the tail was recorded with an infrared digital thermographic camera (ThermaCAM P45, FLIR, Sweden) placed 1 m above the animal as previously described (Vianna et al., 2008). The home box lids were removed and replaced with 60 cm tall Plexiglas walls opened at the top to allow an unobstructed view of the animal for the camera.

3.2.6 Data collection and analysis Up to 4 parameters were recorded simultaneously: heart rate (HR), mean arterial pressure (MAP), locomotor activity (Activity), surface temperatures of the tail (TTail). HR, MAP and activity were extracted automatically from the pulsatile blood pressure signal of the telemetric probes using the ART gold software (Data Sciences International). HR and MAP were sampled continuously in 3 s time windows. Activity was a cumulated measure of body movements over a 1 min period. These values were then averaged over each minute. Infrared thermographic images were captured automatically every minute, starting 30 min before and ending 90 min after administration of the drugs. The thermal sensitivity of the camera is approximately 0.1 °C with a spatial resolution of 320 × 240 pixels. The emissivity factor was set at 0.98, which corresponds to the emissivity of the skin. The images were analysed with the FLIR Reporter 9.0 Professional software. The temperature value of the hottest pixel from each area of interest was extracted and recorded. Occasionally, depending on the posture of the animal, an area would be momentarily concealed and therefore not imaged.

3.2.7 Verification of cannula placement At the end of the experiment, the animals were given an overdose of pentobarbitone (120 mg/kg i.p.) and intracranially microinjected with a dye (Pontamine Sky Blue, 0.4 µl) at the most ventral injection site (2 mm below the guide cannula). The brains were removed, post-fixed in 10% formalin solution, and the brains sectioned at 50 µm. The most ventral sites of injection were identified by the presence of the dye and plotted on standard plates from the atlas of Paxinos and Watson (2005). The locations of more dorsal injection sites were interpolated from brain atlas figures by measuring 0.5 mm and 1 mm above the most ventral injection site.

3.2.8 Statistical analysis Statistical analysis was performed with Prism 6 (GraphPad Software, Inc.). Data was first tested for normality with the D’Agnostino and Pearson omnibus normality test. Data that was normally distributed (HR, MAP) was analysed with a two-way repeated measure of analysis of variance (ANOVA) with Tukeys, Bonferroni, Holm-Sidak or Dunnets multiple comparisons tests. The independent factor was drug or saline, and the repeated factor was time. Data that was not normally distributed (Activity) was analysed in two ways; firstly with two-way ANOVA with repeated measure as described above, and also by finding means for each subject and then testing for normality again. If the data was normally distributed, significance testing was carried out by one-way ANOVA (if three or more groups were analysed) or a paired or unpaired t-test as appropriate. If the mean data was still not normally distributed, significance testing was done by Kruskal-Wallis test for three or more groups, or the Mann-Whitney test for testing between two groups.The percentage of subjects displaying an activity score of zero per minute (three minute bins) was fitted to a standard curve (non-linear regression to a sigmoidal dose-response curve with variable hillslope; least sum of squares with outlier detection, Q = 1%). A sigmoidal dose-response curve was used since the percentage of inactive subjects versus time consistently appeared to conform to this shape. Furthermore, this curve was repeatedly statistically verified as the most robust fit according to an extra-sum-of-squares F test. Latency to rest was defined as the latency until 50% of subjects displayed an activity score of zero per minute (three minute bins). Statistical significance was set at P ≤ 0.05. Unless stated otherwise, all comparisons were made between the 1st and 90th minute after animals were injected and returned to their home box.

3.3 Results

Pairs of injection sites were categorised according to the following histological criteria. Category one consisted of pairs in which each injection site was centred within the CeA (n = 11). Category two consisted of pairs in which both sites were either within the CeA or within 0.5 mm ventral or adjacent to it (n = 16). Category three consisted of pairs in which at least one 98

site of injection was centred within the CeA (n = 24). Infrared thermography data was only available for a minority of rats in each group, as only one rat could be imaged at any point in time. Occaisonally, only one or two doses were injected at a particular injection site due to the cement holding the cannulae detaching from the skull before all 3 doses could be administered at that site. For example, Fig. 3.1 depicts 12 injection sites, yet the high dose group consisted of only 11 injection sites. Additionally, some data were collected from subjects used in chapter 4, which did not receive injections of low dose orexin prior to return to their home boxes - thus there are fewer subjects in the low dose group.

3.3.1 Category 1 - Sites of injection centred bilaterally in the CeA (n =11)

3.3.1.1 Response to saline injections (n = 9)

Return to home box after saline injection elicited a strong increase in activity (Fig. 3.2), which returned to baseline levels (< 1 arbitrary units, a.u.) within 15 minutes. This early activity typically consisted of running, grooming, exploratory behaviour, sniffing, eating and drinking. There were no signs of increased anxiety after the first few minutes, as the animal recovered from the handling stress. This increased activity was associated with an elevated HR, MAP and tail temperature response. HR peaked in the first minute and then fell to within 10 bpm of baseline levels within 20 min. HR returned to baseline levels within 30 min. MAP peaked in the 2nd minute to 115 mmHg (+20 mmHg) and fell to baseline levels within 25 min. Tail temperature (n = 3) was 3.8°C colder upon the return to the home box (26.8°C versus 30.6°C). This was maintained for 4 min and then sharply increased to a peak of 34 °C (+ 3°C) at 13 min, before gradually returning to baseline at 50 min. The reduction in activity and cardiovascular parameters to baseline was almost always associated with the animal returning to rest, which occurred on average by 13 min (Figs 3.3, 3.4).The mean activity score over 90 min was 2.2 a.u.

3.3.1.2 Response to orexin-A injected bilaterally in the CeA (n = 11)

Activity and behaviour: Behavioural observations revealed consistent differences between the treatment and control groups. The most striking differences were an increase in alertness, exploratory behaviour, eating, drinking, grooming, increased speed of locomotor activity, and difficulty initiating rest and increased latency to rest. These effects were dose dependent, with increasing dose associated with more vigorous behaviour sustained over a longer period. Animals receiving injections of orexin-A in the CeA displayed greater interest and curiosity in their environment, as though it was novel. They spent more time exploring their home boxes, in particular sniffing and rearing to look through the transparent perspex walls of the home box. There were marked increases in time spent drinking, eating and grooming. Rats would often eat immediately upon returning to the home cage for up to 10 min and groom vigorously for 5 - 10

min periods, which was not observed to the same degree in the saline groups. Interestingly, bilateral microinjection of orexin-A in the CeA did not appear to increase behavioural signs of anxiety or aversive affect, with the exception that the startle response to a sound or a tap on the cage seemed to be enhanced. However animals did not appear to be fearful, did not freeze or display tonic immobility and instead showed active interest and curiosity in the environment.

When rats in the treatment group began to show signs of rest, they would frequently become restless within about 15 - 60 sec, and repeatedly shift position. This process would repeat for long periods, whereafter the rat would either eventually stop moving and rest, or return to an active state. Frequently the rat would rest and then resume an intense burst of activity shortly after. Therefore, ‘time to rest’ could not be easily assessed for individual rats, especially those in the treatment groups. Nevertheless, the proportion of rats at rest reliably tended to increase with time (Fig. 3.3), until it approached or reached a plateau, when most rats were in a resting state. We therefore decided to define ‘latency to rest’ as the timepoint at which 50% of rats displayed an activity score of zero, interpolated from a standard curve of grouped activity data (see methods - statistical analysis).

Return to home box after low dose (3 pmol) orexin-A injection elicited an initial burst of activity comparable to the control group (Fig. 3.2). The activity traces were remarkably similar for the first 10 min, with both groups exhibiting a minimum inflection point at 4-5 min. After 11 min, the activity traces diverged sharply. The low dose group (n = 6) maintained a moderate level of activity until 20 min - approximately the mean latency to rest (Fig. 3.3). After 20 min, the activity trace stabilised at 1-3 arbitrary units until reaching baseline levels (< 1 a.u.) by 40 min. The mean activity score over 90 min was 3.3 a.u (140% relative to saline). There was not a significant effect of low dose orexin-A in elevating activity levels over the 90 min period relative to saline, but a significant increase in activity between the 12th and 90th minute (p < 0.01, unpaired t-test).

The activity response to high dose orexin-A (n = 11) was initially similar to the low dose and saline (Fig. 3.2). After the 10th min, the high dose group displayed moderate to high levels of activity until 68 min, after which activity levels plateaued at 1 - 3 a.u. before finally returning to < 1 in the 87th minute. The mean activity score over 90 min was 6.6 a.u (280% relative to saline). There was a significant effect of orexin-A on Activity (F(2, 23) = 6.43, p < 0.01; two- way ANOVA with RM), and Dunnet’s multiple comparison post test revealed that the high dose group displayed a significantly greater activity score relative to low dose (p < 0.05) and saline (p < 0.01) groups over 90 min. Accordingly, latency to rest was much longer (53 ± 5 min) in the high dose group relative to both saline (13 ± 1 min) and low dose (17 ± 4 min) groups (Figs. 3.3, 3.4). 100

HR: Bilateral microinjection of orexin-A was associated with a dose-dependent increase in heart rate over 90 min (F(2,23) = 7.2, p = 0.0037) and Tukey’s post test revealed a significant difference in the high dose group relative to control (p < 0.01). The HR response to low dose parallelled the saline HR response for the first 12 min and then diverged, sustained at ~ 400 bpm until 19 min, then gradually diminished to baseline levels at 44 min (Fig. 3.2). There was a marked increase in HR in the high dose group relative to control. The HR trace matched the saline trace for 8 min, then remained close to 440 bpm until 20 min, and was approximately 400 bpm at 30 min. After this point the HR gradually dropped to baseline levels at 88 min. The maximum difference between high dose and saline occurred at 21 min (a time point at which over 75% of rats in the saline group were at rest; Fig. 3.3), when HR was 116 bpm higher than in the saline group; 95% CI [68, 196].

MAP: Bilateral microinjection of orexin-A in the CeA was associated with a significant increase in the pressor response compared to control (F(2,21) = 4.69, p = 0.021). Mean arterial pressure was greater after low dose orexin compared to saline upon returning to the home box, and reached a peak at 2 min (120 mmHg) after which it gradually returned to baseline levels which was reached towards 50 min. High dose orexin was associated with a sustained, elevated pressor response which was significantly greater than that elicited in the saline group (p < 0.05, Tukey’s post test). It diverged from the saline group after 4 min and gradually reduced to baseline at 70 min. The maximum difference in MAP between high dose and saline was 15 mmHg (95% CI [1.93, 28.0]), which occurred at 27 min.

Tail temperature: Tail temperature cooled immediately after injection of Orexin-A and return to the homebox, in line with the control group. The tail temperatures of the treatment groups were very similar to those from the control for the first 30 min, but then sharply diverged (Fig. 3.2). Orexin-A was associated with a dose dependent increase in tail temperature relative to controls over the course of 90 min (F(2,6) = 6.20, p = 0.035), and Holm-Sidak post tests revealed that tail temperature was significantly (p < 0.05) warmer in both treatment groups relative to the control group. Differences in temperature between treatment and control groups were clearly apparent between 30 and 90 min (F(2,6) = 18.39, p = 0.0028). The greatest temperature difference between high dose and control groups was 5.0°C, which occurred at 50 min.

101

Figure 3.1 Location of bilateral injection sites (n = 12) in the CeA (category 1). Distances in mm relative to Bregma.

102

Figure 3.2 Average heart rate (HR), mean arterial pressure (MAP), locomotor activity (Activity) and tail temperature baselines and responses to high dose orexin-A (30 pmol, black circles), low dose orexin-A (3 pmol, grey circles) and saline (white circles) injected bilaterally in the CeA (sites indicated in Fig. 3.1; category 1). Values are mean ± SEM. 103

Figure 3.3 Mean percentage of subjects with an activity score of zero per minute (3 minute bins) before and after drug injections placed bilaterally within the CeA (sites indicated in Fig. 3.1; category 1).

Figure 3.4 Latency until 50% of subjects displayed an activity score of zero per minute (data interpolated from sigmoidal non-linear regression curve; Fig. 3.3). Values are mean ± 95% confidence intervals.

3.3.2 Category 2 - Sites of injection centred bilaterally in the CeA or within 0.5 mm (n = 17)

When the size of each group was expanded (n = 17, n = 11 and n = 13 for high dose, low dose and saline respectively) by including bilateral sites of injection that were centred next to the CeA (Fig. 3.5), responses (Fig. 3.6) were similar to category 1 (Fig. 3.2). Means for HR, MAP, Activity, TTail and latency to rest varied little between the two categories, and the traces were of a broadly similar shape, with low dose evenly bisecting the high dose and saline responses. Further, expansion of the grouping in this manner reduced the standard deviations for each physiological measure under inverstigation.

Behaviour and activity: Behavioural observations and Activity scores in category 2 were similar to category 1. There were highly significant differences in Activity between groups (F(2,35) = 12.47, p < 0.0001; one-way ANOVA). Tukey’s multiple comparison tests revealed that the increased Activity observed in the high dose group relative to control was significant (p < 0.0001), as well as relative to the low dose group (p < 0.01).

104

HR: The heart rate response was similar between both categories; however mean HR over 90 min in category 2 was slightly higher than in category 1 for high dose (384 versus 376 bpm respectively) whereas low dose (345 vs 347 bpm) and saline (322 vs 326 bpm) were similar (Figs. 3.2 and 3.6). Maximal HR, which always occurred in the first minute, was slightly lower in the high dose group in category 2 (- 6 bpm) and marginally lower in low dose (- 2 bpm) and saline (-3 bpm). The HR traces were similar in shape, although the low dose response was more clearly separate from the other responses. Microinjection of Orexin-A was associated with a highly significant, dose dependent increase in HR, according to a two-way ANOVA with repeated measure (F(2,35) = 15.02), p < 0.0001). Furthermore, Holm-Sidak post-hoc tests revealed that treatment with both low dose (p < 0.05) and high dose (p < 0.0001) orexin-A was associated with a significantly elevated heart rate relative to controls.

MAP: The pressor responses were similar between categories. Mean pressor responses differed by less than 1 mmHg for each dose. Maximal pressor responses – again occurring in the second minute - were the same for high dose and saline, and marginally less for low dose in the second category (- 3 mmHg). The shapes of the trace for each dose were similar; though notably the MAP of the low dose group in category 2 continued to decline smoothly until 70 min, where it reached baseline levels and the saline trace; whereas in category 1, the low dose trace dropped to baseline levels at 35 min and then rose again (Fig. 3.2). Microinjection of Orexin-A was associated with a highly significant dose dependent increase in MAP, according to a two-way ANOVA with RM (F(2,29) = 6.36, p = 0.0051). Further analysis using two-way ANOVA with RM revealed that the pressor response to high dose was significantly greater than the response to saline (F(1,21) = 11.26, p = 0.003). The maximum difference in MAP between high dose and control was 15 mmHg (95% CI [-4, 26], Bonferroni post-test) which occurred at 32 min.

Tail temperature: The tail temperature responses over 90 min differed by less than 0.3°C between categories. There was a highly significant, dose dependent association between orexin A and TTail (F(2,16) = 32.42, p < 0.0001) according to a two-way ANOVA with repeated measure. The maximum difference in TTail between high dose (n = 6) and saline was 5.3°C (95% CI [2.3, 8.3]) which occurred at 58 min; this was also the time at which TTail peaked in the high dose group in category 1 (34.1°C). Single comparisons of TTail using the same statistical test revealed a significant difference between high dose and low dose (F(1,11) = 19.74, p = 0.001), a highly significant difference between high dose and saline (F(1,10) = 66.87, p < 0.0001) and a significant difference between low dose and saline (F(1,11) = 15.99, p = 0.0021).

105

Figure 3.5 Locations of pairs of injection sites (n = 18) in which both sites were either in the CeA or within 0.5 mm of it (Category 2). Distances in mm relative to Bregma.

106

Figure 3.6 Average heart rate (HR), mean arterial pressure (MAP), locomotor activity (Activity) and tail temperature baselines and responses to high dose orexin-A (30 pmol, black circles), low dose orexin-A (3 pmol, grey circles) and saline (white circles) injected bilaterally in, or within 0.5 mm of the CeA (sites indicated in Fig. 3.5; category 2). Values are mean ± SEM. 107

Figure 3.7 Mean percentage of subjects with an activity score of zero per minute (3 minute bins) before and after drug injections placed bilaterally in, or within 0.5 mm of the CeA (sites indicated in Fig. 3.5; category 2).

Figure 3.8 Latency until 50% of subjects displayed an activity score of zero per minute (data interpolated from sigmoidal non-linear regression curve; Fig. 3.7). Values are mean ± 95% confidence intervals.

3.3.3 Category 3 - Sites of injection in which at least one site was centred within the CeA (n = 24)

Category 3 contained pairs of injection sites whereby at least one site was centred in the CeA (note that Fig. 3.9 depicts two extra injection sites on the right hand side. This was due to a damaged left cannula one rat, thus this rat received injections only in the right amygdala). Mean responses over the 90 min recording period (Fig. 3.10) were similar to categories 1 and 2 (Figs. 3.2, 3.6), as were the general shapes of the traces.

Briefly, there was a highly significant, dose dependent increase in activity after microinjection of orexin-A according to a one-way ANOVA (F(2,52) = 18.08, p < 0.0001). Tukey’s multiple comparison post-tests revealed highly significant differences in Activity between high dose and low dose groups (p < 0.001) and between high dose and saline (p < 0.0001). Behavioural observations were consistent with previous categories. Orexin-A was also associated with significant, dose dependent increases in heart rate (F(2,52) = 22.91, p < 0.0001), mean arterial pressure (F(2,47) = 4.63, p = 0.0147) and tail temperature (F(2,17) = 14.92, p = 0.0002) according to two-way ANOVA with repeated measure.

108

Figure 3.9 Locations of pairs of injection sites in which at least one site was in the CeA (category 3).

109

Figure 3.10 Average heart rate (HR), mean arterial pressure (MAP), locomotor activity (Activity) and tail temperature baselines and responses to high dose orexin-A (30 pmol, black circles), low dose orexin-A (3 pmol, grey circles) and saline (white circles) , where at least one injection site was in the CeA (sites indicated in Fig. 3.9; category 3). Values are mean ± SEM. Numbers represent distances in mm from Bregma. 110 Locations of pairs of injection sites in which at least one site was located in the CeA (Fig. 3.9; category 3).

Figure 3.11 Mean percentage of subjects with an activity score of zero per minute (3 minute bins) before and after drug injections in which at least one site was located within the CeA (sites indicated in Fig. 3.9; category 3).

Figure 3.12. Latency until 50% of subjects displayed an activity score of zero per minute (data interpolated from sigmoidal non-linear regression curve; Fig. 3.11). Values are mean ± 95% confidence intervals.

3.4 Discussion

The results of the present study demonstrate that bilateral and unilateral microinjection of orexin-A in the CeA induces increases in heart rate, blood pressure, tail temperature, locomotor activity and general activity. Freezing behaviour, bradycardia and depressor responses were never observed. Orexin-A also markedly increased arousal, the amount of time spent moving and latency to rest, grooming, running, eating and drinking. Apart from an apparent increase in startle responses to a sound, there did not appear to be any increase in behavioural signs of anxiety - however these parameters were not recorded.

3.4.1 Methodological considerations

The effects of orexin were generally only apparent after 4 - 10 minutes post injection. This may have been due to a delayed effect of the drug in depolarising CeM neurons. Indeed, bath application of orexin in vitro has no effect on the firing rate of CeM in neurons for the first 1-2 min (Bisetti et al., 2006; Johnson et al., 2012a), whilst frequent firing did not occur until 4 min (Johnson et al., 2012a). Another explanation is that this may be due to the stress associated with the handling and restraining of the animal during the injection procedure, which increases

111

locomotor activity, heart rate, blood pressure and reduces tail temperature secondary to sympathetic activation (Vianna and Carrive, 2005). In other words, orexin-A failed to significantly potentiate the early (0 - 5 min) autonomic and behavioural responses to handling stress; and this may have been due to a ceiling effect. Consistent with this notion, the heart rate and blood pressure in the high dose group was stable at around 440 bpm and 110 mmHg until 20 - 25 min, which may represent the maximum cardiovascular response produced by this dose of orexin-A in the CeA. A similar observation was made in a previous report from our laboratory; injection of orexin-A in the RVM failed to potentiate the early HR, behavioural and temperature responses to handling stress, although orexin induced an increase in MAP by the 3rd min (Luong and Carrive, 2012), however injections of orexin in the lateral and fourth ventricles produced clear increases in both HR and MAP by 3 min (Luong, 2012).

Injection of orexin-A was associated with a dose-dependent increase in latency to rest (Figs. 3.3, 3.4, 3.7, 3.8, 3.11, 3.12). Rats injected with saline would usually return to rest by 12 - 15 min post-injection, whereas those in the low dose group would rest after 20 - 30 min, and rats in the high dose group would generally rest by about 50 - 60 min. Therefore, the extent to which orexin-A administered in the CeA potentiates behavioural and cardiovascular responses relative to an awake and unstressed control is not clear.

Another possible limitation of the present study is that some of the effects may have been mediated by structures surrounding the CeA due to possible spread of orexin-A, particularly cholinergic cells in the basal nucleus of maynert and substantia innominata, located immediately dorsal of the CeA. These neurons are activated by orexin and mediate increases in arousal, cerebral blood flow and fear-induced increases in locomotor activity (Arrigoni et al., 2010; Fadel and Burk, 2010; Gozzi et al., 2010; Nakai et al., 1997). However, we found that injections located in the ventral part of the CeA, or immediately ventral to the CeA, were associated with an enhanced magnitude and duration of arousal, tachycardic, pressor and hyperlocomotor responses relative to responses obtained from injections located in dorsal parts of the CeA - although this difference was not statistically significant (data not shown). Importantly, a previous study showed that orexin microinjected in the SI does not increase locomotor activity (España et al., 2001). These observations suggest that direct activation of cholinergic cells of the basal forebrain was not responsible for the effects observed in the present study.

3.4.2 Locomotor activity

Bilateral and unilateral injection of orexin-A induced a long-lasting, dose-dependent increase in locomotor and spontaneous physical activity. These results are consistent with a previous study showing that microinjection of orexin-A and B produced strong hyperlocomotor and anxiogenic effects (Avolio et al., 2011). The fact that similar effects were obtained by both orexin peptides 112

suggest that these effects may be induced by ORX2 receptors, consistent with a previous report showing that orexin activates CeM neurons via ORX2 receptors (Bisetti et al., 2006). However, some evidence seems to suggest a putative role of orexin in the CeA in mediating immobility, as ORX1R mRNA in the CeA correlated with immobility behaviour in the forced swim test (Arendt et al., 2013).

The results of the present study, and those from Avolio et al. (2011) showing that orexin was associated with a robust increase in locomotor activity and absence of freezing may be surprising given that orexins activate CeM neurons (Bisetti et al., 2006; Johnson et al., 2012a) and that activation of the CeM is strongly correlated with, and spontaneously induces, freezing behaviour (Ciocchi et al., 2010; Duvarci et al., 2011; Knapska and Maren, 2009; Nobre and Brandão, 2011). Further, orexin fibres project strongly to the CeM but largely avoid the CeL and CeC (Fig. 1.4, 1.5; Baldo, Daniel, Berridge, & Kelley, 2003; Fadel & Deutch, 2002; Peyron et al., 1998) and ORX1R appear to be located only in the medial division of the CeA (Marcus et al., 2001), whilst the only division of the CeA which has been specifically reported to contain ORX2 receptors is the CeM, which was inferred from electrophysiological experiments (Bisetti et al., 2006) - however a detailed analysis of orexin receptors in the CeA this has not yet been published, to the best of our knowledge. Therefore, intra-CeA injection of orexin would presumably activate neurons in the medial CeA rather than the lateral or capsular parts - which contain cell groups which mediate feed-forward inhibition of the CeM (Ciocchi et al., 2010; Duvarci et al., 2011; Haubensak et al., 2010; Li et al., 2013; Petrovich and Swanson, 1997).

One interpretation of this finding is that orexin receptors are not located on VLPAG-projecting neurons in the CeM, and instead may be found on CeM neurons projecting to structures that mediate increased locomotor activity such as the LPAG, orexin field of the hypothalamus, locus coeruleus and dorsal raphe. At face value this is conceivable, as many cells in the CeM send non-collateralised projections to different structures (Fritz et al., 2005; Thompson and Cassell, 1989; Viviani et al., 2011). However this interpretation seems unlikely because orexin was found to have a potent excitatory effect on 91% of electrophysiologically identified low- threshold burst (LTB) CeM neurons (Bisetti et al., 2006), and all projection neurons in the CeM appear to be of the low-threshold burst type (Chieng et al., 2006), including those projecting to the VLPAG (Chieng & Christie, 2009, 2010). It is possible that the 9% of CeM LTB neurons that were unresponsive to orexin were VLPAG-projecting - however the proportion of CeM neurons that are VLPAG projecting is presumably much higher than 9%. Further, low-threshold burst neurons comprise 90 - 94% of all CeM neurons (Bisetti et al., 2006; Chieng, Christie, & Osborne, 2006), and the remainder are electrophysiologically characterised as regular spiking - although an earlier study found that LTB neurons comprised 71% and regular spiking neurons

113

comprised 27% of all CeM neurons (Dumont et al., 2002). Regular-spiking neurons in the CeM were not responsive to orexin, but these made up only 6% of all CeM neurons (Bisetti et al., 2006). Thus, at least in vitro, it seems highly likely that orexin activates VLPAG-projecting CeM neurons.

An alternative interpretation of the increased locomotor activity observed in the present study is that orexin neurons also project to other divisions of the CeA, which has been reported in one study (Schmitt et al., 2012), and low-magnification images contained in one study investigating the distribution of orexin receptors seemed to show a modest distribution in lateral parts of the CeA, although this is unclear (Cluderay et al., 2002). Consistent with this, i.c.v. injection of orexin-A increases Fos expression in CRF immunoreactive and other neurons in the CeA; and some of these activated cells appear to be located in the CeL - although the anatomical distribution is difficult to infer from this study (Sakamoto et al., 2004). If orexin neurons also activate other parts of the CeA, it is possible that this would induce a feed-forward inhibition of the CeM to reduce freezing, whilst stimulating a subclass of neurons in the CeL/CeC - activation of which can promotes active responses (Gozzi et al., 2010) through a projection to the substantia innominata (Bourgeais et al., 2001; Gozzi et al., 2010; Grove, 1988).

A third interpretation is that the stimulatory effect of orexin on CeM neurons is not sufficient to induce activation of the CeM and thus freezing in freely moving rats, as CeM neurons are tonically gated by GABA in vivo when animals are at rest (Ciocchi et al., 2010; Haubensak et al., 2010; Li et al., 2013). Consistent with this notion, vasopressin – which also preferentially activates neurons in the medial CeA, where its receptors are exclusively located (Huber et al., 2005; Veinante and Freund-Mercier, 1997) – injected at a low dose in the CeA of freely moving rats induces a minor bradycardia and increased activity, although this trend did not reach significance. whereas orexin seems to potently increase locomotor activity (Avolio et al., 2011; Roozendaal et al., 1993b). In contrast, vasopressin injected in the CeA before a short duration exposure to a context previously paired with shock potentiates freezing and robustly enhances bradycardia (Roozendaal et al., 1992b). One interpretation of these opposite, state-dependent effects of vasopressin is that it does not strongly activate VLPAG-projecting CeM neurons when they are under GABAergic inhibition, which occurs at rest but is removed during conditioned fear (Ciocchi et al., 2010; Haubensak et al., 2010; Li et al., 2013). This same putative mechanism may occur with orexin, and this will be expanded on in the next chapter. Importantly however, this explanation does not account for why orexin led to a strong increase in activity and cardiovascular responses in the present study and elsewhere (Avolio et al., 2011).

The fourth interpretation is that orexin induces activation of GABAergic VLPAG-projecting neurons at a frequency sufficient to release GABA (but not excitatory peptides such as CRF) 114

onto VLPAG output neurons; and this would lead to increased activity (Morgan and Carrive, 2001; Walker and Carrive, 2003). It has been shown that increases in tonic activity of CeM cells are associated with non-significant reductions in freezing (Ciocchi et al., 2010), which provides evidence of a putative principle that increases in CeM activity below a certain threshold may reduce freezing and increase activity. Furthermore, increased Fos expression in the CeM is correlated with active avoidance responses (Martinez et al., 2013), operant responding for food (Knapska et al., 2006) and aggressive behaviour in dominant rats (Haller et al., 2006) and negatively correlated with freezing (Martinez et al., 2013; Savonenko et al., 1999). This suggests that in some circumstances, increased activity in at least some CeM neurons may lead to active coping and inhibit freezing. This is consistent with a hypothesised GABAergic projection to VLPAG output neurons.

In any case, since orexin has a similar mechanism of action as vasopressin - insofar as they both appear to directly preferentially activate CeM neurons (Baldo et al., 2003; Bisetti et al., 2006; Fadel and Deutch, 2002b; Huber et al., 2005; Johnson et al., 2012a; Lu et al., 1997; Marcus et al., 2001), and the same neurons activated by orexin are activated by vasopressin (Bisetti et al., 2006), the effects of orexin microinjection in the CeA may also be state-dependent, and may also potentiate freezing during conditioned fear, despite increasing locomotor activity in freely moving rats (see chapter 4).

3.4.3 Heart rate, blood pressure and tail temperature

Bilateral and unilateral microinjection of orexin-A in the CeA induced tachycardia and a pressor response in conjunction with increased physical activity. HR and MAP remained elevated for about 60 to 70 min post- injection. However, tail temperature was not significantly reduced relative to the control group at any time point, perhaps due to heightened activity (see 3.4.4).

It is not clear if the changes in cardiovascular parameters associated with injection of orexin reflect feed-forward mechanisms mediated via descending projections from the CeA to structures controlling sympathetic and parasympathetic outflow, or whether these responses are simply feedback mechanisms secondary to increased locomotor activity. Another possibility may be that motor reactions may be secondary to rises in blood pressure (Heinemann et al., 1973). Interestingly, changes in cardiovascular responses to electrical or glutamatergic stimulation of the CeA usually occur before the onset motor activity, and occasionally at the same time (Heinemann et al., 1973a, 1973b; Iwata et al., 1987). Similarly, in the present study, orexin-A was associated with slightly (non-significantly) lower activity for the first 9 min, but increases in MAP emerged by 4 min in rats receiving bilateral orexin-A, and these changes approached significance in category 2 (Fig. 3.6) (p = 0.07, LD v control; p = 0.14; HD v control). This suggests that the influence of the CeA on cardiovascular responses observed in 115

the present study may be at least partly due to feed-forward sympathoexcitatory mechanisms, and not secondary to motor activity.

Orexin-A was associated with pronounced tachycardia rather than bradycardia. This is in contrast to vasopressin - which also activates CeM neurons (Huber et al., 2005; Lu et al., 1997) and was found to activate all (7/7) of the neurons that were excited by orexin in the CeM (Bisetti et al., 2006) - induces bradycardia when microinjected in the CeA in both freely moving rats and those exposed to a fear-conditioned context (Roozendaal et al., 1993b, 1992b). Further, neurons expressing vasopressin receptors are found in the medial, but not lateral or capsular CeA (Huber et al., 2005; Veinante and Freund-Mercier, 1997), which seems to loosely correspond with the distribution of orexin fibres and terminals. Therefore, it is difficult to interpret the discrepancy in the effects of these neuropeptides on heart rate. One possibility is that there may be orexin receptors in the CeL and CeC, which could oppose the action of the CeM through feed-forward inhibition. Another possibility is that orexin may have spread to the dorsal part of the medial (MeAD), basomedial (BMA), intercalated and basolateral (BLA) amygdala, which are all innervated by orexin fibres (Peyron et al., 1998; Schmitt et al., 2012) and express orexin receptors, particularly the MeA (Cluderay et al., 2002; Lu et al., 2000; Marcus et al., 2001; Trivedi et al., 1998). This would presumably activate neurons in these structures, as orexin primarily has an excitatory effect on postsynaptic neurons (reviewed in Lungwitz et al., 2012) - although some evidence shows that it may reduce excitatory synaptic transmission in the BNST and VLPAG (Conrad et al., 2012; Ho et al., 2011). The MeAD and BMA project densely to the hypothalamus (Canteras et al., 1995; Petrovich et al., 1996) and activation of the MeAD and BMA leads to increases in HR and BP (Chiou et al., 2009; Dayas and Day, 2002; Kubo et al., 2004; Neckel et al., 2012; Stock et al., 1979; Yoshida et al., 2002).

The structures positioned immediately ventral and medial to the CeA (MeA, BMA, intercalated cells) project densely and quite selectively to the medial CeA (Canteras et al., 1995; Paré and Smith, 1993; Petrovich et al., 1996). Interestingly, the MeAD contains many more GABAergic than glutamatergic neurons (Niu et al., 2012; Swanson and Petrovich, 1998), and many neurons projecting from the MeA to the CeA are GABAergic (Bian, 2013) thus activation of this structure by orexin could lead to feed-forward inhibition of the CeM. This is also true of the intercalated nuclei which are GABAergic (Niu et al., 2012; Pitkänen and Amaral, 1994) and project densely to the CeM (Paré and Smith, 1993). The reverse may be true for the BMA, which contains many more glutamatergic than GABAergic neurons (chapter 2; Niu et al., 2012). The BLA contains two separate classes of neurons, activation of which is suspected to either activate or inhibit the CeM (Herry et al., 2008; Tye et al., 2011), thus it is unclear what effect orexin would have in this structure.

116

In contrast, the only parts of the amygdala containing vasopressin receptors are the CeM, anterior amygdala area and interstitial nucleus of the posterior limb of the anterior commissure (IPAC) (Huber et al., 2005; Veinante and Freund-Mercier, 1997). Thus, it is more likely that vasopressin would selectively activate CeM neurons and thus induce bradycardia, whilst orexin may have activated neurons in surrounding structures, which may explain the clear tachycardia and hyperlocomotion observed in the present study and others (Avolio et al., 2011). However, orexin-A was associated with consistent increases in HR, MAP, locomotor activity and arousal responses at each anatomical site, including those located in the centre of the CeA.

The results of the present study are consistent with many other studies reporting pressor and tachycardic effects of orexin in multiple brain structures, ventricles and the spinal cord (Ciriello et al., 2003; Luong, 2012; Matsumura et al., 2001; Samson et al., 1999; Shahid et al., 2012) and a global stimulatory effect of orexin in mediating these responses to certain forms of stress and disinhibition of the defense area (Furlong et al., 2009; Iigaya et al., 2012; Johnson et al., 2012c; Kayaba et al., 2003; Zhang et al., 2009). Cardioinhibitory and depressor responses to orexin microinjection have only been observed after injection in the NTS and nucleus ambiguous (Ciriello and de Oliveira, 2003; de Oliveira et al., 2003), and at very low does - but another study reported a pressor response to orexin injected in the NTS (Smith et al., 2002).

The results of the present study suggest that the CeA is a site which mediates the cardiovascular effects of orexin. This is in line with dense projections from the CeA to cardioregulatory sites such as the PeF, DMH and LH, LC, LPAG, RVLM and DVC (Danielsen et al., 1989; Retson and Van Bockstaele, 2013; Rizvi et al., 1991; Saha et al., 2005; Yoshida et al., 2006). Further, activation of the CeA with glutamate or electrical stimulation leads to increased HR, MAP, increased arousal and activity, in conscious rat and cats, but not during anaesthesia (Chiou et al., 2009; Davis, 2000; Heinemann et al., 1973b; Iwata et al., 1987; Schlör et al., 1984; Stock et al., 1981, 1979), nor during sleep (Frysinger et al., 1984), and only when blood pressure is permitted to rise (Heinemann et al., 1973a). Further, the spontaneous discharge of single CeA neurons precedes synchronised increases in blood pressure with EEG correlates of arousal in the sensorimotor cortex (Schulz et al., 1996).

On the other hand, electrical stimulation of the CeM in anaethetised rabbits leads to bradycardia and depressor responses (Kapp et al., 1982), and in conscious rabbits causes bradycardia and immobility (Applegate et al., 1982), similar to the effects of vasopressin in conscious rats (Roozendaal et al., 1993b, 1992b). Additionally, pharmacological stimulation of the CeA with other agents does not produce consistent effects on cardiovascular responses in awake animals. It appears that disinhibition of the CeA with bicuculline does not seem to strongly affect cardiovascular responses (Sanders and Shekhar, 1991; Soltis et al., 1997). Glutamate injected in 117

the CeA increased blood pressure and heart rate, but at large doses (0.5 M; 0.5 µl) which presumably would have spread to other parts of the amygdala (Iwata et al., 1987) and this was not replicated (Gelsema et al., 1987). CRH injected in the CeA was found to increase HR through inhibition of parasympathetic outflow, but had no effect on sympathetic activity (Wiersma et al., 1993). Thus, the role cells bodies in the CeA have on cardiovascular remains unclear.

3.4.4 Tail temperature

Tail temperature became elevated relative to controls 20 to 30 min after injection and remained until the end of the recording period The warmer tail temperature that was apparent after about 20 min in experimental groups was probably due at least in part to greatly increased skeletal and cardiac muscle activity, but may have also been partly due to increased brown-adipose tissue thermogenesis, although we did not assess this directly. Orexin-A was not associated with significantly cooler tail temperature at any time points. Tail temperature in treatment groups was slightly cooler between about 8 - 18 min in bilateral and bilateral-close groups but this did not reach significance (p > 0.3). The failure of orexin-A to significantly reduce tail temperature may have been due to only a small potentiation of the sympathetic response relative to controls at this time point. Alternatively, orexin may have potentiated stress-induced thermogenesis which is known to be mediated by orexin neurons (Zhang et al., 2010).

3.4.5 Arousal and wakefulness

One of the more prominent findings of the present study was that intra-CeA microinjection of orexin-A greatly increased the latency to rest (Figs 3.3-4, 3.7-8, 3.11-12) and elicited a long- lasting increase in the degree of arousal; for instance, rats in the high dose group appeared more motivated to explore their home boxes and paid more attention to the environment (e.g. sniffing, examining different parts of the home box and looking outside the box) than controls. The stimulatory effects of orexin on wakefulness are well known (Mieda et al., 2004; Sakurai and Mieda, 2011; Sakurai, 2007; Sasaki et al., 2011). One may be drawn to speculate that part of the effect of orexin on cardiovascular and behavioural responses may have been secondary to prolonging the period of wakefulness, which is associated with increased autonomic and behavioural arousal. In other words, activity and sympathoexcitation may simply be more likely to occur during wakefulness. Another interpretation may be that the extended period of wakefulness does not increase locomotor activity and may be secondary to the increase in locomotor activity and sympathoexcitation.

However, both of these interpretations are questionable because increased wakefulness and arousal is not sufficient to increase locomotor activity, nor is locomotor activity necessary for

118

arousal. However, wakefulness is probably a precondition for the pressor and behavioural responses to stimulation of the CeA, as sleep (Frysinger et al., 1984) and anaesthesia (Chiou et al., 2009; Davis, 2000) prevent these. Secondly, orexin microinjection in most brain structures seems to increase wakefulness and arousal, but only increases locomotor or stereotypic behaviour in certain structures, whilst in others it has little or no effect or inhibits activity. For instance, injection of orexin in the substantia innominata increases wakefulness but does not increase activity, whilst injection in the medial septum and medial preoptic area increases mainly quiet waking and only slightly increases activity (España et al., 2001). Similarly, injection in the BNST increases arousal insofar as it increases anxiety but has no effect on locomotor activity (Lungwitz et al., 2012). Orexin-A injected in the RVM increases wakefulness, arousal, stereotypic behaviour and sympathoexcitation but does not have a strong effect on locomotor activity (Luong and Carrive, 2012). Further, injection in the paraventricular thalamus increases arousal, anxiety and freezing but decreases locomotor activity (Li et al., 2010b, 2010c, 2009). Finally, injection of orexin in the median raphe increases theta rhythm, through which increases arousal and anxiety (Hsiao et al., 2013, 2012)

On the other hand, injection of orexin in the lateral and fourth ventricles produce a pronounced increase in locomotor activity, arousal and anxiety (España et al., 2001; Luong, 2012; Samson et al., 2010), which may be due to activation of dopaminergic neurons (Nakamura et al., 2000). Further, injection of orexin in many structures increases locomotor and stereotypic activity such as grooming, in conjunction with arousal. Some of these structures include the locus coeruleus (Hagan et al., 1999), pontine reticular formation (Brevig et al., 2010), substantia nigra, paraventricular and lateral hypothalamus (Kotz et al., 2006), nucleus accumbens shell, dorsal raphe, tuberomammillary nucleus (Kotz et al., 2008) and cervical and upper thoracic spinal cord (Luong and Carrive, 2012; Luong, 2012).

An alternative interpretation of the concomitant increase in arousal, wakefulness, locomotor activity and sympathoexcitation observed in the present study may be that the same neural systems activated by descending projections of the CeA which induce locomotor activity and sympathoexcitation may also induce arousal/wakefulness. Indeed, enhancing arousal is considered to be one of the primary functions of the amygdala (Davis and Whalen, 2001; Rosen and Donley, 2006; Schlör et al., 1984; Silvestri and Kapp, 1998; Whalen, 1998). Candidate efferent structures may be orexin neurons themselves and the locus coeruleus, which contain presympathetic and premotor neurons which increase sympathetic, motorneuron and locomotor activity (Fung et al., 1991; Kerman et al., 2007; Samson et al., 2010; Samuels and Szabadi, 2008; Stone et al., 2004; Yamuy et al., 2010). Other candidates could be the LPAG and VTA, which promote arousal, sympathoexcitation and locomotor activity (Carrive & Bandler, 1991;

119

Jones, 2008; Kerman et al., 2007; Nakai & Maeda, 1994; Nakai et al., 1997; Nakamura et al., 2000; Sakurai & Mieda, 2011; S. P. Zhang, Bandler, & Carrive, 1990) and are innervated by the CeA (El-Amamy & Holland, 2007; Nakamura, Tsumori, Yokota, Oka, & Yasui, 2009; Rizvi, Ennis, Behbehani, & Shipley, 1991; Rosen, Hitchcock, Sananes, Miserendino, & Davis, 1991; Sakurai et al., 2005; Wallace, Magnuson, & Gray, 1992; Yoshida, McCormack, España, Crocker, & Scammell, 2006).

3.4.6 Coupling of anxiety and arousal with locomotor activity and sympathoexcitation

Whilst anxiety was not directly measured in the present study, rats seemed to exhibit enhanced startle responses to sudden noises, although a previous study found no effect of systemic administration of a dual orexin antagonist on baseline startle responses (Steiner et al., 2012). However, administration of orexin in the CeA potently increases anxiety (Avolio et al., 2011).

Orexin appears to mediate the coupling of arousal with enhanced somatomotor and sympathetic responses (Kerman et al., 2007). Interestingly, running normally increases wakefulness, and cataplectic attacks are more common during exercise in orexin knock-out mice (Burgess et al., 2013; Espana et al., 2007), consistent with the notion that orexin mediates synchronous coupling of arousal with locomotor activity and sympathoexcitation, and that increased arousal is a necessary concomitant of activity to prevent cataplexy. Interestingly, lesion of the CeA and BLA prevents running and pleasure-induced cataplexy in orexin knock-out mice (Burgess et al., 2013). Further, humour and laughter, which is the strongest trigger of cataplexy in humans, elicits the greatest increase of orexin release in the amygdala of humans (Blouin et al., 2013).

One interpretation of this finding is that the CeA represents a critical site through which orexin release leads to coupling of locomotor and sympathetic activity with arousal. Orexin may normally act in the CeA to oppose the atonia and lack of arousal seen in cataplectic attacks. This is consistent with the observations of the present study that orexin release in the CeA increases arousal and locomotor activity and muscle tone by somehow opposing the well-known passive response to stimulation of the CeM - for example by inhibiting rather than activating VLPAG output neurons. This hypothesis could be tested by investigating whether injection of orexin in the CeA could rescue cataplexy secondary to orexin knock-out.

3.5 Conclusion

In this study we showed that activation of CeM neurons with orexin (Bisetti et al., 2006; Johnson et al., 2012a) led to an increase rather than a decrease in locomotor activity, coupled with increased HR, MAP and tail temperature. Freezing was not observed. This contrasts to previous work showing that activation of CeM neurons is associated with freezing (Ciocchi et

120

al., 2010; Duvarci et al., 2011; Knapska and Maren, 2009) and bradycardia (Applegate et al., 1982; Kapp et al., 1982; Roozendaal et al., 1993b). Three explanations were provided.

In vivo, CeM neurons are tonically gated by GABA, and thus neuropeptides such as orexin and vasopressin may not sufficiently increase the firing rate to a threshold that induces release of excitatory peptides (Whim and Lloyd, 1989) in the VLPAG to promote freezing or immobility, and may instead increase activity by increasing the release of GABA onto VLPAG neurons (Walker and Carrive, 2003). Consistent with this, increased tonic activity of the CeM is associated with less freezing (Ciocchi, 2009; Ciocchi et al., 2010) and some studies report a negative correlation between Fos expression in the CeM and freezing (Martinez et al., 2013; Savonenko et al., 1999). Another possibility is that orexin may contain receptors in other parts of the CeL and CeC. This has been put forth elsewhere (Cluderay et al., 2002; Schmitt et al., 2012), however other work shows much greater innervation of orexin fibres and receptor density in the CeM (Baldo et al., 2003; Fadel and Deutch, 2002b; Marcus et al., 2001; Peyron et al., 1998). More detailed descriptions of receptor density in the CeA are needed. Finally, it is quite possible that some of the effects in the present study may be due to spread of orexin into the MeAD, BMA, intercalated cells and BLA, which could produce feed-forward inhibition of the CeM, as well as mediating tachycardia and pressor responses through dense projections from the MeAD and BMA to the hypothalamus.

The general role of orexin in the amygdala may be to co-ordinate and synchronise increases in arousal, locomotor activity and muscle tone, anxiety, tachycardia and pressor responses to situations which require engagement with the environment, locomotor activity, and to potentiate and maintain active coping and active defense reactions, as well as to prevent cataplexy to positive emotions and running.

Injection of orexin in the CeA produces an emotional, autonomic and behavioural response that is similar to defense responses. Tachycardia and pressor responses are observed in the rat during conditioned fear and anxiety (Carrive, 2006; Iwata and LeDoux, 1988; LeDoux et al., 1988; Walker and Carrive, 2003), however this is associated with freezing, not running and hyperlocomotor activity. Rather, the effect of orexin in the CeA more closely resembles active avoidant or defense responses (Hilton, 1982). Interestingly, inhibition of a class of cells in the CeL enhances locomotor activity and cortical arousal upon presentation of a CS, but this response is transformed into freezing in rats pre-injected with atropine, suggesting that these rats are anxious (Gozzi et al., 2010). Thus, the CeL can enhance locomotor activity in parallel with increased anxiety or fear, arousal and sympathoexcitation. We propose that both active and passive responses can also be evoked by activation of CeM neurons (Avolio et al., 2011; Haller et al., 2006; Knapska et al., 2006; Martinez et al., 2013). This may be through separate, non- 121

collateralised projections (Fritz et al., 2005; Thompson and Cassell, 1989; Viviani et al., 2011); separate subpopulations of excitatory neuropeptides (e.g. about 40-50% of CeM neurons may contain CRF); or through frequency-dependent release of either GABA or CRF onto output neurons of descending targets of the CeM.

Since orexin has an excitatory effect on almost all CeM neurons (Bisetti et al., 2006), we suggest that orexin in the CeM led to the inhibition of VLPAG output neurons to increase locomotor activity. This is consistent with a monosynaptic, GABAergic projection to VLPAG output neurons.

122

Chapter 4 Behavioural and physiological responses to microinjection of orexin-A in the CeA of rats re-exposed to a feared context

4.1 Introduction

In chapter 2, we demonstrated that projections from the CeM to the VLPAG were GABAergic, and very few of these projections (0.6%) expressed Fos after long-duration re-exposure to a feared context. We suggested that these brainstem-projecting CeM neurons may have been inhibited by the BNST, which mediates long duration fear responses (Davis et al., 2010; Walker et al., 2009). Inhibition of GABAergic CeM neurons could mediate freezing responses by reducing the inhibitory feedback to the BNST (Davis et al., 2010; Dong et al., 2001a; Myers et al., 2013; Walker et al., 2009) and by decreasing GABA release onto VLPAG output neurons, consistent with evidence that CeA axons directly synapse onto glutamatergic PAG output neurons (Oka et al., 2008), and that activation of VLPAG output induces freezing (Morgan and Whitney, 2000; Morgan et al., 1998; Vianna et al., 2008; Walker and Carrive, 2003).

In chapter 3, we showed that microinjection of orexin-A in the CeA, which activates CeM neurons in vitro (Bisetti et al., 2006; Johnson et al., 2012a) did not increase freezing behaviour. Instead, we found that orexin-A was associated with a marked increase in activity including bursts of running. We suggested several interpretations of this finding. One was that orexin may have increased the firing rate of CeM neurons, which may have inhibited VLPAG output neurons, consistent with the idea that increasing CeM activity does not necessarily lead to freezing and may induce the opposite response in some circumstances (Martinez et al., 2013; Roozendaal et al., 1993b; Savonenko et al., 1999).

Another interpretation was that in vivo, orexin may not activate CeM neurons when the animal is at rest, since CeM activity is tightly regulated by tonic GABAergic inhibition during quiet waking (Ciocchi et al., 2010; Haubensak et al., 2010; Li et al., 2013; Nobre and Brandão, 2011). Thus, the threshold required for the sufficient activation of CeM neurons for freezing behaviour to occur may not have been reached by the injection of orexin-A when the animal was unstressed in its home box. This contrasts with the freezing induced in freely moving rodents by more powerful treatments such as optogenetic stimulation (Ciocchi et al., 2010) and bicuculline (Nobre and Brandão, 2011) which are much more likely to activate these neurons. However, this explanation does not easily account for the tachycardia, pressor and activity responses to orexin that we observed in chapter 3, unless they were mediated by a nearby structure.

Consistent with the second interpretation, injection of the neuropeptide vasopressin in the CeA - which selectively activates CeM neurons (Bisetti et al., 2006; Huber et al., 2005; Johnson et al.,

123

2012a; Lu et al., 1997) - increased activity and did not increase freezing in freely moving rats (Roozendaal et al., 1993b), but enhanced freezing during short-duration re-exposure to a feared context (Roozendaal et al., 1992b). Crucially, short-duration conditioned responses are thought to be mediated by increased CeM activity (Davis et al., 2010; Walker et al., 2009).

If conditioned fear to context is associated with increased activity (by disinhibition) of CeM neurons, similar to conditioned fear of a discrete or short-duration stimulus (Ciocchi et al., 2010; Duvarci et al., 2011; Haubensak et al., 2010; Li et al., 2013) it would be expected that potentiation of these neurons by orexin would enhance conditioned fear responses.

However, if conditioned responses to long-duration re-exposure to a feared context is mediated by the BNST, and is associated with the inhibition of CeM neurons, as we (Chapter 2) and others (Walker et al., 2009) have proposed, it would be expected that potentiation of CeM neurons by orexin would decrease freezing and conditioned fear responses, particularly given that the CeM sends GABAergic projections to the BNST (Dong et al., 2001a; Li et al., 2012) and PAG output neurons (Oka et al., 2008). Furthermore, activation of CeM neurons has been associated with increased active avoidance responses (Martinez et al., 2013), and presumed activation of these neurons by orexin robustly enhances locomotor activity (Chapter 3; Avolio et al., 2011).

Thus, we hypothesised that bilateral microinjection of orexin-A in the CeA would not potentiate behavioural and cardiovascular conditioned fear responses, and may instead reduce them.

4.2 Methods

4.2.1 Subjects

The subjects were 8 naive male Wistar rats (350 - 550 g) purchased from Monash Animal Services (Melbourne, Australia). The animals were housed in individual home boxes (65 × 40 × 22 cm) with ad libitum food and water. The room in which they were housed and tested was maintained at a constant temperature of 22 - 25 °C and kept on a normal 12:12 h light/dark cycle. All procedures were approved by the Animals Ethics Committee of the University of New South Wales and conformed to the rules and guidelines on animal experimentation in Australia.

4.2.2 Radio-telemetric probe implantation

124

pretreated with the analgesic carprofen (Rimadyl, 5 mg/kg, s.c.) and received antibiotics (Benicillin, 0.3 ml, i.p.) at the end of the surgery. The probes were implanted in the peritoneal cavity, with the catheter sitting in the descending aorta at the level of the iliac bifurcation, as previously described (Carrive, 2000). During the recovery period (1 week), the animals were handled every day to habituate to the experimenter.

4.2.3 Guide cannulae implantation

The guide cannulae were implanted 1 week after the radio-telemetric probes. The surgery was done under the same anaesthetic, analgesic, and aseptic regimen as the radio-telemetric probe implantations. Once anaesthetised, the animal’s head was secured in a stereotaxic frame in the flat skull position. The scalp was cut and the skull exposed. Three small holes were drilled for the screws (3 mm, Plastics One, Roanoke, VA, USA). The screws were set with the screw head approximately 1 mm above the skull surface. Two more holes were drilled for the bilateral implantation of guide cannulae (26 G, Plastics One, Roanoke, VA, USA), which were implanted 1 mm above the target regions, aimed at the medial division of the central nucleus of the amygdala (CeM). The coordinates were AP + -2.1, ML + 3.8, DV – 7.5 mm relative to Bregma according to the stereotaxic atlas of Paxinos and Watson (2005). The guide cannulae were finally anchored to the screws with dental cement. Animals were allowed to recover for at least 1 week before fear conditioning began.

4.2.4 Fear conditioning

Fear conditioning was done in footshock chambers (23 × 21 × 20 cm) made of clear Perspex walls on two sides with a grid floor composed of 18 stainless steel rods (2 mm in diameter), spaced 1.5 cm apart and wired to a constant-current shock generator. The chambers were cleaned before and after use with 0.5% acetic acid. There were four shock sessions spaced over a period of 7 days. Each shock session lasted 40 min and consisted of four unsignalled electric footshocks (1 mA, 1 s) delivered approximately every 10 min to the grid floor. This procedure produces a robust and maximal fear response (Carrive, 2002, 2006; Walker & Carrive, 2003; Vianna & Carrive, 2005). The animals were allowed to recover for 3 - 4 days after conditioning before testing.

4.2.5 Orexin-A microinjections and testing

On the first day of testing, baseline recordings of heart rate (HR), mean arterial pressure (MAP) and locomotor activity (activity) were made for 30 min, during which the animal was predominantly sleeping. The animal was then gently removed from its homebox and restrained with a soft cloth wrapped around its body. An injection cannula (33 G, Plastics One), connected

125

to a 5 µl Hamilton syringe, was inserted into the guide cannula 1 mm below the guide cannula. Either saline (0.4 µl; vehicle) or 30 pmol Orexin-A (0.4 µl; Tocris BioScience) was injected over 30 s. The cannula was left in place for a further 30 s. The injection cannula was then removed and placed in the contralateral cannula and the injection repeated. Immediately following the bilateral microinjections, the conditioned fear response was tested by re-exposing the animals for 30 min to the same footshock chambers in which they had been conditioned, this time without shock delivery. Freezing (defined as the absence of movement while assuming a tense posture), along with HR, MAP and Activity were recorded throughout the re-exposure. At the end of the re-exposure period, the animals were returned to their home box, where telemetric recording continued for a further 30 min. The animals were rested for 48 h after each re- exposure session throughout the experiment. The order of microinjections was randomised and then counterbalanced, such that for the second re-exposure, an individual animal would receive saline if it had previously received orexin-A, and vice versa.

Two days after the second re-exposure, the animals were re-conditioned to the footshock chamber with a single shock session. The animals recovered over the next 48 h, and then received another round of re-exposure, with the order of drug microinjection inverted, and the site of injection 1.5 mm below the guide cannulae. This process was repeated again at the third depth (2 mm).

4.2.6 Histology

At the end of the experiment, the animals were given an overdose of pentobarbitone (120 mg/kg i.p.), intracranially microinjected with a dye (Pontamine Sky Blue, 0.4 µl). The brains were removed, post-fixed in 10% formalin solution, and the brainstems sectioned at 50 µm. The centres of the sites of injection were identified and plotted on standard plates from the atlas of Paxinos and Watson (2005).

4.2.7 Data collection and analysis

HR, MAP and Activity were extracted automatically from the pulsatile blood pressure signal of the telemetric probes using the ART gold software (Data Sciences International). HR, MAP, Activity and freezing were sampled continuously in 3 s time windows. Activity represents a cumulative measure of body movements over a 1 min period. These values were then averaged over each minute.

4.2.8 Statistical analysis

Statistical analysis was performed with Prism 6 (GraphPad Software, Inc.). Data was first tested for normality with the D’Agnostino and Pearson omnibus normality test. Data that was 126

normally distributed (HR, MAP) was analysed with a two-way repeated measure of analysis of variance (ANOVA) with Tukeys, Bonferroni, Holm-Sidak or Dunnets multiple comparisons tests. The independent factor was drug or saline, and the repeated factor was time, and occasionally both time and subjects (RM by both factors). Data that was not normally distributed (Activity and Freezing) was analysed in two ways; firstly with two-way ANOVA with repeated measure as described above, and also by finding means for each subject and then testing for normality again. If this data was normally distributed, significance testing was carried out by one-way ANOVA (if three or more groups were analysed) or a paired or unpaired t-test as appropriate. If the mean data was still not normally distributed, significance testing was done by Kruskal-Wallis test for three or more groups, or the Mann-Whitney test for testing between two groups.

Linear regression analysis (minimum sum of squares) was performed on freezing data (2 - 30 min). Linear regressions, together with 95% confidence intervals, were displayed on figures. P- values associated with each slope indicate whether the slope was significantly non-zero. The percentage of subjects displaying an activity score of zero per minute (three minute bins) during baseline and return to homebox was fitted to a standard curve (non-linear regression to a sigmoidal dose-response curve with variable hillslope; least sum of squares with outlier detection, Q = 1%). A sigmoidal dose-response curve was used since the percentage of inactive subjects versus time consistently appeared to conform to this shape. Furthermore, this curve was repeatedly statistically verified as the most robust fit according to an extra-sum-of-squares F test. Statistical significance was set at P ≤ 0.05. Unless stated otherwise, all comparisons were made between 1 - 30 min after injection (for re-exposure) or 1 - 30 min after handling (for the recovery period). Finally, within-subject comparisons were made between responses evoked by conditioned fear and return to home box. This was done by matching the physiological and behavioural responses accompanying the re-exposure trial associated with the maximal freezing response for that subject, with responses evoked by re-exposure to the home box, following microinjections of either saline or orexin-A. All data were analysed by two-way ANOVA with RM by both factors (subjects and time).

4.3 Results

Injection sites were classified into two categories - those in which injection sites were placed bilaterally in the CeA (Fig. 4.1; bilateral group) and those in which at least one site was within the CeA (Fig. 4.6; bilateral + unilateral group).

127

4.3.1 Category 1 - Sites of injection bilaterally centred in the CeA (n = 10)

4.3.1.1 Response to conditioned fear - saline

Rats that received bilateral microinjections of saline (n = 10; Fig. 4.1) in the CeA displayed all of the characteristic responses of conditioned fear to context: freezing, increased blood pressure, net tachycardia but with a bradycardic component (Figs. 4.2, 4.11, 4.12).

HR. Re-exposure to the foot-shock chamber elicited a strong initial tachycardia. Mean HR was 35 bpm higher during the 5 min following introduction to the foot-shock chamber, as compared with the HR response observed in rats returned immediately to the home box after saline injection (Fig. 4.2, Fig. 3.6; 481 bpm versus 445 bpm respectively). This initial tachycardic response to conditioned fear to context was significant (F(1,29) = 9.71, p < 0.01) according to a two-way ANOVA with RM. HR continued to fall until 10 min, at which point it plateaued between 365 and 390 bpm during the remaining period of re-exposure to the foot-shock chamber. For comparison, in the group injected with saline and immediately returned to home box in the previous experiment, HR continued to fall consistently to 310 bpm by 30 min (see section 4.4 and Fig. 4.11 for more detailed analysis).

MAP. Blood pressure (n = 7) rose to 117 mmHg in the 2nd min and then dropped 10 mmHg within 12 min, after which it stabilised and remained between 105 and 107 mmHg for the remaining period in the footshock box (Fig 4.2). For comparison, animals injected with saline and immediately returned to their home box displayed a maximal pressor response at 116 mmHg, which fell smoothly to 96 mmHg by 30 min (see Fig. 4.11).

4.3.1.2 Recovery period – saline

After the re-exposure session, rats were immediately returned to their home boxes. This recovery period was associated with the complete cessation of freezing, and replaced by a surge of Activity, which peaked in the first minute and returned to baseline levels towards 30 min after return to home box. Return to home box was also accompanied by a marked increase in HR (Fig. 4.2). HR rose to 450 bpm and remained above 400 bpm for 15 min and then dropped to 330 bpm by 30 min. Despite increased HR, return to home box was not associated with any initial change in MAP. MAP remained stable for 15 min and then diminished to baseline levels by 30 min.

4.3.1.3 Response to conditioned fear: orexin-A versus saline

Freezing. Bilateral microinjection of orexin A (n = 10) in the CeA was associated with a significant reduction in freezing (F(1,9) = 11.5, p < 0.01) according to a 2-way ANOVA with RM by both factors (Fig. 4.2). A ceiling effect may have reduced the difference between groups,

128

especially in the first half of the re-exposure. There was a significant decline in freezing over the 30 min period of re-exposure in the saline group (slope = -0.34; 95% CI [-0.46, -0.23], p < 0.0001), suggesting within-trial extinction, consistent with previous results obtained with this experimental protocol. However no within-trial extinction trend in freezing was apparent in the treatment group (slope = 0.04; [-0.11, 0.19], p > 0.5. The difference between trends in freezing between the treatment and control groups in each re-exposure sessions was significant (p < 0.0001).

Activity. Consistent with reduced freezing in the treatment groups, Activity levels were slightly higher during re-exposure in the orexin-A group (4.1 a.u.) compared to saline (3 a.u.), however this difference was not significant (p > 0.2).

HR & MAP. Consistent with the increased activity, HR was slightly higher after 5 min in the experimental group - however this was not significant (p > 0.2). MAP was remarkably similar to that seen in the control group (Fig. 4.2), and intra-group variance was very low, indicated by small error bars (SEM). Interestingly, HR was significantly (p = 0.05, two-way ANOVA with RM) lower between 9 - 26 min in the high dose group in the present experiment compared to the high dose group in Chapter 3, consistent with fear-induced bradycardia, whilst MAP was similar (p > 0.5) between high dose groups in the fear- and freely moving (chapter 3) conditions.

4.3.1.4 Recovery period – orexin A

The response to the return to home box was initially similar to that observed in controls (Fig. 4.2.).

Activity. Small differences in Activity emerged after 6 min, whereas the cardiovascular response diverged from controls at around 15 min (Fig. 4.2.). Mean Activity was 30% greater in the treatment group (p = 0.049, Wilcoxon matched-pairs test) during the recovery period.

HR & MAP. Accordingly, heart rate was significantly higher in the orexin group during this period (F(1,9) = 6.8, p = 0.028). The increase in MAP over the 30 min recovery period was not significant relative to controls, however it was significant when the first 15 min of the recording period were excluded (F(1, 6) = 8.1, p = 0.029). It should be noted that reduction of Activity and cardiovascular parameters to baseline levels occurred long after the recovery period in the experimental group - often falling after 1 hour; however only the 30 min period was recorded. If this was included in the analysis, the differences between treatment and controls would be decidedly greater. This is clear from the trends apparent in the graphs (Fig. 4.2).

129

4.3.1.5 Response to conditioned fear: interaction between drug and order

Upon further investigation, it was immediately apparent that the interaction between drug and order of re-exposure was affecting responses (Fig. 4.3).

After each phase of fear conditioning, animals were injected with either orexin-A or saline and re-exposed to the footshock box without shock. Two days later, the treatment and control were swapped, and the animals were again re-exposed to the footshock box. In other words, one trial of extinction training had already occurred before the second injection & re-exposure session. To account for the possible effects of extinction, or other potential drug-order interactions, we separated the groups into further categories depending on the order of injection.

The saline-first group (Sal1; n = 4) represented responses to saline injected immediately prior to the first re-exposure session. Naturally, this group was paired with the orexin-second group (Orx2, n = 4), in which orexin was injected immediately before the second re-exposure (saline having been injected before the previous re-exposure). The orexin-first group (Orx1; n = 6) represented responses to orexin-A injected immediately prior to the first re-exposure session. This group was paired with the saline-second group (Sal2; n = 6), which represented responses to saline injected immediately prior to the second re-exposure session (orexin having been injected before the previous re-exposure).

Freezing. The differences in freezing between groups was significant (F(3,16) = 4.73, p = 0.015; two-way ANOVA with RM). Time spent freezing was clearly lowest in the Orx2 group (mean = 46%; Fig. 4.3), significantly less than its paired group Sal1 (69% freezing; p = 0.038, paired t-test). Additionally, Dunnet’s post-test revealed that Orx2 displayed significantly less freezing than Orx1 (71% freezing; p < 0.05) and Sal2 (83% freezing; p < 0.01). The freezing response in Sal2 was significantly enhanced relative to its paired group Orx1 (p = 0.031, Wilcoxon matched-paired test). Interestingly, the level of freezing in Sal2 appeared to be greater than in Sal1 (p = 0.077; two-tailed t-test). Furthermore, we suspect that these differences were impeded by a ceiling effect occurring primarily in Sal2 and Sal1, which displayed maximal freezing in the first half of the test. No other significant differences were found.

Both saline groups showed within-trial decline in the rate of freezing (Sal1: slope = -0.53, p < 0.0001; Sal2: slope = -0.22, p < 0.001) which may have also been impeded by a ceiling effect in the first half of the re-exposure. There was no trend in either orexin group (Orx1: slope = -0.03, p > 0.7; Orx2: slope = 0.016, p = 0.17). The difference in freezing trends between the treatment and control groups in each re-exposure sessions was significant (re-exposure 1: p < 0.01; re- exposure 2: p < 0.001).

130

The apparent within-trial extinction seen in Sal1 corresponded to the lower levels of freezing in its paired group Orx2, and the apparent lack of extinction shown by Orx1 was consistent with the observation that Sal2 spent significantly more time freezing than Orx1.

Activity, HR and MAP. Low levels of freezing in Orx2 corresponded to non-significantly enhanced Activity levels (6.1 a.u.) relative to Orx1 (2.3 a.u.; p = 0.10) and Sal1 (2.2 a.u.; p = 0.09). Consistent with higher levels of activity in the Orx2 group, heart rate was non- significantly elevated relative to Orx1 (p = 0.068) and Sal2 (p = 0.072) according to Dunnet’s post-tests; however these differences in HR were significant between 10 - 30 min (p < 0.05). The Orx2 group did not exhibit an increase in MAP, despite greater HR and Activity. There were no other significant differences in responses between groups during the re-exposure session.

4.3.1.6 Response to recovery: interaction between drug and order

Activity. The locomotor Activity displayed by groups Orx1, Orx2 and Sal2 after return to the homebox were similar (12-14 a.u.), whilst Sal1 displayed a significantly lower level of Activity (6.0 a.u) (F(3, 16) = 3.4, p = 0.044, two-way ANOVA with RM), and Sal1 was significantly less Active during this period than all other groups (p < 0.05, Holm-Sidak post-tests).

HR & MAP. Rats injected with saline displayed similar cardiovascular responses during the recovery period, irrespective of order (Fig. 4.3). This cardiovascular response was essentially that described in the pooled saline group (Fig. 4.2). There was a significant difference in HR between groups (F(3,16) = 4.0, p = 0.027). The Orx2 group displayed a significantly higher HR in the recovery period as compared with every other group (p < 0.05; Holm-Sidak multiple comparisons test). As noted above, the differences in cardiovascular and Activity responses during the recovery period were underestimated in the present experiment, as rats receiving the high dose would usually be active for 1 hour after return to home, whereas control rats would be at rest by 30 min.

131

Figure 4.1 Pairs of injection sites located bilaterally in the central nucleus of the amygdala.

132

Figure 4.2 Heart rate (HR), Mean arterial pressure (MAP), freezing and locomotor Activity responses subsequent to bilateral microinjection of Orexin-A (30 pmol; black circles) or saline (white circles) in the central nucleus of the amygdala (Fig. 4.1) before, during and after exposure to a context previously paired with footshock. 133

Figure 4.3 Heart rate (HR), Mean arterial pressure (MAP), freezing and locomotor Activity responses subsequent to bilateral microinjection of Orexin-A (30 pmol) or saline in the central nucleus of the amygdala (Fig. 4.1) before, during and after exposure to a context previously paired with footshock. Black circles: Responses when orexin-A was the first of the two injections; Black diamonds: responses when orexin-A was the second of the two injections; White circles: Responses when saline was the first of the two injections White diamonds: Responses when saline was the second of the two injections. Arrows: represent the experimental crossover design 134

Figure 4.4 Latency to rest: Mean percentage of subjects with an activity score of zero per minute (3 min bins) before and after drug injections placed bilaterally within the CeA (sites indicated in Fig. 4.1; category 1).

Figure 4.5 Latency to rest: Mean percentage of subjects with an activity score of zero per minute (3 minute bins) before and after drug injections placed bilaterally within the CeA (sites indicated in Fig. 4.1; category 1), according to treatment order.

4.3.2 Category 2 - Sites of injection in which at least one site was centred in the CeA (n = 20)

The size of each group was increased by including pairs of injection sites whereby at least one site was within, or immediately adjacent (within 0.5 mm) to the CeA (Fig. 4.6). Previous research (chapter 3) demonstrated that these categories consisted of responses that were very similar to those seen when the injection sites were centred bilaterally in the CeA. This was also observed in the present study: behavioural and physiological responses to orexin-A during conditioned fear and recovery were conserved despite the inclusion of pairs of injection sites which were not centred in the CeA (compare Figs. 4.2 - 4.5 with Figs. 4.7 - 4.10).

4.3.2.1 Response to conditioned fear

Freezing. Freezing was significantly lower in rats receiving orexin-A (n = 20) compared with control (n = 20) (F(1,19) = 16.9, p < 0.001). The magnitude of this difference may have been 135

underestimated due to a possible ceiling effect which would have primarily affected the control group. In contrast to the findings obtained by bilateral microinjections, there was a significant reduction in freezing throughout the re-exposure session in both treatment (slope = -0.14; 95% CI [-0.24, -0.04], p < 0.01) and control (slope = -0.23, [-0.32, -0.15], p < 0.0001) groups. The difference in slopes between groups was not significant (p = 0.16).

Activity, HR & MAP. Corresponding to the reduced freezing in the treatment group, there was a significantly increased level of Activity in the orexin-A group (4.0 a.u.) relative to controls (F(1, 19) = 4.4, p = 0.049). This increase in Activity in the treatment group was associated with a significantly increased HR (F(1,19) = 6.2, p = 0.022; two-way ANOVA with RM by both factors). No difference in MAP was observed.

4.3.2.2. Response to recovery

Activity, HR & MAP. Perhaps the clearest and most consistent differences between experimental and control groups were the divergent cardiovascular responses during the recovery period (Fig. 4.7). Orexin-A was associated with significantly higher levels of Activity (F(1, 19) = 14.6, p < 0.01), HR (F(1, 19) = 33.2, p < 0.0001) and MAP (F(1,16) = 16.7, p < 0.001) according to two-way ANOVA with RM by both factors. It should be noted that these results do not capture the complete recovery response, as rats injected with orexin continued to be active for approximately 60 min after return to the homebox. This period was not consistently recorded. If it was included in the analysis, the contrast in responses between drug and vehicle would be decidedly greater.

4.3.2.3. Interaction between drug and order - response to conditioned fear

Freezing. The group differences in freezing were highly significant (F(3,36) = 8.5, p < 0.001, two-way ANOVA with RM) (Fig. 4.8). Tukey’s multiple comparison test revealed that the Orx2 group, which spent 50% of time freezing, exhibited significantly lower levels of freezing compared to each other group: vs Orx1 (72% freezing, p < 0.01); vs Sal1 (76%, p < 0.01); and vs Sal2 (81%, p < 0.001). Rats in the Orx1 group exhibited less freezing than the Sal2 group, but this was not significant (p = 0.13, Wilcoxon matched-pairs test) however a ceiling effect may have curtailed this difference. There was no difference in freezing between Orx1 and Sal1.

Both treatment and control groups displayed significant negative trends in the rate of freezing during the first re-exposure (Sal1: slope = -0.27, p < 0.0001; Orx1: slope = -0.19, p < 0.01) whilst in the second re-exposure, only the saline group displayed a negative trend (Sal2: slope = -0.20, p < 0.01; Orx1: slope = -0.07, p > 0.3) however the differences between treatment and controls were not significant (p > 0.2).

136

Activity, HR & MAP. The differences in Activity between groups was not significant (F(3,36) = 2.8, p = 0.054; two-way ANOVA with RM), however the Orx2 group was significantly more active than both Sal1 and Sal2 (p < 0.05; Dunnet’s post-tests). Corresponding to the increased Activity in Orx2, this group exhibited an elevated HR relative to both control groups (p < 0.05, Dunnet’s post-tests). No differences were found in MAP.

4.3.2.4. Response to recovery

Activity. There was a significant difference in Activity between groups (F(3, 36) = 6.5, p = 0.0012), and Sal1 displayed less activity than both treatment groups (p < 0.01; Tukey’s post- test).

HR & MAP. Cardiovascular responses to recovery in the treatment groups were clearly elevated above those exhibited by the saline groups during recovery (Fig. 4.8). Heart rate responses were significantly different between groups (F(3,36) = 8.3, p < 0.001; two-way ANOVA with RM), and Holm-Sidak’s multiple comparison post-tests revealed a higher HR in Orx2 than both saline groups (p < 0.001). HR was significantly higher in Orx1 than its paired group Sal2 during the recovery period (F(1, 9) = 10.0, p = 0.012). MAP was significantly elevated during recovery in Orx1 relative to its paired group Sal2 (F(1,6) = 10.3, p = 0.018) and Orx2 displayed a higher MAP than its paired group Sal1 during this period (F(1,8) = 6.9, p = 0.030).

137

Figure 4.6 Pairs of injection sites in which at least one site was located in the central nucleus of the amygdala (CeA). Closed circles represent sites which were considered to be in the CeA, open circles represent sites located outside of the CeA.

138

Figure 4.7 Heart rate (HR), Mean arterial pressure (MAP), freezing and locomotor Activity responses subsequent to microinjection of Orexin-A (30 pmol; black circles) or saline (white circles) within (bilaterally or unilaterally) the CeA before, during and after exposure to a context previously paired with footshock. Injection sites represented in Fig. 4.6; category 2.

139

Figure 4.8 Heart rate (HR), Mean arterial pressure (MAP), freezing and locomotor activity responses to combined unilateral and bilateral microinjection of Orexin-A (30 pmol; black circles) or saline (white circles) in the central nucleus of the amygdala (injection sites represented in Fig. 4.6) before, during and after exposure to a context previously paired with footshock. Black circles: Responses when orexin-A was the first of the two injections; black diamonds: responses when orexin-A was the second of the two injections; White circles: Responses when saline was the first of the two injections White diamonds Responses when saline was the second of the two injections. 140

Figure 4.9 Latency to rest: Mean percentage of subjects with an activity score of zero per minute (3 minute bins) before and after drug injections placed (unilaterally or bilaterally) within the CeA (sites indicated in Fig. 4.6; category 2).

Figure 4.10 Latency to rest: Mean percentage of subjects with an activity score of zero per minute (3 minute bins) before and after drug injections placed (unilaterally or bilaterally) within the CeA (sites indicated in Fig. 4.6; category 2) according to treatment order.

4.4 Autonomic balance in conditioned fear to a context versus return to homebox

We then sought to perform a post-hoc investigation on the relative contributions of the sympathetic and parasympathetic nervous systems on heart rate and blood pressure in conditioned fear compared to a moderately stressful procedure (handling, microinjection and return to homebox). This was done by comparing physiological responses to re-exposure to the footshock box with responses obtained from the return to homebox in the same subjects, after respective injection of bilateral and unilateral injections of either saline or high dose orexin in the CeA (sites indicated in Fig. 4.6).

Autonomic balance in conditioned fear to a context versus home box - saline microinjections

Each subject involved in the conditioned fear experiment also received an injection of saline in the CeA followed by return to the homecage (n = 9). The behavioural and physiological

141

responses to this challenge were compared against responses evoked following saline injections prior to re-exposure to the footshock box (Fig. 4.11). Only the physiological and behavioural responses accompanying the maximum freezing responses for each subject were analysed (n = 9).

Levels of Activity were significantly elevated in the fear group versus the rest group in the 30 min following injection with saline (F(1, 8) = 25.8, p = 0.0010; two-way ANOVA with RM by both factors). There was no significant difference between groups in heart rate over the 30 min period following saline injection (9.3 bpm; 95% CI [-21.7, 40.2]; p > 0.5). In contrast, MAP was strongly (9.8 mmHg, [9.0, 10.6]) and significantly (F(1,7) = 39.1, p < 0.001) elevated in the fear group relative to the home box group during this period.

Injection with saline followed by re-exposure to the footshock box was associated with a significant tachycardia for the first 6 min after injection, relative to rats returned to their home boxes (Fig. 4.11; F(1,8) = 7.5, p = 0.026; two-way ANOVA with RM by both factors), despite greatly attenuated levels of activity during the same period (Fig. 4.11; F(1,8) = 23.7, p = 0.0012). After this initial tachycardia, mean HR in the fear group dropped below that in the home box group between 7 and 18 min - although this was not statistically significant (p > 0.4). It should be noted that the drop in HR, MAP and Activity after 10 min in the home box group is strongly associated with the animals returning to rest (Fig. 4.11), whereas rats in the fear group remained vigilant and aroused throughout the re-exposure to the footshock box.

Autonomic balance in conditioned fear to a context versus home box - orexin microinjections

Behavioural and physiological responses following microinjection of orexin-A in the CeA were compared within subjects, between re-exposure to the footshock box and the home box (Fig. 4.12). Only the physiological and behavioural responses accompanying the maximum freezing responses for each subject were analysed (n = 9).

Activity was significantly greater in the home box versus the footshock box (F(1, 8) = 47.7, p < 0.0001). Heart rate was significantly lower over the 30 min following microinjection of orexin- A when rats were re-exposed to the footshock box relative to the immediate return to their home boxes (F(1, 8) =160.6, p < 0.0001; Fig. 4.12). There was no difference in MAP over the whole 30 min period after re-exposure (p > 0.3); however, MAP was relatively elevated in the fear versus homebox group during the first 10 min after injection (F(1, 7) = 6.4, p < 0.05), despite exhibiting significantly lower Activity (F(1, 8) = 53.6, p < 0.0001) and lower HR (95% CI [- 33.1, 6.9]) during this period.

142

Figure 4.11 Average heart rate (HR), mean arterial pressure (MAP), locomotor activity (Activity) and freezing and time spent immobile, in response to bilateral injection of saline, where at least one injection site was in the CeA (sites indicated in Fig. 4.6) prior to either immediate return to homebox (white circles) or re-exposure to footshock box (black circles). Values are mean ± SEM. 143

Figure 4.12 Average heart rate (HR), mean arterial pressure (MAP), locomotor activity (Activity) and freezing and time spent immobile, in response to bilateral injection of orexin, where at least one injection site was in the CeA (sites indicated in Fig. 4.6) prior to either immediate return to homebox (white circles) or re-exposure to footshock box (black circles). Values are mean ± SEM.

144

4.5 Discussion

Microinjection of orexin-A in the CeA before re-exposure did not potentiate conditioned fear responses, suggesting that activation of the CeM does not contribute to conditioned responses in long-duration re-exposure to a feared context. In fact, in both categories (bilateral and bilateral + unilateral), microinjection of orexin-A in the CeA was associated with an attenuated freezing response (Figs. 4.2, 4.6) during conditioned fear, and increased activity and HR during the recovery period. Additionally, in the second (bilateral + unilateral) category (Figs. 4.6 - 4.10), orexin-A was associated with increased HR and Activity during conditioned fear. However, these differences were mainly due to differences between the Sal2 and Orx2 group (Figs. 4.3, 4.8).

An unexpected finding of the present study was an apparent interaction between order of re- exposure and drug effects. Orexin-A administered before the second re-exposure (Orx2) (Figs. 4.3, 4.8) was associated with less freezing and enhanced heart rate and activity This group exhibited significantly less freezing than all other groups (p < 0.01), the extent of which may have been impaired by a ceiling effect. However, no differences in any parameters (apart from within-trial reductions in freezing in Sal1) were found between Orx1 and Sal1. We suggest two general interpretations of the results of this study.

The first interpretation is that the lower levels of freezing in the treatment groups is due to a direct excitatory effect of orexin-A on CeM neurons during re-exposure, and thus reduce the expression of freezing behaviour and conditioned fear responses generally. This could occur via increasing the activity of GABAergic VLPAG-projecting CeM neurons, thus increasing GABA release in the VLPAG, which would reduce freezing (Walker and Carrive, 2003). Additionally, orexin may have increased the activity of the dense (Dong et al., 2001a), GABAergic (Li et al., 2012; Myers et al., 2013) CeM projection to the BNST, which mediates long-duration conditioned fear responses (Davis et al., 2010; Jennings et al., 2013; Walker et al., 2009). Activation of this CeM-BNST projection could inhibit tonically active neurons in structures such as the oval nucleus, which the CeM strongly projects to (Dong et al., 2001a). This could decrease the expression of fear responses (Kim et al., 2013; Li et al., 2012) by disinhibiting (activating) GABAergic (Kudo et al., 2012; Myers et al., 2013; Poulin et al., 2009) brainstem and hypothalamic projections from other parts of the BNST, culminating in decreased expression of behavioural and physiological correlates of fear (Jennings et al., 2013; Kim et al., 2013).

Consistent with our hypothesis that CeM neurons are inhibited during long-duration re-exposure to a feared context, orexin-A had no effect on behavioural or cardiovascular responses when

145

levels of fear were near-maximal (first re-exposure), possibly because of enhanced putative GABAergic inhibition of the CeM. However, when levels of fear were reduced (second re- exposure), when GABAergic input to the CeM would presumably have been lower, these CeM neurons may have been labile to the effects of orexin, which resulted in decreased freezing. However, this interpretation does not account for the enhanced levels of freezing in the Sal2 group, nor does it account for the lack of within-trial extinction in the treatment groups in the bilateral category.

The second interpretation is that the effects of orexin were mainly mnemonic; specifically, it prevented extinction and/or may have enhanced the reconsolidation of conditioned fear memories.

Finally, since orexin failed to potentiate conditioned responses and instead either had no effect, or impaired them, these results argue against the notion that activation of CeM neurons promotes conditioned fear responses in sustained, contextually-conditioned fear. These results also suggest that orexinergic projections to the CeA do not enhance the recall or expression of conditioned fear responses, and that the deficits in amygdala activation (Ponz et al., 2010) to fear-conditioned stimuli in patients with narcolepsy and cataplexy may instead be due to impaired consolidation or acquisition.

4.5.1 Methodological considerations

It is possible that the putative mnemonic effect of orexin in the present study may have been due to the dorsal spread of the drug into the basal nucleus of Meynert/Substantia innominata. This would activate local cholinergic neurons (Arrigoni et al., 2010; Fadel and Burk, 2010), which project to the hippocampus (Amaral and Cowan, 1980). Interestingly, consolidation of contextual fear memories is dependent on muscarinic receptor activation in the hippocampus (Chang and Liang, 2012).

One possibile explanation of why orexin did not facilitate conditioned fear responses, especially in the Orx1 group, may be that the dose was too low to activate CeM neurons. However, this dose was sufficient to significantly increase activity, HR and MAP when the animals returned to their homecages, which provided a positive control, and the same dose (30 pmol) injected in the CeA strongly increased all of these responses in freely moving rats (Chapter 3). Further, if CeM neurons were disinhibited by long-duration re-exposure to a CS, similar to what occurs after a short-duration CS (Ciocchi et al., 2010; Duvarci et al., 2011; Haubensak et al., 2010; Li et al., 2013), it would be expected that CeM neurons would be more labile to the effects of orexin during re-exposure than in rest. This notion is consistent with the state-dependent effects of vasopressin in the CeA, which increased activity and induced a minor bradycardia in freely 146

moving rats, but clearly enhanced bradycardia and freezing in response to a short-duration CS, during which CeM neurons would presumably have been disinhibited (activated), and thus more responsive to the excitatory action of vasopressin (Roozendaal et al., 1993b, 1992b). Since the state-dependent effect that occurred were opposite to that previously reported (Roozendaal et al., 1993b, 1992b) - that is, orexin-A had little or no effect on cardiovascular or behavioural responses during re-exposure, especially when levels of fear were higher (Orx1), but had a strong effect at rest, this seems to suggest that CeM neurons may be under greater tonic inhibition during long-duration contextual fear than at rest or recovery.

Whilst it remains a possibility, it seems unlikely that the effects of orexin-A were due to feed- forward inhibition of the CeM due to activation of the CeL or CeC, since the CeM appears to contain a much greater density of orexin fibres and receptors than other divisions of the CeA (Figs. 1.4, 1.5; Baldo, Daniel, Berridge, & Kelley, 2003; Fadel & Deutch, 2002) but see (Cluderay et al., 2002; Schmitt et al., 2012). Another unlikely, but possible explanation is that orexin may have directly inhibited EPSPs onto CeM neurons, a mechanism found to occur in the VLPAG and BNST (Conrad et al., 2012; Ho et al., 2011). This may have produced a net inhibitory effect on CeM neurons if GABAergic drive onto CeM neurons was withdrawn, as occurs in conditioned fear to a phasic CS (Ciocchi et al., 2010; Haubensak et al., 2010).

Whilst this seems unlikely given the robust excitatory effect in vitro, the results of the present study, chapter 3 and (Avolio et al., 2011) showed that activation of the CeM reduces freezing and increases activity, the opposite of what would be predicted from other work (Ciocchi et al., 2010; Duvarci et al., 2011; Nobre and Brandão, 2011). Furthermore, orexin injected in the CeA decreased time spent in the open arms of the elevated plus maze (Avolio et al., 2011), however, CeM activity increases when the rat is in the closed, rather than open arms of the EPM (Thomas et al., 2013), and disinhibition of the CeA, which would presumably activate CeM neurons, increases open arm time and entries (Zarrindast et al., 2008). At face value, these results appear to be the opposite of what may be expected by activation of the CeM. Further electrophysiological work in vivo may be needed to address this question.

4.5.2 Interpretation 1: Activation of CeM neurons by orexin may have a direct inhibitory effect on conditioned fear responses

Orexin may have had a direct inhibitory effect on conditioned fear responses to sustained re- exposure to a feared context. Orexin was associated with less freezing and reduced bradycardia, resulting in increased HR. However, importantly, this difference was only seen in the second re- exposure - perhaps due to lower levels of fear (in the present case, due to following an extinction session), which may have resulted in reduced GABAergic input to CeM neurons from the BNST or elsewhere, making CeM neurons more labile to activation by orexin. 147

Since orexin has been shown to strongly activate CeM neurons in vitro (Bisetti et al., 2006; Huber et al., 2005; Lu et al., 1997; Veinante and Freund-Mercier, 1997), one interpretation of these results may be that increased activation of the CeM in the Orx2 group may reduce conditioned fear responses. This is consistent with the hypothesis that activation of the CeM may in some cases be inversely associated with conditioned and unconditioned aversive responses (Chieng and Christie, 2010; Dayas and Day, 2002; Gilpin and Roberto, 2012; Li et al., 2012; Martinez et al., 2013; Pascoe and Kapp, 1985; Savonenko et al., 1999).

Increased CeM activity could also reduce conditioned fear responses by enhancing GABA release in the BNST. This could impair long-duration fear responses, since these are mediated by the BNST (González-Pardo et al., 2012; Luyten et al., 2012, 2011; Sullivan et al., 2004; Walker and Davis, 1997; Zimmerman and Maren, 2011) whilst the CeM is either not involved (Davis et al., 2010; Luyten et al., 2012; Walker and Davis, 1997; Walker et al., 2009; Zimmerman and Maren, 2011) or is inhibited by the BNST during re-exposure to a sustained CS (Davis et al., 2010; Walker et al., 2009). Indeed, inhibition of the BNST potentiates conditioned fear responses to a short duration CS - possibly by reduction of GABAergic input to the CeM - but attenuates conditioned fear responses to long duration CS’s (Davis et al., 2010; Meloni et al., 2006; Walker et al., 2009; Zimmerman and Maren, 2011).

The BNST is anatomically positioned to induce freezing due to its dense projections to the VTA and VLPAG (Beitz, 1982; Dong and Swanson, 2003, 2006b, 2004; Gray and Magnuson, 1992; Olsen, 2007). Inhibition of GABAergic VTA-projecting neurons, and activation of glutamatergic VTA-projecting neurons has been shown to occur in the BNST during contextual fear, and this may partly mediate the freezing response (Barrot et al., 2012; Jennings et al., 2013). Most or all of these BNST-VTA projecting neurons probably send collaterals to the VLPAG, as the same, singular fibre bundle which projects to the VTA continues through a lateral to medial arch to densely innervate VLPAG (Holstege et al., 1985). Further, the same parts of the BNST which project to the VTA also project to the VLPAG (Dong and Swanson, 2003, 2006b, 2004). This may reflect a general mechanism of the activity in brainstem- projecting neurons in the extended amygdala during contextual fear - that is, inhibition of GABAergic neurons and activation of glutamatergic neurons (Chapter 2).

The BNST may also directly inhibit the CeM through its vast projections which selectively project to the medial the CeA, and avoid the lateral and capsular divisions (Dong et al., 2001; Dong & Swanson, 2004a, 2004b, 2006a, 2006b; Dong et al., 2000; Dong & Swanson, 2006). Further, most of these projections are probably GABAergic (Kudo et al., 2012; Poulin et al., 2009). Activation of this GABAergic BNST-CeA pathway may even increase conditioned fear responses to a fear-conditioned context. Indeed, reduction in the tonic activity of CeM neurons 148

is significantly associated with fear generalisation (Ciocchi et al., 2010), and non-significantly associated with increased freezing. It is conceivable that these same processes may be enhanced in foreground contextual conditioning. Further, we previously found that only 0.6% of VLPAG- projecting CeM neurons expressed Fos after 40 min of re-exposure to a fear-conditioned context (Chapter 2).

Conversely, activation of the CeM by orexin may inhibit neurons in the BNST through its dense, reciprocal projection (Dong et al., 2001a) which are GABAergic (Li et al., 2012; Myers et al., 2013; Poulin et al., 2008), which may explain the attenuating effects of orexin on conditioned fear responses in the present study. This dense, reciprocal GABAergic projection between the BNST and CeA may also represent a ‘flip-flop’ switch.

The only study that we are aware of which selectively manipulated CeM activity during contextual fear was by Roozendaal et al., (1992). This report showed that injection of vasopressin in the CeA - which selectively activates CeM neurons (Huber et al., 2005; Lu et al., 1997; Veinante and Freund-Mercier, 1997), including all of those activated by orexin (Bisetti et al., 2006) - increased freezing behaviour and bradycardia during short duration (5 min) conditioned fear to context - although these parameters were only recorded between 2 - 4 min. One interpretation of these findings in conjunction with the findings of the present study is that activation of the CeM only occurs during short duration conditioned stimuli, and is not changed or possibly reduced in long-durtation re-exposure. Interestingly, inactivation of the BNST strongly enhances fear-potentiated startle for the first 4 min of a long-duration conditioned stimulus, but strongly inhibits it between 5 and 8 min (Davis et al., 2010), suggesting that the conditioned responses during the first 5 min of a CS may be mediated by the CeM, but that the BNST mediates responses after this period. However in the present study, orexin-A did not potentiate freezing relative to saline at any time point. Perhaps this was because long-duration exposure was expected due to previous training, whilst short duration exposure was expected in the report by Roozendaal and colleagues.

The results of the present study are consistent with the hypothesis that activation of the CeM may have attenuated freezing in long-duration conditioned fear. Since VLPAG-projecting CeM neurons are almost all (92%) GABAergic (Chapter 2), it is possible that activation of these projections increased GABA release in the VLPAG, which could reduce freezing by increasing GABA release onto VLPAG output neurons (Morgan and Whitney, 2000; Morgan et al., 1998; Vianna et al., 2008; Walker and Carrive, 2003), consistent with some evidence that CeA axons synapse directly onto glutamatergic output neurons in the PAG (Oka et al., 2008).

149

Assuming that the primary mechanism of action of orexin in the present study was activation of the CeM, this raises the question of how increased CeM activity is associated with conditioned fear response in short-duration, discrete cue-conditioned fear (Ciocchi et al., 2010; Duvarci et al., 2011), but may impair conditioned fear responses in long-duration, contextually conditioned fear? This will be addressed in the general discussion (chapter 6).

Finally, the main problem with this interpretation is that it does not account for the apparent increase in freezing in the Sal2 group, or the lack of within-trial extinction in the treatment groups in the bilateral category.

4.5.3 Interpretation 2: Orexin-A injection in the CeA may have impaired extinction or enchanced reconsolidation

Freezing was enhanced in the Sal2 group relative to the Orx1 group in the bilateral category (p < 0.05). Similarly, freezing was non-significantly enhanced in Sal2 relative to Sal1 in the bilateral category (p = 0.077) however the difference may have been impeded by a ceiling effect occurring in Sal2. This apparent increase in freezing in Sal2 was unusual, as we normally observe a decrease in freezing after the first trial.

Unfortunately, due to the aims of the study and its subsequent design, we did not include a group injected with saline in both re-exposure groups to determine the rate of extinction between trials. However, interestingly, there was a complete absence of within-trial decline in the rate of freezing in the treatment groups in the bilateral condition, whilst controls displayed a significant decline. These effects were dependent on bilateral administration of orexin, as the Orx1 group in the unilateral + bilateral category showed within-trial decline in freezing - though less than the control group.

Whilst speculative, an inhibitory or potentiating effect of orexin on extinction and reconsolidation respectively is consistent with the mnemonic effects of orexin (see below) and may provide a good account of the present findings.

4.5.4 Extinction

Orexin may have inhibited extinction through an excitatory action on CeM neurons. This notion is consistent with an inter-trial potentiation of the freezing response rather than extinction after injection of orexin in the first re-exposure (i.e. Sal2 > Orx1) relative to the decline after the first re-exposure in rats given saline.

This hypothesis is congruent with the neural mechanisms of extinction and of orexin in the amygdala. Extinction is mediated by the inhibition of CeM neurons (Amano et al., 2010;

150

Berretta et al., 2005; Likhtik et al., 2008; Paré et al., 2004; Quirk and Mueller, 2007; Sotres- Bayon and Quirk, 2010; Vidal-Gonzalez et al., 2006), and reduced extinction is associated with greater activation of the CeM (Knapska and Maren, 2009; Muigg et al., 2008). Since orexin has a potent excitatory effect on CeM neurons (Bisetti et al., 2006; Johnson et al., 2012a), it would be expected that it would prevent extinction, consistent with the lack of within- and between- trial extinction after intra CeA injection of orexin-A that was noted in the present study.

Interestingly, orexin in the BNST has been shown to inhibit extinction of conditioned place preference for cocaine (Conrad et al., 2012). Finally, systemic or i.c.v. injections of vasopressin - which activates the same neurons in the CeM as orexin (Bisetti et al., 2006) - also markedly impairs and delays fear extinction or enhances consolidation (Baranowska et al., 1983; Bohus et al., 1978; Kovács and Wied, 1994).

4.5.5 Brief review of reconsolidation

An effect on reconsolidation is also consistent with the known mnemonic effects of orexin (see below) and may explain the enhanced freezing response in Sal2 relative to Sal1 (p = 0.077).

Re-exposure to a CS alone is thought to trigger one of either two dissociable plasticity processes: one which maintains or strengthens the original fear memory (reconsolidation) and one which strengthens the extinction memory (Duvarci and Nader, 2004; Eisenberg and Dudai, 2004; Eisenberg, 2003; Lee et al., 2006; McKenzie and Eichenbaum, 2011; Pedreira and Maldonado, 2003; Tronson et al., 2006) - although both may occur in some instances (Duvarci et al., 2006; Pérez-Cuesta and Maldonado, 2009). Interestingly, enhancing reconsolidation can potentiate conditioned responses to a greater level relative to the first re-exposure to a CS alone (Tronson et al., 2006). Reconsolidation and consolidation are mediated by many overlapping mechanisms (Besnard et al., 2012) and have been argued to be the same process (McKenzie and Eichenbaum, 2011).

Reconsolidation of aversive, appetitive and non-emotional memories is sensitive to systemic or intra-amygdala beta-adrenergic blockade (Dębiec and Ledoux, 2004; Dębiec et al., 2011; Diergaarde et al., 2006; Milton et al., 2008; Przybyslawski et al., 1999), is time sensitive and can be enhanced by a variety of drugs that seem to increase arousal (Besnard et al., 2012).

4.5.6 Evidence of orexin as a critical mediator of consolidation and reconsolidation

Orexin may be a critical molecule in the (re)consolidation of fear memories. This notion is supported by evidence demonstrating that patients with narcolepsy - who have vastly fewer orexin neurons and less orexin expression (Mignot et al., 2002; Peyron et al., 2000; Thannickal 151

et al., 2000) do not display increased amygdaloid cerebral blood flow in response to presentation of a conditioned stimulus (Ponz et al., 2010). This may be due to impaired acquisition or consolidation, which may be dependent on orexin. This is quite likely, as orexin has been shown to strongly enhance the consolidation of fear learning. Post-training i.c.v. injections of orexin potently improved memory of active and passive avoidance responses to footshock (Jaeger et al., 2002; Telegdy and Adamik, 2002). This may be partly mediated by the hippocampus, as blocking ORX1R in the dentate gyrus impaired acquisition and consolidation of passive avoidance memory (Akbari et al., 2008). Similarly, disinhibition of the PeF/DMH, which contains many orexin neurons, strongly enhances acquisition of avoidance responses, the recall of fear memories and inhibit extinction and/or potentiate reconsolidation (Johnson et al., 2012a). Other studies have shown that orexin increases acquisition and consolidation of spatial learning (Akbari et al., 2007, 2006; Sil’kis, 2012) and improves performance on various memory tests (Deadwyler et al., 2007; Mair and Hembrook, 2008); but see (Aou et al., 2003; Dietrich and Jenck, 2010).

Interestingly, orexin mediates changes in hippocampal theta rhythm in response to footshock through the septohippocampal pathway (Hsiao et al., 2013, 2012; Wu et al., 2002b), and hippocampal theta may be necessary for contextual fear consolidation (Bissiere et al., 2011). Further, injection of cholinergic antagonists in the hippocampus shortly after conditioning impairs consolidation of contextual fear memories (Chang and Liang, 2012), thus orexin may mediate consolidation of this form of fear memory through its central role in the engagement of the septohippocampal pathway. Finally, orexin is well known to mediates the learning associated with conditioned place preference to addictive drugs (Aston-Jones et al., 2010; Harris et al., 2007).

Seen through the lens of memory and consolidation, it may not be surprising that the activity of orexin neurons is greatest during exploration of novel environments, emotionally valenced stimuli such as reward and footshock, and social interaction, as these all demand new learning and memory.

Finally, it is interesting to consider that footshock activates many orexin neurons (Zhu et al., 2002) - possibly around half of them (Winsky-Sommerer et al., 2004), whilst exposure to a context previously paired with footshock recruits far fewer orexin neurons (respectively 26%; 21%; or ~ 0%) (Furlong, 2006; Luong, 2012; Zhu et al., 2002). This difference may reflect a greater recruitment of orexin neurons during the original consolidation of the fear memory, which represents greater learning and would presumably demand more plasticity resources than during reconsolidation or extinction occurring after presentation of the CS alone. It is conceivable that it is the mnemonic consolidation occuring after footshock which induces 152

activation of orexin neurons, as rats which continually received footshock until they were sacrificed displayed very few orexin neurons containing Fos immunoreactivity (McGregor et al., 2011) and pain suppresses orexin neurons (Blouin et al., 2013). These authors (Blouin et al., 2013; McGregor et al., 2011) suggested that Fos expression in orexin neurons after footshock or conditioned fear may be due to increased grooming and locomotor activity after conditioning, however these neurons may also be recruited to enhance (re)consolidation.

4.5.7 Where is the memory trace?

We will return shortly to potential mechanisms through which orexin may affect reconsolidation. But first, a broader question arises, namely ‘where is the location of the fear memory trace?’. There is broad consensus about the general model - that temporally proximal signals relaying the CS and US converge within the amygdala, and this is associated with strengthened synaptic connections - from the source relaying the CS (e.g. auditory thalamus and cortex or hippocampus) to the basolateral complex, and from ‘fear’ neurons in the basolateral complex to the CeA (Davis, 2000; LeDoux, 2000; Pape and Pare, 2010; Paré et al., 2004). Synaptic pathways potentiated by fear conditioning from the basolateral complex to the CeA may be direct - for example from the LA to the CeL (Li et al., 2013) - or indirect - via the basal nuclei (BLA and BMA), or a series of GABAergic intercalated cells (Amano et al., 2011; Ciocchi et al., 2010; Ehrlich et al., 2009; Paré and Smith, 1993). The precise mechanisms underlying which pathways are potentiated and under what conditions may be far off, due to the inherent complexity of the amygdala, potentially involving many synapses and cells competing for dominance via mutual GABAergic inhibition. In any case, extensive evidence supports the provisional consensus that the best answer to the broader question of where the fear trace, engram or plastic changes induced by conditioned fear are located, are the synapses between the neural substrates encoding the CS (e.g. the hippocampus), through the basolateral complex, and up to and including the CeL. This will be discussed below.

4.5.8 Plastic changes in the BLA and CeA are necessary for fear acquisition and consolidation to both contextual and discrete cues

Within the amygdala, the location of fear memory traces to contextual versus discrete cues appears to be broadly similar, and overlapping (Goosens and Maren, 2003, 2001) but with subtle differences - for example the basolateral nucleus may be more involved in learning conditioned fear to contextual rather than discrete cues, whereas the lateral nucleus may be preferentially involved in learning to associate footshocks with discrete cues (Calandreau et al., 2005).

153

In fear conditioning to discrete cues, extensive evidence shows that the CeA is involved in associative plasticity in the conditioning (learning) process and encoding of the fear memory trace, alongside the established role of the BLA (C. D. Applegate et al., 1982; Ciocchi et al., 2010; Duvarci et al., 2011; Ehrlich et al., 2009; Goosens and Maren, 2003; Haubensak et al., 2010; Li et al., 2013; Ono et al., 1995; Paré et al., 2004; Pascoe and Kapp, 1985; Pitts and Takahashi, 2011; Pitts et al., 2009; Rorick-Kehn and Steinmetz, 2005; Rosenkranz et al., 2006; Samson and Paré, 2005; Wilensky et al., 2006). The role of the CeA in associative plasticity was most clearly demonstrated by a study where protein synthesis in the CeA was inhibited prior to conditioning to a discrete CS strongly attenuated subsequent fear memory (Wilensky et al., 2006). To the best of our knowledge, this technique has not been replicated using contextual fear cues. However, infusion of the selective NMDA receptor antagonist APV into the CeA prior to contextual conditioning strongly attenuated subsequent fear memories (Goosens and Maren, 2003). This provides additional strong evidence that the CeA is involved in the acquisition or encoding of contextual CS’s. Interestingly, some evidence suggests that plastic changes in the CeA due to fear learning may only occur in the CeL and CeC but not CeM neurons. Preliminary evidence indicating this comes from (Ciocchi et al., 2010), who showed that muscimol microinjected discretely in the CeL or throughout the CeA, attenuated acquisition of fear learning; however, injections restricted to the CeM had no effect on subsequent freezing during recall. This suggests that plasticity in synapses in the CeM may not necessary for fear learning. Further, it suggests the possibility that plastic changes to dendrites of CeM neurons may not occur during acquisition (and possibly consolidation) of fear memories. On the other hand, another study showed that electrical stimulation of thalamic axons projecting to the CeM led to LTP, which was found to occur exclusively presynaptically (Samson and Paré, 2005) through a direct pathway. To the best of our knowledge, no study has shown that acquisition or re(consolidation) of fear memories involves post-synaptic changes in the CeM.

Recent evidence shows that fear conditioning to a discrete CS is associated with experience- dependent presynaptic strengthening of LA-CeL synapses (Li et al., 2013). Interestingly, activation of the auditory thalamus (relaying CS information) did not drive CeL neurons, but did excite LA neurons, consistent with the notion that at least some of the physical changes in the brain subsequent to conditioning (the memory trace) are associated with strengthening synapses through a serial rather than parallel pathway from the basolateral complex to the CeA. Parallel (rather than solely BLA-CeA) pathways of CS and US convergence in the amygdala have also been put forward (Paré et al., 2004; Samson and Paré, 2005), in part due to anatomical evidence. For instance, both the BLA and CeA receive converging inputs capable of signalling the US and CS. Information signalling the nociceptive or aversive US is thought to enter the CeA from a dense, direct projection from the parabrachial nucleus (Bernard et al., 1993; Jhamandas et al., 154

1996; Krukoff et al., 1993; Sarhan et al., 2005) which mostly avoids the BLA, whereas the BLA receives input from the PBN relayed through the insula along with other input signalling the US from the thalamus (Shi and Davis, 1999; Wilensky et al., 2006). This information signalling the US can then additionally be relayed to the CeA in a series-like fashion. Information regarding a discrete CS can also be carried directly to the CeM via direct projections from the thalamus (Samson and Paré, 2005).

4.5.9 Similarities and differences in fear memory traces to contextual and discrete cues

In the case of contextual cues, input signalling the CS is stored in the hippocampus (Kim and Fanselow, 1992; Liu et al., 2012; Phillips and LeDoux, 1992; Ramirez et al., 2013a). These hippocampal projections preferentially target the basolateral complex (basomedial, basolateral and lateral nuclei) with lighter projections to the CeA (Canteras and Swanson, 1992; Kishi et al., 2006). Recent evidence clearly demonstrates that the discrete re-activation of a subpopulation of cells in the dentate gyrus activated by a context where animals were shocked (representing the contextual memory - the engram of the CS) (Liu et al., 2012; Ramirez et al., 2013a) is sufficient to drive freezing. Strikingly, neurons in the dentage gyrus that were initially activated whilst exploring a neutral, novel context were optogenetically re-activated during contextual conditioning in a different context. A subsequent re-activation of these neurons in a third context was sufficient to drive freezing. In other words, the activation of cells encoding a neutral context became a CS in itself, when paired with footshock (Ramirez et al., 2013a). Optogenetic re-activation of these hippocampal neurons triggered activation of neurons in the BLA and CeA - although the images of Fos immunoreactivity seemed to indicate that CeL and CeC rather than CeM cells were activated; see (Ramirez et al., 2013b). It is important to note that this engram in the hippocampus represents the contextual CS and does not represent the entire engram of the fear memory per se, as synaptic remodelling and strengthening of hippocampal input to the basolateral complex and possibly CeA through its connections (Canteras and Swanson, 1992; Kishi et al., 2006) and from the basolateral complex to the CeA, during acquisition and consolidation, is almost certainly required for fear memories to be encoded and subsequently expressed after evoking the CS.

These results are broadly consistent with the general model describing how conditioned fear to discrete cues is associated with plastic changes in the amygdala (Li et al., 2013; Paré et al., 2004). Namely, activation of synaptically potentiated pathways signalling the CS (from the hippocampus or thalamus/cortex for contextual and discrete cues respectively) reach the basolateral complex and then either directly, or via a series of potentiated synapses to and from GABAergic intercalated cells or the basomedial nuclei - activate (in the case of discrete cues),

155

via a potentiated pathway, the CeL, which disinhibits the CeM, leading to the expression of fear responses (Ciocchi et al., 2010; Ehrlich et al., 2009; Li et al., 2013; Tye et al., 2011). It is unknown whether contextual cues are associated with activation or inhibition of the CeM, or if the CeM is simply not involved in the expression of conditioned fear (see chapter 2). Either of these possibilities could be accounted for by this general model - for example an extra GABAergic relay could evoke inhibition of CeM.

To summarise, we propose a tentative hypothesis that fear memory traces to contextual and discrete cues are similarly organised in the brain insofar as learning involves potentiation of each synapse, from the brain structure encoding to the CS through to the basolateral complex and then to CeA (again, synapses directly from the CS substrate to the CeL may also be strengthened). We also propose that they differ in several important ways: i) that the engram of the CS is represented primarily in the hippocampus in the case of contextual cues, and in the thalamus and cortex in discrete cue conditioning (e.g. medial geniculate nucleus and auditory cortex in the case of auditory cues); ii) the involvement of specific subnuclei in the basolateral complex and CeA involved in fear learning of contextual versus discrete cues may differ - for example the lateral and basal nuclei may be differentially involved according to the discrete or contextual form of the cues (Calandreau et al., 2005); and iii) that, in accordance with the interpretation in chapter 2, the CeM may be inhibited or not be involved in re-exposure to a fear conditioned context , whereas it is activated and drives fear responses in response to a discrete CS (Ciocchi et al., 2010; Duvarci et al., 2011).

4.5.10 Orexin in the CeA may facilitate (re)consolidation through multiple mechanisms

There are several likely putative mechanisms through which orexin release in the CeA may enhance (re)consolidation and acquisition of fear memories, some of which are listed below.

i) Direct effect on synaptic plasticity in the CeA

Orexin release in the CeA may potentiate (re)consolidation through a direct, local effect on synaptic plasticity. Orexin has been shown to induce synaptic plasticity (LTP) in the hippocampus both directly (Akbari et al., 2007, 2006, 2011, 2008; Selbach et al., 2010, 2004; Wayner et al., 2004; Yang et al., 2013) and indirectly through other arousal systems (Walling et al., 2004; Wu et al., 2002b). Orexin has also been shown to mediate synaptic plasticity in the hypothalamus (Guo and Feng, 2012) and VTA (Borgland et al., 2006). These changes are mediated by multiple second messenger pathways such as phosphorylation of cyclic AMP response element binding protein (CREB) via protein kinase C activation (Guo and Feng, 2012; Yang et al., 2013), phospholipase C (Borgland et al., 2006) as well as those involving

156

extracellular signal-related kinases (ERK), mitogen activated protein (MAP) kinase, calmodulin dependent protein kinase (CaMKII), tyrosine kinases (Trk), phosphoinositide kinase (PI3K) and activation of protein kinase A (Selbach et al., 2010) - an enzyme which also mediates synaptic plasticity in the CeA (de Armentia and Sah, 2007).

As mentioned previously, extensive research indicates that the CeA (in particular the CeL) is an important site for synaptic plasticity in the acquisition and consolidation of fear learning (Ciocchi et al., 2010; Duvarci et al., 2011; Goosens and Maren, 2003, 2001; Li et al., 2013; Samson and Paré, 2005; Wilensky et al., 2006). However, this plasticity appears to resist interference by local injection of drugs targeting neurotransmitter systems, administered post- conditioning [but not pre-conditioning (Ciocchi et al., 2010; Goosens and Maren, 2003)], even though local injection of protein synthesis inhibitors in the CeA after conditioning attenuate consolidation (Wilensky et al., 2006). This is in contrast to the BLA, which mediates consolidation and is sensitive to local injections of neurotransmitters (such as noradrenalin and acetylcholine) or neuromodulators after conditioning (Da Cunha et al., 1999; McGaugh, 2000; McGaugh et al., 2002; Parent and McGaugh, 1994; Roozendaal and McGaugh, 1997; Roozendaal et al., 2007, 2002; Wilensky et al., 2006). Further, some research has found that drug injections in the CeA has a minimal (Bahar et al., 2004; Si et al., 2012; Wang et al., 2008) or limited (Chuang et al., 2012) capability to affect reconsolidation. It might be argued that if other neurotransmitters in the CeA are not appear capable of affecting consolidation, it is unlikely at face value that orexin would be capable of this. Furthermore, orexin fibres and receptors appear to be preferentially located in the CeM, yet so far only the CeL has been implicated in fear learning and memory, and the LTP that does occur in the CeM from thalamic inputs occurs exclusively presynaptically (Samson and Paré, 2005).

ii) Activation of CRF-containing and non-CRF-containing CeA neurons projections to other structures involved in consolidation.

It may be necessary to point out that the mechanism(s) through which orexin release in the CeA on fear memory acquisition or (re)consolidation need not be confined to a local effect, and may be secondary to activated projections to other structures involved in mnemonic plasticity.

Orexin release in the CeA may potentiate fear learning through activation of CRF-containing CeA neurons, which have been shown to be essential for consolidation of contextual fear memories (Pitts and Takahashi, 2011; Pitts et al., 2009). The authors proposed that this CRF- dependent consolidation process could be mediated by CRF-containing CeA projections to the BNST and other brainstem projections such as the locus coeruleus (Retson and Van Bockstaele, 2013; Reyes et al., 2011). This could activate noradrenergic cells in the LC, inducing

157

noradrenaline release in the BLA, which it densely innervates (Samuels and Szabadi, 2008). Crucially, noradrenaline release in the BLA has been shown to enhance consolidation (McGaugh, McIntyre, & Power, 2002) and reconsolidation of fear memories - and may even be necessary for it to occur (Dębiec and Ledoux, 2004; Dębiec et al., 2011; Milton et al., 2008).

Interestingly, i.c.v administration of orexin activates 45% of CRF neurons in the CeA (Sakamoto et al., 2004). These CRF-containing CeA neurons project to and activate noradrenergic cells in the LC (Bouret et al., 2003; Retson and Van Bockstaele, 2013; Valentino et al., 1983; Van Bockstaele et al., 1998), which promote reconsolidation through noradrenergic projections to the BLA (Dębiec and Ledoux, 2004; Dębiec et al., 2011; Milton et al., 2008). This suggests a possible mechanism through which orexin release in the CeA could enhance (re)consolidation. Orexin-activated CRF-containing CeA neurons could also contribute to consolidation through dense CRF-ergic projections to the BNST, where CRF has been shown to enhance consolidation of inhibitory avoidance memory (Liang et al., 2001).

iii) Feedback to orexin neurons

The CeACRF - LHORX projection may be functionally reciprocal, as orexin fibres make close appositions onto CRF neurons in the CeA (Laorden et al., 2012; Winsky-Sommerer et al., 2004) and orexin activates CRF and non CRF neurons in the CeA and CeM (Bisetti et al., 2006; Sakamoto et al., 2004); Conversely, orexin neurons are strongly depolarised by CRF (Winsky- Sommerer et al., 2004), which is found abundantly in the CeA (Chen et al., 2009; Retson and Van Bockstaele, 2013; Reyes et al., 2011). CeL and CeM neurons project densely to the orexin field (Yoshida et al., 2006) and synapse onto orexin neurons (Nakamura et al., 2009; Sakurai et al., 2005), and CRF neurons in the CeA are necessary for consolidation of contextual fear memories (Pitts and Takahashi, 2011; Pitts et al., 2009). Further, CRF knock-out mice exhibit strongly attenuated orexin neuron activation subsequent to footshock (Winsky-Sommerer et al., 2004). Thus, an additional candidate neural substrate which could mediate the putative effects of orexin in the CeA on fear memory consolidation may be orexin neurons themselves.

Activation of the orexin system is linked to enhanced memory acquisition and consolidation (Akbari et al., 2007, 2008; Jaeger et al., 2002; Soya et al., 2013; Telegdy and Adamik, 2002, 2002; Yang et al., 2013). This has been shown to occur through direct action on synaptic plasticity (see above), and by activating noradrenergic and cholinergic cell groups (Sears et al., 2013; Soya et al., 2013; Walling et al., 2004; Wu et al., 2002b)

One such system is the locus coeruleus, the brain structure receiving the most dense orexin fibre distribution in the brain (Hagan et al., 1999). Orexin activates noradrenergic cells in the LC (Hagan et al., 1999) and induce noradrenalin release (Walling et al., 2004). This facilitates 158

reconsolidation through noradrenalin release in the BLA (Dębiec and Ledoux, 2004; Dębiec et al., 2011; Milton et al., 2008). The hypothesis that orexin is necessary for normal fear acquisition and (re)consolidation has received strong support by two more recent studies which have shown that ORX1 receptors in the locus coeruleus are involved in the acquisition and consolidation of fear learning to both contextual and discrete cues (Sears et al., 2013; Soya et al., 2013). It has been demonstrated that mice lacking ORX1 receptors showed strongly attenuated fear learning to discrete and contextual cues (Soya et al., 2013). This study showed that Fos expression in noradrenergic LC neurons was similarly attenuated in conditioned fear. Furthermore, deficits in fear memory recall were suggested to be partly mediated by the strong reduction of activity in the amygdala due to impaired recruitment of LC neurons by orexin. These findings are consistent with human findings of deficient amygdala activation in fear acquisition and/or consolidation in patients suffering from nacolepsy with cataplexy (Khatami et al., 2007; Ponz et al., 2010). These findings point to a central role of orexin in fear memory acquisition and consolidation, and possibly reconsolidation.

If orexin release in the CeA leads to activation of orexin neurons, as suggested above and elsewhere (Bisetti et al., 2006; Sakamoto et al., 2004; Winsky-Sommerer et al., 2005), this could also enhance memory consolidation of the contextual CS, by mediating plasticity (LTP) in the hippocampus through direct (Akbari et al., 2011; Marcus et al., 2001; Peyron et al., 1998; Schmitt et al., 2012; Selbach et al., 2010; Wayner et al., 2004; Yang et al., 2013) and indirect pathways such as via the septohippocampal pathway (Wu et al., 2002b). Indeed, contextual fear memories are dependent on cholinergic activation (Chang and Liang, 2012) from the septohippocampal pathway. Furthermore, orexin has been shown to enhance hippocampal- dependent social memory (Yang et al., 2013). Another mechanism through which activation of orexin may enhance fear learning, is that orexin neurons activate cholinergic cells in the basal forebrain such as the basal nucleus of Meynert (Arrigoni et al., 2010; Fadel and Burk, 2010), which projects to the BLA, releasing acetylcholine which drives fear-memory formation (McGaugh et al., 2002). Thus, orexin neurons are anatomically positioned to co-ordinate (re)consolidation through projections to other neurotransmitter systems involved in the formation and maintenance of fear memories.

Finally, in the present study, pathways from CeA neurons to the LC, BNST and orexin field presumably remained activated long after re-exposure to the conditioned context, as the effect of orexin on CeM neurons seemed to be maintained for 40 - 60 min after return to homebox, consistent with our previous study (chapter 3). This can also be inferred through physiological parameters, as arousal, HR, MAP and activity were maintained at elevated levels for well over 30 min after return to the homebox (Figs. 4.2 - 4.10). Thus, increased recruitment of

159

noradrenergic and orexin systems may have occurred after conditioning, which could potentiate reconsolidation (Dębiec et al., 2011).

To summarise, we suggest that orexin in the CeA could enhance reconsolidation through three separate mechanisms: i) a local effect of orexin-A on synaptic plasticity in the CeA; ii) activation of CRF containing neurons in the CeA which are necessary for consolidation - possibly via the BNST, LC and cholinergic cells; and iii) activation of orexin neurons themselves, which have been clearly demonstrated to enhance fear memory acquisition and consolidation by direct projections to the hippocampus, and by orexinergic projections to the locus coeruleus.

4.5.11 Effect of arousal on consolidation

Interestingly, enhancement of consolidation of fear-memories by neurotransmitters that mediate heightened behavioural and autonomic arousal has been previously demonstrated, particularly by systemic or intra-amygdala administration of glucocorticoids, noradrenalin and CRF, whilst inhibition of acquisition and consolidation can be produced by agents which reduce arousal such as systemic antihistamines, morphine, and antagonists of glucocorticoid, CRF, cholinergic and beta-adrenergic systems (Chang and Liang, 2012; Dębiec and Ledoux, 2004; Dębiec et al., 2011; Good and Westbrook, 1995; Holbrook et al., 2010; Kolber et al., 2008; McGaugh, 2000; Nonaka et al., 2013; Pitts and Takahashi, 2011; Roozendaal et al., 2008; Vaiva et al., 2003, 2003). Further, agents which reduce autonomic and behavioural arousal such as morphine and propanalol administred shortly after trauma also lowers the chance of developing PTSD (Holbrook et al., 2010; Vaiva et al., 2003).

Interestingly, a strong predictor of subsequent development of PTSD is elevated heart rate shortly after the initial trauma (Blanchard et al., 2002; Bryant et al., 2004; Shalev et al., 1998; Zatzick et al., 2002). Since orexin injection in the CeA was associated with increased behavioural and autonomic arousal after return to homebox, and at rest (chapter 3), it is conceivable that some of the putative mnemonic effects of orexin in the present study were secondary to this effect on autonomic activity and arousal. Further, it might be speculated that the higher heart rate observed in patients that subsequently developed PTSD actually reflects a greater activation of orexin neurons, which mediates the increased HR induced by threatening stimuli (Furlong and Carrive, 2007; Iigaya et al., 2012; Johnson et al., 2012b; Kayaba et al., 2003; Luong, 2012; Shahid et al., 2012; Xiao et al., 2013), and that the increased release of orexin in the CeA and other parts of the extended amygdala and hippocampus may lead to over- consolidated fear memories leading to PTSD.

160

4.5.12 Locomotor and cardiovascular effects of orexin

The HR in all groups during re-exposure was lower than in rats receiving the same dose of orexin and returned immediately to their homecages (chapter 3), consistent with bradycardia induced by conditioned fear (Carrive, 2006; Iwata & LeDoux, 1988), whilst MAP was higher during conditioned fear than in the previous study, regardless of drug treatment. Further, whilst heart rate and activity varied between groups during re-expsosure in the present study, blood pressure was consistent. This suggests that MAP may be more tightly regulated during fear than HR, or with the notion that the CeM may not directly control blood pressure (Bohus et al., 1996; Viviani et al., 2011).

The Orx2 group showed increased heart rate and activity, but no change in MAP during the re- exposure. However, both treatment groups (Orx1 and Orx2) showed enhanced HR, MAP and activity after return to the home box. Similar to the freezing response, orexin per se did not seem to be associated with any cardiovascular or locomotor changes during re-exposure, as Orx1 displayed remarkably similar cardiovascular and locomotor activity to control groups. This contrasts to the return to homebox, and with the findings of chapter 3, where the same dose of orexin in the CeA had a pronounced effect on all recorded parameters.

The increase in HR and locomotor activity in Orx2 relative to Orx1 during re-exposure may have been due to a reduced memory of conditioned fear subsequent to extinction from the first re-exposure, as freezing was replaced by locomotor activity, which is itself associated with increased HR. Additionally, this may have been associated with CeA activity that was more labile to orexin, which tends to increase HR (chapter 3). Further, bradycardia normally covaries with freezing (Hermans et al., 2013; Morgan and Carrive, 2001; Roozendaal et al., 1993b). Thus, reduced freezing would be expected to be associated with higher HR.

4.5.13 The effects of orexin were state dependent

According to the first hypothesis we have presented, one explanation of why orexin-A had no effect on any paramaters in the Orx1 group (except an absence of within-trial extinction in the bilateral group) may be that CeM activity was already maximally inhibited due to activation of GABAergic inputs from the BNST or CeL (Ciocchi et al., 2010; Haubensak et al., 2010; Poulin et al., 2009; Walker et al., 2009) which may have impeded an excitatory effect of orexin-A. However, in the Orx2 group, the CeM may have been under less GABAergic inhibition than the Orx1 group due to previous extinction. This would allow orexin-A to activate CeM neurons, which then induced tachycardia and activity, which we found in the previous study (chapter 3). A similar withdrawal of GABAergic tone from the CeM may have occurred in the recovery phase, as the rat returned to a relaxed state. 161

4.5.14 Anxiolysis or active coping?

Finally, it is worth considering whether the injection of orexin in the CeA reduced anxiety or fear, or whether the reduction in freezing was due to an effect on locomotor activity.

It is possible that the reduction in freezing in the treatment group was due to being ‘out- competed’ by increased locomotor activity, which is robustly evoked by orexin injection in the CeA (chapter 3; (Avolio et al., 2011). Fear expression can manifest in passive responses such as freezing, or active responses such as avoidance, locomotor activity or ‘escape’ behaviour, and such a switch between these responses has been shown to exist in the CeA (Gozzi et al., 2010). This study showed that presentation of a CS triggered either freezing or locomotor activity, and this response was determined by the activity of a class of CeL. Thus, anxiety or fear may not have been affected, or may even have been enhanced by intra-CeA injection of orexin-A. Interestingly, increased anxiety in conjunction with increased locomotor activity is precisely what was observed after intra-CeA injection of orexin (Avolio et al., 2011). Anxiety was measured by performance on the elevated plus maze, wherein increases in locomotor activity and anxiety can both be observed without these factors interacting. This is not the case when the measured behaviour is freezing, since freezing necessarily precludes activity, and vice versa.

4.5.15 Autonomic balance in conditioned fear to a context

Previous research has demonstrated dual activation of both sympathetic and parasympathetic nervous systems during conditioned fear in rats (Carrive, 2006; Iwata and LeDoux, 1988; Nijsen et al., 1998; Pascoe and Kapp, 1985; Roozendaal et al., 1990). We showed that re-exposure to a feared context is associated with a net increase in heart rate relative to both baseline levels and relative to return to homebox following saline microinjections (Fig. 4.11). However, initial HR was not significantly greater in the fear group relative to the homebox group following orexin microinjections in the CeA (Fig. 4.12; p > 0.3) - possibly owing to enhanced sympathetic outflow and/or a conceivable withdrawal of vagal outflow accompanied with increased Activity associated with orexin microinjection in the CeA followed by return to homebox (chapter 3). The initial tachycardia in the fear/saline group is presumably driven by enhanced sympathetic outflow, consistent with the observation of strongly enhanced mean arterial pressure. These changes are clearly not secondary to Activity, since activity was significantly lower in the fear groups. Bradycardia could not be observed (though was almost certainly present) in the fear/saline group relative to the homebox /saline group - however this is probably partly due to a floor effect since animals returned to their home boxes only display an elevated HR for a few min, and partly due to the finding that most animals returning to rest in the homebox/saline within 15 min (Fig. 4.11). This interpretation is consistent with the observation that when HR

162

was elevated by orexin-A (Fig. 4.12), HR was > 50 bpm lower (95% CI [45, 60]) in the fear/orexin group than in the homebox/orexin group. This suggests an active, vagally-mediated bradycardia, consistent with previous reports (Carrive, 2006; Iwata and LeDoux, 1988; Nijsen et al., 1998; Pascoe and Kapp, 1985; Roozendaal et al., 1990). Lower HR in the fear/orexin group was not due to lower sympathetic tone, since MAP was equal to (and significantly greater in the first 10 min) the MAP found in the homebox/orexin group, despite (presumably) reduced cardiac output owing to lower HR, and despite lower Activity. Rather, these findings suggest that both the sympathetic and parasympathetic nervous systems were activated by conditioned fear.

Enhanced sympathetic tone appears to occur immediately after re-exposure to the footshock box relative to the home box, evidenced by enhanced initial MAP in both fear groups (Figs. 4.11, 4.12), and elevated initial HR in the fear/saline group (Fig. 4.11). Vagally-mediated bradycardia was only apparent, or identifiable after 4 min in the fear/orexin group (Fig. 4.12), however we strongly suspect that it was also immediately triggered by conditioned fear, but is masked by elevated sympathetic tone. This interpretation is consistent with previous findings from our laboratory (Carrive, 2006). Furthermore, both fear-conditioned bradycardia and freezing (which occurred immediately upon re-exposure; Figs. 4.11, 4.12) are under the control of the same structures - the VLPAG (Hermans et al., 2013; Walker and Carrive, 2003) and the CeA - especially the CeM (Applegate et al., 1982; Ciocchi et al., 2010; Healy and Peck, 1997; Kapp et al., 1982, 1979; Roozendaal et al., 1990; Viviani et al., 2011).

4.6 Conclusion

The present study, in conjunction with the previous (chapter 3) demonstrated that the behavioural and cardiovascular effects of orexin-A in the CeA are state dependent. The present study also demonstrated that orexin-A injection in the CeA did not increase freezing. Two hypotheses could account for these findings.

The first is that during long-duration exposure to a feared context, CeM neurons are inhibited, which may remove the BNST and VLPAG from GABAergic inhibition to induce freezing. According to this model, injection of orexin-A in the CeA, which activates CeM neurons, would be expected to reduce freezing by increasing GABA release in the VLPAG and BNST. This model accounts for the state- and drug-order dependent differences. Greater levels of fear result in more GABAergic inhibition of the CeM, which precluded an effect of orexin in the first re- exposure. When levels of fear were lower in the second re-exposure due to a previous extinction session or animals were at rest in their homecages (recovery or in chapter 3), CeM inhibition was reduced, thus an effect of orexin was apparent. However this model does not account for

163

the increased freezing in Sal2 or the impaired within-trial extinction in the treatment groups in the bilateral condition.

The second interpretation is that orexin prevented extinction and/or enhanced reconsolidation. This model accounts for: i) the lack of within-trial and inter-trial decline in the rate of freezing in rats injected bilaterally with orexin; ii) the observation that Sal2 displayed more freezing than any other group. This model is consistent with the excitatory effect of orexin-A on CeM neurons, which could inhibit extinction and emerging evidence of the role of orexin in memory consolidation, including fear memories.

It is possible that both of these putative mechanisms were responsible for the results in the present study, however, we suggest that the putative mnemonic effect of orexin is the more likely explanation of the findings, as the other explanation does not account for the absence of within-trial extinction in the treatment group or the increased freezing in Sal2.

Finally, the findings of the present study do not support the idea that activation of CeM neurons contributes to conditioned fear responses in long-duration, contextual fear. It is also possible that the orexinergic projection to the amygdala may be more critical in learning than in the expression of conditioned fear responses generally. The findings of the present study also suggest that the deficits in conditioned fear responses and amygdala activation in narcolepsy/cataplexy may be due to impaired acquisition or consolidation rather than retrieval and expression.

164

Chapter 5 Behavioural and physiological responses to microinjection of orexin-A in the VLPAG of conscious, freely moving rats

5.1 Introduction

The aim of this study was to investigate the behavioural and physiological consequences of bilateral microinjection of orexin-A in the caudal ventrolateral periaqueductal gray (VLPAG) in freely moving rats.

In the previous chapters (3 and 4) we demonstrated state-dependent behavioural and physiological changes subsequent to bilateral microinjection of orexin-A in the CeA. This treatment was found to induce strong and sustained elevation of HR, MAP, Activity and tail temperature when the animal was in its home box, consistent with increased activity found by another group after injecting orexin in the CeA (Avolio et al., 2011). However, we did not find that orexin increased anxiety or fear responses during re-exposure to a feared context, in contrast to a previous report in which rats were placed in the elevated plus maze (EPM) (Avolio et al., 2011) - although fear and anxiety responses to conditioned stimuli and the EPM are mediated by different neural systems, and lesions of the amygdala tend to have an anxiolytic rather than anxiogenic effect on EPM responses (Treit et al., 1993) - see chapter 2.

Previous research in our laboratory revealed that injection of the same dose (30 pmol) of orexin- A in the RVM in freely moving rats in their homecages evoked similar cardiovascular and behavioural responses to injection in the CeA - although locomotor activity was lower relative to the injection in the CeA (Luong and Carrive, 2012). This suggests the possibility that orexin may promote active coping behavioural and cardiovascular responses, and/or inhibit passive coping responses through its action at all levels of the descending CeM-VLPAG-RVM pathway in freely moving rats. This would be consistent with the generally uniform action of the orexin system at multiple sites throughout the central nervous system. The orexin system is recruited to mediate active coping responses (Kerman et al., 2007) such as defence, panic, engagement with the environment, exploration, locomotor activity, social interaction and reward-seeking (Blouin et al., 2013; Dias et al., 2009; Harris et al., 2007; Iigaya et al., 2012; Johnson et al., 2010; Kayaba et al., 2003; Kerman et al., 2007; Mileykovskiy et al., 2005; Torterolo et al., 2003; Wu et al., 2011; Zhang et al., 2006a), to promote increases in arousal, locomotor, stereotypic and explosive motor activity, muscle tone, sympathoexcitation, heart rate, blood pressure, stress- induced antinociception and thermogenesis, increased respiration and skeletal muscle vasodilation, learning and memory (Georgescu et al., 2003; Iigaya et al., 2012; Jaeger et al., 2002; Kotz et al., 2006; Lee et al., 2005; Luong, 2012; Nakamura et al., 2000; Nattie and Li, 2012; Samson et al., 2010, 1999; Zhang et al., 2010; Zheng et al., 2005). Further, levels of

165

orexin receptor expression in the prefrontal cortex is greater in dominant rats which display more active coping behaviours (Davis et al., 2009).

Conversely, the orexin system is suppressed during passive coping responses such as inescapable pain, sickness behaviour, sleep, social defeat and depression (Allard et al., 2004; Blouin et al., 2013; Brundin et al., 2007a; Grossberg et al., 2011; Lee et al., 2005; McGregor et al., 2011; Nocjar et al., 2012).

On the other hand, injection of orexin in a limited number of structures has been shown to induce passive coping responses. Orexin partly mediates freezing induced by conditioned fear (Chen et al., 2013), and immobility and freezing have been reported following injections of orexin into the paraventricular thalamus (PVT) (Li et al., 2010b, 2009), disinhibition of the PeF in conjunction with sodium lactate (a model of hypercapnic panic) is mediated by ORX1 receptors (Johnson et al., 2010). Interestingly, this panic model is associated with increased Fos expression in the VLPAG (Johnson et al., 2011). Further, cardioinhibitory and depressor effects of orexin have only been reported after low doses (< 5 pmol) injected in the nucleus ambiguus, which reduced HR (Ciriello and de Oliveira, 2003) and nucleus of the solitary tract (de Oliveira et al., 2003), which reduced both HR and MAP.

Activation of the VLPAG with excitatory amino acids (EAA’s) is thought to activate descending projections to the RVM (Morgan and Whitney, 2000; Vianna et al., 2008) to generate passive coping responses: immobility, bradycardia and antinociception (Bandler and Shipley, 1994; Bellgowan and Helmstetter, 1998; Depaulis et al., 1994; Hermans et al., 2013; Morgan and Carrive, 2001; Morgan et al., 1998, 2008; Walker and Carrive, 2003; Zhang et al., 1990) and in some cases hypotension (Vagg et al., 2008).

The VLPAG densely stains for orexin fibres and terminals (Date et al., 1999; Peyron et al., 1998) and approximately one quarter of all orexin neurons project to the VLPAG (Burgess et al., 2013). The VLPAG expresses both ORX1 and ORX2 receptors (Ho et al., 2011; Kaur et al., 2009; Marcus et al., 2001), and ORX2 receptors have been found to be expressed on GABAergic VLPAG neurons (Kaur et al., 2009), raising the possibility that orexin may activate inhibitory interneurons. These GABAergic neurons play an important role in the maintenance of arousal and preventing REM and non-REM sleep and may enhance attention and vigilance (Kaur et al., 2009), consistent with a role in active coping.

Conversely, orexin has been shown to activate VLPAG neurons via ORX1 receptors, including descending projections to the RVM (Ho et al., 2011), leading to descending antinociception (Azhdari Zarmehri et al., 2011; Ho et al., 2011). This is consistent with the alternative possibility that the release of orexin in the VLPAG may replicate the action of EAA’s in the 166

VLPAG, and lead to immobility and bradycardia, as well as contribute to the freezing, bradycardic and antinociceptive responses observed in conditioned fear.

Thus, there is evidence consistent with both facilitatory and inhibitory effects of orexin in the VLPAG on immobility and bradycardia. We sought to clarify this, and determine if injection of orexin-A in the VLPAG would evoke similar cardiovascular and behavioural responses to injection in the CeA or RVM. We hypothesised that orexin would have a consistent effect in the CeM-VLPAG-RVM pathway and the central nervous system generally, and promote the expression of active coping responses - in this case, increases in HR, MAP and locomotor activity.

5.2 Methods

5.2.1 Subjects

The subjects were 12 naive male Wistar rats (350 - 550 g) purchased from Monash Animal Services (Melbourne, Australia). The animals were housed in individual home boxes (65 × 40 × 22 cm) with ad libitum food and water. The room in which they were housed and tested was maintained at a constant temperature of 22 - 25 °C and kept on a normal 12:12 h light/dark cycle. All procedures were approved by the Animals Ethics Committee of the University of New South Wales and conformed to the rules and guidelines on animal experimentation in Australia.

5.2.2 Radio-telemetric probe implantation

Rats were first implanted with radio-telemetric probes (PA-C40, Data Sciences International, St. Paul, MN, USA) for recording of arterial pressure, heart rate, and locomotor activity. The surgery was performed in aseptic conditions under isoflurane anaesthesia. The rats were pretreated with the analgesic carprofen (Rimadyl, 5 mg/kg, s.c.) and received antibiotics (Benicillin, 0.3 ml, i.p.) at the end of the surgery. The probes were implanted in the peritoneal cavity, with the catheter sitting in the descending aorta at the level of the iliac bifurcation, as previously described (Carrive, 2000). During the recovery period (1 week), the animals were handled every day to habituate to the experimenter.

5.2.3 Guide cannulae implantation

the screws (3 mm, Plastics One, Roanoke, VA, USA). The screws were set with the screw head approximately 1 mm above the skull surface. Two more holes were drilled for the bilateral implantation of guide cannulae (26 G, Plastics One, Roanoke, VA, USA), which were implanted 1 mm above the target regions, aimed at the ventrolateral periaqueductal gray (VLPAG). The cannulae were fixed at angle of 20° to limit spread of the drug into the lateral PAG. Coordinates were AP + .6, ML + 2.85, DV - 5.7 mm relative to Lambda, ording to the stereotaxic atlas of Paxinos and Watson (2005). The guide cannulae were finally anchored to the screws with dental cement. Animals were allowed to recover for at least 1 week before testing began.

5.2.4 Drug and testing

Each site of injection was tested with two doses of orexin-A (3 pmol and 30 pmol, Tocris BioScience) and physiological saline (vehicle solution). The three injections were made in a counterbalanced order. Each animal was tested every second day. The procedure for the injection was as follows: Baseline recordings of HR, MAP, activity and TTail were taken for 30 min, during which the animal spent most of its time asleep. After this period, the animal was gently removed from its home box and restrained with a soft cloth wrapped around its body. An injection cannula (33 G, Plastics One), connected to a 5 µl Hamilton syringe, was inserted into the guide cannula and the injection was made. The volume was 0.4 µl and was injected over 30 s. The cannula was left in place for a further 30 s. The injection cannula was then removed and the animal returned to its home box where recording continued for a further 90 min. To minimize the number of rats and optimise the use of the telemetric probes, we used up to three sets of injection cannulae of different lengths (1.0 mm, 1.5 mm and 2 mm beyond the tip of guide cannula). This allowed testing of up to three sites per animal.

5.2.5 Infrared thermography

The surface temperature of the tail was recorded with an infrared digital thermographic camera (ThermaCAM P45, FLIR, Sweden) placed 1 m above the animal as previously described (Vianna et al., 2008). The home box lids were removed and replaced with 60 cm tall Plexiglas walls opened at the top to allow an unobstructed view of the animal for the camera.

5.2.6 Data collection and analysis

Up to 4 parameters were recorded simultaneously: heart rate (HR), mean arterial pressure (MAP), locomotor activity (Activity), surface temperatures of the tail (TTail). HR, MAP and activity were extracted automatically from the pulsatile blood pressure signal of the telemetric probes using the ART gold software (Data Sciences International). HR and MAP were sampled

168

continuously in 3 s time windows. Activity was a cumulated measure of body movements over a 1 min period. These values were then averaged over each minute. Infrared thermographic images were captured automatically every minute, starting 30 min before and ending 90 min after administration of the drugs. The thermal sensitivity of the camera is approximately 0.1 °C with a spatial resolution of 320 × 240 pixels. The emissivity factor was set at 0.98, which corresponds to the emissivity of the skin. The images were analysed with the FLIR Reporter 9.0 Professional software. The temperature value of the hottest pixel from each area of interest was extracted and recorded. Occasionally, depending on the posture of the animal, an area would be momentarily concealed and therefore not imaged.

5.2.7 Verification of cannula placement

5.2.8 Statistical analysis

Statistical analysis was performed with Prism 6 (GraphPad Software, Inc.). Data was first tested for normality with the D’Agnostino and Pearson omnibus normality test. Data that was normally distributed (HR, MAP) was analysed with a two-way repeated measure of analysis of variance (ANOVA) with Tukeys, Bonferroni, Holm-Sidak or Dunnets multiple comparisons tests. The independent factor was drug or saline, and the repeated factor was time, and occasionally both time and subjects (RM by both factors). Data that was not normally distributed (Activity) was analysed in two ways; firstly with two-way ANOVA with repeated measure as described above, and also by finding means for each subject and then testing for normality again. If this data was normally distributed, significance testing was carried out by one-way ANOVA (if three or more groups were analysed) or a paired or unpaired t-test as appropriate. If the mean data was still not normally distributed, significance testing was done by Kruskal-Wallis test for three or more groups, or the Mann-Whitney test for testing between two groups. The percentage of subjects displaying an activity score of zero per minute (three minute bins) was fitted to a standard curve (non-linear regression to a sigmoidal dose-response curve with variable hillslope; least sum of squares with outlier detection, Q = 1%). A sigmoidal dose- response curve was used since the percentage of inactive subjects versus time consistently appeared to conform to this shape. Furthermore, this curve was repeatedly statistically verified as the most robust fit according to an extra-sum-of-squares F test. Latency to rest was defined as the latency until 50% of subjects displayed an activity score of zero per minute (three minute 169

bins). Statistical significance was set at P ≤ 0.05. Unless stated otherwise, all comparisons were made between the 1st and 90th minute after animals were injected and returned to their home box.

5.3 Results

5.3.1 Histology

Pairs of injection sites were categorised according to their proximity to the VLPAG. Category one: consisted of pairs in which both sites were either within the VLPAG or within 0.5 mm ventral of it, that is, in the dorsal parts of the LDTg or DR (n = 11; Figs. 5.1 - 5.4). Category two: consisted of pairs in which at least one site of injection was centred within the VLPAG (n = 12; Figs. 5.5 - 5.8). Category 3: consisted of bilateral injections in the VLPAG, LDTg or DR, and sites with at least one injection in the VLPAG (n = 18; Figs 5.9 - 5.12). Category four: consisted of pairs of injection sites in which at least one site was located in the LPAG (n = 4; Figs. 5.13 - 5.16). Infrared thermography data was only available for a minority of rats in each group, as only rat could be imaged at any point in time.

5.3.2 Category one - Sites of injection bilaterally centred inside, or within 0.5 mm ventral of the VLPAG (n = 11)

Orexin-A injected bilaterally in the VLPAG or immediately ventral to the VLPAG (in the dorsal raphe (DR), laterodorsal tegmental nucleus (LDTGg), dorsal tegmental nucleus (DTgP) or ‘central gray’) was associated with behavioural response similar to that described previously (chapter 3) and consisted of running, grooming, exploratory behaviour, sniffing, eating and drinking that occurred at a greater frequency and intensity than rats injected with saline.

However in some of the subjects receiving orexin-A, and occasionally in those receiving saline, short duration periods of immobility occurred during the first 12 min, which lasted between 1 to 6 min with an accompanying bradycardia (- 100 to - 200 bpm, over 2-3 min) and only a slight reduction in MAP (about 3 mmHg), whilst tail temperature usually remained at lower temperatures for longer periods in rats experiencing immobility. The immobility did not resemble the freezing that accompanies conditioned fear responses, as there was no tense, crouched posture. Rats displaying this behaviour were standing, clearly alert and vigilant, with enhanced attentive responses (e.g. ears pinned back) to sound and movement of the experimenter, increased startle response and tachypnea. Unfortunately, immobility per se was not measured objectively, but could be observed directly and was verified by the absence of activity data at more time points in some rats in the treatment groups during the first 6 min, however differences between groups were not significant.

170

These periods of immobility were always interspersed with periods of quite vigorous locomotor activity and increased HR. Since the immobility and bradycardia occurred at different time points, and were interspersed with periods of increased activity and HR relative to control, the physiological and behavioural responses averaged across different subjects at each time point (Fig. 5.2) did not result in any changes in mean Activity or HR responses during the first 6 min.

Activity: High dose orexin-A (n = 11) was associated with greater Activity than both low dose (n = 10) and control (n = 10) groups. This approached significance according to a two-way ANOVA with RM (F(2,28) = 3.2, p = 0.057) and Dunnet’s post-test revealed a near-significant difference between high dose and control (p = 0.059). However, these differences were statistically significant when the first 2 min were excluded (F(2, 28) = 3.5, p = 0.044) and Dunnet’s test revealed a significant difference between high dose and control groups (p = 0.043).

HR: HR was significantly greater after injections of high dose orexin-A than low dose or saline (F(2, 28) = 4.6, p = 0.020) according to two-way ANOVA with RM. Tukey’s multiple comparison post-tests between groups revealed significant (p < 0.05) differences in HR between the high dose and other groups.

MAP: The pressor response was more prominent in the high dose group (mean = 111 mmHg; n = 11) than the low dose (107 mmHg; n = 9) and controls (106 mmHg; n = 10). The differences between high dose and saline groups during the first hour after return to homebox was not significant according to a two-way ANOVA with RM (F(1,19) = 3.3, p < 0.01).

Tail temperature: Low dose orexin-A (n = 5) was associated with a slightly warmer tail temperature than controls (n = 7) between 10 - 35 min, although this was not significant. High dose orexin-A (n = 9) was associated with a significantly warmer tail temperature than controls between 60 and 90 min post-injection (F(1, 14) = 8.1, p = 0.013; two-way ANOVA with RM).

171

Figure 5.1 Location of bilateral injection sites in the VLPAG or 0.5 mm ventral (Category 1). Distances in mm relative to Bregma.

172

Figure 5.2 Average heart rate (HR), mean arterial pressure (MAP), locomotor activity (Activity) and tail temperature responses to high dose orexin-A (30 pmol, black circles), low dose orexin-A (3 pmol, grey circles) and saline (white circles) injected bilaterally in, or within or 0.5 mm of the VLPAG (Category 1; sites indicated in Fig. 5.1). Values are mean ± SEM.

173

Figure 5.3 Mean percentage of subjects with an activity score of zero per minute (3 min bins) after drug injections placed bilaterally in, or within 0.5 mm of the VLPAG (sites indicated in Fig. 5.1; category 1).

Figure 5.4 Latency until 50% of subjects displayed an activity score of zero per minute (data interpolated from non-linear regression curves; Fig. 5.3). Values are mean ± 95% confidence intervals.

5.3.3 Category 2: Sites of injection in which at least one site was centred within the VLPAG (n = 12)

Activity: Mean Activity scores were 3.9 a.u., 3.2 a.u. and 2.1 a.u. after high dose (n = 12), low dose (n = 11) and saline (n = 11) injections respectively. Orexin-A was associated with a significant increase in Activity relative to controls (F(2, 31) = 5.55, p < 0.01) according to a two-way ANOVA, and Tukey's multiple comparisons test revealed a significant increase in Activity in the high dose group relative to the control group (p < 0.01).

HR: Mean HR was 368 bpm, 346 bpm and 337 bpm in the high dose, low dose and saline groups respectively. Orexin-A was associated with increased HR (F(2, 31) = 3.99, p = 0.029). Tukey's multiple comparisons test revealed a significant increase in Activity in the high dose group relative to the control group (p < 0.05).

MAP: Average MAP was 108 mmHg 104 mmHg and 103 mmHg for high dose, low dose and saline groups respectively. Orexin-A was associated with increased MAP (F(2, 31) = 3.74, p = 0.035) according to a two-way ANOVA with RM, and Holm-Sidak multiple comparisons test revealed a significantly higher MAP in the high dose relative to both low dose and control groups (p < 0.05). 174

Tail temperature: The differences between groups were not statistically significant over the course of the 90 min recording period (F(2,21) = 2.53, p = 0.10). However, the trace representing the high dose group diverged from the other traces at about 40 min after the return to homebox, and remained elevated for the remaining period of recording. The effect of orexin- A on temperature between this 40 - 90 min period was significant (F(2, 21) = 4.36, p = 0.026), and Dunnet’s post-test revealed that the tail temperature of the high dose group was significantly greater than low dose and controls (p < 0.05).

Figure 5.5 Locations of pairs of injection sites in which at least one site was located in the VLPAG (category 2). Empty circles represent complementary injection sites on the contralateral side of an injection in the VLPAG. Distances in mm from Bregma. 175

Figure 5.6 Average heart rate (HR), mean arterial pressure (MAP), locomotor activity (Activity) and tail temperature baselines and responses to high dose orexin-A (30 pmol, black circles), low dose orexin-A (3 pmol, grey circles) and saline (white circles) injected (at least on one side) in the VLPAG (Category 2; sites indicated in Fig. 5.5). Values are mean ± SEM.

176

Figure 5.7 Mean percentage of subjects with an activity score of zero per minute (3 minute bins) after drug injections placed bilaterally or unilaterally in the VLPAG (sites indicated in Fig. 5.5; category 2).

Figure 5.8 Latency until 50% of subjects displayed an activity score of zero per minute (data interpolated from non-linear regression curves; Fig. 5.7). Values are mean ± 95% confidence intervals.

5.3.4 Category 3: Injections bilaterally centred within the VLPAG/LDTg/DR, and sites of injection in with at least one site was centred in the VLPAG (n = 18)

Activity: There were significant differences in activity between groups (F(2, 48) = 5.2, p < 0.01) and Tukey’s post test revealed that the high dose group was significantly more active than the saline group (p < 0.01).

HR: Differences between groups were significant F(2, 48) = 8.7, p < 0.001) and Tukey’s post tests showed that the high dose group disaplyed a significantly greater HR relative to low dose (p < 0.05) and control (p < 0.001).

MAP: The differences between all groups was not significant (p = 0.10). However when two- way ANOVA compared the high dose with the control group, the effect was significant (F(1,33) = 4.4, p < 0.05).

Tail temperature: The high dose group exhibited significantly higher tail temperature than the other groups between 40 to 90 min (F(2,37) = 5.8, p < 0.01) and Tukey’s post tests showed that the tail temperature in the high dose group was significantly warmer than low dose (p < 0.05) and saline (p < 0.01).

177

Figure 5.9 Locations of injection sites which were bilaterally placed in the VLPAG, LDTg or DR or in which at least one injection was in the VLPAG (Category 3). Empty circles represent complementary injection sites on the contralateral side of an injection in the VLPAG.

178

Figure 5.10 Average heart rate (HR), mean arterial pressure (MAP), locomotor activity and tail temperature responses to high dose orexin-A (30 pmol, black circles), low dose orexin-A (3 pmol, grey circles) and saline (white circles) injected bilaterally in the VLPAG/ LDTg/DR area, or injected in the VLPAG on one side (Category 3; sites indicated in Fig. 5.9) Values are mean ± SEM. 179

Figure 5.11 Mean percentage of subjects with an activity score of zero per minute (3 minute bins) after drug injections placed bilaterally in the VLPAG/LDTg/DR area or injected within the VLPAG on one side (sites indicated in Fig. 5.9; category 3).

Figure 5.12 Latency until 50% of subjects displayed an activity score of zero per minute (data interpolated from sigmoidal non-linear regression curve, Fig. 5.11). Values are mean ± 95% confidence intervals.

5.3.5 Category 4: Sites of injection in which one site was located in the LPAG (n = 4)

Unilateral injections of high dose orexin-A in the LPAG were associated with strong and sustained increases in HR, MAP, Activity, tail temperature and latency to rest relative to controls (Fig. 5.14 - 5.16). Each of these effects were greater than those elicited by injections in or near the VLPAG.

Activity: Unilateral injection of orexin-A in the LPAG induced a strong increase in locomotor activity. Rats displayed vigorous grooming and locomotor activity, including running, which lasted approximately 1 hour. Mean Activity scores were 6.6, 3.0 and 2.6 in the high dose, low dose and saline groups respectively. There was a significant effect of injection of orexin-A on comparisons test revealed significant differences between the high dose group and both low dose and control groups.

HR: The increased activity seen in treatment groups was associated with an increased HR. Mean HR over the 90 min recording period was 418 bpm, 353 bpm and 342 bpm in the high dose, low dose and control groups, respectively. The effect of the drug was statistically

180

significant (F(2, 9) = 14.62, p = 0.0015) according to a two-way ANOVA with RM, and Tukey’s multiple comparisons tests revealed significant (p < 0.01) differences between high dose and control, and between high dose and low dose.

High dose orexin-A injected in the LPAG was also associated with a significantly enhanced HR (p < 0.01) relative to the same dose injected bilaterally into the VLPAG (F(1,6) = 9.96, p = 0.020). This was also true when high dose orexin-A was injected unilaterally (F(1,14) = 10.14, p = 0.0064) or within 0.5 mm of the CeA on both sides (F(1,13) = 8.67 p = 0.011).

MAP: The pressor response was significantly enhanced by injection of orexin-A in the LPAG (F(2, 9) = 5.18, p = 0.032; two-way ANOVA with RM) and Holm-Sidak post hoc tests revealed that the high dose group displayed significantly higher MAP than low dose and saline. Mean arterial pressure was 112 mmHg, 104 mmHg and 103 mmHg for high dose, low dose and control groups respectively.

Tail temperature: Greater temperature differences between the high dose group and controls occurred towards the end of the recording period, with the maximum difference (+ 4.5°C) occurring at 71 min. These differences in temperature were substantially greater than those observed after injections of orexin-A in the VLPAG (+2.7°C vs + 1.5°C). There was a significant effect of orexin-A injected in the LPAG on tail temperature between 20 - 90 min (F(2, 7) = 5.7, p = 0.034), and Holm-Sidak post-test found that both treatment groups exhibited significantly (p < 0.05) warmer tail temperature than saline during this period.

181

Figure 5.13 Locations of pairs of injection sites in which at least one site was located in the LPAG (Category 4). Empty circles represent complementary injection sites on the contralateral side of an injection in the LPAG.

182

Figure 5.14 Average heart rate (HR), mean arterial pressure (MAP), locomotor activity (Activity) and tail temperature baselines and responses to high dose orexin-A (30 pmol, black circles), low dose orexin-A (3 pmol, grey circles) and saline (white circles) where one site was in the LPAG (Category 4; sites indicated in Fig. 5.13). Values are mean ± SEM.

183

Figure 5.15 Mean percentage of subjects with an activity score of zero per minute (3 minute bins) after drug injections in the LPAG (sites indicated in Fig. 5.13; category 4).

Figure 5.16 Latency until 50% of subjects displayed an activity score of zero per minute (data interpolated from sigmoidal non-linear regression curve; Fig. 5.15.). Values are mean ± 95% confidence intervals.

5.4 Discussion

Injection of orexin-A bilaterally or unilaterally in the VLPAG was associated with moderate, statistically significant increases in HR, MAP, activity and tail temperature, as well as increased arousal and latency to rest. We also found that some cannula placements were in the LPAG. Injection of orexin-A at these sites was strongly and significantly associated with enhanced cardiovascular, locomotor, arousal and tail temperature responses, which (apart from tail temp.) have previously been found after LPAG stimulation (Bandler and Shipley, 1994; Nakai et al., 1997; Zhang et al., 1990).

These results support our hypothesis that orexin evokes a broadly consistent action at all levels of the CeA-PAG-RVM pathway. They are also consistent with an excitatory effect of orexin on GABAergic interneurons in the VLPAG, which express ORX2 receptors, and are thought to maintain arousal and vigilance (Kaur et al., 2009), important components of active coping.

Whilst immobility and bradycardia were occasionally observed in the first few minutes in the high dose group, these responses were not reliably evoked, were of short duration, were interspersed with periods of vigorous activity and were not significantly different to the control

184

group. In contrast, net increases in HR, MAP activity and tail temperature were reliably found in all rats receiving orexin relative to saline over the 90 min period.

5.4.1 The general effects of orexin in the CeM-VLPAG-RVM pathway are consistent with known functions of the orexin system

The results of this study, in conjunction with previous work (Luong and Carrive, 2012), reveal that orexin induces a similar pattern of behavioural and physiological responses at all levels of the descending CeM-VLPAG-RVM pathway, although the magnitude of these responses differs between structures. Activation of the CeM (Applegate et al., 1982; Bohus et al., 1996; Chieng et al., 2006; Ciocchi et al., 2010; Kapp et al., 1982; Roozendaal et al., 1992a, 1992b, 1997; Viviani et al., 2011) and VLPAG (Bandler and Shipley, 1994; Depaulis et al., 1994; Morgan and Carrive, 2001; Morgan et al., 1998; Zhang et al., 1990) triggers passive coping responses, yet we have shown that injection of orexin into these structures evokes correlates of active coping.

Alternatively, it could be argued that the results of the present study suggest that orexin inhibited passive coping responses. Interestingly, injection of the glutamatergic antagonist kynurenic acid in the VLPAG leads to uncontrollable, constant movement associated with increased HR and MAP (Luong and Carrive, unpublished observations). This suggests that the passive coping system may be tonically active when animals are at rest, and this is partly mediated by tonic glutamatergic activity in the VLPAG. Whilst the effects of orexin were not as striking as those of muscimol or kynurenic acid (Walker and Carrive, 2003), the pattern of responses was similar, suggesting that orexin in the VLPAG may inhibit the tonic activity in the passive coping system.

The findings of the present study are consistent with multiple lines of evidence showing that the orexin system is strongly associated with active coping responses, and this system is recruited by stimuli which require this response - broadly defined as engagement with the environment (Bandler et al., 2000) - and is suppressed during passive coping responses (see introduction, literature review). However, correlates of passive coping have occasionally been reported to be triggered or mediated by orexin (Ciriello and de Oliveira, 2003; de Oliveira et al., 2003; Johnson et al., 2012a, 2010; Li et al., 2010b, 2009; Rodgers et al., 2000).

Injection of the same dose of orexin-A in the CeA, RVM and LPAG evoked more prominent pressor, tachycardic and tail temperature responses than in the VLPAG, and orexin injected in the CeA and LPAG was associated with greater locomotor responses than orexin in the VLPAG. These differences may be due to the different projections of these structures. Another possibility may be that orexin triggered opposing mechanisms via the ORX1 and ORX2 receptor, which may have impeded the net effect.

185

5.4.2 Possible mechanism of action

The effect of orexin-A in the present study, that is, activity, tachycardia and a pressor response more closely resemble the effects of inhibition than activation of VLPAG output neurons. Administration of GABA agonists or glutamate antagonists in freely moving rats leads to increased HR, MAP and activity (Walker and Carrive, 2003). In contrast, activation of the VLPAG with EAA’s (Bandler and Shipley, 1994; Depaulis et al., 1994; Morgan and Carrive, 2001; Morgan et al., 1998; Zhang et al., 1990), acetylcholine (Deolindo, Pelosi, Busnardo, Resstel, & Corrêa, 2011; Monassi, Hoffmann, & Menescal-de-Oliveira, 1997; Monassi, Leite- Panissi, & Menescal-de-Oliveira, 1999), and electrical stimulation (De Luca-Vinhas et al., 2006) increase immobility and cause behavioural arrest. Thus, it seems likely that the dominant effect of orexin-A in the VLPAG in vivo in freely moving rats may be to activate GABAergic interneurons, which could prevent the activation of VLPAG output neurons. Indeed, ORX2 receptors have been found to be localised on GABAergic neurons in the VLPAG (Kaur et al., 2009). Since orexin has been shown to evoke an almost exclusively excitatory post-synaptic effect in multiple brain structures (reviewed in (Lungwitz et al., 2012) but see (Conrad et al., 2012), orexin would presumably activate GABAergic VLPAG neurons that express ORX2 receptors, and this may lead to inhibition of glutamatergic output neurons, which is thought to mediate immobility (Morgan and Whitney, 2000; Vianna et al., 2008). Further, ORX2Rs, but not ORX1Rs mediate the hyperlocomotor effects of i.c.v. administration of orexin (Mang et al., 2012; Samson et al., 2010), and activation of ORX2 receptors in the RVLM (Huang et al., 2010) and NTS (Smith et al., 2002) evoke greater pressor responses than activation of ORX1 receptors.

Previous reports have provided evidence that orexin-A may activate VLPAG output neurons through ORX1 receptors. Orexin-A depolarises and activates 45% of VLPAG neurons in slice preparation - and this proportion increased after presynaptic facilitation, even if presynaptic inputs led to hyperpolarisation (Ho et al., 2011). Importantly, orexin-A reduced IPSC’s by 30% in RVM-projecting VLPAG neurons via ORX1 receptors (Ho et al., 2011), which likely represents the mechanism mediating the antinociception induced by orexin-A in the VLPAG (Azhdari Zarmehri et al., 2011; Ho et al., 2011; Morgan et al., 2008). However, it was not determined if orexin-A led to action potentials in these RVM-projecting VLPAG neurons. This is an important consideration given that orexin-A was also shown to also inhibit EPSC’s (Ho et al., 2011), an effect which may be more prominent in vivo.

It is possible that orexin-A may have simultaneously triggered different pathways mediating opposing behavioural and physiological responses via ORX1 and ORX2 receptors. More specifically, ligand binding to the ORX1 receptor may have had an excitatory effect on RVM- 186

projecting neurons, but this effect may have been out-competed by a dominant, opposing effect at the ORX2 receptor when rats were unstressed in their homecages. We noted that shortly after return to the homecage, in the first 6 min, rats in the high dose group were slightly more likely to display immobility. However this was of short-duration and was not significant. One interpretation of this may be that during stress (e.g. after handling) GABAergic interneurons in the VLPAG may be inhibited by afferents arising in the limbic forebrain (da Costa Gomez and Behbehani, 1995), removing output neurons from tonic inhibition such that they may be labile to activation through the ORX1 receptor.

The notion that orexin may induce either active or passive coping responses through action at ORX2 and ORX1 receptors respectively, is in line with previous work which demonstrated that ORX1R knock-out mice show less immobility/behavioural despair in the forced swim test, whilst knock-out of ORX2R has the opposite effect (Scott et al., 2011). It is quite possible that the VLPAG is an important site of action of these opposite, orexin receptor-mediated effects on behavioural immobility in the forced swim test, as activity in this structure strongly predicts immobility in forced swim test (Berton et al., 2007; Lino-de-Oliveira et al., 2006).

If orexin activates RVM-projecting VLPAG neurons (Ho et al., 2011), leading to antinociception in vivo (Azhdari Zarmehri et al., 2011; Ho et al., 2011), and these phenomena are thought to be linked with bradycardia and immobility (Morgan and Carrive, 2001; Morgan et al., 1998), at face value it may be surprising that these were not found, and instead the opposite responses were seen. However, it is important to note that whilst there are overlapping mechanisms underlying immobility with bradycardia and antinociception (Bellgowan and Helmstetter, 1998; Morgan and Carrive, 2001; Morgan et al., 1998; Zhang et al., 1990), these responses are pharmacologically dissociable in the VLPAG (Helmstetter and Landeira- Fernandez, 1990; Morgan and Clayton, 2005; Palazzo et al., 2010). Thus, it may be possible that antinociception and active coping responses may sometimes occur in parallel (Morgan and Clayton, 2005). Thus, another possibility is that the orexin system may recruit the VLPAG to trigger active coping responses and arousal through ORX2 receptors in conjunction with descending antinociception through ORX1 receptors.

5.4.3 Methodological considerations

A crucial factor which may have precluded a bradycardic/immobility response may have been the dose of orexin-A (3 and 30 pmol). We have previously found 30 pmol to be sufficient to evoke robust behavioural and physiological effects when injected in the CeA (chapter 3), RVM ((Luong and Carrive, 2012), and in the LPAG in the present study; whilst the 3 pmol has a less pronounced, but clear effect in the CeA and RVM. However, a previous study reported that 300

187

pmol or 1nmol - but not 100 pmol - of orexin-A injected in the VLPAG was sufficient to induce antinociception in the hot plate test (Ho et al., 2011). Since this antinociception is likely to be mediated by activation of PAG-RVM projections (Ho et al., 2011; Morgan et al., 2008), this suggests that the 100 pmol dose of orexin-A failed to sufficiently activate RVM-projecting VLPAG neurons in vivo. The doses used in the present study were even lower than this (3 - 30 pmol), thus it seems quite possible that these doses of orexin-A were not sufficient to depolarise RVM-projecting neurons in the present study. Indeed, we found that the 3 pmol dose had almost no effect on any the behavioural and physiological responses in the present study.

That a greater dose of orexin-A may be needed to reach a sufficient threshold to activate projection neurons in the VLPAG relative to other structures is consistent with the existence of many tonically active GABAergic interneurons in the VLPAG which inhibit projection neurons (Behbehani, 1995; Depaulis et al., 1987; Oka et al., 2008). These GABAergic neurons may be subject to less tonic inhibition than output neurons (but see Barbaresi, 2005; Da Costa Gomez and Behbehani, 1995).

Another possible explanation for the higher dose threshold necessary to produce an effect in the VLPAG may also be because orexin-A inhibits EPSC’s as well as IPSC’s in VLPAG neurons (Ho et al., 2011). This reduction in EPSC’s in VLPAG neurons would presumably require a greater dose of orexin-A to produce the same degree of depolarisation of neurons as induced by orexin in other structures such as the CeA and RVM.

Another pertinent consideration is the possibility of spread of the drug into surrounding structures. Whilst cannulas were fixed in the skull at an angle of 20°, and thus spread of the drug up the cannula into the LPAG would presumably have been minimised, a sufficient dose of the drug may have still spread dorsally into the LPAG - a site which is innervated by orexin fibres and contains orexin receptors (Marcus et al., 2001; Peyron et al., 1998) and in which orexin microinjection is associated with strong increases in HR, MAP, Activity and latency to rest (Figs. 5.14 - 5.16). Thus it is quite possible that the enhanced HR, MAP, locomotor activity and latency to rest associated with injections in the VLPAG were due to the spread of orexin into the LPAG. Further investigations with smaller injection volumes or sensitive techniques such as optogenetic-evoked axonal release of orexin in the VLPAG may be required to answer this question. The drug may have also spread laterally or dorsolaterally to the cuneiform and pedunculopontine nuclei, and injections of orexin in this area robustly evokes locomotor activity (Takakusaki et al., 2005).

The drug may have also spread into the dorsal raphe (DR) and laterodorsal tegmental nucleus (LDTGg) - in fact some injections were centred in these structures (Figs. 5.1, 5.5, 5.9). These

188

structures contain similar densities of orexin receptors and fibres to the VLPAG (Marcus et al., 2001; Peyron et al., 1998) and orexin activates their respective serotonergic and cholinergic subpopulations (Burlet et al., 2002; Kohlmeier et al., 2008; Takahashi et al., 2002; Tao et al., 2006). Increased acetylcholine release in the LDTg is linked to enhanced locomotor activity, mediated by projections to midbrain dopaminergic subpopulations (Alderson et al., 2005; Dobbs and Mark, 2012). Similarly, activation of serotonergic neurons in the DR is also linked to increased movement (Jacobs and Fornal, 1993) and wakefulness (Portas and McCarley, 1994). Further, injections of large doses of orexin-A (500 pmol) in the dorsal raphe increases activity (Kotz et al., 2008) and injections of orexin in the LDTg strongly enhances wakefulness (Xi et al., 2001). Thus, the VLPAG is surrounded by structures which have either been demonstrated to, or are highly likely to increase activity and arousal in response to orexin. Thus, spread of the drug into these structures may also have been responsible for the arousal, hyperlocomotor, pressor and tachycardic responses seen in the present study.

Finally, orexin-A is normally co-expressed with glutamate (Rosin et al., 2003), dynorphin (Chou et al., 2001) and neurotensin (Furutani et al., 2013). Thus, the results of the present study do not model the effect of the endogenous, axonal release of orexin with its co-transmitters, which may produce much stronger, or different (McAllen, 2010; Zhang et al., 2010) effects. Indeed, both neurotensin and glutamate induce antinociception in the VLPAG (Behbehani et al., 1988; Bellgowan and Helmstetter, 1998; Morgan et al., 1998), and release of these in the VLPAG appears to mediate the antinociception induced by chemical or electrical stimulation of the lateral hypothalamus (Behbehani et al., 1988).

5.4.4 Effect on arousal

Similar to the findings reported in chapter 3, microinjection of orexin in the VLPAG increased the amount of time until rats returned to rest, however this latency was not systematically recorded. This is consistent with previous work suggesting that activation of ORX2 receptors on GABAergic VLPAG neurons is associated with the maintainance of wakefulness and arousal and reduced sleep (Kaur et al., 2009).

5.5 Conclusion

Injection of orexin-A in the VLPAG was associated with increased arousal, HR, MAP, locomotor activity and tail temperature. Although these responses were moderate relative to those induced by the same doses of orexin in the CeA, RVM and LPAG, they are consistent with a general effect of orexin in promoting active coping, or inhibiting passive coping at all levels of the descending CeA-PAG-RVM pathway.

189

We suggest that in the VLPAG, orexin may inhibit passive coping responses through the activation of ORX2-expressing GABAergic, which inhibits VLPAG output neurons, reducing the tonic activity of the passive coping system. Furthermore, we suggest that orexin-A may produce co-ordinated behavioural and physiological effects on the CeA-VLPAG pathway partly through inhibition of tonically active (Walker and Carrive, 2003) VLPAG output neurons.

Future studies utilising higher doses of orexin, exposure to fear or stress, selective activation or inhibition of ORX1 and ORX2 receptors, and optogenetic stimulation and inhibition of orexin- containing axons in the VLPAG may reveal more information about the functional properties of this pathway.

190

Chapter 6 General Discussion

The results of this thesis point to two main conclusions. The first is that we have provided evidence that is consistent with a model whereby, during long-duration re-exposure to a feared context, freezing may be partly mediated by the inhibition of GABAergic VLPAG-projecting neurons in the CeA, and activation of glutamatergic neurons in other divisions of the amygdala, similar to what has been found to occur in the BNST (Jennings et al., 2013).

The second conclusion was that microinjection of orexin-A triggers active coping responses (or inhibits passive coping responses) at all levels of the descending CeM-VLPAG-RVM pathway. We found that microinjection of orexin in these structures led to increased arousal and latency to rest, activity, heart rate, blood pressure, tail temperature, and did not increase freezing, and may have reduced it. One interpretation of this finding is that injection of orexin in the CeA or VLPAG leads to a similar pattern of inhibition of output neurons in the VLPAG.

Finally, we propose that CeM neurons project directly to VLPAG output neurons. This could trigger either active or passive coping responses depending on the frequency of stimulation.

6.1 The role of the CeM in conditioned fear to a short-duration versus long-duration CS

We have shown that projections from the CeA to the VLPAG are GABAergic, and lack VGLUT1 and VGLUT2 (chapter 2). These results are consistent with a model whereby presentation of a short-duration CS leads to phasic activation of the CeM (Ciocchi et al., 2010; Duvarci et al., 2011), which would lead to monosynaptic inhibition of tonically active interneurons in the VLPAG, which would disinhibit of output neurons (da Costa Gomez and Behbehani, 1995) culminating in freezing behaviour (Fig. 6.1) (Carrive et al., 1997b; De Oca et al., 1998; Morgan and Whitney, 2000; Vianna et al., 2008; Walker and Carrive, 2003).

Figure 6.1 Disinhibition model representing how activation (up arrow) of a GABAergic CeM- VLPAG pathway by a short-duration CS (+ symbol) could inhibit (down arrow) a GABAergic interneuron in the VLPAG to disinhibit (up arrow)

VLPAG output neurons to induce freezing. This is based off physiological and behavioural findings (Ciocchi et al., 2010; da Costa Gomez and Behbehani, 1995; Duvarci et al., 2011). However, this model does not account for increased locomotor activity observed after CeM stimulation by orexin, or how putative inhibition of the CeM during sustained fear could enhance freezing. Abbreviations: CeM - central nucleus of the amygdala, medial division; VLPAG - ventrolateral periaqueductal gray. 191

It is possible that the same mechanism occurs during sustained, contextual fear. However, to the best of our knowledge, CeM activity has not been recorded or selectively manipulated during this stressor. Previous studies have shown that activation of CeL neurons in sustained, contextual fear is associated with reduced freezing (Knobloch et al., 2012; Viviani et al., 2011). This was suggested to be due to feed-forward inhibition of brainstem-projecting CeM neurons. However, the CeL projects densely to the BNST (Dong et al., 2001a; Petrovich and Swanson, 1997; Roder and Ciriello, 1993; Sun and Cassell, 1993), and these projections are GABAergic (Li et al., 2012; Myers et al., 2013). Thus, activation of these CeL neurons could inhibit the BNST, a structure that is well known to mediate sustained fear responses (Davis et al., 2010; Jennings et al., 2013; Luyten et al., 2012, 2011; Resstel et al., 2008; Sullivan et al., 2004; Walker et al., 2009; Zimmerman and Maren, 2011).

We propose that the findings presented in this thesis support an alternative hypothesis: that CeM neurons may be inhibited during sustained conditioned fear to context, or are not activated. Inhibition of CeM neurons may not necessarily contribute to the freezing response, although this is possible. This hypothesis is based on the following observations. Firstly, we have shown that sustained conditioned fear to context leads to Fos expression in only 0.6% of VLPAG-projecting neurons in the CeM, less than in the rest group, although this difference was not significant. We also showed that some VLPAG-projecting neurons expressed Fos, however these were mainly located in structures where these projections are mostly glutamatergic. Interestingly, less than 1% of VLPAG-projecting neurons in the CeL contained Fos, despite observations of single labelled Fos neurons in the CeL, consistent with a previous report (Scicli et al., 2004). We suggest that these findings reflect an inhibition of GABAergic, brainstem- projecting neurons and activation of glutamatergic brainstem-projecting neurons in the extended amygdala in this stressor, consistent with what has been shown to occur in BNST neurons (Jennings et al., 2013).

Secondly, orexin-A fibres and receptors are almost exclusively found in the medial division of the CeA (Baldo et al., 2003; Fadel and Deutch, 2002b; Lu et al., 2000; Marcus et al., 2001; Peyron et al., 1998), and orexin has been shown to strongly activate CeM neurons (Bisetti et al., 2006; Johnson et al., 2012a). We found that microinjection of orexin-A in the CeA produced a state dependent effect, evoking a strong increase in arousal, heart rate, blood pressure and locomotor activity when rats were unstressed in their homecages, but had no effect on these parameters when conditioned fear was heightened in the first re-exposure (chapter 4). If CeM neurons are tightly regulated by tonic GABAergic inhibition when animals are at rest (Ciocchi et al., 2010; Haubensak et al., 2010), and disinhibited during re-exposure to a sustained CS (Knobloch et al., 2012; Viviani et al., 2011), it might be expected that CeM neurons would be

192

more labile to the excitatory effects of orexin when GABAergic inhibition was withdrawn, and potentiate freezing. Indeed, selective activation of CeM neurons by vasopressin increased the activity of freely moving rats but potentiated freezing and bradycardia in short-duration conditioned fear (Roozendaal et al., 1993a, 1992b). This is consistent with evidence that this form of conditioned fear is mediated by disinhibition of the CeM (Ciocchi et al., 2010; Davis et al., 2010), making these neurons more labile to excitation by vasopressin. In contrast, we found that freezing (or any other parameter) was not affected by orexin during sustained conditioned fear in the first re-exposure. It seems unlikely that this was due to a ceiling effect, as freezing was not maximal in the Orx1 group (70%). Thus, we think that the state-dependent effect of orexin in the CeA is more adequately explained by a model whereby CeM neurons are inhibited during sustained re-exposure to a CS.

This alternative hypothesis has been proposed previously (Walker et al., 2009) and is consistent with both functional evidence suggesting that the BNST may inhibit the CeM (Davis et al., 2010; Meloni et al., 2006; Walker et al., 2009; Zimmerman and Maren, 2011), and anatomical evidence (H.-W. Dong and Swanson, 2006, 2004; Dong and Swanson, 2006a, 2006b, 2004; Dong et al., 2001b, 2000; Holstege et al., 1985; Kudo et al., 2012; Poulin et al., 2009). Further, inhibition of the tonic activity of CeM neurons is significantly associated with fear generalisation and non-significantly associated with freezing (Ciocchi, 2009; Ciocchi et al., 2010). We think that it is conceivable that foreground, sustained contextual conditioned fear could be mediated by similar neural processes as those responsible for fear generalisation insofar as both being significantly associated with inhibition of tonic activity of CeM neurons. This is appealing as both may be argued to be more accurately be seen as anxiety, or generalised hypervigilance, as opposed to fear, which may be associated with increased activity of the BNST, inversely associated with activity of the CeM (Thomas et al., 2013; Treit et al., 1993; Walker et al., 2009; Zarrindast et al., 2008). Inhibition of CeM neurons by contextual, generalised or second order cues is intuitively appealing, as it may promote freezing behaviour whilst retaining the ability to respond phasically (powerfully and immediately) to cues which reliably signal onset of threat (e.g. CS +) (see similar comments in (Campeau et al., 1997; Davis et al., 1997)).

Additionally, Fos expression in CeM neurons has been associated with active responses such as conditioned avoidance (Martinez et al., 2013), aggressive behaviour (Haller et al., 2006) and instrumental appetitive conditioning (Knapska et al., 2006) but negatively correlated with freezing (Martinez et al., 2013; Savonenko et al., 1999). This suggests that in some circumstances, activation of the CeM could inhibit or disrupt freezing. Finally, the BNST, but not the CeA, displays increased cerebral blood flow during re-exposure to a sustained,

193

contextual CS, and fibre-sparing lesions of the CeA do not affect freezing in sustained contextual fear (Koo et al., 2004; Pitts and Takahashi, 2011). These observations suggest that CeM neurons may not be necessary to drive conditioned responses to a sustained CS.

6.2 Could activation and inhibition of the CeM be associated with conditioned fear responses?

An important question raised by this model is how both activation and putative inhibition of the CeM could be associated with freezing. We suggest several answers to this question. The first is that inhibition of the CeM in sustained fear may reflect activation of GABAergic BNST-CeM projections, and that this putative inhibition of the CeM may be an effect rather than a cause of fear to a sustained CS. Second, the VLPAG is also densely innervated by the BNST (Holstege et al., 1985) - which mediates freezing responses to a sustained CS (Davis et al., 2010; Jennings et al., 2013) but not a short-duration CS (Iwata et al., 1986b; LeDoux et al., 1988; Sullivan et al., 2004; Walker et al., 2009; Zimmerman and Maren, 2011). Thus, the additional recruitment of this structure in sustained fear may compensate for the inhibition of the CeM.

Figure 6.2 Hypothesised model of sustained fear. We have shown that CeM neurons do not express Fos after sustained conditioned fear, and that microinjection of orexin in the CeA failed to affect conditioned fear responses, suggesting that CeM neurons are strongly inhibited in sustained fear. CeL OFF neurons are thought to be inhibited during sustained fear (Knobloch et al., 2012; Viviani et al., 2011). CeLOFF cells show very low expression of CRF and dynorphin (Haubensak et al., 2010), which are expressed in another population of CeL neurons (Day et al., 1999; Marchant et al., 2007), possibly CeLON neurons. This population of CeL neurons may b e activated in sustained fear (Scicli et al., 2004). Dynorphin has been shown to inhibit presynaptic GABA release (- symbol) in CeA-BNST projections (Li et al., 2012), whilst CRF is thought to activate neurons in the BNST (Davis et al., 2010). Thus, CeLON neurons may activate the sustained fear system in the BNST. Activation of GABAergic BNST neurons projecting to the CeM may prevent inhibitory feedback from this structure. VLPAG output neurons are likely to be disinhibited by inhibition of GABAergic brainstem-projecting neurons (Jennings et al., 2013) and activation of projections from the prelimbic cortex (Corcoran and Quirk, 2007). These structures may also provide the glutamatergic input to the VLPAG which is required for freezing (Walker and Carrive, 2003). Symbols: Up arrows - cells activated; down arrows - cells inhibited; +: an excitatory or potentiating effect. Abbreviations: BNST - bed nucleus of the stria terminalis; CeL - central nucleus of the amygdala, lateral division; CeM - central nucleus of the amygdala, medial division; CRF - corticotropin releasing factor; mPFC - medial prefrontal cortex; PrL - prelimbic cortex; VLPAG - ventrolateral periaqueductal gray. 194

It is also possible that inhibition of CeM neurons by the BNST could contribute to fear responses. Firstly, inhibition of the CeM would prevent reciprocal feedback inhibition to the BNST (Dong et al., 2001a; Li et al., 2012; Myers et al., 2013; Walker et al., 2009). Second, CeA axons also directly synapse onto glutamatergic PAG output neurons (Oka et al., 2008). This suggests the possibility that withdrawal of tonic GABAergic activity by the inhibition of some CeM neurons projecting to glutamatergic VLPAG output neurons may culminate in their disinhibition.

Another explanation is that strong, phasic activation of CeM neurons by a discrete, short- duration CS may be of sufficient intensity to induce the co-release of excitatory neuropeptides from CeA terminals in brainstem efferents of the CeA (Chen et al., 2009; Gray and Magnuson, 1992; Retson and Van Bockstaele, 2013; Van Bockstaele et al., 1999), which could selectively activate output neurons, leading to the expression of correlates of fear (Bowers et al., 2003; Commons and Valentino, 2002; Fendt et al., 1997). Conversely, a low level of activity in CeM neurons would presumably only release GABA. This in line with the notion that peptide release by peptidergic neurons requires high frequency stimulation, whilst tonic or low level activity is sufficient for neurotransmitter but not neuropeptide release (Vilim et al., 1996; Whim and Lloyd, 1989; Zupanc, 1996). Conversely, a moderate increase in CeM activity (e.g. by orexin in freely moving rats) may produce the opposite effect through increased GABA release, whilst a putative reduction of tonic CeM activity in sustained fear could reduce GABA release and thus increase signs of fear. Importantly, recent research shows that about 42 - 50% of brainstem- projecting CeA neurons contain CRF (Chen et al., 2009; Reyes et al., 2011).

Consistent with this hypothesis, local injection of low dose CRF in the VLPAG strongly potentiates freezing and fear-potentiated startle (Borelli et al., 2013). Co-release of excitatory neuropeptides onto output neurons may partly explain why activation of presumed VLPAG output neurons by CeA stimulation did not appear to be dependent on the inhibition of presumed VLPAG interneurons (da Costa Gomez and Behbehani, 1995). Neuropeptide release in other targets of CeA projections may be necessary for the expression of the behavioural and autonomic signs of fear. The CeA is a major source of CRF for noradrenergic cells in the locus coeruleus (Reyes et al., 2011; Van Bockstaele et al., 2001, 1999, 1998) and stimulation of the CeA leads to activation of noradrenergic cells in the locus coeruleus, which is dependent on CRF (Bouret et al., 2003; Curtis et al., 2002, 1997; Valentino et al., 1983).The caudal pontine reticular nucleus (PnC) receives CRF input exclusively from the CeA (Fendt et al., 1997). Infusion of CRF in the PnC enhances the activity of cells responding to a tone CS (Fendt et al., 1997) and acoustic startle responses (Birnbaum and Davis, 1998). Conversely, injection of a CRF antagonist in this structure almost completely abolished fear potentiated startle to a tone

195

(Fendt et al., 1997), but importantly had no effect on baseline startle, suggesting that these CRF- containing CeA neurons were phasically activated by the CS. Further, blockade of the CRF receptor in the locus coeruleus reduces freezing (Swiergiel et al., 1992). It is important to note that CRF release mediates short-latency (10 - 20 ms) activation of brainstem neurons after electrical stimulation of the CeA (Bouret et al., 2003). Thus, it is conceivable that CRF may have a functional role similar to a classic excitatory neurotransmitter and mediate fast responses to short-duration conditioned stimuli through different projections of the CeA (Fig. 6.4).

6.3 Microinjection of orexin in the CeA increases active coping responses

Injection of orexin in the CeA in freely moving rats increased activity, heart rate and blood pressure. This observation is not easily explained by a model in which activated CeM neurons disinhibit VLPAG output neurons. These results are consistent with the possibility that in some situations, activation of CeM neurons may promote active rather than passive coping responses (Avolio et al., 2011; Haller et al., 2006; Knapska et al., 2006; Martinez et al., 2013). We suggest that orexin increases the tonic activity of CeM neurons, increasing GABA (but not CRF) release directly onto VLPAG output neurons, leading to their inhibition and thus increased locomotor activity (Fig. 6.3; Walker and Carrive, 2003)

6.4 GABAergic CeM neurons may project mainly to VLPAG output neurons

We propose that the results of this thesis support a model whereby CeM neurons directly project to VLPAG output neurons.

If CeM neurons are tightly regulated by tonic GABAergic input in vivo (Ciocchi et al., 2010; Duvarci et al., 2011; Haubensak et al., 2010), it would be expected that intra-CeA injection of excitatory neuropeptides such as orexin or vasopressin would lead to a moderate activation of CeM-VLPAG cells in freely moving rats. This excitation would presumably not be of sufficient intensity to induce neuropeptide release by CeA axons, which requires high frequency stimulation (Vilim et al., 1996; Whim and Lloyd, 1989; Zupanc, 1996), however it should be sufficient to induce GABA release in the VLPAG. Since injection of orexin in the CeA increases locomotor activity in freely moving rats (chapter 3; Avolio et al., 2011; B. Roozendaal et al., 1993), and inhibition of VLPAG output neurons causes movement and blocks freezing (Walker and Carrive, 2003), we propose that increased tonic activity of CeM neurons increases GABA release primarily onto output neurons in the VLPAG. These VLPAG output neurons are normally tonically active, suppress activity and heart rate, and represent the tonic activity of the passive coping system (see Walker and Carrive, 2003). Thus, inhibition of these neurons by GABAergic input from the CeA would increase activity and heart rate, which was observed in chapter 3. 196

Figure 6.3 Speculative model of the effect of orexin on the CeM-VLPAG pathway. Injection of orexin in the CeA could moderately enhance CeM activity in vivo, as the CeM is tightly regulated by GABA at rest. This could increase GABA (but not CRF) release onto VLPAG output neurons. We found that orexin in the CeA increased locomotor activity in freely moving rats. This suggests that the effect of CeM neurons on VLPAG output neurons is inhibitory, consistent with a monosynaptic, GABAergic projection. Other descending projections of the CeM could also contribute to the increased activity observed after microinjection of orexin in this structure. Abbreviations: CeM - central nucleus of the amygdala, medial division, CRF - corticotropin releasing factor; VLPAG - ventrolateral periaqueductal gray

A B

Figure 6.4. Speculative model of the CeM-VLPAG pathway in phasic and sustained fear A: Activation of CeM neurons at a sufficiently high frequency by a phasic CS, or by powerful treatments such as bicucculine or optogenetic stimulation would be sufficient to induce peptide (CRF) release. Phasic release of excitatory neuropeptides such as CRF in CeM (and CeA) neurons may be necessary for activation of output neurons in descending targets of the CeA (Bouret et al., 2003; Fendt et al., 1997). Around 40-50% of brainstem projecting CeM neurons may contain CRF (Chen et al., 2009; Reyes et al., 2011). Interestingly, preventing the inhibition of tonically active interneurons in the VLPAG with naloxone does not prevent excitation of presumed output neurons produced by stimulation of the CeA (da Costa Gomez and Behbehani, 1995). One possible explanation of this is that CeM neurons also directly project to output neurons, and activating CeA neurons at sufficiently high frequencies induces CRF release, which has a potent excitatory effect on VLPAG output neurons (Borelli et al., 2013; Bowers et al., 2003). Further, naloxone prevents conditioned antinociception but not freezing (see text) suggesting that two separate pathways mediate these responses. B: Conversely, during rest, CeM neurons show moderate tonic activity which could lead to GABA but not peptide release. We suggest that CeM activity is inhibited in sustained fear (right). Withdrawal of tonic GABA releaseay enhance freezing if the main pathway is monosynaptic. Importantly, in sustained fear, VLPAG neurons mediating freezing and antinociception are highly likely to be activated by other afferents such as the BNST and elsewhere (Fig. 6.2). Abbreviations: BNST - bed nucleus of the stria terminalis; CeM - central nucleus of the amygdala, medial division, CRF - corticotropin releasing factor; VLPAG - ventrolateral periaqueductal gray. Symbols: up arrows - activated cells; down arrows - inhibited cells; +: excitatory or potentiating effect 197

This would imply that the dominant pathway from the CeM to VLPAG output neurons which control freezing is inhibitory, consistent with a monosynaptic GABAergic projection to these neurons. Furthermore, this is consistent with our results and hypothesis suggesting that CeM neurons are inhibited during sustained fear (chapter 2, 4) and that CeM-VLPAG neurons are GABAergic (chapter 2) and that many contain CRF (Chen et al., 2009; Reyes et al., 2011) which activates VLPAG output neurons (Bowers et al., 2003) and enhances freezing (Borelli et al., 2013). Finally, this model is also consistent with enhanced freezing to a short duration CS.

This model contrasts with a previous study (da Costa Gomez and Behbehani, 1995). However it is not known if the CeA stimulation in that study primarily activated CeA-VLPAG neurons or inhibitory interneurons in the CeL. Secondly and crucially, activation of presumed VLPAG output neurons was not dependent on the inhibition of interneurons by naloxone. One possibile explanation of this is that the inhibition of VLPAG interneurons by CeA stimulation represents a separate neural pathway mediating conditioned antinociception, which is pharmacologically dissociated from freezing. Indeed, injection of naloxone in the VLPAG reduces conditioned antinociception but has no effect on freezing (Helmstetter and Landeira-Fernandez, 1990), suggesting that these phenomena are mediated by separate neural systems in the VLPAG, and may even be innervated by separate neurons in the CeM (Fig. 6.4).

Microinjection of orexin in the CeA-PAG pathway enhances active coping responses

The behavioural and physiological consequences of microinjection of orexin into the VLPAG of freely moving rats were broadly consistent with the effects observed after orexin injection in the CeA, although the magnitude of changes after injections in the VLPAG were not as pronounced. This may be because orexin may trigger opposing pathways, as it could activate both interneurons and output neurons through ORX2 (Kaur et al., 2009) and ORX1 (Ho et al., 2011) receptors respectively. Whilst it is possible that orexin in the VLPAG may contribute to immobility during stress or conditioned fear, the effect of orexin in unstressed animals at all levels of the CeA-PAG-RVM pathway is to increase active coping responses, including arousal. This may be partly mediated by the inhibition of tonically active output neurons in the VLPAG, thus inhibiting the tonic activity (Walker and Carrive, 2003) of the passive coping system.

The effects of orexin in the CeA-PAG-RVM pathway are consistent with a general role of orexin in the central nervous system in mediating increased locomotor activity, arousal, heart rate, blood pressure and memory (Jaeger et al., 2002; Kaur et al., 2009; Kotz et al., 2006; Matsumura et al., 2001; Nakamura et al., 2000; Samson et al., 2010, 1999; Shirasaka et al., 1999). The orexin system is generally recruited by stimuli which demand active coping or engagement with the environment (Blouin et al., 2013; Furlong et al., 2009; Harris and Aston- Jones, 2006; Kayaba et al., 2003; Mileykovskiy et al., 2005; Torterolo et al., 2003; Wu et al., 198

2002a), and is supressed during passive coping (Blouin et al., 2013; Brundin et al., 2009, 2007a; Grossberg et al., 2011; McGregor et al., 2011; Nocjar et al., 2012; Rotter et al., 2011) - although some evidence suggests that orexin may partly mediate immobility in states of heightened anxiety, conditioned fear and panic (Chen et al., 2013; Johnson et al., 2010; Li et al., 2010b, 2009).

Injection of orexin in the CeA does not appear to inhibit freezing when levels of fear are high - however it is possible that it may inhibit freezing when fear memories are weaker, although this interpretation is confounded by a more likely mnemonic effect of orexin. It may be that the orexin system increases activity or reduces immobility in freely moving animals, but permits or contributes to immobility during states of fear or heightened anxiety.

Finally, we suggest that orexin may have a co-ordinated mechanism of action in the CeA- VLPAG pathway of inhibiting VLPAG output neurons to increase active coping and inhibit passive coping responses in animals at rest.

6.5 Orexin may inhibit extinction or facilitate reconsolidation via the CeA

An unexpected finding in this thesis was an apparent mnemonic effect of orexin. Bilateral injection of orexin in the CeA appeared to either inhibit the extinction, or enhance the reconsolidation of contextual fear memories. Importantly, rats bilaterally injected with orexin did not show within-trial reductions in freezing. Further, instead of displaying signs of extinction in the subsequent re-exposure session, these animals displayed an enhancement of freezing relative to the first re-exposure control group. This finding is consistent with emerging evidence of an important role for this neuropeptide in memory (Akbari et al., 2007; Selbach et al., 2010; Wayner et al., 2004; Yang et al., 2013), fear-memory consolidation (Jaeger et al., 2002; Telegdy and Adamik, 2002) and the impaired fear learning, consolidation and amygdala activation observed in human patients with narcolepsy with cataplexy (Ponz et al., 2010).

Chapter 7 Future directions: Testable hypotheses arising from this thesis

It would be interesting to perform the following studies to test hypotheses put forward in this thesis and elsewhere.

 Sustained fear system: Electrophysiological recording of CeM neurons during sustained, contextual fear. We would expect that these neurons would be inhibited, or not activated.  To determine if the BNST sends non-collateralised projections to the amygdala and brainstem, large injections of different retrograde tracers in the CeA and VLPAG would be

199

expected to reveal non-overlapping cell populations in the BNST, and these would presumably be GABAergic.  Phasic fear system: We would expect that injection of orexin in the CeA would potentiate conditioned fear responses (freezing, bradycardia) to a discrete CS, by potentiating the activation of CeM neurons. This would be a positive control for our negative results in sustained fear.  It would be interesting to determine whether the same CeM neurons project to anatomical substrates of active and passive coping. For example, injection of different retrograde tracers in the LPAG and VLPAG may reveal non-collateralised projections in the CeM. This would be consistent with the notion that activation of some CeM neurons may lead to active rather than passive coping responses  Injection of an anterograde tracer in the CeM and a retrograde tracer in the RVM to determine if CeA neurons make close appositions onto VLPAG output neurons. Co- labelling for GAD and VGLUT2 would also indicate the neurochemical identity of VLPAG neurons receiving synaptic input from the CeA.  We would expect that CRF antagonists microinjected in the VLPAG would reduce freezing to a phasic CS.  Orexin and conditioned fear Some evidence suggests that orexin may have a moderate effect in the expression of conditioned fear (Chen et al., 2013; Furlong et al., 2009; Steiner et al., 2012). To determine if this is mediated by the CeA, orexin antagonists could be injected in this structure to determine whether this affects conditioned fear responses. Alternatively, the orexinergic projection to the amygdala may be more important in learning and consolidation (Ponz et al., 2010).  Orexin and fear memories Perform a similar experiment to that in chapter 4, but i) Alter the conditioning protocol to produce moderate levels of freezing to prevent a ceiling effect; ii) inject orexin in the CeA after conditioning and after re-exposure, to determine if it facilitates consolidation and reconsolidation.  Systemic or intra-amygdala administration of a dual orexin receptor antagonist shortly after conditioning and re-exposure may inhibit (re)consolidation. If this is found to occur, this class of drugs may be therapeutic or prophylactic for PTSD.  Orexin and cataplexy If orexin tone in the CeA co-ordinates coupling of arousal with enhanced muscle tone and sympathoexcitation in response to exercise or emotional stimuli, injection of orexin in the CeA may rescue cataplectic attacks in orexin knock-out mice.  Orexin microinjection in the VLPAG: Orexin microinjected in the VLPAG may enhance freezing or immobility during states of fear and stress. Orexin receptors are found on both RVM-projecting VLPAG neurons (Ho et al., 2011) and possibly interneurons (Kaur et al.,

200

2009). In states of fear, interneurons would be expected to be inhibited (da Costa Gomez and Behbehani, 1995), thus orexin may potentiate the activity of RVM-projecting neurons, as GABAergic inhibition may be withdrawn from these cells. This may explain orexin’s dual role in producing immobility in states of stress, and increased activity in unstressed animals.  Selective ORX1 and ORX2 antagonists could produce opposite effects in the VLPAG, in line with our hypothesis that ORX2 receptors are expressed on interneurons, and ORX1 receptors on output neurons.

Chapter 8 The orexin system is implicated in various pathological states

8.1 Orexin antagonists could prevent and treat PTSD

Orexin could enhance (re)consolidation or inhibit extinction via action in other structures besides the CeA (Jaeger et al., 2002; Telegdy and Adamik, 2002), and by facilitation of arousal. It is becoming clear that increased recruitment of arousal and stress systems (e.g. cholinergic, noradrenergic, histaminergic and CRF systems) may inhibit extinction, as well as mediate and enhance the (re)consolidation of fear memories; conversely, inhibition of these systems impairs (re)consolidation and may enhance extinction (Chang and Liang, 2012; Dębiec and Ledoux, 2004; Dębiec et al., 2011; Kolber et al., 2008; McGaugh, 2000; Nonaka et al., 2013; Pitts and Takahashi, 2011; Roozendaal et al., 2008). Interestingly, orexin neurons densely project to and activate all of these arousal systems (Fadel and Burk, 2010; Hagan et al., 1999; Harris and Aston-Jones, 2006; Jones, 2008; Sakamoto et al., 2004; Siegel, 2009; Winsky-Sommerer et al., 2005), and could act as a ‘master switch’ in recruiting these systems in states of heightened arousal, panic and fear. Thus, it is quite possible that hyperactivation of this system after trauma may lead to ‘over-consolidated’ memories of trauma, leading to PTSD.

Secondly, a strong predictor of subsequent development of PTSD is elevated heart rate shortly after the initial trauma (Blanchard et al., 2002; Bryant et al., 2004; Shalev et al., 1998; Zatzick et al., 2002). It is unknown if this is a cause or effect of processes involved in the development of PTSD. One possibility is that elevated heart rate after trauma could reflect increased activation of the orexin system, which enhances learning (Ponz et al., 2010) and (re)consolidation (chapter 4) of fear memories through projections to the amygdala, and also contributes a large proportion of the cardiac sympathetic outflow and tachycardia in response to stress (Furlong et al., 2009; Iigaya et al., 2012; Johnson et al., 2012b; Kayaba et al., 2003; Luong, 2012; Shirasaka et al., 1999; Xiao et al., 2013; Zhang et al., 2006a, 2006b). Furthermore, about half of all orexin neurons are activated after (but not during (McGregor et

201

al., 2011) a single footshock session (Winsky-Sommerer et al., 2004; Zhu et al., 2002), suggesting the recruitment of this system for consolidation. On the other hand, if elevated heart rate after trauma per se is a causal factor in the development of PTSD, orexin antagonists could prevent PTSD by blocking sympathetic outflow. Accordingly, systemic administration of a dual orexin antagonist strongly attenuates the tachycardia seen in the recovery period after stress and fear (Furlong et al., 2009).

Interestingly, treatment with morphine or propanalol shortly after trauma reduces the chance of developing PTSD (De biec, 2012; olbrook et al., 2010; Vaiva et al., 2003). We suggest that administration of a dual orexin-antagonist shortly after trauma, or after recall of traumatic memories, could inhibit consolidation mediated by all arousal systems, as well as inhibiting a direct effect of orexin on (re)consolidation and extinction. This treatment could prove to be an alternative treatment to propanalol, which only targets the beta-adrenergic system. Alternatively, orexin antagonists could be given in conjunction with antagonists of other arousal systems. Further research is required to determine if orexin in the CeA given after (rather than before) conditioning and re-exposure facilitates (re)consolidation, and whether treatment with a dual receptor antagonist immediately after conditioning or re-exposure impairs (re)consolidation of fear memories.

8.2 Inhibition of the orexin system is linked to obesity, depression and chronic PTSD

Suppression of the orexin system has been associated with obesity (Kotz et al., 2012; Perez- Leighton et al., 2013, 2012). This may be related to reduced activity and passive versus active coping styles. Non exercise thermogenesis and spontaneous physical activity (NEAT/SPA) are strongly enhanced by microinjection of orexin in many structures (Kotz et al., 2008). This orexin-mediated increase in NEAT/SPA has a net effect of increasing the ratio of energy expenditure versus calorie intake, despite the known stimulatory effect of orexins on appetite (Nixon et al., 2012). NEAT and SPA are also associated with active coping (Careau et al., 2008; Garland et al., 2011) and active coping personality styles are protective against visceral obesity and insulin resistance (Boersma et al., 2010)

Interestingly, obese individuals are more prone to depression than lean ones (Garland et al., 2011; Luppino et al., 2010), though the causal relationship between depression and obesity is bidirectional (Luppino et al., 2010). The rate of obesity is also higher in patients with PTSD (Pagoto et al., 2012). One possible explanation of these findings is that obesity and depression could in some cases be secondary to suppression of the orexin system, which is found in patients with depression and PTSD (Brundin et al., 2007a, 2007b; Johnson et al., 2010; Rotter et

202

al., 2011; Strawn et al., 2010) and is correlated with depressive symptoms, especially vegetative symptoms (Brundin et al., 2009, 2007a, 2007b; Rotter et al., 2011).

8.3 How is the orexin system suppressed in depression and chronic PTSD?

A speculative hypothesis is that heightened amygdala activation in depression and PTSD may suppress the orexin system, which could result in less active coping, exacerbating the symptoms of depression. This tentative hypothesis is consistent with direct, GABAergic inhibitory control of the orexin system by CeA neurons (Nakamura et al., 2009; Sakurai et al., 2005; Yoshida et al., 2006). These CeA neurons are tonically active (Ciocchi, 2009; Ciocchi et al., 2010; Collins and Paré, 1999; Huber et al., 2005; Lu et al., 1997; Pascoe and Kapp, 1985; Rosenkranz et al., 2006; Thomas et al., 2013; Viviani et al., 2011). Furthermore, the amygdala is both phasically hyper-reactive to threatening stimuli, and tonically hyperactive in both depression and PTSD (Bryant et al., 2005; Chung et al., 2006; Drevets, 2000, 1999). Moreover, both activation of the CeA (Bohus et al., 1996; Gozzi et al., 2010; Roozendaal et al., 1993a, 1992a, 1997) and inhibition of the orexin system (Blouin et al., 2013; Brundin et al., 2009, 2007a; Grossberg et al., 2011; Lutter et al., 2008; McGregor et al., 2011; Nocjar et al., 2012; Rotter et al., 2011) are associated with passive coping and depression-like symptoms.

Interestingly, long term inhibition of orexin neurons downregulates the orexin content of orexin neurons (Michinaga et al., 2010). This provides a mechanism through which chronic stress (possibly mediated by enhanced GABAergic input from the extended amygdala) could lead to depression. Another mechanism may be epigenetic silencing of the orexin promoter, which is observed in depression (Lutter et al., 2008; Rotter et al., 2011). Further, a reduction in orexin expression and orexin neurons is observed in animals model of depression (Allard et al., 2004; Lutter et al., 2008).

8.4 The orexin system in stress-induced reinstatement of drug seeking

It is well known that fear and stress triggers drug craving and relapse in animals and humans (Sinha et al., 2000a; Stewart, 2000). Indeed, stress is one of three strong risk factors in the reinstatement of addictive behaviours and drug seeking, along with exposure to the drug itself, or drug-associated cues (Mahler et al., 2012; Sinha and Li, 2007; Sinha et al., 2011, 2000b; Stewart, 2000). Both stress and drug cues produce similar increases in anxiety, heart rate and cortisol release in humans (Sinha et al., 2000a). In animals, footshock induces reinstatement of drug seeking (Boutrel et al., 2005; Stewart, 2000), and this appears to be dependent on the existence of CRF-containing projections from the CeA to BNST (Erb et al., 2001). Similarly, inactivation of the CeA also strongly attenuates drug-cue reinstatement (See et al., 2003), suggesting a crucial role of the CeA in drug relapse. Orexin neurons located in the lateral 203

hypothalamus also mediate drug and reward seeking (Brown et al., 2013; Dayas et al., 2008; Harris and Aston-Jones, 2006; Harris et al., 2007, 2005). Importantly, orexin mediates reinstatement of stress-induced drug seeking (Boutrel et al., 2005).

Thus, there appears to be strong associations between stress-induced drug seeking with activation of both the CeA and orexin system in the LH. Whilst activation of orexin neurons in the LH is associated with reinstatement of drug seeking behaviour, and is necessary for context- associated drug seeking (Smith et al., 2010), it is unknown whether activation of orexin neurons in the LH (as opposed to medially located orexin neurons) are involved in stress-induced drug seeking. If orexin neurons in the LH are involved in stress-induced drug seeking, it might be expected that stressful and aversive situations (perhaps via afferents in the CeA) would activate orexin neurons in the LH, which would then trigger drug seeking behaviour. However, stress in the form of footshock or conditioned fear (albeit in drug-naïve rats) is associated with minimal or suppressed Fos expression in LH orexin neurons (Furlong et al., 2009; Harris and Aston- Jones, 2006; Harris et al., 2005; McGregor et al., 2011) and relatively much higher levels of Fos expression in orexin neurons medial to the LH. Therefore, since orexin mediates stress induced reinstatement of drug seeking (Boutrel et al., 2005), these findings raise the possibility that orexin neurons medial to the LH - involved in mediating stress responses (Mahler et al., 2012) - may contribute the orexin release necessary for this phenomena. Consistent with this, orexin- mediated reinstatement is thought to be independent of the dopamine system (Boutrel et al., 2005) - which is preferentially recruited by neurons in the lateral part of the orexin field (Fadel and Deutch, 2002a) - and instead dependent on CRF and noradrenergic systems.

8.5 Melancholic depression

Orexin concentration in cerebrospinal fluid is inversely correlated with the severity of vegetative symptoms seen in depression (Brundin et al., 2007a, 2007b). Several important correlates of melancholic depression - as described by (Parker et al., 2013) - are remarkably similar to what might be expected from reduced orexin tone, and increased passive coping secondary to activation of the central amygdala.

 “Low energy/hard to get out of bed and ‘get going’.” This could relate to a reduced arousal/wakefulness-promoting function of orexin.

 “Anhedonia; can’t “look forward to anything in life”; losing interest in things.” These features could relate to enhanced inhibition of dopaminergic neurons in the VTA (El- Amamy and Holland, 2007) by hyperactivation of the GABAergic CeM-VTA projection (El- Amamy and Holland, 2007; Fudge and Haber, 2000) and also reduced activation of VTA-

204

projecting orexin neurons (Borgland et al., 2008; Fadel and Deutch, 2002b). This could result in reduced dopamine release (Aston-Jones et al., 2010) culminating in anhedonia and a reduction in motivated seeking behaviour (Nocjar et al., 2012), which is mediated by the orexin system (Harris et al., 2005; McGregor et al., 2011). Consistent with this notion, the chronic social defeat model of depression is linked with less orexin in the VTA (Nocjar et al., 2012).

 “Inactivity/psychomotor retardation; ‘distinctly physically slowed, at times almost feeling ‘paralysed’ or as if walking through sand’.” Immobility could be due to reduced physical activity due to lower orexin tone. Orexin appears to activate GABAergic neurons in the VLPAG, inhibiting output neurons and thus the tonic activity of an important pathway in the passive coping system. Orexin in the VLPAG leads to increased arousal, activity, heart rate and blood pressure (Kaur et al., 2009). Thus, withdrawal of orexin release from the VLPAG could enhance tonic (baseline) immobility. Similarly, enhanced immobility would also be expected by increased activity of the CeA. Interestingly, orexin in the CeA also acts to enhance active coping in freely moving animals (chapter 3).

 “Reduced focus and concentration” Patients with PTSD and depression display lower cortical blood flow and metabolism (Drevets, 2000; Drevets et al., 1998; Williams et al., 2006). This could be due to reduced cortical activation secondary to activation of a passive coping switch in the CeA (Bohus et al., 1996; Gozzi et al., 2010; Roozendaal et al., 1997) and less forebrain arousal due to a subsequent inhibition of orexin neurons. The orexin system projects to the mPFC (Peyron et al., 1998) and activates it (Li et al., 2010), as well as the hippocampus (Ito et al., 2008; Jaeger et al., 2002; Wu et al., 2002b). Orexin also activates cholingergic, histaminergic, dopaminergic and noradrenergic arousal systems (Arrigoni et al., 2010; España et al., 2001; Fadel and Burk, 2010; Hagan et al., 1999; Siegel, 2009). Further, inhibition of other active coping modules downstream of the orexin system such as the LPAG (Peyron et al., 1998) could also reduce cerebral blood flow (Nakai and Maeda, 1996; Nakai et al., 1997).

Orexin activates glutamatergic neurons in the mPFC (Li et al., 2010) and fluoxetine increases ORX2 receptor expression in the prefrontal cortex (Nollet et al., 2011). Further, ORX1 receptor expression in the mPFC is associated with active coping, motivated behaviour and reduced anxiety (Davis et al., 2009). These findings may reveal a mechanism of action of antidepressants, given the important role of the mPFC in selecting appropriate coping responses (Amat et al., 2005, 2008; Warden et al., 2012) and regulation of amygdala output (Paré et al., 2004; Vidal-Gonzalez et al., 2006), which is dysregulated in depression (Drevets, 2000, 1999).

205

Interestingly, sleep deprivation, a known treatment for depression (Germain et al., 2008; Hemmeter et al., 2010), activates orexin neurons (Pedrazzoli et al., 2004). This is consistent with the putative antidepressant effects of orexin. Finally, orexin may promote antidepressant effects through increased hippocampal neurogenesis (Ito et al., 2008). Thus, orexin agonists could enhance active coping and have antidepressant properties, especially for melancholic forms of depression. However, orexin administration may not be suitable for patients with anxiety, panic or PTSD (Chen et al., 2013; Johnson et al., 2010).

206

References

Abrahams, V.C., Hilton, S.M., Zbrozyna, A., 1960. Active muscle vasodilatation produced by stimulation of the brain stem: its significance in the defence reaction. J Physiol 154, 491–513. Abrahams, V.C., Hilton, S.M., Zbrozyna, A.W., 1964. The role of active muscle vasodilatation in the alerting stage of the defence reaction. J Physiol 171, 189–202. Adamantidis, A.R., Zhang, F., Aravanis, A.M., Deisseroth, K., de Lecea, L., 2007. Neural substrates of awakening probed with optogenetic control of hypocretin neurons. Nature 450, 420–424. Akbari, E., Motamedi, F., Davoodi, F.G., Noorbakhshnia, M., Ghanbarian, E., 2011. Orexin-1 receptor mediates long-term potentiation in the dentate gyrus area of freely moving rats. Behav. Brain Res. 216, 375–380. Akbari, E., Motamedi, F., Naghdi, N., Noorbakhshnia, M., 2008. The effect of antagonization of orexin 1 receptors in CA1 and dentate gyrus regions on memory processing in passive avoidance task. Behav. Brain Res. 187, 172–177. Akbari, Naghdi, N., Motamedi, F., 2006. Functional inactivation of orexin 1 receptors in CA1 region impairs acquisition, consolidation and retrieval in Morris water maze task. Behavioural Brain Research 173, 47–52. Akbari, Naghdi, N., Motamedi, F., 2007. The selective orexin 1 receptor antagonist SB-334867- A impairs acquisition and consolidation but not retrieval of spatial memory in Morris water maze. Peptides 28, 650–656. Al-Barazanji, K.A., Wilson, S., Baker, J., Jessop, D.S., Harbuz, M.S., 2001. Central Orexin-A Activates Hypothalamic-Pituitary-Adrenal Axis and Stimulates Hypothalamic Corticotropin Releasing Factor and Arginine Vasopressin Neurones in Conscious Rats. Journal of Neuroendocrinology 13, 421–424. Alam, M.N., Kumar, S., Bashir, T., Suntsova, N., Methippara, M.M., Szymusiak, R., McGinty, D., 2005. GABA-mediated control of hypocretin- but not melanin-concentrating hormone-immunoreactive neurones during sleep in rats. J. Physiol. (Lond.) 563, 569– 582. Alderson, H.L., Latimer, M.P., Winn, P., 2005. Involvement of the laterodorsal tegmental nucleus in the locomotor response to repeated nicotine administration. Neurosci. Lett. 380, 335–339. Allard, J.S., Tizabi, Y., Shaffery, J.P., Trouth, C.O., Manaye, K., 2004. Stereological analysis of the hypothalamic hypocretin/orexin neurons in an animal model of depression. Neuropeptides 38, 311–315. Allen, Cechetto, D.F., 1994. Serotoninergic and nonserotoninergic neurons in the medullary raphe system have axon collateral projections to autonomic and somatic cell groups in the medulla and spinal cord. The Journal of Comparative Neurology 350, 357–366. Allen, G.V., Cechetto, D.F., 1992. Functional and anatomical organization of cardiovascular pressor and depressor sites in the lateral hypothalamic area: I. Descending projections. J. Comp. Neurol. 315, 313–332. Allen, G.V., Cechetto, D.F., 1995. Neurotensin in the lateral hypothalamic area: origin and function. Neuroscience 69, 533–544. Amano, T., Duvarci, S., Popa, D., Paré, D., 2011. The fear circuit revisited: contributions of the basal amygdala nuclei to conditioned fear. J. Neurosci. 31, 15481–15489. Amano, T., Unal, C.T., Pare, D., 2010. Synaptic Correlates Of Fear Extinction In The Amygdala. Nat Neurosci 13, 489–494. Amaral, D.G., Cowan, W.M., 1980. Subcortical afferents to the hippocampal formation in the monkey. J. Comp. Neurol. 189, 573–591. Amat, Baratta, M.V., Paul, E., Bland, S.T., Watkins, L.R., Maier, S.F., 2005. Medial prefrontal cortex determines how stressor controllability affects behavior and dorsal raphe nucleus. Nat. Neurosci. 8, 365–371.

207

Amat, J., Aleksejev, R.M., Paul, E., Watkins, L.R., Maier, S.F., 2010. Behavioral control over shock blocks behavioral and neurochemical effects of later social defeat. Neuroscience 165, 1031–1038. Amat, J., Paul, E., Watkins, L.R., Maier, S.F., 2008. Activation of the ventral medial prefrontal cortex during an uncontrollable stressor reproduces both the immediate and long-term protective effects of behavioral control. Neuroscience 154, 1178–1186. Amat, Paul, E., Zarza, C., Watkins, L.R., Maier, S.F., 2006. Previous Experience with Behavioral Control over Stress Blocks the Behavioral and Dorsal Raphe Nucleus Activating Effects of Later Uncontrollable Stress: Role of the Ventral Medial Prefrontal Cortex. J. Neurosci. 26, 13264–13272. Ammoun, S., Holmqvist, T., Shariatmadari, R., Oonk, H.B., Detheux, M., Parmentier, M., Akerman, K.E.O., Kukkonen, J.P., 2003. Distinct recognition of OX1 and OX2 receptors by orexin peptides. J. Pharmacol. Exp. Ther. 305, 507–514. An, X., Bandler, R., Ongür, D., Price, J.L., 1998. Prefrontal cortical projections to longitudinal columns in the midbrain periaqueductal gray in macaque monkeys. J. Comp. Neurol. 401, 455–479. Antoniadis, E.A., McDonald, R.J., 2001. Amygdala, hippocampus, and unconditioned fear. Exp Brain Res 138, 200–209. Antoniadis, E.A., Winslow, J.T., Davis, M., Amaral, D.G., 2007. Role of the primate amygdala in fear-potentiated startle: effects of chronic lesions in the rhesus monkey. J. Neurosci. 27, 7386–7396. Aou, S., Li, X.-L., Li, A.-J., Oomura, Y., Shiraishi, T., Sasaki, K., Imamura, T., Wayner, M.J., 2003. Orexin-A (hypocretin-1) impairs Morris water maze performance and CA1- Schaffer collateral long-term potentiation in rats. Neuroscience 119, 1221–1228. Applegate, C.D., Frysinger, R.C., Kapp, B.S., Gallagher, M., 1982. Multiple unit activity recorded from amygdala central nucleus during Pavlovian heart rate conditioning in rabbit. Brain Res. 238, 457–462. Applegate, Kapp, Underwood, McNall, 1982. Autonomic and Somatomotor Effects of Amygdala Central N. Stimulation in Awake Rabbits. Physiology & Behavior 31, 353– 360. Arendt, D.H., Ronan, P.J., Oliver, K.D., Callahan, L.B., Summers, T.R., Summers, C.H., 2013. Depressive behavior and activation of the orexin/hypocretin system. Behav. Neurosci. 127, 86–94. Arrigoni, E., Mochizuki, T., Scammell, T.E., 2010. Activation of the basal forebrain by the orexin/hypocretin neurones. Acta Physiol (Oxf) 198, 223–235. Aston-Jones, G., Smith, R.J., Sartor, G.C., Moorman, D.E., Massi, L., Tahsili-Fahadan, P., Richardson, K.A., 2010. Lateral hypothalamic orexin/hypocretin neurons: A role in reward-seeking and addiction. Brain Res. 1314, 74–90. Avolio, E., Alò, R., Carelli, A., Canonaco, M., 2011. Amygdalar orexinergic-GABAergic interactions regulate anxiety behaviors of the Syrian golden hamster. Behav. Brain Res. 218, 288–295. Azhdari Zarmehri, H., Semnanian, S., Fathollahi, Y., Erami, E., Khakpay, R., Azizi, H., Rohampour, K., 2011. Intra-periaqueductal gray matter microinjection of orexin-A decreases formalin-induced nociceptive behaviors in adult male rats. J Pain 12, 280– 287. Bahar, A., Dorfman, N., Dudai, Y., 2004. Amygdalar circuits required for either consolidation or extinction of taste aversion memory are not required for reconsolidation. European Journal of Neuroscience 19, 1115–1118. Baldo, B.A., Daniel, R.A., Berridge, C.W., Kelley, A.E., 2003. Overlapping distributions of orexin/hypocretin- and dopamine-beta-hydroxylase immunoreactive fibers in rat brain regions mediating arousal, motivation, and stress. J. Comp. Neurol. 464, 220–237. Bandler, R., Keay, K.A., Floyd, N., Price, J., 2000. Central circuits mediating patterned autonomic activity during active vs. passive emotional coping. Brain Res. Bull. 53, 95– 104.

208

Bandler, R., Shipley, M.T., 1994. Columnar organization in the midbrain periaqueductal gray: modules for emotional expression? Trends Neurosci. 17, 379–389. Baranowska, D., Braszko, J.J., Wiśniewski, K., 1983. Effect of angiotensin II and vasopressin on acquisition and extinction of conditioned avoidance in rats. Psychopharmacology (Berl.) 81, 247–251. Baratta, M.V., Zarza, C.M., Gomez, D.M., Campeau, S., Watkins, L.R., Maier, S.F., 2009. Selective activation of dorsal raphe nucleus-projecting neurons in the ventral medial prefrontal cortex by controllable stress. European Journal of Neuroscience 30, 1111– 1116. Barbaresi, P., 2005. GABA-immunoreactive neurons and terminals in the cat periaqueductal gray matter: a light and electron microscopic study. J. Neurocytol. 34, 471–487. Barrot, M., Sesack, S.R., Georges, F., Pistis, M., Hong, S., Jhou, T.C., 2012. Braking dopamine systems: a new GABA master structure for mesolimbic and nigrostriatal functions. J. Neurosci. 32, 14094–14101. Beck, C.H., Fibiger, H.C., 1995. Conditioned fear-induced changes in behavior and in the expression of the immediate early gene c-fos: with and without diazepam pretreatment. J. Neurosci. 15, 709–720. Behbehani, M.M., 1995. Functional characteristics of the midbrain periaqueductal gray. Prog. Neurobiol. 46, 575–605. Behbehani, M.M., Jiang, M.R., Chandler, S.D., Ennis, M., 1990. The effect of GABA and its antagonists on midbrain periaqueductal gray neurons in the rat. Pain 40, 195–204. Behbehani, M.M., Park, M.R., Clement, M.E., 1988. Interactions between the lateral hypothalamus and the periaqueductal gray. J. Neurosci. 8, 2780–2787. Beitz, A.J., 1982. The organization of afferent projections to the midbrain periaqueductal gray of the rat. Neuroscience 7, 133–159. Bellgowan, P.S., Helmstetter, F.J., 1998. The role of mu and kappa opioid receptors within the periaqueductal gray in the expression of conditional hypoalgesia. Brain Res. 791, 83– 89. Bernard, J.F., Alden, M., Besson, J.M., 1993. The organization of the efferent projections from the pontine parabrachial area to the amygdaloid complex: a Phaseolus vulgaris leucoagglutinin (PHA-L) study in the rat. J. Comp. Neurol. 329, 201–229. Berretta, S., Pantazopoulos, H., Caldera, M., Pantazopoulos, P., Paré, D., 2005. Infralimbic cortex activation increases c-fos expression in intercalated neurons of the amygdala. Neuroscience 132, 943–953. Berthoud, H.R., Patterson, L.M., Sutton, G.M., Morrison, C., Zheng, H.Y., 2005. Orexin inputs to caudal raphe neurons involved in thermal, cardiovascular, and gastrointestinal regulation. Histochem. Cell Biol. 123, 147–156. Berton, O., Covington III, H.E., Ebner, K., Tsankova, N.M., Carle, T.L., Ulery, P., Bhonsle, A., Barrot, M., Krishnan, V., Singewald, G.M., Singewald, N., Birnbaum, S., Neve, R.L., Nestler, E.J., 2007. Induction of ΔFosB in the Periaqueductal Gray by Stress Promotes Active Coping Responses. Neuron 55, 289–300. Besnard, A., Caboche, J., Laroche, S., 2012. Reconsolidation of memory: A decade of debate. Progress in Neurobiology 99, 61–80. Bian, X., 2013. Physiological and morphological characterization of GABAergic neurons in the medial amygdala. Brain Res. 1509, 8–19. Birnbaum, S.G., Davis, M., 1998. Modulation of the acoustic startle reflex by infusion of corticotropin-releasing hormone into the nucleus reticularis pontis caudalis. Brain Res. 782, 318–323. Bisetti, A., Cvetkovic, V., Serafin, M., Bayer, L., Machard, D., Jones, B.E., Mühlethaler, M., 2006. Excitatory action of hypocretin/orexin on neurons of the central medial amygdala. Neuroscience 142, 999–1004. Bissiere, S., Zelikowsky, M., Ponnusamy, R., Jacobs, N.S., Blair, H.T., Fanselow, M.S., 2011. Electrical Synapses Control Hippocampal Contributions to Fear Learning and Memory. Science 331, 87–91.

209

Blanchard, D.C., Blanchard, R.J., 1972. Innate and conditioned reactions to threat in rats with amygdaloid lesions. J Comp Physiol Psychol 81, 281–290. Blanchard, E.B., Hickling, E.J., Galovski, T., Veazey, C., 2002. Emergency room vital signs and PTSD in a treatment seeking sample of motor vehicle accident survivors. J Trauma Stress 15, 199–204. Blouin, A.M., Fried, I., Wilson, C.L., Staba, R.J., Behnke, E.J., Lam, H.A., Maidment, N.T., Karlsson, K.Æ., Lapierre, J.L., Siegel, J.M., 2013. Human hypocretin and melanin- concentrating hormone levels are linked to emotion and social interaction. Nat Commun 4, 1547. Boersma, G.J., Benthem, L., van Dijk, G., Steimer, T.J., Scheurink, A.J.W., 2010. Coping style predicts the (in)sensitivity for developing hyperinsulinemia on a high fat diet in rats. Physiol. Behav. 100, 401–407. Bohus, B., Kova´cs, G.L., De Wied, D., 1978. Oxytocin, vasopressin and memory: opposite effects on consolidation and retrieval processes. Brain Research 157, 414–417. Bohus, Koolhaas, J.M., Luiten, P.G.M., Korte, S.M., Roozendaal, B., Wiersma, A., 1996. Chapter 27 The neurobiology of the central nucleus of the amygdala in relation to neuroendocrine and autonomic outflow. In: G. Holstege, R.B. and C.B.S. (Ed.), Progress in Brain Research. Elsevier, pp. 447–460. Boissard, R., Fort, P., Gervasoni, D., Barbagli, B., Luppi, P.-H., 2003. Localization of the GABAergic and non-GABAergic neurons projecting to the sublaterodorsal nucleus and potentially gating paradoxical sleep onset. Eur. J. Neurosci. 18, 1627–1639. Borelli, K.G., Albrechet-Souza, L., Fedoce, A.G., Fabri, D.S., Resstel, L.B., Brandão, M.L., 2013. Conditioned fear is modulated by CRF mechanisms in the periaqueductal gray columns. Horm Behav. Borelli, K.G., Ferreira-Netto, C., Brandão, M.L., 2006. Distribution of Fos immunoreactivity in the rat brain after freezing or escape elicited by inhibition of glutamic acid decarboxylase or antagonism of GABA-A receptors in the inferior colliculus. Behav. Brain Res. 170, 84–93. Borgland, S.L., Storm, E., Bonci, A., 2008. Orexin B/hypocretin 2 increases glutamatergic transmission to ventral tegmental area neurons. Eur. J. Neurosci. 28, 1545–1556. Borgland, S.L., Taha, S.A., Sarti, F., Fields, H.L., Bonci, A., 2006. Orexin A in the VTA is critical for the induction of synaptic plasticity and behavioral sensitization to cocaine. Neuron 49, 589–601. Borsody, M.K., Weiss, J.M., 1996. Influence of corticotropin-releasing hormone on electrophysiological activity of locus coeruleus neurons. Brain Research 724, 149–168. Bouret, S., Duvel, A., Onat, S., Sara, S.J., 2003. Phasic activation of locus ceruleus neurons by the central nucleus of the amygdala. J. Neurosci. 23, 3491–3497. Bourgeais, L., Gauriau, C., Bernard, J.F., 2001. Projections from the nociceptive area of the central nucleus of the amygdala to the forebrain: a PHA-L study in the rat. Eur. J. Neurosci. 14, 229–255. Boutrel, B., Cannella, N., de Lecea, L., 2010. The role of hypocretin in driving arousal and goal-oriented behaviors. Brain Res. 1314, 103–111. Boutrel, B., Kenny, P.J., Specio, S.E., Martin-Fardon, R., Markou, A., Koob, G.F., de Lecea, L., 2005. Role for hypocretin in mediating stress-induced reinstatement of cocaine-seeking behavior. Proc Natl Acad Sci U S A 102, 19168–19173. Bowers, L.K., Swisher, C.B., Behbehani, M.M., 2003. Membrane and synaptic effects of corticotropin-releasing factor on periaqueductal gray neurons of the rat. Brain Res. 981, 52–57. Bowman, B.R., Kumar, N.N., Hassan, S.F., McMullan, S., Goodchild, A.K., 2013. Brain sources of inhibitory input to the rat rostral ventrolateral medulla. J. Comp. Neurol. 521, 213–232. Brandão, M.L., Borelli, K.G., Nobre, M.J., Santos, J.M., Albrechet-Souza, L., Oliveira, A.R., Martinez, R.C., 2005. Gabaergic regulation of the neural organization of fear in the midbrain tectum. Neurosci Biobehav Rev 29, 1299–1311.

210

Brandão, M.L., Vianna, D.M., Masson, S., Santos, J., 2003. Neural organization of different types of fear: implications for the understanding of anxiety. Rev Bras Psiquiatr 25 Suppl 2, 36–41. Brevig, H.N., Watson, C.J., Lydic, R., Baghdoyan, H.A., 2010. Hypocretin and GABA interact in the pontine reticular formation to increase wakefulness. Sleep 33, 1285–1293. Brown, R.E., Sergeeva, O.A., Eriksson, K.S., Haas, H.L., 2002. Convergent excitation of dorsal raphe serotonin neurons by multiple arousal systems (orexin/hypocretin, histamine and noradrenaline). J. Neurosci. 22, 8850–8859. Brown, R.M., Khoo, S.Y.-S., Lawrence, A.J., 2013. Central orexin (hypocretin) 2 receptor antagonism reduces ethanol self-administration, but not cue-conditioned ethanol- seeking, in ethanol-preferring rats. Int. J. Neuropsychopharmacol. 16, 2067–2079. Brundin, L., Björkqvist, M., Petersén, A., Träskman-Bendz, L., 2007a. Reduced orexin levels in the cerebrospinal fluid of suicidal patients with major depressive disorder. Eur Neuropsychopharmacol 17, 573–579. Brundin, L., Björkqvist, M., Träskman-Bendz, L., Petersén, A., 2009. Increased orexin levels in the cerebrospinal fluid the first year after a suicide attempt. J Affect Disord 113, 179– 182. Brundin, L., Petersén, A., Björkqvist, M., Träskman-Bendz, L., 2007b. Orexin and psychiatric symptoms in suicide attempters. J Affect Disord 100, 259–263. Bryant, R.A., Felmingham, K.L., Kemp, A.H., Barton, M., Peduto, A.S., Rennie, C., Gordon, E., Williams, L.M., 2005. Neural networks of information processing in posttraumatic stress disorder: a functional magnetic resonance imaging study. Biol. Psychiatry 58, 111–118. Bryant, R.A., Marosszeky, J.E., Crooks, J., Gurka, J.A., 2004. Elevated resting heart rate as a predictor of posttraumatic stress disorder after severe traumatic brain injury. Psychosom Med 66, 760–761. Bucy, P.C., Kluver, H., 1955. An anatomical investigation of the temporal lobe in the monkey (Macaca mulatta). J. Comp. Neurol. 103, 151–251. Burgess, C.R., Oishi, Y., Mochizuki, T., Peever, J.H., Scammell, T.E., 2013. Amygdala Lesions Reduce Cataplexy in Orexin Knock-Out Mice. J. Neurosci. 33, 9734–9742. Burgos-Robles, A., Vidal-Gonzalez, I., Quirk, G.J., 2009. Sustained conditioned responses in prelimbic prefrontal neurons are correlated with fear expression and extinction failure. J Neurosci 29, 8474–8482. Burke, P.G.R., Li, Q., Costin, M.L., McMullan, S., Pilowsky, P.M., Goodchild, A.K., 2008. Somatostatin 2A receptor-expressing presympathetic neurons in the rostral ventrolateral medulla maintain blood pressure. Hypertension 52, 1127–1133. Burlet, S., Tyler, C.J., Leonard, C.S., 2002. Direct and indirect excitation of laterodorsal tegmental neurons by Hypocretin/Orexin peptides: implications for wakefulness and narcolepsy. J. Neurosci. 22, 2862–2872. Butler, P.D., Weiss, J.M., Stout, J.C., Nemeroff, C.B., 1990. Corticotropin-releasing factor produces fear-enhancing and behavioral activating effects following infusion into the locus coeruleus. J. Neurosci. 10, 176–183. Calandreau, L., Desmedt, A., Decorte, L., Jaffard, R., 2005. A different recruitment of the lateral and basolateral amygdala promotes contextual or elemental conditioned association in Pavlovian fear conditioning. Learn Mem 12, 383–388. Cameron, A.A., Khan, I.A., Westlund, K.N., Willis, W.D., 1995. The efferent projections of the periaqueductal gray in the rat: a Phaseolus vulgaris-leucoagglutinin study. II. Descending projections. J. Comp. Neurol. 351, 585–601. Campeau, S., Falls, W.A., Cullinan, W.E., Helmreich, D.L., Davis, M., Watson, S.J., 1997. Elicitation and reduction of fear: behavioural and neuroendocrine indices and brain induction of the immediate-early gene c-fos. Neuroscience 78, 1087–1104. Canteras, N.S., Simerly, R.B., Swanson, L.W., 1995. Organization of projections from the medial nucleus of the amygdala: A PHAL study in the rat. The Journal of Comparative Neurology 360, 213–245.

211

Canteras, N.S., Swanson, L.W., 1992. Projections of the ventral subiculum to the amygdala, septum, and hypothalamus: A PHAL anterograde tract-tracing study in the rat. The Journal of Comparative Neurology 324, 180–194. Careau, V., Thomas, D., Humphries, M.M., Réale, D., 2008. Energy metabolism and animal personality. Oikos 117, 641–653. Carrive, 2006. Dual activation of cardiac sympathetic and parasympathetic components during conditioned fear to context in the rat. Clin. Exp. Pharmacol. Physiol. 33, 1251–1254. Carrive, Bowen, R., Walker, P., 1999. Role of the perifornical and paraventricular nuclei in the cardiovascular component of conditioned stress demonstrated by bilateral blockade with kynurenic acid and and muscimol. Proc. Aust. Neuroscience Soc. 10. Carrive, Gorissen, M., 2008. Premotor sympathetic neurons of conditioned fear in the rat. Eur. J. Neurosci. 28, 428–446. Carrive, Kehoe, E.J., Macrae, M., Paxinos, G., 1997a. Fos-like immunoreactivity in locus coeruleus after classical conditioning of the rabbit’s nictitating membrane response. Neurosci. Lett. 223, 33–36. Carrive, Leung, P., Harris, J., Paxinos, G., 1997b. Conditioned fear to context is associated with increased Fos expression in the caudal ventrolateral region of the midbrain periaqueductal gray. Neuroscience 78, 165–177. Carrive, P., 1993. The periaqueductal gray and defensive behavior: functional representation and neuronal organization. Behav. Brain Res. 58, 27–47. Carrive, P., Bandler, R., 1991. Control of extracranial and hindlimb blood flow by the midbrain periaqueductal grey of the cat. Exp Brain Res 84, 599–606. Carrive, P., Lee, J., Su, A., 1999. Lidocaine blockade of amygdala output in fear-conditioned rats reduces Fos expression in the ventrolateral periaqueductal gray. Neuroscience 95, 1071–1080. Carter, M.E., Adamantidis, A., Ohtsu, H., Deisseroth, K., de Lecea, L., 2009. Sleep homeostasis modulates hypocretin-mediated sleep-to-wake transitions. J. Neurosci. 29, 10939– 10949. Cassell, M.D., Gray, T.S., 1989a. The amygdala directly innervates adrenergic (C1) neurons in the ventrolateral medulla in the rat. Neurosci. Lett. 97, 163–168. Cassell, M.D., Gray, T.S., 1989b. Morphology of peptide-immunoreactive neurons in the rat central nucleus of the amygdala. J. Comp. Neurol. 281, 320–333. Cassella, J.V., Harty, T.P., Davis, M., 1986. Fear conditioning, pre-pulse inhibition and drug modulation of a short latency startle response measured electromyographically from neck muscles in the rat. Physiol. Behav. 36, 1187–1191. Chang, S.-D., Liang, K.C., 2012. Roles of hippocampal GABA(A) and muscarinic receptors in consolidation of context memory and context-shock association in contextual fear conditioning: a double dissociation study. Neurobiol Learn Mem 98, 17–24. Chen, X., Wang, H., Lin, Z., Li, S., Li, Y., Bergen, H.T., Vrontakis, M.E., Kirouac, G.J., 2013. Orexins (hypocretins) contribute to fear and avoidance in rats exposed to a single episode of footshocks. Brain Struct Funct. Chen, Y.-L., Li, A.H., Yeh, T.-H., Chou, A.-H., Wang, H.-L., 2009. Nocistatin and nociceptin exert opposite effects on the excitability of central amygdala nucleus-periaqueductal gray projection neurons. Mol. Cell. Neurosci. 40, 76–88. Chieng, B., Christie, M.J., 2010. Somatostatin and nociceptin inhibit neurons in the central nucleus of amygdala that project to the periaqueductal grey. Neuropharmacology 59, 425–430. Chieng, Christie, M.J., 2009. Chronic morphine treatment induces functional delta-opioid receptors in amygdala neurons that project to periaqueductal grey. Neuropharmacology 57, 430–437. Chieng, Christie, M.J., Osborne, P.B., 2006. Characterization of neurons in the rat central nucleus of the amygdala: cellular physiology, morphology, and opioid sensitivity. J. Comp. Neurol. 497, 910–927.

212

Chiou, R.-J., Kuo, C.-C., Liang, K.-C., Yen, C.-T., 2009. State-dependent amygdala stimulation-induced cardiovascular effects in rats. Chin J Physiol 52, 432–440. Choi, J.-S., Cain, C.K., LeDoux, J.E., 2010. The role of amygdala nuclei in the expression of auditory signaled two-way active avoidance in rats. Learn. Mem. 17, 139–147. Chou, T.C., Lee, C.E., Lu, J., Elmquist, J.K., Hara, J., Willie, J.T., Beuckmann, C.T., Chemelli, R.M., Sakurai, T., Yanagisawa, M., Saper, C.B., Scammell, T.E., 2001. Orexin (hypocretin) neurons contain dynorphin. J. Neurosci. 21, RC168. Chuang, J.-Y., Lin, K.-Y., Cherng, C.G., Yu, L., 2012. Involvement of amygdaloid protein synthesis in early- and late-phase reconsolidation of emotion-related memories. Chin J Physiol 55, 314–322. Chung, Y.A., Kim, S.H., Chung, S.K., Chae, J.-H., Yang, D.W., Sohn, H.S., Jeong, J., 2006. Alterations in cerebral perfusion in posttraumatic stress disorder patients without re- exposure to accident-related stimuli. Clin Neurophysiol 117, 637–642. Ciocchi, S., 2009. Fear conditioning- and extinction-induced neuronal plasticity in the mouse amygdala. University of Basel. Ciocchi, S., Herry, C., Grenier, F., Wolff, S.B.E., Letzkus, J.J., Vlachos, I., Ehrlich, I., Sprengel, R., Deisseroth, K., Stadler, M.B., Müller, C., Lüthi, A., 2010. Encoding of conditioned fear in central amygdala inhibitory circuits. Nature 468, 277–282. Ciriello, J., de Oliveira, C.V.R., 2003. Cardiac effects of hypocretin-1 in nucleus ambiguus. Am. J. Physiol. Regul. Integr. Comp. Physiol. 284, R1611–1620. Ciriello, J., Li, Z., de Oliveira, C.V.R., 2003. Cardioacceleratory responses to hypocretin-1 injections into rostral ventromedial medulla. Brain Res. 991, 84–95. Cluderay, J.E., Harrison, D.C., Hervieu, G.J., 2002. Protein distribution of the orexin-2 receptor in the rat central nervous system. Regul. Pept. 104, 131–144. Cohen, R.S., Blomberg, F., Berzins, K., Siekevitz, P., 1977. The structure of postsynaptic densities isolated from dog cerebral cortex. I. Overall morphology and protein composition. J. Cell Biol. 74, 181–203. Collins, D.R., Paré, D., 1999. Reciprocal Changes in the Firing Probability of Lateral and Central Medial Amygdala Neurons. J. Neurosci. 19, 836–844. Commons, K.G., Valentino, R.J., 2002. Cellular basis for the effects of substance P in the periaqueductal gray and dorsal raphe nucleus. J. Comp. Neurol. 447, 82–97. Conrad, K.L., Davis, A.R., Silberman, Y., Sheffler, D.J., Shields, A.D., Saleh, S.A., Sen, N., Matthies, H.J., Javitch, J.A., Lindsley, C.W., Winder, D.G., 2012. Yohimbine Depresses Excitatory Transmission in BNST and Impairs Extinction of Cocaine Place Preference Through Orexin-Dependent, Norepinephrine-Independent Processes. Neuropsychopharmacology 37, 2253–2266. Conzales, C., Chesselet, M.-F., 1990. Amygdalonigral pathway: An anterograde study in the rat with Phaseolus vulgaris leucoagglutinin (PHA-L). The Journal of Comparative Neurology 297, 182–200. Coover, G., Ursin, H., Levine, S., 1973. Corticosterone and avoidance in rats with basolateral amygdala lesions. J Comp Physiol Psychol 85, 111–122. Corcoran, K.A., Desmond, T.J., Frey, K.A., Maren, S., 2005. Hippocampal inactivation disrupts the acquisition and contextual encoding of fear extinction. J. Neurosci. 25, 8978–8987. Corcoran, K.A., Quirk, G.J., 2007. Activity in prelimbic cortex is necessary for the expression of learned, but not innate, fears. J. Neurosci. 27, 840–844. Cox, G.E., Jordan, D., Moruzzi, P., Schwaber, J.S., Spyer, K.M., Turner, S.A., 1986. Amygdaloid influences on brain-stem neurones in the rabbit. J. Physiol. (Lond.) 381, 135–148. Crane, J.W., Ebner, K., Day, T.A., 2003. Medial prefrontal cortex suppression of the hypothalamic-pituitary-adrenal axis response to a physical stressor, systemic delivery of interleukin-1beta. Eur. J. Neurosci. 17, 1473–1481. Curtis, A.L., Bello, N.T., Connolly, K.R., Valentino, R.J., 2002. Corticotropin-releasing factor neurones of the central nucleus of the amygdala mediate locus coeruleus activation by cardiovascular stress. J. Neuroendocrinol. 14, 667–682.

213

Curtis, A.L., Lechner, S.M., Pavcovich, L.A., Valentino, R.J., 1997. Activation of the locus coeruleus noradrenergic system by intracoerulear microinfusion of corticotropin- releasing factor: effects on discharge rate, cortical norepinephrine levels and cortical electroencephalographic activity. J. Pharmacol. Exp. Ther. 281, 163–172. da Costa Gomez, Behbehani, M.M., 1995. An electrophysiological characterization of the projection from the central nucleus of the amygdala to the periaqueductal gray of the rat: the role of opioid receptors. Brain Res. 689, 21–31. Da Cunha, C., Roozendaal, B., Vazdarjanova, A., McGaugh, J.L., 1999. Microinfusions of flumazenil into the basolateral but not the central nucleus of the amygdala enhance memory consolidation in rats. Neurobiol Learn Mem 72, 1–7. Da Silva, L.F.S., Coimbra, N.C., Menescal-de-Oliveira, L., 2013. Rostral ventromedial medulla connections in Cavia porcellus and their relation with tonic immobility defensive behavior: a biotinylated dextran amine neurotracing study. Neurosci. Lett. 535, 116– 121. Da Silva, L.F.S., Menescal-de-Oliveira, L., 2007. Role of opioidergic and GABAergic neurotransmission of the nucleus raphe magnus in the modulation of tonic immobility in guinea pigs. Brain Res. Bull. 72, 25–31. Dampney, R.A., Li, Y.W., Hirooka, Y., Potts, P., Polson, J.W., 1995. Use of c-fos functional mapping to identify the central baroreceptor reflex pathway: advantages and limitations. Clin. Exp. Hypertens. 17, 197–208. Dampney, R.A.L., Horiuchi, J., 2003. Functional organisation of central cardiovascular pathways: studies using c-fos gene expression. Prog. Neurobiol. 71, 359–384. Danielsen, E.H., Magnuson, D.J., Gray, T.S., 1989. The central amygdaloid nucleus innervation of the dorsal vagal complex in rat: A Phaseolus vulgaris leucoagglutinin lectin anterograde tracing study. Brain Research Bulletin 22, 705–715. Date, Y., Ueta, Y., Yamashita, H., Yamaguchi, H., Matsukura, S., Kangawa, K., Sakurai, T., Yanagisawa, M., Nakazato, M., 1999. Orexins, orexigenic hypothalamic peptides, interact with autonomic, neuroendocrine and neuroregulatory systems. Proc Natl Acad Sci U S A 96, 748–753. Davern, P.J., Head, G.A., 2011. Role of the medial amygdala in mediating responses to aversive stimuli leading to hypertension. Clin. Exp. Pharmacol. Physiol. 38, 136–143. Davis, J.F., Krause, E.G., Melhorn, S.J., Sakai, R.R., Benoit, S.C., 2009. Dominant rats are natural risk takers and display increased motivation for food reward. Neuroscience 162, 23–30. Davis, M., 1992a. The role of the amygdala in fear and anxiety. Annu. Rev. Neurosci. 15, 353– 375. Davis, M., 1992b. The role of the amygdala in fear-potentiated startle: implications for animal models of anxiety. Trends Pharmacol. Sci. 13, 35–41. Davis, M., 1992c. The role of the amygdala in conditioned fear. In: The Amygdala: Neurobiological Aspects of Emotion, Memory, and Mental Dysfunction. Wiley-Liss, New York, NY, US, pp. 255–306. Davis, M., 2000. The Amygdala: A Functional Analysis, 2nd ed. Oxford University Press, USA. Davis, M., Gendelman, D.S., Tischler, M.D., Gendelman, P.M., 1982. A primary acoustic startle circuit: lesion and stimulation studies. J. Neurosci. 2, 791–805. Davis, M., Rainnie, D., Cassell, M., 1994. Neurotransmission in the rat amygdala related to fear and anxiety. Trends Neurosci. 17, 208–214. Davis, M., Walker, D.L., Lee, Y., 1997. Amygdala and bed nucleus of the stria terminalis: differential roles in fear and anxiety measured with the acoustic startle reflex. Philos. Trans. R. Soc. Lond., B, Biol. Sci. 352, 1675–1687. Davis, Walker, D.L., Miles, L., Grillon, C., 2010. Phasic vs sustained fear in rats and humans: role of the extended amygdala in fear vs anxiety. Neuropsychopharmacology 35, 105– 135. Davis, Whalen, P.J., 2001. The amygdala: vigilance and emotion. Mol. Psychiatry 6, 13–34.

214

Day, H.E., Curran, E.J., Watson, S.J., Jr, Akil, H., 1999. Distinct neurochemical populations in the rat central nucleus of the amygdala and bed nucleus of the stria terminalis: evidence for their selective activation by interleukin-1beta. J. Comp. Neurol. 413, 113–128. Day, Kryskow, E.M., Nyhuis, T.J., Herlihy, L., Campeau, S., 2008. Conditioned fear inhibits c- fos mRNA expression in the central extended amygdala. Brain Research 1229, 137– 146. Dayas, C.V., Buller, K.M., Crane, J.W., Xu, J., Day, T.A., 2001. Stressor categorization: acute physical and psychological stressors elicit distinctive recruitment patterns in the amygdala and in medullary noradrenergic cell groups. Eur. J. Neurosci. 14, 1143–1152. Dayas, C.V., Buller, K.M., Day, T.A., 1999. Neuroendocrine responses to an emotional stressor: evidence for involvement of the medial but not the central amygdala. European Journal of Neuroscience 11, 2312–2322. Dayas, C.V., Day, T.A., 2002. Opposing roles for medial and central amygdala in the initiation of noradrenergic cell responses to a psychological stressor. Eur. J. Neurosci. 15, 1712– 1718. Dayas, C.V., McGranahan, T.M., Martin-Fardon, R., Weiss, F., 2008. Stimuli linked to ethanol availability activate hypothalamic CART and orexin neurons in a reinstatement model of relapse. Biol. Psychiatry 63, 152–157. De Armentia, M.L., Sah, P., 2007. Bidirectional synaptic plasticity at nociceptive afferents in the rat central amygdala. J Physiol 581, 961–970. De Lecea, L., Kilduff, T.S., Peyron, C., Gao, X., Foye, P.E., Danielson, P.E., Fukuhara, C., Battenberg, E.L., Gautvik, V.T., Bartlett, F.S., 2nd, Frankel, W.N., van den Pol, A.N., Bloom, F.E., Gautvik, K.M., Sutcliffe, J.G., 1998. The hypocretins: hypothalamus- specific peptides with neuroexcitatory activity. Proc. Natl. Acad. Sci. U.S.A. 95, 322– 327. De Luca-Vinhas, M.C.Z., Macedo, C.E., Brandão, M.L., 2006. Pharmacological assessment of the freezing, antinociception, and exploratory behavior organized in the ventrolateral periaqueductal gray. Pain 121, 94–104. De Oca, B.M., DeCola, J.P., Maren, S., Fanselow, M.S., 1998. Distinct regions of the periaqueductal gray are involved in the acquisition and expression of defensive responses. J. Neurosci. 18, 3426–3432. De Oliveira, C.V.R., Rosas-Arellano, M.P., Solano-Flores, L.P., Ciriello, J., 2003. Cardiovascular effects of hypocretin-1 in nucleus of the solitary tract. Am. J. Physiol. Heart Circ. Physiol. 284, H1369–1377. Deadwyler, S.A., Porrino, L., Siegel, J.M., Hampson, R.E., 2007. Systemic and nasal delivery of orexin-A (Hypocretin-1) reduces the effects of sleep deprivation on cognitive performance in nonhuman primates. J. Neurosci. 27, 14239–14247. Dębiec, Bush, D.E.A., LeDoux, J.E., 2011. Noradrenergic enhancement of reconsolidation in the amygdala impairs extinction of conditioned fear in rats-a possible mechanism for the persistence of traumatic memories in PTSD. Depression and Anxiety 28, 186–193. De biec, J., 2012. Memory Reconsolidation Processes and Posttraumatic Stress Disorder: Promises and Challenges of Translational Research. Biological Psychiatry 71, 284–285. Dębiec, Ledoux, J.E., 2004. Disruption of reconsolidation but not consolidation of auditory fear conditioning by noradrenergic blockade in the amygdala. Neuroscience 129, 267–272. Deolindo, Pelosi, G.G., Busnardo, C., Resstel, L.B.M., Corrêa, F.M.A., 2011. Cardiovascular effects of acetylcholine microinjection into the ventrolateral and dorsal periaqueductal gray of rats. Brain Res. 1371, 74–81. Depaulis, A., Keay, K.A., Bandler, R., 1994. Quiescence and hyporeactivity evoked by activation of cell bodies in the ventrolateral midbrain periaqueductal gray of the rat. Exp Brain Res 99, 75–83. Depaulis, A., Morgan, M.M., Liebeskind, J.C., 1987. GABAergic modulation of the analgesic effects of morphine microinjected in the ventral periaqueductal gray matter of the rat. Brain Res. 436, 223–228.

215

Dias, M.B., Li, A., Nattie, E.E., 2009. Antagonism of orexin receptor-1 in the retrotrapezoid nucleus inhibits the ventilatory response to hypercapnia predominantly in wakefulness. J. Physiol.-London 587, 2059–2067. Dielenberg, R.A., unt, G.E., McGregor, I.S., 2001. “When a rat smells a cat”: the distribution of Fos immunoreactivity in rat brain following exposure to a predatory odor. Neuroscience 104, 1085–1097. Diergaarde, L., Schoffelmeer, A.N.M., De Vries, T.J., 2006. β-adrenoceptor mediated inhibition of long-term reward-related memory reconsolidation. Behavioural Brain Research 170, 333–336. Dietrich, H., Jenck, F., 2010. Intact learning and memory in rats following treatment with the dual orexin receptor antagonist almorexant. Psychopharmacology 212, 145–154. Dobbs, L.K., Mark, G.P., 2012. Acetylcholine from the mesopontine tegmental nuclei differentially affects methamphetamine induced locomotor activity and neurotransmitter levels in the mesolimbic pathway. Behav Brain Res 226, 224–234. Dong, H.-W., Petrovich, G.., Swanson, L.., 2000. Organization of projections from the juxtacapsular nucleus of the BST: a PHAL study in the rat. Brain Research 859, 1–14. Dong, H.-W., Swanson, L.W., 2003. Projections from the rhomboid nucleus of the bed nuclei of the stria terminalis: Implications for cerebral hemisphere regulation of ingestive behaviors. The Journal of Comparative Neurology 463, 434–472. Dong, H.-W., Swanson, L.W., 2004. Projections from bed nuclei of the stria terminalis, posterior division: Implications for cerebral hemisphere regulation of defensive and reproductive behaviors. The Journal of Comparative Neurology 471, 396–433. Dong, H.-W., Swanson, L.W., 2006. Projections from bed nuclei of the stria terminalis, dorsomedial nucleus: implications for cerebral hemisphere integration of neuroendocrine, autonomic, and drinking responses. J. Comp. Neurol. 494, 75–107. Dong, Petrovich, G.D., Swanson, L.W., 2001a. Topography of projections from amygdala to bed nuclei of the stria terminalis. Brain Res. Brain Res. Rev. 38, 192–246. Dong, Petrovich, G.D., Watts, A.G., Swanson, L.W., 2001b. Basic organization of projections from the oval and fusiform nuclei of the bed nuclei of the stria terminalis in adult rat brain. J. Comp. Neurol. 436, 430–455. Dong, Swanson, L., 2006a. Projections from Bed Nuclei of the Stria Terminalis, Magnocellular Nucleus: Implications for Cerebral Hemisphere Regulation of Micturition, Defecation, and Penile Erection. J Comp Neurol 494, 108–141. Dong, Swanson, L.W., 2004. Organization of axonal projections from the anterolateral area of the bed nuclei of the stria terminalis. J. Comp. Neurol. 468, 277–298. Dong, Swanson, L.W., 2006b. Projections from bed nuclei of the stria terminalis, anteromedial area: cerebral hemisphere integration of neuroendocrine, autonomic, and behavioral aspects of energy balance. J. Comp. Neurol. 494, 142–178. Drevets, W.C., 1999. Prefrontal cortical-amygdalar metabolism in major depression. Ann. N. Y. Acad. Sci. 877, 614–637. Drevets, W.C., 2000. Functional anatomical abnormalities in limbic and prefrontal cortical structures in major depression. Prog. Brain Res. 126, 413–431. Drevets, W.C., Ongür, D., Price, J.L., 1998. Reduced glucose metabolism in the subgenual prefrontal cortex in unipolar depression. Mol. Psychiatry 3, 190–191. Drew, G.M., Lau, B.K., Vaughan, C.W., 2009. Substance P drives endocannabinoid-mediated disinhibition in a midbrain descending analgesic pathway. J. Neurosci. 29, 7220–7229. Dumont, E.C., Martina, M., Samson, R.D., Drolet, G., Paré, D., 2002. Physiological properties of central amygdala neurons: species differences. Eur. J. Neurosci. 15, 545–552. Duvarci, S., Mamou, C. ben, Nader, K., 2006. Extinction is not a sufficient condition to prevent fear memories from undergoing reconsolidation in the basolateral amygdala. European Journal of Neuroscience 24, 249–260. Duvarci, S., Nader, K., 2004. Characterization of Fear Memory Reconsolidation. J. Neurosci. 24, 9269–9275.

216

Duvarci, S., Popa, D., Paré, D., 2011. Central amygdala activity during fear conditioning. J. Neurosci. 31, 289–294. Egwuenu, E.J., Fong, A.Y., Pilowsky, P.M., 2012. Intrathecal melanin-concentrating hormone reduces sympathetic tone and blocks cardiovascular reflexes. Am. J. Physiol. Regul. Integr. Comp. Physiol. 303, R624–632. Ehrlich, I., Humeau, Y., Grenier, F., Ciocchi, S., Herry, C., Lüthi, A., 2009. Amygdala inhibitory circuits and the control of fear memory. Neuron 62, 757–771. Eisenberg, M., 2003. Stability of retrieved memory: inverse correlation with trace dominance. Science (New York, N.Y.) 301, 1102–4. Eisenberg, M., Dudai, Y., 2004. Reconsolidation of fresh, remote, and extinguished fear memory in Medaka: old fears don’t die. Eur. J. Neurosci. 20, 3397–3403. El-Amamy, H., Holland, P.C., 2007. Dissociable effects of disconnecting amygdala central nucleus from the ventral tegmental area or substantia nigra on learned orienting and incentive motivation. Eur J Neurosci 25, 1557–1567. Ennis, M., Behbehani, M., Shipley, M.T., Van Bockstaele, E.J., Aston-Jones, G., 1991. Projections from the periaqueductal gray to the rostromedial pericoerulear region and nucleus locus coeruleus: anatomic and physiologic studies. J. Comp. Neurol. 306, 480– 494. Erb, S., Salmaso, N., Rodaros, D., Stewart, J., 2001. A role for the CRF-containing pathway from central nucleus of the amygdala to bed nucleus of the stria terminalis in the stress- induced reinstatement of cocaine seeking in rats. Psychopharmacology (Berl.) 158, 360–365. Eriksson, K.S., Sergeeva, O., Brown, R.E., Haas, H.L., 2001. Orexin/hypocretin excites the histaminergic neurons of the tuberomammillary nucleus. J. Neurosci. 21, 9273–9279. España, R.., Baldo, B.., Kelley, A.., Berridge, C.., 2001. Wake-promoting and sleep-suppressing actions of hypocretin (orexin): basal forebrain sites of action. Neuroscience 106, 699– 715. Espana, R.A., McCormack, S.L., Mochizuki, T., Scammell, T.E., 2007. Running Promotes Wakefulness and Increases Cataplexy in Orexin Knockout Mice. Sleep 30, 1417–1425. Fadel, J., Burk, J.A., 2010. Orexin/hypocretin modulation of the basal forebrain cholinergic system: Role in attention. Brain Res. 1314, 112–123. Fadel, J., Deutch, A.., 2002a. Anatomical substrates of orexin–dopamine interactions: lateral hypothalamic projections to the ventral tegmental area. Neuroscience 111, 379–387. Fadel, J., Deutch, A.Y., 2002b. Anatomical substrates of orexin-dopamine interactions: lateral hypothalamic projections to the ventral tegmental area. Neuroscience 111, 379–387. Fanselow, M.S., 1986. Conditioned Fear-Induced Opiate Analgesia: A Competing Motivational State Theory of Stress Analgesiaa. Annals of the New York Academy of Sciences 467, 40–54. Fanselow, M.S., 1994. Neural organization of the defensive behavior system responsible for fear. Psychon Bull Rev 1, 429–438. Feinstein, J.S., Buzza, C., Hurlemann, R., Follmer, R.L., Dahdaleh, N.S., Coryell, W.H., Welsh, M.J., Tranel, D., Wemmie, J.A., 2013. Fear and panic in humans with bilateral amygdala damage. Nat. Neurosci. 16, 270–272. Fendt, M., Endres, T., Apfelbach, R., 2003. Temporary inactivation of the bed nucleus of the stria terminalis but not of the amygdala blocks freezing induced by trimethylthiazoline, a component of fox feces. J. Neurosci. 23, 23–28. Fendt, M., Koch, M., Schnitzler, H.U., 1997. Corticotropin-releasing factor in the caudal pontine reticular nucleus mediates the expression of fear-potentiated startle in the rat. Eur. J. Neurosci. 9, 299–305. Fernandez de Molina, A., Hunsperger, R.W., 1959. Central representation of affective reactions in forebrain and brain stem: electrical stimulation of amygdala, stria terminalis, and adjacent structures. J. Physiol. (Lond.) 145, 251–265.

217

Floyd, N.S., Price, J.L., Ferry, A.T., Keay, K.A., Bandler, R., 2000. Orbitomedial prefrontal cortical projections to distinct longitudinal columns of the periaqueductal gray in the rat. The Journal of Comparative Neurology 422, 556–578. Floyd, N.S., Price, J.L., Ferry, A.T., Keay, K.A., Bandler, R., 2001. Orbitomedial prefrontal cortical projections to hypothalamus in the rat. J. Comp. Neurol. 432, 307–328. Fredericks, A., Moore, J.W., Metcalf, F.U., Schwaber, J.S., Schneiderman, N., 1974. Selective autonomic blockade of conditioned and unconditioned heart rate changes in rabbits. Pharmacol. Biochem. Behav. 2, 493–501. Fremeau, R.T., Jr, Burman, J., Qureshi, T., Tran, C.H., Proctor, J., Johnson, J., Zhang, H., Sulzer, D., Copenhagen, D.R., Storm-Mathisen, J., Reimer, R.J., Chaudhry, F.A., Edwards, R.H., 2002. The identification of vesicular glutamate transporter 3 suggests novel modes of signaling by glutamate. Proc. Natl. Acad. Sci. U.S.A. 99, 14488–14493. Fritz, R., Yilmazer-Hanke, D., Roskoden, T., Schwegler, H., Linke, R., 2005. Separate sets of neurons of the central nucleus of the amygdala project to the substantia innominata and the caudal pontine reticular nucleus in the rat. Neurosci. Lett. 373, 130–133. Frysinger, R.C., Marks, J.D., Trelease, R.B., Schechtman, V.L., Harper, R.M., 1984. Sleep states attenuate the pressor response to central amygdala stimulation. Exp. Neurol. 83, 604–617. Fudge, J.L., Haber, S.N., 2000. The central nucleus of the amygdala projection to dopamine subpopulations in primates. Neuroscience 97, 479–494. Fung, Manzoni, D., Chan, J.Y., Pompeiano, O., Barnes, C.D., 1991. Locus coeruleus control of spinal motor output. Prog. Brain Res. 88, 395–409. Fung, Xi, Zhang, J., Torterolo, P., Sampogna, S., Morales, F.R., Chase, M.H., 2011. Projection Neurons from The Central Nucleus of The Amygdala to The Nucleus Pontis Oralis. J Neurosci Res 89, 429–436. Furlong, 2006. An investigation of the role of the neuropeptide hypocretin/orexin in stress. Furlong, T., Carrive, P., 2007. Neurotoxic lesions centered on the perifornical hypothalamus abolish the cardiovascular and behavioral responses of conditioned fear to context but not of restraint. Brain Res. 1128, 107–119. Furlong, Vianna, D.M.L., Liu, L., Carrive, P., 2009. Hypocretin/orexin contributes to the expression of some but not all forms of stress and arousal. Eur. J. Neurosci. 30, 1603– 1614. Furutani, N., Hondo, M., Kageyama, H., Tsujino, N., Mieda, M., Yanagisawa, M., Shioda, S., Sakurai, T., 2013. Neurotensin Co-Expressed in Orexin-Producing Neurons in the Lateral Hypothalamus Plays an Important Role in Regulation of Sleep/Wakefulness States. PLoS ONE 8, e62391. Garland, T., Schutz, H., Chappell, M.A., Keeney, B.K., Meek, T.H., Copes, L.E., Acosta, W., Drenowatz, C., Maciel, R.C., van Dijk, G., Kotz, C.M., Eisenmann, J.C., 2011. The biological control of voluntary exercise, spontaneous physical activity and daily energy expenditure in relation to obesity: human and rodent perspectives. J Exp Biol 214, 206– 229. Geerling, J.C., Mettenleiter, T.C., Loewy, A.D., 2003. Orexin neurons project to diverse sympathetic outflow systems. Neuroscience 122, 541–550. Gelsema, A.J., Agarwal, S.K., Calaresu, F.R., 1989. Cardiovascular responses and changes in neural activity in the rostral ventrolateral medulla elicited by electrical stimulation of the amygdala of the rat. J. Auton. Nerv. Syst. 27, 91–100. Gelsema, A.J., Copeland, N.E., Drolet, G., Bachelard, H., 1993. Cardiovascular effects of neuronal activation of the extended amygdala in rats. Brain Res. 626, 156–166. Gelsema, A.J., McKitrick, D.J., Calaresu, F.R., 1987. Cardiovascular responses to chemical and electrical stimulation of amygdala in rats. Am. J. Physiol. 253, R712–718. Georgescu, D., Zachariou, V., Barrot, M., Mieda, M., Willie, J.T., Eisch, A.J., Yanagisawa, M., Nestler, E.J., DiLeone, R.J., 2003. Involvement of the Lateral Hypothalamic Peptide Orexin in Morphine Dependence and Withdrawal. J. Neurosci. 23, 3106–3111.

218

Germain, A., Buysse, D.J., Nofzinger, E., 2008. Sleep-specific Mechanisms Underlying Posttraumatic Stress Disorder: Integrative Review and Neurobiological Hypotheses. Sleep Med Rev 12, 185–195. Gilpin, N.W., 2012. Corticotropin-releasing factor (CRF) and neuropeptide Y (NPY): Effects on inhibitory transmission in central amygdala, and anxiety- & alcohol-related behaviors. Alcohol 46, 329–337. Gilpin, N.W., Roberto, M., 2012. Neuropeptide modulation of central amygdala neuroplasticity is a key mediator of alcohol dependence. Neurosci Biobehav Rev 36, 873–888. González-Pardo, H., Conejo, N.M., Lana, G., Arias, J.L., 2012. Different brain networks underlying the acquisition and expression of contextual fear conditioning: a metabolic mapping study. Neuroscience 202, 234–242. Good, A.J., Westbrook, R.F., 1995. Effects of a microinjection of morphine into the amygdala on the acquisition and expression of conditioned fear and hypoalgesia in rats. Behavioral Neuroscience 109, 631–641. Goosens, K.A., Maren, S., 2001. Contextual and Auditory Fear Conditioning are Mediated by the Lateral, Basal, and Central Amygdaloid Nuclei in Rats. Learn Mem 8, 148–155. Goosens, K.A., Maren, S., 2003. Pretraining NMDA receptor blockade in the basolateral complex, but not the central nucleus, of the amygdala prevents savings of conditional fear. Behav. Neurosci. 117, 738–750. Goto, M., Swanson, L.W., 2004. Axonal projections from the parasubthalamic nucleus. J. Comp. Neurol. 469, 581–607. Gozzi, A., Jain, A., Giovannelli, A., Giovanelli, A., Bertollini, C., Crestan, V., Schwarz, A.J., Tsetsenis, T., Ragozzino, D., Gross, C.T., Bifone, A., 2010. A neural switch for active and passive fear. Neuron 67, 656–666. Gray, T.S., 1993. Amygdaloid CRF pathways. Role in autonomic, neuroendocrine, and behavioral responses to stress. Ann. N. Y. Acad. Sci. 697, 53–60. Gray, T.S., Cassell, M.D., Nilaver, G., Zimmerman, E.A., Williams, T.H., 1984. The distribution and ultrastructure of VIP-immunoreactivity in the central nucleus of the rat amygdala. Neuroscience 11, 399–408. Gray, T.S., Magnuson, D.J., 1987. Galanin-like immunoreactivity within amygdaloid and hypothalamic neurons that project to the midbrain central grey in rat. Neurosci. Lett. 83, 264–268. Gray, T.S., Magnuson, D.J., 1992. Peptide immunoreactive neurons in the amygdala and the bed nucleus of the stria terminalis project to the midbrain central gray in the rat. Peptides 13, 451–460. Green, S., Vale, A.L., 1992. Role of amygdaloid nuclei in the anxiolytic effects of benzodiazepines in rats. Behav Pharmacol 3, 261–264. Grossberg, A.J., Zhu, X., Leinninger, G.M., Levasseur, P.R., Braun, T.P., Myers, M.G., Jr, Marks, D.L., 2011. Inflammation-induced lethargy is mediated by suppression of orexin neuron activity. J. Neurosci. 31, 11376–11386. Grove, E.A., 1988. Neural associations of the substantia innominata in the rat: Afferent connections. The Journal of Comparative Neurology 277, 315–346. Guo, Y., Feng, P., 2012. OX2R activation induces PKC-mediated ERK and CREB phosphorylation. Exp Cell Res 318, 2004–2013. Hagan, J.J., Leslie, R.A., Patel, S., Evans, M.L., Wattam, T.A., Holmes, S., Benham, C.D., Taylor, S.G., Routledge, C., Hemmati, P., Munton, R.P., Ashmeade, T.E., Shah, A.S., Hatcher, J.P., Hatcher, P.D., Jones, D.N.C., Smith, M.I., Piper, D.C., Hunter, A.J., Porter, R.A., Upton, N., 1999. Orexin A activates locus coeruleus cell firing and increases arousal in the rat. Proc Natl Acad Sci U S A 96, 10911–10916. Haller, J., Tóth, M., Halasz, J., De Boer, S.F., 2006. Patterns of violent aggression-induced brain c-fos expression in male mice selected for aggressiveness. Physiology & Behavior 88, 173–182. Harris, G.C., Aston-Jones, G., 2006. Arousal and reward: a dichotomy in orexin function. Trends in Neurosciences 29, 571–577.

219

Harris, G.C., Wimmer, M., Aston-Jones, G., 2005. A role for lateral hypothalamic orexin neurons in reward seeking. Nature 437, 556–559. Harris, G.C., Wimmer, M., Randall-Thompson, J.F., Aston-Jones, G., 2007. Lateral hypothalamic orexin neurons are critically involved in learning to associate an environment with morphine reward. Behav. Brain Res. 183, 43–51. Hart, B.L., 1988. Biological basis of the behavior of sick animals. Neurosci Biobehav Rev 12, 123–137. Haubensak, W., Kunwar, P.S., Cai, H., Ciocchi, S., Wall, N.R., Ponnusamy, R., Biag, J., Dong, H.-W., Deisseroth, K., Callaway, E.M., Fanselow, M.S., Lüthi, A., Anderson, D.J., 2010. Genetic dissection of an amygdala microcircuit that gates conditioned fear. Nature 468, 270–276. Healy, B., Peck, J., 1997. Bradycardia induced from stimulation of the left versus right central nucleus of the amygdala. Epilepsy Res. 28, 101–104. Heinemann, Stock, G., Bergande, F., 1973a. The influence of blood pressure on the psychomotor behavior of cats. Pflugers Arch. 344, 13–20. Heinemann, Stock, G., Schafer, H., 1973b. Temporal correlation of responses in blood pressure and motor reaction under electrical stimulation of limbic structures in unanaesthetized, unrestrained cats. Pflugers Arch. 343, 27–40. Helmstetter, F.J., Fanselow, M.S., 1987. Effects of naltrexone on learning and performance of conditional fear-induced freezing and opioid analgesia. Physiol. Behav. 39, 501–505. Helmstetter, F.J., Landeira-Fernandez, J., 1990. Conditional hypoalgesia is attenuated by naltrexone applied to the periaqueductal gray. Brain Res. 537, 88–92. Hemmeter, U.-M., Hemmeter-Spernal, J., Krieg, J.-C., 2010. Sleep deprivation in depression. Expert Rev Neurother 10, 1101–1115. Hermann, D.M., Luppi, P.-H., Peyron, C., Hinckel, P., Jouvet, M., 1997. Afferent projections to the rat nuclei raphe magnus, raphe pallidus and reticularis gigantocellularis pars α demonstrated by iontophoretic application of choleratoxin (subunit b). Journal of Chemical Neuroanatomy 13, 1–21. Hermans, E.J., Henckens, M.J.A.G., Roelofs, K., Fernández, G., 2013. Fear bradycardia and activation of the human periaqueductal grey. NeuroImage 66, 278–287. Herry, C., Ciocchi, S., Senn, V., Demmou, L., Müller, C., Lüthi, A., 2008. Switching on and off fear by distinct neuronal circuits. Nature 454, 600–606. Herzog, E., Gilchrist, J., Gras, C., Muzerelle, A., Ravassard, P., Giros, B., Gaspar, P., El Mestikawy, S., 2004. Localization of VGLUT3, the vesicular glutamate transporter type 3, in the rat brain. Neuroscience 123, 983–1002. Heydendael, W., Sharma, K., Iyer, V., Luz, S., Piel, D., Beck, S., Bhatnagar, S., 2011. Orexins/Hypocretins Act in the Posterior Paraventricular Thalamic Nucleus During Repeated Stress to Regulate Facilitation to Novel Stress. Endocrinology 152, 4738– 4752. Hilton, S.M., 1982. The defence-arousal system and its relevance for circulatory and respiratory control. J Exp Biol 100, 159–174. Hilton, S.M., Zbrozyna, A.W., 1963. Amygdaloid region for defence reactions and its efferent pathway to the brain stem. J Physiol 165, 160–173. Ho, Y.-C., Lee, H.-J., Tung, L.-W., Liao, Y.-Y., Fu, S.-Y., Teng, S.-F., Liao, H.-T., Mackie, K., Chiou, L.-C., 2011. Activation of orexin 1 receptors in the periaqueductal gray of male rats leads to antinociception via retrograde endocannabinoid (2-arachidonoylglycerol)- induced disinhibition. J Neurosci 31, 14600–14610. Holahan, M.R., White, N.M., 2002. Conditioned memory modulation, freezing, and avoidance as measures of amygdala-mediated conditioned fear. Neurobiol Learn Mem 77, 250– 275. Holahan, M.R., White, N.M., 2004. Amygdala c-Fos induction corresponds to unconditioned and conditioned aversive stimuli but not to freezing. Behavioural Brain Research 152, 109–120.

220

Holbrook, T.L., Galarneau, M.R., Dye, J.L., Quinn, K., Dougherty, A.L., 2010. Morphine Use after Combat Injury in Iraq and Post-Traumatic Stress Disorder. New England Journal of Medicine 362, 110–117. Holschneider, D.P., Yang, J., Sadler, T.R., Nguyen, P.T., Givrad, T.K., Maarek, J.-M.I., 2006. Mapping Cerebral Blood Flow Changes During Auditory-Cued Conditioned Fear in the Nontethered, Nonrestrained Rat. Neuroimage 29, 1344–1358. Holstege, G., 1992. The emotional motor system. Eur J Morphol 30, 67–79. Holstege, G., Meiners, L., Tan, K., 1985. Projections of the bed nucleus of the stria terminalis to the mesencephalon, pons, and medulla oblongata in the cat. Exp Brain Res 58, 379–391. Honkaniemi, J., 1992. Colocalization of peptide- and tyrosine hydroxylase-like immunoreactivities with Fos-immunoreactive neurons in rat central amygdaloid nucleus after immobilization stress. Brain Research 598, 107–113. Hopkins, D.A., Holstege, G., 1978. Amygdaloid projections to the mesencephalon, pons and medulla oblongata in the cat. Exp Brain Res 32, 529–547. Hsiao, Y.-T., Jou, S.-B., Yi, P.-L., Chang, F.-C., 2012. Activation of GABAergic pathway by hypocretin in the median raphe nucleus (MRN) mediates stress-induced theta rhythm in rats. Behavioural Brain Research 233, 224–231. Hsiao, Y.-T., Yi, P.-L., Cheng, C.-H., Chang, F.-C., 2013. Disruption of footshock-induced theta rhythms by stimulating median raphe nucleus reduces anxiety in rats. Behavioural Brain Research 247, 193–200. Huang, S.-C., Dai, Y.-W.E., Lee, Y.-H., Chiou, L.-C., Hwang, L.-L., 2010. Orexins Depolarize Rostral Ventrolateral Medulla Neurons and Increase Arterial Pressure and Heart Rate in Rats Mainly via Orexin 2 Receptors. J. Pharmacol. Exp. Ther. 334, 522–529. Huang, T., Yan, J., Kang, Y., 2003. Role of the central amygdaloid nucleus in shaping the discharge of gustatory neurons in the rat parabrachial nucleus. Brain Res. Bull. 61, 443– 452. Huber, D., Veinante, P., Stoop, R., 2005. Vasopressin and oxytocin excite distinct neuronal populations in the central amygdala. Science 308, 245–248. Hunsperger, R.W., 1956a. Role of substantia grisea centralis mesencephali in electrically- induced rage reactions. Prog Neurobiol 289–294. Hunsperger, R.W., 1956b. Affective reaction from electric stimulation of brain stem in cats. Helv Physiol Pharmacol Acta 14, 70–92. Ida, T., Nakahara, K., Murakami, T., Hanada, R., Nakazato, M., Murakami, N., 2000. Possible involvement of orexin in the stress reaction in rats. Biochem. Biophys. Res. Commun. 270, 318–323. Iigaya, K., Horiuchi, J., McDowall, L.M., Lam, A.C.B., Sediqi, Y., Polson, J.W., Carrive, P., Dampney, R.A.L., 2012. Blockade of orexin receptors with Almorexant reduces cardiorespiratory responses evoked from the hypothalamus but not baro- or chemoreceptor reflex responses. Am. J. Physiol. Regul. Integr. Comp. Physiol. 303, R1011–1022. Inagaki, H., Kuwahara, M., Tsubone, H., 2004. Effects of psychological stress on autonomic control of heart in rats. Exp. Anim. 53, 373–378. Ishida, Y., Hashiguchi, H., Takeda, R., Ishizuka, Y., Mitsuyama, Y., Kannan, H., Nishimori, T., Nakahara, D., 2002. Conditioned-fear stress increases Fos expression in monoaminergic and GABAergic neurons of the locus coeruleus and dorsal raphe nuclei. Synapse 45, 46–51. Ito, N., Yabe, T., Gamo, Y., Nagai, T., Oikawa, T., Yamada, H., Hanawa, T., 2008. I.c.v. administration of orexin-A induces an antidepressive-like effect through hippocampal cell proliferation. Neuroscience 157, 720–732. Iwata, J., Chida, K., LeDoux, J.E., 1987. Cardiovascular responses elicited by stimulation of neurons in the central amygdaloid nucleus in awake but not anesthetized rats resemble conditioned emotional responses. Brain Res. 418, 183–188. Iwata, J., LeDoux, J.E., 1988. Dissociation of associative and nonassociative concomitants of classical fear conditioning in the freely behaving rat. Behav. Neurosci. 102, 66–76.

221

Iwata, J., LeDoux, J.E., Meeley, M.P., Arneric, S., Reis, D.J., 1986a. Intrinsic neurons in the amygdaloid field projected to by the medial geniculate body mediate emotional responses conditioned to acoustic stimuli. Brain Res. 383, 195–214. Iwata, J., LeDoux, J.E., Reis, D.J., 1986b. Destruction of intrinsic neurons in the lateral hypothalamus disrupts the classical conditioning of autonomic but not behavioral emotional responses in the rat. Brain Res. 368, 161–166. Jacobs, B.L., Fornal, C.A., 1993. 5-HT and motor control: a hypothesis. Trends in Neurosciences 16, 346–352. Jaeger, L.B., Farr, S.A., Banks, W.A., Morley, J.E., 2002. Effects of orexin-A on memory processing. Peptides 23, 1683–1688. Jansen, A.S., Nguyen, X.V., Karpitskiy, V., Mettenleiter, T.C., Loewy, A.D., 1995. Central command neurons of the sympathetic nervous system: basis of the fight-or-flight response. Science 270, 644–646. Jennings, J.H., Sparta, D.R., Stamatakis, A.M., Ung, R.L., Pleil, K.E., Kash, T.L., Stuber, G.D., 2013. Distinct extended amygdala circuits for divergent motivational states. Nature 496, 224–228. Jhamandas, J.H., Petrov, T., Harris, K.H., Vu, T., Krukoff, T.L., 1996. Parabrachial nucleus projection to the amygdala in the rat: electrophysiological and anatomical observations. Brain Res. Bull. 39, 115–126. Jhou, T.C., Fields, H.L., Baxter, M.G., Saper, C.B., Holland, P.C., 2009a. The rostromedial tegmental nucleus (RMTg), a major GABAergic afferent to midbrain dopamine neurons, selectively encodes aversive stimuli and promotes behavioral inhibition. Neuron 61, 786–800. Jhou, T.C., Geisler, S., Marinelli, M., DeGarmo, B.A., Zahm, D.S., 2009b. The mesopontine rostromedial tegmental nucleus: a structure targeted by the lateral habenula that projects to the ventral tegmental area of Tsai and substantia nigra compacta. J Comp Neurol 513, 566–596. Jia, H.-G., Rao, Z.-R., Shi, J.-W., 1997. Evidence of gamma-aminobutyric acidergic control over the catecholaminergic projection from the medulla oblongata to the central nucleus of the amygdala. The Journal of Comparative Neurology 381, 262–281. Jia, H.-G., Zhang, G.-Y., Wan, Q., 2005. A GABAergic projection from the central nucleus of the amygdala to the parabrachial nucleus: an ultrastructural study of anterograde tracing in combination with post-embedding immunocytochemistry in the rat. Neuroscience Letters 382, 153–157. Johnson, Molosh, A., Truitt, W.A., Fitz, S.D., Shekhar, A., 2012a. OREXIN, STRESS AND ANXIETY/PANIC STATES. Prog Brain Res 198, 133–161. Johnson, P.L., Fitz, S.D., Hollis, J.H., Moratalla, R., Lightman, S.L., Shekhar, A., Lowry, C.A., 2011. Induction of c-Fos in “panic/defence”-related brain circuits following brief hypercarbic gas exposure. J. Psychopharmacol. (Oxford) 25, 26–36. Johnson, Samuels, B.C., Fitz, S.D., Federici, L.M., Hammes, N., Early, M.C., Truitt, W., Lowry, C.A., Shekhar, A., 2012b. Orexin 1 receptors are a novel target to modulate panic responses and the panic brain network. Physiology & Behavior 107, 733–742. Johnson, Samuels, B.C., Fitz, S.D., Lightman, S.L., Lowry, C.A., Shekhar, A., 2012c. Activation of the Orexin 1 Receptor is a Critical Component of CO2-Mediated Anxiety and Hypertension but not Bradycardia. Neuropsychopharmacology 37, 1911–1922. Johnson, Truitt, W., Fitz, S.D., Minick, P.E., Dietrich, A., Sanghani, S., Träskman-Bendz, L., Goddard, A.W., Brundin, L., Shekhar, A., 2010. A key role for orexin in panic anxiety. Nat Med 16, 111–115. Jolkkonen, E., Miettinen, R., Pikkarainen, M., Pitkänen, A., 2002. Projections from the amygdaloid complex to the magnocellular cholinergic basal forebrain in rat. Neuroscience 111, 133–149. Jones, B.E., 2008. Modulation of cortical activation and behavioral arousal by cholinergic and orexinergic systems. Ann. N. Y. Acad. Sci. 1129, 26–34.

222

Jongen-Rêlo, A.L., Amaral, D.G., 1998. Evidence for a GABAergic projection from the central nucleus of the amygdala to the brainstem of the macaque monkey: a combined retrograde tracing and in situ hybridization study. Eur. J. Neurosci. 10, 2924–2933. Kaada, B.R., Andersen, P., Jansen Jr., J., 1954. Stimulation of the amygdaloid nuclear complex in unanesthetized cats. Neurology 4, 48–64. Kapp, B.S., Frysinger, R.C., Gallagher, M., Haselton, J.R., 1979. Amygdala central nucleus lesions: effect on heart rate conditioning in the rabbit. Physiol. Behav. 23, 1109–1117. Kapp, Gallagher, M., Underwood, M.D., McNall, C.L., Whitehorn, D., 1982. Cardiovascular responses elicited by electrical stimulation of the amygdala central nucleus in the rabbit. Brain Res. 234, 251–262. Karnani, M.M., Szabó, G., Erdélyi, F., Burdakov, D., 2013. Lateral hypothalamic GAD65 neurons are spontaneously firing and distinct from orexin- and melanin-concentrating hormone neurons. J. Physiol. (Lond.) 591, 933–953. Kaur, S., Thankachan, S., Begum, S., Liu, M., Blanco-Centurion, C., Shiromani, P.J., 2009. Hypocretin-2 Saporin Lesions of the Ventrolateral Periaquaductal Gray (vlPAG) Increase REM Sleep in Hypocretin Knockout Mice. PLoS One 4. Kayaba, Y., Nakamura, A., Kasuya, Y., Ohuchi, T., Yanagisawa, M., Komuro, I., Fukuda, Y., Kuwaki, T., 2003. Attenuated defense response and low basal blood pressure in orexin knockout mice. Am. J. Physiol. Regul. Integr. Comp. Physiol. 285, R581–593. Keay, K.A., Bandler, R., 2001. Parallel circuits mediating distinct emotional coping reactions to different types of stress. Neurosci Biobehav Rev 25, 669–678. Kellicutt, M., Schwartzbaum, J., 1963. Formation of a conditioned emotional response (CER) following lesions of the amygdaloid complex in rats. Psychological Reports 12, 351– 358. Kerman, Bernard, R., Rosenthal, D., Beals, J., Akil, H., Watson, S.J., 2007. Distinct populations of presympathetic-premotor neurons express orexin or melanin-concentrating hormone in the rat lateral hypothalamus. The Journal of Comparative Neurology 505, 586–601. Kerman, I.A., 2008. Organization of brain somatomotor-sympathetic circuits. Exp Brain Res 187, 1–16. Kerman, I.A., Enquist, L.W., Watson, S.J., Yates, B.J., 2003. Brainstem Substrates of Sympatho-Motor Circuitry Identified Using Trans-Synaptic Tracing with Pseudorabies Virus Recombinants. J. Neurosci. 23, 4657–4666. Kessler, M.S., Debilly, S., Schöppenthau, S., Bielser, T., Bruns, A., Künnecke, B., Kienlin, M. von, Wettstein, J.G., Moreau, J.-L., Risterucci, C., 2012. fMRI fingerprint of unconditioned fear-like behavior in rats exposed to trimethylthiazoline. Eur Neuropsychopharmacol 22, 222–230. Khatami, R., Birkmann, S., Bassetti, C.L., 2007. Amygdala dysfunction in narcolepsy- cataplexy. J Sleep Res 16, 226–229. Kim, Adhikari, A., Lee, S.Y., Marshel, J.H., Kim, C.K., Mallory, C.S., Lo, M., Pak, S., Mattis, J., Lim, B.K., Malenka, R.C., Warden, M.R., Neve, R., Tye, K.M., Deisseroth, K., 2013. Diverging neural pathways assemble a behavioural state from separable features in anxiety. Nature 496, 219–223. Kim, J., Rison, R., Fanselow, M., 1993. Effects of Amygdala, Hippocampus, and Periaqueductal Gray Lesions on Short-Term and Long-Term Contextual Fear. Behav. Neurosci. 107, 1093–1098. Kim, J.J., Fanselow, M.S., 1992. Modality-specific retrograde amnesia of fear. Science 256, 675–677. Kishi, T., Tsumori, T., Yokota, S., Yasui, Y., 2006. Topographical projection from the hippocampal formation to the amygdala: a combined anterograde and retrograde tracing study in the rat. J. Comp. Neurol. 496, 349–368. Kiss, J., Csaba, Z., Csáki, A., alász, B., 2013. Demonstration of estrogen receptor α protein in glutamatergic (vesicular glutamate transporter 2 immunoreactive) neurons of the female rat hypothalamus and amygdala using double-label immunocytochemistry. Exp Brain Res 226, 595–602.

223

Knapska, E., Maren, S., 2009. Reciprocal patterns of c-Fos expression in the medial prefrontal cortex and amygdala after extinction and renewal of conditioned fear. Learn. Mem. 16, 486–493. Knapska, E., Radwanska, K., Werka, T., Kaczmarek, L., 2007. Functional internal complexity of amygdala: focus on gene activity mapping after behavioral training and drugs of abuse. Physiol. Rev. 87, 1113–1173. Knapska, E., Walasek, G., Nikolaev, E., Neuhäusser-Wespy, F., Lipp, H.-P., Kaczmarek, L., Werka, T., 2006. Differential involvement of the central amygdala in appetitive versus aversive learning. Learn. Mem. 13, 192–200. Knobloch, H.S., Charlet, A., Hoffmann, L.C., Eliava, M., Khrulev, S., Cetin, A.H., Osten, P., Schwarz, M.K., Seeburg, P.H., Stoop, R., Grinevich, V., 2012. Evoked Axonal Oxytocin Release in the Central Amygdala Attenuates Fear Response. Neuron 73, 553– 566. Kodama, T., Usui, S., Honda, Y., Kimura, M., 2005. High Fos expression during the active phase in orexin neurons of a diurnal rodent, Tamias sibiricus barberi. Peptides 26, 631– 638. Kohlmeier, K.A., Watanabe, S., Tyler, C.J., Burlet, S., Leonard, C.S., 2008. Dual Orexin Actions on Dorsal Raphe and Laterodorsal Tegmentum Neurons: Noisy Cation Current Activation and Selective Enhancement of Ca2+ Transients Mediated by L-Type Calcium Channels. J Neurophysiol 100, 2265–2281. Kolber, B.J., Roberts, M.S., Howell, M.P., Wozniak, D.F., Sands, M.S., Muglia, L.J., 2008. Central amygdala glucocorticoid receptor action promotes fear-associated CRH activation and conditioning. Proc Natl Acad Sci U S A 105, 12004–12009. Koo, J.W., Han, J.-S., Kim, J.J., 2004. Selective neurotoxic lesions of basolateral and central nuclei of the amygdala produce differential effects on fear conditioning. J. Neurosci. 24, 7654–7662. Koolhaas, J.M., de Boer, S.F., Coppens, C.M., Buwalda, B., 2010. Neuroendocrinology of coping styles: Towards understanding the biology of individual variation. Frontiers in Neuroendocrinology 31, 307–321. Kopytova, F.V., 1980. Hypothalamic unit activity during defensive conditioning. Neurosci Behav Physiol 10, 452–459. Kotz, Nixon, J., Butterick, T., Perez-Leighton, C., Teske, J., Billington, C., 2012. Brain orexin promotes obesity resistance. Ann N Y Acad Sci 1264, 72–86. Kotz, Teske, J.A., Billington, C.J., 2008. Neuroregulation of nonexercise activity thermogenesis and obesity resistance. Am J Physiol Regul Integr Comp Physiol 294, R699–R710. Kotz, Wang, C., Teske, J.A., Thorpe, A.J., Novak, C.M., Kiwaki, K., Levine, J.A., 2006. Orexin A mediation of time spent moving in rats: neural mechanisms. Neuroscience 142, 29– 36. Kovács, G.L., Wied, D.D., 1994. Peptidergic modulation of learning and memory processes. Pharmacol Rev 46, 269–291. Kovács, K.J., 1998. c-Fos as a transcription factor: a stressful (re)view from a functional map. Neurochem. Int. 33, 287–297. Krettek, J.E., Price, J.L., 1978. A description of the amygdaloid complex in the rat and cat with observations on intra-amygdaloid axonal connections. J. Comp. Neurol. 178, 255–280. Krout, K.., Mettenleiter, T.., Loewy, A.., 2003. Single cns neurons link both central motor and cardiosympathetic systems: a double-virus tracing study. Neuroscience 118, 853–866. Krukoff, T.L., Harris, K.H., Jhamandas, J.H., 1993. Efferent projections from the parabrachial nucleus demonstrated with the anterograde tracer Phaseolus vulgaris leucoagglutinin. Brain Res. Bull. 30, 163–172. Kubo, T., Okatani, H., Nishigori, Y., Hagiwara, Y., Fukumori, R., Goshima, Y., 2004. Involvement of the medial amygdaloid nucleus in restraint stress-induced pressor responses in rats. Neuroscience Letters 354, 84–86. Kudo, T., Uchigashima, M., Miyazaki, T., Konno, K., Yamasaki, M., Yanagawa, Y., Minami, M., Watanabe, M., 2012. Three types of neurochemical projection from the bed nucleus

224

of the stria terminalis to the ventral tegmental area in adult mice. J. Neurosci. 32, 18035–18046. Kumada, M., Dampney, R.A., Reis, D.J., 1977. The trigeminal depressor response: a novel vasodepressor response originating from the trigeminal system. Brain Res. 119, 305– 326. Laorden, M.L., Ferenczi, S., Pintér-Kübler, B., González-Martín, L.L., Lasheras, M.C., Kovács, K.J., Milanés, M.V., Núñez, C., 2012. Hypothalamic Orexin-A Neurons Are Involved in the Response of the Brain Stress System to Morphine Withdrawal. PLoS ONE 7, e36871. LeDoux, J.E., 2000. Emotion circuits in the brain. Annu. Rev. Neurosci. 23, 155–184. LeDoux, J.E., Iwata, J., Cicchetti, P., Reis, D.J., 1988. Different projections of the central amygdaloid nucleus mediate autonomic and behavioral correlates of conditioned fear. J. Neurosci. 8, 2517–2529. Lee, H.S., Eum, Y.J., Jo, S.M., Waterhouse, B.D., 2007. Projection patterns from the amygdaloid nuclear complex to subdivisions of the dorsal raphe nucleus in the rat. Brain Res. 1143, 116–125. Lee, J.L.C., Milton, A.L., Everitt, B.J., 2006. Reconsolidation and Extinction of Conditioned Fear: Inhibition and Potentiation. J. Neurosci. 26, 10051–10056. Lee, M.G., Hassani, O.K., Jones, B.E., 2005. Discharge of identified orexin/hypocretin neurons across the sleep-waking cycle. J. Neurosci. 25, 6716–6720. Li, C., Pleil, K.E., Stamatakis, A.M., Busan, S., Vong, L., Lowell, B.B., Stuber, G.D., Kash, T.L., 2012. Presynaptic inhibition of gamma-aminobutyric acid release in the bed nucleus of the stria terminalis by kappa opioid receptor signaling. Biol. Psychiatry 71, 725–732. Li, Chen, F., Ye, J., Chen, X., Yan, J., Li, Y., Xiong, Y., Zhou, Z., Xia, J., Hu, Z., 2010a. The modulation of orexin A on HCN currents of pyramidal neurons in mouse prelimbic cortex. Cereb. Cortex 20, 1756–1767. Li, Li, S., Sui, N., Kirouac, G.J., 2009. Orexin-A acts on the paraventricular nucleus of the midline thalamus to inhibit locomotor activity in rats. Pharmacol. Biochem. Behav. 93, 506–514. Li, Li, S., Wei, C., Wang, H., Sui, N., Kirouac, G.J., 2010b. Changes in emotional behavior produced by orexin microinjections in the paraventricular nucleus of the thalamus. Pharmacol. Biochem. Behav. 95, 121–128. Li, Li, S., Wei, C., Wang, H., Sui, N., Kirouac, G.J., 2010c. Orexins in the paraventricular nucleus of the thalamus mediate anxiety-like responses in rats. Psychopharmacology 212, 251–265. Li, Penzo, M.A., Taniguchi, H., Kopec, C.D., Huang, Z.J., Li, B., 2013. Experience-dependent modification of a central amygdala fear circuit. Nat. Neurosci. 16, 332–339. Li, Q., Goodchild, A.K., Seyedabadi, M., Pilowsky, P.M., 2005. Pre-protachykinin A mRNA is colocalized with tyrosine hydroxylase-immunoreactivity in bulbospinal neurons. Neuroscience 136, 205–216. Li, Y.W., Dampney, R.A., 1994. Expression of Fos-like protein in brain following sustained hypertension and hypotension in conscious rabbits. Neuroscience 61, 613–634. Liang, K.C., Chen, H.C., Chen, D.Y., 2001. Posttraining infusion of norepinephrine and corticotropin releasing factor into the bed nucleus of the stria terminalis enhanced retention in an inhibitory avoidance task. Chin J Physiol 44, 33–43. Likhtik, E., Popa, D., Apergis-Schoute, J., Fidacaro, G.A., Paré, D., 2008. Amygdala intercalated neurons are required for expression of fear extinction. Nature 454, 642– 645. Lino-de-Oliveira, C., De Lima, T.C.M., Carobrez, A.P., 2002. Dorsal periaqueductal gray matter inhibits passive coping strategy elicited by forced swimming stress in rats. Neurosci. Lett. 335, 87–90. Lino-de-Oliveira, C., de Oliveira, R.M.W., Pádua Carobrez, A., de Lima, T.C.M., del Bel, E.A., Guimarães, F.S., 2006. Antidepressant treatment reduces Fos-like immunoreactivity

225

induced by swim stress in different columns of the periaqueductal gray matter. Brain Res. Bull. 70, 414–421. Liu, X., Ramirez, S., Pang, P.T., Puryear, C.B., Govindarajan, A., Deisseroth, K., Tonegawa, S., 2012. Optogenetic stimulation of a hippocampal engram activates fear memory recall. Nature 484, 381–385. Lovick, T.A., 1993. The periaqueductal gray-rostral medulla connection in the defence reaction: efferent pathways and descending control mechanisms. Behav. Brain Res. 58, 19–25. Loyd, D.R., Morgan, M.M., Murphy, A.Z., 2007. Morphine preferentially activates the periaqueductal gray-rostral ventromedial medullary pathway in the male rat: a potential mechanism for sex differences in antinociception. Neuroscience 147, 456–468. Lu, Moriwaki, A., Tomizawa, K., Onuma, H., Cai, X.H., Matsui, H., 1997. Effects of vasopressin and involvement of receptor subtypes in the rat central amygdaloid nucleus in vitro. Brain Res. 768, 266–272. Lu, X.Y., Bagnol, D., Burke, S., Akil, H., Watson, S.J., 2000. Differential distribution and regulation of OX1 and OX2 orexin/hypocretin receptor messenger RNA in the brain upon fasting. Horm Behav 37, 335–344. Lungwitz, E.A., Molosh, A., Johnson, P.L., Harvey, B.P., Dirks, R.C., Dietrich, A., Minick, P., Shekhar, A., Truitt, W.A., 2012. Orexin-A induces anxiety-like behavior through interactions with glutamatergic receptors in the bed nucleus of the stria terminalis of rats. Physiol. Behav. 107, 726–732. Luong, Carrive, P., 2012. Orexin microinjection in the medullary raphe increases heart rate and arterial pressure but does not reduce tail skin blood flow in the awake rat. Neuroscience 202, 209–217. Luong, L., 2012. The role of orexin and serotonin 1A receptor in the expression or modulation of the cardiovascular and behavioural components of psychological and physical stress. Luppino, F.S., de Wit, L.M., Bouvy, P.F., Stijnen, T., Cuijpers, P., Penninx, B.W.J.H., Zitman, F.G., 2010. Overweight, obesity, and depression: a systematic review and meta-analysis of longitudinal studies. Arch. Gen. Psychiatry 67, 220–229. Lutter, M., Krishnan, V., Russo, S.J., Jung, S., McClung, C.A., Nestler, E.J., 2008. Orexin Signaling Mediates the Antidepressant-Like Effect of Calorie Restriction. J Neurosci 28, 3071–3075. Luyten, L., Casteels, C., Vansteenwegen, D., Kuyck, K. van, Koole, M., Laere, K.V., Nuttin, B., 2012. Micro-Positron Emission Tomography Imaging of Rat Brain Metabolism during Expression of Contextual Conditioning. J. Neurosci. 32, 254–263. Luyten, L., van Kuyck, K., Vansteenwegen, D., Nuttin, B., 2011. Electrolytic lesions of the bed nucleus of the stria terminalis disrupt freezing and startle potentiation in a conditioned context. Behavioural Brain Research 222, 357–362. Mahler, S.V., Smith, R.J., Moorman, D.E., Sartor, G.C., Aston-Jones, G., 2012. Multiple roles for orexin/hypocretin in addiction. Prog Brain Res 198, 79–121. Mair, R.G., Hembrook, J.R., 2008. Memory enhancement with event-related stimulation of the rostral intralaminar thalamic nuclei. J. Neurosci. 28, 14293–14300. Mancia, G., Baccelli, G., Zanchetti, A., 1972. Hemodynamic responses to different emotional stimuli in the cat: patterns and mechanisms. Am J Physiol 223, 925–933. Mang, G.M., Durst, T., Burki, H., Imobersteg, S., Abramowski, D., Schuepbach, E., Hoyer, D., Fendt, M., Gee, C.E., 2012. The Dual Orexin Receptor Antagonist Almorexant Induces Sleep and Decreases Orexin-Induced Locomotion by Blocking Orexin 2 Receptors. Sleep 35, 1625–1635. Marcus, J.N., Aschkenasi, C.J., Lee, C.E., Chemelli, R.M., Saper, C.B., Yanagisawa, M., Elmquist, J.K., 2001. Differential expression of orexin receptors 1 and 2 in the rat brain. J. Comp. Neurol. 435, 6–25. Marks, A., Vianna, D.M.L., Carrive, P., 2009. Nonshivering thermogenesis without interscapular brown adipose tissue involvement during conditioned fear in the rat. Am. J. Physiol. Regul. Integr. Comp. Physiol. 296, R1239–1247.

226

Martinez, R.C., Carvalho-Netto, E.F., Ribeiro-Barbosa, E.R., Baldo, M.V.C., Canteras, N.S., 2011. Amygdalar roles during exposure to a live predator and to a predator-associated context. Neuroscience 172, 314–328. Martinez, R.C.R., Gupta, N., Lázaro-Muñoz, G., Sears, R.M., Kim, S., Moscarello, J.M., LeDoux, J.E., Cain, C.K., 2013. Active vs. reactive threat responding is associated with differential c-Fos expression in specific regions of amygdala and prefrontal cortex. Learn. Mem. 20, 446–452. Martins, P.J.F., D’Almeida, V., Pedrazzoli, M., Lin, L., Mignot, E., Tufik, S., 2004. Increased hypocretin-1 (orexin-a) levels in cerebrospinal fluid of rats after short-term forced activity. Regul. Pept. 117, 155–158. Matsumura, K., Tsuchihashi, T., Abe, I., 2001. Central Orexin-A Augments Sympathoadrenal Outflow in Conscious Rabbits. Hypertension 37, 1382–1387. McAllen, R., 2010. The peptide or the neuron? J Physiol 588, 4067–4068. McDonald, A.J., 1989. Coexistence of somatostatin with neuropeptide Y, but not with cholecystokinin or vasoactive intestinal peptide, in neurons of the rat amygdala. Brain Res. 500, 37–45. McDonald, A.J., Augustine, J.R., 1993. Localization of GABA-like immunoreactivity in the monkey amygdala. Neuroscience 52, 281–294. McDonald, A.J., Beitz, A.J., Larson, A.A., Kuriyama, R., Sellitto, C., Madl, J.E., 1989. Co- localization of glutamate and tubulin in putative excitatory neurons of the hippocampus and amygdala: an immunohistochemical study using monoclonal antibodies. Neuroscience 30, 405–421. McDonald, A.J., Culberson, J.L., 1986. Efferent projections of the basolateral amygdala in the opossum, Didelphis virginiana. Brain Res. Bull. 17, 335–350. McGaugh, J.L., 2000. Memory--a century of consolidation. Science 287, 248–251. McGaugh, McIntyre, C.K., Power, A.E., 2002. Amygdala modulation of memory consolidation: interaction with other brain systems. Neurobiol Learn Mem 78, 539–552. McGregor, R., Wu, M.-F., Barber, G., Ramanathan, L., Siegel, J.M., 2011. Highly specific role of hypocretin (orexin) neurons: differential activation as a function of diurnal phase, operant reinforcement vs. operant avoidance and light level. J Neurosci 31, 15455– 15467. McKenzie, S., Eichenbaum, H., 2011. Consolidation and reconsolidation: Two lives of memories? Neuron 71, 224–233. McRitchie, R.J., White, S.W., 1974. Role of trigeminal, olfactory, carotid sinus and aortic nerves in the respiratory and circulatory response to nasal inhalation of cigarette smoke and other irritants in the rabbit. Aust J Exp Biol Med Sci 52, 127–140. Meloni, E.G., Jackson, A., Gerety, L.P., Cohen, B.M., Carlezon, W.A., Jr, 2006. Role of the bed nucleus of the stria terminalis (BST) in the expression of conditioned fear. Ann. N. Y. Acad. Sci. 1071, 538–541. Michinaga, S., Hisatsune, A., Isohama, Y., Katsuki, H., 2010. Inhibition of neural activity depletes orexin from rat hypothalamic slice culture. J. Neurosci. Res. 88, 214–221. Mieda, M., Willie, J.T., Hara, J., Sinton, C.M., Sakurai, T., Yanagisawa, M., 2004. Orexin peptides prevent cataplexy and improve wakefulness in an orexin neuron-ablated model of narcolepsy in mice. Proc. Natl. Acad. Sci. U.S.A. 101, 4649–4654. Mignot, E., Lammers, G.J., Ripley, B., Okun, M., Nevsimalova, S., Overeem, S., Vankova, J., Black, J., Harsh, J., Bassetti, C., Schrader, H., Nishino, S., 2002. The role of cerebrospinal fluid hypocretin measurement in the diagnosis of narcolepsy and other hypersomnias. Arch. Neurol. 59, 1553–1562. Miki, K., Yoshimoto, M., 2010. Role of differential changes in sympathetic nerve activity in the preparatory adjustments of cardiovascular functions during freezing behaviour in rats. Exp Physiol 95, 56–60. Milanovic, S., Radulovic, J., Laban, O., Stiedl, O., Henn, F., Spiess, J., 1998. Production of the Fos protein after contextual fear conditioning of C57BL/6N mice. Brain Research 784, 37–47.

227

Mileykovskiy, B.Y., Kiyashchenko, L.I., Siegel, J.M., 2005. Behavioral correlates of activity in identified hypocretin/orexin neurons. Neuron 46, 787–798. Milton, A.L., Lee, J.L.C., Everitt, B.J., 2008. Reconsolidation of appetitive memories for both natural and drug reinforcement is dependent on β-adrenergic receptors. Learn. Mem. 15, 88–92. Miserendino, M.J., Davis, M., 1993. NMDA and non-NMDA antagonists infused into the nucleus reticularis pontis caudalis depress the acoustic startle reflex. Brain Res. 623, 215–222. Mitchell, V.A., Kawahara, H., Vaughan, C.W., 2009. Neurotensin inhibition of GABAergic transmission via mGluR-induced endocannabinoid signalling in rat periaqueductal grey. J. Physiol. (Lond.) 587, 2511–2520. Monassi, C.R., Hoffmann, A., Menescal-de-Oliveira, L., 1997. Involvement of the cholinergic system and periaqueductal gray matter in the modulation of tonic immobility in the guinea pig. Physiol. Behav. 62, 53–59. Monassi, C.R., Leite-Panissi, C.R., Menescal-de-Oliveira, L., 1999. Ventrolateral periaqueductal gray matter and the control of tonic immobility. Brain Res. Bull. 50, 201–208. Morgan, Carrive, P., 2001. Activation of the ventrolateral periaqueductal gray reduces locomotion but not mean arterial pressure in awake, freely moving rats. Neuroscience 102, 905–910. Morgan, Clayton, C.C., 2005. Defensive behaviors evoked from the ventrolateral periaqueductal gray of the rat: comparison of opioid and GABA disinhibition. Behav. Brain Res. 164, 61–66. Morgan, M.M., Whittier, K.L., Hegarty, D.M., Aicher, S.A., 2008. Periaqueductal gray neurons project to spinally projecting GABAergic neurons in the rostral ventromedial medulla. Pain 140, 376–386. Morgan, Whitney, P.K., 2000. Immobility accompanies the antinociception mediated by the rostral ventromedial medulla of the rat. Brain Res. 872, 276–281. Morgan, Whitney, P.K., Gold, M.S., 1998. Immobility and flight associated with antinociception produced by activation of the ventral and lateral/dorsal regions of the rat periaqueductal gray. Brain Research 804, 159–166. Morrison, S.F., Madden, C.J., Tupone, D., 2012. An orexinergic projection from perifornical hypothalamus to raphe pallidus increases rat brown adipose tissue thermogenesis. Adipocyte 1, 116–120. Moscarello, J.M., LeDoux, J.E., 2013. Active Avoidance Learning Requires Prefrontal Suppression of Amygdala-Mediated Defensive Reactions. J. Neurosci. 33, 3815–3823. Mosher, C.P., Zimmerman, P.E., Gothard, K.M., 2010. Response Characteristics of Basolateral and Centromedial Neurons in the Primate Amygdala. J. Neurosci. 30, 16197–16207. Muigg, P., Hetzenauer, A., Hauer, G., Hauschild, M., Gaburro, S., Frank, E., Landgraf, R., Singewald, N., 2008. Impaired extinction of learned fear in rats selectively bred for high anxiety - evidence of altered neuronal processing in prefrontal-amygdala pathways. Eur J Neurosci 28, 2299–2309. Muschamp, J.W., Dominguez, J.M., Sato, S.M., Shen, R.-Y., Hull, E.M., 2007. A role for hypocretin (orexin) in male sexual behavior. J. Neurosci. 27, 2837–2845. Myers, B., Mark Dolgas, C., Kasckow, J., Cullinan, W.E., Herman, J.P., 2013. Central stress- integrative circuits: forebrain glutamatergic and GABAergic projections to the dorsomedial hypothalamus, medial preoptic area, and bed nucleus of the stria terminalis. Brain Struct Funct. Nagy, F.Z., Paré, D., 2008. Timing of impulses from the central amygdala and bed nucleus of the stria terminalis to the brain stem. J. Neurophysiol. 100, 3429–3436. Nakai, M., Maeda, M., 1994. Systemic and regional haemodynamic responses elicited by microinjection of N-methyl-D-aspartate into the lateral periaqueductal gray matter in anaesthetized rats. Neuroscience 58, 777–783.

228

Nakai, M., Maeda, M., 1996. Vasodilatation and enhanced oxidative metabolism of the cerebral cortex provoked by the periaqueductal gray matter in anaesthetized rats. Neuroscience 72, 1133–1140. Nakai, M., Ogata, J., Fukui, K., Nakai, Y., Maeda, M., 1997. Basal forebrain and cerebral cortical muscarinic receptors mediate increase in cortical blood flow provoked by periaqueductal gray matter. Neuroscience 79, 571–579. Nakamura, Tsumori, T., Yokota, S., Oka, T., Yasui, Y., 2009. Amygdaloid axons innervate melanin-concentrating hormone- and orexin-containing neurons in the mouse lateral hypothalamus. Brain Res. 1278, 66–74. Nakamura, Uramura, K., Nambu, T., Yada, T., Goto, K., Yanagisawa, M., Sakurai, T., 2000. Orexin-induced hyperlocomotion and stereotypy are mediated by the dopaminergic system. Brain Res. 873, 181–187. Nambu, T., Sakurai, T., Mizukami, K., Hosoya, Y., Yanagisawa, M., Goto, K., 1999. Distribution of orexin neurons in the adult rat brain. Brain Research 827, 243–260. Nattie, E., Li, A., 2012. Respiration and autonomic regulation and orexin. Prog. Brain Res. 198, 25–46. Neckel, H., Quagliotto, E., Casali, K.R., Montano, N., Dal Lago, P., Rasia-Filho, A.A., 2012. Glutamate and GABA in the medial amygdala induce selective central sympathetic/parasympathetic cardiovascular responses. Can. J. Physiol. Pharmacol. 90, 525–536. Nijsen, M.J., Croiset, G., Diamant, M., Stam, R., Delsing, D., de Wied, D., Wiegant, V.M., 1998. Conditioned fear-induced tachycardia in the rat: vagal involvement. Eur. J. Pharmacol. 350, 211–222. Nitecka, L., Ben-Ari, Y., 1987. Distribution of GABA-like immunoreactivity in the rat amygdaloid complex. J. Comp. Neurol. 266, 45–55. Niu, J.-G., Yokota, S., Tsumori, T., Oka, T., Yasui, Y., 2012. Projections from the anterior basomedial and anterior cortical amygdaloid nuclei to melanin-concentrating hormone- containing neurons in the lateral hypothalamus of the rat. Brain Research 1479, 31–43. Nixon, J.P., Kotz, C.M., Novak, C.M., Billington, C.J., Teske, J.A., 2012. Neuropeptides controlling energy balance: orexins and neuromedins. Handb Exp Pharmacol 77–109. Nixon, J.P., Smale, L., 2004. Individual differences in wheel-running rhythms are related to temporal and spatial patterns of activation of orexin A and B cells in a diurnal rodent (Arvicanthis niloticus). Neuroscience 127, 25–34. Nobre, M.J., Brandão, M.L., 2011. Modulation of auditory-evoked potentials recorded in the inferior colliculus by GABAergic mechanisms in the basolateral and central nuclei of the amygdala in high- and low-anxiety rats. Brain Research 1421, 20–29. Nocjar, C., Zhang, J., Feng, P., Panksepp, J., 2012. The social defeat animal model of depression shows diminished levels of orexin in mesocortical regions of the dopamine system, and of dynorphin and orexin in the hypothalamus. Neuroscience 218, 138–153. Nollet, M., Gaillard, P., Minier, F., Tanti, A., Belzung, C., Leman, S., 2011. Activation of orexin neurons in dorsomedial/perifornical hypothalamus and antidepressant reversal in a rodent model of depression. Neuropharmacology 61, 336–346. Nollet, M., Leman, S., 2013. Role of Orexin in the Pathophysiology of Depression: Potential for Pharmacological Intervention. CNS Drugs. Nonaka, A., Masuda, F., Nomura, H., Matsuki, N., 2013. Impairment of fear memory consolidation and expression by antihistamines. Brain Res. 1493, 19–26. Nose, I., Higashi, H., Inokuchi, H., Nishi, S., 1991. Synaptic responses of guinea pig and rat central amygdala neurons in vitro. J. Neurophysiol. 65, 1227–1241. Novaes, L.S., Shammah-Lagnado, S.J., 2011. Projections from the anteroventral part of the medial amygdaloid nucleus in the rat. Brain Research 1421, 30–43. Oka, T., Tsumori, T., Yokota, S., Yasui, Y., 2008. Neuroanatomical and neurochemical organization of projections from the central amygdaloid nucleus to the nucleus retroambiguus via the periaqueductal gray in the rat. Neuroscience Research 62, 286– 298.

229

Oliveira, M.A., Prado, W.A., 2001. Role of PAG in the antinociception evoked from the medial or central amygdala in rats. Brain Res. Bull. 54, 55–63. Olsen, N., 2007. Fear activated projections to the ventrolateral periaqueductal gray. University of New South Wales, Department of Anatomy. Ono, T., Luiten, P.G., Nishijo, H., Fukuda, M., Nishino, H., 1985. Topographic organization of projections from the amygdala to the hypothalamus of the rat. Neurosci. Res. 2, 221– 238. Ono, T., Nishijo, H., Uwano, T., 1995. Amygdala role in conditioned associative learning. Prog. Neurobiol. 46, 401–422. Osborne, P.B., Vaughan, C.W., Wilson, H.I., Christie, M.J., 1996. Opioid inhibition of rat periaqueductal grey neurones with identified projections to rostral ventromedial medulla in vitro. J. Physiol. (Lond.) 490 ( Pt 2), 383–389. Overmier, J.B., Seligman, M.E., 1967. Effects of inescapable shock upon subsequent escape and avoidance responding. J Comp Physiol Psychol 63, 28–33. Page, M.E., Abercrombie, E.D., 1999. Discrete local application of corticotropin-releasing factor increases locus coeruleus discharge and extracellular norepinephrine in rat hippocampus. Synapse 33, 304–313. Pagoto, S.L., Schneider, K.L., Bodenlos, J.S., Appelhans, B.M., Whited, M.C., Ma, Y., Lemon, S.C., 2012. Association of post-traumatic stress disorder and obesity in a nationally representative sample. Obesity (Silver Spring) 20, 200–205. Palazzo, E., Rimoli, M.G., De Chiaro, M., Guida, F., Melisi, D., Curcio, A., de Novellis, V., Marabese, I., Rossi, F., Abignente, E., Maione, S., 2010. Intra-periaqueductal grey microinjections of an imidazo[1,2-b]pyridazine derivative, DM2, affects rostral ventromedial medulla cell activity and shows antinociceptive effect. Neuropharmacology 58, 660–667. Pape, H.-C., Pare, D., 2010. Plastic Synaptic Networks of the Amygdala for the Acquisition, Expression, and Extinction of Conditioned Fear. Physiol Rev 90, 419–463. Pardo-Bellver, C., Cádiz-Moretti, B., Novejarque, A., Martínez-García, F., Lanuza, E., 2012. Differential efferent projections of the anterior, posteroventral, and posterodorsal subdivisions of the medial amygdala in mice. Front Neuroanat 6, 33. Paré, D., Quirk, G.J., Ledoux, J.E., 2004. New vistas on amygdala networks in conditioned fear. J. Neurophysiol. 92, 1–9. Paré, D., Smith, Y., 1993. The intercalated cell masses project to the central and medial nuclei of the amygdala in cats. Neuroscience 57, 1077–1090. Paredes, J., Winters, R.W., Schneiderman, N., McCabe, P.M., 2000. Afferents to the central nucleus of the amygdala and functional subdivisions of the periaqueductal gray: neuroanatomical substrates for affective behavior. Brain Research 887, 157–173. Parent, M.B., McGaugh, J.L., 1994. Posttraining infusion of lidocaine into the amygdala basolateral complex impairs retention of inhibitory avoidance training. Brain Res. 661, 97–103. Parker, G., McCraw, S., Blanch, B., Hadzi-Pavlovic, D., Synnott, H., Rees, A.-M., 2013. Discriminating melancholic and non-melancholic depression by prototypic clinical features. Journal of Affective Disorders 144, 199–207. Pascoe, J.P., Kapp, B.S., 1985. Electrophysiological characteristics of amygdaloid central nucleus neurons during Pavlovian fear conditioning in the rabbit. Behavioural Brain Research 16, 117–133. Pedrazzoli, M., D’Almeida, V., Martins, P.J.F., Machado, R.B., Ling, L., Nishino, S., Tufik, S., Mignot, E., 2004. Increased hypocretin-1 levels in cerebrospinal fluid after REM sleep deprivation. Brain Res. 995, 1–6. Pedreira, Maldonado, 2003. Protein Synthesis Subserves Reconsolidation or Extinction Depending on Reminder Duration. Neuron 38, 863–869. Peever, J.H., Lai, Y.-Y., Siegel, J.M., 2003. Excitatory effects of hypocretin-1 (orexin-A) in the trigeminal motor nucleus are reversed by NMDA antagonism. J. Neurophysiol. 89, 2591–2600.

230

Pellegrino, L., 1968. Amygdaloid lesions and behavioral inhibition in the rat. J Comp Physiol Psychol 65, 483–491. Pérez-Cuesta, L.M., Maldonado, H., 2009. Memory reconsolidation and extinction in the crab: Mutual exclusion or coexistence? Learn. Mem. 16, 714–721. Perez-Leighton, C.E., Boland, K., Teske, J.A., Billington, C., Kotz, C.M., 2012. Behavioral responses to orexin, orexin receptor gene expression, and spontaneous physical activity contribute to individual sensitivity to obesity. Am. J. Physiol. Endocrinol. Metab. 303, E865–874. Perez-Leighton, C.E., Butterick-Peterson, T.A., Billington, C.J., Kotz, C.M., 2013. Role of orexin receptors in obesity: from cellular to behavioral evidence. Int J Obes (Lond) 37, 167–174. Peters, A., Palay, S.L., 1996. The morphology of synapses. J. Neurocytol. 25, 687–700. Peters, A., Palay, S.L., Webster, H. deF, 1991. Fine Structure of the Nervous System: Neurons and Their Supporting Cells, 3rd ed. Oxford University Press, USA. Petrovich, G.D., Risold, P.Y., Swanson, L.W., 1996. Organization of projections from the basomedial nucleus of the amygdala: a PHAL study in the rat. J. Comp. Neurol. 374, 387–420. Petrovich, G.D., Scicli, A.P., Thompson, R.F., Swanson, L.W., 2000. Associative fear conditioning of enkephalin mRNA levels in central amygdalar neurons. Behav. Neurosci. 114, 681–686. Petrovich, G.D., Swanson, L.W., 1997. Projections from the lateral part of the central amygdalar nucleus to the postulated fear conditioning circuit. Brain Res. 763, 247–254. Peyron, C., Faraco, J., Rogers, W., Ripley, B., Overeem, S., Charnay, Y., Nevsimalova, S., Aldrich, M., Reynolds, D., Albin, R., Li, R., Hungs, M., Pedrazzoli, M., Padigaru, M., Kucherlapati, M., Fan, J., Maki, R., Lammers, G.J., Bouras, C., Kucherlapati, R., Nishino, S., Mignot, E., 2000. A mutation in a case of early onset narcolepsy and a generalized absence of hypocretin peptides in human narcoleptic brains. Nat. Med. 6, 991–997. Peyron, C., Tighe, D.K., van den Pol, A.N., de Lecea, L., Heller, H.C., Sutcliffe, J.G., Kilduff, T.S., 1998. Neurons containing hypocretin (orexin) project to multiple neuronal systems. J. Neurosci. 18, 9996–10015. Pezzone, M.A., Lee, W.S., Hoffman, G.E., Rabin, B.S., 1992. Induction of c-Fos immunoreactivity in the rat forebrain by conditioned and unconditioned aversive stimuli. Brain Res. 597, 41–50. Phillips, R.G., LeDoux, J.E., 1992. Differential contribution of amygdala and hippocampus to cued and contextual fear conditioning. Behav. Neurosci. 106, 274–285. Pickel, V.M., Chan, J., Chronwall, B.M., O’Donohue, T.L., Oertel, W. ., Massari, V.J., 1988. Neuropeptide Y in the rat nucleus accumbens: ultrastructural localization in aspiny neurons receiving synaptic input from GABAergic terminals. J. Neurosci. Res. 19, 171– 186. Pickel, V.M., van Bockstaele, E.J., Chan, J., Cestari, D.M., 1995. Amygdala efferents form inhibitory-type synapses with a subpopulation of catecholaminergic neurons in the rat Nucleus tractus solitarius. J. Comp. Neurol. 362, 510–523. Pickel, V.M., Van Bockstaele, E.J., Chan, J., Cestari, D.M., 1996. GABAergic neurons in rat nuclei of solitary tracts receive inhibitory-type synapses from amygdaloid efferents lacking detectable GABA-immunoreactivity. J. Neurosci. Res. 44, 446–458. Pitkänen, A., Amaral, D.G., 1994. The distribution of GABAergic cells, fibers, and terminals in the monkey amygdaloid complex: an immunohistochemical and in situ hybridization study. J. Neurosci. 14, 2200–2224. Pitts, M.W., Takahashi, L.K., 2011. The central amygdala nucleus via corticotropin-releasing factor is necessary for time-limited consolidation processing but not storage of contextual fear memory. Neurobiol Learn Mem 95, 86–91.

231

Pitts, M.W., Todorovic, C., Blank, T., Takahashi, L.K., 2009. The central nucleus of the amygdala and corticotropin-releasing factor: insights into contextual fear memory. J. Neurosci. 29, 7379–7388. Ponz, A., Khatami, R., Poryazova, R., Werth, E., Boesiger, P., Schwartz, S., Bassetti, C.L., 2010. Reduced amygdala activity during aversive conditioning in human narcolepsy. Annals of Neurology 67, 394–398. Portas, C.M., McCarley, R.W., 1994. Behavioral state-related changes of extracellular serotonin concentration in the dorsal raphe nucleus: a microdialysis study in the freely moving cat. Brain Research 648, 306–312. Poulin, J.-F., Arbour, D., Laforest, S., Drolet, G., 2009. Neuroanatomical characterization of endogenous opioids in the bed nucleus of the stria terminalis. Prog. Neuropsychopharmacol. Biol. Psychiatry 33, 1356–1365. Poulin, J.-F., Castonguay-Lebel, Z., Laforest, S., Drolet, G., 2008. Enkephalin co-expression with classic neurotransmitters in the amygdaloid complex of the rat. J. Comp. Neurol. 506, 943–959. Price, J.L., Amaral, D.G., 1981. An autoradiographic study of the projections of the central nucleus of the monkey amygdala. J. Neurosci. 1, 1242–1259. Price, Russchen, Amaral, 1987. The limbic region. II: The amygdaloid complex. In: Björklund A, Hökfelt T, Swanson LW, eds (Ed.), Handbook of Chemical Neuroanatomy. Elsevier, Amsterdam, pp. 279–388. Przybyslawski, J., Roullet, P., Sara, S.J., 1999. Attenuation of Emotional and Nonemotional Memories after their Reactivation: Role of β Adrenergic Receptors. J. Neurosci. 19, 6623–6628. Quirk, G.J., Mueller, D., 2007. Neural Mechanisms of Extinction Learning and Retrieval. Neuropsychopharmacology 33, 56–72. Radley, J.J., Sawchenko, 2013. A Common Substrate for Prefrontal and Hippocampal Inhibition of the Neuroendocrine Stress Response [WWW Document]. URL http://www.jneurosci.org (accessed 6.7.13). Radulovic, J., Kammermeier, J., Spiess, J., 1998a. Generalization of fear responses in C57BL/6N mice subjected to one-trial foreground contextual fear conditioning. Behavioural Brain Research 95, 179–189. Radulovic, J., Kammermeier, J., Spiess, J., 1998b. Relationship between Fos Production and Classical Fear Conditioning: Effects of Novelty, Latent Inhibition, and Unconditioned Stimulus Preexposure. J. Neurosci. 18, 7452–7461. Ramirez, S., Liu, X., Lin, P.-A., Suh, J., Pignatelli, M., Redondo, R.L., Ryan, T.J., Tonegawa, S., 2013a. Creating a False Memory in the Hippocampus. Science 341, 387–391. Ramirez, S., Liu, X., Lin, P.-A., Suh, J., Pignatelli, M., Redondo, R.L., Ryan, T.J., Tonegawa, S., 2013b. Creating a false memory in the hippocampus. Science 341, 387–391. Reichling, D.B., Basbaum, A.I., 1991. Collateralization of periaqueductal gray neurons to forebrain or diencephalon and to the medullary nucleus raphe magnus in the rat. Neuroscience 42, 183–200. Reid, J.V., Ito, B.R., Huang, A.H., Buffington, C.W., Feigl, E.O., 1985. Parasympathetic control of transmural coronary blood flow in dogs. Am. J. Physiol. 249, H337–343. Reis, D.J., Oliphant, M.C., 1964. BRADYCARDIA AND TACHYCARDIA FOLLOWING ELECTRICAL STIMULATION OF THE AMYGDALOID REGION IN MONKEY. J. Neurophysiol. 27, 893–912. Resstel, L.B.M., Alves, F.H.F., Reis, D.G., Crestani, C.C., Corrêa, F.M.A., Guimarães, F.S., 2008. Anxiolytic-like effects induced by acute reversible inactivation of the bed nucleus of stria terminalis. Neuroscience 154, 869–876. Retson, T.A., Van Bockstaele, E.J., 2013. Coordinate regulation of noradrenergic and serotonergic brain regions by amygdalar neurons. J. Chem. Neuroanat. Reyes, B.A.S., Carvalho, A.F., Vakharia, K., Van Bockstaele, E.J., 2011. Amygdalar peptidergic circuits regulating noradrenergic locus coeruleus neurons: linking limbic and arousal centers. Exp. Neurol. 230, 96–105.

232

Rizvi, T.A., Ennis, M., Behbehani, M.M., Shipley, M.T., 1991. Connections between the central nucleus of the amygdala and the midbrain periaqueductal gray: topography and reciprocity. J. Comp. Neurol. 303, 121–131. Roder, S., Ciriello, J., 1993. Contribution of bed nucleus of the stria terminalis to the cardiovascular responses elicited by stimulation of the amygdala. Journal of the Autonomic Nervous System 45, 61–75. Rodgers, R.J., Halford, J.C., Nunes de Souza, R.L., Canto de Souza, A.L., Piper, D.C., Arch, J.R., Blundell, J.E., 2000. Dose-response effects of orexin-A on food intake and the behavioural satiety sequence in rats. Regul. Pept. 96, 71–84. Rodgers, R.J., Wright, F.L., Snow, N.F., Taylor, L.J., 2013. Orexin-1 receptor antagonism fails to reduce anxiety-like behaviour in either plus-maze-naïve or plus-maze-experienced mice. Behav. Brain Res. 243C, 213–219. Roozendaal, B., Koolhaas, J.M., Bohus, B., 1990. Differential effect of lesioning of the central amygdala on the bradycardiac and behavioral response of the rat in relation to conditioned social and solitary stress. Behav. Brain Res. 41, 39–48. Roozendaal, B., Koolhaas, J.M., Bohus, B., 1997. The role of the central amygdala in stress and adaption. Acta Physiol Scand Suppl 640, 51–54. Roozendaal, B., McGaugh, J.L., 1997. Glucocorticoid receptor agonist and antagonist administration into the basolateral but not central amygdala modulates memory storage. Neurobiol Learn Mem 67, 176–179. Roozendaal, Brunson, K.L., Holloway, B.L., McGaugh, J.L., Baram, T.Z., 2002. Involvement of stress-released corticotropin-releasing hormone in the basolateral amygdala in regulating memory consolidation. Proc. Natl. Acad. Sci. U.S.A. 99, 13908–13913. Roozendaal, Koolhaas, J.M., Bohus, B., 1992a. Central Amygdaloid Involvement in Neuroendocrine Correlates of Conditioned Stress Responses. Journal of Neuroendocrinology 4, 483–489. Roozendaal, Koolhaas, J.M., Bohus, B., 1993a. The central amygdala is involved in conditioning but not in retention of active and passive shock avoidance in male rats. Behav. Neural Biol. 59, 143–149. Roozendaal, Lengvilas, R., McGaugh, J.L., Civelli, O., Reinscheid, R.K., 2007. Orphanin FQ/nociceptin interacts with the basolateral amygdala noradrenergic system in memory consolidation. Learn. Mem. 14, 29–35. Roozendaal, Schelling, G., McGaugh, J.L., 2008. Corticotropin-Releasing Factor in the Basolateral Amygdala Enhances Memory Consolidation via an Interaction with the ?- Adrenoceptor-cAMP Pathway: Dependence on Glucocorticoid Receptor Activation. J Neurosci 28, 6642–6651. Roozendaal, Schoorlemmer, G.H., Koolhaas, J.M., Bohus, B., 1993b. Cardiac, neuroendocrine, and behavioral effects of central amygdaloid vasopressinergic and oxytocinergic mechanisms under stress-free conditions in rats. Brain Res. Bull. 32, 573–579. Roozendaal, Wiersma, A., Driscoll, P., Koolhaas, J.M., Bohus, B., 1992b. Vasopressinergic modulation of stress responses in the central amygdala of the Roman high-avoidance and low-avoidance rat. Brain Res. 596, 35–40. Rorick-Kehn, L.M., Steinmetz, J.E., 2005. Amygdalar unit activity during three learning tasks: eyeblink classical conditioning, Pavlovian fear conditioning, and signaled avoidance conditioning. Behav. Neurosci. 119, 1254–1276. Rosen, J.B., Donley, M.P., 2006. Animal studies of amygdala function in fear and uncertainty: relevance to human research. Biol Psychol 73, 49–60. Rosen, J.B., Hitchcock, J.M., Sananes, C.B., Miserendino, M.J., Davis, M., 1991. A direct projection from the central nucleus of the amygdala to the acoustic startle pathway: anterograde and retrograde tracing studies. Behav. Neurosci. 105, 817–825. Rosenkranz, J.A., Buffalari, D.M., Grace, A.A., 2006. Opposing Influence of Basolateral Amygdala and Footshock Stimulation on Neurons of the Central Amygdala. Biological Psychiatry 59, 801–811.

233

Rosin, D.L., Weston, M.C., Sevigny, C.P., Stornetta, R.L., Guyenet, P.G., 2003. Hypothalamic orexin (hypocretin) neurons express vesicular glutamate transporters VGLUT1 or VGLUT2. The Journal of Comparative Neurology 465, 593–603. Rotter, A., Asemann, R., Decker, A., Kornhuber, J., Biermann, T., 2011. Orexin expression and promoter-methylation in peripheral blood of patients suffering from major depressive disorder. J Affect Disord 131, 186–192. Saggu, S., Lundy, R.F., 2008. Forebrain neurons that project to the gustatory parabrachial nucleus in rat lack glutamic acid decarboxylase. Am. J. Physiol. Regul. Integr. Comp. Physiol. 294, R52–57. Sah, P., Faber, E.S.L., Armentia, M.L.D., Power, J., 2003. The Amygdaloid Complex: Anatomy and Physiology. Physiol Rev 83, 803–834. Saha, Drinkhill, M.J., Moore, J.P., Batten, T.F.C., 2005. Central nucleus of amygdala projections to rostral ventrolateral medulla neurones activated by decreased blood pressure. Eur. J. Neurosci. 21, 1921–1930. Saha, S., 2005. Role of the central nucleus of the amygdala in the control of blood pressure: descending pathways to medullary cardiovascular nuclei. Clin. Exp. Pharmacol. Physiol. 32, 450–456. Saha, S., Batten, T.F.., Henderson, Z., 2000. A GABAergic projection from the central nucleus of the amygdala to the nucleus of the solitary tract: a combined anterograde tracing and electron microscopic immunohistochemical study. Neuroscience 99, 613–626. Saha, S., Henderson, Z., Batten, T.F.., 2002. Somatostatin immunoreactivity in axon terminals in rat nucleus tractus solitarii arising from central nucleus of amygdala: coexistence with GABA and postsynaptic expression of sst2A receptor. Journal of Chemical Neuroanatomy 24, 1–13. Sakamoto, F., Yamada, S., Ueta, Y., 2004. Centrally administered orexin-A activates corticotropin-releasing factor-containing neurons in the hypothalamic paraventricular nucleus and central amygdaloid nucleus of rats: possible involvement of central orexins on stress-activated central CRF neurons. Regul. Pept. 118, 183–191. Sakurai, T., 2007. The neural circuit of orexin (hypocretin): maintaining sleep and wakefulness. Nat Rev Neurosci 8, 171–181. Sakurai, T., Amemiya, A., Ishii, M., Matsuzaki, I., Chemelli, R.M., Tanaka, H., Williams, S.C., Richardson, J.A., Kozlowski, G.P., Wilson, S., Arch, J.R., Buckingham, R.E., Haynes, A.C., Carr, S.A., Annan, R.S., McNulty, D.E., Liu, W.S., Terrett, J.A., Elshourbagy, N.A., Bergsma, D.J., Yanagisawa, M., 1998. Orexins and orexin receptors: a family of hypothalamic neuropeptides and G protein-coupled receptors that regulate feeding behavior. Cell 92, 573–585. Sakurai, T., Mieda, M., 2011. Connectomics of orexin-producing neurons: interface of systems of emotion, energy homeostasis and arousal. Trends Pharmacol. Sci. 32, 451–462. Sakurai, T., Nagata, R., Yamanaka, A., Kawamura, H., Tsujino, N., Muraki, Y., Kageyama, H., Kunita, S., Takahashi, S., Goto, K., Koyama, Y., Shioda, S., Yanagisawa, M., 2005. Input of orexin/hypocretin neurons revealed by a genetically encoded tracer in mice. Neuron 46, 297–308. Samson, R.D., Paré, D., 2005. Activity-dependent synaptic plasticity in the central nucleus of the amygdala. J. Neurosci. 25, 1847–1855. Samson, W.K., Bagley, S.L., Ferguson, A.V., White, M.M., 2010. Orexin Receptor Subtype Activation and Locomotor Behavior in the Rat. Acta Physiol (Oxf) 198, 313–324. Samson, W.K., Gosnell, B., Chang, J.-K., Resch, Z.T., Murphy, T.C., 1999. Cardiovascular regulatory actions of the hypocretins in brain. Brain Research 831, 248–253. Samuels, E.R., Szabadi, E., 2008. Functional Neuroanatomy of the Noradrenergic Locus Coeruleus: Its Roles in the Regulation of Arousal and Autonomic Function Part II: Physiological and Pharmacological Manipulations and Pathological Alterations of Locus Coeruleus Activity in Humans. Curr Neuropharmacol 6, 254–285.

234

Sanders, S.K., Shekhar, A., 1991. Blockade of GABAA receptors in the region of the anterior basolateral amygdala of rats elicits increases in heart rate and blood pressure. Brain Res. 567, 101–110. Sanders, S.K., Shekhar, A., 1995. Regulation of anxiety by GABAA receptors in the rat amygdala. Pharmacology Biochemistry and Behavior 52, 701–706. Sarhan, M., Freund-Mercier, M.-J., Veinante, P., 2005. Branching patterns of parabrachial neurons projecting to the central extended amgydala: single axonal reconstructions. J. Comp. Neurol. 491, 418–442. Sasaki, K., Suzuki, M., Mieda, M., Tsujino, N., Roth, B., Sakurai, T., 2011. Pharmacogenetic modulation of orexin neurons alters sleep/wakefulness states in mice. PLoS ONE 6, e20360. Savonenko, A., Filipkowski, R.K., Werka, T., Zielinski, K., Kaczmarek, L., 1999. Defensive conditioning-related functional heterogeneity among nuclei of the rat amygdala revealed by c-Fos mapping. Neuroscience 94, 723–733. Schadt, J.C., Hasser, E.M., 2004. Hemodynamic effects of blood loss during a passive response to a stressor in the conscious rabbit. Am. J. Physiol. Regul. Integr. Comp. Physiol. 286, R373–380. Schettino, L.F., Otto, T., 2001. Patterns of Fos expression in the amygdala and ventral perirhinal cortex induced by training in an olfactory fear conditioning paradigm. Behav. Neurosci. 115, 1257–1272. Schlör, K.H., Stumpf, H., Stock, G., 1984. Baroreceptor reflex during arousal induced by electrical stimulation of the amygdala or by natural stimuli. J. Auton. Nerv. Syst. 10, 157–165. Schmitt, O., Usunoff, K.G., Lazarov, N.E., Itzev, D.E., Eipert, P., Rolfs, A., Wree, A., 2012. Orexinergic innervation of the extended amygdala and basal ganglia in the rat. Brain Struct Funct 217, 233–256. Schulz, G., Knuepfer, M., Lambertz, M., Langhorst, P., Stock, G., 1996. Relationship between rhythmic discharge patterns of neurons in the central nucleus of the amygdala, blood pressure fluctuations and cortical activity. Journal of the Autonomic Nervous System 57, 158–162. Scicli, A.P., Petrovich, G.D., Swanson, L.W., Thompson, R.F., 2004. Contextual fear conditioning is associated with lateralized expression of the immediate early gene c-fos in the central and basolateral amygdalar nuclei. Behav. Neurosci. 118, 5–14. Scott, M.M., Marcus, J.N., Pettersen, A., Birnbaum, S.G., Mochizuki, T., Scammell, T.E., Nestler, E.J., Elmquist, J.K., Lutter, M., 2011. Hcrtr1 and 2 signaling differentially regulates depression-like behaviors. Behav. Brain Res. 222, 289–294. Sears, R.M., Fink, A.E., Wigestrand, M.B., Farb, C.R., de Lecea, L., LeDoux, J.E., 2013. Orexin/hypocretin system modulates amygdala-dependent threat learning through the locus coeruleus. Proc Natl Acad Sci U S A 110, 20260–20265. See, R.E., Fuchs, R.A., Ledford, C.C., McLAUGHLIN, J., 2003. Drug Addiction, Relapse, and the Amygdala. Annals of the New York Academy of Sciences 985, 294–307. Selbach, O., Bohla, C., Barbara, A., Doreulee, N., Eriksson, K.S., Sergeeva, O.A., Haas, H.L., 2010. Orexins/hypocretins control bistability of hippocampal long-term synaptic plasticity through co-activation of multiple kinases. Acta Physiol (Oxf) 198, 277–285. Selbach, O., Doreulee, N., Bohla, C., Eriksson, K.S., Sergeeva, O.A., Poelchen, W., Brown, R.E., Haas, H.L., 2004. Orexins/hypocretins cause sharp wave- and theta-related synaptic plasticity in the hippocampus via glutamatergic, gabaergic, noradrenergic, and cholinergic signaling. Neuroscience 127, 519–528. Seligman, M.E., Maier, S.F., 1967. Failure to escape traumatic shock. J Exp Psychol 74, 1–9. Seyedabadi, M., Li, Q., Padley, J.R., Pilowsky, P.M., Goodchild, A.K., 2006. A novel pressor area at the medullo-cervical junction that is not dependent on the RVLM: efferent pathways and chemical mediators. J. Neurosci. 26, 5420–5427.

235

Shahid, I.Z., Rahman, A.A., Pilowsky, P.M., 2012. Orexin A in rat rostral ventrolateral medulla is pressor, sympatho-excitatory, increases barosensitivity and attenuates the somato- sympathetic reflex. Br. J. Pharmacol. 165, 2292–2303. Shaikh, M.B., Lu, C.L., Siegel, A., 1991. An enkephalinergic mechanism involved in amygdaloid suppression of affective defence behavior elicited from the midbrain periaqueductal gray in the cat. Brain Res. 559, 109–117. Shalev, A.Y., Sahar, T., Freedman, S., Peri, T., Glick, N., Brandes, D., Orr, S.P., Pitman, R.K., 1998. A prospective study of heart rate response following trauma and the subsequent development of posttraumatic stress disorder. Arch. Gen. Psychiatry 55, 553–559. Shane, R., Lazar, D.A., Rossi, G.C., Pasternak, G.W., Bodnar, R.J., 2001. Analgesia elicited by OFQ/nociceptin and its fragments from the amygdala in rats. Brain Research 907, 109– 116. Shi, C., Davis, M., 1999. Pain Pathways Involved in Fear Conditioning Measured with Fear- Potentiated Startle: Lesion Studies. J. Neurosci. 19, 420–430. Shimada, S., Inagaki, S., Kubota, Y., Ogawa, N., Shibasaki, T., Takagi, H., 1989. Coexistence of peptides (corticotropin releasing factor/neurotensin and substance P/somatostatin) in the bed nucleus of the stria terminalis and central amygdaloid nucleus of the rat. Neuroscience 30, 377–383. Shirasaka, T., Nakazato, M., Matsukura, S., Takasaki, M., Kannan, H., 1999. Sympathetic and cardiovascular actions of orexins in conscious rats. Am. J. Physiol. 277, R1780–1785. Si, J., Yang, J., Xue, L., Yang, C., Luo, Y., Shi, H., Lu, L., 2012. Activation of NF-κB in Basolateral Amygdala Is Required for Memory Reconsolidation in Auditory Fear Conditioning. PLoS ONE 7, e43973. Siegel, J., 2009. The Neurobiology of Sleep. Seminars in Neurology 29, 277–296. Sierra-Mercado, D., Padilla-Coreano, N., Quirk, G.J., 2011. Dissociable Roles of Prelimbic and Infralimbic Cortices, Ventral Hippocampus, and Basolateral Amygdala in the Expression and Extinction of Conditioned Fear. Neuropsychopharmacology 36, 529– 538. Sil’kis, I.G., 2012. Possible mechanisms for orexin effects on the functioning of the hippocampus and spatial learning (analytical review). Zh Vyssh Nerv Deiat Im I P Pavlova 62, 389–400. Silvestri, A.J., Kapp, B.S., 1998. Amygdaloid modulation of mesopontine peribrachial neuronal activity: implications for arousal. Behav. Neurosci. 112, 571–588. Sinha, R., Fox, H.C., Hong, K.A., Hansen, J., Tuit, K., Kreek, M.J., 2011. Effects of Adrenal Sensitivity, Stress- and Cue-Induced Craving, and Anxiety on Subsequent Alcohol Relapse and Treatment Outcomes. Arch Gen Psychiatry 68, 942–952. Sinha, R., Fuse, T., Aubin, L.R., O’Malley, S.S., 2000a. Psychological stress, drug-related cues and cocaine craving. Psychopharmacology (Berl.) 152, 140–148. Sinha, R., Fuse, T., Aubin, L.R., O’Malley, S.S., 2000b. Psychological stress, drug-related cues and cocaine craving. Psychopharmacology (Berl.) 152, 140–148. Sinha, R., Li, C.S.R., 2007. Imaging stress- and cue-induced drug and alcohol craving: association with relapse and clinical implications. Drug Alcohol Rev 26, 25–31. Skórzewska, A., Bidziński, A., amed, A., Lehner, M., Turzyńska, D., Sobolewska, A., Maciejak, P., Szyndler, J., Wisłowska-Stanek, A., Płaźnik, A., 2008. The influence of CRF and α-helical CRF(9-41) on rat fear responses, c-Fos and CRF expression, and concentration of amino acids in brain structures. Hormones and Behavior 54, 602–612. Skórzewska, A., Bidziński, A., amed, A., Lehner, M., Turzyńska, D., Sobolewska, A., Szyndler, J., Maciejak, P., Wisłowska-Stanek, A., Płaźnik, A., 2009. The effect of CRF and alpha-helical CRF((9-41)) on rat fear responses and amino acids release in the central nucleus of the amygdala. Neuropharmacology 57, 148–156. Smith, P.M., Connolly, B.C., Ferguson, A.V., 2002. Microinjection of orexin into the rat nucleus tractus solitarius causes increases in blood pressure. Brain Res. 950, 261–267. Smith, R.J., Tahsili-Fahadan, P., Aston-Jones, G., 2010. Orexin/hypocretin is necessary for context-driven cocaine-seeking. Neuropharmacology 58, 179–184.

236

Soltis, R.P., Cook, J.C., Gregg, A.E., Sanders, B.J., 1997. Interaction of GABA and excitatory amino acids in the basolateral amygdala: role in cardiovascular regulation. J. Neurosci. 17, 9367–9374. Sotres-Bayon, F., Quirk, G.J., 2010. Prefrontal control of fear: more than just extinction. Current Opinion in Neurobiology 20, 231–235. Soya, S., Shoji, H., Hasegawa, E., Hondo, M., Miyakawa, T., Yanagisawa, M., Mieda, M., Sakurai, T., 2013. Orexin receptor-1 in the locus coeruleus plays an important role in cue-dependent fear memory consolidation. J. Neurosci. 33, 14549–14557. Steenland, H.W., Zhuo, M., 2009. Neck electromyography is an effective measure of fear behavior. J. Neurosci. Methods 177, 355–360. Steiner, M.A., Lecourt, H., Jenck, F., 2012. The brain orexin system and almorexant in fear- conditioned startle reactions in the rat. Psychopharmacology (Berl.) 223, 465–475. Stensrud, M.J., Chaudhry, F.A., Leergaard, T.B., Bjaalie, J.G., Gundersen, V., 2013. Vesicular glutamate transporter-3 in the rodent brain: Vesicular colocalization with vesicular γ- aminobutyric acid transporter. J. Comp. Neurol. 521, 3042–3056. Stewart, J., 2000. Pathways to relapse: the neurobiology of drug- and stress-induced relapse to drug-taking. Journal of Psychiatry and Neuroscience 25, 125. Stiedl, O., Tovote, P., Ögren, S.O., Meyer, M., 2004. Behavioral and autonomic dynamics during contextual fear conditioning in mice. Autonomic Neuroscience 115, 15–27. Stock, G., Rupprecht, U., Stumpf, H., Schlör, K.H., 1981. Cardiovascular changes during arousal elicited by stimulation of amygdala, hypothalamus and locus coeruleus. J. Auton. Nerv. Syst. 3, 503–510. Stock, G., Stumpf, H., Schlör, K.H., 1979. Absence of sympathetic cholinergic vasodilatation in cats during early stages of affective behaviour elicited by stimulation of central amygdala, postero-lateral hypothalamus and locus coeruleus. Clin. Sci. 57 Suppl 5, 205s–208s. Stone, E.A., Lin, Y., Ahsan, R., Quartermain, D., 2004. Role of locus coeruleus alpha1- adrenoceptors in motor activity in rats. Synapse 54, 164–172. Stornetta, R.L., Guyenet, P.G., 1999. Distribution of glutamic acid decarboxylase mRNA- containing neurons in rat medulla projecting to thoracic spinal cord in relation to monoaminergic brainstem neurons. J. Comp. Neurol. 407, 367–380. Stornetta, R.L., Rosin, D.L., Simmons, J.R., McQuiston, T.J., Vujovic, N., Weston, M.C., Guyenet, P.G., 2005. Coexpression of vesicular glutamate transporter-3 and gamma- aminobutyric acidergic markers in rat rostral medullary raphe and intermediolateral cell column. J. Comp. Neurol. 492, 477–494. Strawn, J.R., Pyne-Geithman, G.J., Ekhator, N.N., Horn, P.S., Uhde, T.W., Shutter, L.A., Baker, D.G., Geracioti Jr., T.D., 2010. Low cerebrospinal fluid and plasma orexin-A (hypocretin-1) concentrations in combat-related posttraumatic stress disorder. Psychoneuroendocrinology 35, 1001–1007. Sullivan, G.M., Apergis, J., Bush, D.E.A., Johnson, L.R., Hou, M., LeDoux, J.E., 2004. Lesions in the bed nucleus of the stria terminalis disrupt corticosterone and freezing responses elicited by a contextual but not by a specific cue-conditioned fear stimulus. Neuroscience 128, 7–14. Sun, Cassell, M.D., 1993. Intrinsic GABAergic neurons in the rat central extended amygdala. The Journal of Comparative Neurology 330, 381–404. Sun, M.K., Guyenet, P.G., 1986. Hypothalamic glutamatergic input to medullary sympathoexcitatory neurons in rats. Am. J. Physiol. 251, R798–810. Sun, Yi, H., Cassell, M.D., 1994. Evidence for a GABAergic interface between cortical afferents and brainstem projection neurons in the rat central extended amygdala. The Journal of Comparative Neurology 340, 43–64. Swanson, 2003. The amygdala and its place in the cerebral hemisphere. Ann. N. Y. Acad. Sci. 985, 174–184. Swanson, Petrovich, G.D., 1998. What is the amygdala? Trends Neurosci. 21, 323–331.

237

Swiergiel, A.H., Takahashi, L.K., Rubin, W.W., Kalin, N.H., 1992. Antagonism of corticotropin-releasing factor receptors in the locus coeruleus attenuates shock-induced freezing in rats. Brain Research 587, 263–268. Takahashi, K., Koyama, Y., Kayama, Y., Yamamoto, M., 2002. Effects of orexin on the laterodorsal tegmental neurones. Psychiatry Clin. Neurosci. 56, 335–336. Takakusaki, K., Takahashi, K., Saitoh, K., Harada, H., Okumura, T., Kayama, Y., Koyama, Y., 2005. Orexinergic projections to the cat midbrain mediate alternation of emotional behavioural states from locomotion to cataplexy. J Physiol 568, 1003–1020. Takayama, K., Miura, M., 1991. Glutamate-immunoreactive neurons of the central amygdaloid nucleus projecting to the subretrofacial nucleus of SHR and WKY rats: A double- labeling study. Neuroscience Letters 134, 62–66. Tao, R., Ma, Z., McKenna, J.T., Thakkar, M.M., Winston, S., Strecker, R.E., McCarley, R.W., 2006. Differential effect of orexins (hypocretins) on serotonin release in the dorsal and median raphe nuclei of freely behaving rats. Neuroscience 141, 1101–1105. Telegdy, G., Adamik, A., 2002. The action of orexin A on passive avoidance learning. Involvement of transmitters. Regulatory Peptides 104, 105–110. Thannickal, T.C., Moore, R.Y., Nienhuis, R., Ramanathan, L., Gulyani, S., Aldrich, M., Cornford, M., Siegel, J.M., 2000. Reduced number of hypocretin neurons in human narcolepsy. Neuron 27, 469–474. Thomas, E., Burock, D., Knudsen, K., Deterding, E., Yadin, E., 2013. Single unit activity in the lateral septum and central nucleus of the amygdala in the elevated plus-maze: A model of exposure therapy? Neurosci. Lett. Thompson, R.L., Cassell, M.D., 1989. Differential distribution and non-collateralization of central amygdaloid neurons projecting to different medullary regions. Neurosci. Lett. 97, 245–251. Tkacs, N.C., Li, J., 1999. Immune stimulation induces Fos expression in brainstem amygdala afferents. Brain Res. Bull. 48, 223–231. Torterolo, P., Yamuy, J., Sampogna, S., Morales, F.R., Chase, M.H., 2003. Hypocretinergic neurons are primarily involved in activation of the somatomotor system. Sleep 26, 25– 28. Tose, R., Kushikata, T., Yoshida, H., Kudo, M., Furukawa, K., Ueno, S., Hirota, K., 2009. Interaction between orexinergic neurons and NMDA receptors in the control of locus coeruleus-cerebrocortical noradrenergic activity of the rat. Brain Res. 1250, 81–87. Treit, D., Pesold, C., Rotzinger, S., 1993. Dissociating the anti-fear effects of septal and amygdaloid lesions using two pharmacologically validated models of rat anxiety. Behav. Neurosci. 107, 770–785. Trivedi, P., Yu, H., MacNeil, D.J., Van der Ploeg, L.H., Guan, X.M., 1998. Distribution of orexin receptor mRNA in the rat brain. FEBS Lett. 438, 71–75. Tronson, N.C., Wiseman, S.L., Olausson, P., Taylor, J.R., 2006. Bidirectional behavioral plasticity of memory reconsolidation depends on amygdalar protein kinase A. Nature Neuroscience 9, 167–169. Tsubouchi, K., Tsumori, T., Yokota, S., Okunishi, H., Yasui, Y., 2007. A disynaptic pathway from the central amygdaloid nucleus to the paraventricular hypothalamic nucleus via the parastrial nucleus in the rat. Neurosci. Res. 59, 390–398. Tsumori, T., Qin, Y., Yokota, S., Niu, J., Yasui, Y., 2010. Central amygdaloid axon terminals are in contact with retrorubral field neurons that project to the parvicellular reticular formation of the medulla oblongata in the rat. Brain Research 1306, 18–28. Tsumori, T., Yokota, S., Kishi, T., Qin, Y., Oka, T., Yasui, Y., 2006a. Insular cortical and amygdaloid fibers are in contact with posterolateral hypothalamic neurons projecting to the nucleus of the solitary tract in the rat. Brain Res. 1070, 139–144. Tsumori, T., Yokota, S., Qin, Y., Oka, T., Yasui, Y., 2006b. A light and electron microscopic analysis of the convergent insular cortical and amygdaloid projections to the posterior lateral hypothalamus in the rat, with special reference to cardiovascular function. Neurosci. Res. 56, 261–269.

238

Tye, K.M., Prakash, R., Kim, S.-Y., Fenno, L.E., Grosenick, L., Zarabi, H., Thompson, K.R., Gradinaru, V., Ramakrishnan, C., Deisseroth, K., 2011. Amygdala circuitry mediating reversible and bidirectional control of anxiety. Nature 471, 358–362. Vagg, D.J., Bandler, R., Keay, K.A., 2008. Hypovolemic shock: critical involvement of a projection from the ventrolateral periaqueductal gray to the caudal midline medulla. Neuroscience 152, 1099–1109. Vaiva, G., Ducrocq, F., Jezequel, K., Averland, B., Lestavel, P., Brunet, A., Marmar, C.R., 2003. Immediate treatment with propranolol decreases posttraumatic stress disorder two months after trauma. Biol. Psychiatry 54, 947–949. Valentino, R.., Rudoy, C., Saunders, A., Liu, X.-B., Van Bockstaele, E.., 2001. Corticotropin- releasing factor is preferentially colocalized with excitatory rather than inhibitory amino acids in axon terminals in the peri-locus coeruleus region. Neuroscience 106, 375–384. Valentino, R.J., Foote, S.L., Aston-Jones, G., 1983. Corticotropin-releasing factor activates noradrenergic neurons of the locus coeruleus. Brain Research 270, 363–367. Van Bockstaele, E.J., Aston-Jones, G., Pieribone, V.A., Ennis, M., Shipley, M.T., 1991. Subregions of the periaqueductal gray topographically innervate the rostral ventral medulla in the rat. The Journal of Comparative Neurology 309, 305–327. Van Bockstaele, E.J., Bajic, D., Proudfit, H., Valentino, R.J., 2001. Topographic architecture of stress-related pathways targeting the noradrenergic locus coeruleus. Physiol. Behav. 73, 273–283. Van Bockstaele, E.J., Chan, J., Pickel, V.M., 1996. Input from central nucleus of the amygdala efferents to pericoerulear dendrites, some of which contain tyrosine hydroxylase immunoreactivity. J. Neurosci. Res. 45, 289–302. Van Bockstaele, E.J., Colago, E.E., Valentino, R.J., 1998. Amygdaloid corticotropin-releasing factor targets locus coeruleus dendrites: substrate for the co-ordination of emotional and cognitive limbs of the stress response. J. Neuroendocrinol. 10, 743–757. Van Bockstaele, E.J., Peoples, J., Valentino, R.J., 1999. A.E. Bennett Research Award. Anatomic basis for differential regulation of the rostrolateral peri-locus coeruleus region by limbic afferents. Biol. Psychiatry 46, 1352–1363. Van den Top, M., Nolan, M.F., Lee, K., Richardson, P.J., Buijs, R.M., Davies, C.H., Spanswick, D., 2003. Orexins induce increased excitability and synchronisation of rat sympathetic preganglionic neurones. J. Physiol. (Lond.) 549, 809–821. Veening, J.G., Swanson, L.W., Sawchenko, P.E., 1984. The organization of projections from the central nucleus of the amygdala to brainstem sites involved in central autonomic regulation: A combined retrograde transport-immunohistochemical study. Brain Research 303, 337–357. Veinante, P., Freund-Mercier, M.-J., 1997. Distribution of oxytocin- and vasopressin-binding sites in the rat extended amygdala: a histoautoradiographic study. The Journal of Comparative Neurology 383, 305–325. Veinante, P., Freund-Mercier, M.-J., 2003. Branching Patterns of Central Amygdaloid Nucleus Efferents in the Rat. Annals of the New York Academy of Sciences 985, 552–553. Vertes, R.P., 2004. Differential projections of the infralimbic and prelimbic cortex in the rat. Synapse 51, 32–58. Vianna, Allen, C., Carrive, P., 2008. Cardiovascular and behavioral responses to conditioned fear after medullary raphe neuronal blockade. Neuroscience 153, 1344–1353. Vianna, D.M., Graeff, F.G., Landeira-Fernandez, J., Brandão, M.L., 2001. Lesion of the ventral periaqueductal gray reduces conditioned fear but does not change freezing induced by stimulation of the dorsal periaqueductal gray. Learn. Mem. 8, 164–169. Vianna, D.M.L., Borelli, K.G., Ferreira-Netto, C., Macedo, C.E., Brandão, M.L., 2003. Fos-like immunoreactive neurons following electrical stimulation of the dorsal periaqueductal gray at freezing and escape thresholds. Brain Res. Bull. 62, 179–189. Vianna, D.M.L., Carrive, P., 2005. Changes in cutaneous and body temperature during and after conditioned fear to context in the rat. Eur. J. Neurosci. 21, 2505–2512.

239

Vidal-Gonzalez, I., Vidal-Gonzalez, B., Rauch, S.L., Quirk, G.J., 2006. Microstimulation reveals opposing influences of prelimbic and infralimbic cortex on the expression of conditioned fear. Learn Mem 13, 728–733. Vilim, F.S., Price, D.A., Lesser, W., Kupfermann, I., Weiss, K.R., 1996. Costorage and Corelease of Modulatory Peptide Cotransmitters with Partially Antagonistic Actions on the Accessory Radula Closer Muscle ofAplysia californica. J. Neurosci. 16, 8092–8104. Viviani, D., Charlet, A., van den Burg, E., Robinet, C., Hurni, N., Abatis, M., Magara, F., Stoop, R., 2011. Oxytocin selectively gates fear responses through distinct outputs from the central amygdala. Science 333, 104–107. Walker, D.L., Davis, M., 1997. Double dissociation between the involvement of the bed nucleus of the stria terminalis and the central nucleus of the amygdala in startle increases produced by conditioned versus unconditioned fear. J. Neurosci. 17, 9375–9383. Walker, D.L., Miles, L.A., Davis, M., 2009. Selective Participation of the Bed Nucleus of the Stria Terminalis and CRF in Sustained Anxiety-Like versus Phasic Fear-Like Responses. Prog Neuropsychopharmacol Biol Psychiatry 33, 1291–1308. Walker, P., Carrive, P., 2003. Role of ventrolateral periaqueductal gray neurons in the behavioral and cardiovascular responses to contextual conditioned fear and poststress recovery. Neuroscience 116, 897–912. Walker, D.L., Paschall, G.Y., Davis, M., 2005. Glutamate receptor antagonist infusions into the basolateral and medial amygdala reveal differential contributions to olfactory vs. context fear conditioning and expression. Learn. Mem. 12, 120–129. Walker, D.L., Toufexis, D.J., Davis, M., 2003. Role of the bed nucleus of the stria terminalis versus the amygdala in fear, stress, and anxiety. Eur. J. Pharmacol. 463, 199–216. Wallace, D.M., Magnuson, D.J., Gray, T.S., 1992. Organization of amygdaloid projections to brainstem dopaminergic, noradrenergic, and adrenergic cell groups in the rat. Brain Res. Bull. 28, 447–454. Wallén-Mackenzie, Å., Nordenankar, K., Fejgin, K., Lagerström, M.C., Emilsson, L., Fredriksson, R., Wass, C., Andersson, D., Egecioglu, E., Andersson, M., Strandberg, J., Lindhe, Ö., Schiöth, H.B., Chergui, K., Hanse, E., Långström, B., Fredriksson, A., Svensson, L., Roman, E., Kullander, K., 2009. Restricted Cortical and Amygdaloid Removal of Vesicular Glutamate Transporter 2 in Preadolescent Mice Impacts Dopaminergic Activity and Neuronal Circuitry of Higher Brain Function. J. Neurosci. 29, 2238–2251. Walling, S.G., Nutt, D.J., Lalies, M.D., Harley, C.W., 2004. Orexin-A infusion in the locus ceruleus triggers norepinephrine (NE) release and NE-induced long-term potentiation in the dentate gyrus. J. Neurosci. 24, 7421–7426. Wang, X.-Y., Zhao, M., Ghitza, U.E., Li, Y.-Q., Lu, L., 2008. Stress impairs reconsolidation of drug memory via glucocorticoid receptors in the basolateral amygdala. J. Neurosci. 28, 5602–5610. Warden, M.R., Selimbeyoglu, A., Mirzabekov, J.J., Lo, M., Thompson, K.R., Kim, S.-Y., Adhikari, A., Tye, K.M., Frank, L.M., Deisseroth, K., 2012. A prefrontal cortex- brainstem neuronal projection that controls response to behavioural challenge. Nature 492, 428–432. Watanabe, S., Kuwaki, T., Yanagisawa, M., Fukuda, Y., Shimoyama, M., 2005. Persistent pain and stress activate pain-inhibitory orexin pathways. Neuroreport 16, 5–8. Wayner, M.., Armstrong, D.., Phelix, C.., Oomura, Y., 2004. Orexin-A (Hypocretin-1) and leptin enhance LTP in the dentate gyrus of rats in vivo. Peptides 25, 991–996. Werka, T., 1997. The effects of the medial and cortical amygdala lesions on post-stress analgesia in rats. Behav. Brain Res. 86, 59–65. Whalen, P.J., 1998. Fear, vigilance, and ambiguity: Initial neuroimaging studies of the human amygdala. Current Directions in Psychological Science 7, 177–188. Whim, M.D., Lloyd, P.E., 1989. Frequency-dependent release of peptide cotransmitters from identified cholinergic motor neurons in Aplysia. Proc. Natl. Acad. Sci. U.S.A. 86, 9034–9038.

240

Wiersma, A., Bohus, B., Koolhaas, J.M., 1993. Corticotropin-releasing hormone microinfusion in the central amygdala diminishes a cardiac parasympathetic outflow under stress-free conditions. Brain Res. 625, 219–227. Wilensky, A.E., Schafe, G.E., Kristensen, M.P., LeDoux, J.E., 2006. Rethinking the fear circuit: the central nucleus of the amygdala is required for the acquisition, consolidation, and expression of Pavlovian fear conditioning. J. Neurosci. 26, 12387–12396. Williams, L.M., Kemp, A.H., Felmingham, K., Barton, M., Olivieri, G., Peduto, A., Gordon, E., Bryant, R.A., 2006. Trauma modulates amygdala and medial prefrontal responses to consciously attended fear. Neuroimage 29, 347–357. Wiltgen, B.J., Sanders, M.J., Anagnostaras, S.G., Sage, J.R., Fanselow, M.S., 2006. Context Fear Learning in the Absence of the Hippocampus. J. Neurosci. 26, 5484–5491. Winsky-Sommerer, R., Boutrel, B., de Lecea, L., 2005. Stress and arousal: the corticotrophin- releasing factor/hypocretin circuitry. Mol. Neurobiol. 32, 285–294. Winsky-Sommerer, R., Yamanaka, A., Diano, S., Borok, E., Roberts, A.J., Sakurai, T., Kilduff, T.S., Horvath, T.L., Lecea, L. de, 2004. Interaction between the Corticotropin- Releasing Factor System and Hypocretins (Orexins): A Novel Circuit Mediating Stress Response. J. Neurosci. 24, 11439–11448. Wu, John, J., Maidment, N., Lam, H.A., Siegel, J.M., 2002a. Hypocretin release in normal and narcoleptic dogs after food and sleep deprivation, eating, and movement. Am J Physiol Regul Integr Comp Physiol 283, R1079–R1086. Wu, M.-F., Nienhuis, R., Maidment, N., Lam, H.A., Siegel, J.M., 2011. Cerebrospinal fluid hypocretin (orexin) levels are elevated by play but are not raised by exercise and its associated heart rate, blood pressure, respiration or body temperature changes. Arch Ital Biol 149, 492–498. Wu, Zhang, Z., Leranth, C., Xu, C., Pol, A.N. van den, Alreja, M., 2002b. Hypocretin Increases Impulse Flow in the Septohippocampal GABAergic Pathway: Implications for Arousal via a Mechanism of Hippocampal Disinhibition. J. Neurosci. 22, 7754–7765. Xi, Fung, S.J., Sampogna, S., Chase, M.H., 2011. Excitatory projections from the amygdala to neurons in the nucleus pontis oralis in the rat: an intracellular study. Neuroscience 197, 181–190. Xi, Fung, S.J., Zhang, J., Sampogna, S., Chase, M.H., 2012. The amygdala and the pedunculopontine tegmental nucleus: interactions controlling active (rapid eye movement) sleep. Exp. Neurol. 238, 44–51. Xi, M.C., Morales, F.R., Chase, M.H., 2001. Effects on sleep and wakefulness of the injection of hypocretin-1 (orexin-A) into the laterodorsal tegmental nucleus of the cat. Brain Res. 901, 259–264. Xiao, F., Jiang, M., Du, D., Xia, C., Wang, J., Cao, Y., Shen, L., Zhu, D., 2013. Orexin A regulates cardiovascular responses in stress-induced hypertensive rats. Neuropharmacology 67, 16–24. Yamuy, J., Fung, S.J., Xi, M., Chase, M.H., 2010. State-dependent control of lumbar motoneurons by the hypocretinergic system. Exp. Neurol. 221, 335–345. Yang, L., Zou, B., Xiong, X., Pascual, C., Xie, J., Malik, A., Xie, J., Sakurai, T., Xie, X.S., 2013. Hypocretin/orexin neurons contribute to hippocampus-dependent social memory and synaptic plasticity in mice. J. Neurosci. 33, 5275–5284. Yardley, C.P., Hilton, S.M., 1986. The hypothalamic and brainstem areas from which the cardiovascular and behavioural components of the defence reaction are elicited in the rat. J. Auton. Nerv. Syst. 15, 227–244. Yassa, M.A., Hazlett, R.L., Stark, C.E.L., Hoehn-Saric, R., 2012. Functional MRI of the amygdala and bed nucleus of the stria terminalis during conditions of uncertainty in generalized anxiety disorder. Journal of Psychiatric Research 46, 1045–1052. Yasui, Y., Tsumori, T., Oka, T., Yokota, S., 2004. Amygdaloid axon terminals are in contact with trigeminal premotor neurons in the parvicellular reticular formation of the rat medulla oblongata. Brain Research 1016, 129–134.

241

Yoshida, K., McCormack, S., España, R.A., Crocker, A., Scammell, T.E., 2006. Afferents to the orexin neurons of the rat brain. The Journal of Comparative Neurology 494, 845–861. Yoshida, S., Matsubara, T., Uemura, A., Iguchi, A., Hotta, N., 2002. Role of Medial Amygdala in Controlling Hemodynamics Via GABAA Receptor in Anesthetized Rats. Circulation Journal 66, 197–203. Yoshimoto, M., Nagata, K., Miki, K., 2010. Differential control of renal and lumbar sympathetic nerve activity during freezing behavior in conscious rats. Am J Physiol Regul Integr Comp Physiol 299, R1114–R1120. Young, J.K., Wu, M.F., Manaye, K.F., Kc, P., Allard, J.S., Mack, S.O., Haxhiu, M.A., 2005. Orexin stimulates breathing via medullary and spinal pathways. J. Appl. Physiol. 98, 1387–1395. Zardetto-Smith, A.M., Moga, M.M., Magnuson, D.J., Gray, T.S., 1988. Lateral hypothalamic dynorphinergic efferents to the amygdala and brainstem in the rat. Peptides 9, 1121– 1127. Zarrindast, M.-R., Solati, J., Oryan, S., Parivar, K., 2008. Effect of intra-amygdala injection of nicotine and GABA receptor agents on anxiety-like behaviour in rats. Pharmacology 82, 276–284. Zatzick, D.F., Kang, S.-M., Müller, H.-G., Russo, J.E., Rivara, F.P., Katon, W., Jurkovich, G.J., Roy-Byrne, P., 2002. Predicting Posttraumatic Distress in Hospitalized Trauma Survivors With Acute Injuries. Am J Psychiatry 159, 941–946. Zhang, Bandler, R., Carrive, P., 1990. Flight and immobility evoked by excitatory amino acid microinjection within distinct parts of the subtentorial midbrain periaqueductal gray of the cat. Brain Res. 520, 73–82. Zhang, J., Xi, M., Fung, S.J., Sampogna, S., Chase, M.H., 2012. Projections from the central nucleus of the amygdala to the nucleus pontis oralis in the rat: an anterograde labeling study. Neurosci. Lett. 525, 157–162. Zhang, W., Sakurai, T., Fukuda, Y., Kuwaki, T., 2006a. Orexin neuron-mediated skeletal muscle vasodilation and shift of baroreflex during defense response in mice. Am J Physiol Regul Integr Comp Physiol 290, R1654–R1663. Zhang, W., Shimoyama, M., Fukuda, Y., Kuwaki, T., 2006b. Multiple components of the defense response depend on orexin: evidence from orexin knockout mice and orexin neuron-ablated mice. Auton Neurosci 126-127, 139–145. Zhang, W., Sunanaga, J., Takahashi, Y., Mori, T., Sakurai, T., Kanmura, Y., Kuwaki, T., 2010. Orexin neurons are indispensable for stress-induced thermogenesis in mice. J Physiol 588, 4117–4129. Zhang, X., Cui, J., Tan, Z., Jiang, C., Fogel, R., 2003. The central nucleus of the amygdala modulates gut-related neurons in the dorsal vagal complex in rats. J Physiol 553, 1005– 1018. Zhang, Zhang, N., Sakurai, T., Kuwaki, T., 2009. Orexin neurons in the hypothalamus mediate cardiorespiratory responses induced by disinhibition of the amygdala and bed nucleus of the stria terminalis. Brain Res. 1262, 25–37. Zhao, X., Yan, J., Yang, X., Chen, K., Li, J., Zhang, Y., 2012. Fos positive neurons in the brain stem and amygdala mostly express vesicular glutamate transporter 3 after bitter taste stimulation. Brain Research 1445, 20–29. Zheng, H.Y., Patterson, L.M., Berthoud, H.R., 2005. Orexin-A projections to the caudal medulla and orexin-induced c-fos expression, food intake, and autonomic function. J. Comp. Neurol. 485, 127–142. Zhu, L., Onaka, T., Sakurai, T., Yada, T., 2002. Activation of orexin neurones after noxious but not conditioned fear stimuli in rats. Neuroreport 13, 1351–1353. Zimmerman, J.M., Maren, S., 2011. The bed nucleus of the stria terminalis is required for the expression of contextual but not auditory freezing in rats with basolateral amygdala lesions. Neurobiol Learn Mem 95, 199–205. Zupanc, G.K., 1996. Peptidergic transmission: from morphological correlates to functional implications. Micron 27, 35–91.

242

Appendix

This section contains text and pages extracted directly from the results section of my honours thesis (Fear activated projections to the ventrolateral periaqueductal gray; University of New South Wales, Department of Anatomy; 2007).

The methods of this experiment were summarised in section 2.2.5. Briefly, CTB was injected unilaterally via pressure or iontophoresis in the VLPAG of rats. After completely recovering from surgery, rats were placed in a footshock box and received 4 footshocks over 40 min at semi-random intervals (mean = 10). Half of these rats (n = 4) were re-exposed to the fear- conditioned context (footshock box) for 40 min, 2 hours before being euthenased and their brains removed and processed for Fos and CTB immunohistochemistry, whilst the other half (n = 4) were euthenased after resting undisturbed in their home boxes. The number of Fos-CTB double-labelled neurons were counted in each brain structure. [The remaining text and figures were extracted directly from the honours thesis].

Analysis …. The mean number of double labelled neurons in each structure was compared between the fear group and rest group, and this was compared in a non parametric statistical test (Mann- Whitney U). Statistical significance was assigned when p < 0.05. The number of double- labelled cells in each brain region was also expressed as a percentage of the total number of double-labelled cells in each brain, and the same comparison between groups was made. All data were expressed as mean ± SEM.

Delineation of structures The boundaries for most structures were defined according to the atlas of Paxinos and Watson (2005), except for the ventrolateral tegmentum, which was defined according to Paxinos et al. (1999). The dorsolateral tegmentum corresponded to the area dorsal of ventrolateral tegmentum. The ventral thalamus corresponded to thalamic areas ventral of the central medial thalamic nucleus. The ventrolateral medulla was defined as the area ventral to the gigantocellular reticular nucleus; the dorsal medulla was defined as the area dorsal of the horizontal plane passing through the central canal; the rostral ventral periaqueductal gray consisted of the following areas: supraoculomotor periaqueductal gray, supraoculomotor cap, oculomotor nuclei, Edinger-Westphal nucleus, interstitial nucleus of Cajal, nucleus of Darkschewitsch and trochlear nuclei.

243

Abbreviations

Ac/VP nucleus accumbens/ventral pallidum AH anterior hypothalamic area aq cerebral aqueduct Arc arcuate hypothalamic nucleus BNST bed nucleus of the stria terminalis CeM medial division of the central nucleus of amygdala Cg cingulate cortex Cn cuneiform nucleus Cpu/GP caudate putamen/globus pallidus CTB Cholera toxin subunit B DAB diaminobenzine DB diagonal band DLPAG dorsolateral periaqueductal gray DLTeg dorsolateral tegmentum Dmed dorsal medulla DMHA dorsomedial hypothalamic nucleus/A13 dopamine cells/dorsal hypothalamic area DMPAG dorsomedial periaqueductal gray DMTeg dorsal medial tegmentum DpMe deep mesencephalon DTeg dorsal tegmentum DTM dorsal tuberomammillary nucleus Genic geniculate nuclei Gi gigantocellular reticular nucleus/intermediate medulla Hb oth habenular nucleus (undifferentiated) IL infralimbic cortex Insula/Cl insular cortex/claustrum ip intraperitoneal LdTg Laterodorsal tegmental nucleus LH ant lateral hypothalamus, anterior part LHbM lateral habenular nucleus, medial part LO lateral orbital cortex LPAG lateral periaqueductal gray LPO lateral preoptic area LSI lateral septum m1/m2 primary and secondary motor cortex Ma cplx mammillary cortex MaLH lateral hypothalamus, posterior part middle LH lateral hypotalamus, middle part MO medial orbital cortex MPA medial preoptic area Mtu medial tuberal nucleus Nsol nucleus of the solitary tract oth vmpfc other ventromedial prefrontal cortex PAG periaqueductal gray (undifferentiated) Pa paraventricular hypothalamic nucleus PB phosphate buffer PBA parabrachial nuclei PeFLH perifornical part of lateral hypothalamus PeV periventricular area of thalamus PH posterior hypothalamus PMHth premammillary nucleus Pn pontine nuclei PrC/DPF precommissural nucleus/dorsal parafascicular thalamic nucleus PrL prelimic cortex PrT pretectal nuclei/dorsal thalamus RCh retrochiasmatic nucleus RVPAG rostral ventral periaqueductal gray Sens cortex sensory cortex Shy septohypothalamic nucleus SN substantia nigra SubB subbrachial nucleus TuLH lateral hypothalamus, tuberal part Vlmed ventrolateral medulla VLPAG ventrolateral periaqueductal gray VLTeg ventrolateral tegmentum VMHth area ventromedial hypothalamic area VO ventral orbital cortex VTA/PBP ventral tegmental area/parabrachial pigment Vthal ventral thalamus ZI/Sub zona incerta/subincertal region

244

245

246

247

248

Table 1. Mean numbers of double -labelled cells in each structure. Stars indicate statistically significant differences between bilateral cell counts in fear and rest groups (p < 0.05) 249

Table 2. Mean percentages of double-labelled cells in each structure relative to the whole brain. Stars indicate statistically significant differences between bilateral cell counts in fear and rest groups (p < 0.05) 250