DOCSLIB.ORG

A-Interferon Structure and Natural Killer Cell Stimulatory Activity1

Total Page：16

File Type：pdf, Size：1020Kb

Download full-text PDF Read full-text
A-Interferon Structure and Natural Killer Cell Stimulatory Activity1 [CANCER RESEARCH 50. 5328-5332, September 1, 1990] a-Interferon Structure and Natural Killer Cell Stimulatory Activity1 Bo-Liang Li,2 Xiao-Xia Zhao,3 Xin-Yuan Liu,2 Hyon Suk Kim, Karel Raska, Jr., John R. Ortaldo, Barbara Schwartz, and Sidney Pestka4 Departments of Molecular Genetics and Microbiology [B.-L. L., X-X. Z.. X-Y. L., B. S., S. P.] and Pathology [H. S. A., A'. R.J, University of Medicine and Dentistry of New Jersey-Robert Wood Johnson Medical School, Piscataway, Sew Jersey 08854, and National Cancer Institute, Frederick Cancer Research Facility, Frederick, Maryland 217011J. R.O.I ABSTRACT chased from New England BioLabs, T4 DNA ligase from International Biotechnologies Inc., polynucleotide kinase and deoxyribonucleotide Expression vectors for human a-interferon (Hu-IFN-a) .11. a site- triphosphates from P-L Biochemicals, and [«-"SjATP and [7-12P]ATP specific mutant |Ser"6]Hu-IFN-aJl, and Hu-IFN-aJ/C or Hu-IFN-aC/ from Amersham Corporation. J hybrids were constructed and expressed in Escherichìacoli. These Oligonucleotide-directed Site-specific Mutagenesis. M13mp8 Rf interferons and others were purified by immunoaffinity chromatography DN A was digested with £coRIand Hindi (Fig. 1) and then precipitated with a monoclonal antibody against human a-interferon. Their antiviral by equal volumes of 13% polyethylene glycol/1.6 M NaCl (9). The activity and ability to stimulate natural killer cell activity were determined precipitate was dissolved in 0.01 M Tris •HCl,pH 7.5-1.0 IHMEDTA) in comparison to several other human interferons. These results provide and ligated to the J689 fragment from the Hu-IFN-aJl gene (1, 10, some insight into structure-activity relationships for stimulating natural 11) under the following conditions: 100 ng of M13mpl8 Rf DNA killer cells and confirm our previous conclusions that antiviral activity vector fragment (EcoRl/Hincl\), 10-40 ng of fragment J689, and 0.9 cannot be used to predict other activities for an individual IFN-a species. units of T4 DNA ligase in 10 ¿ilofligation buffer (supplied by Inter The observations suggest that the tertiary structure rather than any national Biotechnologies) was incubated at 12°Cfor 3 h; then an specific linear sequence of amino acids regulates the ability of the additional 1.8 units of T4 DNA ligase were added and kept at room interferons to stimulate natural killer cell activity. temperature overnight. The reaction products were transfected into E. coli JM101 as described previously (12, 13). The transfected bacterium mixture with 10 Mlof 100 mM IPTG, 50 n\ of 2% X-gal, 0.2 ml of fresh INTRODUCTION exponentially growing E. coli JM101, and 3 ml of soft agar at 45°C A number of Hu-IFN-a5 molecules have been expressed in was then plated onto nutrient agar and cultured at 37°Covernight. Escherichia coli and purified (see Refs. 1 and 2 and citations White individual plaques were picked and grown in 3 ml of YT medium containing 10 p\ of fresh exponential culture of E. coli JM101 at 37°C therein). The antiviral, antiproliferative, and natural killer cell stimulatory activity (NK activity) of each a-interferon appeared for about 8-10 h. The culture was centrifuged in an Eppendorf micro- to vary independently with the ratio of antiviral:antiproliferative fuge for 10 min. The supernatant and cell pellet were used to prepare single-stranded DNA (14) as a template for the site-specific mutagenesis or antiviral:NK activity differing greatly between the interferon molecules (3-7). Hu-IFN-aJ was found to lack the ability to (Fig. 1) and the replicative form DNA was used for obtaining the J697 fragment with the £c0RIand Pst\ restriction endonucleases (Fig. 2), stimulate the biological activity of natural killer cells (6). The respectively. structure of Hu-IFN-aJ has been compared with other «-inter Site-specific mutagenesis of the Hu-IFN-aJ 1 gene inserted into ferons, and it was found that the amino acids Arg10, Glu35, the M13mpl8 phage was performed by the method of Smith and Gil- Glu40, His45, Phe"6, and Met"2 of Hu-IFN-aJ were markedly Ham (15) except for the use of acid phenol extraction (16) instead different from the other a-interferons which stimulate natural of ultracentrifugation for enrichment of double-stranded DNA. killer cell activity (6). Thus, it was predicted that amino acids The 18mer oligodeoxyribonucleotide, GCCAGGATGGAGTCCTCA, which contains one changed base, the underlined "G," was synthesized in one or more of these six positions determine the ability of a-interferon to stimulate natural killer cells (5-7). In order to by the phosphoramidite method (17, 18) and used both as primer for site-specific mutagenesis and as probe for screening the mutant by dot determine those amino acids which are responsible for the lack blot hybridization at different temperatures (15). The other synthetic of natural killer cell activity of IFN-aJ, a series of interferons 20meroIigodeoxyribonucleotide,5'd(CTCATGATTTCTGCTCTGAC) was constructed and expressed in E. coli. The details of these 3' (19), was used as primer for DNA sequencing to confirm further the constructions as well as the activities of these interferons are correct mutation. reported in this communication. Construction of Various Expression Plasmids. The DNA fragments C234, C701, C566 (from plasmid pIFN-aC), J234, J379 (from plasmid pIFN-«Jl)(l, 10, 11), J577 (from phage Ml3mpJl), and J577[Ser"6] MATERIALS AND METHODS (from phage M13mpJ 116s") were obtained by digestion with the proper Plasmids, Enzymes, and Reagents. Plasmids were prepared by the restriction endonucleases (Figs. 2 and 3) and then separated on a 0.6% alkaline extraction method (8). Restriction endonucleases were pur- low melting point agarose gel. Plasmid pIFN-«C was digested with Xbal and Pstl restriction endonucleases to isolate the vector fragment Received 2/14/90; revised 5/8/90. containing the trp promoter and a tetracycline resistance gene (Fig. 2). The costs of publication of this article were defrayed in part by the payment of page charges. This article must therefore be hereby marked advertisement in The various expression plasmids were constructed by joining three accordance with 18 U.S.C. Section 1734 solely to indicate this fact. fragments together (Fig. 3) under the following conditions: 10 ng of 1This research was supported in part by grants AI-25914 and CA-46465 to smaller fragment (C234, J234, or J379), 20 ng of larger fragment Sidney Pestka and grants AI-25914 and CA-21196 to Karel Raska. Jr.. from the (C701, J577, or C566), 100 ng of vector fragment (Xbal/Pstl), and 8 N1H. * Present address: Shanghai Institute of Biochemistry. Academia Sinica. 320 units of T4 DNA ligase in a total volume of 200 n\ were mixed and Yue-Yang Road. Shanghai. China. incubated at 16°Cfor 24 h. The reaction mixture was used for trans 3Present address: Institute of Virology. China National Centre for Preventive formation of E. coli MM294 (20). The transformed bacteria were Medicine. Beijing. China. cultured on agar plates containing tetracycline at 37°Covernight to ' To whom requests for reprints should be addressed, at Department of Molecular Genetics. UMDNJ-Robert Wood Johnson Medical School. 675 Hoes obtain the individual colonies. Lane, Piscataway, NJ 08854-5635. The individual colonies were grown in YT medium containing 12.5 5The abbreviations used are: Hu-IFN-a. human a-interferon: NK, natural Mgof tetracycline/ml of medium at 37°Covernight and used to prepare killer cell: Arg. arginine: Glu. glutamic acid: His, histidine: Phe. phenylalanine: plasmids by the alkaline extraction method (8). For identification, the Met, methionine: Ser. serine; Gin, glutamine; Lys, lysine; E:T, effectontarget ratio; Rf. replicative form; IPTG, isopropyl /i-D-thiogalactoside; X-gal, 5-bromo- digestion of plasmid DNA with the proper restriction endonucleases 4-chloro-3-indolyl-í¡-D-galactos¡de. and then analysis on 1% agarose gels were performed as described 5328 Downloaded from cancerres.aacrjournals.org on September 30, 2021. © 1990 American Association for Cancer Research. NATURAL KILLER CELL ACTIVITY OF INTERFERONS Ecciti BsmHI Pill HUtflll EcoRI EcoRI scribed before (3, 27-29). The following human interferons were puri fied as described above with their specific activities given in parentheses: Hu-IFN-aA (3 x 10" units/mg), Hu-IFN-aD (3 x IO7 units/mg), Hu- IFN-aA/D(Sg/) (6 x IO7units/nig), Hu-IFN-aC (1.5 x 10s units/mg), Hu-IFN-aJl(6.5x 10"units/mg), [Ser"6]Hu-IFN-aJl (1.4x 10" units/ mg), Hu-IFN-aJ (9.3 x IO7 units/mg). Hu-IFN-aC,_75/Jl70-166 (9.2 x IO7units/mg), [Ser"6]Hu-IFN-aC,_75/-n76-166(8.9 x IO7units/mg), Hu- IFN-aJ,.m/C^W^m/i) (1.7 x 10" units/mg), and Hu-IFN-aJ,_75/ C76-i66(fnu) (1.1 x 10' units/mg). The specific activities of Hu-IFN- aA, -aD, -aA/D, and -a} were determined as previously reported (3, 6, 7, 27, 28). Protein concentration for the remainder of the interferons was determined by a new ultramicroassay, which is able to detect picograms (allomóles) of prolein.6 The amino acid sequences lhal dislinguish ihese interferon species from others are shown in Fig. 4 and the amino acid sequences of Hu-IFN-aA, -aD, -aC, -aj and -ajl in Fig. 5. Interferon Assays. Interferon assays were performed wilh a cylo- palhic effecl inhibilion assay as previously described (30) wilh bovine MDBK cells and vesicular stomatitis virus. All interferon tilers are expressed in international unils as determined by comparison wilh Ihe Hu-IFN-aA reference slandard GxaOl-901-535 (31) supplied by Ihe Research Resources Branch, Nalional Inslilule of Allergy and Infec tious Diseases, NIH, Bethesda, MD.
Load more

Recommended publications
  • Robert Wood Johnson Medical School Retired Faculty Association Newsletter
    ROBERT WOOD JOHNSON MEDICAL SCHOOL RETIRED FACULTY ASSOCIATION NEWSLETTER JANUARY 2017 VOLUME X, NO. 1 UPCOMING RFA MEETING IN VITRO FERTILIZATION: AN EMBRYONIC HISTORY “A Robot’s View of Our Ocean Planet” By Eckhard Kemmann, MD When I started my training in Obstetrics- Gynecology at SUNY Downstate-Kings County Hospital in Brooklyn almost five decades ago, infertility was encountered by ten percent of couples, and treatment options were limited and primarily surgical. My teachers and mentors at the institution represented different aspects of the presently evolving field of reproductive medicine. Dr. A. Siegler was a pioneer in tubal surgery and laparoscopy – in the 80s he would introduce laparoscopy to China. Dr. J. R. Jones was an early expert in reproductive hormone research, and Dr. A. Gemzell had come from Sweden where he faced mandatory retirement at the age of 65 and brought his expertise to the United States in the use of ovulation induction. Dr. Gemzell was the first to isolate and use (continued on page 2) Josh Kohut, Ph.D. Associate Professor, Department of Marine TABLE OF CONTENTS PAGE and Coastal Science, Rutgers University Upcoming Meeting 1 InT Vitro Fertilization: An Embryonic History Friday, March 3, 2017 by Eckhard Kemmann, MD 1 Noon – 1:30 p.m. Dean’s Conference Room I See You by Elliot Sultanik, MD, Class of 2016 4 Rutgers Robert Wood Johnson Medical School RWJMS RFA Election Results 5 Piscataway, New Jersey Retired RWJMS Faculty Program to Mentor Medical Students 5 All current and retired faculty, staff, and students Faculty Transition to Retirement Program 6 are welcome to attend.
    [Show full text]
  • Sidney Pestka Sid Died Dec. 22, 2016, Surrounded by Family. The
    Sidney Pestka Sid died Dec. 22, 2016, surrounded by family. The quintessential scientist since adolescence, he had been afflicted with dementia for the last few years of his life. Born in Drobin, Poland, at 21 months of age he moved near family to the Williamsburg neighborhood of Brooklyn, and then at age 8 to Trenton, where he excelled at Trenton Central High School. He received a scholarship to Princeton University, from where he graduated summa cum laude with a B.A. in chemistry. He received his medical degree from the University of Pennsylvania School of Medicine on full scholarship. Afterwards, he worked at the National Institutes of Health in the laboratory of Marshall W. Nirenberg. Sid’s early work on the genetic code, protein synthesis and ribosome function led to Nirenberg’s 1968 Nobel Prize in Physiology or Medicine. In 1969, Sid left the NIH for the Roche Institute of Molecular Biology, where he focused on defining how antibiotics worked and proteins are synthesized and, later, interferons. There he was first to purify interferon alpha and beta; the first to clone mature interferons; and the first to develop a commercialized recombinant biotherapeutic—Roferon A. Sid is known as the "Father of Interferon" for his seminal work on interferon, work that gave birth to a $6 billion dollar market directed at the therapy of hepatitis, multiple sclerosis, cancer, and other diseases that affect mankind. Sid was Emeritus Professor of the Department of Biochemistry and Molecular Biology at Robert Wood Johnson Medical School of Rutgers, The State University of New Jersey, which he joined in 1986 and where he served as Chairman for 25 years.
    [Show full text]
  • NJ's Top 10 Scientists
    NJ’s Top 10 Scientists here are more than 400,000 scientists and engineers in New Jersey hard at work each day delivering breakthrough medicines and technologies that save lives, improve our quality of life and keep our T economy competitive. With the cooperation of the leading technology trade associations in the state, New Jersey Business magazine is proud to present who we think are the “cream of the crop” in innovation: NJ’s Top 10 Scientists. Through their hard work and dedication, these men and women have made significant contributions to their companies, research institutions and society at large. Whether it is a biotechnology drug that helps fight cancer or AIDS, or a new kind of organic, light-emitting device that is four times more efficient than liquid crystal displays, these and other innovations from the scientists profiled are testaments to the research and development work being conducted in “The Innovative State”. We extend our appreciation to The Healthcare Institute of New Jersey, BioNJ, The New Jersey Research & Development Council, the New Jersey Technology Council and the Chemical Council of New Jersey for their assistance in gathering the nominations. The editors at New Jersey Business selected the final winners based on the impact their work has on society at large. A special recognition is being given to one scientist who, after the judging was completed, announced his retirement. Here, we present the innovators in alphabetical order: SPECIAL RECOGNITION Magid Abou-Gharbia, Ph.D., Senior Vice President and Head (Retired), Chemical and Screening Sciences, Wyeth Drug Discovery and Development, South Brunswick, NJ In October, Magid Abou-Gharbia, Ph.D., retired after 26 years with Wyeth Drug Discovery and Development – but not before leaving his mark in the pharmaceutical industry.
    [Show full text]
  • PHS 398/2590 (Rev. 06/09), Biographical Sketch Format Page
    Program Director/Principal Investigator (Last, First, Middle): BIOGRAPHICAL SKETCH Provide the following information for the Senior/key personnel and other significant contributors in the order listed on Form Page 2. Follow this format for each person. DO NOT EXCEED FOUR PAGES. NAME POSITION TITLE Emine Ercikan Abali Associate Professor of Biochemistry, eRA COMMONS USER NAME (credential, e.g., agency login) Pharmacology and Medicine ABALIEM EDUCATION/TRAINING (Begin with baccalaureate or other initial professional education, such as nursing, include postdoctoral training and residency training if applicable.) INSTITUTION AND LOCATION DEGREE MM/YY FIELD OF STUDY (if applicable) University of Southwestern Louisiana, Lafayette, LA B.Sc. 1982-1986 Chemistry University of Southwestern Louisiana, Lafayette, LA M.S. 1988-1988 Chemistry The Ohio State University, Columbus, OH Ph.D. student 1989-1990 Chemistry Cornell University Graduate School of Medical Ph.D. 1990-1996 Pharmacology Sciences and Memorial Sloan Kettering Cancer Center, New York, NY Memorial Sloan Kettering Cancer Center, NY, NY Postdoc 1996-1998 Molecular Therapeutics Columbia University, NY, NY Postdoc 1998-1999 Biological Sciences (10months) A. Personal Background The overall aim of this project is to use dihydrofolate reductase (DHFR) as a prototype for other NAD(P) binding dehydrogenases to identify novel NAD(P) analogues that specifically target the NADPH binding site of DHFR as potent inhibitors of cancer cells. Specifically, we plan to investigate metabolism of NADPS in cell lines and in xenograft animal and to perform in silico screening of the NADPH binding site to identify potential new inhibitors targeted to DHFR. Lastly, we will determine further characterize the mechanism of action of NADPS in accelerating the degradation of DHFR in order to address development of drug-resistance to this new class of inhibitors.
    [Show full text]
  • Extensions of Remarks E1059 HON. NANCY L. JOHNSON HON. FRANK
    June 14, 2002 CONGRESSIONAL RECORD — Extensions of Remarks E1059 HONORING LOUISE BELKIN, FRANK and introduced the ‘‘Invention Convention’’ the now used in the clinic and stimulated the cre- JOSLYN, AND TERRY WERDEN West District School’s Grade 5. She also has ation and development of today’s extensive FOR THEIR OUTSTANDING SERV- given her time as an active member of the biotechnology industry. Dr. Pestka’s achieve- ICE AND DEDICATION TO TEACH- Farmington Education Association, and as a ments are the basis of several U.S. and for- ING AT THE WEST DISTRICT member of curriculum teams for writing, eign patents and interferon is now a major SCHOOL IN FARMINGTON, CON- science and social studies. She currently has product of several U.S. and foreign compa- NECTICUT three students whose parents she also taught nies. The market for interferon is expected to in the Farmington School system. Mrs. exceed $7 billion by 2003. HON. NANCY L. JOHNSON Werden is a dedicated public servant and her In addition to interferon’s commercial im- OF CONNECTICUT influence has been strongly felt throughout pact, there was no general antiviral therapy IN THE HOUSE OF REPRESENTATIVES West District School and the families it serves. available before Dr. Pestka began his work on Her presence within our walls will be greatly interferon; today, interferon is the first and only Thursday, June 13, 2002 missed, as she moves on to teach at Farming- general antiviral therapy. Interferon is used to Mrs. JOHNSON of Connecticut. Mr. Speak- ton’s new 5–6 school. treat hepatitis B and C, diseases that afflict er, I rise today to acknowledge the achieve- These three educators have served on the 300 million people worldwide.
    [Show full text]
  • Contributions of Cloned Type I Interferon Receptor Subunits to Differential Ligand Binding
    FEBS 18274 FEBS Letters 404 (1997) 197-202 Contributions of cloned type I interferon receptor subunits to differential ligand binding Elizabeth Cali Cutronea, Jerome A. Langera'b'* aDepartment of Molecular Genetics and Microbiology, UMDNJ-Robert Wood Johnson Medical School, Piscataway, NJ 08854, USA h Cancer Institute of New Jersey, UMDNJ-Robert Wood Johnson Medical School, 675 Hoes Lane, Piscataway, NJ 08854, USA Received 20 January 1997 IFNAR-1) [5] has weak intrinsic affinity for at least two Abstract The human type I interferons, including at least 12 IFN-as, IFN-P and IFN-co, bind to a receptor (IFNAR) IFNs, IFN-a2 and -a8 [6,7]. Its expression confers on rodent composed of at least two transmembrane subunits, IFNAR-1 cells limited responsiveness and binding of human type I IFNs and IFNAR-2. The contributions of the receptor subunits to [5], and enhances the ability of monkey-derived COS cells to ligand binding were investigated by measuring the binding bind human IFNs [8]. In contrast to HuIFNAR-1, the bovine properties of IFNAR-1 or IFNAR-2 alone, or when co- homologue (BoIFNAR-1) fortuitously binds human IFN-as expressed. The affinity of IFNAR-2 for IFN-ct2 was increased with high affinity [6,9,10]. The ability of antibodies against by the co-expression of IFNAR-1, which itself binds ligand very HuIFNAR-1 to block the binding of various type I interfer- weakly. Most type I IFNs inhibited the binding of IFN-ot2 to ons to human cells [11,12] suggests that IFNAR-1 is involved IFNAR-2 alone with IC50 values of 2-20 nM.
    [Show full text]
  • Sydney Udenfriend 1918– 1999
    NATIONAL ACADEMY OF SCIENCES SYDNEY UDENFRIEND 1918– 1999 A Biographical Memoir by HERBERT WEISSBACH AND BERNHARD WITKOP Any opinions expressed in this memoir are those of the authors and do not necessarily reflect the views of the National Academy of Sciences. Biographical Memoirs, VOLUME 83 PUBLISHED 2003 BY THE NATIONAL ACADEMIES PRESS WASHINGTON, D.C. Taken from the Annual Report of the Roche Institute of Molecular Biology SIDNEY UDENFRIEND April 5, 1918–December 29, 1999 BY HERBERT WEISSBACH AND BERNHARD WITKOP IDNEY UDENFRIEND’S PARENTS emigrated to the United S States from an Austro-Polish region in central Eu- rope in 1913. They had three children; the oldest was Sidney, who was born in Brooklyn, New York, on April 5, 1918. After attending public schools in Brooklyn Udenfriend en- tered the City College of New York (CCNY) in 1935. At that time CCNY was the dream for so many of the immigrant parents who wanted their children to obtain a college edu- cation. Supported by public funds, with no tuition, CCNY provided that opportunity for those students who could pass the rigid requirements for entrance. The Chemistry De- partment was well recognized in the field of physiological chemistry (or biochemistry) thanks in large part to Ben- jamin Harrow, who wrote a widely used textbook. Harrow had a great influence on Udenfriend, and after graduation in 1939 Udenfriend was set on a career in bio- chemistry and determined to go to graduate school. In 1940 he was accepted at New York University Graduate School in the Department of Biology working with Kenneth Blanchard.
    [Show full text]
  • LONG-TERM MEMBERS 25+ Years of Membership
    LONG-TERM MEMBERS 25+ Years of Membership Stuart A. Aaronson, MD Stephen P. Ackland, MBBS Carol Aghajanian, MD Steven A. Akman, MD Icahn School of Medicine at Mount Sinai University of Newcastle Memorial Sloan Kettering Cancer Center Roper St. Francis Healthcare United States Australia United States United States Active Member Active Member Active Member Active Member 38 Years of Membership 33 Years of Membership 27 Years of Membership 35 Years of Membership Cory Abate-Shen, PhD Edward M. Acton, PhD Irina U. Agoulnik, PhD Emmanuel T. Akporiaye, PhD Columbia University Irving Medical United States Florida International University Verana Therapeutics Center Emeritus Member United States United States United States 42 Years of Membership Active Member Emeritus Member Active Member 25 Years of Membership 31 Years of Membership 26 Years of Membership David J. Adams, PhD Duke University Medical Center Imran Ahmad, PhD Ala-Eddin Al Moustafa, PhD James L. Abbruzzese, MD United States Northwestern Medicine McGill University Duke University Emeritus Member United States Canada United States 32 Years of Membership Active Member Active Member Active Member 25 Years of Membership 26 Years of Membership 32 Years of Membership Gregory P. Adams, PhD Elucida Oncology Nihal Ahmad, PhD Abdul Al Saadi, PhD Ehtesham A. Abdi, MBBS United States Univ. of Wisconsin Madison Sch. of Med. William Beaumont Hospital The Tweed Hospital Active Member & Public Health United States Australia 29 Years of Membership United States Emeritus Member Emeritus Member Active Member 52 Years of Membership 33 Years of Membership Lucile L. Adams-Campbell, PhD 25 Years of Membership Georgetown Lombardi Comprehensive Suresh K.
    [Show full text]
  • Sidney Pestka, MD Dr. Sidney Pestka Received His Undergraduate Degree
    Sidney Pestka, MD Dr. Sidney Pestka received his undergraduate degree in chemistry from Princeton University in 1957 and his medical degree from the University of Pennsylvania School of Medicine in 1961. After completing a pediatric and medical internship at Baltimore City Hospitals, in 1962 he took a position in the laboratory of Dr. Marshall W. Nirenberg at the National Heart Institute, where he was part of the team working on research involving the genetic code, protein synthesis and ribosome function that led to the Nobel Prize in Physiology or Medicine received by Dr. Nirenberg. While in the Nirenberg Laboratory, Dr. Pestka discovered how the genetic code of the mRNA is translated into protein through the small ribosomal subunit, a surprising discovery that was contrary to the scientific thinking at that time. This early work helped create new fundamental tenets about the mechanism of protein biosynthesis and antibiotic action. In 1966, Dr. Pestka moved to the National Cancer Institute, where for three years he continued his research on protein synthesis and began investigations in other areas. In 1969, he joined the Roche Institute of Molecular Biology in Nutley, New Jersey, where he initiated the work on interferon. Dr. Pestka's breakthroughs have made an enormous impact on the biotechnology and pharmaceutical industries and on the development of new biotherapeutics for medicine. His work is the basis of a number of U.S. and more than 100 foreign patents. Interferon is a major product of several U.S. companies and foreign companies almost all of which license interferon under Dr. Pestka's patents, including Schering-Plough, Hoffmann-La Roche, Amgen, Biogen and Berlex.
    [Show full text]
  • Identification of a Yeast Artificial Chromosome Clone Encoding an Accessory Factor for the Human Interferon Y Receptor
    Proc. Natl. Acad. Sci. USA Vol. 90, pp. 8737-8741, September 1993 Biochemistry Identification of a yeast artificial chromosome clone encoding an accessory factor for the human interferon y receptor: Evidence for multiple accessory factors (chromosome 21/dass I major histocompatibilt complex antigens/ al tansduction) JAEMOG SOH, ROBERT J. DONNELLY, THOMAS M. MARIANO, JEFFRY R. COOK, BARBARA SCHWARTZ, AND SIDNEY PESTKA* Department of Molecular Genetics and Microbiology, University of Medicine and Dentistry of New Jersey, Robert Wood Johnson Medical School, Piscataway, NJ 08854-5635 Communicated by George R. Stark, May 19, 1993 ABSTRACT Human chromosomes 6 and 21 are both nec- suggested by experiments with chimeric receptors (17-19). essary to confer sensitivity to human Interferon y (Hu-IFN-y), Furthermore, a 5-amino acid sequence (YDKPH) of the as measured by the induction of human HLA class I antigen. intracellular domain ofthe Hu-IFN-y receptor is required for Human chromosome 6 encodes the receptor for Hu-IFN-y, and this activity (20, 21). Moreover different accessory factors human chromosome 21 encodes accessory factors for generat- are involved in encephalomyocarditis virus (EMCV) and ing biological activity through the Hu-IFN-y receptor. A small vesicular stomatitis virus antiviral activity (20). However, region of human chromosome 21 that is responsible for encod- little is known about how the binding of Hu-IFN--y to its ing such factors was localzed with hamster-human somatic cell receptor initiates this diverse array of functional changes. hybrids carrying an irradiation-reduced fragment of human The region of chromosome 21 necessary for sensitivity to chromosome 21.
    [Show full text]
  • And Neutralizes Its Activity IL-22 of a Novel
    Identification, Cloning, and Characterization of a Novel Soluble Receptor That Binds IL-22 and Neutralizes Its Activity1,2 Sergei V. Kotenko,3,4* Lara S. Izotova,* Olga V. Mirochnitchenko,* Elena Esterova,* Harold Dickensheets,† Raymond P. Donnelly,† and Sidney Pestka3* With the use of a partial sequence of the human genome, we identified a gene encoding a novel soluble receptor belonging to the class II cytokine receptor family. This gene is positioned on chromosome 6 in the vicinity of the IFNGR1 gene in a head-to-tail orientation. The gene consists of six exons and encodes a 231-aa protein with a 21-aa leader sequence. The secreted mature protein demonstrates 34% amino acid identity to the extracellular domain of the IL-22R1 chain. Cross-linking experiments demonstrate that the protein binds IL-22 and prevents binding of IL-22 to the functional cell surface IL-22R complex, which consists of two subunits, the IL-22R1 and the IL-10R2c chains. Moreover, this soluble receptor, designated IL-22-binding protein (BP), is capable of neutralizing IL-22 activity. In the presence of the IL-22BP, IL-22 is unable to induce Stat activation in IL-22-responsive human lung carcinoma A549 cells. IL-22BP also blocked induction of the suppressors of cytokine signaling-3 (SOCS-3) gene expression by IL-22 in HepG2 cells. To further evaluate IL-22BP action, we used hamster cells expressing a modified IL-22R complex ␥ consisting of the intact IL-10R2c and the chimeric IL-22R1/ R1 receptor in which the IL-22R1 intracellular domain was replaced with the IFN-␥R1 intracellular domain.
    [Show full text]
  • Download The
    MDA-97 MDAdvisor Winter 10:Layout 1 1/4/10 10:57 AM Page 1 T T E G G A D S I R H C K S I VO R L - U k M T l E a 2 A v • r I S N e SU d E A 4 n • a r F G VO o A V LUM LL N E n 2 I 2 e • r 0 T t ISS e 0 t UE 9 C 2 v VOLUME 3 • I SSUE 1 • WINTER 2010 o • . E l SP o r RI T N G G a 2009 O h y y R C e P s n r : e E S a J I e m T N o w S O e I s I w T N R ® y l r r A H b o Z f C I m e e N S S c e s i I U s o R A J h M H C C M t I D h ig R e R w h T S m E e 9 E A 0 A I R 0 y O 2 h N E W N H O T H W E M f N O I R C I F o D A E E R M E A C N N I I H y Z E T E L R C A O n E N E C H L L N N N E a C O 0 I O J X S E R A E p L V L O 1 C I I T .
    [Show full text]