OSTEOCLAST AND OSTEOBLAST ACTIVITIES DURING EARLY

ORTHODONTIC TOOTH MOVEMENT AND ACCELERATION OF TOOTH

MOVEMENT THROUGH THE TARGETING OF PREOSTEOCLASTS WITH

EXOGENOUS RECOMBINANT MOUSE M-CSF

by

Patricia Joyce Brooks, HBSc

A thesis submitted in conformity with the requirements

for the degree of Master of Science

Graduate Faculty of Dentistry

University of Toronto

© Copyright by Patricia Joyce Brooks (2009) Library and Archives Bibliotheque et 1*1 Canada Archives Canada Published Heritage Direction du Branch Patrimoine de I'edition 395 Wellington Street 395, rue Wellington OttawaONK1A0N4 OttawaONK1A0N4 Canada Canada Your We Vote reference ISBN: 978-0-494-55793-8 Our file Notre reference ISBN: 978-0-494-55793-8

NOTICE: AVIS:

The author has granted a non­ L'auteur a accorde une licence non exclusive exclusive license allowing Library and permettant a la Bibliotheque et Archives Archives Canada to reproduce, Canada de reproduire, publier, archiver, publish, archive, preserve, conserve, sauvegarder, conserver, transmettre au public communicate to the public by par telecommunication ou par I'lnternet, preter, telecommunication or on the Internet, distribuer et vendre des theses partout dans le loan, distribute and sell theses monde, a des fins commerciales ou autres, sur worldwide, for commercial or non­ support microforme, papier, electronique et/ou commercial purposes, in microform, autres formats. paper, electronic and/or any other formats.

The author retains copyright L'auteur conserve la propriete du droit d'auteur ownership and moral rights in this et des droits moraux qui protege cette these. Ni thesis. Neither the thesis nor la these ni des extraits substantiels de celle-ci substantial extracts from it may be ne doivent etre imprimes ou autrement printed or otherwise reproduced reproduits sans son autorisation. without the author's permission.

In compliance with the Canadian Conformement a la loi canadienne sur la Privacy Act some supporting forms protection de la vie privee, quelques may have been removed from this formulaires secondares ont ete enleves de thesis. cette these.

While these forms may be included Bien que ces formulaires aient inclus dans in the document page count, their la pagination, il n'y aura aucun contenu removal does not represent any loss manquant. of content from the thesis.

•+• Canada Abstract

Osteoclast and osteoblast activities during early orthodontic tooth movement and acceleration of tooth movement through the targeting of preosteoclasts with exogenous recombinant mouse M-CSF Master of Science, 2009 Patricia Joyce Brooks Graduate Faculty of Dentistry, University of Toronto

Osteoclasts and osteoblasts play critical roles in remodelling alveolar bone during orthodontic tooth movement (OTM). The objectives of this study were i) To characterize the spatial/temporal pattern of osteoblast and osteoclast differentiation in the periodontal ligament (PDL) during OTM, and ii) To determine if OTM acceleration could occur with

PDL administration of an osteoclastic differentiation factor, Macrophage-Colony

Stimulating Factor (M-CSF). Rat/mouse OTM models were used to characterize the expression of osteoblast and osteoclast differentiation markers. Expression of markers involved in recruiting osteoclast precursors and markers found on preosteoclasts, but not monocytes, were found in the PDL during early stages of OTM. We found up-regulated expression of genes downstream of M-CSF and an increase in OTM rate after M-CSF administration. Taken together, our results showed that improved knowledge of the molecular basis of cellular activities is critical towards the development and testing of pharmacological strategies as a means to accelerate OTM.

11 Acknowledgements

I would like to thank my supervisor Dr. Siew-Ging Gong for her patience, guidance, and support. She encouraged me to be inquisitive, enabling me to become a more proficient researcher. I would also like to thank my committee members, Dr. Simmons, Dr.

Manolson, and Dr. McCulloch for bringing their ideas to the table, as well as helping me to look at my project from different perspectives. I would like to express my gratitude to

Dr. Dorrin Nilforoushan for helping me to ease into orthodontic research, and for the use of her rat orthodontic model. Also, heartfelt appreciation to Dr. Andrea Heckler for her orthodontic expertise, and Susan Carter for her assistance with animal work. I also greatly appreciated Dr. Kuiru Wei's help with Real-Time RT-PCR, and Feryal Sarraf for her histological assistance. Lastly, I would like to thank the University of Toronto for my

Research Fellowship and the Dental Research Institute for their financial support.

in To my parents

IV Table of Contents

Title Page i Abstract ii Acknowledgements iii Dedication iv Table of Contents v List of Figures vii List of Tables viii List of Acronyms and Abbreviations ix

CHAPTER 1. Introduction 1 1.1 Periodontal Tissues 1 1.1.1 Alveolar Bone 2 1.1.2 Gingiva 2 1.1.3 Cementum 3 1.1.4 Periodontal Ligament 4 1.2 Periodontal Cells 5 1.2.1 Fibroblasts 5 1.2.2 Osteoblasts 6 1.2.3 Osteoclasts 8 1.2.3.1 Morphological Changes during Osteoclast Differentiation 8 1.2.3.2 The Role of M-CSF 10 1.2.3.3 Osteoclast Function 13 1.3 Orthodontic Tooth Movement 14 1.3.1 Orthodontic Tooth Movement Theories 14 1.3.2 Animal Models of Orthodontic Tooth Movement 17 1.3.3 Wounding in Orthodontic 18 1.3.4 Orthodontic Tooth Movement Phases 20 1.3.4.1 Initial Phase 21 1.3.4.2 Lag Phase 23 1.3.4.3 Acceleration and Linear Phases 25 /. 3.5 Orthodontic Tooth Movement A cceleration 27 1.4 Thesis Project Objectives 29

CHAPTER 2. Molecular Markers of Early Orthodontic Tooth Movement 31 2.1 Introduction 31 2.2 Materials & Methods 32 2.2.1 Rat Model of Orthodontic Tooth Movement 32 2.2.2 Histological and Immunohistochemical Procedures 33 2.2.3 Quantification and Analysis 34 2.3 Results 35 2.3.1 RANKL, Runx2, TRAP and KI-67 expression near the furcation of the disto-palatal root 35 2.3.2 KI-67 expression along the root length of the disto-palatal

v root 36 2.4 Discussion 41 2.4.1 The rat OTM model accurately replicates the cellular and molecular changes 41 2.4.2 Prediction of axis of rotation of orthodontically moved tooth 43

CHAPTER 3. Exogenous M-CSF accelerates orthodontic tooth movement by targeting preosteoclasts 44 3.1 Introduction 44 3.2 Materials & Methods 45 3.2.1 Animal Models 45 3.2.2 Immunohistochemistry and TRAP Staining 49 3.2.3 Real-time RT-PCR 49 3.2.4 Data Analysis 50 3.2.4.1 Tooth Movement Quantification 50 3.2.4.2 Quantification ofc-Fms, F4/80, and TRAP-positive cells 50 3.2.4.3 Gene Expression Analysis 50 3.3 Results 51 3.3.1 Tooth Movement and c-Fms, F4/80, and TRAP-positive cells during OTM 51 3.3.2 Tooth Movement and Gene Expression with M-CSF Administration 52 3.4 Discussion 58 3.4.1 OTM Model and c-Fms, F4/80, and TRAP-positive Cell Distribution 58 3.4.2 Gene Expression with M-CSF Treatment and Tooth Movement 59

CHAPTER 4. CONCLUSIONS 62

CHAPTER 5. FUTURE WORK 63

CHAPTER 6. REFERENCES 65

VI List of Figures

Figure 1.1 Osteoclast Differentiation and Marker Proteins 9 Figure 1.2 Summary of Molecular Markers found in the PDL during OTM 20 Figure 2.1 RANKL expression after 3 hours of force 38 Figure 2.2 KI-67 expression after 3 and 24 hours of force 39 Figure 2.3 KI-67 expression along the length of orthodontically moved tooth roots .... 40 Figure 3.1 Orthodontic appliance insertion in mice 48 Figure 3.2 Expression of osteoclast differentiation markers during OTM 54 Figure 3.3 Percentage of c-Fms, F4/80, and TRAP-positive cells during OTM 55 Figure 3.4 Tooth movement and gene expression with OTM and M-CSF treated mice 56

vn List of Tables

Table 2.1 Number of KI-67-positive cells along the length of orthodontically moved tooth roots 37 Table 3.1 Bone densities of animals treated with M-CSF 57 Table 3.2 Tooth Movement with M-CSF and orthodontic treatments 57

VIII List of Acronyms and Abbreviations

ANOVA analysis of variance AOI area of interest BAX BCL2-associated X protein

CT threshold cycle Cbfal core-binding factor a 1 CDJ cementum-dentin junction c-Fms colony-stimulating factor-1 receptor DAPI 4',6-diamino-2-phenylindole EDTA ethylenediaminetetraacetic acid FACIT fibril-associated collagen with interrupted triple helices GAPDH glyceraldehyde-3-phosphate dehydrogenase FfATPase proton adenosine triphosphatase pump M-CSF macrophage-colony stimulating factor MAP mitogen-activated protein OB osteoblast OC osteoclast OPG osteoprotegrin OTM orthodontic tooth movement PBS phosphate buffered saline PDL periodontal ligament RANKL receptor activator of nuclear factor kappa p RANKL receptor activator of nuclear factor kappa P ligand Runx2 runt-related transcription factor 2 TRAP tartrate resistant acid phosphatase VEGF vascular endothelial growth factor

IX CHAPTER 1. INTRODUCTION

During orthodontic tooth movement (OTM), cells in the periodontal ligament (PDL) surrounding the tooth respond to the mechanical force. The different cell populations in the PDL act in concert to result in remodelling of the bone surrounding the tooth, thus allowing the tooth to move through bone. Our study was primarily focused on two major cell populations during different phases of OTM: the osteoblasts during early orthodontic treatment and osteoclasts and their precursors throughout all phases of OTM. The review of the literature in this section is divided into different parts. The first part will focus on the supporting periodontal tissues and the cells in the PDL (Chapter 1.1), to be followed by a more detailed description of the functions and differentiation pathways of osteoblasts, osteoclasts, and fibroblasts in the PDL (Chapter 1.2). The last part of the review will cover the theories behind orthodontic tooth movement (Chapter 1.3.1), the methodologies for studying tooth movement in animals (Chapter 1.3.2), the cellular and molecular events during orthodontic tooth movement (Chapters 1.3.3 & 1.3.4), and the methods that have been attempted to accelerate orthodontic tooth movement (Chapter

1.3.5).

1.1 Periodontal Tissues

In humans and other mammals teeth are supported by a collective group of tissues known as the periodontium that consists of the alveolar bone, gingiva, cementum, and periodontal ligament (Bosshardt and Selvig 1997; Cho and Garant 2000).

1 1.1.1 Alveolar Bone

The primary support structure for teeth is the alveolar bone, a specialized part of the mandibular and maxillary bones. The bony sockets that hold teeth are lined with compact bone, called the alveolar wall (Mariotti 1993). In general, compact bone lines the outer layer of bony tissues and is hard and strong due to the minimal gaps and spaces within its packed structure of osteons. The supporting alveolar bone is composed of bundle bone, a less dense bone (Sodek and McKee 2000). Bundle bone is formed in layers parallel to the coronal-apical length of tooth (Schroeder 1992). Through this parallel orientation the alveolar bone provides a platform for association of periodontal ligament fibres.

1.1.2 Gingiva

The gingiva is a soft mucosal tissue that covers the alveolar bone and upper tooth root.

The gingiva consists of three distinct domains: the free marginal gingiva, the interdental gingiva, and the attached gingiva. It can also be described histologically as a connective tissue with an epithelial layer and an underlying mesenchymal tissue composed of few cellular elements embedded in a network of proteins. The epithelial tissues form an attachment to the tooth coronal to the cementum region of the tooth root via an epithelial attachment called the junctional epithelium. Apical to the junctional epithelium the gingival tissues incorporate fibres into the cementum. Through these interactions the gingiva provides the periodontium with protective and defensive means. The permeability of the junctional epithelium acts as a selective barrier against foreign particles (Page et al. 1997).

2 1.1.3 Cementum

The entire tooth root surface is covered in a mineralized connective tissue, the cementum, whose primary function is to attach the principle fibres of the periodontal ligament to the tooth (Nanci and Bosshardt 2006). While similar to bone, cementum is not innervated, is avascular, less mineralized and undergoes little or no remodelling, and is thus softer

(Saygin et al. 2000). Cementum is composed of 50% inorganic material (mainly calcium hydroxyapatite) and 50% organic material, primarily collagens and to a lesser degree glycoproteins and proteoglycans (Bosshardt and Selvig 1997). Several different varieties of cementum exist, distinguished by the presence or absence of cells and the origin of the collagenous fibres within the matrix (Bosshardt and Selvig 1997). The location of the different varieties of cementum reveals tooth-type specific distribution patterns that may also vary along the same tooth root (Bosshardt and Selvig 1997). Cementum is deposited on the surface dentin of the tooth root by cementoblasts, that, although similar to osteoblasts, are not very well-understood and occasionally regarded as a distinct cell population (Bosshardt 2005). To better characterize the cementoblast, some research groups characterized the origin of the cemento-progenitors and the molecular factors that regulate their differentiation (Bosshardt and Schroeder 1996; Bosshardt and Selvig 1997;

Cho and Garant 2000; Saygin et al. 2000). Another area of great interest is the way that cementum attaches to the dentin in a region called the cementum-dentin junction, or CDJ.

Many investigators believe that the union between cementum and dentin occurs during development in the CDJ through the interaction of the PDL fibres with collagen fibres of the cementum (Bosshardt and Schroeder 1996; Ten Cate 1997). Other groups suggest that the union is accomplished through Sharpey's fibres which are calcified collagen type I

3 fiber extremities embedded in the cementum and dentin (Stern 1964; Saffar et al 1997;

Strocchi et al. 1999; Raspanti et al. 2000).

1.1.4 Periodontal Ligament

The periodontal ligament (PDL) is a complex connective tissue that connects the cementum of tooth roots to the adjacent alveolar bone and provides support and protection to the teeth. The components that make up the PDL are similar to those involved in other connective tissues. The extracellular matrix of these tissues is, for the most part, made up of fibrillar collagens which endow the connective tissue with their own specific mechanical properties. The fibrillar collagens have a highly ordered structure and form lateral aggregates leading to rigidity and the ability to provide tensile strength (Kato et al. 1989; An et al. 2004). Fibrillar collagen types I, III, and V are present within the PDL (Ballard and Butler 1974; Butler et al. 1975; Becker et al. 1991).

Collagen types I and III are both uniformly distributed in the PDL with collagen type I predominating (Ballard and Butler 1974; Butler et al. 1975; Rao et al. 1979). Collagen type I connects the tooth to the adjacent alveolar bone through Sharpey's fibres that interact with the alveolar bone and cellular cementum (Stern 1964; Saffar et al. 1997;

Raspanti et al. 2000). Collagen type V is localized near basement membranes and has also been shown to co-assemble with type I into heterotypic fibrils (Becker et al. 1991;

Birk 2001). Collagen type XII is also found in the PDL and is a fibril-associated collagen with interrupted triple helices (FACIT), a group of collagens that connect fibrillar collagens to the matrix (Shaw and Olsen 1991; Beertsen et al. 1997). Many non- collagenous proteins are found within the PDL and appear to be involved in organization

4 and maintenance of the extracellular matrix, including fibronectin, tenascin, undulin, laminin, and osteonectin, as well as other types of glycoproteins and proteoglycans

(Mariotti 1993; Zhang et al. 1993). Through this organization of the extracellular matrix, cellular function can be regulated by mediating cell adhesion and the binding of growth factors. The adhesion of cells via integrins and proteoglycans to the molecules of the extracellular matrix also provides the cells with anchorage (Albelda and Buck 1990).

In addition to the elements of an extracellular matrix, the PDL also contains nerve bundles and blood and lymph vessels for transporting substances to and from the tissues.

Cellular elements specific to the PDL are also present, and include fibroblasts, osteoclasts, cementoclasts, osteoblasts, cementoblasts, and other connective tissue cells such as macrophages and mast cells. Precursor cells, such as preosteoclasts, and undifferentiated mesenchymal cells are also found in the PDL.

1.2 Periodontal Cells

1.2.1 Fibroblasts

The predominant cell type in the soft connective tissues of the periodontium is the fibroblast. Fibroblasts are responsible for synthesizing and maintaining a diverse group of connective tissue matrices that exist throughout the periodontium, including collagen, elastin, and many nonfibrillar glycoproteins. These cells are also involved with shaping the extracellular matrix by exhibiting motility and contractility during developmental and regeneration processes, such as wounding and orthodontic tooth movement (Ten Cate and

Freeman 1974; Ten Cate et al. 1976; Roberts and Chase 1981). During connective tissue remodelling, fibroblasts are capable of the synthesis and phagocytosis of collagens and

5 other extracellular matrix components by releasing cytokines (e.g. matrix metalloproteinases and their respective tissue inhibitors) that mediate tissue destruction.

Fibroblasts can also release other factors e.g. prostaglandins, interleukins, and tumour necrosis factors to initiate a wounding response that can stimulate osteoclastogenesis and the resorptive activity of osteoclasts (Genco 1992; Suda et al. 1999; Teitelbaum 2000;

Bodet et al. 2007).

Similar to most other connective tissue cells, fibroblasts originate from cells within the mesenchyme. Physical forces, cell shape, as well as matrix and fibrogenic cytokines have been shown to induce differentiation and functional changes in fibroblasts (Ten Cate et al. 1976; Watt 1986). Fibroblasts are typically characterized by their elongated or spindle-like morphology and synthesis of collagens. However, due to differences in synthetic products, responses to regulatory molecules, and some morphological features, it has been suggested that heterogeneous subpopulations of fibroblasts exist (Roberts and

Chamberlain 1978; Roberts and Morey 1985).

1.2.2 Osteoblasts

Another type of cell that originates from mesenchymal cells is the osteoblast (OB), a bone-depositing cell. In cell culture, OBs are morphologically indistinguishable from fibroblasts. In vivo, however, mature OBs are usually cuboidal cells lying adherent to bone surfaces. Fully mature OBs produce many of the proteins of the extracellular matrix of the bone such as type I collagen and other bone matrix proteins (e.g. proteoglycans and glycoproteins) to produce a matrix collectively termed the osteoid. Hydroxyapatite is laid upon this matrix and mineralization is thought to be catalyzed through osteoblastic

6 secretion of bone sialoprotein, a macromolecular nucleator (Hunter and Goldberg 1994;

Ganss et al. 1999).

OBs can control the mineralization of the extracellular matrix (Ducy et al. 2000). OBs trapped in the secreted mineralized matrix do not undergo apoptosis and are termed osteocytes, which are suggested to be the chief mechanosensory cells within bone (Klein-

Nulend et al. 1995). OBs are also capable of regulating bone resorption as they express the cell-surface protein Receptor Activator of Nuclear Factor K p ligand (RANKL) that is crucial during osteoclast differentiation (Gori et al. 2000).

OB differentiation is controlled by hormones and growth factors that activate specific signalling proteins and a group of transcription factors. The most well-known transcription factor involved in OB differentiation is Runt-related transcription factor 2

(Runx2), also known as Core Binding Factor alpha 1 (Cbfal). Cbfal stimulates transcription of Osteocalcin, Type I collagen, Bone sialoprotein, and Osteopontin, genes essential for formation and maturation of mineralized tissues (Ducy et al. 1997; Kern et al. 2001; Franceschi and Xiao 2003). Cbfal -deficient mice develop to term with skeletons entirely composed of cartilage, indicating its importance in OB differentiation

(Komori et al. 1997; Otto et al. 1997). Very early markers of the OB phenotype, type I collagen and alkaline phosphatase, are present in the C7?/a/-deficient mice indicating that their expression is not regulated by Cbfal. These results suggest that Cbfal only controls the expression of those genes expressed at a more differentiated state. Once differentiated, OB function has been shown to be dependent on the continued expression of Cbfal, where the high levels of osteocalcin expression present in OBs are regulated by

Cbfal (Ducye/o/. 1999).

7 1.2.3 Osteoclasts

Bone resorption is performed by osteoclasts (OCs), specialized cells that are derived from the monocyte/macrophage haematopoietic lineage.

1.2.3.1 Morphological Changes During Osteoclast Differentiation

Bone marrow precursor cells are small mononuclear cells that are generally found within the bone marrow and are recruited to different sites within the body. During differentiation, OCs undergo a series of cellular changes that can be observed at the histological level (Figure 1.1) (UdaGawa et al. 1990). Monocytes and preosteoclasts are both round, mononucleated cells. During differentiation, preosteoclasts undergo fusion with one another to form multinucleated polykaryon cells that, once mature, attach to bone surface and become polarized (Boyle et al. 2003). The surface of the cell that lies adjacent to the bone develops a ruffled border which is encompassed in the OCs sealing zone, which comprises a band of actin that isolates the resorption site. The sealing zone forms only when the cell is adherent to bone and is hence a microenvironment where bone resorption occurs (Takahashi et al. 2007).

8 Figure 1.1 Osteoclast Differentiation and Marker Proteins (+ indicates the presence of a protein, - denotes its absence) Much information is available regarding the molecular basis of OC differentiation

(Figure 1.1). OC differentiation factors were first identified when cell cultures containing bone marrow cells yielded OC-like cells in the presence of stromal cells, indicating that stromal cell factors are required for differentiation (Takahashi et al. 1988). One crucial factor for OC proliferation and differentiation is Macrophage-Colony Stimulating Factor

(M-CSF). M-CSF, however, is not the only factor involved in OC differentiation, as it has been shown that RANKL is required for differentiation of preosteoclasts into mature OCs

(Lean et al. 2000; UdaGawa 2003). As well, Vascular Endothelial Growth Factor

(VEGF) has been shown to play an important role (Niida et al. 1999).

1.2.3.2 The Role of M-CSF

The importance of M-CSF to OCs has been shown in both in vivo and in vitro studies. M-

CSF is involved in monocyte recruitment, proliferation, differentiation, as well as cell survival (Wiktor-Jedrzejczak et al. 1990). One of the first clues of the importance of M-

CSF in bone remodelling came from studies of mice homozygous for the recessive mutation osteopetrosis (op/op) (Marks and Lane 1976). Op/op mice have restricted bone remodelling and lack mature macrophage and osteoclast cell populations (Wiktor-

Jedrzejczak et al. 1982; Wiktor-Jedrzejczak et al. 1990; Yoshida et al. 1990; Felix et al.

1990a; Felix et al. 1990b; Kodama et al. 1991). While this defect may be associated with an abnormal haematopoietic microenvironment, rather than with M-CSF, in vitro studies have offered further support for a role in bone remodeling. In vitro op/op cells when treated with M-CSF, and subsequently RANKL, a further differentiation factor, led to the production of functional OCs. Additionally, in vivo administration of M-CSF led to the

10 complete rescue of the osteoporotic phenotype, with OC numbers restored to normal levels (Felix et al. 1990b; Corboz et al. 1992). In vitro studies using bone or dentine slices revealed that treatment of M-CSF on OC precursor cells led to increased proliferation of the precursors (Corboz et al. 1992). The role of M-CSF appears to lie in its ability to induce monocytes into preosteoclasts (Boyle et al. 2003). Furthermore, M-

CSF administration has also been demonstrated in vitro to regulate anti-apoptosis signals in OC precursors, thus promoting cell survival and the likelihood of subsequent differentiation (Woo et al. 2002).

M-CSF appears to have biphasic effects on OCs and their precursors depending upon its concentrations (Hattersley et al. 1988; Hattersley et al. 1991; Corboz et al. 1992; Woo et al. 2002; Hodge et al. 2004; Hodge et al. 2007). In vitro studies revealed that short-term high dose treatments of M-CSF on mature OCs led to decreased bone resorption (Corboz et al. 1992). Longer treatments of M-CSF revealed increased OC size, nuclei per cell, and resorption (Corboz et al. 1992; Hodge et al. 2007). At higher doses, M-CSF has been shown to cause OC precursors to differentiate into dendritic cells instead of OCs, and inhibit the bone resorbing activites of mature OCs (Hattersley et al. 1988; Hattersley et al. 1991; Hodge et al. 2004).

M-CSF functions in OC differentiation by binding to its specific receptor, Colony

Stimulating Factor 1 Receptor (c-Fms) (Stanley et al. 1997). Mice deficient in Csflr, the gene that encodes c-Fms, showed a very similar phenotype to M-CSF knock-out mice in having osteopetrosis due to an OC deficiency (Dai et al. 2002; Van Wesenbeeck et al.

2002). M-CSF binding to c-Fms results in receptor dimerization and activation of the tyrosine kinase pathway, leading to the subsequent activation of approximately 150

11 proteins (Yeung et al. 1998). The complex signalling cascades triggered by M-CSF signalling are responsible for the multiple roles of this protein e.g. proliferation, survival, differentiation, spreading, motility, and cytoskeletal reorganization (Insogna et al. 1997).

Survival and proliferation occur through Rho kinase BAX, while differentiation of these cells has been shown to occur through the classical MAP kinase pathway, as well as the

JNK and p38 MAP kinase pathway (Weilbaecher et al. 2001; Lutter et al. 2008). The complete effects of M-CSF on the cells of the monocytic lineage, however, are yet to be clarified (Ross 2006).

One of the downstream genes activated by M-CSF is VEGF (Eubank et al. 2003). VEGF is mainly involved with activating angiogenic processes; however, the activation of

VEGF by M-CSF results in an amplification of M-CSF signal, as VEGF's effects are similar and even more potent to that of M-CSF (Eubank et al. 2003). It has been proposed that the actions of VEGF may be the reason for osteoclasts being found in the M-CSF knock-out mouse, and has been shown in vivo to correct the osteopetrotic defect by restoring osteoclast numbers and activity (Wiktor-Jedrzejczak et al. 1990; Niida et al.

1999). Therefore, M-CSF is not the only growth factor that promotes OC differentiation from monocytes. Macrophage marker F4/80 is another gene that is activated by M-CSF

(Hirsch et al. 1981; Boyle et al. 2003). Preosteoclasts express the macrophage marker

F4/80 whereas OC precursors and committed OCs do not express this antigen (Lean et al.

2000). F4/80's major role has been proposed to be involved with the induction of

immunological tolerance; however, its activities during OC differentiation remain elusive

(Lin et al. 2005; van den Berg and Kraal 2005). The F4/80 antigen is only expressed on

one cell type of the osteoclastic lineage, the preosteoclast, but has also been seen to be

12 expressed on some macrophages (Hirsch et al. 1981). The human equivalent of the F4/80 macrophage marker has been proposed to be the epidermal growth factor module- containing mucin-like receptor 1 (Baud et al. 1995; McKnight et al. 1996).

It has also been found that M-CSF can activate Receptor Activator of Nuclear factor kappa B (RANK), a receptor crucial for the next stage of differentiation into a mature OC

(Cappellen et al. 2002). RANKL is a transmembrane protein found on OBs, stromal cells, and T-cells that interacts with RANK, a receptor that is present on preosteoclasts, and is thought to promote preosteoclastic cell fusion in order to produce polykaron cells

(UdaGawa 2003; Hotokezaka et al. 2007). RANKL promotes maturation of the polykaryon cell into an activated OC that is capable of bone resorption by activating the expression of specific genes (Teitelbaum and Ross 2003). Cbfal knockout mice, which lack mature OBs, also do not possess mature OC, proving that RANK-RANKL interactions are critical for OC maturation (Ducy et al. 1997; Komori et al. 1997; Otto et al. 1997). OC differentiation is also regulated by osteoprotegrin (OPG), a soluble protein that blocks OC formation in vitro and bone resorption in vivo (Simonet et al. 1997;

Yasuda et al. 1998; Morony et al. 1999).

1.2.3.3. Osteoclast Function

Once mature, OCs usually localize near mineralized matrix and exhibit a polarized morphology during bone resorption. It is known that the av(33 integrin is central for OC- bone recognition and initiation of reorganization of the cell's actin cytoskeleton into a polarized cell with a sealing zone on the bone surface and a ruffled border (McHugh et al. 2000). Once attached to the bone the integrin is also thought to signal H+ATPases in vesicles to be deposited on the sealing zone membrane so that the microenvironment

13 created between the bone and OC can be acidified (Abu-Amer et al. 1997). The acidified environment mobilizes the hydroxyapatite component of the bone leaving the organic elements to be degraded by cathepsin K (Gelb et al. 1996; Saftig et al. 1998). Cathepsin

K is responsible for activating tartrate resistant acid phosphatase (TRAP), an enzyme that hydrolyzes phosphates in OCs and is commonly used as a histological marker for OCs

(Roodman 1996; Teitelbaum and Ross 2003).

1.3 Orthodontic Tooth Movement

Orthodontic tooth movement (OTM) occurs upon the application of a controlled mechanical force and results in tooth root movement through the alveolar bone.

Orthodontic force is transduced to the surrounding periodontal tissues and results in the interruption of blood flow, altered localized electrochemical environment, and a disturbance of the homeostatic environment in the periodontal space. These changes lead to the initiation of coordinated biochemical and cellular reactions, such as cell differentiation, proliferation, and protein synthesis. There are three main theories that attempt to describe the mechanism through which OTM occurs: pressure-tension, bone- bending, and most recently, a combination of these two mechanisms.

1.3.1 Orthodontic Tooth Movement Theories

Since the late 1800's researchers have been trying to determine the mechanism that occurs when an orthodontic force is applied to a tooth. One hundred years later, we are getting closer to understanding the complex processes involved in OTM with several theories to explain them.

14 When a force is initially applied to a tooth it results in a shifting of the tooth within the periodontal space and creates disorganization of the collagen fibres in the PDL

(Oppenheim 1911). Areas of pressure and tensions are formed, respectively, where the tooth root on one side compresses the PDL and on the opposite side the collagen fibres of the PDL are pulled taut (Oppenheim 1911; Schwarz 1932). The pressure-tension hypothesis is a theory based upon histological observations: in the compression side the

PDL displays disorganization and diminution of fibre production and a decrease in cell replication whereas on the tension side, stretching of the PDL fibres results in an increase in cell replication and subsequent fibre production (Oppenheim 1911). These initial in vivo studies, performed in baboons (Oppenheim 1911), were subsequently corroborated in dogs (Schwarz 1932) and together formed the basis for the pressure-tension hypothesis where changes in PDL width during OTM were believed to lead to alteration of the cellular activities of the periodontium and subsequent alveolar bone deposition and resorption (Schwarz 1932). This theory was reinforced by the findings that if the alveolar bone made contact with the tooth root, tooth movement would no longer occur (Gottlieb

1946). In the mid-1900's, however, the pressure-tension hypothesis was re-evaluated by several groups who believed that, as the composition of the ground substance that makes up the PDL is a fluid environment, the laws for liquid behaviour should be used to describe the changes that occur in the PDL during tooth movement (Baumrind 1969;

Grimm 1972). With the prediction that the regions of compression and tension provide the stimulus for bone remodelling follows the assumption that the hydrostatic environment is not consistent throughout. This inconsistency in pressure in the PDL violates Pascal's Law that states that a change in pressure to an enclosed incompressible

15 fluid should be uniform with respect to the entire fluid body. Thus, only the solid elements of the periodontal tissues could experience differential pressures, leading groups to investigate another theory already in progress, the bone-bending theory.

The bone-bending theory was initiated by Farrar (1876) and was based on his general observations of his own interactions with patients experiencing tooth movement. He was one of the first to observe the bending of the alveolar bone during orthodontic tooth movement (Farrar 1876). Other groups also noted alveolar bone bending during orthodontic treatment corroborating Farrar's evidence (Miihlemann and Zander 1954;

MacDowell and Regli 1961; Picton 1965; Cochran et al. 1967; Baumrind 1969; Grimm

1972). In vivo experiments by Baumrind (1969) in rats and Grimm (1972) in humans revealed that forces applied to teeth bent the adjacent alveolar bone and promoted bone turnover and renewal of cellular elements. These researchers determined that bent bone develops stress lines and activates cells that lie adjacent to the stress lines. It had been proposed that osteocytes may provide the stimulus for bone-remodeling through their interactions with specific cell types (Mullender and Huiskes 1997; Martin 2000).

Osteocytes are networked to one another through cytoplasmic extensions, called canaliculi, and are believed to communicate via gap junctions with one another and with

OBs and bone lining cells (Yamaguchu et al. 1994; Donahue et al. 1995; Cantarella et al.

2006). Through these interactions, osteocytes would be able to activate these cell types and create a chain of events sufficient to produce bone resorption and deposition (Martin

2000). However, the bone-bending theory conflicted with the current orthopaedic theory that mechanical compression stimulates bone formation whereas tension stimulates bone resorption (Melsen 1999).

16 The newest theory describing the mechanism through which tooth movement occurs is a combination of the bone-bending and pressure-tension theories. A study using different amounts of orthodontic force suggested that bone deposition occurred on the tension side due to a load created by the PDL fibres, subsequently causing alveolar bone bending

(Melsen 2001). At low orthodontic forces there is direct bone resorption due to the unloading of the alveolar wall by the PDL fibres; at higher forces indirect resorption occurs as a result of ischemia (Melsen 2001). These results have been supported by a finite element model created with this mechanism as its basis (Cattaneo et al. 2005).

However, this new combined theory has yet to be studied in detail and so work continues within this field.

The mechanistic theories that attempt to explain OTM have been the product of many different investigations. Due to the inability to examine tissues other than the gingiva in humans, researchers turned to the use of animal models of OTM in order to study the other periodontal structures.

1.3.2 Animal Models of OTM

In the 20' century many orthodontic experiments employed the use of many different types of animals, including dogs, cats, hamsters, rats, rabbits, guinea pigs, and monkeys

(Oppenheim 1911; Schwarz 1932; Myers and Wyatt 1961; Utley 1968; Pilon et al. 1996;

Vas Leeuwen et al. 1999). With many different species being used, each with their own orthodontic appliance and force level, it became difficult to compare results across studies. Since then, most OTM experiments have been performed in rodents, mainly rats and mice.

17 The most common method of movement is through force on the maxillary or mandibular molars, with incisors used in some cases. Forces have been applied in a variety of ways e.g. through the use of palatal expanders, protraction using elastic rings, or the more widely used methods, involving the use of elastic pieces or springs (Waldo 1953; Lilja et al. 1981; Brudvik and Rygh 1993; Soma and Iwamoto 1999).

The most popular technique involving elastics is called the Waldo Method, after the group that developed it (Waldo 1953). A small piece of elastic is placed in between the first and second molars, creating a mesial force on the first molar and a distal force on the second molar. While this method is relatively simple, the amount of force that is being applied is not known and tooth movement occurs in two different directions, making it difficult to isolate the changes that are occurring within the tissues. A more complicated procedure involves the use of a coiled spring whose force can be determined prior to insertion. The spring is usually bonded to a molar on one end and the incisors on the other, where the spring is activated, or stretched, upon insertion. This method provides a known amount of force in the mesial direction on the molars. Although the spring also causes distal forces on the incisors, anchorage to both incisors minimizes this movement.

1.3.3 Wounding in Orthodontic Tooth Movement

It has been suggested that restructuring of the periodontium as a result of OTM could result in a wounding response. Based on histological work on OTM in rats, guinea pigs, and rabbits, Storey (1973) observed increased permeability of the periodontal blood vessels similar to what happens during inflammation (Storey 1973). Inflammation is generally thought to be a host's response to a microbial infection or tissue damage. While

18 tissue remodelling during orthodontic treatment is considered to be a sterile process, necrotic tissue forms due to ischemia in regions experiencing compressive forces that are potent enough to act as inflammatory stimuli (Lilja et al. 1983). In the compression region of the PDL, cells that have been damaged release chemical signals such as interleukin-1, tumour necrosis factor-a, and prostaglandins, all of which have been found in the gingival crevicular fluid of human patients undergoing orthodontic treatment

(Grieve et al. 1994; Lowney et al. 1996; Uematsu et al. 1996; Tzannetou et al. 2008) and the PDL of rats after 24 hours of orthodontic force (Bletsa et al. 2006). Interleukin-1 and tumour necrosis factor are pro-inflammatory cytokines that induce the synthesis of proteins that cause acute or chronic inflammation (Ozaki et al. 1996) and prostaglandins are potent inflammatory mediators that elicit increased blood flow and vessel permeability (Lewis and Austen 1981). Subsequently, dilation and permeability of the blood vessels close to the compression region of the PDL occurs as well as in-growth of the vascular structures into the necrotic tissue areas, as seen in tooth movement studies in rats, hamsters, and cats (Rygh et al. 1986; Hosoyama 1989; Warita 1990). Histologically,

it has been found that, due to the increased vascular permeability, mononuclear phagocytic cells enter the orthodontically treated PDL (Rygh et al. 1986; Jager et al.

1993; Vandevska-Radunovic et al. 1997). It was noticed by these groups and others that

the population and distribution of lymphocytes and granulocytes did not change during

orthodontic treatment (Kurihara 1977; Rygh et al. 1986; Vandevska-Radunovic et al.

1997). These findings suggest that the wounding response occurring during OTM is

indeed aseptic, where the macrophage-like cells presumably resorb the necrotic tissue and

19 secrete chemical signals to promote the growth and replication of other cells, such as

fibroblasts, which synthesize a new extracellular matrix (Nathan 1987).

1.3.4 Orthodontic Tooth Movement Phases

There are generally four different phases that are recognized during OTM. The first phase

is called the initial, or tipping phase, and involves rapid movement of the tooth within the

periodontal space (Krishnan and Davidovitch 2006). This is followed by the lag phase,

where little or no tooth movement occurs, and the recruitment and differentiation of cell

types required for remodelling takes place (Rygh 1974; Melsen 2001). The next phases

are the acceleration and linear phases, where tooth movement through bone occurs

exponentially and then becomes fairly constant over time, respectively (Pilon et al.

1996). Linear tooth movement continues until the mechanical force has been dissipated

through efficient movement of the tooth. A summary of the molecular markers associated

with OCs and OBs that have been studied during orthodontic treatment is given in Figure

1.2, and discussed in further detail in Section 1.3.4.1 - Section 1.3.4.3.

Initial Phase Lag Phase Linear, Acceleration Phases OC U13 OC OB OC OB Inlcilcukiu-l • Ii'AIT.isc 4- II A'lT;isc + 1 uniiHir nccmsjs |jcio r RANK + 1 rdnsl'ormiiiL' LTOV, ih t'juoi 1 Prostaglandin-. • RANK! [ I RAP + RANKI. * '[RAP + Colbyen npc 1 4- Run\2 ! ALT +

Figure 1.2 Summary of Molecular Markers found in the PDL during OTM (OC = osteoclast, OB = osteoblast, | denotes protein increases differentiation, J, denotes protein causes a decrease in differentiation, and + indicates the presence of a precursor or mature cell type)

20 1.3.4.1 Initial Phase

The initial phase of OTM generally lasts several hours to one day in animal models and usually one to two days in humans (Storey 1973; Pilon et al. 1996; Vas Leeuwen et al.

1999). When a mechanical force is applied, the tooth moves within the periodontal space, resulting in areas of compression and tension. With the tooth root pushing the PDL against the alveolar bone, creating the compression region, bone loading is alleviated

(Melsen 2001). On the opposite side of the tooth the PDL is being pulled taut, creating areas of tension and subsequent alveolar bone-bending. It is in this way that the mechanical force is transduced to the supporting soft and hard periodontal tissues, causing cellular and tissue reactions to occur immediately after force application. While mechanosensory cells in bone have been thought to be the stimulus for bone remodelling, recent findings, however, suggest that it is the cells of the PDL that provide this relatively

immediate reaction.

The mechanosensory cells in bone, osteocytes, are thought to be the first cells to respond to mechanical force and have been examined in many tooth movement models. After 6 hours of orthodontic force in mice, osteocytes showed increased expression of dentin matrix protein and decreased levels of matrix extracellular phosphoglycoprotein regulator, two proteins involved in modulation of mineralization (Gluhak-Heinrich et al.

2003; Gluhak-Heinrich et al. 2007). Biomechanical studies have shown that osteocytes

express nitric oxide which activates neighbouring osteocytes in response to mechanical

forces (Vatsa et al. 2007). Nitric oxide has been shown to have biphasic effects on bone

cells, but in general tends to increase the bone depositing activity of OBs and inhibit that

of OCs (van'T Hof and Ralston 2001). This explains the observation that, on the tension

21 side, bone deposition occurs. In the presence of orthodontic force in a rat model, however, nitric oxide synthase activity did not increase in osteocytes of the surrounding alveolar bone even after 24 hours of force (Nilforoushan and Manolson 2008). This

finding suggests that the initial cellular and molecular events of OTM occur in the PDL.

In fact, nitric oxide secretion has actually been shown to be induced by the proinflammatory cytokines interleukin-1 and tumor necrosis factor (Evans and Ralston

1996). Thus the inflammation response is intertwined with the bone-remodelling processes involved in OTM (Goldring 2003).

Some of the factors released during the inflammatory process, specifically the major

cytokines already mentioned, interleukin-1, tumour necrosis factor-a, and prostaglandins,

also have the potential to enhance osteoclastogenesis to promote resorption of the

adjacent alveolar bone (Suda et al. 1999; Teitelbaum 2000). Interleukin treatment on OBs

in vitro and prostaglandin E2 addition to compressed human PDL cells have be shown to

lead to an upregulation of the RANKL gene (Horwood et al. 1998; Kanzaki et al. 2002).

It has been proposed that, upon the application of force, PDL cells initiate expression of

the Cox-2 gene, causing expression of prostaglandin E2 which has an autocrine affect

producing expression of RANKL, enhancing osteoclastogenesis (Kanzaki et al. 2002). In

vivo the expression of RANKL in the periodontal ligament of rats undergoing orthodontic

treatment has been detected after 24 hours (Kim et al. 2007). OBs are also thought to be

involved in OC precursor recruitment based on results that show that with force

osteoblastic cells up-regulate expression of M-CSF after 3 hours (Motokawa et al. 2005).

It has also been shown that OB precursors undergo accelerated differentiation in the

presence of a mechanical force, as seen by the detection of Runx2 after 8 hours of

22 orthodontic treatment (Kawarizadeh et al. 2005). Runx2 was also found to be expressed after only 30 minutes of tensile force on PDL fibroblasts and human OBs, and mediated via mitogen-activated protein kinases (Matsuda et al. 1998; Ziros et al. 2002; Baumert et al. 2004). Through mechanical strain OBs interact with collagen I and integrin receptors with the deformation of the cytoskeleton, which then activates Runx2 expression

(Carvalho et al 1996; Matsuda et al. 1998; Xiao et al. 2000; Lai et al. 2001). Another effect of tensile force has also been found in a rat tooth movement model which showed cell proliferation increased on the tension side of the PDL after 12 hours of force

(Baumrind and Buck 1970).

1.3.4.2 Lag Phase

The lag phase occurs as a result of the compressive forces that occur in the PDL. Blood flow is thus inhibited and cells either undergo necrosis or apoptosis (Rygh 1973; Rana et al. 2001). In animal models the lag phase can extend 3-8 days from initial force application, and anywhere from 10-40 days in humans (Rody et al. 2001; Keles et al.

2007). The necrotic tissue that is formed in the compression region becomes hyalinised, or cell-free, and requires the recruitment and differentiation of OC precursor cells for its subsequent removal. A number of molecules have been shown to be expressed during the lag phase of OTM and believed to be involved in either the differentiation of OC or OB precursors. For example, M-CSF and VEGF expressed by OBs are believed to activate recruitment of OC precursors (Motokawa et al. 2005). M-CSF is also capable of recanting circulating macrophages which are involved in the resorption of the necrotic tissue (Rody et al. 2001). After only 6 hours of orthodontic force in rats H+-ATPase- positive preosteoclasts, cells capable of forming the acidic environment required for bone

23 resorption but that are not yet TRAP-positive, have been detected in the vascular canals of the alveolar bone crest near the compression side of the PDL (Yokoya et al. 1997). In two other rat models of OTM RANK-positive cells were observed in the compression region after 24 hours and 3 days of force, indicating the presence of preosteoclasts

(Ogasawara et al. 2004; Xie et al. 2008). While the presence of RANKL was confirmed during the initial phase, RANKL has been shown to still be expressed in vivo during the lag phase, after 3 days in a rat OTM model (Kim et al. 2007). With the influx of OC precursor cells and the presence of RANKL-positive cells fusion of the precursors can occur, creating OCs. An in vitro experiment involving the co-culturing of human PDL cells that had undergone compression with monocytes led to increased OC formation, thus supporting this idea (Yokoya et al. 1997). Another in vitro experiment where human

PDL cells underwent compression observed that over a span of 2-4 days the levels of osteoprotegrin expression decreased, while levels of RANKL increased (Nakao et al.

2007). With the levels of osteoprotegrin decreasing, the likelihood of RANK-RANKL interactions increases, which can potentially lead to a greater number of OCs. This result was seen in osteoprotegrin-deficient mice undergoing OTM, where a larger number of

OCs and more bone resorption were observed (Oshiro et al. 2002). The presence of mature OCs in the compression side of the PDL has been observed by many groups after

3-5 days of force in rat models as denoted by multinucleated TRAP-positive or vacuolar- type H+-ATPase-positive cells (Yokoya et al. 1997; Rody et al. 2001; Fujihara et al.

2006; Kim et al. 2007). In mouse models, similar results have been found, where TRAP- positive cells have been detected around 2-3 days after force application (Oshiro et al.

2002; Yoshimatsu et al. 2006).

24 In the tension side of the PDL it is thought that mesenchymal cells undergo differentiation into OBs through the expression of Runx2. In mouse and human models of

OTM the levels of alkaline phosphatase (ALP), which has been determined to be an early marker of mechanically-induced differentiation of OBs, and Runx2, respectively, increased in the tension regions after 24 hours of force (Pavlin et al. 2000b; Garlet et al.

2008). The upregulation of these genes indicates an increase in osteoblastogenesis, and was confirmed by the presence of OBs after 2 days of orthodontic force in a mouse model

(Pavlin et al. 2000a).

Other important processes that are occurring during the lag phase involve remodelling of the extracellular matrix of the soft tissues. The inflammation response is generally thought to have ended by this time, where macrophages have already been recruited to the areas of necrotic tissue (Vandevska-Radunovic et al. 1997). Many different groups have detected members of the matrix metalloproteinase family in the bone and PDL of animals and humans as well as in human gingival crevicular fluid (Cantarella et al. 2006;

Leonardi et al. 2007; Chang et al 2008). The presence of these proteins indicates that fibroblasts and macrophages are likely remodelling the extracellular matrix, both on the tension and compression sides (Kerrigan et al. 2000).

1.3.4.3 Acceleration and Linear Phases

In humans, tooth movement through bone does not actually begin until 20-40 days after

initial force application (Storey 1973). Tooth movement increases greatly directly after the lag phase, where many different cell types are working in tandem to remove the necrotic tissue and adjacent alveolar bone, a period termed the acceleration phase (Pilon

et al. 1996). After this point tooth movement occurs at a relatively linear rate, called the

25 linear phase, and continues until the mechanical forces initially placed on the tooth become dissipated.

When the required mature cell types are present in the PDL, such as OCs, OBs, and fibroblasts, tooth movement through bone can occur. In a rat model of OTM H+-ATPase- positive OCs, considered activated cell types, were seen lined against the alveolar bone on the compression side of the PDL after 3 days of force; however, bone resorption was evident histologically after 4 days, indicating the beginning of the acceleration phase

(Yokoya et al. 1997). A mouse model of OTM found bone resorption was occurring due to the presence of resorptive pits after 4 days of orthodontic force (Oshiro et al. 2002).

With respect to those cells that were aiding in the differentiation of OCs, the levels of

RANKL decrease after 7 days of force (Kim et al. 2007). It is suggested that this is a result not of force dissipation but of the release of transforming growth factors from the alveolar bone being resorbed (Theill et al. 2002). Transforming growth factor has been shown to inhibit RANKL levels, indirectly regulating the formation of OCs (Theill et al.

2002; Kim et al. 2007). Evidence of osteoblastic activity on the opposite side of the tooth root has been shown through the increased expression of collagen type I after 72 hours and 1 week of orthodontic force in periodontal tissues of rat (Karimbux and Nishimura

1995). New osteoid laid down by OBs is evident histologically after 3 days in a mouse model, and 5 days in a hamster model (Myers and Wyatt 1961; Pavlin et al. 2001).

The cellular and molecular events involved in OTM are becoming increasingly clear.

With improved knowledge the possibility of accelerating tooth movement becomes more feasible.

26 1.3.5 Orthodontic Tooth Movement Acceleration

Optimal tooth movement can be defined as the fastest tooth movement with the least

amount of tissue damage (Ren et al. 2003). Several experimental approaches have been used to accelerate OTM. Many groups have been focusing on the ability to increase OC

activity in order to produce more bone resorption, hence accelerating OTM. Increased

OC activity during OTM has been produced through administration of prostaglandins and

their analogs, such as prostaglandin Ei, prostacyclin, and thromboxane A2, where

prostaglandin Et therapy in humans clinically produced 50% more tooth movement than

in the control (Yamasaki et al. 1982; Yamasaki et al. 1984; Gurton et al. 2004).

Hyperalgesia, however, is a side effect of prostaglandin treatment due to the release of

noxious agents (Yamaguchi and Kasai 2005). The active form of Vitamin D3 has also

been shown to increase OC activity during orthodontic tooth movement in rats and

increase tooth movement by 20% (Takano-Yamamoto et al. 1992). Other treatments

include VEGF, of which the change in tooth movement was not reported, and osteocalcin

delivered through local injection to result in increased recruitment of OC precursor cells,

where osteocalcin produced a 53% increase in movement (Takano-Yamamoto et al.

1992; Hashimoto et al. 2001; Kaku et al. 2001). Continuous systemic infusion of

parathyroid hormone resulted in accelerated tooth movement by enhancing osteoclastic

bone resorption in the compression regions of the periodontal tissues (Soma and Iwamoto

1999). Later experiments involving intermittent injection of parathyroid hormone did not

significantly affect tooth movement. These results suggest that although injections may

hold potential to increase tooth movement briefly, the substances injected are likely to be

27 cleared from the extracellular matrix before having a sufficient effect on the surrounding cells.

One group, in an effort to inhibit tooth movement found that osteoprotegrin gene transfer to the periodontal tissues prolonged osteoprotegrin expression leading to diminished

RANKL-mediated osteoclastogenesis and tooth movement (Kanzaki et al. 2004). Based on this work they performed the same experiment, only increasing the expression of

RANKL through gene transfer and accelerated OTM and presumably osteoclastogenesis, increasing tooth movement by 25% (Kanzaki et al. 2006). As well, low-energy laser irradiation has been shown to stimulate tooth movement via increased expression of M-

CSF and C-fms (Yamaguchi et al. 2007). These methodologies, however, require frequent administration, either daily or every other day, which clinically is not feasible.

28 1.4 Thesis Project Objectives

Rationale: In humans, the lag phase that occurs during orthodontic treatment is considered to be the rate-limiting step for tooth movement, where the required cell types are recruited to the periodontal ligament and undergo differentiation. In order to pharmacologically decrease orthodontic treatment times the activities of these cells need to be documented in detail in order to ascertain the best method for accelerating their recruitment and differentiation.

Objective: This thesis is intended to obtain a better understanding of the activities of the periodontal ligament cells during orthodontic tooth movement, particularly the proliferation and differentiation of osteoblasts and osteoclasts in order to determine the best therapeutic strategy to accelerate tooth movement, as well as to apply this strategy and determine its effect on tooth movement.

Research Question: Over what time period do osteoblasts and osteoclasts undergo recruitment and differentiation during orthodontic treatment and can this process be accelerated with Macrophage-Colony Stimulating Factor?

Hypothesis: It is hypothesized that the addition of Macrophage-Colony Stimulating

Factor to the periodontal ligament in conjunction with orthodontic force in mice will produced accelerated tooth movement.

29 Specific Aims:

1. To look at the recruitment and differentiation of osteoclasts and osteoblasts in the periodontal ligament during orthodontic tooth movement

2. To determine if an injection of Macrophage-Colony Stimulating Factor to the periodontal ligament of mice experiencing orthodontic treatment will affect the periodontal cells and accelerate tooth movement.

Methods: The activity of the periodontal cells was analyzed using immunohistochemical procedures and TRAP staining on sections of mouse and rat maxillae that had undergone tooth movement, as well as real-time RT-PCR using cells from the periodontal ligament to determine if gene expression was affected by Macrophage-Colony Stimulating Factor administration.

30 CHAPTER 2. Molecular Markers of Early Orthodontic Tooth Movement

2.1 Introduction

Orthodontic tooth movement (OTM) occurs upon the application of a controlled mechanical force and results in biological reactions that model and remodel the surrounding dental and periodontal tissues (Krishnan and Davidovitch 2006). During the first phase of OTM there is displacement of the tooth in the periodontal space followed by the lag phase, when movement ceases and resorption of the necrotic tissue formed during the initial phase is required (Keles et al. 2007). While the later stages of tooth movement through bone are better understood, the cellular and molecular processes occurring in the early stages of OTM, the initial and lag phases are relatively uncharacterized.

During OTM movement of the tooth within the periodontal space causes stretch and compression of collagen fibers and changes in cellular activity (Lekic and McCulloch

1996). Tooth movement only occurs when the areas of hyalinized (cell-free) tissue in the compression side, created due to a combination of inflammatory cytokines and a disruption in the blood flow are removed (Rody et al. 2001; Keles et al. 2007). Removal of this tissue and adjacent alveolar bone is achieved by circulating macrophages and bone marrow osteoclastic precursors that are recruited to the PDL (Rody et al. 2001; Krishnan and Davidovitch 2006). Stresses generated on the tension side results in the differentiation of mesenchymal cells into osteoblasts (Garlet et al. 2007). Communication occurs between the osteoblast and osteoclast populations, e.g., osteoblasts and their precursors aid in the differentiation of osteoclasts through expression of Tumor necrosis

31 factor ligand superfamily member 11, or Receptor Activator of Nuclear factor Kappa p ligand (RANKL), a transmembrane or soluble protein also found on fibroblasts, stromal cells, and T-cells (Ikeda et al. 2001; Boyle et al. 2003; UdaGawa 2003). Interaction between Receptor Activator of Nuclear factor Kappa p (RANK) on the preosteoclasts and

RANKL promotes maturation and fusion of the preosteoclasts into activated osteoclasts

(Roodman 1996; Boyle et al. 2003; Teitelbaum and Ross 2003). RANKL and Runt- related transcription factor 2 (Runx2), a transcription factor of osteoblast precursors, have been detected as early as 24 hours; however, as yet the spatial expression patterns of these proteins and cell proliferation have not been examined in detail or at earlier time points (Roberts and Morey 1985; Pavlin and Gluhak-Heinrich 2001; Kawarizadeh et al.

2005; Kim et al. 2007; Watanabe et al. 2007). Our hypothesis is that mechanical loading on a tooth will activate proliferation of PDL cells and specific gene products within the

PDL in the early phases of OTM.

2.2 Materials and Methods

2.2.1 Rat model of OTM

Ten grams, or 10 cN, of orthodontic force was applied in the mesial direction to the right maxillary first molar of male Sprague-Dawley rats in a split-mouth design, as described previously (Nilforoushan and Manolson 2009). This force value was chosen because it was the smallest amount of force that could be accurately created in rats. In this way the model relates well to clinical applications where human teeth are much larger than those of rats. Twenty-four animals from the same litter were divided randomly into two test groups of 3 (n=10) and 24 (n=12) hours of force duration, where two animals from the 3

32 hour group died during anesthesia administration. Ligature wires were placed around the

molar and incisors in cervical grooves created with a bur, and held in place with self-cure

composite resin (Reliance Orthodontic Products Inc., Itasca, IL). A 10 grf Sentalloy

closed-coil spring (GAC International Inc., Bohemia, NY) was attached to these wires running between the right first maxillary molar and the upper incisors. The experimental

design was approved by the Animal Ethics Committee of the University of Toronto.

2.2.2 Histological and Immunohistochemical Procedures

Maxillae were dissected, formalin fixed, and decalcified in EDTA. Samples were

dehydrated, paraffin embedded, and 6 um thick horizontal sections were prepared. Tissue

sections less than 180 \xm from the furcation of the disto-palatal root of the right and left

first maxillary molars were stained for RANKL and Runx2, using nine sections from

each animal. Also, every third slide containing sections obtained from the furcation of the

first maxillary molar disto-palatal roots down to the apex of the root were analyzed for

KI-67 expression, in order to look at expression along the entire tooth root. Sections were

dewaxed, blocked for endogenous hydrogen peroxidase, subjected to antigen retrieval,

incubated with serum (Sigma, Oakville, ON), and incubated with polyclonal goat anti-

RANKL antibody (1:200, VectorLab, Burlington, ON), polyclonal goat anti-Runx2

antibody (1:50, VectorLab, Burlington, ON), or polyclonal rabbit anti-KI-67 antibody

(1:1000, VectorLab, Burlington, ON). Biotinylated secondary antibodies against the

primary antibodies (VectorLabs, Burlington, ON) were used followed by Avidin-Biotin

complex (Vectastain Universal Elite ABC kit, VectorLabs, Burlington, ON),

diaminobenzidine (DAB, VectorLabs, Burlington, ON) and eosin. Negative controls were

33 conducted in the absence of the primary antibody. To determine the specificity of the

RANKL antibody, it was incubated with soluble recombinant mouse RANKL before application to the tissue sample for immunohistochemical detection. Several slides stained for RANKL were counterstained with DAPI to visualize the RANKL signal location. The presence of osteoclasts was determined with TRAP staining, as described previously (van de Wijngaert and Burger 1986) using one slide per animal containing sections close to the furcation of the disto-palatal root of the first maxillary molar.

2.2.3 Quantification and Analysis

Images were taken with an Infinity 2 Color Camera attached to an Olympus 1X71

Microscope at 60x magnification. Quantification was achieved using Image Pro Software

(Image Pro Plus 2.0). Areas of interest (AOIs) were defined as regions containing the mesial and distal portions of the PDL surrounding the disto-palatal root of the right and left first maxillary molars. All AOIs were of equal size, 208 p.m by 52 |im, and positive cells were counted in the total area of these four AOIs. For AOIs that contained hyalinized tissues, the number of positive cells in the total AOI area was extrapolated from the density of positive cells in the non-hyalinized tissue area. The two AOIs on the experimental side were compared to their control AOIs with paired t-test (SPSS, version

15.0). The number of positive cells in the tension and compression AOIs were normalized to the number of positive cells in the contralateral controls by subtraction. To test if the protein expression in the tension and compression AOIs were different from one another and if the duration of force (3 & 24 hours) affected the expression patterns, a

Kolmogorov-Smirnov test was performed to show that the data was not normally

34 distributed (p >.05) and was followed by a Mann-Whitney non-parametric test (SPSS, version 15.0). Sections along the length of the disto-palatal root slides spanning 70 um at the middle, apex, and furcation were grouped together and compared to one another using one-way ANOVA analysis. Results were significant ifp <.05.

2.3 Results

2.3.1 RANKL, Runx2, TRAP, and KI-67 expression near the furcation of the disto- palatal root

Histological analysis of the tissues surrounding the orthodontically moved molar showed areas of taut collagen fibers and disorganized collagenous tissue in the PDL of the distal and mesial regions, respectively, as seen in Figures 2.1 - 2.3. Also, in the compression side of the PDL after 24 hours of orthodontic force, cell-free regions were present.

Immunohistochemical analysis of RANKL, an osteoclastic differentiation factor, showed

RANKL was expressed by cells in the mesial side (compression) of the PDL surrounding the disto-palatal root of the maxillary first molar, after 3 hours of force (Figure 2.1).

Specificity of RANKL antibody staining in these sections was confirmed by incubation of the RANKL antibody with soluble RANKL prior to the immunohistochemical procedures. RANKL, as expected of a soluble or transmembrane protein, was expressed in the cytoplasm and not in the nucleus when counterstained with DAPI (data not shown).

The RANKL-positive cells were found within 30 um of the tooth root, and were small and circular in shape. The mean ± standard deviation of positive cells on the mesial side was found to be 7.8 ± 2.2 cells/AOIarea, and 1.0 ± 0.6 cells/AOIa,ea on the distal side.

After 24 hours of force, RANKL was no longer detected. Runx2, a marker of osteoblast

35 precursors, was present in three of eight animals examined in only the distal PDL after 24 hours, but not after 3 hours (data not shown).

The presence of osteoclasts was determined through TRAP staining, where TRAP- positive cells were found only on the distal side of the experimental and control PDL at both time points (data not shown).

KI-67, a proliferation marker, was found in sections taken within 180 um apical to the furcation of the disto-palatal root of the moved first maxillary molar (Figure 2.2). Those cells that were KI-67-positive were located throughout the PDL and comprised many different cell types based upon cell shape. Quantification of the KI-67-positive cells on the mesial and distal sides of the PDL showed that there were approximately twice the number of KI-67-positive cells in the compression area after 3 hours of orthodontic force

(26.7 ± 0.6 cells/AOIarea) when compared to the tension area (13.3 ± 0.6 cells/AOIarea).

After 24 hours of force about twice as many cells were KI-67-positive in the tension region (23.0 ± 2.7 cells/AOIaiea) than in the compression region (12.3 ± 3.2 celWAOIarea).

2-way ANOVA with interaction revealed the tension and compression AOIs were statistically different in terms of the number of positive cells and force duration, p < 0.05.

2.3.2 KI-67 expression along the length of the disto-palatal root

The expression of KI-67 by cells in the PDL was also determined along the coronal- apical length of the disto-palatal root of the orthodontically moved molar, a distance of roughly 1400 um. It was found that fewer cells were KI-67-positive at approximately 700 um from the root furcation compared to those tissue sections above and below this point

(Figure 2.3). The KI-67 expression patterns that were seen less than 180 um from the

36 furcation of the root were also seen along the rest of the root. Towards the apex of the

tooth root after the point where a negligible number of KI-67-positive cells were present,

the expression patterns were reversed when comparing the mesial and distal regions of

the PDL, where the pattern expected in the mesial region was observed in the distal

region. It was found that there were approximately three times fewer KI-67-positive cells

above and below this point both in the distal and mesial PDL at both time points (Table

2.1).

Apical Distance 3 hours of force 24 hours of force

(urn) Distal PDL Mesial PDL P Distal PDL Mesial PDL P 360 14.0 ±3.0 21.0 ±0.0 0.019 19.0± 1.0 13.0±3.5 0.045 680* 4.3 ±2.5 5.0 ± 1.0 0.690 3.7 ± 1.2 5.0 ±2.0 0.374 1000 18.7 ± 3.1 13.0 ± 1.0 0.038 13.7 ±2.2 23.7 ±2.1 0.016

Table 2.1 Number of KI-67-positive cells (given in cells/AOIa,ea) in each region of the PDL down the length of the tooth root at 3 and 24 hours is presented as mean ± standard deviation,/? < 0.05 with Mann-Whitney non-parametric test of compression compared to tension region, n = 3. *p > 0.05

37 Figure 2.1 RANKL expression (black) in the distal (A & B) and mesial (C & D) areas of the PDL after 3 hours of orthodontic force in the mesial direction. Arrow indicates RANKL-positive cell. D = dentin ^•••i'r.^K, Ctb^tr^

7 • J

A)

1^*^ ^ o *» mmm «^V

Figure 2.2 KI-67 expression (black) in the distal (A, B, E, & F) and mesial (C, D, G, & H) areas of PDL of the disto-palatal root after 3 (B & D) and 24 hours (F& H) of orthodontic force in the mesial direction. D = dentin, AB = alveolar bone [S—T% v)>. Controt ;;-^Expi^im0rftal'C^ ControJ^ofl W erimental // * ^ f>' '* GontYo|i>''.-. •• fe > :ilxtierirjfeFrtal "*>*.., D ''• .**?< <;•*'•

j i<; r r* *i . r i •" . i } ** * # * 4 ••"/ e '•• V.f c c t t i i 0 o 1*1 n ©_ n HL o 13 D * .D o f D f F F] iK' 0

•_•*. • 3f~ yp e I-:"-''" ^.'' '^y"'• • *".~^r''"' *j *^. 1 •"'i.'S ; 1 v "

4^ O 2.4 Discussion

2.4.1 The rat OTM model accurately replicates the cellular and molecular changes observed during early phases of OTM

Histological analysis of the tissues surrounding the first molar displayed features of tissues that have been subjected to orthodontic force, confirming that OTM has been established, as described previously by other groups (Reitan 1960; Martinez and Johnson

1987).

The expression of RANKL, a ligand associated with osteoclastic differentiation, by PDL cells indicates that the orthodontic force is being transduced to the PDL. The expression of this ligand is only observed in the mesial areas of the PDL surrounding the tooth root, areas under compressive forces. Based on cell shape, we believe that the RANKL - positive cells (Figure 2.2D) most likely represent preosteoblastic cells which have been shown to express RANKL and have a round morphology in other studies (Chen et al.

1997; Gori et al. 2000). The RANKL-positive cells in our samples displayed a round morphology, suggesting that they are not fibroblasts, which appear spindle-like, nor are they osteoblasts, which assume a cuboidal shape (Piche et al. 1989; Aubin 1998). Other groups have noted the in vivo expression of RANKL by PDL cells through immunohistochemistry and RT-PCR in the compression side after 1 day of orthodontic force, but did not look at earlier time points (Kim et al. 2007; Garlet et al. 2008). In our model, we see RANKL expression after only 3 hours of force. After 24 hours, however, the ligand is no longer expressed, due likely to interaction with RANK or release of the ligand into the extracellular matrix. The difference in temporal expression of RANKL in our study versus those of others could be due to the light orthodontic force we applied (10

41 grams as opposed to 20-60 grams) (Ren et al. 2003). It is possible that a lighter orthodontic force is more conducive for blood flow, allowing blood to reach the PDL enabling cell survival and RANKL expression.

Osteocytes, mechanosensory cells in bone, are considered to be highly involved in mechanical loading and unloading, producing nitric oxide as a response (Klein-Nulend et al. 1995; Vatsa et al. 2007). Previously, another group has looked at the differential expression of nitric oxide synthases in rat maxilla during early OTM, and have found that it is not osteocytes that are involved with early nitric oxide signaling, but cells of the PDL

(Nilforoushan and Manolson 2008). These results agree with our findings in that the cells involved in early signaling are not osteocytes, but cells within the PDL.

The presence of Runx2, a marker expressed by osteoblast precursors, in some animals (3 of 8 examined) after 24 hours of force in the tension region of the PDL indicates that mesenchymal cells are undergoing differentiation. Previously, other studies have noted the expression of Runx2 at or before 24 hours of force application, confirming that we have a model depicting early OTM cellular processes (Kawarizadeh et al. 2005;

Watanabe et al. 2007). The inconsistency of Runx2 expression is most likely due to the inconsistent magnitudes of force applied by the orthodontic springs. Although we do not see expression of Runx2 by those cells that were RANKL-positive, others have shown that as preosteoblastic cells mature expression of RANKL decreases and Runx2 expression increases (Gori et al. 2000; Hassan et al. 2006).

42 2.4.2 Prediction of axis of rotation of orthodontically moved tooth

Cell proliferation is a hallmark of a changing extracellular environment, which is produced during OTM (Roberts and Chase 1981). The fewer KI-67-positive cells in the compression region observed after 24 hours of force application corroborated the work of others that showed fewer cells present during the lag phase in the compression region

(Rody et al. 2001). However, as yet to be described by other groups, cell proliferation was greater after 3 hours of orthodontic force in the compression region.

The lack of cell proliferation observed at approximately 700 um apically from the root furcation of the orthodontically moved tooth suggests that little or no force is being placed on the tissues in this area. We speculate that this area represents the axis of rotation (AOR) of the tooth, defined as the line in a tooth about which it rotates in a non- translational displacement (Hayashi et al. 2007). The absence of cell proliferation could also indicate areas of excessive force; however, we do not think that this is the case as areas of compression were not observed. The AOR was about 700 um apical from the furcation of the root, near the midpoint of the root. It is noted that, apical to the AOR, we saw a reversal in the expected pattern of KI-67 expression of cells in the mesial and distal regions of the PDL when compared to the PDL coronal to the AOR. This pattern of KI-

67-positive cells confirms that the tooth has not moved in a translational direction, but has tipped within the periodontal space. Therefore, analysis of KI-67-expression in the

PDL of teeth subjected to an orthodontic force may provide potential in studies to correlate force with gene/protein expression along the axis of a tooth that has undergone

OTM.

43 CHAPTER 3. Exogenous M-CSF accelerates orthodontic tooth movement by targeting preosteoclasts

3.1 Introduction

The application of a force to a tooth during orthodontic tooth movement (OTM) results in remodeling of the alveolar bone by cells of the periodontal ligament (PDL) (Krishnan and

Davidovitch 2006). In the PDL of an orthodontically moved tooth, bone resorption by osteoclasts (OCs) and deposition by osteoblasts occur on the pressure and tension sides, respectively. Four distinct phases of tooth movement have been noted during OTM. Soon after force application, teeth tip within the periodontal space. This is followed by a lag phase as cells required for tissue remodeling are being recruited (Rygh 1974; Melsen

2001). Once cells have been recruited, teeth move rapidly (the acceleration phase) followed by an eventual plateau (linear phase) (Pilon et al. 1996). The rate-limiting step during OTM in human patients and in animal OTM models occurs during the lag phase as cells such as OCs are being recruited into the PDL (Rody et al. 2001).

OCs in OTM have been shown to be recruited from the bone marrow (Rody et al. 2001).

Bone marrow precursor cells mature into preosteoclasts; fusion of preosteoclasts creates polykaryon cells that subsequently become activated and form multinucleated OCs capable of resorbing bone (Boyle et al. 2003). Macrophage Colony-Stimulating Factor

(M-CSF) is known to induce OC differentiation by recruiting OC precursors and promoting expression of cell surface receptors important for cell fusion (Cappellen et al.

2002; Boyle et al. 2003). M-CSF binds to cell surface receptor c-Fms present on cells of

the monocytic lineage to activate proteins such as macrophage marker F4/80 (Hirsch et

44 al. 1981; Lean et al. 2000; Boyle et al. 2003; Blair et al. 2005), Vascular Endothelial

Growth Factor (VEGF), and Receptor Activator of Nuclear factor kappa B (RANK)

(Cappallen et al. 2002; Okazaki et al. 2005; Curry et al. 2008). RANK in turn binds to its ligand (RANKL) present on osteoblasts, fibroblasts, and T-cells, inducing preosteoclastic cell fusion to produce polykaryon cells that ultimately become mature OCs (Boyle et al.

2003; Teitelbaum and Ross 2003; UdaGawa 2003).

In attempts to accelerate the rate of OTM, various groups have experimented with pharmacological agents such as RANKL (Kanzaki et al. 2006), vitamin D3 (Collins and

Sinclair 1988), and osteocalcin (Hashimoto et al. 2001). Although many of these treatments resulted in increased OTM, the necessity for frequent administration to prevent total clearance of the drugs from the tissues makes it impractical and unfeasible in a clinical setting. In this current study, we were particularly interested in the role of the OCs during OTM and tested the exogenous application of an OC differentiation factor, M-CSF, on tooth movement and gene expression changes in the PDL of the orthodontically moved tooth.

3.2 Materials & Methods

3.2.1 Animal Models

All work performed on the animals and experimental design in this study was approved by the Animal Ethics Committee of the University of Toronto.

For orthodontic appliance insertion in both parts of the study, each animal was given an intraperitoneal injection of ketamine and xylazine and 12 grams of orthodontic force

(measured using an Instron machine) was applied in the mesial direction using an open

45 0.008 x 0.022 inch red Elgiloy coiled spring (Rocky Mountain Orthodontics, USA) placed between the maxillary incisors and the right first maxillary molar by using light- cured resin on the buccal surface of the right first maxillary molar and the labial surface of the upper incisors (Figure 3.1). The contralateral (left) side of the mouth served as the control. Impressions of the maxillary molars were taken prior to application insertion and after euthanization using Blu-Mousse Impression Material (Parkell Inc., USA). Each group of animals was euthanized after the allotted time of force duration was completed.

For the first part of the study, twenty male 10-week old CD-I mice were divided randomly into 5 test groups (n=4) of 3 hours, 1, 2, 4 and 6 day(s) of force duration, whereupon the maxillae was dissected, formalin fixed, decalcified for 10 weeks (17%

EDTA), and sectioned horizontally for use in histological procedures.

For the second part of our study, forty-eight male 10-week old CD-I mice were divided randomly into 4 test groups (n=12). The animals were grouped according to the following treatment: 1. exogenous delivery of M-CSF or PBS, 2. force application/none, 3. duration of force. The four test groups were: Group [PBS+F] - Phosphate buffered saline (PBS) injection with orthodontic force (F); Group [MH], where MH denotes 1 ug/kg of M-CSF injection with no force applied; Group [ML+F], where ML denotes 0.1 ug/kg of M-CSF, with force; and, Group [MH+F] denotes 1 ug/kg of M-CSF with force. Each test group of animals was divided into two subgroups (n=6) according to a 2 or 6 day duration of orthodontic force. Each animal received a palatal sub-periosteum injection of either recombinant mouse M-CSF (Calbiochem, Gibbstown, NJ, USA) or PBS into the PDL adjacent to the furcation of the right maxillary first molar. The animals were euthanized after the allotted time of force duration, and the maxillary molars from each animal were

46 extracted and the PDL was scraped from the tooth roots, frozen at -80 C until RNA extraction. Additionally, 5 mice were injected with 10 ug/kg, 1 |ig/kg, 0.1 iig/kg, and

0.01 Hg/kg of M-CSF and euthanized after 6 days to assess bone density changes in the skeleton and skull by micro-computed tomography (|iCT).

47 »

•

Figure 3.1 Orthodontic appliance insertion in mice 3.2.2 Immunohistochemistry and TRAP Staining

Immunohistochemistry was performed as described previously (Gong 2001) with antibodies against F4/80 (59171, 1:500, Santa Cruz Biotech) and c-Fms antibody (61137,

1:200, Abeam) and counterstained with neutral red. TRAP staining was performed as described previously (van de Wijngaert and Burger 1986) and counterstained with hematoxylin and eosin.

3.2.3. Real-time RT-PCR

Total RNA was extracted using a Micro-RNeasy kit (Fibrous Tissues Protocol, Qiagen).

Reverse transcription and quantitative PCR were performed in a one-step methodology

(Qiagen QuantiTect SYBR Green RT-PCR Kit, Qiagen, Burlington, Ontario, CA) in a iQ5 Multi Color Real-Time PCR Detection System (BioRad, Burlington, Ontario,

Canada). Duplicates/sample were performed using the following gene-specific primers:

TRAP 5'cgtctctgcacagattgcat3' (sense); 5'aagcgcaaacggtagtaagg3' (antisense), RANK

5'tgcctacagcatgggcttt3' (sense); 5'agagatgaacgtggagttactgttt3' (antisense), VEGF

5'aacgatgaagccctggagt3' (sense); 5'aggtttgatccgcatgatct3' (antisense), GAPDH

5'tgtccgtcgtggatctgac3' (sense); 5'cctgcttcaccaccttcttg3' (antisense). Melt curves were performed for each primer set using untreated mouse PDL RNA and standard curves generated to ensure primer specificity and efficiency. Thermocycling conditions were:

50°C for 3 min, 95°C for 5 min, followed by 40 cycles of amplification at 95°C for 15 sec alternating with 60°C for 30 seconds.

49 3.2.4 Data Analysis

3.2.4.1 Tooth Movement Quantification

Quantification of tooth movement was performed with the use of an electronic caliper on impressions of the maxillary molars. The distance from the mesial-buccal cusp tip of the first molar and disto-buccal cusp tip of the second molar was measured. Total tooth movement was obtained by subtracting the intermolar distance prior to appliance insertion from those obtained after euthanization. Statistical differences were determined using a two-way ANOVA followed by a Bonferroni post-hoc test (p < 0.05).

3.2.4.2 Quantification ofc-Fms, F4/80 and TRAP-positive cells

A area of interest (AOI) encompassing populations of the OCs and their precursors in the mesial PDL of the disto-palatal root of the maxillary first molars was determined.

Positive and negative cells within, and on the borders of each AOI were counted and expressed as a percentage of total cells in the AOI. TRAP positive cells were divided into mono/bi and multinucleate groups. All percentages of experimental groups were normalized to the control/contralateral tooth within the same mouse. Counts were done twice and expressed as means ± standard deviation. Statistical differences were evaluated using a multivariate ANOVA test followed by a Bonferroni post-hoc test (p < 0.05).

3.2.4.3 Gene Expression Analysis

The relative difference in expression of genes of interest was determined with the use of

threshold cycle, CT. Expression of glyceraldehyde-3-phosphate dehydrogenase (Gapdh) was determined as an internal standard for normalization. Expression levels with

significant differences between controls and duration of treatment were determined with

a two-way ANOVA followed by a Bonferroni post-hoc test (p < 0.05).

50 3.3 Results

3.3.1 Tooth Movement and c-Fms, F4/80, and TRAP-positive cells during OTM

We focused on the four different phases of OTM (Pilon et al. 1996) in our mouse model: initial tipping phase (3 and 24 hours), the lag phase (2 days), and acceleration and linear phases (4 and 6 days). After confirming that these phases of tooth movement were present in our mouse OTM model (see results below), we characterized the population of

OCs and their precursors in the PDL of molars in our OTM mouse model. To detect each specific osteoclastic cell type, we used c-Fms as a marker of bone marrow precursor cells, F4/80 for preosteoclasts, and TRAP for OCs in the compression site of the PDL of orthodontically moved teeth. C-Fms-positive cells were observed in the PDL after 3 hours of force (Figure 3.2B), showing an increase of 8.49% when compared to teeth in the contralateral control side of the same animal, where no force was applied (compare

Figure 3.2B with 3.2A). However, after 1 day of force, the percentage of c-Fms-positive cells decreased to control side levels (Figure 3.2C), followed by another increase at day 2 to 14.33%, after which the number remained fairly constant (Figure 3.3A).

Cells expressing the F4/80 antigen (arrows, Figure 3.2D-F) were only found in the mesial side of the PDL after 2 days of orthodontic treatment (Figure 3.2F), showing an increase of 17.10% compared to the control (Figure 3.2D). After 2 days no more F4/80-positive cells were found in the PDL (Figure 3.3B).

TRAP-positive cells were present in the mesial side of the PDL of orthodontically moved teeth after 4 days (arrows, Figure 3.2H) and 6 days (arrows, Figure 3.21) of orthodontic force. Both mono/bi-nucleated and multinucleated were present in the PDL after 4 days

(Figure 3.2G). After 6 days of force application, the number of mono/bi-nucleated-

51 positive cells in the PDL on the compression side decreased while the percentage of multinucleated TRAP-positive cells increased (Figure 3.3C).

3.3.2 Tooth Movement and Gene Expression with M-CSF Administration

Our results so far showed that there was an increase of F4/80-positive cells i.e. the preosteoclasts during the beginning of the lag phase of OTM. We reasoned that if the differentiation of this preosteoclastic populations of cells in the PDL during OTM could be accelerated before this phase e.g. by exogenous administration of an OC differentiation factor such as M-CSF, the rate of OTM could be accelerated. We subsequently characterized whether exogenous application of M-CSF to the PDL of orthodontically moved teeth would lead to an increase in the rate of tooth movement by targeting the recruitment and differentiation of preosteoclasts. We first tested a range of dosages of M-CSF (ranging from 0.01 to 10 |ig/kg) to determine whether M-CSF injection into the PDL of the upper first molar would result in a systemic effect and found that these animals did not exhibit any changes in bone density after 6 days, as evidenced by p.CT scans performed on the axial and appendicular skeleton and skull (Table 3.1).

We then chose two different doses of M-CSF into the PDL of molars subject to orthodontic force based on similar amounts of other growth factors used in other OTM models (Kaku et al. 2001): dose 1 (0.1 ug/kg) and dose 2 (1 ug/kg). Comparisons were made between groups that received PBS versus M-CSF to determine the effect of M-CSF administered in the PDL on the mesial side of teeth either with or without force. After 2 days of orthodontic force those groups that had appliances all experienced around 68 urn of movement whereas group [MH] had negligible tooth movement at both 2 and 6 days

52 (Figure 3.4A). After 6 days, group [ML+F] had the most tooth movement (220 ± 18 u,m), whereas the movement in groups [MH+F] and [PBS+F] were not significantly different from each other (200 ± 14 |im, and 193 ± 6 (im, respectively) (Table 3.2).

Next, we wanted to investigate whether the change in OTM as a result of M-CSF administration could be correlated with a change in recruitment and differentiation of preosteoclasts in the PDL. We analyzed the relative expression of M-CSF-downstream genes VEGF and RANK, as well as TRAP, a marker of OCs, at 2 and 6 days of OTM by real-time quantitative RT-PCR. There were significant changes in gene expression in the

[PBS+F] group when compared to its control side, where all three genes increased over the duration of the experiment (Figure 3.4B-D). Regardless of force or no force, administration of M-CSF at low or high doses resulted in an elevation of VEGF expression levels in the PDL after 2 and 6 days (Fig 3.4B). VEGF expression levels increased over time in the two control groups [PBS+F] and [MH] as well as group

[ML+F], with the highest increase present in group [ML+F] (see Figure 3.4B). In group

[MH+F], VEGF expression level was slightly higher than that of group [PBS+F]. Similar trends were noted in the expression of RANK in each of the four groups (Figure 3.4C), with one significant difference: RANK expression levels in group [MH+F] was lower than group [PBS+F] after 6 days. TRAP expression in groups [MH] and [MH+F] was not

significantly different from [PBS+F], but was observed to be much higher after 2 and 6

days in group [ML+F] (Figure 3.4D). In summary, the greatest increase in expression

levels of all genes was observed in the PDL of teeth subject to orthodontic force and

injected with the lower dose of M-CSF, the group that also had the most tooth movement.

53 :" VP- u * i * * ,A. ,- J. a ' 4 "* '"* «,-- 4 •-•,.' ^ t A " '• * 4 - J* ".*?,, 3 * -^ • V F * **

* *** * • m -„t t. y t'f ** "**•»» * '-* ,/**- r\ * *** ^ ^* * v'* .!;'# *s* - ' 'A- AB *»f - A) Central „ B)~ 3 hours '-' "Z: _ _J3 C) •'* lday " --.7 -V: !> 1. . ' '.' '. t "#• 11 : v '•• .- »' • , s***'- - '•* JU F * »*•* * • - » '„, ° 4 A > * -• **. »• / ** '

t 8 !•..* f' s ,,« i'^y* i 0 #* I H• E Control jj£ ) 1 day ... .. ||fc„ -. 2 days Mi »i "•:'", iT'W- .. p^isr-T ... A» '*''".'-i o' >, H B 1 1/ >• T * ' 0- * R '-' * A A p

G) Control m 4 days il) 6 days sojun

Figure 3.2 Expression of OC differentiation markers in the mesial PDL surrounding the disto-palatal root of the maxillary first molar during OTM. A-C) Stained for c-Fms-positive cells (arrows), A) Control, B) 3 hours of force, C) -1^ 1 day of force. D-F) F4/80-positive cells (arrowheads) after D) Control. E) 1 day, F) 2 days of force. G-I) TRAP positive cells (red) after G) Control, H) 4 days, and I) 6 days of force. D = dentin, AB = alveolar bone. 6iS - -Km;. MHO 25 • tfl 1 20 >0) 12 > S 15 • * 1 01 g. B O *ar 10 "S 6 0 S^ -r T 5 T 0- . M -L 20 .10 00 80 100 120 MO 160 20 40 60 60 10 1-10 100 Time (hours) Time (hours)

FRAP 4 monc'bf nucleated o multinucleated

60 80 100 60 SO 100 Time (hours) Time (hours)

Figure 3.3 Percentage of positively stained cells over time during orthodontic treatment A) c-Fms-positive cells, B) F4/80-positive cells, and C) TRAP-positive cells. * denotes p < 0.05 when compared with the previous time point. D) Trends of positive cells during orthodontic treatment (curves fit to original data)

55 03 YH(ih

3 maw D 2 days = 0.2 rh CD i-t-l mm B 6 days E r^i g Q.15 a ys b o 1 - ra o S 0.05 Relativ e gen expressio n flri A [PBS+F] [MH] [ML+F] [MH+F] B [PBS+F] [MH] [M.+F] [MH+F]

40 -, •I5i

•f - 35 - RANK 1 RAP 1 Sa­ •2 30- ul tfi C/) HI D 2 days •m a 2 days aj 0) 3- w 25- Q. X X •} * (!) ^0 - C 2 GJ S " O) 15 - 0) »15 1 1 °- « 1 - * 5- 05 - 0 -- J ri 0 • C i D [PBS+F] [MH] [PBS+F] [MH] ML+F] [MH+F] L[ML+F] [MH+F] Figure 3.4 Tooth movement and PDL gene expression in OTM and M-CSF treated mice. A) Movement of the right first maxillary molar after 6 days of treatment, * denotes p < 0.05 compared to OTM & PBS group. B-D) Relative gene expression by the cells of the PDL after 2 and 6 days of force, B) VEGF expression, C) RANK expression, and D) TRAP expression. Melt curves were performed for each primer set using untreated mouse PDL RNA and standard curves generated to ensure primer specificity and efficiency. *denotes p < 0.05 when compared to that of the OTM & PBS group.

56 Treatment Skeleton bone density Skull bone density lOuLPBS 0.0624 0.1143 10 iig/kg M-CSF 0.0687 0.1162 1 ug/kg M-CSF 0.0648 0.1122 0.1 ug/kg M-CSF 0.0622 0.1114 0.01 ug/kg M-CSF 0.0650 0.1110

Table 3.1 Bone densities of animals treated with M-CSF

Treatment Molar displacement ± standard deviation (um) 2 days of treatment 6 days of treatment PBS + Force 72 ± 8.4 193 ±5.7 M-CSF High + No Force 0±2.0 0± 1.0 M-CSF Low + Force 64 ±8.9 220 ±18.3 M-CSF High + Force 68 ±8.4 200 ± 14.1

Table 3.2 Tooth Movement with M-CSF and orthodontic treatments

57 3.4 Discussion

Unlike many other studies involving application of exogenous agents to alter rates of tooth movement, our study is one of few to first seek to understand and characterize the basic cellular and molecular events of a specific cell type of interest at a distinct phase of

OTM. The sensitivity and consistency of the available methodologies in our hands have allowed us to make significant conclusions about the activities of an important population of cells during OTM, the OCs, thus forming a framework for a therapeutic means to accelerate tooth movement in animals and humans.

3.4.1 OTM Model and c-Fms, F4/80, and TRAP-positive Cell Distribution

We observed the well-described phases (lag and acceleration/linear) of OTM in our mouse model of OTM, replicating work performed by others (Rygh 1974; Pilon et al.

1996). Specifically, we confirmed the presence of the lag phase by day 2, a phase of interest to our subsequent study. The distinct temporal pattern of the different OC markers in the mesial (compressive) side of the PDL of teeth subject to orthodontic forces

(summarized in Figure 3.3D) can be directly correlated with possible cellular events during OTM. The finding of c-Fms-positive cells as early as 3 hours after orthodontic treatment showed that cells of the monocytic lineage had entered the PDL by that time.

This early entry into the PDL after force application is most likely an aseptic wounding response due to compressive forces in the mesial PDL, leading to cell death and the release of chemical signals involved in the inflammatory process (Lilja et al. 1983;

Vandevska-Radunovic et al. 1997). Another spike in the number of c-Fms-positive cells

occurred at 2 days of force application, coinciding with the presence of F4/80-positive

58 cells. As preosteoclasts are also c-Fms-positive (Ross 2006), it suggests that preosteoclastic cells are recruited to the PDL within 2 days of force application. The lack of c-Fms-positive cells just prior to the presence of F4/80-positive cells suggests that monocytes (c-Fms-positive cells) undergo differentiation into preosteoclasts (F4/80- positive) before being recruited to the PDL, a theory that has also been proposed by another group (Xie et al. 2008). TRAP-positive OCs were observed after 4 days of force; however, the number of mono/bi-nucleated cells decreased after 6 days whereas the number of multinucleated TRAP-positive cells increased. The increase in multinucleated

OC is in agreement with the general observation that these cells are necessary for bone resorption, thus allow teeth to move through bone as observed in the /inear and acceleration phases during OTM.

3.4.2 Gene Expression with M-CSF Treatment and Tooth Movement

Although many groups have attempted to accelerate tooth movement pharmacologically, no studies so far have addressed the molecular changes in the PDL consequent to the administration of the exogenous substances. We used a state-of-the-art quantitative gene expression level assay, real time RT-PCR, to verify the changes of gene expression levels in the PDL of teeth subsequent to different treatments. One main challenge in using this technique lies in the ability to obtain enough RNA from the PDL for the subsequent gene analysis. We therefore were careful to perform standard curves of each primer set to ensure efficiency of primers and integrity of RNA. Our results indicate that we were successful in reproducing data shown by others with immunohistochemistry and TRAP staining e.g. increases of VEGF, RANK, and TRAP in the PDL during OTM (Kitaura et

59 al. 2008; Xie et al. 2008). We were additionally able to quantify changes of expression levels between treatment groups, an analysis that has not been performed in other studies.

Evidence for the success of the technique can be shown in [PBS+F], where all three genes were upregulated when compared to its control. Additionally, in group [MH], where the teeth were not subject to any force, the administration of M-CSF alone created an increase in the expression of VEGF and RANK. We can therefore conclude that M-

CSF application in the PDL during OTM have an effect at the molecular level on the

PDL cells, despite compression of the PDL and clearance of the substance from the tissues.

We found variation in gene response between the groups that received two different doses of M-CSF. The lower dose of M-CSF produced a higher expression of all three genes, most significantly in TRAP expression. These results correlate strongly with other studies on the effects of M-CSF on OCs, where a biphasic response on OCs has been noted (Hattersley et al. 1988; Hattersley and Chambers 1990). High levels of M-CSF can have inhibitory effects on OC differentiation and impede mature OC bone resorption, explaining why the higher dose of M-CSF led to lower VEGF expression than the lower dose in our study (Corboz et al. 1992). Comparison of the expression levels of RANK in group [MH+F] versus groups [PBS+F] and [MH] showed lower expression in the

[MH+F] after 6 days of force, indicating that RANK expression by mature OCs is being inhibited, confirming the inhibition of OC formation and function seen with high doses of

M-CSF. This is further confirmed by the much lower TRAP expression level in [ML+F].

While not appearing to inhibit OC formation and function, when compared to the PBS group, the high dose administration did aid tooth movement. As our results indicated that

60 the group with the lower dose of M-CSF and orthodontic force led to the greatest change in gene expression, in retrospect, it would have been useful to see the effects of the low dose of M-CSF without force. We suspect that a lower dose of M-CS would result in gene expression change values that would likely be similar to that of group [PBS+F], where OCs are not inhibited.

Exogenous application of other agents in the PDL of mice did result in increases in tooth movement (Collins and Sinclair 1988; Hashimoto et al. 2001; Kanzaki et al. 2006). For example, injections of vitamin D and RANKL every 3 days produced an increase of 20-

25% tooth movement after 7 days (Collins and Sinclair 1988; Kanzaki et al. 2006) and of osteocalcin daily for 6 days showed an increase of 53% in tooth movement (Hashimoto et al. 2001). By comparison, we achieved an increase of 14% by day 6 with only one injection of M-CSF. We believe the one time injection per course of study compared to more frequent applications (e.g. daily) offers a much better alternative in a clinical setting. Conceivably, M-CSF can be given at appliance activation and reactivation without increasing the number of visits to the orthodontic office, therefore decreasing treatment duration without excessive discomfort to the patient. Further studies will be conducted to determine the long term effect of multiple M-CSF administration that coincide with reactivations of orthodontic appliances.

61 CHAPTER 4. CONCLUSIONS

The overall goals of our study were to initially characterize the cellular and molecular basis of two important populations of cells, the osteoblasts and osteoclasts, in the periodontal ligament of teeth undergoing orthodontic tooth movement. We found osteoclast precursor cell recruitment in the periodontal ligament after only 3 hours of orthodontic force. Additionally, we found a region of decreased cell proliferation in the periodontal ligament at the midpoint of the tooth root, a region believed to represent the center of rotation, hence providing a molecular means of visualizing mechanical loading patterns in the periodontal ligament of teeth undergoing force. We also found that preosteoclasts, and not monocytes, were recruited to the periodontal ligament after 2

days, and mature osteoclasts were present by day 4 after force application. We next used

the information obtained from the cellular and molecular analyses of osteoclast

recruitment and differentiation to help design a strategy to increase the rate of orthodontic

tooth movement. We targeted the process of recruiting and differentiating preosteoclasts

in the periodontal ligament during orthodontic tooth movement by the exogenous

administration of two different doses of recombinant mouse M-CSF in the periodontal

ligament of orthodontically moved teeth. We showed an increase in tooth movement with

the lower dose of M-CSF and an up-regulation of the expression of genes downstream of

M-CSF. Overall, our results have shown that with increased knowledge of the events that

are occurring during orthodontic tooth movement, these processes can be manipulated to

accelerate tooth movement.

62 CHAPTER 5. FUTURE WORK

Our study, on the whole, produced a clearer picture of the activities of two specific cell types in the periodontal ligament of teeth undergoing OTM. However, certain aspects of the cellular and molecular reactions in the PDL of teeth subject to orthodontic force remain unclear. The recruitment process of the preosteoclasts into the periodontal ligament from the bone marrow is yet to be clearly defined. However, the aseptic wounding response that has been documented during this time makes these biological processes difficult to isolate and hence to study. In vitro models of periodontal ligament cells (fibroblasts, osteoblasts, and/or mesenchymal cells) undergoing tension and compression forces could be used. The inclusion of a source of bone marrow in these in vitro model systems could elucidate the process of bone marrow cell

(monocytes/preosteoclasts) recruitment in response to force application.

Several issues have to be addressed before exogenous application of M-CSF can be performed in a clinical setting. Although M-CSF promotes recruitment, proliferation, and differentiation of OC precursor cells it may lead to osteoporosis by increasing OC precursor proliferation, resulting in a higher number of active OCs levels, an area that has yet to be studied in detail. Also, M-CSF is considered to be a growth hormone, due to its ability to promote cell proliferation, and with larger doses can result in tissue masses. To ensure that osteoporosis and growths do not occur further analyses of the long-term effect of M-CSF need to be performed in animal models. Longitudinal studies will have to be conducted in animal models, where upon appliance insertion and reactivation M-CSF doses are given, with the total tooth movement, bone density, and body weight monitored over the course of several months, to ensure that long-term effects will not occur. As well

63 a group that receives the low dose of M-CSF only, without orthodontic force would be important to determine if there is more than just an additive effect in gene expression and tooth movement when using orthodontic force and M-CSF combined. It would also be important to attempt treating more than just one tooth at a time with M-CSF. The maxillary and mandibular first molars could both be treated at the same time to ensure that too much M-CSF in the system, as a result of several different doses does not have any systemic effects.

Once these results have been obtained a human trial would be the next logical step in introducing this method of accelerating tooth movement clinically.

64 CHAPTER 6. REFERENCES

Abu-Amer, Y., F. P. Ross, P. Schlesinger, M. M. Tondravi and S. L. Teitelbaum (1997).

Substrate recognition by osteoclast precursors induces s-crc/microtubule

association. J Cell Biol 137: 247-258.

Albelda, S. M. and C. A. Buck (1990). Integrins and other cell adhesion molecules.

FASEB J 4: 2868-2880.

An, K.-N., Y.-L. Sun and L. Z-P. (2004). Flexibility of type I collagen and mechanical

property of connective tissue. Biorheology 41(3-4): 239-246.

Aubin, J. E. (1998). Bone stem cells. J Cell Biochem 72(S30-31): 73-82.

Ballard, J. B. and W. T. Butler (1974). Proteins of the periodontium. Biochemical studies

on the collagen and noncollagenous proteins of human gingivae. J Oral Pathol

Med 3(4): 176-184.

Baud, V., S. L. Chissoe, E. Viegas-Pequignot, S. Diriong, N'Guyen. V.C., B. A. Roe and

M. Lipinski (1995). EMR1, an unusual member in the family of hormone

receptors with seven transmembrane segments. Genomics 26: 334-344.

Baumert, U., I. Golan, B. Becker, B. P. Hrala, M. Redlich, H. A. Roos, A. Palmon, E.

Reichenberg and D. Miissig (2004). Pressure simulation of orthodontic force in

osteoblasts: a pilot study. Orthodont Craniofac Res 7(1): 3-9.

Baumrind, S. (1969). A reconsideration of the property of the pressure tension

hypothesis. Am J Orthod 55: 12-22.

Baumrind, S. and D. Buck (1970). Rate changes in cell replication and protein synthesis

in PDL incident to tooth movement. Am J Orthod 51: 109-131.

65 Becker, J., D. Schuppan, J. P. Rabanus, R. Rauch, U. Niechoy and H. R. Gelderblom

(1991). Immunoelectron microscopic localization of collagens type I, V, VI and

of procollagen type III in human periodontal ligament and cementum. J

Histochem Cytochem 39(1): 103-110.

Beertsen, W., C. A. G. McCulloch and J. Sodek (1997). The periodontal ligament: a

unique, multifunctional connective tissue. Periodontal 2000 13: 20-40.

Birk, D. E. (2001). Type V collagen: heterotropic type I/V colagen interactions in the

regulation of fibril assembly. Micron 32(3): 223-327.

Blair, H. C, L. J. Robinson and M. Zaidi (2005). Osteoclast signalling pathways.

Biochem Bioph Res Co 328(3): 728.

Bletsa, A., E. Berggreen and P. Brudvik (2006). Interleukin-la and tumour necrosis

factor-a expression during the early phases of orthodontic tooth movement in rats.

EurJOralSci 114: 423-429.

Bodet, C, E. Andrian, S. Tanabe and D. Grenier (2007). Actinobacillus

actinomycetemcomitans lipopolysaccharide regulates matrix metalloproteinase,

tissue inhibitors of matrix metalloproteinase, and plasminogen activator

production by human gingival fibroblasts: A potential role in connective tissue

destruction. J Cell Physiol 212(1): 189-194.

Bosshardt, D. D. (2005). Are cementoblasts a subpopulation of osteoblasts or a unique

phenotype? J Dent Res 84(5): 390-406.

Bosshardt, D. D. and H. E. Schroeder (1996). Cementogenesis reviewed: A comparison

between human premolars and rodent molars. AnatRec 245(2): 267-292.

66 Bosshardt, D. D. and K. A. Selvig (1997). Dental cementum: the dynamic tissue covering

of the root. Periodontal 2000 13(1): 41-75.

Boyle, W. J., W. S. Simonet and D. L. Lacey (2003). Osteoclast differentiation and

activation. Nature 423(6937): 337-342.

Brudvik, P. and P. Rygh (1993). The initial phase of orthodontic tooth root resorption

incident to local compression of the periodontal ligament. Eur J Orthod 15(4):

249-263.

Butler, W. T., H. Birkedal-Hansen, W. F. Beegle, R. E. Taylor and E. Chung (1975).

Proteins of the periodontium. Identification of collagens with the

[alphal(I)]2alpha2 and [alpha 1(III)]3 structures in bovine periodontal ligament. J

Biol Chem 250(23): 8907-8912.

Cantarella, G., R. Cantarella, M. Caltabiano, N. Risuglia, R. Bernardini and R. Leonardi

(2006). Levels of matrix metalloproteinases 1 and 2 in human gingival crevicular

fluid during initial tooth movement. Am J Orthod Dentofac Orthop 130(5):

568.ell-568.el6.

Cappallen, D., N.-H. Luong-Nguyen, S. Bongiovanni, O. Grenet, C. Wanke and M. Susa

(2002). Transcriptional program of mouse osteoclast differentiation governed by

the macrophage colony-stimulating factor and the ligand for the receptor activator

of NFKB. J Biol Chem 277: 21971-21982.

Cappellen, D., N.-H. Luong-Nguyen, S. Bongiovanni, O. Grenet, C. Wanke and M. Susa

(2002). Transcriptional program of mouse osteoclast differentiation governed by

the macrophage colony-stimulating factor and the ligand for the receptor activator

of NFKB. J Biol Chem 277: 21971-21982.

67 Carvalho, R. S., A. Bumann, C. Schwarzer, E. Scott and E. H. K. Yen (1996). A

molecular mechanism of integrin regulation from bone cells stimulated by

orthodontic forces. Eur J Orthod 18(1): 227-235.

Cattaneo, P. M., M. Dalstra and B. Melsen (2005). The finite element method: a tool to

study orthodontic tooth movement. J Dent Res 84(5): 428-433.

Chang, H. H., C. B. Wu, Y. J. Chen, C. Y. Weng, W. P. Wong, Y. J. Chen, B. E. Chang,

M. H. Chen and C. C. Yao (2008). MMP-3 response to compressive forces in

vitro and in vivo. J Dent Res 87(7): 692-696.

Chen, J. L., P. Hunt, M. McElvain, T. Black, S. Kaufman and E. S. H. Choi (1997).

Osteoblast precursor cells are found in CD34+ cells from human bone marrow.

Stem Cells 15(5): 368-377.

Cho, M.-I. and P. R. Garant (2000). Development and structure of the periodontium.

Periodontol 2000 24: 9-27.

Cochran, G. V., R. J. Pawluk and C. A. L. Bassett (1967). Stress generated electric

potentials in the mandible and teeth. Arch Oral Biol 12: 917-920.

Collins, M. K. and P. M. Sinclair (1988). The local use of vitamin D to increase the rate

of orthodontic tooth movement. Am J Orthod Dentofac Orthop 94: 278-284.

Corboz, V. A., M. G. Cecchini, R. Felix, H. Fleisch, G. van der Pluijm and C. W. Lowik

(1992). Effect of macrophage colony-stimulating factor on in vitro osteoclast

generation and bone resorption. Endocrinology 130(1): 437-442.

Curry, J. M., T. D. Eubank, R. D. Roberts, Y. Wang, N. Pore, A. Maity and C. B. Marsh

(2008). M-CSF signals through the MAPK/ERK pathway via Spl to induce

VEGF production and induces angiogenesis in vivo. PLoS ONE 3(10): e3405.

68 Dai, X.-M., G. R. Ryan, A. J. Hapel, M. G. Dominguez, R. G. Russell, S. Kapp, V.

Sylvestre and E. R. Stanley (2002). Targeted disruption of the mouse colony-

stimulating factor 1 receptor gene results in osteopetrosis, mononuclear phagocyte

deficiency, increased primitive progenitor cell frequencies, and reproductive

defects. Blood 99(1): 111-120.

Donahue, H. J., K. J. McLeod, C. T. Rubin, J. Anderson, E. A. Grine, H. L. Hertzberg

and P. R. Brink (1995). Cell-to-cell communication in osteoblastic networks: Cell

line-dependent hormonal regulation of gap junction function. J Bone Miner Res

10:881-889.

Ducy, P., T. Schinke and G. Karsenty (2000). The osteoblast: a sophisticated fibroblast

under central surveillance. Science 289(5484): 1501-1504.

Ducy, P., M. Starbuck, M. Priemel, J. Shen, G. Pinero, V. Geoffroy, M. Ampling and G.

Karsentry (1999). A Cbfa 1-dependent genetic pathway controls bone formation

beyond embryonic developmental. Genes Dev 13: 1025-1036.

Ducy, P., G. Zhang, V. Geoffroy, A. L. Ridall and G. Karsenty (1997). Osf2/Cbfal: a

transcriptional activator of osteoblast differentiation. Cell 89(5): 747-754.

Eubank, T. D., M. Galloway, C. M. Montague, W. J. Waldman and C. B. Marsh (2003).

M-CSF induces vascular endothelial growth factor production and angiogenic

activity from human monocytes. J Immunol 171: 2637-2643.

Evans, D. M. and S. H. Ralston (1996). Nitric oxide and bone. J Bone Miner Res 11(3):

300-305.

Farrar, J. N. (1876). An inquiry into physiological and pathological changes in animal

tissues in regulating teeth. Dent Cosmos 18: 13-24.

69 Felix, R., M. G. Cecchini and H. Fleisch (1990b). Macrophage colony stimulating factor

restores in vivo bone resorption in the op/op osteopetrotic mouse. Endocrinology

127(5): 2592-2594.

Felix, R., M. G. Cecchini, W. Hofstetter, P. R. Elford, A. Stutzer and H. Fleisch (1990a).

Impairment of macrophage colony-stimulating factor production and lack of

resident bone marrow macrophages in the osteopetrotic op/op mouse. J Bone

Miner Res 5: 781-789.

Franceschi, R. T. and G. Xiao (2003). Regulation of the osteoblast-specific transcription

factor, Runx2: Responsiveness to multiple signal transduction pathways. J Cell

Biochem 88(3): 446-454.

Fujihara, S., M. Yokozeki, Y. Oba, Y. Higashibata, S. Nomura and K. Moriyama (2006).

Function and regulation of osteopontin in response to mechanical stress. J Bone

Miner Res 21(6): 956-964.

Ganss, B., R. H. Kim and J. Sodek (1999). Bone sialoprotein. Crit Rev Oral Biol Med

10(1): 79-98.

Garlet, T. P., U. Coelho, C. E. Repeke, J. S. Silva, F. Q. Cunha and G. P. Garlet (2008).

Differential expression of osteoblast and osteoclast chemmoatractants in

compression and tension sides during orthodontic movement. Cytokine 42: 330-

335.

Garlet, T. P., U. Coelho, J. S. Silva and G. P. Garlet (2007). Cytokine expression pattern

in compression and tension sides of the periodontal ligament during orthodontic

tooth movement in humans. Eur J Oral Sci 115(5): 355-362.

70 Gelb, B. D., G. P. Shi, H. A. Chapman and R. J. Desnick (1996). Pycnodysostosis, a

lysosomal disease caused by cathepsin-K deficiency. Science 273: 1236-1238.

Genco, R. J. (1992). Host responses in periodontal diseases: Current concepts. J

Periodontal 63: 338-355.

Gluhak-Heinrich, J., D. Pavlin, W. Yang, M. MacDougall and S. E. Harris (2007). MEPE

expression in osteocytes during orthodontic tooth movement. Arch Oral Biol 52:

684-690.

Gluhak-Heinrich, J., L. Ye, L. F. Bonewald, J. Q. Feng, M. MacDougall, S. E. Harris and

D. Pavlin (2003). Mechanical Loading Stimulates Dentin Matrix Protein 1

(DMP1) Expression in Osteocytes In Vivo. J Bone Miner Res 18(5): 807-817.

Goldring, S. R. (2003). Inflammatory mediators as essential elements in bone

remodeling. Calcif Tissue Intl2>(2): 97-100.

Gong, S.-G. (2001). Characterizationof olfactory nerve abnormalities in Twirler mice.

Differentiation 69: 58-65.

Gori, F., L. C. Hofbauer, C. R. Dunstan, T. C. Spelsberg, S. Khosla and B. L. Riggs

(2000). The expression of osteoprotegerin and RANK ligand and the support of

osteoclast formation by stromal-osteoblast lineage cells is developmentally

regulated. Endocrinology 141(12): 4768-4776.

Gottlieb, B. (1946). Some orthodontic problems in histologic illumination. Am J Orthod

32: 1178-1181.

Grieve, W. G., G. K. Johnson, R. N. Moore, R. A. Reinhardt and L. M. DuBois (1994).

Prostaglandin E (PGE) and interleukin-1 beta (IL-1 beta) levels in the gingival

71 crevicular fluid during human orthodontic tooth movement. Am J Orthod

Dentofac Orthop 105: 369-74.

Grimm, F. M. (1972). Bone bending, a feature of orthodontic tooth movement. American

Journal of Orthodontics 62(4): 384-393.

Gurton, A. U., E. Akin, D. Sagdic and H. Olmez (2004). Effects of PGI2 and TxA2

analogs and inhibitors in orthodontic tooth movement. Angle Orthod 74(4): 526-

532.

Hashimoto, F., Y. Kobayashi, S. Mataki, K. Kobayashi, Y. Kato and H. Sakai (2001).

Administration of osteocalcin accelerates orthodontic tooth movement induced by

a closed coil spring in rats. Eur J Orthod 23(5): 535-545.

Hassan, M. Q., R. S. Tare, S. H. Lee, M. Mandeville, M. I. Morasso, A. Javed, A. J. van

Wijnen, J. L. Stein, G. S. Stein and J. B. Lian (2006). BMP2 commitment to the

osteogenic lineage involves activation of Runx2 by DLX3 and a homeodomain

transcriptional network. J Biol Chem 281(52): 40515-40526.

Hattersley, G. and T. J. Chambers (1990). Effects of interleukin 3 and of granulocyte-

macrophage and macrophage colony stimulating factors on osteoclast

differentiation from mouse hemopoietic tissue. J Cell Physiol 142: 201-209.

Hattersley, G., E. Dorey, M. A. Horton and T. J. Chambers (1988). Human macrophage

colony-stimulating factor inhibits bone resorption by osteoclasts disaggregated

from rat bone. J Cell Physiol 137: 199-203.

Hattersley, G., J. Owens, A. M. Flanagan and T. J. Chambers (1991). Macrophage colony

stimulating factor (M-CSF) is essential for osteoclast formation in vitro. Biochem

BiophResCo 177: 526-531.

72 Hayashi, K., J. Uechi, S.-P. Lee and I. Mizoguchi (2007). Three-dimensional analysis of

orthodontic tooth movement based on XYZ and finite helical axis systems. Eur J

Orthod 29(6): 589-595.

Hirsch, S., J. M. Austen and S. Gordon (1981). Expression of the macrophage-specific

antigen F4/80 during differentiation of mouse bone marrow cells in culture. J Exp

Med 154: 713-725.

Hodge, J. M., M. A. Kirkland, C. J. Aitken, C. M. Waugh, D. E. Myers, C. M. Lopez, B.

E. Adams and G. C. Nicholson (2004). Osteoclastic Potential of Human CFU-

GM: Biphasic Effect of GM-CSF. J Bone Miner Res 19(2): 190-199.

Hodge, J. M., M. A. Kirkland and G. C. Nicholson (2007). Multiple roles of M-CSF in

human osteoclastogenesis. J Cell Biochem 102(3): 759-768.

Horwood, N. J., J. Elliott, T. J. Martin and M. T. Gillespie (1998). Osteotropic agents

regulate the expression of osteoclast differentiation factor and osteoprotegerin in

osteoblastic stromal cells. Endocrinology 139(11): 4743-4746.

Hosoyama, M. (1989). Changes in the microvascular pattern of the periodontium in an

experimental tooth movement. Orthod Waves 48: 425-442.

Hotokezaka, H., E. Sakai, N. Ohara, Y. Hotokezaka, C. Gonzales, K.-I. Matsuo, Y.

Fujimura, N. Yoshida and K. Nakayama (2007). Molecular analysis of RANKL-

independent cell fusion of osteoclast-like cells induced by TNF-alpha,

lipopolysaccharide, or peptidoglycan. J Cell Biochem 101(1): 122-134.

Hunter, G. K. and H. A. Goldberg (1994). Modulation of crystal formation by bone

phosphoproteins: role of glutamic acid-rich sequences in the nucleation of

hydroxyapatite by bone sialoprotein. Biochem J 302: 175-179.

73 Ikeda, T., M. Kasai, M. Utsuyama and K. Hirokawa (2001). Determination of three

isoforms of the receptor activator of nuclear factor-K B ligand and their

differential expression in bone and thymus. Endocrinology 142(4): 1419-1426.

Insogna, K. L., M. Sahni, A. B. Grey, S. Tanaka, W. C. Home, L. Neff, M. Mitnick, J. B.

Levy and R. Baron (1997). Colony-stimulating factor-1 induces cytoskeletal

reorganization and c-src-dependent tyrosine phosphorylation of selected cellular

proteins in rodent osteoclasts. J Clin Invest 100(10): 2476-2485.

Jager, A., R. J. Radlanski and W. Gotz (1993). Demonstration of cells of the

mononuclear phagocyte lineage in the periodontium following experimental tooth

movement in the rat. An immunohistochemical study using monoclonal

antibodies EDI and ED2 on paraffin-embedded tissues. Histochem 100: 161-166.

Kaku, M., S. Kohno, T. Kawata, I. Fujita, C. Tokimasa, K. Tsutsui and K. Tanne (2001).

Effects of vascular endothelial growth factor on osteoclast induction during tooth

movement in mice. J Dent Res 80(10): 1880-1883.

Kanzaki, H., M. Chiba, K. Arai, I. Takahashi, N. Haruyama, M. Nishimura and H. Mitani

(2006). Local RANKL gene transfer to the periodontal tissue accelerates

orthodontic tooth movement. Gene Ther 13(8): 678-685.

Kanzaki, H., M. Chiba, Y. Shimizu and H. Mitani (2002). Periodontal ligament cells

under mechanical stress induce osteoclastogenesis by receptor activator of nuclear

factor kappaB ligand up-regulation via prostaglandin E2 synthesis. J Bone Miner

Res 17(2): 210-220.

74 Kanzaki, H., M. Chiba, I. Takahashi, N. Haruyama, M. Nishimura and H. Mitani (2004).

Local OPG gene transfer to the periodontal tissue inhibits orthodontic tooth

movement. J Dent Res 83(12): 920-925.

Karimbux, N. Y. and I. Nishimura (1995). Temporal and Spatial Expressions of Type XII

Collagen in the Remodeling Periodontal Ligament during Experimental Tooth

Movement. J Dent Res 74(1): 313-318.

Kato, Y. P., D. L. Christiansen, R. A. Hahn, S.-J. Shieh, J. D. Goldstein and F. H. Silver

(1989). Mechanical properties of collagen fibres: a comparison of reconstituted

and rat tail tendon fibres. Biomaterials 10(1): 38-42.

Kawarizadeh, A., C. Bourauel, W. Gotz and A. Jager (2005). Early responses of

periodontal ligament cells to mechnical stimulus in vivo. J Dent Res 84(10): 902-

906.

Keles, A., B. Grunes, C. DiFuria, E. Gagari, V. Srinivasan, M. A. Darendeliler, R.

Muller, R. Kent and P. Stashenko (2007). Inhibition of tooth movement by

osteoprotegerin vs. pamidronate under conditions of constant orthodontic force.

Eur J Oral Sci 115(2): 131-136.

Kern, B., J. Shen, M. Starbuck and G. Karsenty (2001). Cbfal contributes to the

osteoblast-specific expression of type I collagen genes. J Biol Chem 276(10):

7101-7107.

Kerrigan, J. J., J. P. Mansell and J. R. Sandy (2000). Matrix Turnover. J Orthod 27(3):

227-233.

75 Kim, T., A. Handa, J. Iida and S. Yoshida (2007). RANKL expression in rat periodontal

ligament subjected to a continuous orthodontic force. Arch Oral Biol 52(3): 244-

250.

Kitaura, H., M. Yoshimatsu, Y. Fujimura, T. Eguchi, H. Kohara, A. Yamaguchi and N.

Yoshida (2008). An anti-c-Fms antibody inhibits orthodontic tooth movement. J

Dent Res 87'(4): 396-400.

Klein-Nulend, J., A. van der Plas, C. M. Semeins, N. E. Ajubi, J. A. Frangos, P. J.

Nijweide and E. H. Burger (1995). Sensitivity of osteocytes to biomechanical

stress in vitro. Faseb J 9(5): 441-445.

Kodama, H., A. Yamasaki, M. Nose, S. Niida, Y. Ohgame, M. Abe, M. Kumegawa and

T. Suda (1991). Congenital osteoclast deficiency in osteopetrotic (op/op) mice is

cured by injections of macrophage colony-stimulating factor. J Exp Med 173(1):

269-272.

Komori, T., H. Yagi, S. Nomura, A. Yamaguchi, K. Sasaki, K. Deguchi, Y. Shimizu, R.

T. Bronson, Y.-H. Gao, M. Inada, M. Sato, R. Okamoto, Y. Kitamura, S. Yoshiki

and T. Kishimoto (1997). Targeted disruption of Cbfal results in a complete lack

of bone formation owing to maturational arrest of osteoblasts. Cell 89(5): 755-

764.

Krishnan, V. and Z. Davidovitch (2006). Cellular, molecular, and tissue-level reactions to

orthodontic force. Am J OrthodDentofac Orthop 129(4): 469.el-469.e32.

Kurihara, S. (1977). An electron microscopic observation on cells found in bone

resorption area incident to experimental tooth movement. Bulletin Tokyo Med

Dent Univ 24: 103-123.

76 Lai, C.-F., L. Chaudhary, A. Fausto, L. R. Halstead, D. S. Ory, L. V. Avioli and S.-L.

Cheng (2001). Erk is essential for growth, differentiation, integrin expression, and

cell function in human osteoblastic cells. J Biol Chem 276(17): 14443-14450.

Lean, J. M., K. Matsuo, S. W. Fox, K. Fuller, F. M. Gibson, G. Draycott, M. R. Wani, K.

E. Bayley, B. R. Wong, Y. Choi, E. F. Wagner and T. J. Chambers (2000).

Osteoclast lineage commitment of bone marrow precursors through expression of

membrane-bound TRANCE. Bone 27(1): 29-40.

Lekic, P. and C. A. G. McCulloch (1996). Periodontal ligament cell populations: The

central role of fibroblasts in creating a unique tissue. Anat Rec 245(2): 327-341.

Leonardi, R., N. F. Talic and C. Loreto (2007). MMP-13 (collagenase 3)

immunolocalisation during initial orthodontic tooth movement in rats. Acta

Histochemica 109: 215-220.

Lewis, R. A. and K. F. Austen (1981). Mediation of local homeostasis and inflammation

by leukotrienes and other mast cell-dependent compounds. Nature 293(5828):

103-108.

Lilja, E., S. Lindskog and L. Hammarstrom (1981). Orthodontic forces and periodontal

compression - a new method and its application. Acta Odontol Scand 39: 367-378.

Lilja, E., S. Lindskog and L. Hammarstrom (1983). Histochemistry of enzymes

associated with tissue degradation incident to orthodontic tooth movement. Am J

Orthod 83(1): 62-75.

Lin, H.-H., D. E. Faunce, M. Stacey, A. Terajewicz, T. Nakamura, J. Zhang-Hoover, M.

Kerley, M. L. Mucenski, S. Gordon and J. Stein-Streilein (2005). The macrophage

77 F4/80 receptor is required for the induction of antigen-specific efferent regulatory

T cells in peripheral tolerance. J Exp Med 201(10): 1615-1625.

Lowney, J. J., L. A. Norton, D. M. Shafer and E. Rossomando (1996). Effect of

orthodontic force on TNF-alpha in human crevicular fluid. Am J Orthod Dentofac

Orthop 108:519-524.

Lutter, D., P. Ugocsai, M. Grandl, E. Orso, F. Theis, E. Lang and G. Schmitz (2008).

Analyzing M-CSF dependent monocyte/macrophage differentiation: Expression

modes and meta-modes derived from an independent component analysis. BMC

Bioinformatics 9(1): 100-111.

MacDowell, J. and C. Regli (1961). A quantitative analysis of the decrease in width of

the mandibular arch during forced movements of the mandible. J Dent Res 40:

1183-1185.

Mariotti, A. (1993). The extracellular matrix of the periodontium: dynamic and

interactive tissues. Periodontal 2000 3(1): 39-63.

Marks, S. C. and P. W. Lane (1976). Osteopetrosis, a new recessive skeletal mutation on

chromosome 12 of the mouse. J Hered 67: 11-18.

Martin, R. B. (2000). Toward a unifying theory of bone remodeling. Bone 26(1): 1-6.

Martinez, R. H. and R. B. Johnson (1987). Effects of orthodontic forces on the

morphology and diameter of Sharpey fibres on the alveolar bone of the rat. Anat

Rec 219: 10-20.

Matsuda, N., N. Morita, K. Matsuda and A. Watanabe (1998). Proliferation and

differentiation of human osteoblastic cells associated with differential activation

78 of MAP kinases in response to epidermal growth factor, hypoxia, and mechanical

stress in vitro. Biochem Bioph Res Commun 249: 350-354.

McHugh, K. P., K. Hodivala-Dilke, M.-H. Zheng, N. Namba, J. Lam, D. Novack, X.

Feng, F. P. Ross, R. O. Hynes and S. L. Teitelbaum (2000). Mice lacking 03

integrins are osteosclerotic because of dysfunctional osteoclasts. J Clin Invest

105(4): 433-440.

McKnight, A. J., MacFarlane A.J., P. Dri, L. Turley, A. C. Willis and S. Gordon (1996).

Molecular cloning of F4/80, a murine macrophage-restricted cell surface

glycoprotein with homology to the G-protein-linked transmembrane 7 hormone

receptor family. J Biol Chem 111: 486-489.

Melsen, B. (1999). Biological reaction of alveolar bone to orthodontic tooth movement.

Angle Orthod 69: 151-158.

Melsen, B. (2001). Tissue reaction to orthodontic tooth movement—a new paradigm. Eur

J Orthod 23(6): 67 1 -681.

Morony, S., C. Capparelli, R. Lee, G. Shimamoto, T. Boone, D. L. Lacey and C. R.

Dunstan (1999). A chimeric form of osteoprotegerin inhibits hypercalcemia and

bone resorption induced by IL-lbeta, TNF-alpha, PTH, PTHrP, and 1,

25(OH)2D3. J Bone Miner Res 14(9): 1478-1485.

Motokawa, M., M. Kaku, Y. Tohma, T. Kawata, T. Fujita, S. Kohno, K. Tsutsui, J.

Ohtani, K. Tenjo, M. Shigekawa, H. Kamada and K. Tanne (2005). Effects of

cyclic tensile forces on the expression of vascular endothelial growth factor

(VEGF) and macrophage-colony-stimulating factor (M-CSF) in murine

osteoblastic MC3T3-E1 cells. J Dent Res 84(5): 422-427.

79 Miihlemann, H. R. and H. A. Zander (1954). The mechanism of tooth mobility. J

Periodontal 25: 128-132.

Mullender, M. G. and R. Huiskes (1997). Osteocytes and bone lining cells: Which are the

best candidates for mechano-sensors in cancellous bone? Bone 20(6): 527-532.

Myers, H. I. and W. P. Wyatt (1961). Some histopathic changes in the hamster as a result

of a continuously acting orthodontic appliance. J Dent Res 40: 846-856.

Nakao, K., T. Goto, K. K. Gunjigake, T. Konoo, S. Kobayashi and K. Yamaguchi (2007).

Intermittent force induces high RANKL expression in human periodontal

ligament cells. J Dent Res 86(7): 623-628.

Nanci, A. and D. D. Bosshardt (2006). Structure of periodontal tissues in health and

disease. Periodontol 2000 40: 11-28.

Nathan, C. (1987). Macrophage secretory products. J Clin Invest 79: 319-326.

Niida, S., M. Kaku, H. Amano, H. Yoshida, H. Kataoka, S. Nishikawa, K. Tanne, N.

Maeda, S.-I. Nishikawa and H. Kodama (1999). Vascular endothelial growth

factor can substitute for macrophage colony-stimulating factor in the support of

osteoclastic bone resorption. J Exp Med 190(2): 293-298.

Nilforoushan, D. and M. Manolson (2008). Expression of nitric oxide synthases in

orthodontic tooth movement. Angle Orthod#: #-#.

Nilforoushan, D. and M. Manolson (2009). Expression of nitric oxide synthases in

orthodontic tooth movement. Angle Orthod 79(3): 502-508.

Ogasawara, T., Y. Yoshimine, Kiyoshima. T., I. Kobayashi, K. Matsuo, A. Akamine and

H. Sakai (2004). In situ expression of RANKL, RANK, osteoprotegerin and

cytokines in osteoclasts of rat periodontal tissue. J Periodont Res 39: 42-49.

80 Okazaki, T., S. Ebihara, H. Takahashi, M. Asada, A. Kanda and H. Sasaki (2005).

Macrophage colony-stimulating factor induced vascular endothelial growth factor

production in skeletal muscle and promotes tumor angiogenesis. J Immunol 174:

7531-7538.

Oppenheim, A. (1911). Tissue changes, particularly of the bone, incident to tooth

movement. Am Orthod3: 51-61.

Oshiro, T., A. Shiotani, Y. Shibasaki and T. Sasaki (2002). Osteoclast induction in

periodontal tissue during experimental movement of incisors in osteoprotegerin-

deficient mice. Anat Rec 266(4): 218-225.

Otto, F., A. P. Thornell, T. Crompton, A. Denzel, K. C. Gilmour, I. R. Rosewell, G. W.

H. Stamp, R. S. P. Beddington, S. Mundlos, B. R. Olsen, P. B. Selby and M. J.

Owen (1997). Cbfal, a candidate gene for cleidocranial dysplasia syndrom, is

essential for osteoblast differentiation and bone development. Cell 89(5): 765-

771.

Ozaki, K., S. Hanazawa, A. Takeshita, Y. Chen, A. Watanabe, K. Nishida, Y. Miyata and

S. Kitano (1996). Interleukin-ip and tumour necrosis factor-a stimulate

synergistically the expression of monocyte chemoattractant protein-1 in

fibroblastic cells derived from human periodontal ligament. Oral Microbiol

Immunol 11: 109-114.

Page, R. C, S. Offenbacher, H. E. Schroeder, G. J. Seymour and K. S. Kornman (1997).

Advances in the pathogenesis of periodontitis: summary of developments, clinical

implications and future directions. Periodontal 2000 14: 216-248.

81 Pavlin, D., S. B. Dove, R. Zadro and J. Gluhak-Heinrich (2000b). Mechanical loading

stimulates differentiation of periodontal osteoblasts in a mouse osteoinduction

model: effect on type I collagen and alkaline phosphatase genes Calcif Tissue Int

61: 163-172.

Pavlin, D. and J. Gluhak-Heinrich (2001). Effect of mechanical loading on periodontal

cells. CritRev Oral Biol Med 12(5): 414-424.

Pavlin, D., M. Magness, R. Zadro, E. S. Goldman and J. Gluhak-Heinrich (2000a).

Orthodontically stressed periodontium of transgenic mouse as a model for

studying mechanical response in bone: The effect on the number of osteoblasts.

Clin Orthod Res 3: 55-66.

Pavlin, D., R. Zadro and J. Gluhak-Heinrich (2001). Temporal pattern of stimulation of

osteoblast-associated genes during mechanically-induced osteogenesis in vivo:

early responses of osteocalcin and type I collagen. Connect Tissue Res 42(2): 135

- 148.

Piche, J. E., D. L. Carnes, Jr. and D. T. Graves (1989). Initial characterization of cells

derived from human periodontia. J Dent Res 68(5): 761-767.

Picton, D. C. A. (1965). On the part played by the socket in tooth support. Arch Oral Biol

10: 945-955.

Pilon, J. J. A. M., A. M. Kuijpers-Jagtman and J. C. Maltha (1996). Magnitude of

orthodontic forces and rate of bodily tooth movement: An experimental study in

beagle dogs. Am J OrthodDentofac Orthop 110(1): 16-23.

82 Rana, M. W., V. Pothisiri, M. K. Dennis and X. M. Xu (2001). Detection of apoptosis

during orthodontic tooth movement in rats. Am J OrthodDentofac Orthop 119(5):

516-521.

Rao, L. G., H. M. Wang, R. Kalliecharan, J. N. M. Heersche and J. Sodek (1979).

Specific immunohistochemical localization of Type I collagen in porcine

periodontal tissues using the peroxidase-labelled antibody technique. The

Histochemical Journal 11(1): 73-82.

Raspanti, M., C. Cesari, V. De Pasquale, V. Ottani, R. Strocchi, G. Zucchelli and A.

Ruggeri (2000). A histological and electron-microscopic study of the architecture

and ultrastructure of human periodontal tissues. Arch Oral Biol 45(3): 185-192.

Reitan, K. (1960). Tissue behaviour during orthodontic tooth movement. Am J Orthod

46: 881-890.

Ren, Y., J. C. Maltha and A. M. Kuijpers-Jagtman (2003). Optimum force magnitude for

orthodontic tooth movement: a systematic literature review. Angle Orthod 73(1):

86-92.

Roberts, W. E. and J. G. Chamberlain (1978). Scanning electron microscopy of the

cellular elements of rat periodontal ligament. Arch Oral Biol 23: 587-589.

Roberts, W. E. and D. C. Chase (1981). Kinetics of cell proliferation and migration

associated with orthodontically-induced osteogenesis. J Dent Res 60(2): 174-181.

Roberts, W. E. and E. R. Morey (1985). Proliferation and differentiation sequence of

osteoblast histogenesis under physiological conditions in rat periodontal ligament.

AmJAnat 174(2): 105-118.

83 Rody, W. J., G. J. King and G. Gu (2001). Osteoclast recruitment to sites of compression

in orthodontic tooth movement. Am J Orthod Dentofac 120(5): 477-489.

Roodman, G. D. (1996). Advances in bone biology: the osteoclast. Endocr Rev 17(4):

308-332.

Ross, F. P. (2006). M-CSF, c-Fms, and signaling in osteoclasts and their precursors. Ann

NY Acad Sci \06S: 110-116.

Rygh, P. (1973). Ultrastructural changes in pressure zones of human periodontium

incident to orthodontic tooth movement. Acta Odontol Scand 31: 109-122.

Rygh, P. (1974). Elimination of hyalinized periodontal tissue associated with orthodontic

tooth movement. Scand J Dent Res 82: 57-73.

Rygh, P., K. Bowling, L. Hovlandsdal and S. Williams (1986). Activation of the vascular

system: A main mediator of periodontal fibre remodeling in orthodontic tooth

movement. Am J Orthod 89: 453-468.

Saffar, J.-L., J.-J. Lasfargues and M. Cherruau (1997). Alveolar bone and the alveolar

process: the socket that is never stable. Periodontal 2000 13: 76-90.

Saftig, P., E. Hunziker, O. Wehmeyer, S. Jones, A. Boyde, W. Rommerskirch, J. D.

Moritz, P. Schu and K. von Figura (1998). Impaired osteoclastic bone resorption

leads to osteopetrosis in cathepsin-K-deficient mice Proc Natl Acad Sci USA 95:

13453-13458.

Saygin, N. E., W. V. Giannobile and M. J. Somerman (2000). Molecular and cell biology

of cementum Periodontal 2000 24: 73-98.

84 Schroeder, H. E. (1992). Biological problems of regenerative cementogenesis: synthesis

and attachment of collagenous matrcies on growing and established root surfaces.

Int Rev Cytol 142: 1-59.

Schwarz, A. M. (1932). Tissue changes incident to orthodontic tooth movement. Int J

Orthod 18: 331-352.

Shaw, L. M. and B. R. Olsen (1991). FACIT collagens: diverse molecular bridges in

extracellular matrices. Trends Biochem Sci 16(5): 191-194.

Simonet, W. S., D. L. Lacey, C. R. Dunstan, M. Kelley, M. S. Chang, R. Liithy, H. Q.

Nguyen, S. Wooden, L. Bennett, T. Boone, G. Shimamoto, M. DeRose, R. Elliott,

A. Colombero, H. L. Tan, G. Trail, J. Sullivan, E. Davy, N. Bucay, L. Renshaw-

Gegg, T. M. Hughes, D. Hill, W. Pattison, P. Campbell, S. Sander, G. Van, J.

Tarpley, P. Derby, R. Lee and W. J. Boyle (1997). Osteoprotegrin: a novel

secreted protein involved in the regulation of bone density. Cell 89(2): 309-319.

Sodek, J. and M. D. McKee (2000). Molecular and cellular biology of alveolar bone.

Periodontol 2000 24: 99-126.

Soma, S. and M. Iwamoto, Higuchi, Y., Kurisu, K. (1999). Effects of continuous infusion

of PTH on experimental tooth movement in rats. J Bone Miner Res 14: 546-553.

Stanley, E. R., K. L. Berg, D. B. Einstein, P. S. W. Lee, F. J. Pixley, Y. Wang and Y.-G.

Yeung (1997). Biology and action of colony-stimulating factor-1. Mol Reprod

Dev46:4-10.

Stern, I. B. (1964). An electron microscopic study of the cementum, Sharpey's fibers, and

periodontal ligament in the rat incisor. Am J Anat 115(3): 377-409.

Storey, E. (1973). The nature of tooth movement. Am J Orthod 63(3): 292-314.

85 Strocchi, R., M. Raspanti, A. Ruggeri, M. Franchi, V. De Pasquale, L. Stringa and A.

Ruggeri (1999). Intertwined Sharpey fibres in human acellular cementum. Ital J

AnatEmbryol 104: 175-183.

Suda, T., N. Takahashi, N. UdaGawa, E. Jimi, M. T. Gillespie and T. J. Martin (1999).

Modulation of osteoclast differentiation and function by the new members of the

tumor necrosis factor receptor and ligand families. Endocr Rev 20: 321-344.

Takahashi, N., S. Ejiri, S. Yanagisawa and H. Ozawa (2007). Regulation of osteoclast

polarization. Odontology 95(1): 1-9.

Takahashi, N., H. Yamana, S. Yoshiki, G. Roodman, Mundy G., S. Jones, A. Boyde and

T. Suda (1988). Osteoclast-like cell formation and its regulation by osteotropic

hormones in mouse bone marrow cultures. Endocrinology 122: 1373-1382.

Takano-Yamamoto, T., M. Kawakami, Y. Kobayashi, T. Yamashiro and M. Sakuda

(1992). The effect of local application of 1,25-dihydroxycholecalciferol on

osteoclast numbers in orthodontically treated rats. J Dent Res 71(1): 53-59.

Teitelbaum, S. L. (2000). Bone resorption by osteoclasts. Science 289: 1504-1508.

Teitelbaum, S. L. and F. P. Ross (2003). Genetic regulation of osteoclast development

and function. Nat Rev Genet 4(8): 638-649.

Ten Cate, A. R. (1997). The development of the periodontium - a largely

ectomesenchymally derived unit. Periodontal 2000 13: 9-19.

Ten Cate, A. R., D. A. Deporter and E. Freeman (1976). The role of fibroblasts in the

remodeling of periodontal ligament during physiologic tooth movement. Am J

Orthod 69(2): 155-168.

86 Ten Cate, A. R. and E. Freeman (1974). Collagen remodelling by fibroblasts in wound

repair. Preliminary observations. Anat Rec 179(4): 543-546.

Theill, L. E., W. J. Boyle and J. M. Penninger (2002). RANK-L AND RANK: T cells,

bone loss, and mammalian evolution. Ann Rev Immunol 20: 795-823.

Tzannetou, S., S. Efstratiadis, O. Nicolay, J. Grbic and I. Lamster (2008). Comparison of

levels of inflammatory mediators IL-1 (3 and pG in gingival crevicular fluid from

molars, premolars, and incisors during rapid palatal expansion. Am J Orthod

Dentofac Orthop 133: 699-707.

UdaGawa, N. (2003). The mechanism of osteoclast differentiation from macrophages:

possible roles of T lymphocytes in osteoclastogenesis. J Bone Miner Metab 21(6):

337-343.

UdaGawa, N., N. Takahashi, T. Akatsu, H. Tanaka, T. Sasaki, T. Nishihara, T. Koga, T.

J. Martin and T. Suda (1990). Origin of osteoclasts: Mature monocytes and

macrophages are capable of differentiating into osteoclasts under a suitable

microenvironment prepared by bone marrow-derived stromal cells Proc Natl

AcadSci USA 87: 7260-7264.

Uematsu, S., M. Mogi and T. Degushi (1996). IL-lp\ IL-6, TNF-a, epidermal growth

factor and p2-microglobulin levels are elevated in gingival fluid during human

orthodontic tooth movement. J Dent Res 75: 562-567.

Utley, R. K. (1968). The activity of alveolar bone incident to orthodontic tooth movement

as studied by oxytetracycline-induced fluorescence. Am J Orthod 54: 167-201. van'T Hof, R. J. and S. H. Ralston (2001). Nitric oxide and bone. Immunol 103(3): 255-

261.

87 van de Wijngaert, F. P. and E. H. Burger (1986). Demonstration of tartrate-resistant acid

phosphatase in un-decalcified, glycolmethacrylate-embedded mouse bone: a

possible marker for (pre)osteoclast identification. J Histochem Cytochem 34(10):

1317-1323. van den Berg, T. K. and G. Kraal (2005). A function for the macrophage F4/80 molecule

in tolerance induction. Trends Immunol 26(10): 506-509.

Van Wesenbeeck, L., P. R. Odgren, C. A. MacKay, M. D'Angelo, F. F. Safadi, S. N.

Popoff, W. Van Hul and S. C. Marks (2002). The osteopetrotic mutation toothless

(tl) is a loss-of-function frameshift mutation in the rat Csfl gene: Evidence of a

crucial role for CSF-1 in osteoclastogenesis and endochondral ossification. Proc

Natl Acad Sci USA 99(22): 14303-14308.

Vandevska-Radunovic, V., I. Hals Kvinnsland, S. Kvinnsland and R. Jonsson (1997).

Immunocompetent cells in rat periodontal ligament and their recruitment incident

to experimental orthodontic tooth movement. Eur J Oral Sci 105: 36-44.

Vas Leeuwen, E. J., J. C. Maltha and A. M. Kuijpers-Jagtman (1999). Tooth movement

with light continuous and discontinuous forces in beagle dogs. Eur J Oral Sci

107:468-474.

Vatsa, A., T. H. Smit and J. Klein-Nulend (2007). Extracellular NO signalling from a

mechanically stimulated osteocyte. J Biomech 40: S89-S95.

Waldo, C. M. (1953). Method for the study of tissue response to tooth movement. J Dent

#es 32: 690-691.

88 Warita, H. (1990). Intra-vital and electron microscopic observations on increased

vascular permeability to light mechanical stimulation. J Stomatol Soc Jap 57:

520-548.

Watanabe, T., N. Okafuji, K. Nakano, T. Shimizu, R. Muraoka, S. Kurihara, K. Yamada

and T. Kawakami (2007). Periodontal Tissue Reaction to Mechanical Stress in

Mice J Hard Tissue Biology 16: 71-74.

Watt, F. M. (1986). The extracellular matrix and cell shape. TIBS 11: 482-485.

Weilbaecher, K. N., G. Motyckova, W. E. Huber, C. M. Takemoto, T. J. Hemesath, Y.

Xu, C. L. Hershey, N. R. Dowland, A. G. Wells and D. E. Fisher (2001). Linkage

of M-CSF signaling to Mitf, TFE3, and the osteoclast defect in Mitfmi/mi mice.

Wiktor-Jedrzejczak, W., A. Bartocci, A. W. J. Ferrante, A. Ahmed-Ansari, K. W. Sell, J.

W. Pollard and E. R. Stanley (1990). Total absence of colony-stimulating factor 1

in the macrophage-deficient osteopetrotic (op/op) mouse. Proc Natl Acad Sci USA

87: 4828-4832.

Wiktor-Jedrzejczak, W. W., A. Ahmed, C. Szczylik and R. R. Skelly (1982).

Hematological characterization of congenital osteopetrosis in op/op mouse.

Possible mechanism for abnormal macrophage differentiation. J Exp Med 156(5):

1516-1527.

Woo, K. M., H. M. Kim and J. S. Ko (2002). Macrophage colony-stimulating factor

promotes the survival of osteoclast precursors by up-regulating Bcl-X(L). Exp

Mol Med 34(5): 340-346.

89 Xiao, G., D. Jiang, P. Thomas, M. D. Benson, K. Guan, G. Karsenty and R. T. Franceschi

(2000). MAPK pathways activate and phosphorylate the osteoblast-specific

transcription factor, Cbfal. J Biol Chem 275(6): 4453-4459.

Xie, R., A. M. Kuijpers-Jagtman and J. C. Maltha (2008). Osteoclast differentiation

during experimental tooth movement by a short-term force application: An

immunohistochernical study in rats. Acta Odontol Scand 66: 314-320.

Yamaguchi, M., S. Fujita, T. Yoshida, K. Oikawa, T. Utsunomiya, H. Yamamoto and K.

Kasai (2007). Low-energy laser irradiation stimulates the tooth movement

velocity via expression of M-CSF and c-fms. Orthodontic Waves 66(4): 139-148.

Yamaguchi, M. and K. Kasai (2005). Inflammation in periodontal tissues in response to

mechanical forces. Arch Immunol Exp Ther 53: 388-398.

Yamaguchu, D. T., D. Ma, A. Lee, J. Huang and H. E. Gruber (1994). Isolation and

characterization of gap junctions in osteoblastic MC3T3-E1 cell line. J Bone

Miner Res 9: 791-803.

Yamasaki, K., Y. Shibata and T. Fukuhara (1982). The effect of prostaglandins on

experimental tooth movement in monkeys (Macaca fuscata). J Dent Res 61(12):

1444-1446.

Yamasaki, K., Y. Shibata, S. Imai, Y. Tani, Y. Shibasaki and T. Fukuhara (1984).

Clinical application of prostaglandin E| (PGEi) upon orthodontic tooth

movement. Am J Orthod 85: 508-518.

Yasuda, H., N. Shima, N. Nakagawa, S. I. Mochizuki, K. Yano, N. Fujise, Y. Sato, M.

Goto, K. Yamaguchi, M. Kuriyama, T. Kanno, A. Murakami, E. Tsuda, T.

Morinaga and K. Higashio (1998). Identity of osteoclastogenesis inhibitory factor

90 (OCIF) and osteoprotegerin (OPG): a mechanism by which OPG/OCIF inhibits

osteoclastogenesis in vitro. Endocrinology 139(3): 1329-1337.

Yeung, Y.-G., Y. Wang, D. B. Einstein, P. S. W. Lee and E. R. Stanley (1998). Colony-

stimulating factor-1 stimulates the formation of multimeric cytosolic complexes

of signaling proteins and cytoskeletal components in macrophages. J Biol Chem

273(27): 17128-17137.

Yokoya, K., T. Sasaki and Y. Shibasaki (1997). Distributional changes of osteoclasts and

pre-osteoclastic cells in periodontal tissues during experimental tooth movement

as revealed by quantitative immunohistochemistry of H(+)-ATPase. J Dent Res

76(1): 580-587.

Yoshida, H., S.-I. Hayashi, T. Kunisada, M. Ogawa, S. Nishikawa, H. Okamura, T. Sudo,

L. D. Schultz and S.-I. Nishikawa (1990). The murine mutation osteopetrosis is in

the coding region of the macrophage colony stimulating factor gene. Nature 345:

442-444.

Yoshimatsu, M., Y. Shibata, H. Kitaura, X. Chang, T. Moriishi, F. Hashimoto, N.

Yoshida and A. Yamaguchi (2006). Experimental model of tooth movement by

orthodontic force in mice and its application to tumor necrosis factor receptor-

deficient mice. J Bone Miner Metab 24: 20-27.

Zhang, X., D. Schuppan, J. Becker, P. Reichart and H. R. Gelderblom (1993).

Distribution of undulin, tenascin, and fibronectin in the human periodontal

ligament and cementum: comparative immunoelectron microscopy with ultra-thin

cryosections. J Histochem Cytochem 41(2): 245-251.

91 Ziros, P. G., A. P. Rojas Gil, T. Georgakopoulos, I. Habeos, D. Kletsas, E. K. Basdra and

A. G. Papavassiliou (2002). The bone-specific transcriptional regulator Cbfal is a

target of mechanical signals in osteoblastic cells. J Biol Chem 277(26): 23934-

23941.

92