EXPRESSION AND REGULATION OF PARATHYROID HORMONE-
RELATED PROTEIN DURING LYMPHOCYTE TRANSFORMATION AND
DEVELOPMENT OF HUMORAL HYPERCALCEMIA OF MALIGNANCY
IN LYMPHOMA
DISSERTATION
Presented in Partial Fulfillment of the Requirements for
the Degree Doctor of Philosophy in the Graduate
School of The Ohio State University
By
Murali Vara Prasad Nadella, B.V.Sc
* * * * *
The Ohio State University 2007
Dissertation Committee:
Dr. Thomas J. Rosol, Adviser Approved by
Dr. Michael D. Lairmore ______
Dr. Patrick L. Green Adviser Dr. William C. Kisseberth Veterinary Biosciences Graduate Program ABSTRACT
Adult T-cell leukemia/lymphoma (ATLL) is caused by infection with the human T- lymphotropic virus type-1 (HTLV-1). HTLV-1 Tax plays an important role in the transformation of lymphocytes; however, the exact mechanisms remain unclear.
Parathyroid hormone-related protein plays an important role in the pathogenesis of humoral hypercalcemia of malignancy (HHM) observed in the majority of ATLL patients. However, PTHrP is up-regulated in HTLV-1-carriers and ATLL patients with normocalcemia, indicating that PTHrP is expressed before malignant transformation of lymphocytes.
Using long-term co-culture assays, herein we demonstrate very high levels of
PTHrP and PTHrP receptor (PTH1R) expression during HTLV-1-mediated immortalization of human T-lymphocytes. PTHrP expression did not correlate temporally with expression of HTLV-1 tax and other accessory proteins known to regulate Tax. Co-transfection of HTLV-1 expression plasmids and PTHrP P2/P3- promoter-driven luciferase reporter plasmids demonstrated that HTLV-1 mildly up- regulated PTHrP expression. This indicated that other cellular factors or events are required for increased expression of PTHrP in ATLL cells.
PTHrP is regulated by three distinct promoters P1, P2 and P3. HTLV-1-infected
T-cells and ATLL cells predominantly utilize the P2 and P3 promoters. We characterized an NF-κB binding site in the P2 promoter of human PTHrP. Using electrophoretic mobility shift assays, we detected a specific complex in Tax-
ii expressing human T-cells composed of p50/c-Rel, and two distinct complexes in
ATLL cells consisting of p50/p50 homodimers and a second unidentified protein(s).
Chromatin immunoprecipitation assays confirmed in vivo binding of p50 and c-Rel on
the PTHrP P2 promoter. Using transient co-transfection with NF-κB expression plasmids and PTHrP P2 luciferase reporter-plasmid, we showed that NF-κB p50/p50 alone and p50/c-Rel or p50/Bcl-3 cooperatively up-regulated the PTHrP P2 promoter.
These data demonstrate that transcriptional regulation of PTHrP in ATLL cells can be controlled by NF-κB activation.
Finally we developed a xenograft model of canine T-cell lymphoma with HHM by
injecting lymphoma cells from a dog with spontaneous lymphoma intraperitoneally
into NOD/SCID mice. The mice developed multicentric lymphoma along with HHM
and increased PTHrP as occurs in dogs with T-cell lymphoma. Quantitative RT-PCR
of T-cell lymphoma samples from hypercalcemic canine patients showed that PTHrP
likely plays a central role in the pathogenesis of HHM and that hypercalcemia is the
result of a combinatorial effect of different hypercalcemic factors. Finally, we
monitored in vivo tumor progression and metastases in the mouse model by
transducing the lymphoma cells with a lentiviral vector that encodes a luciferase-
yellow fluorescent protein reporter and showed that in vivo trafficking patterns in this
model were similar to that seen in dogs. This unique mouse model will be useful for
comparative and/or translational research and for investigating the pathogenesis of
HHM in T-cell lymphomas in dogs and humans.
iii In conclusion, these data demonstrate that 1) PTHrP and its receptor are markedly
up-regulated during immortalization of lymphocytes due to HTLV-1 infection, 2) The
PTHrP P2 promoter is regulated by NF-κB pathway in HTLV-1-infected and ATLL
cells, 3) Hypercalcemia in canine T-cell lymphoma patients is multifactorial and
PTHrP plays an important role in the pathogenesis of HHM.
iv
Dedicated to my loving and supporting parents Tenugutalli and Subba Rao Nadella
v ACKNOWLEDGMENTS
First of all, I would like to thank my adviser, Dr. Thomas Rosol, for his guidance, support and encouragement throughout my PhD studies. He has provided an environment for me to develop into an independent scientist that will benefit my future career. I would also like to specially thank him for the cooperation he extended in completing my pathology residency training program. I am also grateful to my committee members, Drs. Lairmore, Green and Kisseberth for serving on my PhD committee and for providing valuable guidance and helpful ideas in my projects.
I am indebted to my pathology mentors, Drs. Steve Weisbrode and Paul
Stromberg for their support throughout the residency program, without which I would
not have completed it. I really appreciate them taking time in helping me understand
the basics of pathology and for spending a great deal of time with me on the microscope. Besides mentoring, they influenced my personality and my passion for pathology which greatly benefited me and will continue to.
I would like to specially thank my past and present lab members Sherry Shu,
Nanda Thudi, Wessel Dirksen, Wendy Lorch, Chelsea Martin, Jillian Werbeck,
Ramiro Toribio, Xiyun Deng, Sarah Tannehill-Gregg, Bruce LeRoy and Andrea
Levine for providing excellent input into experimental design and for scientific discussions. Thanks also go out to all the members of the Center for Retrovirus
Research for their helpful discussions and suggestions on my projects. I would like to specially thank Dr. Boris-Lawrie for her excellent scientific guidance and input when
I presented in the meetings. Many thanks go out to Dr. Dennis Guttridge, his lab
vi members, and members of Dr. Timothy Huang’s laboratory, at the Comprehensive
Cancer Center for their help in completing some of my projects. I would also like to thank Dr. Soledad Fernandez for her excellent help with analysis of my data.
Many thanks go out to Tim Vojt for his excellent help in image preparation and especially for working with me on tight deadlines. I am also thankful to histotechnologists, Anne Saulsberry, Kim Partee and Mary Ross for their help with preparation of histology.
I would like to thank my family who has been extremely helpful and supportive of me throughout the long course of my studies. In particular, I would like to thank my dad for inculcating the importance of quality in what we do and for serving as a role model for me in life. My mom has always been supportive of my decisions and has been of great help in not only emotionally supporting me but also navigating me through the hardships in life. My sisters (Kiran Sree and Bhavani) and my brothers-in- law (Sridhar and Murali) were of incredible help and encouraged me throughout the course of my studies. Kiran Sree has been an excellent mentor, has always looked out for me and encouraged me throughout my studies. Special thanks go out to my lovely niece Navya, and my nephews Vivek, Akhil and Rohan, for every moment I spent with them made my life more pleasant. Last, but not the least, I would like to thank my wife Harini, for this work would not have been possible without her unconditional support and love. I thank her for all the patience and care she showed in the past few years when everyday was a long day for me at work. I would also like to thank my
vii friends Nandu, Pranitha, Sherry, Geeta, Alex, Wendy, Chelsea, and Jillian for making our stay at The Ohio State University a memorable one.
viii VITA
December 21, 1975………………….. Born-Paloncha, Andhra Pradesh, India
2000 ……………………………... B.V.Sc, Veterinary Science, ANGR Agricultural University, Hyderabad, India
2001-present……………………….. Graduate Research Associate The Ohio State University
2004-2007………………………….Resident in Veterinary Anatomic Pathology, The Ohio State University
PUBLICATIONS
1. Nadella MV, Dirksen WP, Nadella KS, Shu S, Cheng AS, Morgenstern JA,
Richard V, Fernandez S, Huang TH, Guttridge D, and Rosol TJ.: Transcriptional
regulation of parathyroid hormone-related protein promoter P2 by NF-kappaB
in adult T-cell leukemia/lymphoma. Leukemia 2007, 21: 1752-1762.
2. Deng X, Tannehill-Gregg SH, Nadella MV, He G, Levine A, Cao Y and Rosol
TJ.: Parathyroid hormone-related protein and ezrin are up-regulated in human
lung cancer bone metastases. Clin Exp Metastasis 2007, 24: 107-119.
3. Tannehill-Gregg SH, Levine AL, Nadella MV, Iguchi H, Rosol TJ: The effect
of zoledronic acid and osteoprotegerin on growth of human lung cancer in the
tibias of nude mice. Clin Exp Metastasis 2006, 23: 19-31.
ix 4. LeRoy BE, Thudi NK, Nadella MV, Toribio RE, Tannehill-Gregg SH, van
Bokhoven A, Davis D, Corn S, and Rosol TJ.: New bone formation and
osteolysis by a metastatic, highly invasive canine prostate carcinoma xenograft.
Prostate 2006, 66: 1213-1222.
5. Richard V, Nadella MV, Green PL, Lairmore MD, Feuer G, Foley JG, and
Rosol TJ.: Transcriptional regulation of parathyroid hormone-related protein
promoter P3 by ETS-1 in adult T-cell leukemia/lymphoma. Leukemia 2005, 19:
1175-1183.
6. LeRoy BE, Nadella MV, Toribio RE, Leav I, Rosol TJ: Canine prostate
carcinomas express markers of urothelial and prostatic differentiation. Vet
Pathol 2004, 41: 131-140.
FIELDS OF STUDY
Major Field: Veterinary Biosciences
x TABLE OF CONTENTS
Abstract…………………………………………………………………………... ii Dedication…………………………………………………………………………v Acknowledgments………………………………………………………………..vi Vita………………………………………………………………………………viii List of Tables………………………………………………………………….….xii List of Figures……………………………………………………………………xiii Chapters:
1. Literature Review: Pathogenesis of Bone Lesions and Hypercalcemia in Adult T-cell Leukemia/Lymphoma……………………………1
2. Expression of Parathyroid Hormone-Related Protein During Immortalization of Peripheral Blood Mononuclear Cells by HTLV-1: Implications in Transformation……………………………………… 43 2.1 Abstract……………………………………………………………...... 43 2.2 Introduction……………………………………………………………… 44 2.3 Materials and Methods…………………………………………………... 47 2.4 Results…………………………………………………………………… 51 2.5 Discussion……………………………………………………………….. 56 2.6 References……………………………………………………………….. 62
3. Transcriptional Regulation of Parathyroid Hormone-Related Protein Promoter-P2 by NF-κB in Adult T-cell Leukemia/Lymphoma………... 82 3.1 Abstract…………………………………………………………………... 82 3.2 Introduction……………………………………………………………… 83 3.3 Materials and Methods……………………………………………………87 3.4 Results……………………………………………………………………. 93 3.5 Discussion………………………………………………………………... 99 3.6 References………………………………………………………………. 106
4. NOD/SCID Mouse Model of Canine T-cell Lymphoma with Humoral Hypercalcemia of Malignancy: Cytokine Gene Expression Profiling and In Vivo Bioluminescent Imaging…………………... 124 4.1 Abstract………………………………………………………………….. 124 4.2 Introduction……………………………………………………………… 125 4.3 Materials and Methods…………………………………………………... 129 4.4 Results………………………………………………………………….... 136 4.5 Discussion………………………………………………………………...141 xi 4.6 References……………………………………………………………….. 146
5. Synopsis and Future Directions…………………………………………….. 171 5.1 References……………………………………………………………….. 175
Bibliography………………………………………………………………...... 176
xii LIST OF TABLES Table Page
4.1 List of primers used for qRT-PCR with accession numbers for each gene………………………………………………………………….. 158
4.2 Histopathology in NOD/SCID mice xenografted with canine T-cell lymphoma…………………………………………………………... 159
4.3 List of genes up-regulated in xenografted canine T-cell lymphoma compared with normal canine lymph nodes……………. 160
4.4 List of genes down-regulated in xenografted canine T-cell lymphoma compared with normal canine lymph nodes……………. 162
xiii LIST OF FIGURES
Figure Page
2.1 Growth curves and p19 Gag expression in HTLV-1 T-lymphocyte immortalization assays……………………………………….72
2.2 PTHrP was markedly up-regulated during immortalization of PBMCs with HTLV-1 infection…………………………………………...74
2.3 PTHrP was up-regulated by the P2 and P3 promoters……………………… 76
2.4 HTLV-1 infection up-regulated expression of the PTHrP receptor (PTH1R) in PBMCs……………………………………………….. 77
2.5 PTHrP expression did not correlate with HTLV-1 tax and HTLV-1 accessory proteins known to regulate Tax expression……………………… 79
2.6 HTLV-1 infection or over-expression of Rex alone up-regulated PTHrP expression……………………………………………………………80
2.7 MIP-1α induction due to activation of lymphocytes following HTLV-1 infection…………………………………………………………….81
3.1 Schematic representation of human, mouse, rat and dog PTHrP P2 promoter regions………………………………………………...115
3.2 HTLV-1 Tax expression was inversely proportional to IκB-α……………. 116
3.3 NF-κB binding activity on a consensus κB binding site in various cell lines…………………………………………………………….117
3.4 Nuclear NF-κB proteins specifically bound to an oligonucleotide containing the NF-κB binding sequences from the human PTHrP P2 promoter………………………………………………………………… 118
3.5 NF-κB p50 and c-Rel bound to the PTHrP P2 promoter in vivo………….. 119
3.6 PTHrP P2 promoter can be transactivated by NF-κB in a sub-unit dependent manner…………………………………………………120
3.7 Bcl-3 expression was high in HTLV-1-infected T-cells compared to ATLL cells…………………………………………………….122
xiv 3.8 Inhibition of the NF-κB activity in HTLV-1-infected T-cells by Bay 11-7082 decreased PTHrP mRNA expression……………………..123
4.1 Characterization of canine T-cell lymphoma xenografted in NOD/SCID mice……………………………………………………………163
4.2 Plasma total calcium concentrations (mg/dL)……………………………...165
4.3 Hypercalcemic factors in the NOD/SCID mice xenografted with canine lymphoma……………………………………………………...166
4.4 Histomorphometry of tibiae of NOD/SCID mice xenografted with canine T-cell lymphoma………………………………………………167
4.5 Q-RT-PCR verification of microarray data………………………………...168
4.6 Hypercalcemic factors in canine T-cell lymphoma patients with hypercalcemia…………………………………………………………169
4.7 Bioluminescent imaging in mouse model of canine T-cell lymphoma…………………………………………………………….170
xv CHAPTER 1
INTRODUCTION
PATHOGENESIS OF BONE LESIONS AND HYPERCALCEMIA IN ADULT
T-CELL LEUKEMIA/LYMPHOMA
Pathogenesis of Adult T-cell Leukemia/Lymphoma
Adult T-cell leukemia/lymphoma (ATLL) is a highly aggressive malignancy of
CD4+ T lymphocytes caused by infection with human T-lymphotropic virus type-1
(HTLV-1)(1). HTLV-1 infection is also associated with inflammatory diseases
including HTLV-1-associated myelopathy/tropical spastic paraparesis (HAM/TSP),
uveitis, arthropathy and infective dermatitis(2). About 10 to 20 million people
worldwide are infected with HTLV-I, and it is endemic in southwestern Japan, the
Caribbean basin, and Central Africa(3). HTLV-1 exists predominantly as a cell- associated provirus and cell-free infection is inefficient(4). Transmission occurs via
cell-cell contact through exposure to contaminated blood, sexual contact, or vertically
from mother to child either transplacentally or through infected lymphocytes in breast
milk(5). About 2-5% of HTLV-1-infected people develop ATLL after a long latency period of 20-40 years post-infection indicating that additional cellular events besides
HTLV-1 infection are required for development of the disease(6).
1 The HTLV-1 genome encodes typical retroviral structural, enzymatic, and envelope
proteins, HTLV-1-specific regulatory proteins (Tax and Rex), several accessory
proteins (p12, p13, p21, p30) and a minus-strand protein HTLV-1 bZIP-factor,
HBZ(7). The molecular mechanisms by which HTLV-1 induces transformation are not clearly understood, but the 40-kDa nuclear protein Tax is thought to be the viral oncogene and plays important role in the pathogenesis of ATLL(8). Tax not only increases the expression of viral genes through viral LTRs but also stimulates the transcription of cellular genes through the signaling pathways such as nuclear factor kappa B (NF-κB), serum responsive factor (SRF), cyclic AMP response element- binding protein (CREB), and activated protein 1 (AP-1)(9;10). Furthermore, Tax alters the activity of several cell cycle regulators, tumor suppressor genes, and genes involved in DNA repair and apoptosis resulting in deregulation of cellular growth mechanisms(11). Its ability to transcriptionally activate various cellular genes, including proto-oncogenes, is a key mechanism in the transformation of the T-cells.
Tax expression induces an immune response and is the major target of cytotoxic T lymphocytes; however, the majority of ATLL cells do not express significant levels of
Tax(12). Currently, it is believed that Tax plays an important role in the persistent
proliferation of HTLV-1-infected cells during the carrier state, and the mutator
phenotype of Tax accumulates genetic and epigenetic changes in the host genome that
lead to Tax-independent proliferation and escape from the host immune system by
inactivation of Tax(13).
2 The regulator protein, Rex regulates the expression of incompletely spliced viral
RNAs through its interaction with the Rex response element in the viral RNA and
cellular proteins involved in chromosomal region maintenance-dependent nuclear
export(14). Although Rex is not required for immortalization of lymphocytes in vitro, it
is required for infectivity and persistence in vivo(15). The functions of HBZ are still
uncertain, but it has been shown to interact with CREB-2 and suppress Tax-mediated
viral transcription(16). Interestingly, HBZ is thought to have bimodal functions in its
RNA and protein molecular forms and the RNA form of HBZ is speculated to be important in the transforming activity of HTLV-1(17). The accessory proteins, p12, p27, p13, and p30 are important for in vivo viral infectivity, host cell activation, and regulation of gene transcription. Their role in HTLV-1-mediated transformation is not clear(18).
Clinical Features of ATLL and Hypercalcemia
ATLL is characterized by four clinical subtypes: acute, lymphoma, chronic and
smoldering. About 55% are the acute type, 20% are the lymphoma type, 20% are the
chronic type and 5% are the smoldering type. Acute and lymphoma-type show
aggressive clinical courses, whereas the second two types progress more
indolently(19). ATLL is characterized by generalized lymph node, peripheral blood and/or skin involvement by pleomorphic tumor cells with hyperlobated nuclei (flower cells), lytic bone lesions, hypercalcemia, a rapidly progressive course, and a relatively
3 short survival(20;21). Lytic bone lesions are observed in about 5.5% of ATL patients, especially in the tibia, ulna, scapula, femur, and clavicle(22). Hypercalcemia occurs
with a high frequency in acute ATLL patients.
Hypercalcemia is a potentially life-threatening complication that usually affects
several organ systems, but most commonly the gastrointestinal, nervous and urinary
systems. The severity of symptoms usually depends on the degree of hypercalcemia,
the rapidity of the rise in serum calcium, and on the general medical condition of the
patient. Gastrointestinal symptoms are the earliest and most frequent features that
occur in the syndrome, including anorexia, nausea and vomiting. Neurological manifestations occur in more than 50% of the patients and consist of loss of concentration, fatigue, and depression, and are followed by psychiatric symptoms and neuromuscular disturbances if the condition is untreated. In severe cases, drowsiness and coma may occur. Renal manifestations include polyuria and polydypsia which occur because hypercalcemia interferes with antidiuretic hormone action at the distal nephron resulting in a syndrome-like diabetes insipidus(23).
Calcium Homeostasis and Normal Bone Remodeling
Knowledge of calcium homeostasis and normal bone remodeling is required to
understand the mechanisms involved in the pathogenesis of hypercalcemia and bone
lesions in ATLL patients. Normally, calcium homeostasis is a tightly regulated
process involving the coordinated efforts of calcitropic hormones (parathyroid
4 hormone, calcitonin and calcitriol) controlling fluxes of calcium between the extracellular fluid and the skeleton, kidney, and gastrointestinal tract(24). Calcium in the diet that is absorbed by the intestines enters the blood stream and is filtered by the kidney, where the majority of it is reabsorbed in the proximal renal tubules.
Parathyroid hormone (PTH) is synthesized by the chief cells of the parathyroid gland and regulated by serum ionized calcium concentrations, which are sensed by the cell membrane Ca2+ receptor(25). Serum PTH increases as the serum calcium concentration decreases creating a negative feedback loop(26). PTH functions by binding to the PTH receptor type-1 (PTH1R) on osteoblasts and renal epithelial cells to stimulate osteoclastic bone resorption and release calcium from the bone, increase renal calcium reabsorption, and induce production of calcitriol that increases the intestinal absorption of calcium(27). Calcitonin is secreted by the parafollicular cells of the thyroid gland and directly inhibits osteoclastic bone resorption and decreases renal tubular reabsorption of calcium; however, the effects of calcitonin are transient and it likely does not have an important role in chronic calcium homeostasis(28;29). Calcitriol or 1,25-dihydroxyvitamin D3 (1,25-(OH)2D3), the biologically active metabolite of
vitamin D, is produced in the kidney through the action of 1α-hydroxylase on the precursor, 25-hydroxyvitamin D3. Calcitriol increases plasma calcium concentrations by increasing the absorption of calcium from the intestines(30).
The majority of calcium in the body is stored in the skeleton (99%), and the
remaining 1% is present in the extracellular fluid and soft tissues. Bone undergoes
constant remodeling with osteoclasts removing bone and osteoblasts forming new
5 bone at sites of previous bone resorption in a closely coupled fashion(31).
Hypercalcemia and bone resorption associated with cancer is typically due to humoral
factors secreted by tumors that act systemically on the target organs of bone, kidney and intestines, to disrupt normal calcium homeostasis, or from the local production of factors in the bone microenvironment at sites of bone tumors that stimulate osteoclastic bone resorption.
Osteoclastogenesis: Osteoclasts are highly specialized multinucleated cells formed
by the fusion of osteoclast precursors of the monocyte-macrophage lineage circulating
in the peripheral blood(32). Osteoclasts are activated to resorb bone(33). Both systemic and local factors in the bone microenvironment play important roles in the regulation of osteoclast differentiation and activity. It has been shown that osteoclastogenesis is regulated by a common molecular signaling pathway that involves members of the tumor necrosis family; including the receptor activator of nuclear factor-κB (RANK),
osteoprotegerin (OPG), and receptor activator of nuclear factor-κB ligand
(RANKL)(34). RANKL is expressed as a membrane-bound protein (cleaved into a soluble form by metalloproteinases) on several cell types, including osteoblasts and bone marrow stromal cells, and is also secreted by activated T-cells(35;36). RANKL plays a critical role in the differentiation and fusion of osteoclast precursors by binding to the specific receptor RANK expressed on these cells. RANKL not only promotes osteoclastogenesis but also activates mature osteclasts to resorb bone(37). In contrast, OPG, which is also produced by osteoblasts, acts as a decoy receptor for
RANKL and blocks osteoclast differentiation and stimulation of bone-resorbing
6 activity(38). Humoral hypercalcemia of malignancy and tumor-associated bone lesions primarily result from increased bone resorption and uncoupling of the normal remodeling due to increased osteoclast numbers and activity(39).
Cancer-Associated Hypercalcemia
Hypercalcemia occurs when the serum ionized calcium concentrations are greater
than the normal range. Typically total serum calcium concentrations are greater than
12 mg/dL, after adjusting for protein concentration (40). Hypercalcemia occurs in a wide variety of cancers in addition to ATLL(41). Hypercalcemia occurs with a high frequency (70-80%) in ATLL patients compared to other hematologic malignancies and is one of the distinguishing features of ATLL(42). Although clinical presentation and the underlying pathogenesis can sometimes overlap, cancer-associated hypercalcemia can be divided into two syndromes, humoral hypercalcemia of malignancy (HHM) and local osteolytic hypercalcemia (LOH), depending on whether a circulating hormone or local paracrine factors mediate the increased bone resorption(43).
1. Local Osteolytic Hypercalcemia is caused by increased osteoclastic bone
resorption due to skeletal metastases of tumor cells that secrete paracrine factors to
stimulate osteoclasts to resorb bone while tumor-free sites do not have excessive bone
resorption. Although the majority of ATLL patients present with HHM, a small
percentage of them also may have local osteolytic lesions. Some patients have been
7 reported to have lytic bone lesions in the absence of a detectable primary tumor(44-47).
Local osteolytic hypercalcemia also occurs in patients with extensive osteolytic metastases such as those with myeloma, breast cancer and lymphoma. Several cytokines including interleukin-1α, interleukin-1β, interleukin-6, tumor necrosis factor-α, tumor necrosis factor-β, transforming growth factor-α, and parathyroid hormone-related protein have been implicated in the pathogenesis of osteoclastic bone resorption in LOH(48).
2. Humoral Hypercalcemia of Malignancy is a syndrome associated with widespread osteoclastic bone resorption caused by tumors distant from bone and results from factors secreted into the systemic circulation affecting the entire skeleton(48). Biochemical characteristics that define HHM include increased serum
calcium, low serum phosphorus, low PTH concentrations and increased elevated
nephrogenous cyclic adenosine mono-phosphate (NcAMP) and phosphate excretion
rates(49). Several factors have been implicated in the pathogenesis of HHM,
particularly in lymphoma patients, but it is believed that parathyroid hormone-related
protein (PTHrP) plays a central role in the development of HHM in most patients(48).
Factors implicated in the bone lesions associated with ATLL: ATLL cells express a variety of factors that directly and/or indirectly stimulate osteoclast differentiation and activity and are detailed below:
Interleukin-1 (IL-1): IL-1α and -1β are potent stimulators of bone resorption(50).
Dewhirst et al. purified the osteoclast activating factor from the culture supernatant of human peripheral blood lymphocytes and reported that it corresponded to IL-1β(51). In
8 1986, Gowen et al. reported that recombinant IL-1β had bone resorbing activity in vitro(52). Shirakawa et al. reported that there was a significant correlation between the level of IL-1α and bone resorbing activities produced by ATLL cells and serum calcium concentrations of ATLL patients(53). Wano et al. showed that IL-1 was increased in T lymphocytes infected with HTLV-1, and further studies showed that
Tax can transactivate IL-1α gene expression(54;55). Interestingly, IL-1 can act synergistically with tumor necrosis factor and PTHrP to increase osteoclast formation and bone resorption(56). However, a direct role for IL-1 in HHM in ATLL patients has not been established and further studies are required to understand its role in HHM in these patients.
Interleukin 6 (IL-6): IL-6 is a potent osteoclastogenic factor produced by many cell types, including lymphocytes and PTH-stimulated osteoblasts (57). Ishimi et al. have shown that IL-6 can enhance osteoclastic bone resorption in a mouse calvarial resorption assay(58). High levels of IL-6 have been reported in patients with solid
tumors and HHM(59;60) and IL-6 is one of the factors produced by multiple myeloma
that causes osteolysis(61). Consistent with these observations, Matshushima et al. described multiple osteolytic lesions in a patient with ATLL caused by elevated IL-6 levels in the absence of hypercalcemia and elevated PTHrP expression(62). Increased expression of IL-6 has also been described in a pathologic fracture in an ATLL patient(63). IL-6 has been shown to be transactivated by Tax(64). Some reports showed that IL-6 stimulated osteoclast-like cell formation by inducing IL-1(65). Furthermore,
IL-6 can enhance the effect of other osteoclastogenic factors such as RANKL(66) or
9 PTHrP(67), thus it is possible that IL-6 can function synergistically with other cytokines in the induction of bone lesions in ATLL patients. In conclusion, IL-6 likely plays a role in the osteolytic lesions in some ATLL patients but its role in HHM has not been established.
Tumor necrosis factor (TNF): TNF-α and -β (lymphotoxin) have been shown to enhance osteoclastic bone resorption and induce hypercalcemia in vivo(68). Ishibashi et al. analyzed the serum levels of TNF-β in twenty-eight ATLL patients without hypercalcemia and eight ATLL patients with hypercalcemia and found that TNF-β was increased in seven of eight ATLL patients with hypercalcemia indicating that
TNF-β might be one of the factors responsible for bone resorption in these patients(69).
Stashenko et al. reported synergistic interactions between IL-1 and TNF-β in bone resorption of normal rats. Both TNF-α or -β can have synergistic effects with IL-1α or
-1β(70). Therefore, it is possible that TNF and IL-1 could act synergistically to induce
HHM in ATLL patients. More detailed studies are required to determine their roles in
HHM.
Macrophage colony stimulating factor: M-CSF is a critical factor for differentiation
of osteoclast precursors(71) and has been implicated in bone lesions associated with some cancers. Yamada et al, demonstrated high expression of plasma M-CSF in acute
ATLL patients(72). Nosaka et al. reported expression of M-CSF in eight hypercalcemic
ATLL patients and showed that high levels of MCSF may play an important role in
the pathogenesis of HHM in association with RANKL(73). However, M-CSF was increased in patients without hypercalcemia, suggesting that M-CSF alone was not
10 responsible for hypercalcemia. Therefore, a definitive role for M-CSF in the
pathogenesis of HHM in these patients has not been established.
Calcitriol: Increased extra-renal production of calcitriol (1,25-dihydroxyvitamin D, the active form of vitamin D) is believed to be one of the factors responsible for the pathogenesis of HHM in patients with non-Hodgkin’s lymphoma. Hypercalcemia in these patients results from increased intestinal absorption of calcium and osteoclastic bone resorption(74). Because of the association of HHM with calcitriol in lymphoma
patients, expression of calcitriol in ATLL patients with HHM has been measured.
Increased circulating concentrations of calcitriol have been reported in ATLL patients
indicating that calcitriol may play a role in the pathogenesis of HHM in these
patients(75). Furthermore, Fetchik et al. have shown that infection of lymphocytes with
HTLV-1 results in the production of 1-α hydroxylase activity that converts 25- hydroxy D3 to the active metabolite, calcitriol(76). However, a study on five
hypercalcemic patients with ATLL showed that the serum levels of calcitriol were
within or below the normal range in these patients. Moreover, NcAMP levels were
increased in these patients indicating that PTH-like activity was produced by the
lymphoma cells and was responsible for the HHM(77).
Parathyroid hormone-related protein (PTHrP): In 1941 Fuller Albright first
proposed the syndrome of ectopic PTH production by a tumor in a patient with renal
carcinoma and hypercalcemia with normal parathyroid glands. However, PTH was
not detected in the tumor and subsequent studies showed that the factor was not PTH
but instead an immunologically distinct factor with ‘PTH-like’ biological activity(78).
11 Moreover, several of the factors described previously did not satisfactorily explain the other biochemical features of HHM, including elevated NcAMP. In pursuit of the factor responsible for this syndrome, several groups simultaneously purified PTHrP from human lung cancer, breast cancer and renal carcinoma, and PTHrP was shown to be the major mediator of humoral hypercalcemia of malignancy(79-81). The first 13
amino acids of PTHrP are homologous (70%) to the N-terminal portion of PTH. The
hypercalcemic effects of PTHrP are attributed to its N-terminal portion (1-36) which
binds to the common PTH/PTHrP receptor (PTH1R) and increases osteoclastic bone
resorption and renal reabsorption of calcium(82), which mimics the effects of PTH.
PTHrP has been found in multiple tumor types associated with HHM including squamous, breast and renal carcinomas, and lymphomas. Circulating levels of PTHrP are increased in approximately 80% of the patients with HHM (83). A direct causal role for PTHrP in HHM was established when antibodies to PTHrP lowered serum calcium in xenograft mouse models of HHM(84).
Motokura et al. reported the expression of PTHrP mRNA by northern blot analysis and demonstrated PTH-like bioactivity in a HTLV-1-infected cell line, MT-2. The authors concluded that PTHrP likely is responsible for the hypercalcemia seen in
ATLL patients(85). This report was followed by studies showing that PTHrP was
secreted not only by MT-2 cells, but also by cultured peripheral lymphocytes from
ATLL patients(86). Later, Watanabe et al. analyzed PTHrP gene expression in thirteen
ATLL patients, four HAM/TSP patients and four healthy HTLV-1-carriers by RT-
PCR and showed that PTHrP mRNA was expressed in all the samples. Furthermore,
12 the authors reported for the first time transactivation of PTHrP by Tax, providing a
mechanistic basis for the up-regulation of PTHrP in these patients(87). However, it was
not until the advent of the immunoradiometric assay (IRMA) to measure the
circulating protein that PTHrP was measured in ATLL patients with hypercalcemia.
Matsumoto’s group first identified increased circulating PTHrP protein in nine out of
ten hypercalcemic ATLL patients by IRMA(88). Subsequent studies also have
circulating PTHrP in ATLL patients with hypercalcemia(89;90). Mori et al. measured the urinary levels of PTHrP in ATLL patients and reported that the urinary level of
PTHrP were useful for evaluation of ATLL(91). Another study demonstrated that urinary excretion of C-terminal PTHrP could be a valuable predictor for the development of HHM in ATLL patients(92).
Several mechanistic studies using molecular biology approaches have shown that
Tax transactivated the PTHrP P3 promoter via the ETS-binding site and SP-1 site
present within the promoter(93). However, constitutively high PTHrP expression in
ATLL cells in the absence of Tax expression has led researchers to postulate that
PTHrP can be transactivated in a Tax-independent manner. Consistent with this
hypothesis we have shown that activation of T-cell receptor signaling in Jurkat T-cells
by phytohemagglutinin and ionomycin up-regulated PTHrP expression in the absence
of Tax and the protein complexes formed in these cells were similar to those seen in
(94) ATLL cells . Some reports have shown that IL-2 and prostaglandin E1 can up- regulate PTHrP expression in HTLV-1-infected T-cells providing additional mechanisms for the up-regulation of PTHrP observed in ATLL cells(95;96).
13 Although many studies identified a central role for PTHrP in the pathogenesis of
HHM, other studies have shown that there was no strong correlation between PTHrP
expression and hypercalcemia, and that PTHrP was up-regulated in ATLL patients
without hypercalcemia(97). Some studies have implicated PTHrP in combination with
other cytokines in the pathogenesis of HHM, suggesting that HHM in ATLL patients
is likely multifactorial. IL-6 has been shown to act synergistically with PTHrP in the
induction of HHM in mice bearing renal carcinoma(98) and factors such as IL-1 and
TNF can enhance the hypercalcemic effects of PTHrP(99;100). Other cytokines, such as
TGF-β, TNF-α, and IL-1 up-regulate PTHrP gene expression in a variety of nonlymphoid cell lines and tissues(101). Taken together, these studies suggest that
HHM in ATLL patients is caused by the synergistic effects of PTHrP in conjunction with various other cytokines.
PTHrP has been shown to be up-regulated during homotypic adhesion of ATLL
cells via the LFA1/ICAM-1 pathway indicating diverse roles for PTHrP in ATLL(102).
In addition to its well-documented role in HHM, PTHrP is now known to have pleotrophic effects including regulation of cell differentiation, proliferation and apoptosis in various cell types(103). McCauley et al. demonstrated that PTHrP bound to the HTLV-1-infected cell line, MT-2, indicating a potential autocrine role for
PTHrP in these cells(104). More recently, we have shown that PTHrP is up-regulated during immortalization of human peripheral blood mononuclear cells by HTLV-1
(Nadella and Rosol; unpublished data), indicating that PTHrP is expressed not only during HHM but also during early HTLV-1 infection. In conclusion, due to the
14 pleotrophic properties of PTHrP it is likely that PTHrP has several functions in ATLL
besides its central role in HHM.
Receptor activator of nuclear factor κB ligand (RANKL): RANKL produced by osteoblastic lineage cells and activated T-cells is an essential factor for osteoclast formation, fusion and activation. RANKL binds to and activates its receptor RANK present on osteoclasts that in turn results in bone resorption(105). Recently Nosaka et
al. measured the expression of M-CSF, PTHrP, TNF-α and RANKL in eight hypercalcemic and seven normocalcemic ATLL samples. They showed that M-CSF and PTHrP were present in the serum from both groups, whereas the expression of
RANKL mRNA was very high in the ATLL samples from hypercalcemic patients compared to the normocalcemic ATLL samples. The authors concluded that expression of RANKL is critical for induction of hypercalcemia(106).
Macrophage inflammatory protein-1α (MIP-1α): MIP-1α expression can be
induced in most mature hematopoietic cells including monocytes, T and B
lymphocytes, macrophages, neutrophils and dendritic cells by a variety of stimuli
ranging from bacterial LPS, IL-2, and phytohemagglutinin (PHA) to HIV and HTLV-
1 infection(107). MIP-1α has been shown to stimulate RANKL, osteoclast formation, and bone resorption(108;109). In the most recent and largest study, Okada et al. analyzed twenty-four ATLL patients with hypercalcemia and thirty-seven patients without hypercalcemia and reported that MIP-1α was increased in 100% of the ATLL patients with hypercalcemia and only 8% of the ATLL patients with normal calcium levels.
They also showed that PTHrP was increased in only 25% of the ATLL patients with
15 hypercalcemia. IL-1β was increased in 17%, IL-6 was increased in 55%, TNFα was elevated in 12.5% of the ATLL patients with hypercalcemia suggesting that MIP-1α is a specific factor responsible for hypercalcemia in ATL patients(110). Studies such as this one that analyzed more than one factor will be required in the future to better understand the pathogenesis of HHM in ATLL patients. It is likely that the ATLL cells secrete several factors that act in concert with PTHP to induce HHM
Animal Models of HTLV-1-Associated Diseases and Bone Lesions
Because HHM requires a complex interactions of tumor-secreted factors with bone
and kidney, animal models are necessary to understand the pathogenesis of HHM in
ATLL patients. There is no animal model that can recapitulate the complete disease
progression from infection to manifestation of disease. Therefore, the animal models
of HTLV-1 can be divided into two categories: infection models and pathology
models. The infection models provide information focusing on viral infection,
transmission, replication, immune response, and genetics. The pathology models
provide information on viral oncogenesis, disease manifestations and pre-clinical
therapeutic studies(111).
To investigate the pathogenesis of HTLV-1, several lines of transgenic mice
(primarily targeting the Tax viral oncoprotein) have been developed using different
viral gene segments and promoters. The following animal models developed bone
lesions:
16 1. HTLV-1 LTR-Tax model: Transgenic mice with the HTLV-1 LTR-Tax
developed neurofibromas and adrenal medullary tumors. Tax mRNA was expressed at
very high levels in osteoclasts and endosteal spindle-shaped cells within the myelofibrotic lesions of the bone. Generalized skeletal alterations in the femurs,
tibias, humeri and tail bones included thicker but fragile bones and alteration in the
external shape with a thick diaphysis and an irregular external surface were observed.
The transgenic mice had marked bone remodeling with 2-3-fold thicker cortices and
trabeculae compared to the control mice. The authors also reported increases in the
number, size and degree of multinucleation of the osteoclasts, increases in osteoclast
and osteoblast numbers and high bone formation rates in the transgenic mice.
Myelofibrosis also occurred in the mice. Finally, bone turnover did not correlate with
tumor burden in these mice (112).
2. Tax+ C57B6/SJL: In this model, Tax was targeted to mature T-lymphocyte
compartment by utilizing the human granzyme B promoter. The mice developed
tumors on the ears, legs, and tails. Tumors with large granular lymphocytes occurred in the cervical, axillary, popliteal, and mesenteric lymph nodes and the spleen. In addition, there were increased WBC counts in the mice. The mice spontaneously developed mild hypercalcemia, enhanced osteoclast activity and a high-frequency of osteolytic bone metastases. The authors showed that Tax+ tumor cells expressed
mRNA for IL-6, M-CSF, IL-1α, IL-1β, TGF-β, and TNF-α, all of which have been shown to activate osteoclasts and to enhance tumor-associated bone loss. It was shown that intervention with bisphosphonates before the development of lymphoma
17 prevented tumor-associated osteolysis, dissemination of soft-tissue tumors, and prolonged overall survival, suggesting a role for early bisphosphonate therapy in
HTLV-1-infected people(113;114).
The Tax transgenic models revealed the importance of the Tax viral oncoprotein,
but tumor development usually takes longer than 6 months.. To circumvent this
problem, immunodeficient mice engrafted with primary cancer cells from ATLL
patients have been used to test novel therapies for ATLL. The following xenograft
models exhibited bone lesions and hypercalcemia as seen in the patients:
1. ATLL xenograft model: Uchiyama’s group described a severe combined
immunodeficient mouse (SCID) xenograft model developed by intraperitoneal
injection of lymph node cells from a lymphoma-type ATLL patient. These mice
developed tumors along with hypercalcemia within three weeks after inoculation of tumor cells. There was a marked increase in serum C-terminal PTHrP concentrations along with decreased bone formation rates reported in these mice(115).
2. RV-ATL xenograft model: Richard et al developed this model by intraperitoneal
injection of ATLL cells from a patient into SCID/beige mice. The mice developed
lymphoma in the mesentery, liver, thymus, lungs, and spleen approximately 1 month
after the inoculation of tumor cells. The mice developed severe hypercalcemia with
marked increases in serum PTHrP concentrations and increased osteoclastic bone
resorption(116). It was also shown that PTHrP expression in these cells was
independent of HTLV-1 Tax expression as occurs in many ATLL patients(117).
Recently the model was refined using luciferase-expressing RV-ATL cells and
18 subsequent bioluminescent imaging to monitor tumor burden non-invasively. Novel
combined therapy with PS-341, a proteasome inhibitor and zoledronic acid, a potent inhibitor of osteoclastic bone resorption showed that the combination was very effective in reducing tumor burden and HHM. (Shu and Rosol; unpublished data).
Treatment of Hypercalcemia and Bone Lesions
Prognosis of patients with HHM is generally poor because it generallyoccurs in
patients with advanced malignancy. Treatment of hypercalcemia is usually palliative
without prolonging survival. Definitive treatment of HHM is eradication of the
underlying tumor. Most experience in the treatment of HHM comes from treating
patients with solid cancers and has been adapted to patients with ATLL because the
underlying mechanisms of HHM are similar. Palliative treatment for hypercalcemic
patients include rehydration with intravenous administration of isotonic saline, which
increases glomerular filtration rate and reduces the fractional reabsorption of calcium.
Loop diuretics have been used to enhance calcium excretion. Glucocorticoids have
been particularly useful for treating lymphoma patients with HHM(118).
ATLL is a highly aggressive malignancy. Several therapies including doxorubicin-
based combination protocols, nucleoside analogues, topoisomerase inhibitors,
interferon, zidovudine, arsenic trioxide and monoclonal antibodies have been used
with limited success, but the prognosis is still poor due to non-responsiveness, drug
resistance, and marrow or hematological toxicity(119). In patients with symptomatic or
19 life-threatening hypercalcemia, therapy must be targeted at the inhibition of bone
resorption and promoting renal calcium excretion. Bisphosphonates are important
principal treatments for long-term treatment of hypercalcemia and the bone disease
associated with various cancers. Bisphosphonates have a strong affinity to bone
mineral and are released into the bone microenvironment during bone resorption. The
nitrogen-substituted bisphosphonates, such as alendronate, risedronate and zoledronic
acid are potent inhibitors of the enzyme farnesyldiphosphate synthase, which blocks
protein isoprenylation and induces apoptosis of osteoclasts. The non-nitrogen-
containing bisphosphonates, clodronate and etidronate, are less potent and also induce
osteoclastic apoptosis by inhibition of ATP-dependent intracellular enzymes(120;121).
The majority of bisphosphonates have limited antitumor activity, a recent report from
Mori’s group reported that incandronate inhibited growth of HTLV-1-infected cells and ATLL cells and was effective in reducing tumor burden in a sub-cutaneous mouse xenograft model(122). Because the majority of ATLL patients have either hypercalcemia or bone lesions, combination therapy with a bisphosphonate and various anti-tumor drugs should be tested. We recently found that a combinatoion treatment with zoledronic acid and PS-341, a potent proteasome inhibitor of a xenograft mouse model with ATLL cells was very effective in decreasing tumor burden and reducing hypercalcemia (Shu and Rosol; unpublished data). Other novel therapies including RANKL inhibitor (OPG-Fc) and anti-PTHrP antibodies have been promising in decreasing hypercalcemia in mouse models of cancer and HHM(123;124).
Similar treatments need to be tested in mouse models of ATLL or in ATLL patients.
20 Conclusion: Although the exact mechanisms involved in the pathogenesis of HHM and bone lesions associated with ATLL patients are not clearly understood, research over the past several years has shown that HHM in these patients is likely multifactorial and that PTHrP, MIP-1α and RANKL play important roles in HHM.
Studies involving large groups of ATLL patients with and without hypercalcemia need to be analyzed for several hypercalcemic factors simultaneously so that any synergistic or cooperative roles played by the different cytokines in this syndrome can be better understood. There is also a great need for the development of new animal models to study both the molecular pathogenesis of HHM associated with ATLL and to test novel therapies for treating this life-threatening complication.
21 REFERENCE LIST
(1) Poiesz BJ, Ruscetti FW, Gazdar AF, Bunn PA, Minna JD, Gallo RC.
Detection and isolation of type C retrovirus particles from fresh and cultured
lymphocytes of a patient with cutaneous T-cell lymphoma. Proc Natl Acad Sci
U S A 1980; 77(12):7415-7419.
(2) Verdonck K, Gonzalez E, Van Dooren S, Vandamme AM, Vanham G,
Gotuzzo E. Human T-lymphotropic virus 1: recent knowledge about an
ancient infection. Lancet Infect Dis 2007; 7(4):266-281.
(3) Proietti FA, Carneiro-Proietti AB, Catalan-Soares BC, Murphy EL. Global
epidemiology of HTLV-I infection and associated diseases. Oncogene 2005;
24(39):6058-6068.
(4) Taylor GP, Matsuoka M. Natural history of adult T-cell leukemia/lymphoma
and approaches to therapy. Oncogene 2005; 24(39):6047-6057.
(5) Igakura T, Stinchcombe JC, Goon PK, Taylor GP, Weber JN, Griffiths GM,
Tanaka Y, Osame M, Bangham CR. Spread of HTLV-I between lymphocytes
by virus-induced polarization of the cytoskeleton. Science 2003;
299(5613):1713-1716.
(6) Matsuoka M, Jeang KT. Human T-cell leukemia virus type I at age 25: a
progress report. Cancer Res 2005; 65(11):4467-4470.
22 (7) Matsuoka M, Jeang KT. Human T-cell leukaemia virus type 1 (HTLV-1)
infectivity and cellular transformation. Nat Rev Cancer 2007; 7(4):270-280.
(8) Yoshida M. Multiple viral strategies of HTLV-1 for dysregulation of cell
growth control. Annu Rev Immunol 2001; 19:475-496.
(9) Yoshida M, Suzuki T, Fujisawa J, Hirai H. HTLV-1 oncoprotein tax and
cellular transcription factors. Curr Top Microbiol Immunol 1995; 193:79-89.
(10) Yoshida M. HTLV-1 oncoprotein Tax deregulates transcription of cellular
genes through multiple mechanisms. J Cancer Res Clin Oncol 1995; 121(9-
10):521-528.
(11) Marriott SJ, Semmes OJ. Impact of HTLV-I Tax on cell cycle progression and
the cellular DNA damage repair response. Oncogene 2005; 24(39):5986-5995.
(12) Kannagi M, Ohashi T, Harashima N, Hanabuchi S, Hasegawa A.
Immunological risks of adult T-cell leukemia at primary HTLV-I infection.
Trends Microbiol 2004; 12(7):346-352.
(13) Yasunaga J, Matsuoka M. Human T-cell leukemia virus type I induces adult
T-cell leukemia: from clinical aspects to molecular mechanisms. Cancer
Control 2007; 14(2):133-140.
(14) Younis I, Green PL. The human T-cell leukemia virus Rex protein. Front
Biosci 2005; 10:431-445.
23 (15) Younis I, Yamamoto B, Phipps A, Green PL. Human T-cell leukemia virus
type 1 expressing nonoverlapping tax and rex genes replicates and
immortalizes primary human T lymphocytes but fails to replicate and persist
in vivo. J Virol 2005; 79(23):14473-14481.
(16) Gaudray G, Gachon F, Basbous J, Biard-Piechaczyk M, Devaux C, Mesnard
JM. The complementary strand of the human T-cell leukemia virus type 1
RNA genome encodes a bZIP transcription factor that down-regulates viral
transcription. J Virol 2002; 76(24):12813-12822.
(17) Yasunaga J, Matsuoka M. Human T-cell leukemia virus type I induces adult
T-cell leukemia: from clinical aspects to molecular mechanisms. Cancer
Control 2007; 14(2):133-140.
(18) Albrecht B, Lairmore MD. Critical role of human T-lymphotropic virus type 1
accessory proteins in viral replication and pathogenesis. Microbiol Mol Biol
Rev 2002; 66(3):396-406, table.
(19) Uchiyama T. Human T cell leukemia virus type I (HTLV-I) and human
diseases. Annu Rev Immunol 1997; 15:15-37.
(20) Uchiyama T, Yodoi J, Sagawa K, Takatsuki K, Uchino H. Adult T-cell
leukemia: clinical and hematologic features of 16 cases. Blood 1977;
50(3):481-492.
24 (21) Shimoyama M. Diagnostic criteria and classification of clinical subtypes of
adult T-cell leukaemia-lymphoma. A report from the Lymphoma Study Group
(1984-87). Br J Haematol 1991; 79(3):428-437.
(22) Matsushima T, Yamamoto M, Sakai K. Multiple osteolysis of peripheral
extremities in a patient with adult T cell leukemia/lymphoma. Intern Med
1999; 38(10):820-823.
(23) Guise TA, Mundy GR. Cancer and bone. Endocr Rev 1998; 19(1):18-54.
(24) Chattopadhyay N, Mithal A, Brown EM. The calcium-sensing receptor: a
window into the physiology and pathophysiology of mineral ion metabolism.
Endocr Rev 1996; 17(4):289-307.
(25) Raisz LG, Mundy GR, Dietrich JW, Canalis EM. Hormonal regulation of
mineral metabolism. Int Rev Physiol 1977; 16:199-240.
(26) Parfitt AM. The actions of parathyroid hormone on bone: relation to bone
remodeling and turnover, calcium homeostasis, and metabolic bone disease.
Part IV of IV parts: The state of the bones in uremic hyperaparathyroidism--
the mechanisms of skeletal resistance to PTH in renal failure and
pseudohypoparathyroidism and the role of PTH in osteoporosis, osteopetrosis,
and osteofluorosis. Metabolism 1976; 25(10):1157-1188.
25 (27) Clines GA, Guise TA. Hypercalcaemia of malignancy and basic research on
mechanisms responsible for osteolytic and osteoblastic metastasis to bone.
Endocr Relat Cancer 2005; 12(3):549-583.
(28) Friedman J, Au WY, Raisz LG. Responses of fetal rat bone to thyrocalcitonin
in tissue culture. Endocrinology 1968; 82(1):149-156.
(29) Friedman J, Raisz LG. Thyrocalcitonin: inhibitor of bone resorption in tissue
culture. Science 1965; 150(702):1465-1467.
(30) Norman AW, Roth J, Orci L. The vitamin D endocrine system: steroid
metabolism, hormone receptors, and biological response (calcium binding
proteins). Endocr Rev 1982; 3(4):331-366.
(31) Guise TA, Mundy GR. Cancer and bone. Endocr Rev 1998; 19(1):18-54.
(32) Flanagan AM, Massey HM. Generating human osteoclasts in vitro from bone
marrow and peripheral blood. Methods Mol Med 2003; 80:113-128.
(33) Teitelbaum SL. Osteoclasts: what do they do and how do they do it? Am J
Pathol 2007; 170(2):427-435.
(34) Roato I, Grano M, Brunetti G, Colucci S, Mussa A, Bertetto O, Ferracini R.
Mechanisms of spontaneous osteoclastogenesis in cancer with bone
involvement. FASEB J 2005; 19(2):228-230.
26 (35) Yasuda H, Shima N, Nakagawa N, Yamaguchi K, Kinosaki M, Mochizuki S,
Tomoyasu A, Yano K, Goto M, Murakami A, Tsuda E, Morinaga T, Higashio
K, Udagawa N, Takahashi N, Suda T. Osteoclast differentiation factor is a
ligand for osteoprotegerin/osteoclastogenesis-inhibitory factor and is identical
to TRANCE/RANKL. Proc Natl Acad Sci U S A 1998; 95(7):3597-3602.
(36) Theill LE, Boyle WJ, Penninger JM. RANK-L and RANK: T cells, bone loss,
and mammalian evolution. Annu Rev Immunol 2002; 20:795-823.
(37) Roodman GD. Regulation of osteoclast differentiation. Ann N Y Acad Sci
2006; 1068:100-109.
(38) Simonet WS, Lacey DL, Dunstan CR, Kelley M, Chang MS, Luthy R, Nguyen
HQ, Wooden S, Bennett L, Boone T, Shimamoto G, DeRose M, Elliott R,
Colombero A, Tan HL, Trail G, Sullivan J, Davy E, Bucay N, Renshaw-Gegg
L, Hughes TM, Hill D, Pattison W, Campbell P, Sander S, Van G, Tarpley J,
Derby P, Lee R, Boyle WJ. Osteoprotegerin: a novel secreted protein involved
in the regulation of bone density. Cell 1997; 89(2):309-319.
(39) Mundy GR, Guise TA. Hypercalcemia of malignancy. Am J Med 1997;
103(2):134-145.
(40) Mundy GR, Guise TA. Hormonal control of calcium homeostasis. Clin Chem
1999; 45(8 Pt 2):1347-1352.
27 (41) Rosol TJ, Capen CC. Mechanisms of cancer-induced hypercalcemia. Lab
Invest 1992; 67(6):680-702.
(42) Kiyokawa T, Yamaguchi K, Takeya M, Takahashi K, Watanabe T,
Matsumoto T, Lee SY, Takatsuki K. Hypercalcemia and osteoclast
proliferation in adult T-cell leukemia. Cancer 1987; 59(6):1187-1191.
(43) Burtis WJ, Wu TL, Insogna KL, Stewart AF. Humoral hypercalcemia of
malignancy. Ann Intern Med 1988; 108(3):454-457.
(44) Matsushima T, Yamamoto M, Sakai K. Multiple osteolysis of peripheral
extremities in a patient with adult T cell leukemia/lymphoma. Intern Med
1999; 38(10):820-823.
(45) Tabata M, Takahashi H, Izumi T, Komatsu N, Tsunoda J, Yoshida M, Nakama
S, Kuriki K, Saito K, Hatake K, Miura Y. Adult T cell leukemia lymphoma
(ATL) localized in the right tibial bone. Leuk Lymphoma 1999; 35(1-2):189-
192.
(46) Anzai S, Takayasu S, Fujiwara S, Tateyama M, Taira H, Takashita M.
Elevation of IL-6 in ATL patient with a pathological fracture. J Dermatol
2002; 29(10):644-647.
(47) Yamamoto Y, Ishii K, Nomura S, Fukuhara S. [Adult T-cell
leukemia/lymphoma of bone with multiple pathological fractures]. Rinsho
Ketsueki 2004; 45(3):247-249. 28 (48) Wysolmerski JJ, Broadus AE. Hypercalcemia of malignancy: the central role
of parathyroid hormone-related protein. Annu Rev Med 1994; 45:189-200.
(49) Stewart AF, Horst R, Deftos LJ, Cadman EC, Lang R, Broadus AE.
Biochemical evaluation of patients with cancer-associated hypercalcemia:
evidence for humoral and nonhumoral groups. N Engl J Med 1980;
303(24):1377-1383.
(50) Nguyen L, Dewhirst FE, Hauschka PV, Stashenko P. Interleukin-1 beta
stimulates bone resorption and inhibits bone formation in vivo. Lymphokine
Cytokine Res 1991; 10(1-2):15-21.
(51) Dewhirst FE, Stashenko PP, Mole JE, Tsurumachi T. Purification and partial
sequence of human osteoclast-activating factor: identity with interleukin 1
beta. J Immunol 1985; 135(4):2562-2568.
(52) Gowen M, Mundy GR. Actions of recombinant interleukin 1, interleukin 2,
and interferon-gamma on bone resorption in vitro. J Immunol 1986;
136(7):2478-2482.
(53) Shirakawa F, Yamashita U, Tanaka Y, Watanaba K, Sato K, Haratake J,
Fujihira T, Oda S, Eto S. Production of bone-resorbing activity corresponding
to interleukin-1 alpha by adult T-cell leukemia cells in humans. Cancer Res
1988; 48(15):4284-4287.
29 (54) Mori N, Shirakawa F, Saito K, Murakami S, Oda S, Eto S. Transactivation of
the interleukin-1 alpha gene promoter by human T-cell leukemia virus type I
tax in T cells. Blood 1994; 84(5):1688-1689.
(55) Wano Y, Hattori T, Matsuoka M, Takatsuki K, Chua AO, Gubler U, Greene
WC. Interleukin 1 gene expression in adult T cell leukemia. J Clin Invest
1987; 80(3):911-916.
(56) Pfeilschifter J, Chenu C, Bird A, Mundy GR, Roodman GD. Interleukin-1 and
tumor necrosis factor stimulate the formation of human osteoclastlike cells in
vitro. J Bone Miner Res 1989; 4(1):113-118.
(57) Roodman GD. Cell biology of the osteoclast. Exp Hematol 1999; 27(8):1229-
1241.
(58) Ishimi Y, Miyaura C, Jin CH, Akatsu T, Abe E, Nakamura Y, Yamaguchi A,
Yoshiki S, Matsuda T, Hirano T, . IL-6 is produced by osteoblasts and induces
bone resorption. J Immunol 1990; 145(10):3297-3303.
(59) Barhoum M, Hutchins L, Fonseca VA. Intractable hypercalcemia due to a
metastatic carcinoid secreting parathyroid hormone-related peptide and
interleukin-6: response to octreotide. Am J Med Sci 1999; 318(3):203-205.
(60) Ueno M, Ban S, Nakanoma T, Tsukamoto T, Nonaka S, Hirata R, Iida M,
Deguchi N. Hypercalcemia in a patient with renal cell carcinoma producing
30 parathyroid hormone-related protein and interleukin-6. Int J Urol 2000;
7(6):239-242.
(61) Roodman GD. Myeloma bone disease: pathogenesis and treatment. Oncology
(Williston Park) 2005; 19(8):983-4, 986.
(62) Matsushima T, Yamamoto M, Sakai K. Multiple osteolysis of peripheral
extremities in a patient with adult T cell leukemia/lymphoma. Intern Med
1999; 38(10):820-823.
(63) Anzai S, Takayasu S, Fujiwara S, Tateyama M, Taira H, Takashita M.
Elevation of IL-6 in ATL patient with a pathological fracture. J Dermatol
2002; 29(10):644-647.
(64) Yamashita I, Katamine S, Moriuchi R, Nakamura Y, Miyamoto T, Eguchi K,
Nagataki S. Transactivation of the human interleukin-6 gene by human T-
lymphotropic virus type 1 Tax protein. Blood 1994; 84(5):1573-1578.
(65) Kurihara N, Bertolini D, Suda T, Akiyama Y, Roodman GD. IL-6 stimulates
osteoclast-like multinucleated cell formation in long term human marrow
cultures by inducing IL-1 release. J Immunol 1990; 144(11):4226-4230.
(66) Kwan TS, Padrines M, Theoleyre S, Heymann D, Fortun Y. IL-6, RANKL,
TNF-alpha/IL-1: interrelations in bone resorption pathophysiology. Cytokine
Growth Factor Rev 2004; 15(1):49-60.
31 (67) De La MJ, Uy HL, Guise TA, Story B, Boyce BF, Mundy GR, Roodman GD.
Interleukin-6 enhances hypercalcemia and bone resorption mediated by
parathyroid hormone-related protein in vivo. J Clin Invest 1995; 95(6):2846-
2852.
(68) Ibbotson KJ, Twardzik DR, D'Souza SM, Hargreaves WR, Todaro GJ, Mundy
GR. Stimulation of bone resorption in vitro by synthetic transforming growth
factor-alpha. Science 1985; 228(4702):1007-1009.
(69) Ishibashi K, Ishitsuka K, Chuman Y, Otsuka M, Kuwazuru Y, Iwahashi M,
Utsunomiya A, Hanada S, Sakurami T, Arima T. Tumor necrosis factor-beta
in the serum of adult T-cell leukemia with hypercalcemia. Blood 1991;
77(11):2451-2455.
(70) Stashenko P, Dewhirst FE, Peros WJ, Kent RL, Ago JM. Synergistic
interactions between interleukin 1, tumor necrosis factor, and lymphotoxin in
bone resorption. J Immunol 1987; 138(5):1464-1468.
(71) Lacey DL, Tan HL, Lu J, Kaufman S, Van G, Qiu W, Rattan A, Scully S,
Fletcher F, Juan T, Kelley M, Burgess TL, Boyle WJ, Polverino AJ.
Osteoprotegerin ligand modulates murine osteoclast survival in vitro and in
vivo. Am J Pathol 2000; 157(2):435-448.
(72) Yamada Y, Ohmoto Y, Murata K, Tsukasaki K, Momita S, Kamihira S,
Atogami S, Sohda H, Moriuchi Y, Itoyama T, . Increased plasma M-CSF
32 concentration in patients with adult T cell leukemia: clinical correlation. Leuk
Lymphoma 1994; 14(1-2):151-156.
(73) Nosaka K, Miyamoto T, Sakai T, Mitsuya H, Suda T, Matsuoka M.
Mechanism of hypercalcemia in adult T-cell leukemia: overexpression of
receptor activator of nuclear factor kappaB ligand on adult T-cell leukemia
cells. Blood 2002; 99(2):634-640.
(74) Roodman GD. Mechanisms of bone lesions in multiple myeloma and
lymphoma. Cancer 1997; 80(8 Suppl):1557-1563.
(75) Breslau NA, McGuire JL, Zerwekh JE, Frenkel EP, Pak CY. Hypercalcemia
associated with increased serum calcitriol levels in three patients with
lymphoma. Ann Intern Med 1984; 100(1):1-6.
(76) Fetchick DA, Bertolini DR, Sarin PS, Weintraub ST, Mundy GR, Dunn JF.
Production of 1,25-dihydroxyvitamin D3 by human T cell lymphotrophic
virus-I-transformed lymphocytes. J Clin Invest 1986; 78(2):592-596.
(77) Dodd RC, Winkler CF, Williams ME, Bunn PA, Gray TK. Calcitriol levels in
hypercalcemic patients with adult T-cell lymphoma. Arch Intern Med 1986;
146(10):1971-1972.
(78) Guise TA, Mundy GR. Cancer and bone. Endocr Rev 1998; 19(1):18-54.
33 (79) Moseley JM, Kubota M, Diefenbach-Jagger H, Wettenhall RE, Kemp BE,
Suva LJ, Rodda CP, Ebeling PR, Hudson PJ, Zajac JD, . Parathyroid hormone-
related protein purified from a human lung cancer cell line. Proc Natl Acad Sci
U S A 1987; 84(14):5048-5052.
(80) Burtis WJ, Wu T, Bunch C, Wysolmerski JJ, Insogna KL, Weir EC, Broadus
AE, Stewart AF. Identification of a novel 17,000-dalton parathyroid hormone-
like adenylate cyclase-stimulating protein from a tumor associated with
humoral hypercalcemia of malignancy. J Biol Chem 1987; 262(15):7151-
7156.
(81) Strewler GJ, Stern PH, Jacobs JW, Eveloff J, Klein RF, Leung SC, Rosenblatt
M, Nissenson RA. Parathyroid hormonelike protein from human renal
carcinoma cells. Structural and functional homology with parathyroid
hormone. J Clin Invest 1987; 80(6):1803-1807.
(82) Wysolmerski JJ, Broadus AE. Hypercalcemia of malignancy: the central role
of parathyroid hormone-related protein. Annu Rev Med 1994; 45:189-200.
(83) Stewart AF, Broadus AE. Clinical review 16: Parathyroid hormone-related
proteins: coming of age in the 1990s. J Clin Endocrinol Metab 1990;
71(6):1410-1414.
(84) Kukreja SC, Shevrin DH, Wimbiscus SA, Ebeling PR, Danks JA, Rodda CP,
Wood WI, Martin TJ. Antibodies to parathyroid hormone-related protein
34 lower serum calcium in athymic mouse models of malignancy-associated
hypercalcemia due to human tumors. J Clin Invest 1988; 82(5):1798-1802.
(85) Motokura T, Fukumoto S, Takahashi S, Watanabe T, Matsumoto T, Igarashi
T, Ogata E. Expression of parathyroid hormone-related protein in a human T
cell lymphotrophic virus type I-infected T cell line. Biochem Biophys Res
Commun 1988; 154(3):1182-1188.
(86) Fukumoto S, Matsumoto T, Watanabe T, Takahashi H, Miyoshi I, Ogata E.
Secretion of parathyroid hormone-like activity from human T-cell
lymphotropic virus type I-infected lymphocytes. Cancer Res 1989;
49(14):3849-3852.
(87) Watanabe T, Yamaguchi K, Takatsuki K, Osame M, Yoshida M. Constitutive
expression of parathyroid hormone-related protein gene in human T cell
leukemia virus type 1 (HTLV-1) carriers and adult T cell leukemia patients
that can be trans-activated by HTLV-1 tax gene. J Exp Med 1990; 172(3):759-
765.
(88) Ikeda K, Inoue D, Okazaki R, Kikuchi T, Ogata E, Matsumoto T. Parathyroid
hormone-related peptide in hypercalcemia associated with adult T cell
leukemia/lymphoma: molecular and cellular mechanism of parathyroid
hormone-related peptide overexpression in HTLV-I-infected T cells. Miner
Electrolyte Metab 1995; 21(1-3):166-170.
35 (89) Ejima E, Rosenblatt JD, Ou J, Prager D. Parathyroid hormone-related protein
gene expression and human T cell leukemia virus-1 infection. Miner
Electrolyte Metab 1995; 21(1-3):143-147.
(90) Prager D, Rosenblatt JD, Ejima E. Hypercalcemia, parathyroid hormone-
related protein expression and human T-cell leukemia virus infection. Leuk
Lymphoma 1994; 14(5-6):395-400.
(91) Mori N, Ohsumi K, Murakami S, Wake A, Nakata K, Misago M, Oda S, Eto
S. [Urinary excretion of parathyroid hormone-related protein in patients with
adult T-cell leukemia and other hematologic disorders]. Rinsho Ketsueki
1992; 33(9):1158-1165.
(92) Imamura H, Koreeda Y, Okadome T, Tara M, Niina K, Shizume K, Ohsumi
K, Sato K. Urinary excretion of parathyroid hormone-related protein as a
predictor of hypercalcemia in patients with adult T-cell leukemia. Jpn J Clin
Oncol 1992; 22(5):325-330.
(93) Richard V, Rosol TJ, Foley J. PTHrP gene expression in cancer: do all paths
lead to Ets? Crit Rev Eukaryot Gene Expr 2005; 15(2):115-132.
(94) Richard V, Nadella MV, Green PL, Lairmore MD, Feuer G, Foley JG, Rosol
TJ. Transcriptional regulation of parathyroid hormone-related protein
promoter P3 by ETS-1 in adult T-cell leukemia/lymphoma. Leukemia 2005;
19(7):1175-1183.
36 (95) Ikeda K, Okazaki R, Inoue D, Ohno H, Ogata E, Matsumoto T. Interleukin-2
increases production and secretion of parathyroid hormone-related peptide by
human T cell leukemia virus type I-infected T cells: possible role in
hypercalcemia associated with adult T cell leukemia. Endocrinology 1993;
132(6):2551-2556.
(96) Ikeda K, Okazaki R, Inoue D, Ogata E, Matsumoto T. Transcription of the
gene for parathyroid hormone-related peptide from the human is activated
through a cAMP-dependent pathway by prostaglandin E1 in HTLV-I-infected
T cells. J Biol Chem 1993; 268(2):1174-1179.
(97) Watanabe T, Yamaguchi K, Takatsuki K, Osame M, Yoshida M. Constitutive
expression of parathyroid hormone-related protein gene in human T cell
leukemia virus type 1 (HTLV-1) carriers and adult T cell leukemia patients
that can be trans-activated by HTLV-1 tax gene. J Exp Med 1990; 172(3):759-
765.
(98) Weissglas MG, Schamhart DH, Lowik CW, Papapoulos SE, Theuns HM,
Kurth KH. The role of interleukin-6 in the induction of hypercalcemia in renal
cell carcinoma transplanted into nude mice. Endocrinology 1997;
138(5):1879-1885.
(99) Sato K, Fujii Y, Kasono K, Ozawa M, Imamura H, Kanaji Y, Kurosawa H,
Tsushima T, Shizume K. Parathyroid hormone-related protein and interleukin-
37 1 alpha synergistically stimulate bone resorption in vitro and increase the
serum calcium concentration in mice in vivo. Endocrinology 1989;
124(5):2172-2178.
(100) Rizzoli R, Feyen JH, Grau G, Wohlwend A, Sappino AP, Bonjour JP.
Regulation of parathyroid hormone-related protein production in a human lung
squamous cell carcinoma line. J Endocrinol 1994; 143(2):333-341.
(101) Richard V, Lairmore MD, Green PL, Feuer G, Erbe RS, Albrecht B, D'Souza
C, Keller ET, Dai J, Rosol TJ. Humoral hypercalcemia of malignancy: severe
combined immunodeficient/beige mouse model of adult T-cell lymphoma
independent of human T-cell lymphotropic virus type-1 tax expression. Am J
Pathol 2001; 158(6):2219-2228.
(102) Wake A, Tanaka Y, Nakatsuka K, Misago M, Oda S, Morimoto I, Eto S.
Calcium-dependent homotypic adhesion through leukocyte function-
associated antigen-1/intracellular adhesion molecule-1 induces interleukin-1
and parathyroid hormone-related protein production on adult T-cell leukemia
cells in vitro. Blood 1995; 86(6):2257-2267.
(103) Sourbier C, Massfelder T. Parathyroid hormone-related protein in human renal
cell carcinoma. Cancer Lett 2006; 240(2):170-182.
38 (104) McCauley LK, Rosol TJ, Merryman JI, Capen CC. Parathyroid hormone-
related protein binding to human T-cell lymphotropic virus type I-infected
lymphocytes. Endocrinology 1992; 130(1):300-306.
(105) Roodman GD. Regulation of osteoclast differentiation. Ann N Y Acad Sci
2006; 1068:100-109.
(106) Nosaka K, Miyamoto T, Sakai T, Mitsuya H, Suda T, Matsuoka M.
Mechanism of hypercalcemia in adult T-cell leukemia: overexpression of
receptor activator of nuclear factor kappaB ligand on adult T-cell leukemia
cells. Blood 2002; 99(2):634-640.
(107) Menten P, Wuyts A, Van Damme J. Macrophage inflammatory protein-1.
Cytokine Growth Factor Rev 2002; 13(6):455-481.
(108) Oba Y, Lee JW, Ehrlich LA, Chung HY, Jelinek DF, Callander NS, Horuk R,
Choi SJ, Roodman GD. MIP-1alpha utilizes both CCR1 and CCR5 to induce
osteoclast formation and increase adhesion of myeloma cells to marrow
stromal cells. Exp Hematol 2005; 33(3):272-278.
(109) Roodman GD, Choi SJ. MIP-1 alpha and myeloma bone disease. Cancer Treat
Res 2004; 118:83-100.
(110) Okada Y, Tsukada J, Nakano K, Tonai S, Mine S, Tanaka Y. Macrophage
inflammatory protein-1alpha induces hypercalcemia in adult T-cell leukemia.
J Bone Miner Res 2004; 19(7):1105-1111. 39 (111) Lairmore MD, Silverman L, Ratner L. Animal models for human T-
lymphotropic virus type 1 (HTLV-1) infection and transformation. Oncogene
2005; 24(39):6005-6015.
(112) Ruddle NH, Li CB, Horne WC, Santiago P, Troiano N, Jay G, Horowitz M,
Baron R. Mice transgenic for HTLV-I LTR-tax exhibit tax expression in bone,
skeletal alterations, and high bone turnover. Virology 1993; 197(1):196-204.
(113) Grossman WJ, Kimata JT, Wong FH, Zutter M, Ley TJ, Ratner L.
Development of leukemia in mice transgenic for the tax gene of human T-cell
leukemia virus type I. Proc Natl Acad Sci U S A 1995; 92(4):1057-1061.
(114) Gao L, Deng H, Zhao H, Hirbe A, Harding J, Ratner L, Weilbaecher K.
HTLV-1 Tax transgenic mice develop spontaneous osteolytic bone metastases
prevented by osteoclast inhibition. Blood 2005; 106(13):4294-4302.
(115) Takaori-Kondo A, Imada K, Yamamoto I, Kunitomi A, Numata Y, Sawada H,
Uchiyama T. Parathyroid hormone-related protein-induced hypercalcemia in
SCID mice engrafted with adult T-cell leukemia cells. Blood 1998;
91(12):4747-4751.
(116) Richard V, Lairmore MD, Green PL, Feuer G, Erbe RS, Albrecht B, D'Souza
C, Keller ET, Dai J, Rosol TJ. Humoral hypercalcemia of malignancy: severe
combined immunodeficient/beige mouse model of adult T-cell lymphoma
40 independent of human T-cell lymphotropic virus type-1 tax expression. Am J
Pathol 2001; 158(6):2219-2228.
(117) Richard V, Nadella MV, Green PL, Lairmore MD, Feuer G, Foley JG, Rosol
TJ. Transcriptional regulation of parathyroid hormone-related protein
promoter P3 by ETS-1 in adult T-cell leukemia/lymphoma. Leukemia 2005;
19(7):1175-1183.
(118) Insogna KL, Broadus AE. Hypercalcemia of malignancy. Annu Rev Med
1987; 38:241-256.
(119) Taylor GP, Matsuoka M. Natural history of adult T-cell leukemia/lymphoma
and approaches to therapy. Oncogene 2005; 24(39):6047-6057.
(120) Guise TA, Mundy GR. Cancer and bone. Endocr Rev 1998; 19(1):18-54.
(121) Mundy GR, Guise TA. Hypercalcemia of malignancy. Am J Med 1997;
103(2):134-145.
(122) Ishikawa C, Matsuda T, Okudaira T, Tomita M, Kawakami H, Tanaka Y,
Masuda M, Ohshiro K, Ohta T, Mori N. Bisphosphonate incadronate inhibits
growth of human T-cell leukaemia virus type I-infected T-cell lines and
primary adult T-cell leukaemia cells by interfering with the mevalonate
pathway. Br J Haematol 2007; 136(3):424-432.
41 (123) Heath DJ, Vanderkerken K, Cheng X, Gallagher O, Prideaux M, Murali R,
Croucher PI. An osteoprotegerin-like peptidomimetic inhibits osteoclastic
bone resorption and osteolytic bone disease in myeloma. Cancer Res 2007;
67(1):202-208.
(124) Onuma E, Sato K, Saito H, Tsunenari T, Ishii K, Esaki K, Yabuta N,
Wakahara Y, Yamada-Okabe H, Ogata E. Generation of a humanized
monoclonal antibody against human parathyroid hormone-related protein and
its efficacy against humoral hypercalcemia of malignancy. Anticancer Res
2004; 24(5A):2665-2673.
42 CHAPTER 2
EXPRESSION OF PARATHYROID HORMONE-RELATED PROTEIN
DURING IMMORTALIZATION OF HUMAN PERIPHERAL BLOOD
MONONUCLEAR CELLS BY HTLV-1: IMPLICATIONS IN
TRANSFORMATION
2.1 ABSTRACT
Although adult T-cell leukemia/lymphoma (ATLL) is initiated by infection with human T-lymphotropic virus type-1 (HTLV-1), additional host factors are required for T-cell transformation and development of ATLL. HTLV-1 Tax plays an important role in the transformation of lymphocytes; however, the exact mechanisms remain unclear. Parathyroid hormone-related protein (PTHrP) plays an important role in the pathogenesis of humoral hypercalcemia of malignancy (HHM) that occurs in the majority of ATLL patients. However, PTHrP is also up-regulated in HTLV-1-carriers and HTLV-1-associated myelopathy/tropical spastic paraparesis (HAM/TSP) patients with normocalcemia, indicating that PTHrP is expressed before malignant transformation of lymphocytes. The role of PTHrP in the transformation of lymphocytes by HTLV-1 infection has not been investigated. In this study, we report high levels of PTHrP expression during immortalization of lymphocytes due to
43 HTLV-1 infection using long-term co-culture assays. PTHrP expression did not
correlate temporally with expression of HTLV-1 Tax and other accessory proteins
known to regulate Tax. HTLV-1 infection also up-regulated the PTHrP receptor
(PTH1R) in peripheral blood mononuclear cells (PBMCs) indicating a potential
autocrine role for PTHrP. Furthermore, co-transfection of HTLV-1 expression
plasmids and PTHrP P2/P3-promoter-driven luciferase reporter plasmids
demonstrated that HTLV-1 mildly up-regulated PTHrP expression. This indicated that other cellular factors and/or events are required for increased expression of PTHrP in
ATLL cells. We also report that macrophage inflammatory protein-1α (MIP-1α), a cellular gene known to play an important role in the pathogenesis of HHM in ATLL patients, was highly expressed during early HTLV-1 infection indicating that its expression was enhanced due to activation of lymphocytes by HTLV-1 infection.
These data demonstrate that PTHrP and its receptor are up-regulated during immortalization of lymphocytes by HTLV-1 infection and may facilitate the transformation process.
2.2 INTRODUCTION
Human T-lymphotropic virus type I (HTLV-I) is the etiological agent of adult T-cell leukemia/lymphoma (ATLL), HTLV-1-associated myelopathy/tropical spastic paraparesis (HAM/TSP) and a variety of other disorders(1,2). Approximately 10-20 million people worldwide are infected with HTLV-1(3). HTLV-1 predominantly exists
44 as a cell-associated provirus and cell-free infection is inefficient(4). Transmission occurs via cell-cell contact through exposure to contaminated blood, sexual contact, or from mother to child either transplacentally or by infected lymphocytes in breast milk(5).
ATLL is an aggressive malignancy of CD4+ T cells that occurs in approximately 5% of infected individuals after a long latency period of 20–40 years; however the majority of HTLV-1-infected individuals are lifelong asymptomatic carriers of the virus(6). The long latent period and the relatively low proportion of HTLV-1-infected
people developing ATLL reflects the inefficiency of the virus to transform cells and
the need for multiple cooperative changes in growth control mechanisms to induce
leukemogenesis. ATLL cells are typically clonal and contain a single or multiple
copies of integrated provirus. HTLV-1 is a complex deltaretrovirus and its genome
not only encodes for the essential viral proteins Gag, Pol, and Env, but also additional
HTLV-1-specific regulatory proteins Tax and Rex, several accessory proteins p12,
p13, p30 and a minus-strand encoded protein, HTLV-1 bZIP-factor (HBZ)(7).
Although the precise mechanisms underlying transformation are not completely understood, the 40-kDa transcriptional trans-activator Tax is considered the viral oncogene and is thought to be mainly responsible for tumorigenesis(8). In addition to activating transcription from the viral long terminal repeat, Tax activates the expression of multiple cellular genes, which either encode proteins involved in the regulation of cellular proliferation such as interleukin 2 (IL-2)(9), IL-2 receptor α
chain(10), and proliferating cell nuclear antigen (PCNA)(11) or are proto-oncogenes
45 such as c-fos(12) and c-sis(13). Furthermore, Tax interacts with numerous proteins to
deregulate cellular processes including transcription, cell cycle regulation, DNA
repair, and apoptosis(14).
The ability to activate cellular genes, including proto-oncogenes, is a key mechanism leading to immortalization and transformation of HTLV-1-infected cells.
Rex regulates the expression of incompletely spliced viral RNAs by the interaction of the Rex response element in the viral RNA and cellular proteins used by CRM- dependent nuclear export(15). Although Rex is not required for immortalization of
lymphocytes in vitro, it is required for infectivity and persistence in vivo(16). The accessory genes p12, p30, p13 and HBZ contribute to establishing persistent viral infection in vivo but are not required for transformation of cells in vitro(17;18).
About 80% of ATLL patients develop humoral hypercalcemia of malignancy
(HHM), a life-threatening paraneoplastic syndrome, that occurs in a wide variety of cancers in addition to ATLL(19). ATLL cells express factors that directly and/or indirectly stimulate osteoclast differentiation and activity, such as interleukin-1, tumor necrosis factor β, parathyroid hormone-related protein (PTHrP), macrophage inflammatory protein-1α and receptor activator of nuclear factor-κB ligand (RANKL), that have been associated with induction of hypercalcaemia(20-24). PTHrP has been shown to play a central role in the pathogenesis of HHM in ATLL patients(25).
However, there is only a weak correlation between hypercalcemia and PTHrP expression. PTHrP expression was detected in asymptomatic HTLV-1-carriers and
HAM/TSP patients with no evidence of hypercalcemia, which suggests that PTHrP is
46 expressed before malignant transformation of lymphocytes(26). Moreover, ATLL cell
adhesion up-regulated PTHrP expression(27) indicating additional roles for PTHrP
besides its central role in the pathogenesis of HHM. PTHrP, although initially
discovered for its role in HHM, is known to regulate a wide variety of cellular
functions including apoptosis and proliferation(28-30).
The goal of this study was to investigate the expression of PTHrP, its receptor, and other factors during the early stages of immortalization of human lymphocytes by
HTLV-1. Using long-term immortalization and transformation assays we showed that
PTHrP and PTH1R were expressed early in immortalization of lymphocytes. PTHrP expression was independent of HTLV-1 viral gene expression and IL-2 stimulation.
Co-transfection of HTLV-1 with a PTHrP P2/P3 luciferase reporter showed that
PTHrP was up-regulated by HTLV-1 infection. In addition, Rex alone or in the context of the provirus, increased PTHrP expression indicating that Rex might play an important role in the up-regulation of PTHrP during HTLV-1 infection.
2.3 MATERIALS AND METHODS
Cells
293T cells were maintained in Dulbecco’s modified Eagle medium (DMEM) medium
supplemented with 10% fetal bovine serum (FBS), 2 mM glutamine, penicillin (100
U/mL), and streptomycin (100 µg/mL). PBMCs were isolated from blood of healthy
47 donors by centrifugation over Ficoll-paque (Pharmacia, Piscataway, NJ). PBMCs
were cultured in RPMI 1640 medium supplemented with 20% FBS, 2 mM glutamine,
and antibiotics in the presence or absence of 10 U/mL IL-2 (Boehringer Mannheim,
Mannheim, Germany).
Long-term immortalization and transformation assays
Immortalization and transformation assays were performed as described
previously(31). Briefly, 2 x 106 PBMCs were cultured alone or co-cultured with 106
SLB-1 producer cells irradiated with 10,000 rad in 24-well culture plates in the
absence or presence of 10 U/mL human IL-2 (hIL-2) for transformation or immortalization assay, respectively. Viable cells were counted weekly by trypan blue
exclusion. Cells that continued to produce p19 Gag antigen and proliferate 12 weeks
after co-culture in the presence of exogenous IL-2 were identified as HTLV-1- immortalized (IMM-1, IMM-2, IMM-3) and in the absence of exogenous IL-2 as
HTLV-1-transformed cells (TRAN-1, TRAN-2). PBMCs cultured alone (PBMC-1,
PBMC-2) or the in the presence of IL-2 (PBMC-1 + IL-2, PBMC-2 + IL-2) or phytohemagglutinin (PHA) (PBMC-1+PHA, PBMC-2 + PHA) without HTLV-1 infection were used as controls.
Real time RT-PCR
Total RNA was extracted using TRIZOL® Reagent (Invitrogen, CA). To measure the total PTHrP, 1 µg RNA was reverse-transcribed and submitted for real-time RT-PCR
48 analysis using TaqMan® Gene Expression assays (4331182, Applied Biosystems,
CA). β2M (4333766, Applied Biosystems) was used as a reference gene. PTHrP P2 and P3 promoter-initiated transcripts and PTHR1 were measured as described previously(32;33). HTLV-1 viral transcripts p13, p30 and HBZ were measured as
previously described(34) except that SYBR Green technique was used instead of the
TaqMan assays.
PTHrP Immunoradiometric Assay
PTHrP concentrations were measured in the conditioned medium using a two-site
immunoradiometric assay (DSL, Webster, TX) specific for the PTHrP N-terminal region (amino acids 1 to 40) and mid-region (amino acids 57 to 80).
Enzyme Linked Immunosorbant Assays
p19 Gag protein in the culture supernatant was measured using a commercially
available ELISA kit (Zeptometrix, Buffalo, NY). MIP-1α protein in the conditioned medium was measured using Quantikine Human CCL3/MIP-1α Immunoassay (R&D systems, Minneapolis, MN).
Plasmids and transfections
The PTHrP P2/P3 luciferase construct was made by cloning the PTHrP P2/P3 promoter fragment (-1120 Bam H1 to +1 Hind III) into pGL2 basic vector. ACH,
PcTax, BCRex, HBZ plasmids were obtained from the laboratory of Dr. Patrick
49 Green (The Ohio State University). P12, p13 and p30 expression plasmids were
obtained from the laboratory of Dr. Michael Lairmore (The Ohio State University).
293T cells were transfected with either PTHrP P2/P3 PGL2 Luc plasmid alone or
with ACH, PcTax, BCRex, HBZ, p12, p13, p30. pcDNA-3.1 was used as a “filler”
plasmid so that the total amount of DNA would be the same in all transfection groups.
The plasmid pβgal-Control Vector (250 ng) was included in each transfection and served as an internal control to correct for transfection efficiency. Luciferase activity was measured with the Luciferase Assay System (Promega, Madison, WI) using 40 µl of lysate. Simultaneously, β-galactosidase activity was measured with the
Luminescent β-Galactosidase Detection Kit II (BD Biosciences).
Statistical analyses
For the co-culture and transfection experiments, several independent measurements were taken across time and thus ANOVA models were used to study the effects of time, treatment and the interaction between time and treatment. The square-root transformation was used for cell number and MIP-1α data to achieve normality and homogeneous variances. Dunnett’s method was used to adjust for multiple comparisons versus control group. For PTHrP mRNA fold changes, some of the treatments were zero after the 3rd week (PBMC, PBMC+IL2, PBMC+PHA). Non- parametric method (Wilcoxon sum rank) was used for the comparison among non- zero groups to the zero groups.A p value less than 0.05 was considered significant.
50 2.4 RESULTS
HTLV-1-infected PBMCs proliferate beyond six weeks
To investigate the expression of PTHrP early in HTLV-1 infection, we used long-term
co-culture assays of PBMCs from healthy human donors in the presence or absence of
irradiated HTLV-1 producer cells (SLB-1). Viable cells were counted by typan blue
exclusion and the results are shown in Figure 2.1A. Irradiated SLB-1 cells lived up to
1 week in culture. PBMCs, in the absence of stimulation with either IL-2 or PHA,
progressively decreased in numbers and failed to grow in vitro as expected(35).
PBMCs supplemented with IL-2 or PHA lived and proliferated up to 4 weeks in culture, at which time they entered a “growth crisis” phase and decreased in numbers and did not live beyond 6 weeks in culture. In contrast, HTLV-1-infected PBMCs continued to proliferate beyond 6 weeks for up to at least 13 weeks in culture. Cells that continued to proliferate beyond 8-9 weeks in culture in the absence of exogenous
IL-2 were referred to as transformed cells (TRAN-1 and -2) and in the presence of IL-
2 were referred to as immortalized cells (IMM-1, -2 and -3). High levels of p19 Gag protein were detected at very high levels throughout the co-culture demonstrating viral production (Figure 2.1B)
PTHrP was up-regulated during immortalization of PBMCs with HTLV-1
To determine the temporal expression of PTHrP during immortalization of PBMCs with HTLV-1, PTHrP mRNA and protein expression were analyzed at various time
51 points from the long-term co-culture assays (Figure 2.2). Freshly isolated PBMCs
expressed barely detectable PTHrP. There was no increase in PTHrP mRNA or
protein expression in unstimulated PBMCs in culture. IL-2 stimulation up-regulated
PTHrP mRNA expression in the first week (3.8- and 12-fold) compared to
unstimulated PBMCs. Beyond 1 week there was no up-regulation of PTHrP mRNA in
the IL-2-stimulated PBMCs. Although there was an increase in the PTHrP mRNA
expression due to IL-2 stimulation, PTHrP protein (2.6 pM) was detected only in one
of the samples (PBMC-1 + IL-2). No increase in PTHrP mRNA and protein occured with PHA stimulation of PBMCs. In contrast, HTLV-1 infection markedly up- regulated PTHrP mRNA expression compared to the uninfected PBMCs. In the immortalization assays, PTHrP mRNA was up-regulated 300- to 500-fold compared
to un-infected PBMCs at day 0. In the transformation assays, PTHrP mRNA was up-
regulated 1300- to 3800-fold compared to uninfected PBMCs at day 0. PTHrP protein
was detectable in the conditioned medium 1 week following co-culture with HTLV-1
producer cells and peak PTHrP protein expression was detected between weeks 10
and 13 post-infection. For the immortalization assays, peak PTHrP protein expression ranged from 153 to 212 pM and in the transformation assays it ranged from 130 to
160 pM.
Up-regulation of PTHrP was mediated by the PTHrP P2 and P3 promoters
PTHrP is regulated by three distinct promoters that are transactivated by divergent
cellular signal transduction pathways(36). To understand the molecular mechanisms
52 involved in the transcriptional up-regulation of PTHrP following HTLV-1 infection,
we investigated the preferential promoter usage using real time RT-PCR to detect
specific promoter-initiated transcripts. As shown in Figure 2.3, there was preferential
usage of the PTHrP P2 and P3 promoters during immortalization and transformation.
However the ratio of P2 to P3 promoter-initiated transcripts was at least 2-fold higher
during immortalization and transformation of PBMCs with HTLV-1 (1:2) (Figure
2.3A-E) compared to transformed MT-2 cells (1:4) (Figure 2.3E).
HTLV-1 infection up-regulated PTH1R expression
Since many of the biological properties of PTHrP are the result of its interaction with
the PTH1R, which is coupled to adenylyl cyclase (AC) and/or phospholipase C (PLC)
and subsequent signaling pathways(37;38), we analyzed the expression of PTH1R during immortalization and transformation of PBMCs with HTLV-1. As shown in
Figure 2.4A, there was very low PTH1R expression in freshly isolated PBMCs.
Stimulation of PBMCs with IL-2 or PHA did not up-regulate PTH1R. However, following infection with HTLV-1 there was marked induction of PTH1R in PMBCs.
We also analyzed the expression of PTH1R in various HTLV-1-infected and ATLL cells. As shown in Figure 2.4B, HTLV-1-negative Jurkat cells did not express
PTH1R.
High Tax-expressing HTLV-1-positive cells (MT-2, SLB-1, HT-1RV) expressed
moderate levels of PTH1R. ATLL cells (Met-1 and RV-ATL) did not express
PTH1R.
53
PTHrP expression did not correlate with HTLV-1 viral transcripts
HTLV-1 Tax has been shown to transactivate PTHrP; however, ATLL cells that lack
significant Tax expression have very high levels of PTHrP indicating that PTHrP can be expressed in a Tax-independent manner(39). To investigate the basis for up-
regulation of PTHrP due to HTLV-1 infection we analyzed by quantitative real-time
RT-PCR the temporal expression of HTLV-1 viral transcript Tax and other HTLV-1
viral accessory proteins known to regulate Tax expression (Figure 2.5). The high
HTLV-1 viral transcript expression during the first week in the co-cultures (data not
shown) was contributed by the residual live irradiated SLB-1 cells. After the first
week, the decline in the viral gene expression correlated with the death of the
irradiated SLB-1 cells and the subsequent viral gene expression was from the HTLV-
1-infected PBMCs. Among the viral transcripts analyzed, Tax expression was the
greatest. Tax mRNA expression increased from 3 to 7 weeks and then decreased
between 9-11 weeks post-infection (Figure 5A). HTLV-1 accessory genes, p30 and
HBZ have been shown to regulate Tax expression(40-42). In order to determine if the expression of any of these genes that regulate Tax expression correlated with PTHrP expression, we analyzed the expression pattern of p13, p30 and HBZ mRNAs using quantitative real-time RT-PCR. As shown in figure 2.5B-D, the expression of the accessory genes was lower than that of Tax expression. Among the accessory genes analyzed, the expression patterns of these genes did not correlate with the expression of PTHrP.
54
HTLV-1 infection and HTLV-1 Rex up-regulated PTHrP expression
In order to investigate the direct effect of each of the HTLV-1 viral proteins on
PTHrP expression, we co-transfected a PTHrP P2/P3 promoter-driven luciferase
plasmid with an HTLV-1 expression plasmid (ACH) and/or expression plasmids for
p12, p13, p30, Tax, Rex and HBZ (Figure 2.6). Infection with HTLV-1 up-regulated
PTHrP expression only 1.6-fold 48 h after transfection. The expression of HTLV-1-
p12, p13, p30, HBZ or Tax did not alter PTHrP expression (Figure 2.6A). Co-
expression of Rex and ACH up-regulated PTHrP expression, and expression of Rex
alone up-regulated PTHrP. Over-expression of p12, p13, p30, HBZ or Tax along with
the ACH plasmid did not up-regulate PTHrP expression (Figure 2.6B).
MIP-1α expression correlated with activation of PBMCs following HTLV-1
infection
Since PTHrP was specifically up-regulated during the immortalization of PBMCs
with HTLV-1, we also measured the expression of MIP-1α, another chemokine known to be involved the pathogenesis of HHM in ATLL patients. As shown in
Figure 2.7, MIP-1α expression was induced by IL-2 (4- to 14-fold) or PHA (3- to 9- fold) stimulation of PBMCs as expected(43;44). However, there was marked up- regulation of MIP-1α in the first week post co-culture in PBMCs infected with
HTLV-1.
55 The expression of MIP-1α in the immortalization assays ranged from 10,000 to
46,000 pg/mL and in the transformation assays the expression was about 45,000 pg/mL.After the peak induction of MIP-1α at week 1, there was consistent, although lower, MIP-1α expression at all later time points.
2.5 DISCUSSION
Although HTLV-1 Tax is known to have pleotropic effects that either directly or indirectly contribute to immortalization and transformation of infected T-cells, the exact mechanisms of transformation are unclear. In this study we analyzed temporal
PTHrP gene expression during virus-mediated immortalization of lymphocytes to characterize its role in the transformation process. We present data to show that
PTHrP is markedly up-regulated during the immortalization process.
An important step in HTLV-1-induced leukemogenesis is the induction of abnormal
T-cell growth. Long-term immortalization assays have been used to study the kinetics of HTLV-1 infection and abnormal T-cell growth that leads to transformation. The growth curves in our study are similar to previous reports that PBMCs cultured in the presence of IL-2, but not exposed to the virus, survived in vitro only for a few weeks.
Following exposure to HTLV-1, PBMCs initially underwent a proliferative response due to HTLV-1 infection after which the cells entered a “growth crisis” between weeks 5-7 followed by expansion resulting in the immortalized cells. The high levels of HTLV-1 p19 antigen expression in the first few weeks of co-culture was likely
56 contributed by the irradiated SLB-1 cells, however the p19 expression following three
weeks in culture was from the newly infected PBMCs and was indicative of active
HTLV-1 viral infection.
Although PTHrP was discovered for its role in the pathogenesis of HHM, PTHrP is
now known to be a complex factor with various properties and a broad range of
physiologic and/or pathophysiologic actions in different cells and tissues. Watanabe et
al. have shown that PTHrP was constitutively expressed in HTLV-1-carriers and
ATLL patients with or without hypercalcemia. Moreover, homotypic ATLL cell
adhesion up-regulated PTHrP expression, which supported a unique role for PTHrP in
the pathogenesis of ATLL. In this study, we investigated the expression of PTHrP
during transformation of lymphocytes following early HTLV-1 infection using long- term immortalization assays. Our data showed that PTHrP mRNA expression was gradually up-regulated in PBMCs following HTLV-1 infection; however, marked expression of PTHrP protein occured at the time when the PBMCs were undergoing immortalization. This supports an important role for PTHrP during immortalization and the subsequent transformation process. There was some discrepancy between
PTHrP mRNA and protein expression. This is likely due to differences in the translation, processing of the mature protein, and/or its secretion from the cells.
Secretion of PTHrP is a complex process and it has been shown that some PTHrP is not secreted, but can be targeted to the nucleus and function in an intracrine fashion(45).
57
Motokura et al have shown that PTHrP gene expression was induced in close
association with transformation of normal rat embryo fibroblasts by co-transfection with an activated ras gene and a mutated p53 gene(46). Insogna et al. have shown that
PTHrP induced transformation of rat fibroblasts in conjunction with epidermal growth
factor(47). Moreover, co-transfection of rat embryonic fibroblasts with tax and ras
transformed the fibroblasts and they were highly tumorigenic in vivo(48). Based on these reports, it is possible that PTHrP can function as a transforming factor in
conjunction with other oncogenes.
PTHrP has been shown to be an auto/paracrine cell growth regulator that increases
proliferation of several cell types including chondrocytes and renal epithelial cells(49).
PTHrP is known to stimulate proliferation through the PTH1R via mechanisms involving both PKA and PKC signaling pathways. It has been shown that anti-PTHrP antibodies or PTH1R antagonists inhibited the growth of cells(50). In our investigation,
the induction of both PTH1R and PTHrP by HTLV-1 suggests that PTHrP may have
functioned as an autocrine growth regulator in the transformation process.
PTHrP is a complex gene that is regulated by three distinct promoters P1, P2 and P3
and transactivated by diverse cellular signal transduction pathways. We and others
have shown that the P3 promoter in ATLL cells is regulated by the ETS signaling
pathway(51) and recently have shown that the P2 promoter is regulated by the NF-κB
58 pathway(52). Our data, in this investigation demonstrated that PTHrP was up-regulated
during immortalization by the P2 and P3 promoters. The ratio of the P2/P3 promoter-
initiated transcripts during the immortalization phase was higher (1:2) than in the
transformed cells (MT-2; 1:4) or ATLL cells (data not presented) (53). NF-κB is known to play an important role during the immortalization process and our data showed that the P2 promoter was highly expressed during immortalization. This suggests that NF-κB activity known to play an important role in the transformation process transactivated the PTHrP P2 promoter.
HTLV-1 tax has been shown to transactivate PTHrP; however, ATLL cells with no significant Tax expression have very high levels of PTHrP. Recently, we have shown that Tax mRNA expression was inversely proportional to PTHrP mRNA expression and PTHrP can be regulated in a Tax-independent manner in ATLL cells(54). To investigate possible mechanisms for up-regulation of PTHrP in our co-culture assays, we measured the expression of Tax/Rex mRNA. Our data showed that there was no correlation between PTHrP and Tax/Rex mRNA expression. Thus, induction of
PTHrP could either be an indirect effect of Tax or possibly due to a Tax-independent
mechanism. Tax expression has been shown to be regulated by HTLV-1 p13, p30 and
HBZ(55). To investigate the possible effect of any of these viral genes on PTHrP expression, we analyzed their expression in the co-cultures and our data showed that the expression pattern of these genes did not correlate with PTHrP.
59 Data from the transfection experiments showed that HTLV-1 infection up-regulated
PTHrP expression mildly and suggests that additional cellular events are required for
the dramatic PTHrP expression seen in ATLL cells. Alternatively, PTHrP expression might be dependent on cell-type and require lymphocyte-specific factors for marked up-regulation. Interestingly, over-expression of either p12, p13, p30 or Tax did not up-regulate PTHrP while over-expression of Rex alone resulted in the up-regulation of PTHrP. Over-expression of the viral genes in the context of the provirus showed that Tax decreased PTHrP expression whereas over-expression of Rex in the context of the provirus up-regulated PTHrP. Interestingly, Rex and PTHrP have a similar nuclear localization signal and can bind to importin β(56;57). Therefore, the increased
expression of PTHrP in the presence of Rex may have been due to increased nuclear
export of PTHrP or alternatively could be due to the increased PTHrP mRNA stability
since Rex has been shown to increase mRNA stability of genes such as IL-2Rα(58).
Finally, the data from the transfection experiments correlated with the PTHrP expression data from co-culture experiments. The data demonstrated that HTLV-1 infection increased PTHrP expression and cellular transformation was associated with marked up-regulation of PTHrP.
We analyzed the expression of MIP-1α, another cellular gene that is known to play an important role in the pathogenesis of HHM, in the co-cultures. The data showed that MIP-1α was markedly up-regulated as early as 1 week following HTLV-1 infection of PBMCs. These data are in agreement with reports(59) that showed MIP-1α
60 was up-regulated during activation of lymphocytes. Our data demonstrated that MIP-
1α was up-regualted early in co-cultures with HTLV-1 infection due to activation of lymphocytes. In contrast, the up-regulation of PTHrP occurred later during immortalization, which supports a role for PTHrP in the transformation process.
In conclusion, our data demonstrated that PTHrP was dramatically up-regulated during the immortalization of PBMCs with HTLV-1 in a Tax-independent manner.
PTHrP likely functions in an autocrine mechanism with the PTH1R facilitating the transformation process. Although further investigations are required to understand the role of PTHrP in the transformation process, it is apparent that PTHrP is up-regulated not only during HHM but also during early HTLV-1 infection implicating an important role for PTHrP in the pathogenesis of ATLL. Novel therapies directed against PTHrP might be an important strategy to prevent ATLL in HTLV-1-infected people.
61 2.6 REFERENCE LIST
(1) Poiesz BJ, Ruscetti FW, Gazdar AF, Bunn PA, Minna JD, Gallo RC.
Detection and isolation of type C retrovirus particles from fresh and cultured
lymphocytes of a patient with cutaneous T-cell lymphoma. Proc Natl Acad Sci
U S A 1980; 77(12):7415-7419.
(2) Osame M, Arimura K, Nakagawa M, Umehara F, Usuku K, Ijichi S. HTLV-I
associated myelopathy (HAM): review and recent studies. Leukemia 1997; 11
Suppl 3:63-64.
(3) Edlich RF, Arnette JA, Williams FM. Global epidemic of human T-cell
lymphotropic virus type-I (HTLV-I). J Emerg Med 2000; 18(1):109-119.
(4) Bangham CR. Human T-lymphotropic virus type 1 (HTLV-1): persistence and
immune control. Int J Hematol 2003; 78(4):297-303.
(5) Igakura T, Stinchcombe JC, Goon PK, Taylor GP, Weber JN, Griffiths GM,
Tanaka Y, Osame M, Bangham CR. Spread of HTLV-I between lymphocytes
by virus-induced polarization of the cytoskeleton. Science 2003;
299(5613):1713-1716.
(6) Arisawa K, Soda M, Endo S, Kurokawa K, Katamine S, Shimokawa I, Koba
T, Takahashi T, Saito H, Doi H, Shirahama S. Evaluation of adult T-cell
leukemia/lymphoma incidence and its impact on non-Hodgkin lymphoma
incidence in southwestern Japan. Int J Cancer 2000; 85(3):319-324.
62 (7) Matsuoka M, Jeang KT. Human T-cell leukaemia virus type 1 (HTLV-1)
infectivity and cellular transformation. Nat Rev Cancer 2007; 7(4):270-280.
(8) Yasunaga J, Matsuoka M. Human T-cell leukemia virus type I induces adult
T-cell leukemia: from clinical aspects to molecular mechanisms. Cancer
Control 2007; 14(2):133-140.
(9) Siekevitz M, Feinberg MB, Holbrook N, Wong-Staal F, Greene WC.
Activation of interleukin 2 and interleukin 2 receptor (Tac) promoter
expression by the trans-activator (tat) gene product of human T-cell leukemia
virus, type I. Proc Natl Acad Sci U S A 1987; 84(15):5389-5393.
(10) Ballard DW, Bohnlein E, Lowenthal JW, Wano Y, Franza BR, Greene WC.
HTLV-I tax induces cellular proteins that activate the kappa B element in the
IL-2 receptor alpha gene. Science 1988; 241(4873):1652-1655.
(11) Ressler S, Morris GF, Marriott SJ. Human T-cell leukemia virus type 1 Tax
transactivates the human proliferating cell nuclear antigen promoter. J Virol
1997; 71(2):1181-1190.
(12) Fujii M, Sassone-Corsi P, Verma IM. c-fos promoter trans-activation by the
tax1 protein of human T-cell leukemia virus type I. Proc Natl Acad Sci U S A
1988; 85(22):8526-8530.
(13) Ratner L. Regulation of expression of the c-sis proto-oncogene. Nucleic Acids
Res 1989; 17(11):4101-4115. 63 (14) Marriott SJ, Semmes OJ. Impact of HTLV-I Tax on cell cycle progression and
the cellular DNA damage repair response. Oncogene 2005; 24(39):5986-5995.
(15) Younis I, Green PL. The human T-cell leukemia virus Rex protein. Front
Biosci 2005; 10:431-445.
(16) Ye J, Silverman L, Lairmore MD, Green PL. HTLV-1 Rex is required for viral
spread and persistence in vivo but is dispensable for cellular immortalization
in vitro. Blood 2003; 102(12):3963-3969.
(17) Albrecht B, Lairmore MD. Critical role of human T-lymphotropic virus type 1
accessory proteins in viral replication and pathogenesis. Microbiol Mol Biol
Rev 2002; 66(3):396-406, table.
(18) Arnold J, Yamamoto B, Li M, Phipps AJ, Younis I, Lairmore MD, Green PL.
Enhancement of infectivity and persistence in vivo by HBZ, a natural
antisense coded protein of HTLV-1. Blood 2006; 107(10):3976-3982.
(19) Kiyokawa T, Yamaguchi K, Takeya M, Takahashi K, Watanabe T,
Matsumoto T, Lee SY, Takatsuki K. Hypercalcemia and osteoclast
proliferation in adult T-cell leukemia. Cancer 1987; 59(6):1187-1191.
(20) Wano Y, Hattori T, Matsuoka M, Takatsuki K, Chua AO, Gubler U, Greene
WC. Interleukin 1 gene expression in adult T cell leukemia. J Clin Invest
1987; 80(3):911-916.
64 (21) Nosaka K, Miyamoto T, Sakai T, Mitsuya H, Suda T, Matsuoka M.
Mechanism of hypercalcemia in adult T-cell leukemia: overexpression of
receptor activator of nuclear factor kappaB ligand on adult T-cell leukemia
cells. Blood 2002; 99(2):634-640.
(22) Niitsu Y, Urushizaki Y, Koshida Y, Terui K, Mahara K, Kohgo Y, Urushizaki
I. Expression of TGF-beta gene in adult T cell leukemia. Blood 1988;
71(1):263-266.
(23) Senba M, Kawai K. Hypercalcemia and production of parathyroid hormone-
like protein in adult T-cell leukemia-lymphoma. Eur J Haematol 1992;
48(5):278-279.
(24) Okada Y, Tsukada J, Nakano K, Tonai S, Mine S, Tanaka Y. Macrophage
inflammatory protein-1alpha induces hypercalcemia in adult T-cell leukemia.
J Bone Miner Res 2004; 19(7):1105-1111.
(25) Prager D, Rosenblatt JD, Ejima E. Hypercalcemia, parathyroid hormone-
related protein expression and human T-cell leukemia virus infection. Leuk
Lymphoma 1994; 14(5-6):395-400.
(26) Watanabe T, Yamaguchi K, Takatsuki K, Osame M, Yoshida M. Constitutive
expression of parathyroid hormone-related protein gene in human T cell
leukemia virus type 1 (HTLV-1) carriers and adult T cell leukemia patients
65 that can be trans-activated by HTLV-1 tax gene. J Exp Med 1990; 172(3):759-
765.
(27) Wake A, Tanaka Y, Nakatsuka K, Misago M, Oda S, Morimoto I, Eto S.
Calcium-dependent homotypic adhesion through leukocyte function-
associated antigen-1/intracellular adhesion molecule-1 induces interleukin-1
and parathyroid hormone-related protein production on adult T-cell leukemia
cells in vitro. Blood 1995; 86(6):2257-2267.
(28) Dunbar ME, Wysolmerski JJ, Broadus AE. Parathyroid hormone-related
protein: from hypercalcemia of malignancy to developmental regulatory
molecule. Am J Med Sci 1996; 312(6):287-294.
(29) Wysolmerski JJ, Stewart AF. The physiology of parathyroid hormone-related
protein: an emerging role as a developmental factor. Annu Rev Physiol 1998;
60:431-460.
(30) Gessi M, Monego G, Calviello G, Lanza P, Giangaspero F, Silvestrini A,
Lauriola L, Ranelletti FO. Human parathyroid hormone-related protein and
human parathyroid hormone receptor type 1 are expressed in human
medulloblastomas and regulate cell proliferation and apoptosis in
medulloblastoma-derived cell lines. Acta Neuropathol (Berl) 2007;
114(2):135-145.
66 (31) Xie L, Yamamoto B, Haoudi A, Semmes OJ, Green PL. PDZ binding motif of
HTLV-1 Tax promotes virus-mediated T-cell proliferation in vitro and
persistence in vivo. Blood 2006; 107(5):1980-1988.
(32) Richard V, Luchin A, Brena RM, Plass C, Rosol TJ. Quantitative evaluation
of alternative promoter usage and 3' splice variants for parathyroid hormone-
related protein by real-time reverse transcription-PCR. Clin Chem 2003;
49(8):1398-1402.
(33) Southby J, O'Keeffe LM, Martin TJ, Gillespie MT. Alternative promoter usage
and mRNA splicing pathways for parathyroid hormone-related protein in
normal tissues and tumours. Br J Cancer 1995; 72(3):702-707.
(34) Li M, Green PL. Detection and quantitation of HTLV-1 and HTLV-2 mRNA
species by real-time RT-PCR. J Virol Methods 2007; 142(1-2):159-168.
(35) Franzese O, Balestrieri E, Comandini A, Forte G, Macchi B, Bonmassar E.
Telomerase activity of human peripheral blood mononuclear cells in the
course of HTLV type 1 infection in vitro. AIDS Res Hum Retroviruses 2002;
18(4):249-251.
(36) Richard V, Rosol TJ, Foley J. PTHrP gene expression in cancer: do all paths
lead to Ets? Crit Rev Eukaryot Gene Expr 2005; 15(2):115-132.
(37) Philbrick WM, Wysolmerski JJ, Galbraith S, Holt E, Orloff JJ, Yang KH,
Vasavada RC, Weir EC, Broadus AE, Stewart AF. Defining the roles of 67 parathyroid hormone-related protein in normal physiology. Physiol Rev 1996;
76(1):127-173.
(38) Martin TJ, Moseley JM, Williams ED. Parathyroid hormone-related protein:
hormone and cytokine. J Endocrinol 1997; 154 Suppl:S23-S37.
(39) Richard V, Lairmore MD, Green PL, Feuer G, Erbe RS, Albrecht B, D'Souza
C, Keller ET, Dai J, Rosol TJ. Humoral hypercalcemia of malignancy: severe
combined immunodeficient/beige mouse model of adult T-cell lymphoma
independent of human T-cell lymphotropic virus type-1 tax expression. Am J
Pathol 2001; 158(6):2219-2228.
(40) Nicot C, Dundr M, Johnson JM, Fullen JR, Alonzo N, Fukumoto R, Princler
GL, Derse D, Misteli T, Franchini G. HTLV-1-encoded p30II is a post-
transcriptional negative regulator of viral replication. Nat Med 2004;
10(2):197-201.
(41) Nicot C, Harrod RL, Ciminale V, Franchini G. Human T-cell
leukemia/lymphoma virus type 1 nonstructural genes and their functions.
Oncogene 2005; 24(39):6026-6034.
(42) Arnold J, Yamamoto B, Li M, Phipps AJ, Younis I, Lairmore MD, Green PL.
Enhancement of infectivity and persistence in vivo by HBZ, a natural
antisense coded protein of HTLV-1. Blood 2006; 107(10):3976-3982.
68 (43) Sharma V, Lorey SL. Autocrine role of macrophage inflammatory protein-1
beta in human T-cell lymphotropic virus type-I tax-transfected Jurkat T-cells.
Biochem Biophys Res Commun 2001; 287(4):910-913.
(44) Menten P, Wuyts A, Van Damme J. Macrophage inflammatory protein-1.
Cytokine Growth Factor Rev 2002; 13(6):455-481.
(45) Lam MH, Thomas RJ, Martin TJ, Gillespie MT, Jans DA. Nuclear and
nucleolar localization of parathyroid hormone-related protein. Immunol Cell
Biol 2000; 78(4):395-402.
(46) Motokura T, Endo K, Kumaki K, Ogata E, Ikeda K. Neoplastic transformation
of normal rat embryo fibroblasts by a mutated p53 and an activated ras
oncogene induces parathyroid hormone-related peptide gene expression and
causes hypercalcemia in nude mice. J Biol Chem 1995; 270(52):30857-30861.
(47) Insogna KL, Stewart AF, Morris CA, Hough LM, Milstone LM, Centrella M.
Native and a synthetic analogue of the malignancy-associated parathyroid
hormone-like protein have in vitro transforming growth factor-like properties.
J Clin Invest 1989; 83(3):1057-1060.
(48) Pozzatti R, Vogel J, Jay G. The human T-lymphotropic virus type I tax gene
can cooperate with the ras oncogene to induce neoplastic transformation of
cells. Mol Cell Biol 1990; 10(1):413-417.
69 (49) Clemens TL, Cormier S, Eichinger A, Endlich K, Fiaschi-Taesch N, Fischer
E, Friedman PA, Karaplis AC, Massfelder T, Rossert J, Schluter KD, Silve C,
Stewart AF, Takane K, Helwig JJ. Parathyroid hormone-related protein and its
receptors: nuclear functions and roles in the renal and cardiovascular systems,
the placental trophoblasts and the pancreatic islets. Br J Pharmacol 2001;
134(6):1113-1136.
(50) Sourbier C, Massfelder T. Parathyroid hormone-related protein in human renal
cell carcinoma. Cancer Lett 2006; 240(2):170-182.
(51) Richard V, Nadella MV, Green PL, Lairmore MD, Feuer G, Foley JG, Rosol
TJ. Transcriptional regulation of parathyroid hormone-related protein
promoter P3 by ETS-1 in adult T-cell leukemia/lymphoma. Leukemia 2005;
19(7):1175-1183.
(52) Nadella MV, Dirksen WP, Nadella KS, Shu S, Cheng AS, Morgenstern JA,
Richard V, Fernandez SA, Huang TH, Guttridge D, Rosol TJ. Transcriptional
regulation of parathyroid hormone-related protein promoter P2 by NF-kappaB
in adult T-cell leukemia/lymphoma. Leukemia 2007; 21(8):1752-1762.
(53) Richard V, Nadella MV, Green PL, Lairmore MD, Feuer G, Foley JG, Rosol
TJ. Transcriptional regulation of parathyroid hormone-related protein
promoter P3 by ETS-1 in adult T-cell leukemia/lymphoma. Leukemia 2005;
19(7):1175-1183.
70 (54) Richard V, Nadella MV, Green PL, Lairmore MD, Feuer G, Foley JG, Rosol
TJ. Transcriptional regulation of parathyroid hormone-related protein
promoter P3 by ETS-1 in adult T-cell leukemia/lymphoma. Leukemia 2005;
19(7):1175-1183.
(55) Matsuoka M, Jeang KT. Human T-cell leukaemia virus type 1 (HTLV-1)
infectivity and cellular transformation. Nat Rev Cancer 2007; 7(4):270-280.
(56) Cingolani G, Bednenko J, Gillespie MT, Gerace L. Molecular basis for the
recognition of a nonclassical nuclear localization signal by importin beta. Mol
Cell 2002; 10(6):1345-1353.
(57) Lam MH, Thomas RJ, Martin TJ, Gillespie MT, Jans DA. Nuclear and
nucleolar localization of parathyroid hormone-related protein. Immunol Cell
Biol 2000; 78(4):395-402.
(58) Kanamori H, Suzuki N, Siomi H, Nosaka T, Sato A, Sabe H, Hatanaka M,
Honjo T. HTLV-1 p27rex stabilizes human interleukin-2 receptor alpha chain
mRNA. EMBO J 1990; 9(12):4161-4166.
(59) Sharma V, May CC. Human T-cell lymphotrophic virus type-I tax gene
induces secretion of human macrophage inflammatory protein-1alpha.
Biochem Biophys Res Commun 1999; 262(2):429-432.
71
Figure 2.1 Growth curves and p19 Gag expression in HTLV-1 T-lymphocyte immortalization assays. Human PBMCs (2 × 106) were cultured alone or with irradiated donor cells (SLB-1) in 24-well plates. Cell viability was measured weekly by trypan blue exclusion (0-13 weeks after co-cultivation) and growth curves are shown. (A) IMM-1, IMM-2 and IMM-3 represent immortalization assays in which IL-2 (10U/mL) was supplemented from day 1 following HTLV-1 infection; TRAN-1 and TRAN-2 represent transformation assays and did not receive exogenous IL-2. PBMCs-1&2 with no stimulation, PBMCs-1&2 stimulated with PHA and IL-2 served as controls. Only HTLV-1-infected cells continued to proliferate beyond 6 weeks in culture (B) p19 Gag expression in co-cultures. P19 production as a measure of HTLV- 1 viral production was measured in the supernatant of the co-cultures by ELISA. The results showed that PBMCs infected with HTLV-1 produce p19 expression in the immortalization and transformation assays. (*) indicates significant differences in both immortalization (IMM-1,2,3) and transformation groups (TRAN-1, 2) compared to PBMC alone (PBMC-1,2) (p<0.05)
72
Figure 2.1 Growth curves and p19 Gag expression in HTLV-1 T-lymphocyte immortalization assays.
73
Figure 2.2 PTHrP was markedly up-regulated during immortalization of PBMCs with HTLV-1 infection. (A) PTHrP mRNA expression during immortalization of PBMCs with HTLV-1. Total RNA was extracted from the co-cultures at various time points and PTHrP mRNA expression was measured by real-time RT-PCR using the
Taqman method. PTHrP expression was normalized to human β2M and the data was represented as fold change over uninfected PBMCs from day 0. The results showed marked up-regulation of PTHrP mRNA in PBMCs following HTLV-1 infection. (B) PTHrP protein expression during immortalization of PBMCs with HTLV-1. Secreted PTHrP was measured in the conditioned medium from the co-culture assays by IRMA. Results showed marked up-regulation of PTHrP secretion in PBMCs infected with HTLV-1 during the immortalization phase. (*) indicates significant differences in the immortalization (IMM-1,2,3) and transformation groups (TRAN-1,2) compared to PBMC alone (PBMC-1 and 2) (p<0.05).
74
Figure 2.2 PTHrP was markedly up-regulated during immortalization of PBMCs with HTLV-1 infection. 75
Figure 2.3 PTHrP was up-regulated by the P2 and P3 promoters. Specific PTHrP promoter-initiated transcripts were measured by real time quantitative RT-PCR using the SYBR green method. The data was normalized to human β2M gene expression. Specific PTHrP-promoter initiated transcripts at time points day 0, 3, 7 and 13 weeks post co-culture are shown for IMM-1 (A), IMM-2 (B), IMM-3 (C), TRAN-1 (D) TRAN-2; (E) MT-2 cells. The data showed that PTHrP was up-regulated in PBMCs following HTLV-1 infection by the activation of the P2 and P3 promoters.
76 Figure 2.4 HTLV-1 infection up-regulated expression of the PTHrP receptor
(PTH1R) in PBMCs. PTHrP receptor expression and human β2M were measured by
RT-PCR from total RNA at various time points in the co-culture assays. (A) Marked up-regulation of PTH1R in PBMCs at weeks 1, 3, 5, 7, 9, 11, and 13 following
HTLV-1 infection in IMM-1, IMM-2, IMM-3, TRAN-1 and TRAN-2 assays compared to day 0; controls 1 and 4 are PBMC-1 and PBMC-2; controls 2 and 5 are
PBMC-1 and PBMC-2 stimulated with PHA, controls 3, and 6 are PBMC-1 and
PBMC-2 stimulated with IL-2 for one week. (B) PTH1R expression in HTLV-1- infected T-cells. Lane represents (1) Jurkat (2) MT-2 (3) SLB-1 (4) HUT102 (5)
C8166 (6) MET-1 (7) RV-ATL (8) HT-1RV cells. The data showed that PTH1R expression was very low or absent in the ATLL cells (MET-1 and RV-ATL) compared to HTLV-1-infected T-cell lines (MT-2, SLB-1 and HT-1RV). Jurkat T- cells were used as a negative control. β2M was used a loading control.
77
Figure 2.4 HTLV-1 infection up-regulated expression of the PTHrP receptor (PTH1R) in PBMCs
78
Figure 2.5 PTHrP expression did not correlate with HTLV-1 Tax and HTLV-1 accessory genes known to regulate Tax expression. mRNA expression was measured by quantitative real time RT-PCR using the SYBR green method and the
data was normalized to human β2M gene expression. (A) HTLV-1 Tax expression in co-cultures following HTL-1 infection, (B) HBZ mRNA expression in co-cultures, (C) p30 mRNA expression in co-cultures.
79
Figure 2.6 HTLV-1 infection or over-expression of Rex alone up-regulated PTHrP expression. Relative luciferase activity in 293T cells transfected with either pGL2 or pGL2 PTHrP-P2/P3 Luc constructs alone or with expression plasmids for HTLV-1 (ACH), p12, p13, p30, HBZ, Rex and Tax. The quantity of the expression plasmid is indicated in µg. Bars represent the mean ± SD of three independent samples. The data showed that HTLV-1 infection or over-expression of Rex alone up- regulated PTHrP. (*) indicates significant differences between various groups compared to pGL2-PTHrP-P2/P3 Luc alone in figure A. In figure B, (*) indicates significant differences between various groups compared to pGL2-PTHrP-P2/P3 Luc + ACH (p<0.05).
80
Figure 2.7 MIP-1α induction due to activation of lymphocytes following HTLV-1 infection. MIP-1α was measured in the conditioned medium from the co-culture assays at various time points (day 0, 1, 3, 5, 7, 9, 11 and 13 weeks of co-culture) by ELISA. The results showed that MIP-1α expression was up-regulated in PBMCs following stimulation with PHA or IL-2. HTLV-1 infection markedly up-regulated MIP-1α expression in the first week after infection, which demonstrated that HTLV-1 infection activated the lymphocytes. (*) indicates significant differences between IMM-1, 2, 3 and TRAN-1 and 2 groups compared to PBMC-1 and 2 (p< 0.05).
81 CHAPTER 3
TRANSCRIPTIONAL REGULATION OF PARATHYROID HORMONE-
RELATED PROTEIN PROMOTER P2 BY NF-κB IN ADULT T-CELL
LEUKEMIA/LYMPHOMA
3.1 ABSTRACT
Parathyroid hormone-related protein (PTHrP) plays a primary role in the
development of humoral hypercalcemia of malignancy (HHM) that occurs in the
majority of patients with adult T-cell leukemia/lymphoma (ATLL) due to human T-
cell lymphotropic virus type-1 (HTLV-1) infection. We previously showed that
ATLL cells constitutively express high levels of PTHrP via activation of promoters
P2 and P3, resulting in HHM. In this study, we characterized an NF-κB binding site in
the P2 promoter of human PTHrP. Using electrophoretic mobility shift assays, we
detected a specific complex in Tax-expressing human T-cells composed of p50/c-Rel,
and two distinct complexes in ATLL cells consisting of p50/p50 homodimers and p50
with a second unidentified protein(s). Chromatin immunoprecipitation assays
confirmed in vivo binding of p50 and c-Rel on the PTHrP P2 promoter. Using
transient co-transfection with NF-κB expression plasmids and PTHrP P2 luciferase reporter-plasmid, we showed that NF-κB p50/p50 alone and p50/c-Rel or p50/Bcl-3
82 cooperatively up-regulated the PTHrP P2 promoter. Furthermore, inhibition of NF-
κB activity by Bay 11-7082 reduced PTHrP P2 promoter-initiated transcripts in
HTLV-1 infected T-cells. In summary, the data demonstrated that transcriptional
regulation of PTHrP in ATLL cells can be controlled by NF-κB activation and also
suggests a Tax-independent mechanism of activation of PTHrP in ATLL.
3.2 INTRODUCTION
Adult T-cell leukemia/lymphoma (ATLL) is a highly aggressive malignancy of
peripheral helper T-cells associated with human T-cell lymphotropic virus type-1
(HTLV-1) infection(1). About 80% of ATLL patients develop humoral hypercalcemia of malignancy (HHM), a life-threatening paraneoplastic syndrome, seen in a wide variety of cancers in addition to ATLL(2). In HHM, increased circulating parathyroid hormone-related protein (PTHrP) stimulates the parathyroid hormone-1 receptor
(PTH1R) to induce osteoclastic bone resorption and increase calcium reabsorption in kidneys, resulting in hypercalcemia(3). In addition to its role in the induction of HHM,
PTHrP has been shown to be involved in the regulation of cell proliferation and
apoptosis in a wide variety of normal and neoplastic tissues(4).
Transcriptional regulation of the human PTHrP gene is achieved by three distinct
promoters identified as P1, P2 and P3. Promoters P1 and P3 (previously called the P2
promoter) contain a typical TATA box(5-7), while P2 is a GC-rich promoter region
located immediately upstream of exon 3 (also named exon 1c) with the transcription
83 initiation site located 11 nucleotides upstream of the exon 3 splice acceptor site.
Several studies have shown that P2/P3 promoter usage is prevalent in many cancers
such as breast cancer and bone cancer in addition to HTLV-1-positive and ATLL
cells(8-11). Furthermore, Brandt et al. reported a preferential usage of P2 over P1 and
P3 promoters in different cancer cell lines examined(12). Although this stimulation and activity of the PTHrP P2 promoter was identified ten years ago, little is known regarding the transcriptional mechanisms involving cis-acting regulatory sequences within this promoter.
HTLV-1-Tax is a potent transcriptional activator that not only drives the
transcription of all HTLV-1 transcripts from the viral LTR but also activates
numerous cellular genes through activation of nuclear factor-kappaB (NF-κB), cyclic
AMP response element binding protein (CREB/ATF), and serum response factor
(SRF)(13-15). NF-κB, a cytokine-inducible family of transcription factors, controls expression of genetic networks important in cell survival, proliferation, inflammation, and T-cell transformation. Although tightly regulated in normal T-cells, NF-κB is constitutively activated in ATLL and Tax-expressing T-cells(16). While Tax-mediated
NF-κB activation serves as a critical step in the induction of T-cell transformation by
HTLV-1, the presence of constitutively active NF-κB in freshly isolated ATLL cells that lack detectable Tax expression implicates a crucial role for NF-κB in the multistep process of leukemogenesis(17)
The NF-κB family is composed of five structurally related protein subunits that can be divided into two groups: (1) p65/RelA, RelB, and c-Rel contain a well-defined
84 transactivation domain; and (2) p50 and p52, which are generated by proteolytic
processing from their precursors, p105/NF-κB 1 and p100/NF-κB 2, respectively, and
lack transactivation domains. Although the predominant complex in most cells is
p50/p65, various dimeric transcription factor complexes can form between the family
members(18). Heterodimers containing p52 or p50 combined with p65, c-Rel, or RelB
are capable of activating transcription. NF-κB dimers bind target gene regulatory regions through a wide variety of binding sites that generally match a 5’-
GGGRNNYYCC-3’ consensus (R, purine : Y, pyrimidine : N, any base). Although their functions often overlap, NF-κB achieves target gene specificity in part through
preferential binding of different subunit combinations to numerous similar DNA
sequences(19).
NF-κB is expressed in virtually all cell types, but in unstimulated cells the NF-κB homo- and heterodimers are sequestered in the cytoplasm in an inactive form complexed with one of the members of the family of regulatory IκBs, including IκB-
α, IκB-β, IκB-γ and Bcl-3. IκB molecules are subject to phosphorylation, subsequent degradation, and release of active NF-κB upon reception of signals that lead to NF-κB activation(20). In contrast to IκBα and IκBβ, which specifically interact with dimers containing p65 or c-Rel, Bcl-3 specifically interacts with p50 or p52 homodimers and contains N- and C-terminal regions that can act as transactivation domains(21;22).
Although the cellular function of Bcl-3 is still unclear, various studies have suggested that Bcl-3 acts to increase transcription from NF-κB responsive promoters by either 1) acting as an anti-repressor by removing homodimers from the κB sites so that
85 transactivating NF-κB dimers can bind, 2) forming a complex with homodimers at κB sites and acting as a transactivator, or 3) enhancing homodimer binding to κB sites.
Interestingly, Bcl-3 can enhance p50 or p52 homodimer binding to DNA, without being a stable component of the complex(23;24).
We have previously reported that the up-regulation of PTHrP in ATLL and HTLV-
1-infected T-cells is mediated by the PTHrP P2 and P3 promoters and that the P3
promoter is regulated by the ETS signaling pathway. The relative PTHrP P2 promoter
usage was determined to be 16, 4, 7, and 40 copies (per 104 copies of β2M) in HT-
1RV, SLB-1, MT-2 and RV-ATL cells, respectively, compared to the 47, 86, 104, 644 copies (per 104 copies of β2M) of total PTHrP(25). Since ATLL cells display constitutive expression of NF-κB and PTHrP and since sequence analysis of the
PTHrP P2 promoter revealed that it contained potential binding sites for NF-κB, we tested in this report the hypothesis that PTHrP gene is a direct target of the transcription factor, NF-κB. We identified an NF-κB binding site within the human
PTHrP P2 promoter region that is responsible for NF-κB-mediated stimulation of
PTHrP promoter activity. We also demonstrated and characterized the formation of different protein/DNA complexes on the NF-κB-binding site located within the second promoter (P2) of the human PTHrP gene in HTLV-1-infected and ATLL cells.
We present evidence that transactivation of the PTHrP P2 promoter can occur in a subunit-dependent manner by p50/c-Rel and p50/Bcl-3. Finally, we showed that inhibition of NF-κB by the Bay 11-7082 decreased P2 promoter-initiated transcription.
86 Our data demonstrated that transactivation of the PTHrP P2 promoter in HTLV-1-
infected and ATLL cells occurs by activation of NF-κB in a Tax-independent manner.
3.3 MATERIALS AND METHODS
Sequence Analysis: Human, mouse, rat, and dog upstream PTHrP P2 promoter
sequences (GenBank accession: NM 002820, NM 008970, NM 012636, and NM
001003303, respectively) were analyzed for potential NF-κB binding sites using
MatInspector (Genomatix Software GmbH, Munchen, Germany), with ‘weight
matrices’ as the search parameter.
Animals and inoculation. Immunodeficient SCID-NOD (NOD CB17-PRKDC-
SCID/J) mice (Jackson Lab, Bar Harbor, ME) were maintained under specific
pathogen-free conditions in the animal facility of the College of Veterinary Medicine
at The Ohio State University. Male mice aged 5 weeks were used as recipients and
injected intraperitonially with 4x107 RV-ATL cells or 3x107 Met-1 cells suspended in
RPMI 1640 medium. The source of the RV-ATL and Met-1 cells (a kind gift of Dr.
Feuer and Dr. Waldman respectively) was previously described(26;27). RV-ATL cells
were harvested by peritoneal lavage 28 days post-inoculation. Met-1 cells were harvested from peritoneal tumors approximately 60 days post-inoculation.
87 Cell lines. MT-2 and SLB-1 are in-vitro transformed HTLV-1-positive cell lines that
were obtained by co-cultivating lymphocytes from healthy donors with leukemic cells
from ATLL patients(28). RV-ATL and Met-1 cells are leukemic cells derived from
ATLL patients. HT-1RV cells were obtained by superinfecting RV-ATL cells with
HTLV-1(29). IMM-1 cells are IL-2-dependent immortalized cells obtained by in vitro co-cultivation of peripheral blood mononuclear cells from a healthy human donor with lethally-irradiated SLB-1 cells. MT-2 and SLB-1 cells were cultured in RPMI
1640 media supplemented with 10% fetal bovine serum (FBS) and the HT-1RV and
RV-ATL cells in RPMI 1640 with 20% heat-inactivated (56°C, 30 min) FBS, l- glutamine (2 mM), penicillin (50 U/ml) and streptomycin (50 µg/ml) (Invitrogen,
Carlsbad, CA) at 37°C and 5% CO2. NIH 3T3 cells were grown in DMEM supplemented with 10% FBS and 10 mM L-glutamine.
Long-term Immortalization Assay. Human peripheral blood mononuclear cells
(PBMCs) were isolated from the blood of healthy donors by centrifugation over
Ficoll-Paque (Amersham, Piscataway, NJ) and cultured in RPMI 1640 supplemented
with 20% FBS, 10 U/mL IL-2 (Boehringer Mannheim, Mannheim, Germany), 2 mM glutamine, and antibiotics. Irradiated SLB-1 cells (106) were co-cultivated with 2x106 freshly isolated PBMCs with 10 U/mL IL-2 in 24-well culture plates. The presence of
HTLV-1 expression was confirmed by detection of p19 Gag protein in the culture
supernatant at weekly intervals using a commercially-available ELISA kit
(Zeptometrix, Buffalo, NY). Cells from a donor that continued to proliferate after 30
88 weeks of co-culture in the presence of exogenous interleukin-2 (IL-2) were identified as to be HTLV-1-immortalized cells and were named IMM-1 cells.
EMSAs and Supershifts. Nuclear extracts were prepared from RV-ATL, MET-1,
HT1-RV, MT-2, SLB-1, IMM-1, and Jurkat cells using the NE-PER Nuclear and
Cytoplasmic Extraction Reagents kit (Pierce). For NF-κB binding activity on the
PTHrP P2 promoter, 1-5 µl of each nuclear extract (7.5 µg of protein) were incubated in 18 µl total reaction volume, containing 10 mM Tris-HCl, pH 7.5, 50 mM NaCl, 1 mM EDTA, 1 mM DTT, 10% glycerol, 1 µg of poly(dI-dC).poly(dI-dC) (Amersham
Biosciences, Piscataway, NJ), and 0.4 µg/µl bovine serum albumin for 15 minutes at room temperature. The reaction mixture was then incubated with a Cy5 5’-end labeled double-stranded PTHrP P2 promoter wild-type oligonucleotide (sense strand: 5’-
TCATTCCCGGCTCGGGGCTCCCCTCCACTCGCTCG-3’; κB site is underlined) alone or with 25-fold excess of unlabeled wild-type or mutant P2 oligonucleotides for
15 minutes at room temperature. Samples were analyzed by electrophoresis using 4% non-denaturing polyacrylamide gels with 1X TGE buffer (25 mM Tris, 189 mM glycine, and 1 mM EDTA) containing 5% glycerol. The gels were scanned with a
Typhoon 9410 Variable Mode Imager (Amersham Biosciences) to detect the Cy5 fluorescence. Consensus NF-κB binding activity was measured using 5 µg of the nuclear extracts with 2x104 cpm of a 32P-labeled oligonucleotide probe containing a
κB site from the class I MHC promoter (5'-
CAGGGCTGGGGATTCCCCATCTCCAC AGTTTCACTTC-3'; κB site is
89 underlined), as described previously(30). For supershift experiments, 4 µl each of p50
(H-119; sc-7178), p50 NLS (sc-114), P65 (sc-109), c-Rel (sc-71), Bcl-3 (C-14; sc-
185) antibodies (Santa Cruz) was incubated with 7.5 µg nuclear extract for 10 minutes at room temperature prior to addition of the buffers and oligonucleotides.
Chromatin immunoprecipitation (ChIP)-PCR and quantitative PCR. ChIP was performed with antibodies against Bcl-3 (C-14), c-Rel (C) and p50 (H-119) using
ChIP assay kit (Upstate, Charlottesville, VA). The specific sequence from immunoprecipitated and input DNA was detected by PCR using primers for PTHrP
P2 promoter region: (forward, 5-GCCACCTCTTTGCGACTAGCT-3) and (reverse,
5-GGTTGGAGGCGAGTTGAAAAC-3). The annealing temperature was 58oC and the amplicon size was 91-bp. Quantitative PCR monitored with SYBRGreen was performed using the ABI 7500 Fast Real-Time PCR System (Applied Biosystems,
Foster City, CA) as described previously(31). Experimental ChIP-PCR values were normalized against values obtained by a standard curve constructed by input DNA
(5% to 0.008%, 5-fold dilution, R2 >0.99) with the same primer set. Quantitation of transcription factor binding was expressed as enrichment ratio of antibody over IgG control, and each error bar represents standard deviation calculated from triplicates.
Plasmids and site-directed mutagenesis. A human PTHrP P2-luciferase reporter
gene construct was derived by cloning the human P2 promoter -1030 (Sma I) to -611
(Sau3A) fragment into pGL-2 basic vector (Promega, Madison, WI). For site directed
90 mutagenesis, a Sac I-Apa I restriction fragment from the human PTHrP P2 promoter was sub-cloned into the Sac I-Apa I sites of pCR2.1TOPO plasmid (Invitrogen). The
NF-κB site within the PTHrP P2 promoter was mutated by PCR-amplifying the entire
PTHrP-P2/pCR2.1TOPO plasmid using the Expand Long Template PCR System
(Roche) and sense (5’-CTCACATCCACTCGCTCG-3’) and anti-sense (5’-
CACAGAGCCGGGAATGAG-3’) oligonucleotides that contained the desired
mutations (mutated nucleotides are underlined), as described previously(32). A PCR product of the appropriate size (~3.9 kb) was obtained. This PCR product was blunted-ended with T4 DNA Polymerase (New England Biolabs), kinased with T4 polynucleotide kinase (New England Biolabs), circularized with T4 DNA Ligase
(New England Biolabs) and transformed into DH5α cells. Once clones containing the desired mutations were obtained and confirmed by DNA sequencing, the mutated P2 promoter was sub-cloned back into pGL2/PTHrP-P2/Luc plasmid.
Western Blotting: Approximately 40 µg of the nuclear and cytoplasmic lysates were separated on a 12% tris-glycine SDS-PAGE gel. Protein was transferred to a nylon membrane and then probed with primary antibodies specific for Tax (168A51-42 (Tab
176; NIH AIDS Research & Reference Reagent Program), NF-κB p50 (Epitomics,
Burlingame, CA), p65, c-Rel, IκB-α, Bcl-3 (same as used in supershifts), and β-Actin
(Sigma, St. Louis, MO) followed by incubation with goat anti-mouse or goat anti- rabbit (Promega, Madison, WI) horseradish peroxidase-conjugated secondary
91 antibodies. The signal was detected by chemiluminescence using Western Lightning
Chemiluminescence Reagent Plus (PerkinElmer Life Sciences, Boston, MA).
Transfections: To investigate the effect of NF-κB on PTHrP transcriptional
regulation, NIH3T3 cells at 60% confluence were co-transfected with 1 µg of either
wild-type pGL2/PTHrP-P2/Luc, mutant pGL2/PTHrP-P2/Luc or pGL2 constructs in
the presence or absence of expression vectors for NF-κB p50 (50 to 500 ng), p65 (500
ng), c-Rel (50 to 500 ng) or Bcl-3 (10 to 500 ng) using Lipofectamine Plus reagent
(Invitrogen, Carlsbad, Ca) and harvested after 48 h of transfection. pcDNA-3.1 was
used as a “filler” plasmid so that the total amount of DNA would be the same in all
transfection groups. The plasmid pβgal-Control Vector (250 ng) was included in each
transfection and served as an internal control to correct for transfection efficiency.
Luciferase activity was measured with the Luciferase Assay System (Promega) using
40 µl of lysate. Simultaneously, β-galactosidase activity was measured with the
Luminescent β-Galactosidase Detection Kit II (BD Biosciences).
RT-PCR, Bay 11-7082 Treatment and Real Time RT-PCR: Total RNA was
extracted using TRIZOL® Reagent (Invitrogen, CA). Approximately 2.5 µg of RNA was reverse transcribed with SuperscriptTM Reverse Transcriptase (Invitrogen, CA).
The cDNA was amplified with specific oligonucleotide primers for Bcl-3, and β2- microglobulin using Platinum Taq DNA polymerase (Invitrogen), as described previously(33;34). The PCR products were analyzed by electrophoresis on a 1% agarose
92 gel. For Bay 11-7082 treatment, 2x106 cells were treated with Bay 11-7082 (Alexis
Biochemical Corporation, CA) or vehicle control (DMSO).To measure the total
PTHrP and P2 promoter-initiated transcripts, 1 µg RNA was reverse-transcribed and
submitted for real-time RT-PCR analysis using TaqMan® Gene Expression assays
(4331182 and 364171-B4 respectively, Applied Biosystems, CA). β2M (4333766,
Applied Biosystems) was used as a reference gene.
Statistical analysis: Pooled-variance t-tests were used to analyze the data from transfection assays. ANOVA with Dunnett’s tests were used to analyze the data from titration with p50, c-Rel, Bcl-3, and Bay 11-7082 treatment and vehicle control groups. Means and standard deviations are plotted in the figures. The mean differences and 95% confidence intervals are available upon request. A p value of
<0.05 was considered significant.
3.4 RESULTS
Identification of NF-κB Sites in the PTHrP P2 Promoter: Following sequence analysis of the human PTHrP gene (described in the methods section), we identified
two putative NF-κB binding sequences in the 5’-regulatory region beginning at
positions -1558 to -1548 (GGAAATTCCC) and -152 to -142 (GGGGCTCCCC)
nucleotides from the transcription start site for exon 3 (Figure 3.1). These sites
represented excellent matches to the 5’-GGGRNNYYCC-3’ consensus NF-κB
93 sequence(35). Putative κB sites almost identical to the human PTHrP κB sites were also present in the mouse and the rat PTHrP promoter regions (Fig 3.1). The κB binding sequence (-1513 to -1503) was present in dog but the sequence proximal to the transcription start site (-152 to -142) was a partial consensus. In this study, we focused on the κB1 sequence (-152 to -142) due to its proximity to the transcription start site for exon 3 in the human PTHrP gene.
Tax and IкB-α expression in HTLV-1-infected T-cells and ATLL cells. In resting
cells, NF-κB is retained in the cytoplasm due to binding to specific NF-κB inhibitors
of the IκB family. Following activation of cells by various stimuli, signal transduction
cascades lead to the degradation of IκB-α and translocation of NF-κB into the
nucleus. Since Tax is known to activate the NF-κB pathway, we measured the levels
of Tax expression in various cell lines (Figure 3.2). Three of the HTLV-1-infected
cell lines (MT-2, SLB-1 and HT-1RV) have very high levels of Tax expression. In
addition to the 40-kDa Tax band a 69-kDa band, which is a fusion between the
envelope and the Tax-coding sequence, is seen in MT-2 cells as described
previously(36). IMM-1 cells have a lower Tax protein expression compared to the other HTLV-1-infected cell lines. There was no detectable Tax protein expression in
RV-ATL and MET-1 cells. A canine prostate carcinoma cell line, Ace-1, was used as a negative control for Tax. Also, in agreement with prior studies (Mori et al. 1999), the protein level of IκB-α was significantly lower in three of the four HTLV-1- infected cell lines (SLB-1, MT-2, and HT-1RV) compared to ATLL cells (MET-1 and
94 RV-ATL) (Figure 3.2). Imm-1 cells have a higher level of IκB-α protein compared to the other HTLV-1 infected cell lines, indicating a lower IκB-α turnover in these cells and likely lower NF-κB activation. These results suggested a direct relationship between Tax, IκB-α expression and NF-κB activity in T-cells.
Constitutive NF-κB binding activity in HTLV-1-infected T-cell lines and ATLL cells. To measure the NF-κB binding activity in HTLV-1-infected and ATLL cells, nuclear extracts from these cells were subjected to electrophoretic mobility shift assays (EMSA) with a 32P-labeled, double-stranded oligonucleotide probe containing a κB site from the class I MHC promoter. No NF-κB-specific protein DNA complexes were detected in HTLV-1-negative Jurkat T-cells. In contrast, enhanced NF-κB binding activity was detected in the nuclear extracts from HTLV-1-infected T-cell lines and ATLL cells (Figure 3.3A, lanes 3-8). The NF-κB binding activity in MT-2 and SLB-1 extracts consisted of a single complex (C1), while there were two complexes in MET-1, RV-ATL, HT-1RV and IMM-1 extracts (C2 & C3). The complexes in MT-2 cells extracts were composed predominantly of p50 and c-Rel as antibodies against p50 and c-Rel produced a shifted complex (Figure 3.3B, lanes 3, 4 and 6). The lower complex (C2) in MET-1, RV-ATL, HT-1RV, and IMM-1 extracts consisted of p50/p50 (Fig. 3B, lanes 3-4). The upper complex (C3) in RV-ATL and
IMM-1 extracts contained p50 and p65 (Figure 3.3B lanes 3, 4, 5) while the HT-1RV extracts contained p50, p65 and c-Rel (Figure 3.3B, lanes 3-6).
95 NF-κB binds to the sequences in the 5’ regulatory region of PTHrP: To determine if the sequences in the PTHrP P2 promoter region were authentic NF-κB binding sites, a Cy5-labeled, double-stranded oligonucleotide probe spanning the putative NF-
κB binding site was tested by EMSA for binding of NF-κB proteins (Figure 3.4). A single complex (C1) formed in MT-2 and SLB-1 extracts, whereas two complexes
(C2 & C3) formed in MET-1, RV-ATL, HT-1RV and IMM-1 extracts (Figure 3.4A).
The complexes in MT-2 cells were composed of p50 and c-Rel since antibodies specific to these proteins produced a supershift (Fig. 4B, lanes 5, 6 and 8). The lower complex (C2) in RV-ATL, HT-1RV, MET-1 (data not shown), and IMM-1 extracts contained only p50. The upper complex (C3) consisted predominantly of p50 and c-
Rel in HT-1RV extracts, while the complexes in RV-ATL, MET-1 and IMM-1 extracts did not supershift with antibodies to p50, p52 (not shown), p65, c-Rel, RelB
(not shown) or Bcl-3. All of the above complexes formed specifically on the NF-κB binding site, since competition with an excess of unlabeled wild-type probe eliminated the complex (Figure 3.4B, lanes 3), but an excess of an unlabeled probe containing a mutated NF-κB site did not eliminate the complex (Fig 3.4B, lanes 4).
Additional complexes observed are non-specific since they were out-competed by the mutated competitor.
Chromatin immunoprecipitation (ChIP) demonstrated binding of NF-κB p50 and c-Rel to the PTHrP P2 promoter in vivo. To determine if NF-κB transcription factors bind to the PTHrP P2 promoter in vivo, we performed a ChIP assay with
96 antibodies against p50, c-Rel, and Bcl-3. IgG was used as a negative control. As
shown in Figure 3.5a, the PTHrP P2 promoter was occupied by NF-κB p50 and c-Rel
in MT-2 cells as measured by ChIP with real-time PCR quantification. As an
additional measure, gel electrophoresis of the PCR product after a limited number of
cycles gave an independent visual confirmation of the binding activity on the PTHrP
P2 promoter (Figure 3.5b).
Transactivation of the PTHrP κB site by the NF-κB family: To determine which
NF-κB subunits transactivated the PTHrP κB site, expression plasmids for four κB proteins, p50, p65, c-Rel and Bcl-3 were co-transfected in NIH3T3 cells with either wild-type pGL2/PTHrP-P2/Luc, mutant pGL2/PTHrP-P2/Luc or pGL2 reporter plasmids. As shown in Fig. 6A, expression of p65, c-Rel, Bcl-3 or Tax by themselves did not increase the expression of luciferase activity. Interestingly, p50 alone or in combination with c-Rel or Bcl-3 strongly transactivated the PTHrP P2 promoter.
Mutation of the κB binding sequence significantly reduced luciferase activity compared to the wild-type, showing that the transactivation was occurring through the
κB site. The effect of p50 and c-Rel were directly proportional to their concentration
(Figure 3.6B & C). Interestingly, the cooperative effect of Bcl-3 with p50 was inversely related to Bcl-3 concentration (Figure 3.6D&E). While low levels of Bcl-3 co-operated with p50 in transactivating PTHrP, higher levels of Bcl-3 nullified the effect.
97 HTLV-1-infected T-cells and ATLL cells expressed Bcl-3 and other NF-κB
family members. p50 is known to transactivate genes in association with Bcl-3.
Following our observations that p50 alone and p50/Bcl-3 up-regulated PTHrP we
measured the levels of Bcl-3 expression in HTLV-1-infected and ATLL cells. As
shown in Figure 3.7A, Tax-expressing cells have higher levels of Bcl-3 mRNA
expression compared to the ATLL cells. To determine the sub-cellular localization of
Bcl-3 and other NF-κB members in these cells, western blotting was performed on cytoplasmic and nuclear extracts (Figure 3.7B). Cytoplasmic and nuclear fractions of
MT-2, SLB-1, HT-1RV and IMM-1 cells had high levels of Bcl-3 protein. In contrast,
lower levels of Bcl-3 protein were present in MET-1 and RV-ATL cells, but it was
predominantly localized in the nucleus. This was in agreement with the RT-PCR data.
The presence of other NF-κB family members was confirmed by western blot analysis
of the cytoplasmic and nuclear fractions, with β-actin serving as a loading control. p50 and c-Rel were present in similar amounts in all the cells, while p65 was expressed in the highest levels in SLB-1, MT-2, MET-1 and RV-ATL cells.
Inhibition of NF-κB by Bay 11-7082 decreased PTHrP mRNA expression in
HTLV-1 infected T-cells. Since NF-κB is constitutively activated in HTLV-1
infected T-cells, we wanted to determine the effect of inhibition of NF-κB on PTHrP expression. For this purpose we used Bay 11-7082, a specific IκB phosphorylation inhibitor, which is known to reduce NF-κB activity. As shown in Figure 3.8a and c,
inhibition of NF-κB activity by Bay 11-7082 significantly decreased PTHrP mRNA
98 expression in MT-2 and SLB-1 cell lines at 3 and 6 hrs respectively. Analysis of the
promoter-initiated transcripts revealed that Bay 11-7082 reduced P2 promoter-
initiated transcripts as expected (Figure 3.8b and d). Bay 11-7082 treatment reduced
PTHrP starting at 1 hr following treatment (data not shown). Reduction of PTHrP
expression occured at higher concentrations (20µM) and at a later time point (24hrs)
in RV-ATL cells (data not presented). Inhibition of NF-κB activity with PS-341, a
potent proteasome inhibitor, inhibited PTHrP P2-promoter initiated transcripts and the
total PTHrP expression in RV-ATL cells (data not shown).
3.5 DISCUSSION
PTHrP is expressed in a wide variety of tissues and is known to be dysregulated in
several cancers. Increasing evidence suggests a role for PTHrP in proliferation and
apoptosis besides its central role in the pathogenesis of HHM(37). However,
transcriptional regulation of this complex gene is poorly understood. In this study, we tested the hypothesis that the PTHrP gene is a direct target for NF-κB and report three
major observations: (1) Sequence, EMSA, and competition analyses of the PTHrP P2
promoter sequences identified NF-κB binding sequences in the human PTHrP P2
promoter in vitro that was further confirmed as an authentic NF-κB binding site in vivo by chromatin immunoprecipitation assay; (2) NF-κB activated the human PTHrP
P2 promoter in a subunit-specific manner as determined by an NF-κB over-expressing
99 model in 3T3 cells; (3) Inhibition of NF-κB by Bay 11-7082 in HTLV-1 infected T- cell decreased P2 promoter-initiated transcripts.
The GC-rich PTHrP P2 promoter has been shown to be active in a variety of cells,
including HTLV-1-infected and ATLL cells(38). We identified two putative NF-κB- binding sequences in the human PTHrP P2 promoter that are located 1558 (κB2) and
152 (κB1) nucleotides upstream from the transcription initiation start site. Vasavada et
al have shown that the Sma I/Sau3A fragment of the P2 promoter had significant
activity in renal carcinoma cells(39). We identified and characterized the κB binding site (κB 1) within this fragment of the promoter. In addition, both the κB1 and κB2
sites are also present in the P2 promoter regions of mice and rats, although their order
is reversed compared to humans. While the κB1 sequence appears to have two point
mutations in the dog, the κB2 sequence is present and the location of both these
elements is the same as in humans. The presence of these transcription elements
across different species is consistent with the concept that NF-κB is important in
modulating the expression of PTHrP.
Although tightly regulated in normal physiologic cellular responses, NF-κB is
constitutively activated in various malignancies such as solid tumors, lymphomas and
leukemias, including ATLL(40). HTLV-1 Tax, in addition to mediating transcription
from the viral promoter, activates numerous cellular genes by interacting with NF-κB,
CREB/ATF, SRF, and NF-AT pathways. Tax-mediated NF-κB activation is crucial
for transformation of T-cells by HTLV-1(41). However, the presence of constitutively activated NF-κB pathway in ATLL cells, despite the lack of detectable Tax
100 expression, suggests that Tax may be needed to initiate but not to maintain NF-κB activation. Although several studies have shown that Tax transactivates PTHrP, particularly the P3 promoter(42-44), it is not clear whether Tax is required for PTHrP expression because ATLL cells that do not express detectable Tax have high levels of
PTHrP. In this study, we have compared a variety of cell lines with different levels of
Tax expression to understand the role of Tax and NF-κB in the regulation of PTHrP.
In vitro transformed MT-2 and SLB-1 cells express high tax and low PTHrP. ATLL cells (RV-ATL and MET-1) express PTHrP in the absence of Tax. HT-1RV cells, obtained by superinfecting RV-ATL cells with HTLV-1, express very high levels of
Tax and low PTHrP(45). Our newly developed in vitro immortalized cells (IMM-1) express low levels of Tax and moderate levels of PTHrP (data not shown). Our data are in agreement with previous studies where Tax-expressing T-cells have a very low level of IκBα compared to ATLL cells (RV-ATL and MET-1) indicating that Tax significantly accelerated loss of I-κBα.
EMSA and competition analyses of the PTHrP κB1 sequence showed specific
complexes formed between NF-κB transcription factors and P2 oligonucleotides in
extracts from ATLL and the HTLV-1 cell lines tested. It is a well known feature of
NF-κB signaling that different NF-κB dimers can preferentially bind functionally
distinct DNA binding sites. Tax has been shown to activate the c-Rel gene and induce
predominantly c-Rel-containing complexes(46). Consistent with these observations, the complex formed in extracts from SLB-1 and MT-2 cells, which express high levels of
Tax, contained p50 and c-Rel as the major DNA binding components. This finding
101 was confirmed by the presence of a similar complex with a known κB containing probe (from MHC class I gene promoter) in these cells. Interestingly, there were two distinct complexes in the ATL, HT-1RV and surprisingly even in IMM-1 cells. The lower complexes (C1) in extracts from ATL, HT-1RV and IMM-1 cells were composed of p50 alone. The upper complex (C2) in extracts from in HT-1RV cells was composed of p50/c-Rel, confirming our previous observation that Tax induces the formation of p50/c-Rel-containing complexes. On the other hand, the upper complex in extracts from ATL and IMM-1 cells is intriguing since it did not supershift with antibodies against p50, p65, c-Rel, Bcl-3, RelB (data not shown) or p52 (data not shown). Our attempts to identify these proteins by proteomics and mass spectrometry have been unsuccessful; therefore, the proteins in this complex remain unidentified.
Chromatin immunoprecipitation assays confirmed binding of NF-kB p50 and c-Rel on the PTHrP P2 promoter in vivo. Finally, the differences in the complexes formed in these cells potentially explain the differences in the level of PTHrP P2 promoter transactivation in these cells.
Our transfection studies showed that the human PTHrP P2 promoter can be
activated in a subunit-dependent manner by p50/p50 alone, or by a combination of
p50/c-Rel or p50/Bcl-3, but not by p65 or p50/p65. Most of the transcriptional effect
was attributable to an intact NF-kB site as demonstrated by a significant decrease in
luciferase activity in 3T3 cells transfected with constructs bearing a disrupted κB
sequence. We were surprised by the activation of PTHrP by p50/50 alone since p50
does not have a transactivation domain. There have been conflicting reports regarding
102 the role of p50/p50 in transcription. While some studies support the ability of p50 to
transactivate, particularly in the presence of Bcl-3, others have shown that p50
homodimers act as repressors by binding κB sites that would normally be activated by p50/p65 heterodimers. Mori et al have shown that leukemic cells from ATL patients have abundant p50/p50 homodimers; however, p50 was not able to activate transcription from a p50/p65-inducible construct containing five repeats of a κB motif from the IL-2Rα gene. Interestingly, p50 homodimers are capable of binding all κB binding motifs with similar efficiency but can probably transactivate only a subset of these such as those found in the Bcl-2 and H-2K genes (47-49). It is possible that κB binding motifs like those found in Bcl-2, H-2K and PTHrP promoters may provide a sequence with which p50 forms an activating rather than a repressing complex.
Evidence in support of this hypothesis was provided recently by Schreiber et al showing that p50 homodimers can interact with the RNA polymerase II at the
promoters for genes such as CSF2, ICAM1, and TNF and likely maintain basal level
of target gene activity in unstimulated cells(50). Alternatively, transcriptional activity
of p50 may be cell type-dependent or dependent on undefined cofactors.
Although p50 and p52 have no defined transactivating domains, the association with
Bcl-3 can lead to the conversion of these homodimers to positive regulators of gene expression. In addition, it has been shown that the formation of Bcl-3-p50 homodimer-DNA complexes depends on Bcl-3 concentration and phosphorylation(51).
Furthermore, it has been shown that Bcl-3 can increase the quantity of p50 homodimers that translocate to the nucleus(52). In light of the observations that p50
103 activation can be induced by Bcl-3, we tested the possible association of Bcl-3 with
p50 in transactivating PTHrP. First, we studied the expression of Bcl-3 in HTLV-1-
infected and ATLL cells. Interestingly, Tax-expressing cells have higher levels of
Bcl-3 compared to ATLL cells. Our data from transfection experiments have shown
that a higher p50/Bcl-3 ratio resulted in activation of the promoter, while a lower
p50/Bcl-3 ratio (higher concentrations of Bcl-3) resulted in a dramatic reduction of
transactivation. This correlated well with our data where ATLL cells had lower Bcl-3 levels expressed high levels of PTHrP and Tax-expressing cells that had higher Bcl-3 levels expressed low levels of PTHrP. These data suggest that Bcl-3 may mediate its effect on PTHrP indirectly or at higher concentrations Bcl-3 dissociates from complexes with p50. Based on the results from Bcl-3 expression analysis and transfection assays, it is likely that the low level of Bcl-3 expression in ATLL cells contributed to the transactivation of the promoter while the high levels of Bcl-3 in
Tax-expressing cells inhibited the promoter. This may help explain the differences in the transactivation of the PTHrP P2 promoter in ATL and Tax-expressing T-cells.
Bay 11-7082 has been shown to be a specific NF-κB inhibitor by inhibiting the
phosphorylation of the inhibitor IκB(53). Treatment of HTLV-1 infected T-cells not only reduced the P2 promoter-initiated transcripts but also total PTHrP expression providing additional support to our hypothesis that PTHrP is a direct target of NF-κB signaling. PS-341, a potent and selective proteasome inhibitor reduced NF-κB activity
and total PTHrP expression and the P2 promoter-initiated transcripts in ATLL cells
104 (data not shown). These results support for attempting to reduce NF-κB levels in
ATLL patients.
In conclusion, our results support a direct role for NF-κB in the regulation of
PTHrP. Since NF-κB is known to often mediate its effects through other transcription factors including AP-1, SP-1, and the Ets family of proteins and because binding sites for these factors and others exist within the P2 promoter, it will be important to establish the functional interaction between these factors and NF-κB in the regulation of PTHrP.
105 3.6 REFERENCE LIST
(1) Poiesz BJ, Ruscetti FW, Gazdar AF, Bunn PA, Minna JD, Gallo RC.
Detection and isolation of type C retrovirus particles from fresh and cultured
lymphocytes of a patient with cutaneous T-cell lymphoma. Proc Natl Acad Sci
U S A 1980; 77(12):7415-7419.
(2) Broadus AE, Mangin M, Ikeda K, Insogna KL, Weir EC, Burtis WJ, Stewart
AF. Humoral hypercalcemia of cancer. Identification of a novel parathyroid
hormone-like peptide. N Engl J Med 1988; 319(9):556-563.
(3) Grill V, Martin TJ. Hypercalcemia of malignancy. Rev Endocr Metab Disord
2000; 1(4):253-263.
(4) Wysolmerski JJ, Stewart AF. The physiology of parathyroid hormone-related
protein: an emerging role as a developmental factor. Annu Rev Physiol 1998;
60:431-460.
(5) Mangin M, Ikeda K, Dreyer BE, Broadus AE. Identification of an up-stream
promoter of the human parathyroid hormone-related peptide gene. Mol
Endocrinol 1990; 4(6):851-858.
(6) Campos RV, Wang C, Drucker DJ. Regulation of parathyroid hormone-related
peptide (PTHrP) gene transcription. Mol Endocrinol 1992; 6(10):1642-1652.
106 (7) Suva LJ, Mather KA, Gillespie MT, Webb GC, Ng KW, Winslow GA, Wood
WI, Martin TJ, Hudson PJ. Structure of the 5' flanking region of the gene
encoding human parathyroid-hormone-related protein (PTHrP). Gene 1989;
77(1):95-105.
(8) Vasavada RC, Wysolmerski JJ, Broadus AE, Philbrick WM. Identification and
characterization of a GC-rich promoter of the human parathyroid hormone-
related peptide gene. Mol Endocrinol 1993; 7(2):273-282.
(9) Bouizar Z, Spyratos F, De Vernejoul MC. The parathyroid hormone-related
protein (PTHrP) gene: use of downstream TATA promotor and PTHrP 1-139
coding pathways in primary breast cancers vary with the occurrence of bone
metastasis. J Bone Miner Res 1999; 14(3):406-414.
(10) Southby J, Murphy LM, Martin TJ, Gillespie MT. Cell-specific and regulator-
induced promoter usage and messenger ribonucleic acid splicing for
parathyroid hormone-related protein. Endocrinology 1996; 137(4):1349-1357.
(11) Richard V, Luchin A, Brena RM, Plass C, Rosol TJ. Quantitative evaluation
of alternative promoter usage and 3' splice variants for parathyroid hormone-
related protein by real-time reverse transcription-PCR. Clin Chem 2003;
49(8):1398-1402.
(12) Brandt DW, Bruns ME, Bruns DE, Ferguson JE, Burton DW, Deftos LJ. The
parathyroid hormone-related protein (PTHrP) gene preferentially utilizes a
107 GC-rich promoter and the PTHrP 1-139 coding pathway in normal human
amnion. Biochem Biophys Res Commun 1992; 189(2):938-943.
(13) Good L, Maggirwar SB, Sun SC. Activation of the IL-2 gene promoter by
HTLV-I tax involves induction of NF-AT complexes bound to the CD28-
responsive element. EMBO J 1996; 15(14):3744-3750.
(14) Ballard DW, Bohnlein E, Lowenthal JW, Wano Y, Franza BR, Greene WC.
HTLV-I tax induces cellular proteins that activate the kappa B element in the
IL-2 receptor alpha gene. Science 1988; 241(4873):1652-1655.
(15) Duyao MP, Kessler DJ, Spicer DB, Sonenshein GE. Transactivation of the c-
myc gene by HTLV-1 tax is mediated by NFkB. Curr Top Microbiol Immunol
1992; 182:421-424.
(16) Mori N, Fujii M, Ikeda S, Yamada Y, Tomonaga M, Ballard DW, Yamamoto
N. Constitutive activation of NF-kappaB in primary adult T-cell leukemia
cells. Blood 1999; 93(7):2360-2368.
(17) Hironaka N, Mochida K, Mori N, Maeda M, Yamamoto N, Yamaoka S. Tax-
independent constitutive IkappaB kinase activation in adult T-cell leukemia
cells. Neoplasia 2004; 6(3):266-278.
(18) May MJ, Ghosh S. Signal transduction through NF-kappa B. Immunol Today
1998; 19(2):80-88.
108 (19) Leung TH, Hoffmann A, Baltimore D. One nucleotide in a kappaB site can
determine cofactor specificity for NF-kappaB dimers. Cell 2004; 118(4):453-
464.
(20) Hayden MS, Ghosh S. Signaling to NF-kappaB. Genes Dev 2004;
18(18):2195-2224.
(21) Bours V, Franzoso G, Azarenko V, Park S, Kanno T, Brown K, Siebenlist U.
The oncoprotein Bcl-3 directly transactivates through kappa B motifs via
association with DNA-binding p50B homodimers. Cell 1993; 72(5):729-739.
(22) Franzoso G, Bours V, Park S, Tomita-Yamaguchi M, Kelly K, Siebenlist U.
The candidate oncoprotein Bcl-3 is an antagonist of p50/NF-kappa B-
mediated inhibition. Nature 1992; 359(6393):339-342.
(23) Bundy DL, McKeithan TW. Diverse effects of BCL3 phosphorylation on its
modulation of NF-kappaB p52 homodimer binding to DNA. J Biol Chem
1997; 272(52):33132-33139.
(24) Caamano JH, Perez P, Lira SA, Bravo R. Constitutive expression of Bc1-3 in
thymocytes increases the DNA binding of NF-kappaB1 (p50) homodimers in
vivo. Mol Cell Biol 1996; 16(4):1342-1348.
(25) Richard V, Nadella MV, Green PL, Lairmore MD, Feuer G, Foley JG, Rosol
TJ. Transcriptional regulation of parathyroid hormone-related protein
109 promoter P3 by ETS-1 in adult T-cell leukemia/lymphoma. Leukemia 2005;
19(7):1175-1183.
(26) Feuer G, Zack JA, Harrington WJ, Jr., Valderama R, Rosenblatt JD,
Wachsman W, Baird SM, Chen IS. Establishment of human T-cell leukemia
virus type I T-cell lymphomas in severe combined immunodeficient mice.
Blood 1993; 82(3):722-731.
(27) Phillips KE, Herring B, Wilson LA, Rickford MS, Zhang M, Goldman CK,
Tso JY, Waldmann TA. IL-2Ralpha-Directed monoclonal antibodies provide
effective therapy in a murine model of adult T-cell leukemia by a mechanism
other than blockade of IL-2/IL-2Ralpha interaction. Cancer Res 2000;
60(24):6977-6984.
(28) Stewart SA, Feuer G, Jewett A, Lee FV, Bonavida B, Chen IS. HTLV-1 gene
expression in adult T-cell leukemia cells elicits an NK cell response in vitro
and correlates with cell rejection in SCID mice. Virology 1996; 226(2):167-
175.
(29) Mori N, Gill PS, Mougdil T, Murakami S, Eto S, Prager D. Interleukin-10
gene expression in adult T-cell leukemia. Blood 1996; 88(3):1035-1045.
(30) Guttridge DC, Albanese C, Reuther JY, Pestell RG, Baldwin AS, Jr. NF-
kappaB controls cell growth and differentiation through transcriptional
regulation of cyclin D1. Mol Cell Biol 1999; 19(8):5785-5799.
110 (31) Cheng AS, Jin VX, Fan M, Smith LT, Liyanarachchi S, Yan PS, Leu YW,
Chan MW, Plass C, Nephew KP, Davuluri RV, Huang TH. Combinatorial
analysis of transcription factor partners reveals recruitment of c-MYC to
estrogen receptor-alpha responsive promoters. Mol Cell 2006; 21(3):393-404.
(32) Dirksen WP, Mohamed SA, Fisher SA. Splicing of a myosin phosphatase
targeting subunit 1 alternative exon is regulated by intronic cis-elements and a
novel bipartite exonic enhancer/silencer element. J Biol Chem 2003;
278(11):9722-9732.
(33) Nishikori M, Maesako Y, Ueda C, Kurata M, Uchiyama T, Ohno H. High-
level expression of BCL3 differentiates t(2;5)(p23;q35)-positive anaplastic
large cell lymphoma from Hodgkin disease. Blood 2003; 101(7):2789-2796.
(34) Holz LE, Jakobsen KP, Van Snick J, Cormont F, Sewell WA. Dexamethasone
inhibits IL-9 production by human T cells. J Inflamm (Lond) 2005; 2(1):3.
(35) Glasgow JN, Wood T, Perez-Polo JR. Identification and characterization of
nuclear factor kappaB binding sites in the murine bcl-x promoter. J
Neurochem 2000; 75(4):1377-1389.
(36) Jeang KT, Derse D, Matocha M, Sharma O. Expression status of Tax protein
in human T-cell leukemia virus type 1-transformed MT4 cells: recall of MT4
cells distributed by the NIH AIDS Research and Reference Reagent Program.
J Virol 1997; 71(9):6277-6278.
111 (37) Richard V, Lairmore MD, Green PL, Feuer G, Erbe RS, Albrecht B, D'Souza
C, Keller ET, Dai J, Rosol TJ. Humoral hypercalcemia of malignancy: severe
combined immunodeficient/beige mouse model of adult T-cell lymphoma
independent of human T-cell lymphotropic virus type-1 tax expression. Am J
Pathol 2001; 158(6):2219-2228.
(38) Richard V, Luchin A, Brena RM, Plass C, Rosol TJ. Quantitative evaluation
of alternative promoter usage and 3' splice variants for parathyroid hormone-
related protein by real-time reverse transcription-PCR. Clin Chem 2003;
49(8):1398-1402.
(39) Vasavada RC, Wysolmerski JJ, Broadus AE, Philbrick WM. Identification and
characterization of a GC-rich promoter of the human parathyroid hormone-
related peptide gene. Mol Endocrinol 1993; 7(2):273-282.
(40) Peloponese JM, Yeung ML, Jeang KT. Modulation of nuclear factor-kappaB
by human T cell leukemia virus type 1 Tax protein: implications for
oncogenesis and inflammation. Immunol Res 2006; 34(1):1-12.
(41) Sun SC, Yamaoka S. Activation of NF-kappaB by HTLV-I and implications
for cell transformation. Oncogene 2005; 24(39):5952-5964.
(42) Dittmer J, Pise-Masison CA, Clemens KE, Choi KS, Brady JN. Interaction of
human T-cell lymphotropic virus type I Tax, Ets1, and Sp1 in transactivation
of the PTHrP P2 promoter. J Biol Chem 1997; 272(8):4953-4958.
112 (43) Mori N, Ejima E, Prager D. Transactivation of parathyroid hormone-related
protein gene expression by human T-cell leukemia virus type I tax. Eur J
Haematol 1996; 56(1-2):116-117.
(44) Ikeda K, Inoue D, Okazaki R, Kikuchi T, Ogata E, Matsumoto T. Parathyroid
hormone-related peptide in hypercalcemia associated with adult T cell
leukemia/lymphoma: molecular and cellular mechanism of parathyroid
hormone-related peptide overexpression in HTLV-I-infected T cells. Miner
Electrolyte Metab 1995; 21(1-3):166-170.
(45) Richard V, Nadella MV, Green PL, Lairmore MD, Feuer G, Foley JG, Rosol
TJ. Transcriptional regulation of parathyroid hormone-related protein
promoter P3 by ETS-1 in adult T-cell leukemia/lymphoma. Leukemia 2005;
19(7):1175-1183.
(46) Li CC, Ruscetti FW, Rice NR, Chen E, Yang NS, Mikovits J, Longo DL.
Differential expression of Rel family members in human T-cell leukemia virus
type I-infected cells: transcriptional activation of c-rel by Tax protein. J Virol
1993; 67(7):4205-4213.
(47) Kurland JF, Kodym R, Story MD, Spurgers KB, McDonnell TJ, Meyn RE.
NF-kappaB1 (p50) homodimers contribute to transcription of the bcl-2
oncogene. J Biol Chem 2001; 276(48):45380-45386.
113 (48) Fujita T, Nolan GP, Liou HC, Scott ML, Baltimore D. The candidate proto-
oncogene bcl-3 encodes a transcriptional coactivator that activates through
NF-kappa B p50 homodimers. Genes Dev 1993; 7(7B):1354-1363.
(49) Lin R, Gewert D, Hiscott J. Differential transcriptional activation in vitro by
NF-kappa B/Rel proteins. J Biol Chem 1995; 270(7):3123-3131.
(50) Schreiber J, Jenner RG, Murray HL, Gerber GK, Gifford DK, Young RA.
Coordinated binding of NF-kappaB family members in the response of human
cells to lipopolysaccharide. Proc Natl Acad Sci U S A 2006; 103(15):5899-
5904.
(51) Bundy DL, McKeithan TW. Diverse effects of BCL3 phosphorylation on its
modulation of NF-kappaB p52 homodimer binding to DNA. J Biol Chem
1997; 272(52):33132-33139.
(52) Watanabe N, Iwamura T, Shinoda T, Fujita T. Regulation of NFKB1 proteins
by the candidate oncoprotein BCL-3: generation of NF-kappaB homodimers
from the cytoplasmic pool of p50-p105 and nuclear translocation. EMBO J
1997; 16(12):3609-3620.
(53) Mori N, Yamada Y, Ikeda S, Yamasaki Y, Tsukasaki K, Tanaka Y, Tomonaga
M, Yamamoto N, Fujii M. Bay 11-7082 inhibits transcription factor NF-
kappaB and induces apoptosis of HTLV-I-infected T-cell lines and primary
adult T-cell leukemia cells. Blood 2002; 100(5):1828-1834.
114
Figure 3.1: Schematic representation of human, mouse, rat and dog PTHrP P2 promoter regions. The diagram illustrates the highly conserved nature of the NF-κB sequences in the PTHrP P2 promoter of humans, mice, rats, and dogs. The NF-κB binding sequence in the human promoter studied in this report was found at -152 to - 142 nucleotides upstream from transcriptional start site (indicated by arrows) in exon 3.
115
Figure 3.2: HTLV-1 Tax expression was inversely proportional to IκB-α. Western blot analysis was performed on cytoplasmic (C) and nuclear (N) lysates from HTLV- 1-infected and ATLL cells with antibodies against Tax and IκB-α proteins. Ace-1, a canine prostate carcinoma cell line was used as a negative control. β-actin was used as loading control.
116
Figure 3.3: NF-κB binding activity on a consensus κB binding site in various cell lines. a. Approximately 5 µg of nuclear lysates from the cells were incubated with a [32P]-radiolabeled oligonucleotide corresponding to MHC class 1 gene κB sequence and analyzed by EMSA. The complexes are indicated as C1, C2 and C3. b. In super- shift assays, antibodies specific for each NF-kB subunit (indicated above the lane) were incubated with the nuclear extracts from MT-2, RV-ATL, HT-1RV and IMM-1 cells before addition of the probe.
117
Figure 3.4: Nuclear NF-κB proteins specifically bound to an oligonucleotide containing the NF-κB binding sequences from the human PTHrP P2 promoter. a. A Cy5 5’-end labeled double-stranded PTHrP P2 promoter wild-type oligonucleotide was analyzed by EMSA using 7.5 µg of protein from nuclear extracts of various cell lines. The complex formation is indicated as C1, C2, C3 and the specificity of binding was evaluated using a mutant -κB binding site as described in materials and methods. The additional bands in the gel were not characterized and considered non-specific (NS). b. Antibody-mediated shift interference or supershifts were performed using 7-15 µg of protein from the nuclear extracts with specific NF- κB antibodies as indicated.
118
Figure 3.5: NF-κB p50 and c-Rel bound to the PTHrP P2 promoter in vivo: Chromatin immunoprecipitation was performed in MT-2 cells with antibodies to p50, c-Rel, Bcl-3 and IgG. a. Real-time PCR quantification of transcription factor binding was expressed as enrichment ratio of antibody over IgG control, and each error bar represents standard deviation calculated from triplicates. b. PCR amplification of a 91-bp product from the PTHrP P2 promoter genomic DNA is shown on a 2% agarose gel.
119 Figure 3.6: PTHrP P2 promoter can be transactivated by NF-κB in a sub-unit dependent manner: Relative luciferase activity in NIH3T3 cells transfected with: a.1 µg of either wild-type pGL2/PTHrP-P2/Luc, mutant pGL2/PTHrP-P2/Luc or pGL2 constructs in the presence or absence of expression vectors for NF-κB p50, p65, c- Rel, Bcl-3, p50/p65, p50/c-Rel, or p50/Bcl-3 or Tax. b. 1 µg wild-type pGL2/PTHrP- P2/Luc with or without 0.5 µg of NF-kB c-Rel expression vector and 0.1 to 0.5 µg of p50 expression vector. c. 1 µg wild-type pGL2/PTHrP-P2/Luc with or without 0.5 µg of NF-κB p50 expression vector and 0.05 to 0.25 µg of c-Rel expression vector. d. 1 µg wild-type pGL2/PTHrP-P2/Luc with or without 0.2 to 0.5 µg of NF-κB p50 expression vector and 0.25 to 0.5 µg of Bcl-3 expression vector. e. 1 µg wild-type pGL2/PTHrP-P2/Luc with or without 0.05 to 0.5 µg of NF-κB Bcl-3 expression vector and 0.5 µg of p50 expression vector. The quantity of the expression plasmids is indicated in (µg). Bars represent the mean ± SD of 3 independent samples. (**) indicates significant differences between various groups compared to PTHrP P2 Luc alone (p<0.05). (*) indicates significant differences between mutant and wild-type (p<0.05).
120
Figure 3.6: PTHrP P2 promoter can be transactivated by NF-κB in a sub-unit dependent manner
121
Figure 3.7: Bcl-3 expression was high in HTLV-1-infected T-cells compared to ATLL cells: a. RT-PCR was performed on total RNA isolated from various cells as indicated on the top row using primers specific for Bcl-3. β2 microglobulin was used as a loading control. b. Western blot analysis was performed on the cytoplasmic and nuclear lysates of various cells and probed with antibodies specific for Bcl-3, p50, p65, and c-Rel. β-actin was used as protein loading control.
122
Figure 3.8: Inhibition of the NF-κB activity in HTLV-1-infected T-cells by Bay 11-7082 decreased PTHrP mRNA expression. Total RNA was extracted from MT- 2 cells treated with 5, 10, and 20µM for 3 hrs and SLB-1 cells treated with 7.5µM Bay 11-7082 or vehicle alone for 6hrs. Quantitative real time RT-PCR was performed using primers specific for PTHrP all transcripts and PTHrP P2 promoter-initiated transcripts using TaqMan® Gene Expression Assays. In MT-2 cells, Bay 11-7082 decreased a. total PTHrP b. and the P2 promoter-initiated transcripts in a dose dependent manner. In SLB-1 cells 11-7082 significantly decreased c. total PTHrP and d. the P2 promoter-initiated transcripts at 6hrs of treatment. The data were normalized to β2-microglobulin (β2-M). Bars represent the mean ± standard deviation of 3 independent samples (* P<0.05).
123 CHAPTER 4
NOD/SCID MOUSE MODEL OF CANINE T-CELL LYMPHOMA WITH HUMORAL HYPERCALCEMIA OF MALIGNANCY: CYTOKINE GENE EXPRESSION PROFILING AND IN VIVO BIOLUMINESCENT IMAGING
4.1 ABSTRACT
Lymphoma is a malignant neoplasm arising from B or T lymphocytes. In dogs, one- third of lymphomas are highly aggressive multicentric T-cell lymphomas that are often associated with humoral hypercalcemia of malignancy (HHM). There are no cell lines or animal models to investigate the pathogenesis of T-cell lymphoma and HHM in dogs. We developed the first xenograft model by injecting lymphoma cells from an
Irish Wolfhound intraperitoneally into NOD/SCID mice. The mice developed multicentric lymphoma along with HHM and increased parathyroid hormone-related protein (PTHrP) as occurs in dogs with T-cell lymphoma. Using cytokine cDNA arrays we identified genes that have potential implications in the pathogenesis of T- cell lymphoma. Quantitative RT-PCR of T-cell lymphoma samples from hypercalcemic canine patients showed that PTHrP likely plays a central role in the pathogenesis of HHM and that hypercalcemia is the result of a combinatorial effect of different hypercalcemic factors. Finally, we monitored in vivo tumor progression and metastases in the mouse model by transducing the lymphoma cells with a lentiviral vector that encodes a luciferase-yellow fluorescent protein reporter and showed that in
124 vivo trafficking patterns in this model were similar to that seen in dogs. This unique mouse model will be useful for translational research in lymphoma and for investigating the pathogenesis of T-cell lymphoma and HHM in the dog.
4.2 INTRODUCTION
Non-Hodgkin’s lymphoma (NHL) includes several malignant lymphoproliferative diseases that originate from lymphocytes and represents the fifth most common cause of cancer-related deaths in humans in the United States(1). Lymphoma is the third
most common neoplasm in dogs (2) with an estimated annual incidence of approximately 33 per 100,000 dogs (3). In the absence of chemotherapy, survival beyond one month after diagnosis of lymphoma is uncommon (4). The most common anatomic presentation of canine lymphoma is the multicentric form which usually presents as superficial lymphadenopathy (5) with or without hepatosplenomegaly.
About 26-38% of the lymphomas in dogs (6;7) and 15% of the lymphomas in humans(8)
are T-cell in origin. Humoral hypercalcemia of malignancy (HHM) is a frequent
paraneoplastic syndrome seen in approximately 40% of the dogs with T-cell lymphoma(9) and in 15% of humans with NHL(10). In addition, 70% of human patients
with adult T-cell leukemia/lymphoma caused by human T-cell lymphotropic virus
type-1 (HTLV-1)(11) develop HHM. HHM is a multifactorial syndrome due to the
action of multiple factors produced by neoplastic cells affecting bone, kidney and
intestine that disrupt normal calcium homeostasis (12;13). The primary mechanism for
125 hypercalcemia in patients with lymphoma is increased osteoclastic bone resorption induced by humoral mediators (14;15). Factors produced by lymphoma implicated in the pathogenesis of HHM include parathyroid hormone-related protein (PTHrP), calcitriol, transforming growth factors (TGF), tumor necrosis factors (TNF), interleukin-1 (IL-1), interleukin-6 (IL-6), macrophage inflammatory protein-1 alpha
(MIP-1α), and granulocyte colony stimulating factor (GCSF) (16-21). Calcitriol, the
active product of vitamin D metabolism, enhances gastrointestinal calcium absorption
and also mobilizes calcium from bone. Increased calcitriol production was reported in
human NHL patients with hypercalcemia and was implicated as a major humoral
mediator in the pathogenesis of HHM in lymphoma; however, dysregulated calcitriol
production was also observed in normocalcemic patients with NHL (22;23). Firkin et al reported that NHL patients with hypercalcemia had elevated circulating levels of
PTHrP with no increase in the levels of calcitriol (24).
PTHrP originally was isolated from specific tumors as the primary cause of HHM
(25) and is over-expressed by many different types of neoplasms (26). Studies over the past several years have shown that PTHrP plays a primary role in HHM (27) and hypercalcemia in tumor-bearing animals could be corrected using a neutralizing antibody to PTHrP (28). Amino-terminal peptides of PTHrP have been shown to exert
PTH-like actions in bone and kidney by binding to a common receptor for
PTH/PTHrP (PTH-1 receptor) resulting in hypercalcemia (29;30). Our laboratory
previously reported that dogs with lymphoma and hypercalcemia have elevated levels
of plasma PTHrP, but that these levels were lower than in dogs with carcinomas and
126 hypercalcemia. Moreover, there was no significant correlation between serum calcium
and PTHrP concentrations in dogs with lymphoma and hypercalcemia, suggesting a
role for other cytokines in this syndrome (31). Factors such as TGFα, IL-1, IL-6, and
TNF have been shown to enhance the hypercalcemic effects of PTHrP (32).
Furthermore, TGFβ, TNFα, and IL-1 have been reported to up-regulate PTHrP gene expression in a variety of nonlymphoid cell lines and tissues (33;34). We hypothesized that PTHrP plays a central role in the pathogenesis of HHM in dogs with T-cell lymphoma and acts synergistically with other cytokines produced by the tumor cells.
Canine lymphoma is a spontaneous disease which has a clinical presentation and biologic behavior that closely resembles the human disease (35). Furthermore, canine
lymphoma is a useful translational model to study the pathogenesis and treatment of
lymphoma because dogs share extensive genome homology and a common
environment with humans (36;(37). The value of the canine model also depends on the
availability of rodent models that can reproduce the disease as it occurs in dogs.
Development of animal models that recapitulate the natural history of cancers and their clinical response to therapy is an important prerequisite for rapid bench-to-
bedside translation of anticancer therapies (38). Moreover, the pathogenesis of HHM in dogs with T-cell lymphoma has not been investigated due to the lack of relevant in vivo models and little is known about PTHrP expression and its interrelationship with other cytokines. In this study, we report the development and characterization of a
NOD/SCID mouse model of canine T-cell lymphoma with HHM that closely resembles the disease as it occurs in dogs and humans.
127 The study of animal models has been limited by the difficulty of accurately assessing disease burden and response to therapy. Measurement of tumor volume using calipers is limited to tumors that occur at accessible sites (39). Some of the
available in vivo models of hematological malignancies do not readily allow for
sensitive, real-time detection of tumors, or for serial measurements of tumor
progression (40). For this purpose, we have developed canine lymphoma cells that
stably express luciferase and yellow fluorescent protein (YFP), which allows imaging
of tumor growth and metastasis in vivo in real time. Bioluminescent imaging, a non-
invasive imaging technique, can be used to monitor the growth of luciferase-
expressing lymphoma cells.
In this study, we demonstrated that NOD/SCID mice injected intraperitoneally with canine lymphoma cells develop multicentric lymphoma and HHM as observed in canine patients. The bioluminescent mouse model recapitulates the multicentric anatomical distribution of lymphoma, confirmed by histopathological analyses, and is consistent with the distribution of tumors in dogs and humans with lymphoma.
Cytokine gene expression profiling revealed several genes that may contribute to tumorigenesis and metastasis in lymphoma. Furthermore, analysis of expression of potential hypercalcemic factors in xenograft tumors and tumors from dogs with T-cell lymphoma and HHM using quantitative real-time RT-PCR showed that distinct hypercalcemic factors were produced by these cells.
128 Therefore, this study not only provides a clinically relevant in vivo model for more
accurate preclinical evaluation of investigational therapies against lymphoma, but also will permit mechanistic studies on the interrelationships between cytokines and
PTHrP in the pathogenesis of HHM.
4.3 MATERIALS AND METHODS
Animals and Lymphoma Cell Inoculations
Immunodeficient SCID-NOD (NOD CB17-PRKDC-SCID/J) mice (Jackson Lab, Bar
Harbor, ME) were maintained under specific pathogen-free conditions in the animal
facility of the College of Veterinary Medicine at The Ohio State University,
Columbus, OH. Lymphoma cells were obtained from a 4-year-old intact female Irish
Wolfhound that was presented to the Veterinary Teaching Hospital, University of
Wisconsin-Madison, Madison, WI with generalized lymphadenopathy,
hepatosplenomegaly and hypercalcemia (total calcium - 15.4 mg/dL). The lymphoma
was CD3 positive and CD79a negative as determined by routine
immunohistochemistry and T-cell lymphoma was diagnosed. One of the popliteal
lymph nodes from the dog was surgically excised and the cells were passed through a
#100 mesh stainless steel tissue sieve (Bellco, Vineland, NJ) after dissecting away the
capsule. The cells were washed three times with cold HBSS/5µM EDTA and clumps
were removed with 40-µm nylon filter. The RBCs were lysed with ACK lysing buffer
(BioWhittaker, Walkersville, MD) for 5 min at room temperature followed by brief
129 vortexing. The cells were kept frozen (95% fetal bovine serum and 10% DMSO) in
liquid nitrogen until use. Male mice (5 weeks old) were used as recipients and were
injected intraperitoneally with 1.5 x 107 cells suspended in RPMI 1640 medium.
Controls were inoculated with medium alone. The xenografted mice were sacrificed, the tumors from the spleen and mesenteric lymph nodes were removed, minced,
washed three times with RPMI 1640 medium containing 10% fetal bovine serum,
resuspended in RPMI 1640 medium and were serially passaged into SCID-NOD mice
approximately every 6-8 weeks.
Patient Samples and Normal Canine Lymph Nodes
T-cell lymphomas (confirmed by immunohistochemistry, CD3(+)/CD79a(-) were collected from patients presented to the Veterinary Teaching Hospital at The Ohio
State University, Columbus, OH. A serum calcium concentration of greater than or equal to the laboratory reference value of 11.6 mg/dL was considered hypercalcemic.
The samples are represented as dog numbers with the total calcium (mg/dL) indicated in parenthesis: 1(20.5), 2(14.9), 3(11.6), 4(14.2), 5(11.9), 6(17.9). Two popliteal lymph nodes were collected at necropsy from three control (healthy) experimental female Beagle dogs each and used as controls.
Histopathology, Immunohistochemistry and Immunofluorescence
Complete necropsies were performed on all mice. Tissues were fixed in 10% neutral-
buffered formalin, embedded in paraffin, cut into 5-µm sections, and stained with
130 hematoxylin and eosin. Immunohistochemistry was performed on paraffin sections
with the following antibodies: rabbit anti-human CD3 (1:100; DAKO, Carpinteria,
CA) and biotinylated goat anti-rabbit antibody (1:200; DAKO); mouse anti-human
CD79αcy (1:25; DAKO, Carpinteria, CA) and biotinylated horse anti-mouse antibody
(1:200; DAKO). Visualization was achieved using diaminobenzidine (DAKO) and
hematoxylin counterstain. Immunofluorescence staining was performed on a cytospin
preparation of cells from ascites fluid. Briefly, the cells were fixed for 10 min in PBS
containing 4% paraformaldehyde. The fixed cells were permeabilized with 0.1%
Triton X-100 in PBS for 10 min and blocked with 5% bovine serum albumin in PBS
for 1 h at room temperature. The cells were stained for 1 h at room temperature with
polyclonal rabbit anti-PTHrP (PTHrP amino acids 34 to 53) (1:200, Ab-2, Oncogene
Research Products, Cambridge, MA) followed by incubation for 1 h with goat anti- rabbit IgG conjugated with FITC (1:1000, Molecular Probes, Eugene, OR). Confocal microscopy was performed using a Leica TCS SP2 AOBS Confocal Laser Scanning
Microscope (Germany).
Bone Histomorphometry
Proximal tibiae were collected and fixed in 10% neutral-buffered formalin for 24 h at
4°C, decalcified in 10% ethylenediaminetetraacetic acid (pH 7.4) at 4°C, dehydrated in graded series of ethanol for 5 days at 4°C, infiltrated in two changes of glycol methacrylate (Polysciences Inc., Warrington, PA) for 10 days at 4°C, and embedded in glycol methacrylate at 4°C. Sections were cut at 5 µm, histochemically stained for
131 tartrate-resistant acid phosphatase (Sigma Co., St. Louis, MO), and counterstained
with hematoxylin. Measurements were performed using Image-Pro Plus version 5.0
(Media Cybernetics, Silver Spring, MD) image-analysis software. Histomorphometry was performed on 12 mice xenografted with canine T-cell lymphoma and compared to 6 age-matched control mice. Osteoclastic bone resorption was measured in trabecular bone and osteoclasts were identified as cells lining trabecular bone that stained positive (red) for tartrate-resistant acid phosphatase. Measurements included total bone area, trabecular bone area and perimeter, osteoclast number/mm trabecular
bone, and percent osteoclast perimeter.
PCR Amplification of Canine Microsatellites
Genomic DNA was isolated using DNeasy Tissue Kit (Qiagen, Valencia,
CA) from control mouse spleen, whole blood from a dog (canine WB), Ace-1 cells
(canine prostate cancer cell line), and mesenteric lymph nodes from the xenografted
mice. DNA (100 ng) was amplified with primers specific for canine microsatellites
FH2365, FH2356 (41;42) and C36672 as described (43) using PCR Master Mix
(Promega, Madison, WI). The products were separated by electrophoresis on a 1.5% agarose gel for visualization.
Measurement of Plasma Calcium and PTHrP Concentrations
Calcium and PTHrP plasma concentrations were measured in control and lymphoma- bearing mice. Blood was obtained from the femoral artery at necropsy. Total calcium
132 concentrations were measured in 10 µL of heparinized plasma with a Vitros DT-60 II clinical chemistry analyzer (Johnson & Johnson, Cornilla, GA). Plasma PTHrP concentrations were measured using a two-site immunoradiometric assay (DiaSorin,
Stillwater, MN) specific for the PTHrP N-terminal region (amino acids 1 to 40) and
mid-region (amino acids 57 to 80).
Cytokine Gene Expression Profiling
Panorama Human Cytokine Gene Arrays (Sigma-Genosys, St. Louis, MO) were used
to identify the cytokines involved in the pathogenesis of T-cell lymphoma. Total RNA
was isolated using TRIZOL (Invitrogen, Carlsbad, CA). Briefly, 32P-radiolabeled cDNA probes were prepared from 2.5 µg of pooled total RNA using oligo dT and
AMV reverse transcriptase at 42°C, and were purified on a Sephadex G-25 spin
column (Sigma-Genosys). The arrays were hybridized overnight at 60°C, washed, and
subjected to autoradiography for 12-72 h. The intensity of hybridization signals was
quantified using ArrayVision software version 6.0 (Imaging Research Inc., Haverhill,
UK). The intensity of each spot was corrected for background levels and was
normalized for differences in labeling using the average values of the housekeeping
genes (β2-Microglubulin, β-Actin, GAPDH, Cyclophilin A, HPRT, HLA-A0201,
L19, Transferrin R and α-Tubulin). For each gene, the normalized array data was compared as the ratio between lymphoma versus normal canine lymph node. Genes that were up-regulated or down-regulated at least 2.5-fold or more were considered dysregulated.
133
Quantitative Real-Time RT-PCR
Total RNA was isolated from mouse lymph nodes with canine lymphoma, primary
dog lymphomas, and normal canine lymph nodes (NCLN) using TRIZOL
(Invitrogen). Total RNA (5 µg) was reverse transcribed using the Superscript II First
Strand cDNA synthesis kit (Invitrogen) and the final cDNA was diluted to 200 µL
with RNase- and DNase- free water. qRT-PCR was performed with 5 µL of the
cDNA in a 25 µl volume in triplicate using ABI PRISM 7900HT Sequence Detection
System (Applied Biosystems, Foster City, CA) with a standard temperature protocol
and 2X SYBR Green PCR Master Mix reagent (Applied Biosystems, Foster City,
CA). As a control, the mRNA level of GAPDH was determined in the real time PCR
assay for each RNA sample and used to normalize the data. Fold changes were
calculated by the 2-∆∆CT method as described by the manufacturer (Applied
Biosystems). Canine-specific primers for IL-6, TNFα, TGFβ, GAPDH (44;45) and IL-1α
(46) were used as described. Primers for IL-1β, TGFα, TNFβ, PTHrP, RANKL, and
MIP-1α were designed by aligning the human sequence with the dog genome at http://genome.ucsc.edu/cgi-bin/hgBlat and are shown in Table 1.
Generation of Lentiviral Vectors and Transduction of Lymphoma Cells
Retroviral transduction was performed using vectors encoding luciferase/yellow fluorescent protein, generated as described previously(47). The xenografted lymph
134 nodes were minced into 0.25-0.05 mm3 pieces and transduced with 7.2 × 106
infectious viral particles by spin-inoculation at 2700 rpm for 1 h at 32°C. Polybrene
was added at a final concentration of 8 µg/ml. Following transduction, the tissues
were incubated in a cell culture incubator at 37°C for 1 h and washed twice with
RPMI 1640 medium before injection into mice.
In Vivo and Ex Vivo Imaging
Mice were injected intraperitoneally with 150 µl (40 mg/ml) luciferin (Xenogen,
Alameda, CA) dissolved in PBS. Anesthesia was induced using a 3% isoflurane-air
mixture and maintained at 1.5% isoflurane. Mice were placed in the light-
impermeable imaging chamber of the IVIS imaging system (Xenogen) and the
photons emitted from luciferase-expressing cells were quantified and analyzed using
LivingImage software version 2.50 (Xenogen). For ex vivo imaging, luciferin was
injected into the mice immediately prior to necropsy and tissues were collected after
humane euthanasia and imaged.
Statistical Analysis
Student’s t-test was performed to compare the plasma calcium, PTHrP, and bone
histomorphometric parameters between the control mice and mice bearing canine
lymphoma xenografts. T-tests were used to compare the cytokine mRNA expression
profiles between NCLN and xenograft lymphomas from the mice. A p value less than
0.05 was considered significant.
135 4.4 RESULTS
Xenografted Dog Lymphoma Grew in NOD/SCID Mice
Canine lymphoma cells inoculated intraperitoneally into SCID-NOD mice successfully engrafted and produced tumors (Figure 1). The mice (83%; 13 of 16) had diffuse lymphoma in the mesenteric lymph nodes. Moderate to marked splenomegaly was present in 66% (10 of 16) of the mice (Figure 1b). Small, white raised tumors were present in the liver in 66% of the mice (10/16). Tumors also were present in the mandibular lymph nodes in 3 mice (Figure 1c). Moderate amounts of ascites were present in 4/16 mice. The thymus was approximately 6 to 8 times larger than controls in 2 of the 16 mice (Figure 1d). Microscopic evaluation of the mice inoculated with canine lymphoma cells revealed lymphoma in the mesenteric lymph nodes (14 of 16 mice) (Figure 1j), spleen (14 of 16 mice), liver (12 of 16 mice) (Figure 1i), kidney (10 of 16 mice), lung (8 of 16 mice) (Figure 1k) and the thymus (2 of 16 mice). In the mesentery and the spleen solid sheets of large round cells replaced most of the normal tissue. The cells had a large round to oval nucleus with a moderate amount of cytoplasm and a high mitotic index (4 per high power field, 400X).
Lymphomas were T-cell and of Canine Origin
The mesenteric lymph nodes from the xenografted mice demonstrated positive immunoreactivity for CD3 and but not for CD79a confirming the T-cell origin of the lymphomas (Figures 1e-f). Since specific antibodies to detect canine antigens (that do
136 not cross-react with the mouse) were not available, we used a novel PCR-based
technique to amplify canine microsatellites. A specific PCR product was amplified for
canine microsatellites FH2365, FH2356 (data not presented) and C36672 from the
genomic DNA of the lymphoma xenografts, normal canine tissue and canine prostate
cancer cell line (Ace-1), but not from the control mouse spleen (Figure 1g ),
confirming canine origin of the lymphoma.
Plasma Calcium Concentration
Lymphoma-bearing mice had a statistically significant (P < 0.005) increase in total calcium (10.9 ± 0.8 mg/dl) concentrations compared to control mice (9.2 ± 0.1 mg/dl)
(Figure 2). Total calcium concentrations were as high as 12.4 mg/dl in mice with lymphoma.
Hypercalcemic Factors in Lymphoma-Bearing Mice
Plasma PTHrP concentrations were increased in mice with lymphoma (3.2 ± 2.0 pM/L) compared to the control mice (<1.5 pM/L, Figure 3a). PTHrP was present predominantly and diffusely in the cytoplasm of neoplastic xenograft cells with some nuclear staining as evaluated by immunofluorescence microscopy (Figure 1-l). The xenografted canine lymphomas expressed PTHrP mRNA at significantly higher level
(30 fold) than NCLN. In addition to PTHrP, the xenografted cells also expressed
moderately increased levels of TNFα mRNA (3- to 5-fold). There was mild (but not
statistically significant) up-regulation of TGFβ (2-fold) and RANKL (3-fold) mRNA
137 in the xenografted canine lymphoma cells compared to normal canine lymph nodes
(Figure. 3b). There was a significant down-regulation of IL-6 mRNA (data not
shown) in the xenografted lymphoma cells compared to the normal canine lymph
nodes. Although not statistically significant, the xenografted cells had a trend towards
down-regulation of IL-1β, TNFβ and TGFα mRNA compared to NCLN.
Bone Histomorphometry
To examine parameters of osteoclastic bone resorption, bone histomorphometric
analysis was performed. There was no significant difference in the trabecular bone volume in the xenografted mice with lymphoma when compared to controls (Figure
4a). The perimeter of trabecular bone lined by osteoclasts and the number of osteoclasts/mm of trabecular bone, were increased approximately 2-fold (Figure 4b and c respectively) in NOD/SCID mice xenografted with canine T-cell lymphoma compared to controls (p < 0.05).
Microarray Analysis of Cytokines
To allow rapid screening of cytokines potentially involved in the pathogenesis of
lymphoma, we compared cytokine gene expression profiles between lymphoma
xenografts and normal canine lymph nodes using the Panorama Human Cytokine
Array. Of 865 different cytokines and chemokines present, 34 genes were
significantly up-regulated and 18 genes down-regulated in the xenografts compared to
the normal canine lymph nodes. The list of genes dysregulated in xenografts
138 compared to the normal lymph nodes is shown in Table 3. The up-regulated genes
included those involved in signal transduction, cell surface proteins, integrins, and G-
protein coupled receptors. The down-regulated genes included FGF receptor-1,
binding proteins and interleukin receptors. Quantitative real-time RT-PCR for integrin
α4, integrin β9 (data not presented), and IL-1 receptor like 2 (IL-1RL2) genes validated the microarray findings (Figure 5).
Canine T-cell Lymphomas Express Distinct Hypercalcemic Factors
In order to identify the osteoclastogenic factors involved in the pathogenesis of HHM
in dogs with T-cell lymphoma, we compared the mRNA levels of various
hypercalcemic cytokines using quantitative real-time RT-PCR in canine T-cell
lymphoma samples from hypercalcemic dogs (Figure 6). The samples from
hypercalcemic T-cell lymphoma dogs expressed very high levels of PTHrP mRNA
compared to lymph nodes from normal dogs (69 ±71 fold). The expression of PTHrP
mRNA levels from lymphoma samples ranged from 2- to 194-fold higher than normal
lymph nodes. While the average expression of TNFα mRNA was moderately up- regulated (13 ± 23) in lymphomas compared to normal canine lymph node, there was decreased TNFα expression in two lymphoma samples and no TNFα expression in two other lymphoma samples (#6 and 8) compared to NCLN. There was a mild up- regulation of IL-1β mRNA (3.7 ± 8.6) in the lymphoma samples compared to NCLN.
There was a mild up-regulation of RANKL mRNA (2.3 ± 1.2) in the lymphoma samples compared to NCLN. There was moderate down-regulation of IL-6 mRNA (-
139 10 ± 10) and IL-1α mRNA (-6.0 ± 7.6) in the lymphoma samples compared to NCLN.
There was no difference in the expression of TNFβ, TGFα and MIP-1α mRNA between the lymphoma samples and NCLN as shown in Figure 6.
Tumors Were Detected by In Vivo and Ex Vivo Imaging
Since the canine lymphoma cells could not be maintained in culture, a retroviral transduction system was used for the delivery of a luciferase/yellow fluorescent
protein fusion gene. The time course of engraftment of canine lymphoma cells after
intraperitoneal injection into SCID-NOD mice is shown in Figure 7a. The recipients had detectable tumor growth one week after the injection of lymphoma cells.
Repetitive imaging of mice at weekly intervals demonstrated lymphoma growth in the abdominal viscera. Tumor engraftment and progressive tumor growth was readily demonstrable by bioluminescent imaging (BLI) several weeks before the animals appeared sick as monitored by dehydration and depression. At 7-8 weeks, BLI revealed widespread lymphoma growth in the mesenteric lymph nodes, with metastasis to the spleen, liver, lungs which was confirmed by ex vivo imaging of these organs as shown in Figure 7b.
140 4.5 DISCUSSION
Lymphoma is a common malignancy in humans and dogs. Animal models that can
be easily evaluated are critically important to enhance our understanding of the pathogenesis of lymphoma and for the development of more effective therapies. There are few animal models that closely recapitulate the disease as it occurs in both species, and there are no animal models that are useful for investigating the molecular pathogenesis of lymphoma and hypercalcemia in dogs. We report the establishment of a model of canine T-cell lymphoma and HHM in NOD/SCID mice with lymphoma cells from a dog with HHM. The primary lymphoma cells produced multicentric lymphoma in NOD/SCID mice and maintained their morphological, immunohistochemical, and molecular features. The xenografted lymphoma cells in
NOD/SCID mice induced hypercalcemia by up-regulation of PTHrP and TNFα that stimulate osteoclastic bone resorption. Histomorphometric analysis showed that the
HHM in mice bearing canine lymphoma was due to increased osteoclastic bone resorption as seen in human and canine patients with lymphoma and HHM.
There is little information on the pathogenesis of HHM in humans with lymphoma due to the lack of in vivo models. To our knowledge, the only available mouse models of lymphoma with HHM are for adult T-cell leukemia/lymphoma in which hypercalcemia occurs with a very high frequency. We established a SCID/beige mouse model of ATLL with HHM and have shown that hypercalcemia in those mice was mediated primarily by increased levels of PTHrP(48). Similarly, increased PTHrP
141 is associated with HHM in this canine T-cell lymphoma xenograft mouse model and
will be very useful for investigating the pathogenesis of HHM in lymphoma.
DNA microarrays represent a powerful tool for rapid screening of expression of many genes in parallel and have been used extensively for the study of gene expression in a variety of lymphoid malignancies(49). To identify the molecular basis
underlying the pathogenesis of T-cell lymphoma, we used a cDNA microarray to
characterize the cytokine gene expression profiles of the canine lymphoma xenograft.
Human cDNA arrays could be used to study comparative cytokine gene expression in
canine lymphoma due to the extensive genetic homology between the two species.
Using this technique, we identified a variety of genes that have potential implications
in the tumorigenesis and metastases of canine lymphoma. For example, the up-
regulation of cell cycle regulator cdk4 has been reported in a variety of solid tumors such as breast carcinoma (50), mantle cell lymphoma (51) and diffuse large B-cell lymphoma (52). Histone deacetylase (HDAC) has been shown to be up-regulated in several solid tumors such as prostate (53), breast (54) and gastric cancer (55). Up- regulation of MMP-9 has been reported to be a key player in the dissemination of T- cell lymphoma cells to peripheral tissues (56). Integrins have been a subject of
extensive research and several antagonists of integrins are currently being evaluated
as anticancer therapeutics. Integrins have been shown to promote cellular migration
and survival in tumors and primary cells (57) and have been shown to be involved in specific homing of lymphocytes to various tissues (58). For example, it has been shown
that integrin α4β7 targets T-cells to the GALT (59). Interestingly, up-regulation of
142 integrin α4 and β7 might explain the predominance of mesenteric lymphomas seen in our model. Genes such as the interleukin-1 receptor-like 2 (IL-1RL2) have been shown to be down-regulated several-fold in mantle cell lymphoma (60), consistent with
our observations; however, instead of tumor necrosis factor receptor superfamily-1A
(TNFRSF1A), rather TNFRSF1B was down-regulated in our lymphoma model.
Many dogs with T-cell lymphoma develop HHM, a paraneoplastic syndrome that significantly contributes to morbidity and mortality when it occurs (61). PTHrP has been shown to be a causative factor of hypercalcemia in several epithelial cancers in
humans and in animals bearing human solid tumors (62;63). A previous investigation by our laboratory showed that dogs with lymphoma and hypercalcemia had increased concentrations of plasma PTHrP, but there was no correlation between serum calcium and PTHrP levels (31). It was suggested that PTHrP induced HHM in synergy with
tumor-related cytokines. Kuboto et al reported increased plasma PTHrP in one dog
with lymphoma and hypercalcemia, and no detectable PTHrP in dogs with lymphoma
and normocalcemia and healthy dogs. They also detected PTHrP mRNA expression in
one dog with lymphoma and hypercalcemia and four dogs with lymphoma and
normocalcemia (64). In this study, we examined the expression profiles of various cytokines capable of mediating bone resorption in dogs with T-cell lymphoma and
hypercalcemia. Comparison of the mRNA levels in six hypercalcemic dogs with T-
cell lymphoma revealed a distinct set of hypercalcemic factors in each case. PTHrP
mRNA was up-regulated in all hypercalcemic dogs and ranged from 3- to 194-fold.
TNFα mRNA was either moderately up-regulated or down-regulated in
143 hypercalcemic dogs. TNFα, a pro-inflammatory cytokine, is known to stimulate osteoclastogenesis by RANKL-dependent (65) and independent mechanisms (66). Also,
TNFα has been shown to be involved in the pathogenesis of several inflammatory and metabolic bone diseases such as rheumatoid arthritis, periodontitis, and/or postmenopausal osteoporosis (67). The up-regulation of TNFα mRNA in some of the lymphoma samples suggests a potential role for TNFα in the pathogenesis of HHM.
RANKL, secreted by activated T lymphocytes, has been shown to promote differentiation and fusion of osteoclast precursors and activate mature osteoclasts by binding to its specific receptor, RANK (68). There was a mild to moderate up-
regulation of RANKL in some of the hypercalcemic lymphoma samples (dog # 2, 4,
and 5) which likely contributed to the pathogenesis of HHM in those dogs. Although
IL-6 has been shown to be up-regulated in some cancers with HHM, we found down-
regulation of IL-6 in all the samples examined. For example in dog # 1, there was
mild to moderate up-regulation of PTHrP with a moderate to marked up-regulation of
TNFα and IL-1β suggesting a possible synergistic role of TNFα and IL-1β with
PTHrP in causing HHM. In summary, as indicated by Cox et al, because of the heterogeneity of the lymphomas (69) and particularly T-cell lymphomas, a common cause of hypercalcemia is unlikely. Inspite of these differences, our study has revealed that PTHrP likely plays the central role in the pathogenesis of HHM in dogs with T- cell lymphoma and it is likely that hypercalcemia in each case is the result of a combinatorial effect of different sets of cytokines and in this context the roles of various cytokines must be evaluated.
144 The investigation of mechanisms of tumor growth, metastasis, and response to
therapy requires animal models capable of detecting small numbers of cells and assessing disease burden noninvasively and quantitatively. Since lentiviral vectors can infect non-dividing cells, and because our xenografted lymphoma cells do not grow in vitro, we used a novel lentiviral transduction technique. The lentiviral vectors were very useful and efficient for delivering the reporter transgene into tumor cells that do not grow in vitro. Using BLI, we were able to detect and monitor lymphoma cell growth in locations that were not easily monitored grossly such as the abdominal cavity and viscera. Tumor cell trafficking, engraftment in different organs, and
metastasis could be visualized without perturbing intact organs. BLI showed that trafficking of lymphoma cells in this NOD/SCID mouse model has similarities to that in dogs and humans with lymphoma involving the lymph nodes, liver and spleen. The abdominal/mesenteric distribution of the tumor seen in this model is not a common clinical presentation in dogs. This could either be due to the intraperitoneal route of injection of tumor cells, or specific host (species) factors that influence tumor cell trafficking and anatomic distribution of the tumors in dogs and mice.
In conclusion, this bioluminescent NOD/SCID mouse model of canine T-cell lymphoma provides a clinically relevant in vivo model to study the regulation of
PTHrP and its interrelationships with cytokines produced by lymphoma cells in the induction of HHM. This new tool will improve our understanding of tumor biology and facilitate drug discovery and evaluation.
145 4.6 REFERENCE LIST
(1) O'Connor OA, Toner LE, Vrhovac R, Budak-Alpdogan T, Smith EA,
Bergman P. Comparative animal models for the study of lymphohematopoietic
tumors: strengths and limitations of present approaches. Leuk Lymphoma
2005; 46(7):973-992.
(2) Sueiro FA, Alessi AC, Vassallo J. Canine lymphomas: a morphological and
immunohistochemical study of 55 cases, with observations on p53
immunoexpression. J Comp Pathol 2004; 131(2-3):207-213.
(3) Teske E. Canine malignant lymphoma: a review and comparison with human
non-Hodgkin's lymphoma. Vet Q 1994; 16(4):209-219.
(4) MacEwen EG. Spontaneous tumors in dogs and cats: models for the study of
cancer biology and treatment. Cancer Metastasis Rev 1990; 9(2):125-136.
(5) Washizu T, Azakami D, Bonkobara M, Washizu M, Arai T. Changes in
activities of enzymes related to energy metabolism in canine lymphoma cells.
J Vet Med Sci 2005; 67(6):615-616.
(6) Modiano JF, Breen M, Burnett RC, Parker HG, Inusah S, Thomas R, Avery
PR, Lindblad-Toh K, Ostrander EA, Cutter GC, Avery AC. Distinct B-cell and
T-cell lymphoproliferative disease prevalence among dog breeds indicates
heritable risk. Cancer Res 2005; 65(13):5654-5661.
146 (7) Fournel-Fleury C, Magnol JP, Bricaire P, Marchal T, Chabanne L, Delverdier
A, Bryon PA, Felman P. Cytohistological and immunological classification of
canine malignant lymphomas: comparison with human non-Hodgkin's
lymphomas. J Comp Pathol 1997; 117(1):35-59.
(8) A clinical evaluation of the International Lymphoma Study Group
classification of non-Hodgkin's lymphoma. The Non-Hodgkin's Lymphoma
Classification Project. Blood 1997; 89(11):3909-3918.
(9) Fournel-Fleury C, Ponce F, Felman P, Blavier A, Bonnefont C, Chabanne L,
Marchal T, Cadore JL, Goy-Thollot I, Ledieu D, Ghernati I, Magnol JP.
Canine T-cell lymphomas: a morphological, immunological, and clinical study
of 46 new cases. Vet Pathol 2002; 39(1):92-109.
(10) Seymour JF, Gagel RF, Hagemeister FB, Dimopoulos MA, Cabanillas F.
Calcitriol Production in Hypercalcemic and Normocalcemic Patients with
Non-Hodgkin Lymphoma. Ann Intern Med 1994; 121(9):633-640.
(11) Nosaka K, Miyamoto T, Sakai T, Mitsuya H, Suda T, Matsuoka M.
Mechanism of hypercalcemia in adult T-cell leukemia: overexpression of
receptor activator of nuclear factor kappaB ligand on adult T-cell leukemia
cells. Blood 2002; 99(2):634-640.
(12) Rosol TJ, Capen CC. Mechanisms of cancer-induced hypercalcemia. Lab
Invest 1992; 67(6):680-702.
147 (13) Mundy GR, Guise TA. Hypercalcemia of malignancy. Am J Med 1997;
103(2):134-145.
(14) Roodman GD. Mechanisms of bone lesions in multiple myeloma and
lymphoma. Cancer 1997; 80(8 Suppl):1557-1563.
(15) Meuten DJ, Kociba GJ, Capen CC, Chew DJ, Segre GV, Levine L, Tashjian
AH, Jr., Voelkel EF, Nagode LA. Hypercalcemia in dogs with
lymphosarcoma. Biochemical, ultrastructural, and histomorphometric
investigations. Lab Invest 1983; 49(5):553-562.
(16) Yoneda T, Alsina MA, Chavez JB, Bonewald L, Nishimura R, Mundy GR.
Evidence that tumor necrosis factor plays a pathogenetic role in the
paraneoplastic syndromes of cachexia, hypercalcemia, and leukocytosis in a
human tumor in nude mice. J Clin Invest 1991; 87(3):977-985.
(17) Mundy GR. Pathophysiology of cancer-associated hypercalcemia. Semin
Oncol 1990; 17(2 Suppl 5):10-15.
(18) Johnson RA, Boyce BF, Mundy GR, Roodman GD. Tumors producing human
tumor necrosis factor induced hypercalcemia and osteoclastic bone resorption
in nude mice. Endocrinology 1989; 124(3):1424-1427.
(19) Seymour JF, Gagel RF. Calcitriol: the major humoral mediator of
hypercalcemia in Hodgkin's disease and non-Hodgkin's lymphomas. Blood
1993; 82(5):1383-1394. 148 (20) Wano Y, Hattori T, Matsuoka M, Takatsuki K, Chua AO, Gubler U, Greene
WC. Interleukin 1 gene expression in adult T cell leukemia. J Clin Invest
1987; 80(3):911-916.
(21) Niitsu Y, Urushizaki Y, Koshida Y, Terui K, Mahara K, Kohgo Y, Urushizaki
I. Expression of TGF-beta gene in adult T cell leukemia. Blood 1988;
71(1):263-266.
(22) Seymour JF, Gagel RF. Calcitriol: the major humoral mediator of
hypercalcemia in Hodgkin's disease and non-Hodgkin's lymphomas. Blood
1993; 82(5):1383-1394.
(23) Seymour JF, Gagel RF, Hagemeister FB, Dimopoulos MA, Cabanillas F.
Calcitriol production in hypercalcemic and normocalcemic patients with non-
Hodgkin lymphoma. Ann Intern Med 1994; 121(9):633-640.
(24) Firkin F, Seymour JF, Watson AM, Grill V, Martin TJ. Parathyroid hormone-
related protein in hypercalcaemia associated with haematological malignancy.
Br J Haematol 1996; 94(3):486-492.
(25) Rosol TJ, Capen CC. Pathogenesis of humoral hypercalcemia of malignancy.
Domest Anim Endocrinol 1988; 5(1):1-21.
(26) Broadus AE, Mangin M, Ikeda K, Insogna KL, Weir EC, Burtis WJ, Stewart
AF. Humoral hypercalcemia of cancer. Identification of a novel parathyroid
hormone-like peptide. N Engl J Med 1988; 319(9):556-563. 149 (27) Wysolmerski JJ, Broadus AE. Hypercalcemia of malignancy: the central role
of parathyroid hormone-related protein. Annu Rev Med 1994; 45:189-200.
(28) Kukreja SC, Shevrin DH, Wimbiscus SA, Ebeling PR, Danks JA, Rodda CP,
Wood WI, Martin TJ. Antibodies to parathyroid hormone-related protein
lower serum calcium in athymic mouse models of malignancy-associated
hypercalcemia due to human tumors. J Clin Invest 1988; 82(5):1798-1802.
(29) Caulfield MP, McKee RL, Goldman ME, Thiede MA, Thompson DD, Fisher
JE, Levy JJ, Seedor JG, Horiuchi N, Clemens TL, . Parathyroid hormone-
related protein (PTHrP): studies with synthetic peptides indicate that
parathyroid hormone and PTHrP interact with the same receptor. Int J Rad
Appl Instrum B 1990; 17(7):633-637.
(30) Rosenblatt M, Caulfield MP, Fisher JE, Horiuchi N, McKee RL, Rodan SB,
Thiede MA, Thompson DD, Seedor JG, Nutt RE, . A tumor-secreted protein
associated with human hypercalcemia of malignancy. Biology and molecular
biology. Ann N Y Acad Sci 1988; 548:137-145.
(31) Rosol TJ, Nagode LA, Couto CG, Hammer AS, Chew DJ, Peterson JL, Ayl
RD, Steinmeyer CL, Capen CC. Parathyroid hormone (PTH)-related protein,
PTH, and 1,25-dihydroxyvitamin D in dogs with cancer-associated
hypercalcemia. Endocrinology 1992; 131(3):1157-1164.
150 (32) Clines GA, Guise TA. Hypercalcaemia of malignancy and basic research on
mechanisms responsible for osteolytic and osteoblastic metastasis to bone.
Endocr Relat Cancer 2005; 12(3):549-583.
(33) Uy HL, Mundy GR, Boyce BF, Story BM, Dunstan CR, Yin JJ, Roodman GD,
Guise TA. Tumor necrosis factor enhances parathyroid hormone-related
protein-induced hypercalcemia and bone resorption without inhibiting bone
formation in vivo. Cancer Res 1997; 57(15):3194-3199.
(34) Boyce BF, Aufdemorte TB, Garrett IR, Yates AJ, Mundy GR. Effects of
interleukin-1 on bone turnover in normal mice. Endocrinology 1989;
125(3):1142-1150.
(35) Modiano JF, Breen M, Valli VE, Wojcieszyn JW, Cutter GR. Predictive value
of p16 or Rb inactivation in a model of naturally occurring canine non-
Hodgkin's lymphoma. Leukemia 2007; 21(1):184-187.
(36) Starkey MP, Scase TJ, Mellersh CS, Murphy S. Dogs really are man's best
friend--canine genomics has applications in veterinary and human medicine!
Brief Funct Genomic Proteomic 2005; 4(2):112-128.
(37) Vail DM, MacEwen EG. Spontaneously occurring tumors of companion
animals as models for human cancer. Cancer Invest 2000; 18(8):781-792.
(38) Mitsiades CS, Mitsiades NS, Bronson RT, Chauhan D, Munshi N, Treon SP,
Maxwell CA, Pilarski L, Hideshima T, Hoffman RM, Anderson KC. 151 Fluorescence imaging of multiple myeloma cells in a clinically relevant
SCID/NOD in vivo model: biologic and clinical implications. Cancer Res
2003; 63(20):6689-6696.
(39) Edinger M, Cao YA, Verneris MR, Bachmann MH, Contag CH, Negrin RS.
Revealing lymphoma growth and the efficacy of immune cell therapies using
in vivo bioluminescence imaging. Blood 2003; 101(2):640-648.
(40) Mitsiades CS, Mitsiades NS, Bronson RT, Chauhan D, Munshi N, Treon SP,
Maxwell CA, Pilarski L, Hideshima T, Hoffman RM, Anderson KC.
Fluorescence imaging of multiple myeloma cells in a clinically relevant
SCID/NOD in vivo model: biologic and clinical implications. Cancer Res
2003; 63(20):6689-6696.
(41) Starkey MP, Scase TJ, Mellersh CS, Murphy S. Dogs really are man's best
friend--canine genomics has applications in veterinary and human medicine!
Brief Funct Genomic Proteomic 2005; 4(2):112-128.
(42) Mellersh CS, Langston AA, Acland GM, Fleming MA, Ray K, Wiegand NA,
Francisco LV, Gibbs M, Aguirre GD, Ostrander EA. A linkage map of the
canine genome. Genomics 1997; 46(3):326-336.
(43) Ostrander EA, Mapa FA, Yee M, Rine J. One hundred and one new simple
sequence repeat-based markers for the canine genome. Mamm Genome 1995;
6(3):192-195.
152 (44) Peeters D, Peters IR, Clercx C, Day MJ. Real-time RT-PCR quantification of
mRNA encoding cytokines, CC chemokines and CCR3 in bronchial biopsies
from dogs with eosinophilic bronchopneumopathy. Vet Immunol
Immunopathol 2006; 110(1-2):65-77.
(45) Peeters D, Peters IR, Farnir F, Clercx C, Day MJ. Real-time RT-PCR
quantification of mRNA encoding cytokines and chemokines in histologically
normal canine nasal, bronchial and pulmonary tissue. Vet Immunol
Immunopathol 2005; 104(3-4):195-204.
(46) Aihara Y, Kasuya H, Onda H, Hori T, Takeda J, Faraci FM. Quantitative
Analysis of Gene Expressions Related to Inflammation in Canine Spastic
Artery After Subarachnoid Hemorrhage Editorial Comment. Stroke 2001;
32(1):212-217.
(47) Tannehill-Gregg SH, Levine AL, Nadella MV, Iguchi H, Rosol TJ. The effect
of zoledronic acid and osteoprotegerin on growth of human lung cancer in the
tibias of nude mice. Clin Exp Metastasis 2006.
(48) Richard V, Lairmore MD, Green PL, Feuer G, Erbe RS, Albrecht B, D'Souza
C, Keller ET, Dai J, Rosol TJ. Humoral hypercalcemia of malignancy: severe
combined immunodeficient/beige mouse model of adult T-cell lymphoma
independent of human T-cell lymphotropic virus type-1 tax expression. Am J
Pathol 2001; 158(6):2219-2228.
153 (49) Staudt LM. Gene expression profiling of lymphoid malignancies. Annu Rev
Med 2002; 53:303-318.
(50) An HX, Beckmann MW, Reifenberger G, Bender HG, Niederacher D. Gene
Amplification and Overexpression of CDK4 in Sporadic Breast Carcinomas Is
Associated with High Tumor Cell Proliferation. Am J Pathol 1999;
154(1):113-118.
(51) Hernandez L, Bea S, Pinyol M, Ott G, Katzenberger T, Rosenwald A, Bosch
F, Lopez-Guillermo A, Delabie J, Colomer D, Montserrat E, Campo E. CDK4
and MDM2 Gene Alterations Mainly Occur in Highly Proliferative and
Aggressive Mantle Cell Lymphomas with Wild-type INK4a/ARF Locus.
Cancer Res 2005; 65(6):2199-2206.
(52) Rao PH, Houldsworth J, Dyomina K, Parsa NZ, Cigudosa JC, Louie DC,
Popplewell L, Offit K, Jhanwar SC, Chaganti RSK. Chromosomal and Gene
Amplification in Diffuse Large B-Cell Lymphoma. Blood 1998; 92(1):234-
240.
(53) Patra SK, Patra A, Dahiya R. Histone deacetylase and DNA methyltransferase
in human prostate cancer. Biochem Biophys Res Commun 2001; 287(3):705-
713.
154 (54) Vigushin DM, Ali S, Pace PE, Mirsaidi N, Ito K, Adcock I, Coombes RC.
Trichostatin A is a histone deacetylase inhibitor with potent antitumor activity
against breast cancer in vivo. Clin Cancer Res 2001; 7(4):971-976.
(55) Choi JH, Kwon HJ, Yoon BI, Kim JH, Han SU, Joo HJ, Kim DY. Expression
profile of histone deacetylase 1 in gastric cancer tissues. Jpn J Cancer Res
2001; 92(12):1300-1304.
(56) Aoudjit F, Potworowski EF, St Pierre Y. Bi-Directional Induction of Matrix
Metalloproteinase-9 and Tissue Inhibitor of Matrix Metalloproteinase-1
During T Lymphoma/Endothelial Cell Contact: Implication of ICAM-1. J
Immunol 1998; 160(6):2967-2973.
(57) Jin H, Varner J. Integrins: roles in cancer development and as treatment
targets. Br J Cancer 2004; 90(3):561-565.
(58) Drillenburg P, Pals ST. Cell adhesion receptors in lymphoma dissemination.
Blood 2000; 95(6):1900-1910.
(59) Schweighoffer T, Tanaka Y, Tidswell M, Erle DJ, Horgan KJ, Luce GE,
Lazarovits AI, Buck D, Shaw S. Selective expression of integrin alpha 4 beta 7
on a subset of human CD4+ memory T cells with Hallmarks of gut-trophism. J
Immunol 1993; 151(2):717-729.
155 (60) Hofmann WK, de Vos S, Tsukasaki K, Wachsman W, Pinkus GS, Said JW,
Koeffler HP. Altered apoptosis pathways in mantle cell lymphoma detected by
oligonucleotide microarray. Blood 2001; 98(3):787-794.
(61) Gerber B, Hauser B, Reusch CE. Serum levels of 25-hydroxycholecalciferol
and 1,25-dihydroxycholecalciferol in dogs with hypercalcaemia. Vet Res
Commun 2004; 28(8):669-680.
(62) Kukreja SC, Shevrin DH, Wimbiscus SA, Ebeling PR, Danks JA, Rodda CP,
Wood WI, Martin TJ. Antibodies to parathyroid hormone-related protein
lower serum calcium in athymic mouse models of malignancy-associated
hypercalcemia due to human tumors. J Clin Invest 1988; 82(5):1798-1802.
(63) Kukreja SC, Rosol TJ, Wimbiscus SA, Shevrin DH, Grill V, Barengolts EI,
Martin TJ. Tumor resection and antibodies to parathyroid hormone-related
protein cause similar changes on bone histomorphometry in hypercalcemia of
cancer. Endocrinology 1990; 127(1):305-310.
(64) Kubota A, Kano R, Mizuno T, Hisasue M, Moore PF, Watari T, Tsujimoto H,
Hasegawa A. Parathyroid hormone-related protein (PTHrP) produced by dog
lymphoma cells. J Vet Med Sci 2002; 64(9):835-837.
(65) Azuma Y, Kaji K, Katogi R, Takeshita S, Kudo A. Tumor necrosis factor-
alpha induces differentiation of and bone resorption by osteoclasts. J Biol
Chem 2000; 275(7):4858-4864.
156 (66) Kobayashi K, Takahashi N, Jimi E, Udagawa N, Takami M, Kotake S,
Nakagawa N, Kinosaki M, Yamaguchi K, Shima N, Yasuda H, Morinaga T,
Higashio K, Martin TJ, Suda T. Tumor necrosis factor alpha stimulates
osteoclast differentiation by a mechanism independent of the ODF/RANKL-
RANK interaction. J Exp Med 2000; 191(2):275-286.
(67) Roato I, Grano M, Brunetti G, Colucci S, Mussa A, Bertetto O, Ferracini R.
Mechanisms of spontaneous osteoclastogenesis in cancer with bone
involvement. FASEB J 2004;04-1823fje.
(68) Theill LE, Boyle WJ, Penninger JM. RANK-L and RANK: T cells, bone loss,
and mammalian evolution. Annu Rev Immunol 2002; 20:795-823.
(69) Cox M, Haddad JG. Lymphoma, hypercalcemia, and the sunshine vitamin.
Ann Intern Med 1994; 121(9):709-712.
157
Gene and Forward primer Reverse primer Ampli accession con number size IL-1β AGCTTTGGAGAAGCTGAA TCCTGTAACTTGCAGTCCA 170 Z70047 GAAGCC CCGAT bp
RANKL AGGTTGGGCCAAGATCTCC TCAGCTGAAGATACTCTGT 143 NM_033 AACAT GGCGA bp 012 TGFα AGGTTTCTGGTGCAGGAGG AGCACACACGCGATGATG 160 NM_003 ACAA AGGA bp 236 TNFβ AGCACTTCATACAAGGCAC ACCAGGAGGGAATTGTTGC 141 M55913 CCTCA TCAGA bp
MIP-1-α TAGTCGACTGCTTTGAGAC CTTTCAGCTTCAGATCGGC 135 AF04333 CAGCA CACAT bp 9. PTHrP AGCTCGGCCGCCGGCTCAA GGAAGAATCGTCGCCGTA 93 bp U15593 AG
Table 4.1: Primers used for Q-RT-PCR with accession numbers for each gene
158
Organ Number of mice with lymphoma/total number of mice) Mesentery 14/16
Spleen 14/16
Liver 12/16
Kidney 10/16
Lungs 8/16
Thymus 2/16
Table 4.2. Histopathology in NOD/SCID mice xenografted with canine T-cell lymphoma
159
Table 4.3 List of genes up-regulated in the xenografted canine T-cell lymphoma compared to normal canine lymph nodes (NCLN)
160
Genes upregulated in lymphoma compared Fold increase to normal canine lymph node 1. Adhesion Molecules: NCAM 6.1 2. Integrins: Integrin α-4 8.3 Integrin β-7 10.2 Integrin α-7 3.6 Integrin-αL 4.2 3. Cell Surface Proteins: C3 8.3 CD3γ gamma 4.4 CD3 epsilon 6.2 CD3 delta 5.8 CD3zeta 3.1 4. Developmental Factors: MFNG 5.2 SEMA4D 3.8 5. G-Protein Coupled Receptors: GPR 9-6 10.4 GPR10 4.8 6. Protease or Related Factor: MMP9 4.2 7. Signal transduction: HDAC1 3.8 HDAC3 3.1 CBL 3.1 FAST-1 2.8 YWHAZ 4.8 CIS3 5.1 STAT 5A 3.6 ARHB/RhoB 4.2 PTPN5 2.8 TRIP 2.5 8. Cell Cycle Regulators : Cyclin A2 3.6 CDK4 3.5 9. Apoptosis Related: TRADD 5.8 FADD 3.6 10. Eph family: EphB6 3.8 EphB4 4.2 11.TNF superfamily: TNFRSF6B/DcR3 12. Binding protein: 5.6 LTBP4 3.1
161
Genes down-regulated in lymphoma Fold decrease compared to normal canine lymph node 1. TNF Superfamily: TNFRSF1B 20.2 EDAR 10.4 2. Adhesion Molecules: BCAM 4.4 3. Protease or Related Factor: ADAM 12 6.2 4. Other Factors: NMA 10.2 5. Binding Protein: LBP 18.2 6. Interleukin Receptors: IL-1 RL2 8.2 IL-18 RAP 4.8 7. Cell Surface Proteins: RP105 4.8 SLAM 6.2 8. FGF Family: FGFR1 22.3 9. Neurotrophic group: Ret 5.2 10. Chemokines MCP-1 2.6
Table 4.4 List of genes down-regulated in the xenografted canine T-cell lymphoma compared to normal canine lymph nodes (NCLN)
162
Figure 4.1. Characterization of canine T-cell lymphoma xenografted in NOD/SCID mice. Photomicrographs of a: control NOD/SCID mouse. NOD/SCID mouse with canine lymphoma xenograft (shown by arrows) in b: the spleen c: the mandibular lymph nodes and d: the thymus e: Negative immunohistochemistry for CD79cα (pan B-cell marker) in lymphoma of the mesenteric lymph node (immunoperoxidase; final magnification, x200). f: Positive immunohistochemistry for CD3 (pan T-cell marker) in lymphoma of the mesenteric lymph node (immunoperoxidase; final magnification, x200). g: PCR amplification of canine microsatellites. The specific products of 520 bp (FH2365) and 180 bp (C36672) were amplified from canine whole blood (WB), xenografted canine lymphoma, a canine prostate cancer cell line (Ace-1), but not from control mouse spleen. h: Lymphoma cells in the ascites fluid from the xenografted mouse (Wright’s stain; magnification:200X). i: Lymphoma in the liver of a NOD/SCID mouse (H&E, original magnification, x100 j: Diffuse lymphoma in the mesenteric lymph node of a NOD/SCID mouse (H&E, original magnification, x200) k: Lymphoma in the lungs of a NOD/SCID mouse (H&E, original magnification, x200) l: PTHrP immunofluorescence in the cytoplasm and nucleus of lymphoma cells (FITC, confocal imaging, 400 X)
163
Figure 4.1. Characterization of canine T-cell lymphoma xenografted in NOD/SCID mice.
164
Figure 4.2. Plasma total calcium concentrations (mg/dL). Mice engrafted with canine T-cell lymphoma had significantly (P < 0.005) greater plasma total calcium levels (10.9 ± 0.8 mg/dl) than controls (9.2 ± 0.13 mg/dl). Bars indicate means.
165
Figure 4.3. Hypercalcemic factors in the NOD/SCID mice xenografted with canine lymphoma. a: Plasma PTHrP concentrations (pM). The xenografted NOD/SCID mice have increased concentrations of circulating PTHrP (3.2 ± 2.0 pM/L) (p=0.025) compared to control mice (<1.5). Bars represent averages. b: Q-RT- PCR for expression of mRNA for hypercalcemic factors in the xenografted canine T- cell lymphoma. The mesenteric lymphomas expressed significantly higher levels of PTHrP and TNFα mRNA (p<0.005) compared to normal canine lymph nodes (NCLN). No significant differences were observed in other cytokines examined. Bars represent the mean ± SD of 3 independent samples.
166
Figure 4.4. Histomorphometry of tibiae of NOD/SCID mice xenografted with canine T-cell lymphoma. a. There was no significant difference in the trabecular bone volume between the control and lymphoma bearing NOD/SICD mice. b. Percent osteoclast perimeter was significantly increased (*p<0.005) in the lymphoma-bearing mice compared to the controls. c. Osteoclast number/mm trabecular bone was significantly increased in lymphoma-bearing mice compared to controls *p<0.05. Bars represent the mean ± SE.
167
Figure 4.5. Q-RT-PCR verification of microarray data. a. Up-regulation of integrin alpha-4 mRNA in the primary tumor and the mesenteric lymphomas from the xenografted mice compared to the normal canine lymph nodes (NCLN). b. Downregulation of IL-1RL-2 mRNA in the primary tumor and the mesenteric lymphomas from the xenografted mice compared to NCLN.
168
Figure 4.6. Hypercalcemic factors in canine T-cell lymphoma patients with hypercalcemia. Q-RT-PCR analyses for mRNA expression for IL-6, IL-1α, IL-1β, TNFα, TNFβ, TGFα, TGFβ, RANKL, MIPα and PTHrP from dogs with T-cell lymphoma and hypercalcemia normalized to normal canine lymph nodes (NCLN). Moderate to markedly elevated PTHrP and mild up-regulation of RANKL mRNA expression was present in most of the dogs with T-cell lymphoma and hypercalcemia.
169
Figure 4.7. Bioluminescent Imaging in mouse model of canine T-cell lymphoma a. Serial non-invasive bioluminescent imaging (BLI) of canine T-cell lymphoma in NOD/SCID mice following intraperitoneal injection of Luc/YFP transduced lymphoma cells. Note the progressive increase in the photon intensities reflecting the progression of the lymphoma from week 1 to week 8. The BLI signal intensity was measured as photons/sec/cm2.The color bar to the right of the images represents the range of photon flux. b. Ex vivo imaging of mesenteric lymphomas, liver, spleen, heart and lungs, and the gastrointestinal tract after euthanasia. Note the high photon intensities in the mesenteric lymphomas and along the mesentery.
170 CHAPTER 5
SYNOPSIS AND FUTURE DIRECTIONS
A central role for PTHrP in the pathogenesis of HHM associated with breast, renal
and squamous cell carcinomas in humans has been well established(1). PTHrP has been identified as one of the important factors involved in osteoclastic bone resorption and hypercalcemia associated with lymphoma and ATLL(2). A weaker correlation between PTHrP expression and hypercalcemia was observed in these patients.
Moreover, constitutive PTHrP expression has been reported in HTLV-1-carriers and
ATLL patients without hypercalcemia(3). Research over the past several years has shown that ATLL and lymphoma cells secrete several factors that can induce osteoclastic bone resorption suggesting a multifcatorial etiology for HHM in these patients. Circulating PTHrP levels were generally found to be low or undetectable in normal individuals. However, there is widespread expression of PTHrP gene in various normal tissues and cell types indicating several roles for PTHrP in normal physiology as a local or paracrine factor rather than as a systemic factor.
Investigations over the past several decades have shown that PTHrP affects tumor cell proliferation and apoptosis and has transforming growth factor like properties(4;5).
Experiments presented in this dissertation demonstrated that PTHrP is expressed during immortalization of lymphocytes due to HTLV-1 infection, likely in a Tax- independent manner. HTLV-1 infection also markedly up-regulated the PTH1R
171 suggesting a potential autocrine role for PTHrP during the immortalization and
subsequent transformation of lymphocytes by HTLV-1 infection. PTHrP is up-
regulated by the P2 and P3 promoters in HTLV-1-infected and ATLL cells. Data
presented in the third chapter showed that the PTHrP P2 promoter can be
transactivated by the NF-κB pathway.
Finally, data presented in the fourth chapter demonstrated that hypercalcemia in
dogs with T-cell lymphoma is mediated by several osteoclastogenic factors confirming the multifactorial etiology for HHM in lymphoma patients. In addition, dogs can also be used as comparative animal models to study the pathogenesis of
HHM associated with lymphoma.
Our observations raised an array of questions as outlined below.
What is the role of PTHrP in transformation of lymphocytes due to HTLV-1
infection?
Data presented in the second chapter showed that PTHrP and its receptor were
highly up-regulated during immortalization and the subsequent transformation of lymphocytes due to HTLV-1 infection. However, a definitive role for PTHrP in this process has not been determined. A few reports have shown that PTHrP can cooperate with oncogenes such as Ras or EGFR in the transformation process. It has been reported that HTLV-1 Tax can cooperate with Ras in the transformation of fibroblasts. The Ras-MAP-Kinase pathway can increase PTHrP expression. Hence, additional experiments will be required to understand the role of PTHrP, Ras and Tax in the transformation of lymphocytes due to HTLV-1 infection. The role of PTHrP in
172 transformation can be better understood by knocking-down PTHrP using siRNA constructs specific for PTHrP. However, primary lymphocytes derived from the peripheral blood are fragile and hard to transfect. This can be circumvented by designing retroviral or lentiviral vectors to infect cells for effective delivery of the
SiRNA constructs. We recently developed such retroviral vectors and showed that they were effective in reducing PTHrP expression in a human pulmonary squamous cell carcinoma cell line (Nadella and Rosol; unpublished data). These vectors have yet to be tested in primary lymphocytes for efficacy. Secondly, since the PTHrP receptor was up-regulated during the immortalization process, antibodies towards PTHrP and/or PHT1R can be used in the long-term co-culture assays to determine if PTHrP functions through the receptor during the transformation process. Proliferation and apoptosis of lymphocytes can be measured at various time points. Finally, additional experiments knocking out Tax and Ras expression will provide further evidence for roles of these factors in transformation.
What are the complexes formed on the PTHrP P2 promoter in ATLL cells?
Data presented in the third chapter show that the PTHrP P2 promoter is activated by
NF-κB pathway in HTLV-1-infected and ATLL cells. We have shown that a single complex consisting of p50/c-Rel forms in high Tax-expressing T-cells. In contrast two distinct complexes formed on the P2 promoter in ATLL cells. We have identified one of the complexes to be composed of p50/p50 homodimers, but we were unable to identify the protein involved in the second complex formed in ATLL cells. So far our approaches using proteomics and mass spectrometry have been unsuccessful because
173 of high level of contaminating proteins. Nuclear lysates can be passed through a hydroxyappatite column to decrease the level of contaminating proteins and the filtered lysates can be subjected to mass spectrometry to identify the potential proteins present in the lysates. This data can be subsequently confirmed by super-shift assays using specific antibodies against the proteins identified by mass spectrometry.
What are the hypercalcemic factors in lymphoma and ATLL patients?
HHM in lymphoma and ATLL patients is likely multifactorial. Although several studies have shown that PTHrP plays an important role in the development of HHM in these patients, it is becoming obvious that it needs additional factors acting synergistically to induce hypercalcemia. Studies in the past have analyzed single factors in hypercalcemic lymphoma and ATLL patient samples. To better answer this question, a comprehensive approach has to be undertaken to analyze the levels of several hypercalcemic factors in a large number of samples from hypercalcemic patients compared to normocalcemic lymphoma and ATLL patients. Additionally development of new xenograft animal models will be useful in mechanistic investigations on HHM associated with lymphoma and ATLL.
In conclusion, a variety of questions regarding the role of PTHrP in transformation of lymphocytes and development of HHM remain to be addressed. More comprehensive studies integrating various HTLV-1 viral proteins, PTHrP and other hypercalcemic factors is essential to understand the pathogenesis of ATLL and to better treat it.
174 REFERENCE LIST
(1) Clines GA, Guise TA. Hypercalcaemia of malignancy and basic research on
mechanisms responsible for osteolytic and osteoblastic metastasis to bone.
Endocr Relat Cancer 2005; 12(3):549-583.
(2) Roodman GD. Mechanisms of bone lesions in multiple myeloma and
lymphoma. Cancer 1997; 80(8 Suppl):1557-1563.
(3) Watanabe T, Yamaguchi K, Takatsuki K, Osame M, Yoshida M. Constitutive
expression of parathyroid hormone-related protein gene in human T cell
leukemia virus type 1 (HTLV-1) carriers and adult T cell leukemia patients that
can be trans-activated by HTLV-1 tax gene. J Exp Med 1990; 172(3):759-765.
(4) Wysolmerski JJ, Stewart AF. The physiology of parathyroid hormone-related
protein: an emerging role as a developmental factor. Annu Rev Physiol 1998;
60:431-460.
(5) Philbrick WM, Wysolmerski JJ, Galbraith S, Holt E, Orloff JJ, Yang KH,
Vasavada RC, Weir EC, Broadus AE, Stewart AF. Defining the roles of
parathyroid hormone-related protein in normal physiology. Physiol Rev 1996;
76(1):127-173.
175 BIBLIOGRAPHY
Poiesz BJ, Ruscetti FW, Gazdar AF, Bunn PA, Minna JD, Gallo RC. Detection and isolation of type C retrovirus particles from fresh and cultured lymphocytes of a patient with cutaneous T-cell lymphoma. Proc Natl Acad Sci U S A 1980; 77(12):7415-7419.
Verdonck K, Gonzalez E, Van Dooren S, Vandamme AM, Vanham G, Gotuzzo E. Human T-lymphotropic virus 1: recent knowledge about an ancient infection. Lancet Infect Dis 2007; 7(4):266-281.
Proietti FA, Carneiro-Proietti AB, Catalan-Soares BC, Murphy EL. Global epidemiology of HTLV-I infection and associated diseases. Oncogene 2005; 24(39):6058-6068.
Taylor GP, Matsuoka M. Natural history of adult T-cell leukemia/lymphoma and approaches to therapy. Oncogene 2005; 24(39):6047-6057.
Igakura T, Stinchcombe JC, Goon PK, Taylor GP, Weber JN, Griffiths GM, Tanaka Y, Osame M, Bangham CR. Spread of HTLV-I between lymphocytes by virus- induced polarization of the cytoskeleton. Science 2003; 299(5613):1713-1716.
Matsuoka M, Jeang KT. Human T-cell leukemia virus type I at age 25: a progress report. Cancer Res 2005; 65(11):4467-4470.
Matsuoka M, Jeang KT. Human T-cell leukaemia virus type 1 (HTLV-1) infectivity and cellular transformation. Nat Rev Cancer 2007; 7(4):270-280.
176 Yoshida M. Multiple viral strategies of HTLV-1 for dysregulation of cell growth control. Annu Rev Immunol 2001; 19:475-496.
Yoshida M, Suzuki T, Fujisawa J, Hirai H. HTLV-1 oncoprotein tax and cellular transcription factors. Curr Top Microbiol Immunol 1995; 193:79-89.
Yoshida M. HTLV-1 oncoprotein Tax deregulates transcription of cellular genes through multiple mechanisms. J Cancer Res Clin Oncol 1995; 121(9-10):521-528.
Marriott SJ, Semmes OJ. Impact of HTLV-I Tax on cell cycle progression and the cellular DNA damage repair response. Oncogene 2005; 24(39):5986-5995.
Younis I, Green PL. The human T-cell leukemia virus Rex protein. Front Biosci 2005; 10:431-445.
Younis I, Yamamoto B, Phipps A, Green PL. Human T-cell leukemia virus type 1 expressing nonoverlapping tax and rex genes replicates and immortalizes primary human T lymphocytes but fails to replicate and persist in vivo. J Virol 2005; 79(23):14473-14481.
Kannagi M, Ohashi T, Harashima N, Hanabuchi S, Hasegawa A. Immunological risks of adult T-cell leukemia at primary HTLV-I infection. Trends Microbiol 2004; 12(7):346-352.
Yasunaga J, Matsuoka M. Human T-cell leukemia virus type I induces adult T-cell leukemia: from clinical aspects to molecular mechanisms. Cancer Control 2007; 14(2):133-140.
177 Gaudray G, Gachon F, Basbous J, Biard-Piechaczyk M, Devaux C, Mesnard JM. The complementary strand of the human T-cell leukemia virus type 1 RNA genome encodes a bZIP transcription factor that down-regulates viral transcription. J Virol 2002; 76(24):12813-12822.
Yasunaga J, Matsuoka M. Human T-cell leukemia virus type I induces adult T-cell leukemia: from clinical aspects to molecular mechanisms. Cancer Control 2007; 14(2):133-140.
Albrecht B, Lairmore MD. Critical role of human T-lymphotropic virus type 1 accessory proteins in viral replication and pathogenesis. Microbiol Mol Biol Rev 2002; 66(3):396-406, table.
Uchiyama T. Human T cell leukemia virus type I (HTLV-I) and human diseases. Annu Rev Immunol 1997; 15:15-37.
Uchiyama T, Yodoi J, Sagawa K, Takatsuki K, Uchino H. Adult T-cell leukemia: clinical and hematologic features of 16 cases. Blood 1977; 50(3):481-492.
Shimoyama M. Diagnostic criteria and classification of clinical subtypes of adult T- cell leukaemia-lymphoma. A report from the Lymphoma Study Group (1984-87). Br J Haematol 1991; 79(3):428-437.
Matsushima T, Yamamoto M, Sakai K. Multiple osteolysis of peripheral extremities in a patient with adult T cell leukemia/lymphoma. Intern Med 1999; 38(10):820-823.
Guise TA, Mundy GR. Cancer and bone. Endocr Rev 1998; 19(1):18-54.
178 Chattopadhyay N, Mithal A, Brown EM. The calcium-sensing receptor: a window into the physiology and pathophysiology of mineral ion metabolism. Endocr Rev 1996; 17(4):289-307.
Raisz LG, Mundy GR, Dietrich JW, Canalis EM. Hormonal regulation of mineral metabolism. Int Rev Physiol 1977; 16:199-240.
Parfitt AM. The actions of parathyroid hormone on bone: relation to bone remodeling and turnover, calcium homeostasis, and metabolic bone disease. Part IV of IV parts: The state of the bones in uremic hyperaparathyroidism--the mechanisms of skeletal resistance to PTH in renal failure and pseudohypoparathyroidism and the role of PTH in osteoporosis, osteopetrosis, and osteofluorosis. Metabolism 1976; 25(10):1157- 1188.
Clines GA, Guise TA. Hypercalcaemia of malignancy and basic research on mechanisms responsible for osteolytic and osteoblastic metastasis to bone. Endocr Relat Cancer 2005; 12(3):549-583.
Friedman J, Au WY, Raisz LG. Responses of fetal rat bone to thyrocalcitonin in tissue culture. Endocrinology 1968; 82(1):149-156.
Friedman J, Raisz LG. Thyrocalcitonin: inhibitor of bone resorption in tissue culture. Science 1965; 150(702):1465-1467.
Norman AW, Roth J, Orci L. The vitamin D endocrine system: steroid metabolism, hormone receptors, and biological response (calcium binding proteins). Endocr Rev 1982; 3(4):331-366.
179 Flanagan AM, Massey HM. Generating human osteoclasts in vitro from bone marrow and peripheral blood. Methods Mol Med 2003; 80:113-128.
Teitelbaum SL. Osteoclasts: what do they do and how do they do it? Am J Pathol 2007; 170(2):427-435.
Roato I, Grano M, Brunetti G, Colucci S, Mussa A, Bertetto O, Ferracini R. Mechanisms of spontaneous osteoclastogenesis in cancer with bone involvement. FASEB J 2005; 19(2):228-230.
Yasuda H, Shima N, Nakagawa N, Yamaguchi K, Kinosaki M, Mochizuki S, Tomoyasu A, Yano K, Goto M, Murakami A, Tsuda E, Morinaga T, Higashio K, Udagawa N, Takahashi N, Suda T. Osteoclast differentiation factor is a ligand for osteoprotegerin/osteoclastogenesis-inhibitory factor and is identical to TRANCE/RANKL. Proc Natl Acad Sci U S A 1998; 95(7):3597-3602.
Theill LE, Boyle WJ, Penninger JM. RANK-L and RANK: T cells, bone loss, and mammalian evolution. Annu Rev Immunol 2002; 20:795-823.
Roodman GD. Regulation of osteoclast differentiation. Ann N Y Acad Sci 2006; 1068:100-109.
Simonet WS, Lacey DL, Dunstan CR, Kelley M, Chang MS, Luthy R, Nguyen HQ, Wooden S, Bennett L, Boone T, Shimamoto G, DeRose M, Elliott R, Colombero A, Tan HL, Trail G, Sullivan J, Davy E, Bucay N, Renshaw-Gegg L, Hughes TM, Hill D, Pattison W, Campbell P, Sander S, Van G, Tarpley J, Derby P, Lee R, Boyle WJ. Osteoprotegerin: a novel secreted protein involved in the regulation of bone density. Cell 1997; 89(2):309-319.
180 Mundy GR, Guise TA. Hypercalcemia of malignancy. Am J Med 1997; 103(2):134- 145.
Mundy GR, Guise TA. Hormonal control of calcium homeostasis. Clin Chem 1999; 45(8 Pt 2):1347-1352.
Rosol TJ, Capen CC. Mechanisms of cancer-induced hypercalcemia. Lab Invest 1992; 67(6):680-702.
Kiyokawa T, Yamaguchi K, Takeya M, Takahashi K, Watanabe T, Matsumoto T, Lee SY, Takatsuki K. Hypercalcemia and osteoclast proliferation in adult T-cell leukemia. Cancer 1987; 59(6):1187-1191.
Burtis WJ, Wu TL, Insogna KL, Stewart AF. Humoral hypercalcemia of malignancy. Ann Intern Med 1988; 108(3):454-457.
Matsushima T, Yamamoto M, Sakai K. Multiple osteolysis of peripheral extremities in a patient with adult T cell leukemia/lymphoma. Intern Med 1999; 38(10):820-823.
Tabata M, Takahashi H, Izumi T, Komatsu N, Tsunoda J, Yoshida M, Nakama S, Kuriki K, Saito K, Hatake K, Miura Y. Adult T cell leukemia lymphoma (ATL) localized in the right tibial bone. Leuk Lymphoma 1999; 35(1-2):189-192.
Anzai S, Takayasu S, Fujiwara S, Tateyama M, Taira H, Takashita M. Elevation of IL-6 in ATL patient with a pathological fracture. J Dermatol 2002; 29(10):644-647.
Yamamoto Y, Ishii K, Nomura S, Fukuhara S. [Adult T-cell leukemia/lymphoma of bone with multiple pathological fractures]. Rinsho Ketsueki 2004; 45(3):247-249.
181 Wysolmerski JJ, Broadus AE. Hypercalcemia of malignancy: the central role of parathyroid hormone-related protein. Annu Rev Med 1994; 45:189-200.
Stewart AF, Horst R, Deftos LJ, Cadman EC, Lang R, Broadus AE. Biochemical evaluation of patients with cancer-associated hypercalcemia: evidence for humoral and nonhumoral groups. N Engl J Med 1980; 303(24):1377-1383.
Nguyen L, Dewhirst FE, Hauschka PV, Stashenko P. Interleukin-1 beta stimulates bone resorption and inhibits bone formation in vivo. Lymphokine Cytokine Res 1991; 10(1-2):15-21.
Dewhirst FE, Stashenko PP, Mole JE, Tsurumachi T. Purification and partial sequence of human osteoclast-activating factor: identity with interleukin 1 beta. J Immunol 1985; 135(4):2562-2568.
Gowen M, Mundy GR. Actions of recombinant interleukin 1, interleukin 2, and interferon-gamma on bone resorption in vitro. J Immunol 1986; 136(7):2478-2482.
Shirakawa F, Yamashita U, Tanaka Y, Watanaba K, Sato K, Haratake J, Fujihira T, Oda S, Eto S. Production of bone-resorbing activity corresponding to interleukin-1 alpha by adult T-cell leukemia cells in humans. Cancer Res 1988; 48(15):4284-4287.
Mori N, Shirakawa F, Saito K, Murakami S, Oda S, Eto S. Transactivation of the interleukin-1 alpha gene promoter by human T-cell leukemia virus type I tax in T cells. Blood 1994; 84(5):1688-1689.
Wano Y, Hattori T, Matsuoka M, Takatsuki K, Chua AO, Gubler U, Greene WC. Interleukin 1 gene expression in adult T cell leukemia. J Clin Invest 1987; 80(3):911- 916.
182
Pfeilschifter J, Chenu C, Bird A, Mundy GR, Roodman GD. Interleukin-1 and tumor necrosis factor stimulate the formation of human osteoclastlike cells in vitro. J Bone Miner Res 1989; 4(1):113-118.
Roodman GD. Cell biology of the osteoclast. Exp Hematol 1999; 27(8):1229-1241.
Ishimi Y, Miyaura C, Jin CH, Akatsu T, Abe E, Nakamura Y, Yamaguchi A, Yoshiki S, Matsuda T, Hirano T, . IL-6 is produced by osteoblasts and induces bone resorption. J Immunol 1990; 145(10):3297-3303.
Barhoum M, Hutchins L, Fonseca VA. Intractable hypercalcemia due to a metastatic carcinoid secreting parathyroid hormone-related peptide and interleukin-6: response to octreotide. Am J Med Sci 1999; 318(3):203-205.
Ueno M, Ban S, Nakanoma T, Tsukamoto T, Nonaka S, Hirata R, Iida M, Deguchi N. Hypercalcemia in a patient with renal cell carcinoma producing parathyroid hormone- related protein and interleukin-6. Int J Urol 2000; 7(6):239-242.
Roodman GD. Myeloma bone disease: pathogenesis and treatment. Oncology (Williston Park) 2005; 19(8):983-4, 986.
Matsushima T, Yamamoto M, Sakai K. Multiple osteolysis of peripheral extremities in a patient with adult T cell leukemia/lymphoma. Intern Med 1999; 38(10):820-823.
Anzai S, Takayasu S, Fujiwara S, Tateyama M, Taira H, Takashita M. Elevation of IL-6 in ATL patient with a pathological fracture. J Dermatol 2002; 29(10):644-647.
183 Yamashita I, Katamine S, Moriuchi R, Nakamura Y, Miyamoto T, Eguchi K, Nagataki S. Transactivation of the human interleukin-6 gene by human T- lymphotropic virus type 1 Tax protein. Blood 1994; 84(5):1573-1578.
Kurihara N, Bertolini D, Suda T, Akiyama Y, Roodman GD. IL-6 stimulates osteoclast-like multinucleated cell formation in long term human marrow cultures by inducing IL-1 release. J Immunol 1990; 144(11):4226-4230.
Kwan TS, Padrines M, Theoleyre S, Heymann D, Fortun Y. IL-6, RANKL, TNF- alpha/IL-1: interrelations in bone resorption pathophysiology. Cytokine Growth Factor Rev 2004; 15(1):49-60.
De La MJ, Uy HL, Guise TA, Story B, Boyce BF, Mundy GR, Roodman GD. Interleukin-6 enhances hypercalcemia and bone resorption mediated by parathyroid hormone-related protein in vivo. J Clin Invest 1995; 95(6):2846-2852.
Ibbotson KJ, Twardzik DR, D'Souza SM, Hargreaves WR, Todaro GJ, Mundy GR. Stimulation of bone resorption in vitro by synthetic transforming growth factor-alpha. Science 1985; 228(4702):1007-1009.
Ishibashi K, Ishitsuka K, Chuman Y, Otsuka M, Kuwazuru Y, Iwahashi M, Utsunomiya A, Hanada S, Sakurami T, Arima T. Tumor necrosis factor-beta in the serum of adult T-cell leukemia with hypercalcemia. Blood 1991; 77(11):2451-2455.
Stashenko P, Dewhirst FE, Peros WJ, Kent RL, Ago JM. Synergistic interactions between interleukin 1, tumor necrosis factor, and lymphotoxin in bone resorption. J Immunol 1987; 138(5):1464-1468.
184 Lacey DL, Tan HL, Lu J, Kaufman S, Van G, Qiu W, Rattan A, Scully S, Fletcher F, Juan T, Kelley M, Burgess TL, Boyle WJ, Polverino AJ. Osteoprotegerin ligand modulates murine osteoclast survival in vitro and in vivo. Am J Pathol 2000; 157(2):435-448.
Yamada Y, Ohmoto Y, Murata K, Tsukasaki K, Momita S, Kamihira S, Atogami S, Sohda H, Moriuchi Y, Itoyama T, . Increased plasma M-CSF concentration in patients with adult T cell leukemia: clinical correlation. Leuk Lymphoma 1994; 14(1-2):151- 156.
Nosaka K, Miyamoto T, Sakai T, Mitsuya H, Suda T, Matsuoka M. Mechanism of hypercalcemia in adult T-cell leukemia: overexpression of receptor activator of nuclear factor kappaB ligand on adult T-cell leukemia cells. Blood 2002; 99(2):634- 640.
Roodman GD. Mechanisms of bone lesions in multiple myeloma and lymphoma. Cancer 1997; 80(8 Suppl):1557-1563.
Breslau NA, McGuire JL, Zerwekh JE, Frenkel EP, Pak CY. Hypercalcemia associated with increased serum calcitriol levels in three patients with lymphoma. Ann Intern Med 1984; 100(1):1-6.
Fetchick DA, Bertolini DR, Sarin PS, Weintraub ST, Mundy GR, Dunn JF. Production of 1,25-dihydroxyvitamin D3 by human T cell lymphotrophic virus-I- transformed lymphocytes. J Clin Invest 1986; 78(2):592-596.
Dodd RC, Winkler CF, Williams ME, Bunn PA, Gray TK. Calcitriol levels in hypercalcemic patients with adult T-cell lymphoma. Arch Intern Med 1986; 146(10):1971-1972.
185
Moseley JM, Kubota M, Diefenbach-Jagger H, Wettenhall RE, Kemp BE, Suva LJ, Rodda CP, Ebeling PR, Hudson PJ, Zajac JD, . Parathyroid hormone-related protein purified from a human lung cancer cell line. Proc Natl Acad Sci U S A 1987; 84(14):5048-5052.
Burtis WJ, Wu T, Bunch C, Wysolmerski JJ, Insogna KL, Weir EC, Broadus AE, Stewart AF. Identification of a novel 17,000-dalton parathyroid hormone-like adenylate cyclase-stimulating protein from a tumor associated with humoral hypercalcemia of malignancy. J Biol Chem 1987; 262(15):7151-7156.
Strewler GJ, Stern PH, Jacobs JW, Eveloff J, Klein RF, Leung SC, Rosenblatt M, Nissenson RA. Parathyroid hormonelike protein from human renal carcinoma cells. Structural and functional homology with parathyroid hormone. J Clin Invest 1987; 80(6):1803-1807.
Wysolmerski JJ, Broadus AE. Hypercalcemia of malignancy: the central role of parathyroid hormone-related protein. Annu Rev Med 1994; 45:189-200.
Stewart AF, Broadus AE. Clinical review 16: Parathyroid hormone-related proteins: coming of age in the 1990s. J Clin Endocrinol Metab 1990; 71(6):1410-1414.
Kukreja SC, Shevrin DH, Wimbiscus SA, Ebeling PR, Danks JA, Rodda CP, Wood WI, Martin TJ. Antibodies to parathyroid hormone-related protein lower serum calcium in athymic mouse models of malignancy-associated hypercalcemia due to human tumors. J Clin Invest 1988; 82(5):1798-1802.
Motokura T, Fukumoto S, Takahashi S, Watanabe T, Matsumoto T, Igarashi T, Ogata E. Expression of parathyroid hormone-related protein in a human T cell
186 lymphotrophic virus type I-infected T cell line. Biochem Biophys Res Commun 1988; 154(3):1182-1188.
Fukumoto S, Matsumoto T, Watanabe T, Takahashi H, Miyoshi I, Ogata E. Secretion of parathyroid hormone-like activity from human T-cell lymphotropic virus type I- infected lymphocytes. Cancer Res 1989; 49(14):3849-3852.
Watanabe T, Yamaguchi K, Takatsuki K, Osame M, Yoshida M. Constitutive expression of parathyroid hormone-related protein gene in human T cell leukemia virus type 1 (HTLV-1) carriers and adult T cell leukemia patients that can be trans- activated by HTLV-1 tax gene. J Exp Med 1990; 172(3):759-765.
Ikeda K, Inoue D, Okazaki R, Kikuchi T, Ogata E, Matsumoto T. Parathyroid hormone-related peptide in hypercalcemia associated with adult T cell leukemia/lymphoma: molecular and cellular mechanism of parathyroid hormone- related peptide overexpression in HTLV-I-infected T cells. Miner Electrolyte Metab 1995; 21(1-3):166-170.
Ejima E, Rosenblatt JD, Ou J, Prager D. Parathyroid hormone-related protein gene expression and human T cell leukemia virus-1 infection. Miner Electrolyte Metab 1995; 21(1-3):143-147.
Prager D, Rosenblatt JD, Ejima E. Hypercalcemia, parathyroid hormone-related protein expression and human T-cell leukemia virus infection. Leuk Lymphoma 1994; 14(5-6):395-400.
Mori N, Ohsumi K, Murakami S, Wake A, Nakata K, Misago M, Oda S, Eto S. [Urinary excretion of parathyroid hormone-related protein in patients with adult T-cell leukemia and other hematologic disorders]. Rinsho Ketsueki 1992; 33(9):1158-1165.
187
Imamura H, Koreeda Y, Okadome T, Tara M, Niina K, Shizume K, Ohsumi K, Sato K. Urinary excretion of parathyroid hormone-related protein as a predictor of hypercalcemia in patients with adult T-cell leukemia. Jpn J Clin Oncol 1992; 22(5):325-330.
Richard V, Rosol TJ, Foley J. PTHrP gene expression in cancer: do all paths lead to Ets? Crit Rev Eukaryot Gene Expr 2005; 15(2):115-132.
Richard V, Nadella MV, Green PL, Lairmore MD, Feuer G, Foley JG, Rosol TJ. Transcriptional regulation of parathyroid hormone-related protein promoter P3 by ETS-1 in adult T-cell leukemia/lymphoma. Leukemia 2005; 19(7):1175-1183.
Ikeda K, Okazaki R, Inoue D, Ohno H, Ogata E, Matsumoto T. Interleukin-2 increases production and secretion of parathyroid hormone-related peptide by human T cell leukemia virus type I-infected T cells: possible role in hypercalcemia associated with adult T cell leukemia. Endocrinology 1993; 132(6):2551-2556.
Ikeda K, Okazaki R, Inoue D, Ogata E, Matsumoto T. Transcription of the gene for parathyroid hormone-related peptide from the human is activated through a cAMP- dependent pathway by prostaglandin E1 in HTLV-I-infected T cells. J Biol Chem 1993; 268(2):1174-1179.
Watanabe T, Yamaguchi K, Takatsuki K, Osame M, Yoshida M. Constitutive expression of parathyroid hormone-related protein gene in human T cell leukemia virus type 1 (HTLV-1) carriers and adult T cell leukemia patients that can be trans- activated by HTLV-1 tax gene. J Exp Med 1990; 172(3):759-765.
188 Weissglas MG, Schamhart DH, Lowik CW, Papapoulos SE, Theuns HM, Kurth KH. The role of interleukin-6 in the induction of hypercalcemia in renal cell carcinoma transplanted into nude mice. Endocrinology 1997; 138(5):1879-1885.
Sato K, Fujii Y, Kasono K, Ozawa M, Imamura H, Kanaji Y, Kurosawa H, Tsushima T, Shizume K. Parathyroid hormone-related protein and interleukin-1 alpha synergistically stimulate bone resorption in vitro and increase the serum calcium concentration in mice in vivo. Endocrinology 1989; 124(5):2172-2178.
Rizzoli R, Feyen JH, Grau G, Wohlwend A, Sappino AP, Bonjour JP. Regulation of parathyroid hormone-related protein production in a human lung squamous cell carcinoma line. J Endocrinol 1994; 143(2):333-341.
Richard V, Lairmore MD, Green PL, Feuer G, Erbe RS, Albrecht B, D'Souza C, Keller ET, Dai J, Rosol TJ. Humoral hypercalcemia of malignancy: severe combined immunodeficient/beige mouse model of adult T-cell lymphoma independent of human T-cell lymphotropic virus type-1 tax expression. Am J Pathol 2001; 158(6):2219- 2228.
Sourbier C, Massfelder T. Parathyroid hormone-related protein in human renal cell carcinoma. Cancer Lett 2006; 240(2):170-182.
Wake A, Tanaka Y, Nakatsuka K, Misago M, Oda S, Morimoto I, Eto S. Calcium- dependent homotypic adhesion through leukocyte function-associated antigen- 1/intracellular adhesion molecule-1 induces interleukin-1 and parathyroid hormone- related protein production on adult T-cell leukemia cells in vitro. Blood 1995; 86(6):2257-2267.
189 McCauley LK, Rosol TJ, Merryman JI, Capen CC. Parathyroid hormone-related protein binding to human T-cell lymphotropic virus type I-infected lymphocytes. Endocrinology 1992; 130(1):300-306.
Roodman GD. Regulation of osteoclast differentiation. Ann N Y Acad Sci 2006; 1068:100-109.
Nosaka K, Miyamoto T, Sakai T, Mitsuya H, Suda T, Matsuoka M. Mechanism of hypercalcemia in adult T-cell leukemia: overexpression of receptor activator of nuclear factor kappaB ligand on adult T-cell leukemia cells. Blood 2002; 99(2):634- 640.
Menten P, Wuyts A, Van Damme J. Macrophage inflammatory protein-1. Cytokine Growth Factor Rev 2002; 13(6):455-481.
Oba Y, Lee JW, Ehrlich LA, Chung HY, Jelinek DF, Callander NS, Horuk R, Choi SJ, Roodman GD. MIP-1alpha utilizes both CCR1 and CCR5 to induce osteoclast formation and increase adhesion of myeloma cells to marrow stromal cells. Exp Hematol 2005; 33(3):272-278.
Roodman GD, Choi SJ. MIP-1 alpha and myeloma bone disease. Cancer Treat Res 2004; 118:83-100.
Okada Y, Tsukada J, Nakano K, Tonai S, Mine S, Tanaka Y. Macrophage inflammatory protein-1alpha induces hypercalcemia in adult T-cell leukemia. J Bone Miner Res 2004; 19(7):1105-1111.
190 Lairmore MD, Silverman L, Ratner L. Animal models for human T-lymphotropic virus type 1 (HTLV-1) infection and transformation. Oncogene 2005; 24(39):6005- 6015.
Ruddle NH, Li CB, Horne WC, Santiago P, Troiano N, Jay G, Horowitz M, Baron R. Mice transgenic for HTLV-I LTR-tax exhibit tax expression in bone, skeletal alterations, and high bone turnover. Virology 1993; 197(1):196-204.
Grossman WJ, Kimata JT, Wong FH, Zutter M, Ley TJ, Ratner L. Development of leukemia in mice transgenic for the tax gene of human T-cell leukemia virus type I. Proc Natl Acad Sci U S A 1995; 92(4):1057-1061.
Gao L, Deng H, Zhao H, Hirbe A, Harding J, Ratner L, Weilbaecher K. HTLV-1 Tax transgenic mice develop spontaneous osteolytic bone metastases prevented by osteoclast inhibition. Blood 2005; 106(13):4294-4302.
Takaori-Kondo A, Imada K, Yamamoto I, Kunitomi A, Numata Y, Sawada H, Uchiyama T. Parathyroid hormone-related protein-induced hypercalcemia in SCID mice engrafted with adult T-cell leukemia cells. Blood 1998; 91(12):4747-4751.
Richard V, Lairmore MD, Green PL, Feuer G, Erbe RS, Albrecht B, D'Souza C, Keller ET, Dai J, Rosol TJ. Humoral hypercalcemia of malignancy: severe combined immunodeficient/beige mouse model of adult T-cell lymphoma independent of human T-cell lymphotropic virus type-1 tax expression. Am J Pathol 2001; 158(6):2219- 2228.
Richard V, Nadella MV, Green PL, Lairmore MD, Feuer G, Foley JG, Rosol TJ. Transcriptional regulation of parathyroid hormone-related protein promoter P3 by ETS-1 in adult T-cell leukemia/lymphoma. Leukemia 2005; 19(7):1175-1183.
191
Insogna KL, Broadus AE. Hypercalcemia of malignancy. Annu Rev Med 1987; 38:241-256.
Taylor GP, Matsuoka M. Natural history of adult T-cell leukemia/lymphoma and approaches to therapy. Oncogene 2005; 24(39):6047-6057.
Mundy GR, Guise TA. Hypercalcemia of malignancy. Am J Med 1997; 103(2):134- 145.
Ishikawa C, Matsuda T, Okudaira T, Tomita M, Kawakami H, Tanaka Y, Masuda M, Ohshiro K, Ohta T, Mori N. Bisphosphonate incadronate inhibits growth of human T- cell leukaemia virus type I-infected T-cell lines and primary adult T-cell leukaemia cells by interfering with the mevalonate pathway. Br J Haematol 2007; 136(3):424- 432.
Heath DJ, Vanderkerken K, Cheng X, Gallagher O, Prideaux M, Murali R, Croucher PI. An osteoprotegerin-like peptidomimetic inhibits osteoclastic bone resorption and osteolytic bone disease in myeloma. Cancer Res 2007; 67(1):202-208.
Onuma E, Sato K, Saito H, Tsunenari T, Ishii K, Esaki K, Yabuta N, Wakahara Y, Yamada-Okabe H, Ogata E. Generation of a humanized monoclonal antibody against human parathyroid hormone-related protein and its efficacy against humoral hypercalcemia of malignancy. Anticancer Res 2004; 24(5A):2665-2673.
Poiesz BJ, Ruscetti FW, Gazdar AF, Bunn PA, Minna JD, Gallo RC. Detection and isolation of type C retrovirus particles from fresh and cultured lymphocytes of a
192 patient with cutaneous T-cell lymphoma. Proc Natl Acad Sci U S A 1980; 77(12):7415-7419.
Osame M, Arimura K, Nakagawa M, Umehara F, Usuku K, Ijichi S. HTLV-I associated myelopathy (HAM): review and recent studies. Leukemia 1997; 11 Suppl 3:63-64.
Edlich RF, Arnette JA, Williams FM. Global epidemic of human T-cell lymphotropic virus type-I (HTLV-I). J Emerg Med 2000; 18(1):109-119.
Bangham CR. Human T-lymphotropic virus type 1 (HTLV-1): persistence and immune control. Int J Hematol 2003; 78(4):297-303.
Igakura T, Stinchcombe JC, Goon PK, Taylor GP, Weber JN, Griffiths GM, Tanaka Y, Osame M, Bangham CR. Spread of HTLV-I between lymphocytes by virus- induced polarization of the cytoskeleton. Science 2003; 299(5613):1713-1716.
Arisawa K, Soda M, Endo S, Kurokawa K, Katamine S, Shimokawa I, Koba T, Takahashi T, Saito H, Doi H, Shirahama S. Evaluation of adult T-cell leukemia/lymphoma incidence and its impact on non-Hodgkin lymphoma incidence in southwestern Japan. Int J Cancer 2000; 85(3):319-324.
Matsuoka M, Jeang KT. Human T-cell leukaemia virus type 1 (HTLV-1) infectivity and cellular transformation. Nat Rev Cancer 2007; 7(4):270-280.
Yasunaga J, Matsuoka M. Human T-cell leukemia virus type I induces adult T-cell leukemia: from clinical aspects to molecular mechanisms. Cancer Control 2007; 14(2):133-140.
193
Siekevitz M, Feinberg MB, Holbrook N, Wong-Staal F, Greene WC. Activation of interleukin 2 and interleukin 2 receptor (Tac) promoter expression by the trans- activator (tat) gene product of human T-cell leukemia virus, type I. Proc Natl Acad Sci U S A 1987; 84(15):5389-5393.
Ballard DW, Bohnlein E, Lowenthal JW, Wano Y, Franza BR, Greene WC. HTLV-I tax induces cellular proteins that activate the kappa B element in the IL-2 receptor alpha gene. Science 1988; 241(4873):1652-1655.
Ressler S, Morris GF, Marriott SJ. Human T-cell leukemia virus type 1 Tax transactivates the human proliferating cell nuclear antigen promoter. J Virol 1997; 71(2):1181-1190.
Fujii M, Sassone-Corsi P, Verma IM. c-fos promoter trans-activation by the tax1 protein of human T-cell leukemia virus type I. Proc Natl Acad Sci U S A 1988; 85(22):8526-8530.
Ratner L. Regulation of expression of the c-sis proto-oncogene. Nucleic Acids Res 1989; 17(11):4101-4115.
Marriott SJ, Semmes OJ. Impact of HTLV-I Tax on cell cycle progression and the cellular DNA damage repair response. Oncogene 2005; 24(39):5986-5995.
Younis I, Green PL. The human T-cell leukemia virus Rex protein. Front Biosci 2005; 10:431-445.
194 Ye J, Silverman L, Lairmore MD, Green PL. HTLV-1 Rex is required for viral spread and persistence in vivo but is dispensable for cellular immortalization in vitro. Blood 2003; 102(12):3963-3969.
Albrecht B, Lairmore MD. Critical role of human T-lymphotropic virus type 1 accessory proteins in viral replication and pathogenesis. Microbiol Mol Biol Rev 2002; 66(3):396-406, table.
Arnold J, Yamamoto B, Li M, Phipps AJ, Younis I, Lairmore MD, Green PL. Enhancement of infectivity and persistence in vivo by HBZ, a natural antisense coded protein of HTLV-1. Blood 2006; 107(10):3976-3982.
Kiyokawa T, Yamaguchi K, Takeya M, Takahashi K, Watanabe T, Matsumoto T, Lee SY, Takatsuki K. Hypercalcemia and osteoclast proliferation in adult T-cell leukemia. Cancer 1987; 59(6):1187-1191.
Wano Y, Hattori T, Matsuoka M, Takatsuki K, Chua AO, Gubler U, Greene WC. Interleukin 1 gene expression in adult T cell leukemia. J Clin Invest 1987; 80(3):911- 916. Nosaka K, Miyamoto T, Sakai T, Mitsuya H, Suda T, Matsuoka M. Mechanism of hypercalcemia in adult T-cell leukemia: overexpression of receptor activator of nuclear factor kappaB ligand on adult T-cell leukemia cells. Blood 2002; 99(2):634- 640.
Niitsu Y, Urushizaki Y, Koshida Y, Terui K, Mahara K, Kohgo Y, Urushizaki I. Expression of TGF-beta gene in adult T cell leukemia. Blood 1988; 71(1):263-266.
Senba M, Kawai K. Hypercalcemia and production of parathyroid hormone-like protein in adult T-cell leukemia-lymphoma. Eur J Haematol 1992; 48(5):278-279.
195
Okada Y, Tsukada J, Nakano K, Tonai S, Mine S, Tanaka Y. Macrophage inflammatory protein-1alpha induces hypercalcemia in adult T-cell leukemia. J Bone Miner Res 2004; 19(7):1105-1111.
Prager D, Rosenblatt JD, Ejima E. Hypercalcemia, parathyroid hormone-related protein expression and human T-cell leukemia virus infection. Leuk Lymphoma 1994; 14(5-6):395-400.
Dunbar ME, Wysolmerski JJ, Broadus AE. Parathyroid hormone-related protein: from hypercalcemia of malignancy to developmental regulatory molecule. Am J Med Sci 1996; 312(6):287-294.
Wysolmerski JJ, Stewart AF. The physiology of parathyroid hormone-related protein: an emerging role as a developmental factor. Annu Rev Physiol 1998; 60:431-460.
Gessi M, Monego G, Calviello G, Lanza P, Giangaspero F, Silvestrini A, Lauriola L, Ranelletti FO. Human parathyroid hormone-related protein and human parathyroid hormone receptor type 1 are expressed in human medulloblastomas and regulate cell proliferation and apoptosis in medulloblastoma-derived cell lines. Acta Neuropathol (Berl) 2007; 114(2):135-145.
Xie L, Yamamoto B, Haoudi A, Semmes OJ, Green PL. PDZ binding motif of HTLV-1 Tax promotes virus-mediated T-cell proliferation in vitro and persistence in vivo. Blood 2006; 107(5):1980-1988.
Richard V, Luchin A, Brena RM, Plass C, Rosol TJ. Quantitative evaluation of alternative promoter usage and 3' splice variants for parathyroid hormone-related protein by real-time reverse transcription-PCR. Clin Chem 2003; 49(8):1398-1402.
196
Southby J, O'Keeffe LM, Martin TJ, Gillespie MT. Alternative promoter usage and mRNA splicing pathways for parathyroid hormone-related protein in normal tissues and tumours. Br J Cancer 1995; 72(3):702-707.
Li M, Green PL. Detection and quantitation of HTLV-1 and HTLV-2 mRNA species by real-time RT-PCR. J Virol Methods 2007; 142(1-2):159-168.
Franzese O, Balestrieri E, Comandini A, Forte G, Macchi B, Bonmassar E. Telomerase activity of human peripheral blood mononuclear cells in the course of HTLV type 1 infection in vitro. AIDS Res Hum Retroviruses 2002; 18(4):249-251.
Richard V, Rosol TJ, Foley J. PTHrP gene expression in cancer: do all paths lead to Ets? Crit Rev Eukaryot Gene Expr 2005; 15(2):115-132.
Philbrick WM, Wysolmerski JJ, Galbraith S, Holt E, Orloff JJ, Yang KH, Vasavada RC, Weir EC, Broadus AE, Stewart AF. Defining the roles of parathyroid hormone- related protein in normal physiology. Physiol Rev 1996; 76(1):127-173.
Martin TJ, Moseley JM, Williams ED. Parathyroid hormone-related protein: hormone and cytokine. J Endocrinol 1997; 154 Suppl:S23-S37.
Nicot C, Dundr M, Johnson JM, Fullen JR, Alonzo N, Fukumoto R, Princler GL, Derse D, Misteli T, Franchini G. HTLV-1-encoded p30II is a post-transcriptional negative regulator of viral replication. Nat Med 2004; 10(2):197-201.
Nicot C, Harrod RL, Ciminale V, Franchini G. Human T-cell leukemia/lymphoma virus type 1 nonstructural genes and their functions. Oncogene 2005; 24(39):6026- 6034.
197
Arnold J, Yamamoto B, Li M, Phipps AJ, Younis I, Lairmore MD, Green PL. Enhancement of infectivity and persistence in vivo by HBZ, a natural antisense coded protein of HTLV-1. Blood 2006; 107(10):3976-3982.
Sharma V, Lorey SL. Autocrine role of macrophage inflammatory protein-1 beta in human T-cell lymphotropic virus type-I tax-transfected Jurkat T-cells. Biochem Biophys Res Commun 2001; 287(4):910-913.
Menten P, Wuyts A, Van Damme J. Macrophage inflammatory protein-1. Cytokine Growth Factor Rev 2002; 13(6):455-481.
Lam MH, Thomas RJ, Martin TJ, Gillespie MT, Jans DA. Nuclear and nucleolar localization of parathyroid hormone-related protein. Immunol Cell Biol 2000; 78(4):395-402.
Motokura T, Endo K, Kumaki K, Ogata E, Ikeda K. Neoplastic transformation of normal rat embryo fibroblasts by a mutated p53 and an activated ras oncogene induces parathyroid hormone-related peptide gene expression and causes hypercalcemia in nude mice. J Biol Chem 1995; 270(52):30857-30861.
Insogna KL, Stewart AF, Morris CA, Hough LM, Milstone LM, Centrella M. Native and a synthetic analogue of the malignancy-associated parathyroid hormone-like protein have in vitro transforming growth factor-like properties. J Clin Invest 1989; 83(3):1057-1060.
Pozzatti R, Vogel J, Jay G. The human T-lymphotropic virus type I tax gene can cooperate with the ras oncogene to induce neoplastic transformation of cells. Mol Cell Biol 1990; 10(1):413-417.
198
Clemens TL, Cormier S, Eichinger A, Endlich K, Fiaschi-Taesch N, Fischer E, Friedman PA, Karaplis AC, Massfelder T, Rossert J, Schluter KD, Silve C, Stewart AF, Takane K, Helwig JJ. Parathyroid hormone-related protein and its receptors: nuclear functions and roles in the renal and cardiovascular systems, the placental trophoblasts and the pancreatic islets. Br J Pharmacol 2001; 134(6):1113-1136.
Sourbier C, Massfelder T. Parathyroid hormone-related protein in human renal cell carcinoma. Cancer Lett 2006; 240(2):170-182.
Richard V, Nadella MV, Green PL, Lairmore MD, Feuer G, Foley JG, Rosol TJ. Transcriptional regulation of parathyroid hormone-related protein promoter P3 by ETS-1 in adult T-cell leukemia/lymphoma. Leukemia 2005; 19(7):1175-1183.
Nadella MV, Dirksen WP, Nadella KS, Shu S, Cheng AS, Morgenstern JA, Richard V, Fernandez SA, Huang TH, Guttridge D, Rosol TJ. Transcriptional regulation of parathyroid hormone-related protein promoter P2 by NF-kappaB in adult T-cell leukemia/lymphoma. Leukemia 2007; 21(8):1752-1762.
Richard V, Nadella MV, Green PL, Lairmore MD, Feuer G, Foley JG, Rosol TJ. Transcriptional regulation of parathyroid hormone-related protein promoter P3 by ETS-1 in adult T-cell leukemia/lymphoma. Leukemia 2005; 19(7):1175-1183.
Matsuoka M, Jeang KT. Human T-cell leukaemia virus type 1 (HTLV-1) infectivity and cellular transformation. Nat Rev Cancer 2007; 7(4):270-280.
Cingolani G, Bednenko J, Gillespie MT, Gerace L. Molecular basis for the recognition of a nonclassical nuclear localization signal by importin beta. Mol Cell 2002; 10(6):1345-1353.
199
Lam MH, Thomas RJ, Martin TJ, Gillespie MT, Jans DA. Nuclear and nucleolar localization of parathyroid hormone-related protein. Immunol Cell Biol 2000; 78(4):395-402.
Kanamori H, Suzuki N, Siomi H, Nosaka T, Sato A, Sabe H, Hatanaka M, Honjo T. HTLV-1 p27rex stabilizes human interleukin-2 receptor alpha chain mRNA. EMBO J 1990; 9(12):4161-4166.
Sharma V, May CC. Human T-cell lymphotrophic virus type-I tax gene induces secretion of human macrophage inflammatory protein-1alpha. Biochem Biophys Res Commun 1999; 262(2):429-432.
Broadus AE, Mangin M, Ikeda K, Insogna KL, Weir EC, Burtis WJ, Stewart AF. Humoral hypercalcemia of cancer. Identification of a novel parathyroid hormone-like peptide. N Engl J Med 1988; 319(9):556-563.
Grill V, Martin TJ. Hypercalcemia of malignancy. Rev Endocr Metab Disord 2000; 1(4):253-263.
Wysolmerski JJ, Stewart AF. The physiology of parathyroid hormone-related protein: an emerging role as a developmental factor. Annu Rev Physiol 1998; 60:431-460.
Mangin M, Ikeda K, Dreyer BE, Broadus AE. Identification of an up-stream promoter of the human parathyroid hormone-related peptide gene. Mol Endocrinol 1990; 4(6):851-858.
Campos RV, Wang C, Drucker DJ. Regulation of parathyroid hormone-related peptide (PTHrP) gene transcription. Mol Endocrinol 1992; 6(10):1642-1652.
200
Suva LJ, Mather KA, Gillespie MT, Webb GC, Ng KW, Winslow GA, Wood WI, Martin TJ, Hudson PJ. Structure of the 5' flanking region of the gene encoding human parathyroid-hormone-related protein (PTHrP). Gene 1989; 77(1):95-105.
Vasavada RC, Wysolmerski JJ, Broadus AE, Philbrick WM. Identification and characterization of a GC-rich promoter of the human parathyroid hormone-related peptide gene. Mol Endocrinol 1993; 7(2):273-282.
Bouizar Z, Spyratos F, De Vernejoul MC. The parathyroid hormone-related protein (PTHrP) gene: use of downstream TATA promotor and PTHrP 1-139 coding pathways in primary breast cancers vary with the occurrence of bone metastasis. J Bone Miner Res 1999; 14(3):406-414.
Southby J, Murphy LM, Martin TJ, Gillespie MT. Cell-specific and regulator-induced promoter usage and messenger ribonucleic acid splicing for parathyroid hormone- related protein. Endocrinology 1996; 137(4):1349-1357.
Richard V, Luchin A, Brena RM, Plass C, Rosol TJ. Quantitative evaluation of alternative promoter usage and 3' splice variants for parathyroid hormone-related protein by real-time reverse transcription-PCR. Clin Chem 2003; 49(8):1398-1402.
Brandt DW, Bruns ME, Bruns DE, Ferguson JE, Burton DW, Deftos LJ. The parathyroid hormone-related protein (PTHrP) gene preferentially utilizes a GC-rich promoter and the PTHrP 1-139 coding pathway in normal human amnion. Biochem Biophys Res Commun 1992; 189(2):938-943.
201 Good L, Maggirwar SB, Sun SC. Activation of the IL-2 gene promoter by HTLV-I tax involves induction of NF-AT complexes bound to the CD28-responsive element. EMBO J 1996; 15(14):3744-3750.
Ballard DW, Bohnlein E, Lowenthal JW, Wano Y, Franza BR, Greene WC. HTLV-I tax induces cellular proteins that activate the kappa B element in the IL-2 receptor alpha gene. Science 1988; 241(4873):1652-1655.
Duyao MP, Kessler DJ, Spicer DB, Sonenshein GE. Transactivation of the c-myc gene by HTLV-1 tax is mediated by NFkB. Curr Top Microbiol Immunol 1992; 182:421-424.
Mori N, Fujii M, Ikeda S, Yamada Y, Tomonaga M, Ballard DW, Yamamoto N. Constitutive activation of NF-kappaB in primary adult T-cell leukemia cells. Blood 1999; 93(7):2360-2368.
Hironaka N, Mochida K, Mori N, Maeda M, Yamamoto N, Yamaoka S. Tax- independent constitutive IkappaB kinase activation in adult T-cell leukemia cells. Neoplasia 2004; 6(3):266-278.
May MJ, Ghosh S. Signal transduction through NF-kappa B. Immunol Today 1998; 19(2):80-88.
Leung TH, Hoffmann A, Baltimore D. One nucleotide in a kappaB site can determine cofactor specificity for NF-kappaB dimers. Cell 2004; 118(4):453-464.
Hayden MS, Ghosh S. Signaling to NF-kappaB. Genes Dev 2004; 18(18):2195-2224.
202 Bours V, Franzoso G, Azarenko V, Park S, Kanno T, Brown K, Siebenlist U. The oncoprotein Bcl-3 directly transactivates through kappa B motifs via association with DNA-binding p50B homodimers. Cell 1993; 72(5):729-739.
Franzoso G, Bours V, Park S, Tomita-Yamaguchi M, Kelly K, Siebenlist U. The candidate oncoprotein Bcl-3 is an antagonist of p50/NF-kappa B-mediated inhibition. Nature 1992; 359(6393):339-342.
Bundy DL, McKeithan TW. Diverse effects of BCL3 phosphorylation on its modulation of NF-kappaB p52 homodimer binding to DNA. J Biol Chem 1997; 272(52):33132-33139.
Caamano JH, Perez P, Lira SA, Bravo R. Constitutive expression of Bc1-3 in thymocytes increases the DNA binding of NF-kappaB1 (p50) homodimers in vivo. Mol Cell Biol 1996; 16(4):1342-1348.
Feuer G, Zack JA, Harrington WJ, Jr., Valderama R, Rosenblatt JD, Wachsman W, Baird SM, Chen IS. Establishment of human T-cell leukemia virus type I T-cell lymphomas in severe combined immunodeficient mice. Blood 1993; 82(3):722-731.
Phillips KE, Herring B, Wilson LA, Rickford MS, Zhang M, Goldman CK, Tso JY, Waldmann TA. IL-2Ralpha-Directed monoclonal antibodies provide effective therapy in a murine model of adult T-cell leukemia by a mechanism other than blockade of IL-2/IL-2Ralpha interaction. Cancer Res 2000; 60(24):6977-6984.
Stewart SA, Feuer G, Jewett A, Lee FV, Bonavida B, Chen IS. HTLV-1 gene expression in adult T-cell leukemia cells elicits an NK cell response in vitro and correlates with cell rejection in SCID mice. Virology 1996; 226(2):167-175.
203 Mori N, Gill PS, Mougdil T, Murakami S, Eto S, Prager D. Interleukin-10 gene expression in adult T-cell leukemia. Blood 1996; 88(3):1035-1045.
Guttridge DC, Albanese C, Reuther JY, Pestell RG, Baldwin AS, Jr. NF-kappaB controls cell growth and differentiation through transcriptional regulation of cyclin D1. Mol Cell Biol 1999; 19(8):5785-5799.
Cheng AS, Jin VX, Fan M, Smith LT, Liyanarachchi S, Yan PS, Leu YW, Chan MW, Plass C, Nephew KP, Davuluri RV, Huang TH. Combinatorial analysis of transcription factor partners reveals recruitment of c-MYC to estrogen receptor-alpha responsive promoters. Mol Cell 2006; 21(3):393-404.
Dirksen WP, Mohamed SA, Fisher SA. Splicing of a myosin phosphatase targeting subunit 1 alternative exon is regulated by intronic cis-elements and a novel bipartite exonic enhancer/silencer element. J Biol Chem 2003; 278(11):9722-9732.
Nishikori M, Maesako Y, Ueda C, Kurata M, Uchiyama T, Ohno H. High-level expression of BCL3 differentiates t(2;5)(p23;q35)-positive anaplastic large cell lymphoma from Hodgkin disease. Blood 2003; 101(7):2789-2796.
Holz LE, Jakobsen KP, Van Snick J, Cormont F, Sewell WA. Dexamethasone inhibits IL-9 production by human T cells. J Inflamm (Lond) 2005; 2(1):3.
Glasgow JN, Wood T, Perez-Polo JR. Identification and characterization of nuclear factor kappaB binding sites in the murine bcl-x promoter. J Neurochem 2000; 75(4):1377-1389.
Jeang KT, Derse D, Matocha M, Sharma O. Expression status of Tax protein in human T-cell leukemia virus type 1-transformed MT4 cells: recall of MT4 cells
204 distributed by the NIH AIDS Research and Reference Reagent Program. J Virol 1997; 71(9):6277-6278.
Vasavada RC, Wysolmerski JJ, Broadus AE, Philbrick WM. Identification and characterization of a GC-rich promoter of the human parathyroid hormone-related peptide gene. Mol Endocrinol 1993; 7(2):273-282.
Peloponese JM, Yeung ML, Jeang KT. Modulation of nuclear factor-kappaB by human T cell leukemia virus type 1 Tax protein: implications for oncogenesis and inflammation. Immunol Res 2006; 34(1):1-12.
Sun SC, Yamaoka S. Activation of NF-kappaB by HTLV-I and implications for cell transformation. Oncogene 2005; 24(39):5952-5964.
Dittmer J, Pise-Masison CA, Clemens KE, Choi KS, Brady JN. Interaction of human T-cell lymphotropic virus type I Tax, Ets1, and Sp1 in transactivation of the PTHrP P2 promoter. J Biol Chem 1997; 272(8):4953-4958.
Mori N, Ejima E, Prager D. Transactivation of parathyroid hormone-related protein gene expression by human T-cell leukemia virus type I tax. Eur J Haematol 1996; 56(1-2):116-117.
Ikeda K, Inoue D, Okazaki R, Kikuchi T, Ogata E, Matsumoto T. Parathyroid hormone-related peptide in hypercalcemia associated with adult T cell leukemia/lymphoma: molecular and cellular mechanism of parathyroid hormone- related peptide overexpression in HTLV-I-infected T cells. Miner Electrolyte Metab 1995; 21(1-3):166-170.
205 Li CC, Ruscetti FW, Rice NR, Chen E, Yang NS, Mikovits J, Longo DL. Differential expression of Rel family members in human T-cell leukemia virus type I-infected cells: transcriptional activation of c-rel by Tax protein. J Virol 1993; 67(7):4205- 4213.
Kurland JF, Kodym R, Story MD, Spurgers KB, McDonnell TJ, Meyn RE. NF- kappaB1 (p50) homodimers contribute to transcription of the bcl-2 oncogene. J Biol Chem 2001; 276(48):45380-45386.
Fujita T, Nolan GP, Liou HC, Scott ML, Baltimore D. The candidate proto-oncogene bcl-3 encodes a transcriptional coactivator that activates through NF-kappa B p50 homodimers. Genes Dev 1993; 7(7B):1354-1363.
Lin R, Gewert D, Hiscott J. Differential transcriptional activation in vitro by NF- kappa B/Rel proteins. J Biol Chem 1995; 270(7):3123-3131.
Schreiber J, Jenner RG, Murray HL, Gerber GK, Gifford DK, Young RA. Coordinated binding of NF-kappaB family members in the response of human cells to lipopolysaccharide. Proc Natl Acad Sci U S A 2006; 103(15):5899-5904.
Bundy DL, McKeithan TW. Diverse effects of BCL3 phosphorylation on its modulation of NF-kappaB p52 homodimer binding to DNA. J Biol Chem 1997; 272(52):33132-33139.
Watanabe N, Iwamura T, Shinoda T, Fujita T. Regulation of NFKB1 proteins by the candidate oncoprotein BCL-3: generation of NF-kappaB homodimers from the cytoplasmic pool of p50-p105 and nuclear translocation. EMBO J 1997; 16(12):3609- 3620.
206 Mori N, Yamada Y, Ikeda S, Yamasaki Y, Tsukasaki K, Tanaka Y, Tomonaga M, Yamamoto N, Fujii M. Bay 11-7082 inhibits transcription factor NF-kappaB and induces apoptosis of HTLV-I-infected T-cell lines and primary adult T-cell leukemia cells. Blood 2002; 100(5):1828-1834.
O'Connor OA, Toner LE, Vrhovac R, Budak-Alpdogan T, Smith EA, Bergman P. Comparative animal models for the study of lymphohematopoietic tumors: strengths and limitations of present approaches. Leuk Lymphoma 2005; 46(7):973-992. Sueiro FA, Alessi AC, Vassallo J. Canine lymphomas: a morphological and immunohistochemical study of 55 cases, with observations on p53 immunoexpression. J Comp Pathol 2004; 131(2-3):207-213.
Teske E. Canine malignant lymphoma: a review and comparison with human non- Hodgkin's lymphoma. Vet Q 1994; 16(4):209-219.
MacEwen EG. Spontaneous tumors in dogs and cats: models for the study of cancer biology and treatment. Cancer Metastasis Rev 1990; 9(2):125-136.
Washizu T, Azakami D, Bonkobara M, Washizu M, Arai T. Changes in activities of enzymes related to energy metabolism in canine lymphoma cells. J Vet Med Sci 2005; 67(6):615-616.
Modiano JF, Breen M, Burnett RC, Parker HG, Inusah S, Thomas R, Avery PR, Lindblad-Toh K, Ostrander EA, Cutter GC, Avery AC. Distinct B-cell and T-cell lymphoproliferative disease prevalence among dog breeds indicates heritable risk. Cancer Res 2005; 65(13):5654-5661.
Fournel-Fleury C, Magnol JP, Bricaire P, Marchal T, Chabanne L, Delverdier A, Bryon PA, Felman P. Cytohistological and immunological classification of canine
207 malignant lymphomas: comparison with human non-Hodgkin's lymphomas. J Comp Pathol 1997; 117(1):35-59.
A clinical evaluation of the International Lymphoma Study Group classification of non-Hodgkin's lymphoma. The Non-Hodgkin's Lymphoma Classification Project. Blood 1997; 89(11):3909-3918.
Fournel-Fleury C, Ponce F, Felman P, Blavier A, Bonnefont C, Chabanne L, Marchal T, Cadore JL, Goy-Thollot I, Ledieu D, Ghernati I, Magnol JP. Canine T-cell lymphomas: a morphological, immunological, and clinical study of 46 new cases. Vet Pathol 2002; 39(1):92-109.
Seymour JF, Gagel RF, Hagemeister FB, Dimopoulos MA, Cabanillas F. Calcitriol Production in Hypercalcemic and Normocalcemic Patients with Non-Hodgkin Lymphoma. Ann Intern Med 1994; 121(9):633-640.
Nosaka K, Miyamoto T, Sakai T, Mitsuya H, Suda T, Matsuoka M. Mechanism of hypercalcemia in adult T-cell leukemia: overexpression of receptor activator of nuclear factor kappaB ligand on adult T-cell leukemia cells. Blood 2002; 99(2):634- 640.
Meuten DJ, Kociba GJ, Capen CC, Chew DJ, Segre GV, Levine L, Tashjian AH, Jr., Voelkel EF, Nagode LA. Hypercalcemia in dogs with lymphosarcoma. Biochemical, ultrastructural, and histomorphometric investigations. Lab Invest 1983; 49(5):553- 562.
Yoneda T, Alsina MA, Chavez JB, Bonewald L, Nishimura R, Mundy GR. Evidence that tumor necrosis factor plays a pathogenetic role in the paraneoplastic syndromes
208 of cachexia, hypercalcemia, and leukocytosis in a human tumor in nude mice. J Clin Invest 1991; 87(3):977-985.
Mundy GR. Pathophysiology of cancer-associated hypercalcemia. Semin Oncol 1990; 17(2 Suppl 5):10-15.
Johnson RA, Boyce BF, Mundy GR, Roodman GD. Tumors producing human tumor necrosis factor induced hypercalcemia and osteoclastic bone resorption in nude mice. Endocrinology 1989; 124(3):1424-1427.
Seymour JF, Gagel RF. Calcitriol: the major humoral mediator of hypercalcemia in Hodgkin's disease and non-Hodgkin's lymphomas. Blood 1993; 82(5):1383-1394.
Wano Y, Hattori T, Matsuoka M, Takatsuki K, Chua AO, Gubler U, Greene WC. Interleukin 1 gene expression in adult T cell leukemia. J Clin Invest 1987; 80(3):911- 916.
Niitsu Y, Urushizaki Y, Koshida Y, Terui K, Mahara K, Kohgo Y, Urushizaki I. Expression of TGF-beta gene in adult T cell leukemia. Blood 1988; 71(1):263-266.
Seymour JF, Gagel RF. Calcitriol: the major humoral mediator of hypercalcemia in Hodgkin's disease and non-Hodgkin's lymphomas. Blood 1993; 82(5):1383-1394.
Seymour JF, Gagel RF, Hagemeister FB, Dimopoulos MA, Cabanillas F. Calcitriol production in hypercalcemic and normocalcemic patients with non-Hodgkin lymphoma. Ann Intern Med 1994; 121(9):633-640.
209 Firkin F, Seymour JF, Watson AM, Grill V, Martin TJ. Parathyroid hormone-related protein in hypercalcaemia associated with haematological malignancy. Br J Haematol 1996; 94(3):486-492.
Broadus AE, Mangin M, Ikeda K, Insogna KL, Weir EC, Burtis WJ, Stewart AF. Humoral hypercalcemia of cancer. Identification of a novel parathyroid hormone-like peptide. N Engl J Med 1988; 319(9):556-563.
Wysolmerski JJ, Broadus AE. Hypercalcemia of malignancy: the central role of parathyroid hormone-related protein. Annu Rev Med 1994; 45:189-200.
Kukreja SC, Shevrin DH, Wimbiscus SA, Ebeling PR, Danks JA, Rodda CP, Wood WI, Martin TJ. Antibodies to parathyroid hormone-related protein lower serum calcium in athymic mouse models of malignancy-associated hypercalcemia due to human tumors. J Clin Invest 1988; 82(5):1798-1802.
Caulfield MP, McKee RL, Goldman ME, Thiede MA, Thompson DD, Fisher JE, Levy JJ, Seedor JG, Horiuchi N, Clemens TL, . Parathyroid hormone-related protein (PTHrP): studies with synthetic peptides indicate that parathyroid hormone and PTHrP interact with the same receptor. Int J Rad Appl Instrum B 1990; 17(7):633- 637.
Rosenblatt M, Caulfield MP, Fisher JE, Horiuchi N, McKee RL, Rodan SB, Thiede MA, Thompson DD, Seedor JG, Nutt RE, . A tumor-secreted protein associated with human hypercalcemia of malignancy. Biology and molecular biology. Ann N Y Acad Sci 1988; 548:137-145.
Rosol TJ, Nagode LA, Couto CG, Hammer AS, Chew DJ, Peterson JL, Ayl RD, Steinmeyer CL, Capen CC. Parathyroid hormone (PTH)-related protein, PTH, and
210 1,25-dihydroxyvitamin D in dogs with cancer-associated hypercalcemia. Endocrinology 1992; 131(3):1157-1164.
Clines GA, Guise TA. Hypercalcaemia of malignancy and basic research on mechanisms responsible for osteolytic and osteoblastic metastasis to bone. Endocr Relat Cancer 2005; 12(3):549-583.
Uy HL, Mundy GR, Boyce BF, Story BM, Dunstan CR, Yin JJ, Roodman GD, Guise TA. Tumor necrosis factor enhances parathyroid hormone-related protein-induced hypercalcemia and bone resorption without inhibiting bone formation in vivo. Cancer Res 1997; 57(15):3194-3199.
Boyce BF, Aufdemorte TB, Garrett IR, Yates AJ, Mundy GR. Effects of interleukin-1 on bone turnover in normal mice. Endocrinology 1989; 125(3):1142-1150.
Modiano JF, Breen M, Valli VE, Wojcieszyn JW, Cutter GR. Predictive value of p16 or Rb inactivation in a model of naturally occurring canine non-Hodgkin's lymphoma. Leukemia 2007; 21(1):184-187.
Starkey MP, Scase TJ, Mellersh CS, Murphy S. Dogs really are man's best friend-- canine genomics has applications in veterinary and human medicine! Brief Funct Genomic Proteomic 2005; 4(2):112-128.
Vail DM, MacEwen EG. Spontaneously occurring tumors of companion animals as models for human cancer. Cancer Invest 2000; 18(8):781-792.
Mitsiades CS, Mitsiades NS, Bronson RT, Chauhan D, Munshi N, Treon SP, Maxwell CA, Pilarski L, Hideshima T, Hoffman RM, Anderson KC. Fluorescence imaging of
211 multiple myeloma cells in a clinically relevant SCID/NOD in vivo model: biologic and clinical implications. Cancer Res 2003; 63(20):6689-6696.
Edinger M, Cao YA, Verneris MR, Bachmann MH, Contag CH, Negrin RS. Revealing lymphoma growth and the efficacy of immune cell therapies using in vivo bioluminescence imaging. Blood 2003; 101(2):640-648.
Mitsiades CS, Mitsiades NS, Bronson RT, Chauhan D, Munshi N, Treon SP, Maxwell CA, Pilarski L, Hideshima T, Hoffman RM, Anderson KC. Fluorescence imaging of multiple myeloma cells in a clinically relevant SCID/NOD in vivo model: biologic and clinical implications. Cancer Res 2003; 63(20):6689-6696.
Starkey MP, Scase TJ, Mellersh CS, Murphy S. Dogs really are man's best friend-- canine genomics has applications in veterinary and human medicine! Brief Funct Genomic Proteomic 2005; 4(2):112-128.
Mellersh CS, Langston AA, Acland GM, Fleming MA, Ray K, Wiegand NA, Francisco LV, Gibbs M, Aguirre GD, Ostrander EA. A linkage map of the canine genome. Genomics 1997; 46(3):326-336.
Ostrander EA, Mapa FA, Yee M, Rine J. One hundred and one new simple sequence repeat-based markers for the canine genome. Mamm Genome 1995; 6(3):192-195.
Peeters D, Peters IR, Clercx C, Day MJ. Real-time RT-PCR quantification of mRNA encoding cytokines, CC chemokines and CCR3 in bronchial biopsies from dogs with eosinophilic bronchopneumopathy. Vet Immunol Immunopathol 2006; 110(1-2):65- 77.
212 Peeters D, Peters IR, Farnir F, Clercx C, Day MJ. Real-time RT-PCR quantification of mRNA encoding cytokines and chemokines in histologically normal canine nasal, bronchial and pulmonary tissue. Vet Immunol Immunopathol 2005; 104(3-4):195- 204.
Aihara Y, Kasuya H, Onda H, Hori T, Takeda J, Faraci FM. Quantitative Analysis of Gene Expressions Related to Inflammation in Canine Spastic Artery After Subarachnoid Hemorrhage Editorial Comment. Stroke 2001; 32(1):212-217.
Tannehill-Gregg SH, Levine AL, Nadella MV, Iguchi H, Rosol TJ. The effect of zoledronic acid and osteoprotegerin on growth of human lung cancer in the tibias of nude mice. Clin Exp Metastasis 2006.
Richard V, Lairmore MD, Green PL, Feuer G, Erbe RS, Albrecht B, D'Souza C, Keller ET, Dai J, Rosol TJ. Humoral hypercalcemia of malignancy: severe combined immunodeficient/beige mouse model of adult T-cell lymphoma independent of human T-cell lymphotropic virus type-1 tax expression. Am J Pathol 2001; 158(6):2219- 2228.
Staudt LM. Gene expression profiling of lymphoid malignancies. Annu Rev Med 2002; 53:303-318.
An HX, Beckmann MW, Reifenberger G, Bender HG, Niederacher D. Gene Amplification and Overexpression of CDK4 in Sporadic Breast Carcinomas Is Associated with High Tumor Cell Proliferation. Am J Pathol 1999; 154(1):113-118.
Hernandez L, Bea S, Pinyol M, Ott G, Katzenberger T, Rosenwald A, Bosch F, Lopez-Guillermo A, Delabie J, Colomer D, Montserrat E, Campo E. CDK4 and MDM2 Gene Alterations Mainly Occur in Highly Proliferative and Aggressive
213 Mantle Cell Lymphomas with Wild-type INK4a/ARF Locus. Cancer Res 2005; 65(6):2199-2206.
Rao PH, Houldsworth J, Dyomina K, Parsa NZ, Cigudosa JC, Louie DC, Popplewell L, Offit K, Jhanwar SC, Chaganti RSK. Chromosomal and Gene Amplification in Diffuse Large B-Cell Lymphoma. Blood 1998; 92(1):234-240.
Patra SK, Patra A, Dahiya R. Histone deacetylase and DNA methyltransferase in human prostate cancer. Biochem Biophys Res Commun 2001; 287(3):705-713.
Vigushin DM, Ali S, Pace PE, Mirsaidi N, Ito K, Adcock I, Coombes RC. Trichostatin A is a histone deacetylase inhibitor with potent antitumor activity against breast cancer in vivo. Clin Cancer Res 2001; 7(4):971-976.
Choi JH, Kwon HJ, Yoon BI, Kim JH, Han SU, Joo HJ, Kim DY. Expression profile of histone deacetylase 1 in gastric cancer tissues. Jpn J Cancer Res 2001; 92(12):1300-1304.
Aoudjit F, Potworowski EF, St Pierre Y. Bi-Directional Induction of Matrix Metalloproteinase-9 and Tissue Inhibitor of Matrix Metalloproteinase-1 During T Lymphoma/Endothelial Cell Contact: Implication of ICAM-1. J Immunol 1998; 160(6):2967-2973.
Jin H, Varner J. Integrins: roles in cancer development and as treatment targets. Br J Cancer 2004; 90(3):561-565.
Drillenburg P, Pals ST. Cell adhesion receptors in lymphoma dissemination. Blood 2000; 95(6):1900-1910.
214 Schweighoffer T, Tanaka Y, Tidswell M, Erle DJ, Horgan KJ, Luce GE, Lazarovits AI, Buck D, Shaw S. Selective expression of integrin alpha 4 beta 7 on a subset of human CD4+ memory T cells with Hallmarks of gut-trophism. J Immunol 1993; 151(2):717-729.
Hofmann WK, de Vos S, Tsukasaki K, Wachsman W, Pinkus GS, Said JW, Koeffler HP. Altered apoptosis pathways in mantle cell lymphoma detected by oligonucleotide microarray. Blood 2001; 98(3):787-794.
Gerber B, Hauser B, Reusch CE. Serum levels of 25-hydroxycholecalciferol and 1,25- dihydroxycholecalciferol in dogs with hypercalcaemia. Vet Res Commun 2004; 28(8):669-680.
Kukreja SC, Shevrin DH, Wimbiscus SA, Ebeling PR, Danks JA, Rodda CP, Wood WI, Martin TJ. Antibodies to parathyroid hormone-related protein lower serum calcium in athymic mouse models of malignancy-associated hypercalcemia due to human tumors. J Clin Invest 1988; 82(5):1798-1802.
Kukreja SC, Rosol TJ, Wimbiscus SA, Shevrin DH, Grill V, Barengolts EI, Martin TJ. Tumor resection and antibodies to parathyroid hormone-related protein cause similar changes on bone histomorphometry in hypercalcemia of cancer. Endocrinology 1990; 127(1):305-310.
Kubota A, Kano R, Mizuno T, Hisasue M, Moore PF, Watari T, Tsujimoto H, Hasegawa A. Parathyroid hormone-related protein (PTHrP) produced by dog lymphoma cells. J Vet Med Sci 2002; 64(9):835-837.
215 Azuma Y, Kaji K, Katogi R, Takeshita S, Kudo A. Tumor necrosis factor-alpha induces differentiation of and bone resorption by osteoclasts. J Biol Chem 2000; 275(7):4858-4864.
Kobayashi K, Takahashi N, Jimi E, Udagawa N, Takami M, Kotake S, Nakagawa N, Kinosaki M, Yamaguchi K, Shima N, Yasuda H, Morinaga T, Higashio K, Martin TJ, Suda T. Tumor necrosis factor alpha stimulates osteoclast differentiation by a mechanism independent of the ODF/RANKL-RANK interaction. J Exp Med 2000; 191(2):275-286.
Roato I, Grano M, Brunetti G, Colucci S, Mussa A, Bertetto O, Ferracini R. Mechanisms of spontaneous osteoclastogenesis in cancer with bone involvement. FASEB J 2004;04-1823fje.
Theill LE, Boyle WJ, Penninger JM. RANK-L and RANK: T cells, bone loss, and mammalian evolution. Annu Rev Immunol 2002; 20:795-823.
Cox M, Haddad JG. Lymphoma, hypercalcemia, and the sunshine vitamin. Ann Intern Med 1994; 121(9):709-712.
216