sign in sign up
<<
Home , Hachimoji DNA, Nucleic acid, Threose nucleic acid

Evolution of abiotic cubane chemistries in a nucleic allows selective recognition of a malaria biomarker

Yee-Wai Cheunga,1, Pascal Röthlisbergerb,1, Ariel E. Mechalyc, Patrick Weberc, Fabienne Levi-Acobasb, Young Loa, Alvin W. C. Wonga, Andrew B. Kinghorna, Ahmed Haouzc, G. Paul Savaged, Marcel Hollensteinb,2,3, and Julian A. Tannera,2,3

aSchool of Biomedical Sciences, Li Ka Shing Faculty of Medicine, The University of Hong Kong, Hong Kong, China; bInstitut Pasteur, Laboratory for Bioorganic Chemistry of Nucleic , Department of Structural and Chemistry, CNRS UMR-3523, 75015 Paris, France; cCrystallography Platform-C2RT, Department of and Chemistry, CNRS UMR-3528, Institut Pasteur, 75015 Paris, France; and dCSIRO Manufacturing, Clayton, VIC 3168, Australia

Edited by Jack W. Szostak, Massachusetts General Hospital, Boston, MA, and approved May 31, 2020 (received for review February 20, 2020) selected through systematic evolution of aptamers (18, 20–23). Other approaches include aptamers with ligands by exponential enrichment (SELEX) fold into exquisite artificially expanded genetic information systems going beyond globular structures in complex with targets with diverse the simple four building blocks of natural nucleic acids (24), even translational applications. Varying the chemistry of most recently to the eight-building-block Hachimoji system (25). allows evolution of nonnatural nucleic acids, but the extent to have also been modified but have often been re- which exotic chemistries can be integrated into a SELEX selection stricted to mimics of side chains (13, 26, 27) or small to evolve nonnatural macromolecular binding interfaces is unclear. hydrophobic aromatic moieties (28, 29). Perhaps the most im- Here, we report the identification of a cubane-modified aptamer pressive demonstration of translational cross-proteome aptamer (cubamer) against the malaria biomarker Plasmodium vivax lactate specificity are the SOMAmers (slow off-rate modified aptamers) dehydrogenase (PvLDH). The crystal structure of the complex re- (30), which enabled quantification of over 3,000 plasma veals an unprecedented binding mechanism involving a multicu- CHEMISTRY bane cluster within a hydrophobic pocket. The binding interaction to create a genomic atlas of the human plasma proteome (31). is further stabilized through hydrogen bonding via cubyl hydro- Such SOMAmers include a simple modification where instead of gens, previously unobserved in macromolecular binding inter- dT they bear dU functionalized at the 5-position of the nucleo- faces. This binding mechanism allows discriminatory recognition base with protein-like benzyl/2-napthyl/3-indolyl-carboxamide of P. vivax over Plasmodium falciparum lactate dehydrogenase, that confer some hydrophobic and/or base stacking character to thereby distinguishing these highly conserved malaria biomarkers for diagnostic applications. Together, our data demonstrate that Significance SELEX can be used to evolve exotic nucleic acids bearing chemical functional groups which enable remarkable binding mechanisms We report the identification of a cubane-modified aptamer which have never been observed in biology. Extending to other (cubamer) against the malaria biomarker Plasmodium vivax exotic chemistries will open a myriad of possibilities for functional lactate dehydrogenase (PvLDH). The cubamer contains the nucleic acids. benzene isostere cubane, which is entirely alien to biology. The crystal structure of the cubamer–protein complex reveals a modified aptamer | SELEX | X-ray | cubane | malaria binding mechanism involving the formation of an unprece- diagnosis dented cubane pocket and an unusual C–H···O . Importantly, the cubamer is capable of distinguishing the irected evolution of nucleic acids through the iterative PvLDH from the Plasmodium falciparum LDH despite a very Dprocess of SELEX (1, 2) (selective evolution of ligands by high sequence homology, which is impossible for unmodified exponential enrichment) provides routes to aptamers with ex- aptamers. Finally, we have used the cubamer to detect PvLDH quisite structures that cannot be otherwise imagined or designed in a mimetic clinical situation. This approach blending medicinal (3). Even using the simple natural nucleotides of DNA and RNA chemistry and Darwinian evolution can easily be extended to one can select and evolve aptamers with nanomolar and even other nonnatural, exotic functional groups. picomolar binding affinities and surprising discriminatory speci- ficity (4). Such aptamers are finding applications in therapeutics Author contributions: Y.-W.C., P.R., M.H., and J.A.T. designed research; Y.-W.C., P.R., A.E.M., P.W., F.L.-A., Y.L., A.W.C.W., A.B.K., and A.H. performed research; G.P.S. contrib- (5), diagnostics (6), biosensing (7), and (8) and uted new reagents/analytic tools; Y.-W.C., P.R., A.E.M., F.L.-A., Y.L., A.B.K., A.H., M.H., and can display numerous advantages relative to antibodies (9). J.A.T. analyzed data; and Y.-W.C., P.R., M.H., and J.A.T. wrote the paper. The chemistries of canonical DNA and RNA can be limiting Competing interest statement: J.A.T. is a scientific advisor for Zio Health, and J.A.T. and when one compares them to antibodies (10). Postselection A.B.K. are founders of Jushan Bio. chemical modification can aid in vivo stability and residence time This article is a PNAS Direct Submission. (11, 12) and can facilitate binding to problematic targets such as Published under the PNAS license. – glycoproteins or proteins with low isoelectric points (13 15). Data deposition: The crystal structure of the cubamer–target complex has been deposited However, these post-SELEX approaches often come at the ex- in the Protein Data Bank, http://www.wwpdb.org/ (PDB ID 6TXR). pense of a loss of binding affinity and specificity. In contrast, 1Y.-W.C. and P.R. contributed equally to this work. — 2 preselection chemical modification where modified nucleo- M.H. and J.A.T. contributed equally to this work. — tides are directly included in the SELEX process truly opens 3To whom correspondence may be addressed. Email: [email protected] or up to extending the repertoire of aptamer- [email protected]. mediated molecular recognition (16–19). Many chemical modi- This article contains supporting information online at https://www.pnas.org/lookup/suppl/ fications have been directed at the level of the - doi:10.1073/pnas.2003267117/-/DCSupplemental. backbone in order to improve the resistance of

www.pnas.org/cgi/doi/10.1073/pnas.2003267117 PNAS Latest Articles | 1of9 Downloaded by guest on September 29, 2021 the nucleic acid (10). New, engineered are not re- Investigating Compatibility of dUCTP with Primer Extension and PCR. quired to cope with unnatural chemistry introduced at position 5 We next asked whether dUCTP 11 (Fig. 1B) would be compatible of (32). Base modified nucleotides have also been with enzymatic DNA synthesis under primer extension (PEX) proposed as elements in an RNA world to promote the catalytic reaction and PCR conditions. We used the 15--long, 5′ activity of RNA-based catalysts (33). Alternatively, click chem- 6-FAM (fluorescein)-labeled primer P1 annealed to template T1 istry with alkyne-modified nucleotides can be used to select for (see SI Appendix for sequence composition) then investigated the -modified aptamers (34). Through such approaches, ability of various polymerases to perform a PEX reaction with a nucleobase-modified aptamers with nonnatural chemistries be- mixture of either four natural triphosphates or three natural C come accessible. One can then take advantage of the exponential triphosphates together with dU TP replacing 5′- enrichment and enabled by the PCR to allow Dar- triphosphate (dTTP) (SI Appendix, Fig. S20). This analysis C winian , yet inclusion of more exotic un- revealed that most polymerases accepted dU TP as a substrate natural functional groups allows evolutionary experiments well and the primer was extended by 16 nucleotides (accounting for beyond the confined chemistries familiar of biology. the incorporation of four modified nucleotides). When a longer Here, we present an effort to stretch the idea of nonnatural template was used (the 79-mer template T2) which would re- P2 chemistry within an evolutionary nucleic acid aptamer selection quire extension of primer by 60 nucleotides a clear by applying the in vitro evolutionary technique of SELEX to higher-molecular-weight product is formed in the reaction with C SI macromolecular chemistries entirely alien to biology. We per- dU TP when compared to that with natural triphosphates ( Appendix form an aptamer selection incorporating unusual cubane- , Figs. S21 and S22). Several polymerases including exo− Bst modified nucleotides, presenting structural data, mechanistic Therminator, Vent ( ), Deep Vent, Taq, , Klenow, Q5 determination, and diagnostic application of cubane-modified DNA , and phi29 were all capable of forming the exo− nucleic acid aptamers, hereafter called cubamers. The extraor- expected cubane-modified product. However, Vent ( ) appeared to most consistently produce highest-yield product (SI dinary platonic solid cubanes have intrigued chemists for de- Appendix cades (35–37) and are now important functional groups in a wide , Fig. S22) so was carried forward to investigation of range of pharmaceuticals and agrochemicals (36, 38). Cubanes efficacy in PCR. are benzene bioisosteres with unique properties: 1) unlike ben- A PCR was performed using two simple 19/20 nucleotide DNA primers (P3 and P4) on the same 79 nucleotide template zene, cubane is biologically stable and inherently nontoxic; 2) T2 exo− enhanced water solubility compared to benzene due to the dis- . Vent ( ) was capable of forming the expected amplicon in ruption of π stacking; and 3) formation of unusual C–H···O hy- high yields. Here also, the bands corresponding to cubane- drogen bonds caused by the strong s-character in the C–H bonds modified DNA presented a lower electrophoretic mobility compared to the amplicon obtained with the natural dNTPs (SI itself induced by the p-character of the C–C bonds (39, 40). Appendix, Fig. S23). Taq was not able to produce any product Synthetic and medicinal chemistry approaches for cubane func- where Hemo KlenTaq, Q5 DNA polymerase, and Phusion did tion discovery can be challenging, so we considered the possi- produce the expected product albeit with lower yields compared bility of developing a Darwinian approach to the evolution of − − to Vent (exo ). We therefore concluded that Vent (exo ) was the functionalized by cubane bioisosteres. most appropriate DNA polymerase to use with the dUCTP for A goal of this study was to evolve cubamers selective for subsequent SELEX procedures. binding to the malaria diagnostic biomarker Plasmodium vivax lactate dehydrogenase (PvLDH). We had previously selected Plasmodium falciparum SELEX for Cubamers with High Affinity and Specificity for PvLDH. canonical DNA aptamers binding to PvLDH and PfLDH proteins were expressed and purified as lactate dehydrogenase (PfLDH) (4) then applied these in various we described previously (4, 43). For both proteins, we do not – P. falciparum diagnostic approaches (41 44). is the parasite cleave the histidine tag during the purification procedure to fa- which causes the most severe disease with the highest mortality cilitate immobilization onto nickel magnetic beads for aptamer P. vivax while is more widely distributed and causes disease which selection. A single-stranded DNA library containing a 35-mer is complex and recurring. As management and treatment of random region was used as previously described (4). This was patients infected with the two different species differs, an ideal amplified by PCR and transcribed to the cubane-modified pool − point-of-care diagnostic should be able to discriminate the two using Vent (exo ). The cubane-modified pool was incubated with infections. However, canonical DNA aptamers with the ability to target PvLDH protein conjugated onto Ni-NTA beads and un- discriminate PfLDH vs. PvLDH had eluded us. We asked bound species removed. Eluted cubamers were reamplified from whether cubamers might provide a solution. a forward primer and reverse primer with a biotinylated 5′ end. Cubamers were purified through streptavidin magnetic beads Results followed by alkaline elution to result in the cubamer pool for Synthesis of Cubane-Modified Building Blocks for Selection and next round of selection. Four classes of counterselection steps Synthesis of Cubane-Modified Aptamers. We developed an ap- were incorporated: with Ni-NTA magnetic beads after proach to select for cubane-modified aptamers through initially rounds 3 and 9, with PfLDH-immobilized Ni-NTA magnetic synthesizing the cubane-modified triphosphate agarose beads after rounds 4 and 10, with hLDHB-immobilized C dU TP (SI Appendix, Scheme S2, compound 11). To incorporate Ni-NTA magnetic agarose beads after rounds 6 and 12, and with the cubane on the nucleobase we started from the known cubane hLDHA1-immobilized Ni-NTA magnetic agarose beads after derivative 1 (SI Appendix, Scheme S1) to prepare the corre- rounds 5 and 11. One can observe enrichment of PCR products sponding azide (compound 5) through previously published up to round 15 with the expected depletion of PCR product after procedures (45). The 5-position alkyne-modified deoxyuridine round 8 due to counterselection (SI Appendix, Fig. S26A). Am- derivative (compound 6) which had been prepared according to plification of selected pools by either dTTP or by dUCTP showed previously published procedures (46), was then reacted with the the enrichment and expected molecular weight size difference azide 5 through copper(I)-catalyzed azide–alkyne cycloaddition caused by the cubane modification (SI Appendix, Fig. S26B). An (CuAAC) to form compound 10 which was then -linked assay was performed as we pre- converted to the corresponding triphosphate (compound 11, viously described (43) to measure binding of the pool to target Fig. 1B). The cubane-modified deoxyuridine phosphoramidite PvLDH (SI Appendix, Fig. S26C). One can see clear binding of (compound 8, Fig. 1B) was synthesized through similar click the dUCTP-modified pool to PvLDH particularly after round 10 chemistry approaches to yield compound 9. which is not present for the natural nucleotide pool or for other

2of9 | www.pnas.org/cgi/doi/10.1073/pnas.2003267117 Cheung et al. Downloaded by guest on September 29, 2021 CHEMISTRY

Fig. 1. Structure of PvLDH in complex with cubamer. (A) Crystal structure of tetrameric PvLDH binds to two cubamers. The four subunits of PvLDH are colored in yellow, green, cyan, and pink. The two 1501s cubamers are colored in gray and the cubane modification is colored in blue. (B) Protected cubane-modified deoxyuridine phosphoramidite (Left) and cubane-modified deoxyuridine triphosphate (Right). (C) Details of interactions between 1501s and PvLDH. Light blue indicates hydrogen bonding interactions between cubamer and protein. Blue indicates hydrophobic interactions between cubamer and protein. Orange indicates residues within interaction range of 3 Å. Connected nucleotides are within 3.8 Å. Below, the sequence of the 1501s cubamer is shown with X representing cubane-modified deoxyuridine. (D) Buried surface of PvLDH-1501s complex. We pinpointed by different colors the regions of interactions between the A and B of PvLDH and a 1501 cubamer.

controls. These data indicate that SELEX was successful for determined to be 670 ± 9 nM by SPR (Fig. 2A). The cubamer evolving a pool of modified binding to PvLDH, was also observed to be specific for PvLDH relative to PfLDH; and that the binding is dependent on the cubane modification. PfLDH binding was over 30 times weaker at 26 μM (Fig. 2B). Next-generation sequencing was performed after round 15 (SI Appendix, Table S2). Two sequences dominated the pool: 1501s Crystal Structure of Cubamers in Complex with PvLDH. The crystal with five dUC (23.1% of pool sequences) and 1506s with six dUC structure of PvLDH in complex with the 1501s cubamer was (22.4% of pool sequences), then to a lesser extent 1516s (6.0%) solved at 2.5 Å resolution (Protein Data Bank [PDB] ID code and 1526s (4.9%) (SI Appendix, Table S4). These cubane- 6TXR; Fig. 1 and SI Appendix, Table S3). As expected, the modified sequences were then synthesized by automated solid- overall structure of PvLDH is similar to that previously reported phase DNA synthesis using the cubane-modified phosphor- (PDB ID code 3ZH2), indicating that binding of cubamers does amidite 8 (SI Appendix, Fig. S13) and molecular weights were not affect the three-dimensional structure of this protein. Dif- confirmed by mass spectrometry (SI Appendix, Table S1 and ference Fourier electron density maps indicate the presence of Figs. S14–S19). Interestingly, all attempts at synthesizing these two cubamers which bind to the target protein at each end of the oligonucleotides by click reaction with azide 5 and EdU- tetrameric PvLDH (Fig. 1A), in some ways reminiscent of the modified sequences failed due to the presence of a distribution canonical DNA aptamers we had previously selected binding to of products regardless of the conditions. PfLDH (4). The 5′ end of the cubamer showed two base-paired We decided to focus our subsequent studies on the most loops in close interaction with the surface of PvLDH, while the 3′ abundant cubamer in our selection, 1501s. We determined the end of the cubamer extended away from the protein surface and affinity for cubamers binding to PvLDH through surface plas- formed a duplex with an aptamer bound to a second protein mon resonance (SPR) analysis. SPR was performed through in the crystal packing (SI Appendix, Fig. S34). We immobilization of PvLDH onto Ni-NTA with the cubamer in the mapped all of the interactions between PvLDH and cubamer in C mobile phase. The equilibrium dissociation constant (KD) was Fig. 1C. All of the dU units were involved in some hydrogen

Cheung et al. PNAS Latest Articles | 3of9 Downloaded by guest on September 29, 2021 Fig. 2. Determination of binding affinity and specificity of cubamer toward PvLDH. (A) SPR (Biacore) analysis of the interaction between 1501s and PvLDH. PvLDH was immobilized to a Ni-NTA chip, then the response was observed at multiple concentrations of 1501s as shown in the figure. Raw data are shown

background with the best fit overlain with a thick solid line. For 1501s binding to PvLDH, the association rate (kon), dissociation rate (koff), and the equilibrium 4 −1 −1 −2 −1 dissociation constant (KD) were 2.2 × 10 M ·s ,1.4× 10 s , and 670 nM, respectively. (B) Specificity of 1501s binding to PvLDH relative to PfLDH. For 1501s 3 −1 −1 −1 binding to PfLDH, kon, koff, and KD were 6.8 × 10 M ·s ,0.18s , and 26 μM, respectively.

bonding within the cubamer. Two of these dUC (T3-A21 and showed preference for PvLDH, with some weak binding to T17-A8) base-pairing interactions are conventional Watson– PfLDH (Fig. 3B), consistent with the SPR data (Fig. 2B). When Crick base pairs to (SI Appendix, Fig. S27). Others are the dUC nucleotides in 1501s were mutated to simple canonical single hydrogen bond interactions either between themselves (T5 dT units then binding was abolished, indicating the necessity of and T20) or with other noncanonical bases (T13–C11). Four of the cubane modification for the specific binding (Fig. 3B). the cubanes were observed to cluster together through interac- It was noted that leucine 232 and alanine 233 of PvLDH played tions both among themselves but then also through interactions important roles in the binding, directly interacting through hy- with hydrophobic amino acid side chains in the PvLDH. A fifth drophobicity with two of the cubane moieties (Fig. 1C)andbeing cubane was somewhat separate from the other four and involved a critical part of the network of the cubanes in the binding pocket in interactions on another surface. The buried surface between (Fig. 4A). We expressed PvLDH with leucine 232 mutated to the cubamer and PvLDH (Fig. 1D) was 1130 Å2 as calculated glycine, and also with alanine 233 mutated to glycine, then both using the PISA server (https://www.ebi.ac.uk/pdbe/pisa/). together. The L232G mutation decreased binding, the A233G mutation decreased binding slightly, and the PvLDH with the Mechanism of Discrimination of Binding Recognition by Cubamer for double mutation resulted in significant reduction in binding as PvLDH vs. PfLDH. The crystal structure of the complex revealed the shown by electrophoretic mobility shift assay (EMSA) (Fig. 4B) binding site of the cubamer 1501s, which is in close proximity to and by SPR (Fig. 4C). These experiments provided evidence that an alpha helix where there are some amino acid differences cubane interactions were dependent on hydrophobicity of amino between PvLDH and PfLDH (Fig. 3A). This alpha helix is re- acid side chains. markable with regard to its nonconserved nature, as overall PvLDH and PfLDH are highly conserved with 90% amino acid A Unique Hydrogen Bond within the Cubane–Protein Complex identity (47). Electrophoretic mobility shift assays demonstrate Structure. Unlike phenyl or other simple arene moieties, cubane that our previous selected aptamers 2008s (selected as a ca- can also engage in the formation of stabilizing C−Hcubane···O nonical DNA aptamer binding to PfLDH) bound more strongly bonds due to the rather high acidity of the cubyl H atoms (40). to PfLDH than PvLDH (Fig. 3B) (4). A previously selected pan- Such nonclassical hydrogen bonds also seem to occur between a specific DNA aptamer, 1202s, bound to both PfLDH and dUC unit of the aptamer and a carbonyl unit of amino acids of PvLDH with similar affinity (Fig. 3B). The 1501s cubamer PvLDH. Indeed, one C–H(2) atom lies in close proximity (2.4 to

ABPvLDH (μM) PfLDH (μM) 045045 2008s 2008s 1202s 1202s 1501s 1501s

PvLDH (μM) C 020 1501s dU1501s dT1501s Variable Conserved

Fig. 3. The cubamer discriminates PvLDH from PfLDH through binding to a variable region. (A) Superimposition of PvLDH and PfLDH shows they are highly conserved with some difference on the variable region. The variable region is colored in red, whereas the conserved region is in light green. (Inset)The cubanes on the modified nucleotides interact with the variable region. (B) Comparing the affinity of 1501s to PvLDH and PfLDH with the control of the PfLDH- specific aptamer, 2008s, and pan-LDH-specific aptamer, 1202s. EMSA analysis showed 1501s is highly specific to PvLDH. (C) EMSA analysis showed cubanes on modified nucleotides involved in the binding between 1501s and PvLDH. With the replaced cubane-modified triphosphate by dUCTP, dU1501s and dTTP, dT1501s, the affinity of the cubamers is significantly decreased.

4of9 | www.pnas.org/cgi/doi/10.1073/pnas.2003267117 Cheung et al. Downloaded by guest on September 29, 2021 Concentration (μM) AB0 45 PvLDH PvLDH L232G PvLDH A233G PvLDH L232G A233G

C20 4000nM PvLDH 4000nM PvLDH L232G 4000nM PvLDH A233G 4000nM PvLDH L232G 10 A233G

Response unit (RU) 0 Hydrophilic Hydrophobic

0 100 200 300 Time (seconds)

Fig. 4. The cubamer interacts with PvLDH by hydrophobic interactions. (A) The structure of the PvLDH–1501s complex shows the cubane-modified nucle- otides, T1, T5, T20, T13, and T17 formed a hydrophobic cluster. The hydrophobic surface of PvLDH is illustrated with a color code according to the polarity of the respective amino acids. Hydrophobic amino acids are colored red whereas hydrophilic residues are white. (B) EMSA reveals the binding of PvLDH and

1501s along with amino acid side chains. The affinities of 1501s to three mutants of PvLDH, PvLDHL232G, PvLDHA233G, PvLDHL232G/A233G, and the wide-type PvLDH were estimated. (C) SPR comparison of 1501s cubamer binding to PvLDH and the three mutants PvLDHL232G, PvLDHA233G, and PvLDHL232G/A233G. Results from B and C indicate the affinities among all of the mutants are significantly decreased by mutating the hydrophobic amino acids to glycine.

2.6 Å) of the atom of the carbonyl group of Leu232 and detection for the ELONA assay in human serum buffer was forms a near-linear (hydrogen bond angle θ = 147.3 to 158.7°) determined as 1.05 ± 0.20 ng/μL(SI Appendix, Fig. S29A). The angle (Fig. 5). Both values fall within the ranges that have been ELONA assay is not clinically relevant in the present format as reported for the formation of syn‐anti catemers of small cubane the attachment is of His-tagged proteins to nickel-coated plates CHEMISTRY derivatives (d of 2.2 to 3.0 Å and θ between 120 and 180°) (39, 40, but is relevant for our comparison to previous data (43) and 48, 49) and that of weak, nonclassical hydrogen bonds (cutoff could be implemented through direct adherence of the native d value of 2.8 Å and θ range between 150° and 180°) (50). protein as per direct enzyme-linked immunosorbent assay (ELISA) methodologies. Furthermore, the mean levels of PvLDH Using the Cubamer in Diagnostic Assays to Mimic a Clinical Situation. in P. vivax isolates has been reported as 3.9 ± 6.1 ng/μL (51); this We have previously developed both enzyme-linked oligonucle- ELONA assay would occasionally be outside the clinical range as otide (ELONA) assays (43) and an aptamer-tethered enzyme PvLDH in some low parasitemia conditions (51). capture assay (41, 42, 44) to use our aptamers which bind to Therefore, we switched to the aptamer-tethered enzyme cap- LDH as diagnostic approaches for malaria. In the ELONA assay ture (APTEC) assay. In the APTEC assay, the cubamer/aptamer proteins are adhered to a surface, then a biotinylated aptamer/ is biotinylated and adhered to a streptavidin surface, then the cubamer is bound to the target proteins, then streptavidin/ clinical sample containing the target is applied, then washed, horseradish peroxidase (HRP) is added to reveal the binding and then color-developed through the intrinsic catalytic activity of at the same time the presence or absence of the target protein the lactate dehydrogenase (41) (Fig. 6C). Observations were (Fig. 6A). When using this assay it could be observed that the test made for the APTEC assay similar to those made for the was highly specific for PvLDH over PfLDH (Fig. 6B). Further- ELONA assay, confirming that the assay was specific for PvLDH more, when dUCTP was changed to dTTP during enzymatic (Fig. 6D) and required the cubane moieties (SI Appendix, Fig. synthesis of the aptamer, the assay was no longer effective, again S29B). The limit of detection of the APTEC assay in human proving the requirement for the cubane modifications here in the serum buffer was determined as 4.33 ± 1.66 pg/μL(SI Appendix, translational application (SI Appendix, Fig. S29A). The limit of Fig. S29B), which is much below the reported values of the

AB

Fig. 5. A unique hydrogen bond of the cubamer with PvLDH. Close up views of the interaction between a dUC unit (T5) of the two cubamers 1501s with PvLDH (Leu232) in A and monomer B showing the respective angles and bond lengths of the unique C-H(2)···O hydrogen bond. The gray mesh corresponds to a Sigma-A weighted mFo-DFc difference map (contoured at 3 σ), in which Leu232 and the cubane moiety of T5 were omitted from the model before map calculation.

Cheung et al. PNAS Latest Articles | 5of9 Downloaded by guest on September 29, 2021 AB

CD

Fig. 6. Determination of affinity and specificity of the 1501s cubamer against pLDHs in human serum (HS) buffer by ELONA and APTEC assay. (A) Diagram illustrating the ELONA. Target pLDHs are immobilized onto a microtiter plate, then biotinylated cubamers are added to recognize pLDHs. Streptavidin-HRP is added to recognize the biotin end of the cubamer, and TMB solution is used to allow for color development. (B) The response of the ELONA against the clinical range of PvLDH and PfLDH in human serum (HS) buffer. The limit of detection (LOD) of 1501s–PvLDH in the ELONA assay was determined to be 1.05 ± 0.20 ng·μL−1 (SI Appendix, Fig. S29). (C) Schematic diagram illustrating the APTEC assay. Biotinylated cubamers are immobilized onto streptavidin-coated wells, then pLDHs are added and captured by the cubamer. L-lactate/NTB solution is then added for color development. (D) The response of the APTEC assay − against the clinical range of PvLDH and PfLDH in HS buffer. The LOD of 1501s-PvLDH in the APTEC assay was determined to be 4.33 ± 1.66 pg·μL 1 (SI Appendix, Fig. S29). Measurements were done in triplicate, reported in standard errors (SE).

clinical range for PvLDH (51). While further experiments in by merging medicinal chemistry approaches with traditional clinical samples would be important to ascertain diagnostic SELEX, we could isolate a cubamer that outperforms functional sensitivity, particularly at low parasitemia, we have evidence in nucleic acids selected with canonical nucleotides that are unable these mimetic samples that the APTEC cubamer assay can po- to distinguish between both LDHs. tentially be used for clinical applications. Molecular evolution approaches provide routes to which can have translational application but which could other- Discussion wise never be imagined or designed. SELEX has provided an We have used in vitro selection to evolve aptamers that are experimental approach toward evolving nucleic acid ligands by functionalized with the benzene isostere cubane. The so-called the blind watchmaker of evolution entirely without the need for a cubamers were selected against PvLDH and selectively recog- living through the replicative process of the PCR. nized this protein target from PfLDH despite high sequence There have been many extensions to SELEX in recent years homology and bound with an appreciable affinity (KD of 670 through subtle differences of chemistry, but here we have dem- nM). The binding affinity of the cubamer is ∼10-fold lower than onstrated how entirely unnatural artificial functional group a previously reported, unmodified aptamer (4), but this increase chemistries never observed in can be subject to evolution in KD is largely compensated by the capacity of discriminating under SELEX selection pressures. PvLDH from PfLDH. The high sequence homology between This work demonstrates that the inclusion of nucleotides both LDHs might have reduced the number of epitopes available bearing the benzene isostere cubane on their nucleobases in a for binding and thus limited the binding capacity. Importantly, SELEX experiment has profound implications on the resulting we resolved the crystal structure of the binary aptamer–protein functional nucleic acids. Besides opening the possibility of complex, which revealed the formation of a cubane cluster that forming new binding modes with proteins via the formation of interacts with hydrophobic residues of PvLDH. These findings cubane-based pockets combined with C−Hcubane···Ohydrogen mirror the functional interaction interface observed in crystal bonding interactions, the modifications massively improve the structures of SOMAmers in complex with their targets where specificity of the cubamers for binding a PvLDH target, en- hydrophobic interactions between the small aromatic moieties of abling detection of this malaria biomarker in a mimetic clinical the aptamer and of amino acid side chains were largely re- situation. sponsible for the binding mechanism (3, 29). As for SOMAmers One can imagine steps beyond this work for completely new and sequence-defined highly functionalized nucleic acid poly- chemistries which could significantly extend such selection ex- mers (17, 52, 53), the specific location and sequence context of periments where the selection pressure is not just binding but cubane moieties is crucial for binding to the protein target since could be selection pressure for catalysis or other . This is it enables the formation of critical hydrophobic interactions ac- particularly the case when one considers expanded genetic – companied by a C−Hcubane···O hydrogen bond. of six-letter DNA alphabets (54 56), or even of eight-letter DNA In addition, cubamer 1501s was applied for the detection of (25, 57). In addition, the increase in diversity through unusual the malaria biomarker PvLDH with an excellent limit of de- chemistries coupled to the replicative evolutionary power en- tection in the APTEC assay, underscoring the usefulness of abled by the PCR would provide a route to entirely new horizons cubane-modified aptamers in practical applications. Therefore, for nucleic acid chemistry and give rise to hitherto unknown

6of9 | www.pnas.org/cgi/doi/10.1073/pnas.2003267117 Cheung et al. Downloaded by guest on September 29, 2021 binding mechanisms. The introduction of exotic functional PvLDH-AS, ATTATTCTCGAGTTAAATGAGCGCCTTCATCCTTTTAGTCTC, using groups during SELEX may confer additional functional prop- M3-a and M3-b as templates. The PvLDH-M3 ORF then was ligated into the erties not accessible to canonical nucleic acids. This may, for NheI/XhoI-digested pET28a-PvLDH that was constructed in our example, be important for portable to detect bio- previous study to become pET28a-PvLDH-M3. The of the mutants were transformed into E. coli BL21 (DE3) pLysS for IPTG-induced expression. markers for pathogens in low- settings. Evolution of PvLDH mutants were expressed and purified according to our previous study macromolecules incorporating chemistries entirely unknown in (4). Bacterial culture was incubated at 37 °C until OD600 = 0.5, then 0.25 mM biology will have important repercussions across a plethora of IPTG was added followed by 4-h expression at 25 °C. Pellets were collected applications. and sonicated and expressed proteins were purified by using HisTrap chromatography (GE Healthcare). Materials and Methods Chemical Syntheses. Synthetic procedures of the cubane-modified building Cubamer Selection. A single-stranded DNA (ssDNA) library containing a blocks are given in SI Appendix. 35-mer random region flanked by two 18-mer priming regions (5′– CGTACGGTCGACGCTAGC-[N35]-CACGTGGAGCTCGGATCC–3′) was used as PvLDH and PfLDH Expression and Purification. Protein expression and purifi- starting material for in vitro selection. The ssDNA library was amplified by cation was carried out at the platform for production and purification of forward primer (5′–CGTACGGTCGACGCTAGC–3′) and reverse primer with recombinant proteins of Institut Pasteur. The PvLDH sequence was biotinylated 5′-end (5′–biotin–GGATCCGAGCTCCACGTG–3′) using Vent (exo- c inserted into the pET28a (Novagen) vector and then recombinant PvLDH was ) DNA Polymerase (NEB), dU TP, dATP, dGTP, and dCTP. PCR conditions were transformed into Escherichia coli strain BL21 (DE3) pLysS. were in- as follows: denaturation at 95 °C for 15 s, annealing at 50 °C for 30 s, and cubated at 37 °C in Luria–Bertani broth until optical density at 600 nm elongation at 72 °C for 15 s for 10 cycles. The amplified library was purified

(OD600) reached 0.5. After cooling down to room temperature, protein ex- by streptavidin magnetic beads followed by a wash of 100 mM to elute the pression was induced by adding 0.25 mM IPTG (isopropyl β-D-1-thio- nonbiotinylated complementary strand as the cubane-modified ssDNA li- galactopyranoside). Cells were grown at 25 °C for 4 h with agitation (220 brary. Two namomoles of cubane-modified ssDNA library were incubated rpm). Cells were then harvested by centrifuging the culture at 4,000 rpm for with 1 nmol of PvLDH that was conjugated with Ni-NTA magnetic beads. The 45 min. The supernatant was discarded and the pellet was resuspended unbound species were removed, and the ssDNA–protein–magnetic bead by using 1× phosphate-buffered saline (PBS). The cell suspension was complexes were suspended in 10 μL of water for PCR amplification of PfLDH- transferred to 50-mL tubes and centrifuged at 4,000 rpm for 30 min. After bound species by using forward primer (5′–CGTACGGTCGACGCTAGC–3′)and discarding the supernatant, the cell pellet was resuspended in buffer reverse primer with biotinylated 5′-end (5′–biotin–GGATCCGAGCTCCA (100 mM Tris·HCl, 10 mM imidazole, and 0.3 M NaCl, pH 8) in a ratio of 1:50 CGTG–3′) using Vent (exo-) DNA polymerase. PCR conditions were as follows: lysis buffer to the original culture volume. After sonication, cell debris was denaturation at 95 °C for 15 s, annealing at 50 °C for 30 s, and elongation at removed by centrifugation at 19,000 rpm for 1 h at 4 °C. Supernatants were 72 °C for 15 s for 10 cycles. Enriched DNA aptamer pool was purified by loaded onto a 5-mL Protino Ni-NTA column (Macherey Nagel) on an AKTA streptavidin magnetic beads followed by a wash of 100 mM NaOH to CHEMISTRY pure system (GE Healthcare) and eluted with 50 mM Tris·HCl, 0.3 M NaCl, remove the nonbiotinylated complementary strand. The resultant ssDNA and 500 mM imidazole, pH 8. The eluted fractions were then purified on a pool was used for the next round of selection. Counterselections by using Ni- Hiload 16/60 (120 mL) Superdex 75 column using 50 mM Tris·HCl and 0.3 M NTA magnetic agarose beads (after rounds 3 and 9), PfLDH-immobilized Ni- NaCl, pH 8. After dialysis, the purified protein was stored in 25 mM Tris·HCl, NTA magnetic agarose beads (after rounds 4 and 10), hLDHB-immobilized 0.1 M NaCl, and 40% glycerol, pH 8; 120 mg of purified protein were Ni-NTA magnetic agarose beads (after rounds 6 and 12), and hLDHA1- obtained at a concentration of 20 mg/mL. PfLDH was expressed and purified immobilized Ni-NTA magnetic agarose beads (after rounds 5 and 11) were in a similar manner. incorporated in between the SELEX cycles.

Cloning, Expression, and Purification of PvLDH Mutants. The mutants of PvLDH Cubamer Biophysical Characterization by SPR. SPR measurements were col- were amplified by using overlap extension PCR. For PvLDH-M1 that consists lected using a Biacore X100 instrument (GE Healthcare). PvLDH was captured of a mutation at L232 to become G232, two fragments that contained the on the surface of an NTA sensor chip (GE Healthcare). A running buffer corresponding to PvLDH-M1 were first amplified by PvLDH-S, ATT containing 25 mM Tris·HCl, pH 7.5, 100 mM NaCl, 20 mM imidazole, 0.005% ATTGCTAGCATGACGCCGAAACCCAAAATTGTGCTC, and PvLDH-L232G-AS, (vol/vol) Tween 20, and 0.5 mg/mL bovine serum albumin was used for li- TGGGGCAACATAAGGAGAGGCACCGAGGTTCACAATCTCCAA, to become gand capturing. The surface of the NTA chip was primed with running buffer −1 M1-a, and PvLDH-L232G-S, TTGGAGATTGTGAACCTCGGTGCCTCTCCTTATGTT and the PvLDH cubamer, 1501s, was injected in at a flow rate of 30 μL·min GCCCCA, and PvLDH-AS, ATTATTCTCGAGTTAAATGAGCGCCTTCATCCTTTT and at 25 °C. All data were referenced for surface without captured cubamer AGTCTC, to become M1-b. The open (ORF) corresponded to and blank injections of buffer. Sensorgrams were analyzed with Biacore PvLDH-M1 was further amplified by PvLDH-S, ATTATTGCTAGCATGACGCCG X100 Plus Package evaluation software (GE Healthcare). AAACCCAAAATTGTGCTC, and PvLDH-AS, ATTATTCTCGAGTTAAATGAGCGC CTTCATCCTTTTAGTCTC, using M1-a and M1-b as templates. The PvLDH-M1 Crystallization and Data Collection and Structure Refinement. Crystallization ORF then was ligated into the NheI/XhoI-digested pET28a-PvLDH plasmid screening trials of the protein–aptamer complex (14 mg/mL) were carried out that was constructed in our previous study to become pET28a-PvLDH-M1. by the sitting drop vapor-diffusion method with a Mosquito automated For PvLDH-M2 that consists of a mutation at A233 to become G233, two nanoliter dispensing system (TTP Labtech) at 291 K. Sitting drops of 400 nL fragments that contained the mutations corresponding to PvLDH-M1 were were set up in Greiner plates for 672 commercially available screening so- first amplified by PvLDH-S, ATTATTGCTAGCATGACGCCGAAACCCAAAATT lutions using a 1:1 mixture of protein sample and reservoir well solution (150 GTGCTC, and PvLDH-L232G-AS, TGGGGCAACATAAGGAGAACCACCGAGGTT μL). The plates were stored in a RockImager (Formulatrix) automated im- CACAATCTCCAA, to become M2-a, and PvLDH-A233G-S, TTGGAGATTGTG aging system to monitor crystal growth. The crystals appeared after 3 mo in AACCTCCTTGGTTCTCCTTATGTTGCCCCA, and PvLDH-AS, ATTATTCTCGAG crystallization condition 52 of Index HT kit (Hampton Research) containing TTAAATGAGCGCCTTCATCCTTTTAGTCTC, to become M2-b. The ORF of 45% (vol/vol) 2-methyl-2,4-pentanediol, 0.2 M ammonium acetate, and PvLDH-M2 was further amplified by PvLDH-S, ATTATTGCTAGCATGACGCCG 0.1 M Hepes, pH 7.5. The fished crystals were flash-cooled in liquid AAACCCAAAATTGTGCTC, and PvLDH-AS, ATTATTCTCGAGTTAAATGAGCGC directly, as the condition of crystallization served also as cryoprotectant. CTTCATCCTTTTAGTCTC, using M2-a and M2-b as templates. The PvLDH-M2 Diffraction data were collected at beamline PROXIMA-1 (SOLEIL synchro- ORF then was ligated into the NheI/XhoI-digested pET28a-PvLDH plasmid tron, St. Auban, France) and processed with XDS (58) and Aimless (59). that was constructed in our previous study to become pET28a-PvLDH-M2. The structure of the PvLDH–cubamer complex was solved by the molecular For PvLDH-M3 that consists of mutations at L233 and A233 that became replacement technique using a PvLDH tetramer (PDB ID code 3ZH2) as a G233 and G233, respectively, two fragments that contained the mutations search model with Phaser (60). A complete model of the complex was corresponding to PvLDH-M3 were first amplified by PvLDH-S, ATTATTGCT obtained through interactive cycles of manual model building with Coot (61) AGCATGACGCCGAAACCCAAAATTGTGCTC, and PvLDH-L232A233G-AS, TGG and reciprocal space refinement with Buster (62) and phenix.refine (63). The GGCAACATAAGGAGAACCACCGAGGTTCACAATCTCCAA, to become M3-a, complex’s DNA moiety was gradually traced into difference electron density and PvLDH-L232A233G-S, TTGGAGATTGTGAACCTCGGTGGTTCTCCTTATGTT maps during this process. X-ray data collection and model refinement sta- GCCCCA, and PvLDH-AS, ATTATTCTCGAGTTAAATGAGCGCCTTCATCCTTTT tistics are summarized in SI Appendix, Table S23. Figures showing the crys- AGTCTC, to become M3-b. The ORF of PvLDH-M3 was further amplified tallographic model were generated and rendered with Pymol (Schrodinger, by PvLDH-S, ATTATTGCTAGCATGACGCCGAAACCCAAAATTGTGCTC, and LLC) and/or Chimera (64). The atomic coordinates and structure factors for

Cheung et al. PNAS Latest Articles | 7of9 Downloaded by guest on September 29, 2021 the PvLDH–cubamer complex have been deposited in the Protein Data Bank Cubamer-Integrated APTEC Assay. One hundred microliters of biotinylated under ID code 6TXR. cubamer was added to prewashed (PBST 0.1% Tween 20) Pierce streptavidin- coated plates (Thermo Fisher Scientific) for 2 h. Following three washes with EMSA. EMSAs were carried out according to our previous study (4, 43). Protein PBST, 100 μL of sample was added to each cubamer-decorated well for 1 h, was twofold serially diluted in binding buffer (25 mM Tris·HCl at pH 7.5 then washed five times with PBST. For color development, 100 μL of pre- containing 0.1 M NaCl and 20 mM imidazole). The nucleotides, including prepared L-lactate/NTB solution: 12 mL L-lactate buffer (0.2 M sodium L-lac- 1501s, 2008s, 1202s, or corresponding cubamer variants, were mixed with tate, 100 mM Tris HCl, and 0.2% Triton X-100, pH 9.1), 158 μL NAD+ solution the serially diluted proteins to a final concentration of 25 mM, followed by (50 mg/mL in water), 48 μL NBT solution (25 mg/mL in water), and 25 μL PES incubating at room temperature. The reactions were loaded on 12% native solution (5 mg/mL in water) was added and left to incubate for 45 min with polyacrylamide gels and visualized by SYBR gold nucleic acid gel mild shaking in the dark. Acetic acid (5%) was added to stop the reaction (Invitrogen). and the absorbance was read at 570 nm. For recombinant pLDH samples, 2× PBS was used as the binding buffer. For spiked human serum samples, 50 μL Cubamer-Integrated ELONA. A biotinylated complementary strand (3′– of human AB plasma (Sigma-Aldrich) was mixed with 50 μL PBS (0.5% Triton CTCCCGTGCCGTTTT–5′) was annealed to 1501s cubamer by incubating X-100) prior to adding protein. equal molar volumes in buffer (10 mM Tris, pH 7.5, 50 mM NaCl, and 1 mM EDTA), heated at 95 °C for 5 min, then allowed to cool at room temperature Data Availability. All data used in the study are included in the paper and in SI for 60 min before use. Annealing effectiveness was assessed by 12% TAE gel. Appendix. The crystal structure of the cubamer–target complex has been Protein samples were prepared by diluting in PBS with 0.05% Tween 20 to concentrations of 10, 5, 2.5, 1.25, 0.63, 0.31, 0.16, and 0 μg/mL, which is deposited in the PDB (ID code 6TXR) (65). 10,000, 5,000, 2,500, 1,250, 630, 310, 160, and 0 pg/μL, respectively. One hundred microliters of each protein were incubated in Ni-NTA HisSorb Plate ACKNOWLEDGMENTS. We thank the Shirley Boyde Trust for their generous (QIAGEN) wells for 1 h at room temperature. Wells were then washed three support through a Shirley Boyde Foundation Grant to J.A.T. and acknowl- times with 200 μL PBST (0.05% Tween 20), and 100 μL of 50 nM biotinylated edge Institut Pasteur funding to M.H., A.H., P.R., and F.L.-A.. J.A.T. acknowledges The University of Hong Kong Outstanding Young Researcher cubamer was added and incubated for 1 h at room temperature. PBST Award 2015-16, The University of Hong Kong Outstanding Research Student (0.05% Tween 20) was used as the cubamer binding buffer, while a 1:1 ratio Supervisor Award 2016-2017, and The University of Hong Kong Seed Fund of human AB plasma (Sigma-Aldrich) to PBS (0.05% Triton X-100) was used for Basic Research grants 201711159185 and 201611159269. We thank the for the human serum binding buffer. Subsequently, wells were washed staff of the platform for production and purification of recombinant μ three times with PBST, then 100 L of 1:10,000 streptavidin-HRP (Abcam) proteins of Institut Pasteur for technical assistance during the expression diluted in PBST were added and incubated for 30 min at room temperature. and purification of the proteins steps and the staff of the crystallography Following three washes with 200 μL of PBST, 100 μL of Pierce 1-Step Ultra platform at Institut Pasteur for carrying out robot-driven crystallization TMB ELISA Substrate (Thermo Fisher Scientific) was added and incubated for screening. We acknowledge synchrotron SOLEIL (Saint-Aubin, France) for 15 min at room temperature. The reaction was stopped by adding 2 M H2SO4 granting access to their facility and the staff of Proxima1 for helpful and absorbance was read at 450 nm. assistance during the data collection.

1. A. D. Ellington, J. W. Szostak, In vitro selection of RNA molecules that bind specific 21. E. Eremeeva et al., Highly stable hexitol based XNA aptamers targeting the vascular ligands. Nature 346, 818–822 (1990). endothelial growth factor. Nucleic Acids Res. 47, 4927–4939 (2019). 2. C. Tuerk, L. Gold, Systematic evolution of ligands by exponential enrichment: RNA 22. H. Mei et al., Synthesis and evolution of a aptamer bearing ligands to bacteriophage T4 DNA polymerase. Science 249, 505–510 (1990). 7-Deaza-7-substituted residues. J. Am. Chem. Soc. 140, 5706–5713 (2018). 3. A. D. Gelinas, D. R. Davies, N. Janjic, Embracing proteins: Structural themes in 23. K. M. Rose et al., Selection of 2′-deoxy-2′-fluoroarabino nucleic acid (FANA) aptamers aptamer-protein complexes. Curr. Opin. Struct. Biol. 36, 122–132 (2016). that bind HIV-1 integrase with picomolar affinity. ACS Chem. Biol. 14, 2166–2175 4. Y. W. Cheung et al., Structural basis for discriminatory recognition of Plasmodium (2019). lactate dehydrogenase by a DNA aptamer. Proc. Natl. Acad. Sci. U.S.A. 110, 24. E. Biondi, S. A. Benner, Artificially expanded genetic information systems for new 15967–15972 (2013). aptamer technologies. 6, 53 (2018). 5. H. Kaur, J. G. Bruno, A. Kumar, T. K. Sharma, Aptamers in the therapeutics and di- 25. S. Hoshika et al., Hachimoji DNA and RNA: A genetic system with eight building – agnostics pipelines. Theranostics 8, 4016–4032 (2018). blocks. Science 363, 884 887 (2019). 6. S. Liang et al., Measuring luteinising hormone pulsatility with a robotic aptamer- 26. M. Renders, E. Miller, C. H. Lam, D. M. Perrin, Whole cell-SELEX of aptamers with a – enabled electrochemical reader. Nat. Commun. 10, 852 (2019). tyrosine-like side chain against live bacteria. Org. Biomol. Chem. 15, 1980 1989 7. V. T. Nguyen, Y. S. Kwon, M. B. Gu, Aptamer-based environmental biosensors for (2017). small molecule contaminants. Curr. Opin. Biotechnol. 45,15–23 (2017). 27. T. R. Battersby et al., Quantitative analysis of receptors for adenosine nucleotides 8. Y. Sakai et al., DNA aptamers for the functionalisation of DNA origami nano- obtained via in vitro selection from a library incorporating a cationic nucleotide an- – structures. (Basel) 9, 571 (2018). alog. J. Am. Chem. Soc. 121, 9781 9789 (1999). 9. L. Gold, SELEX: How it happened and where it will go. J. Mol. Evol. 81, 140–143 (2015). 28. S. Gupta et al., Chemically modified DNA aptamers bind interleukin-6 with high af- 10. J. C. Rohloff et al., Nucleic acid ligands with protein-like side chains: Modified ap- finity and inhibit signaling by blocking its interaction with interleukin-6 receptor. J. Biol. Chem. 289, 8706–8719 (2014). tamers and their use as diagnostic and therapeutic agents. Mol. Ther. Nucleic Acids 3, 29. X. M. Ren, A. D. Gelinas, I. von Carlowitz, N. Janjic, A. M. Pyle, Structural basis for IL-1 e201 (2014). alpha recognition by a modified DNA aptamer that specifically inhibits IL-1 alpha 11. M. R. Dunn, R. M. Jimenez, J. C. Chaput, Analysis of aptamer discovery and technol- signaling. Nat. Commun. 8, 810 (2017). ogy. Nat. Rev. Chem. 1, 76 (2017). 30. L. Gold, J. J. Walker, S. K. Wilcox, S. Williams, Advances in human proteomics at high 12. P. Röthlisberger, M. Hollenstein, Aptamer chemistry. Adv. Drug Deliv. Rev. 134,3–21 scale with the SOMAscan proteomics platform. N. Biotechnol. 29, 543–549 (2012). (2018). 31. B. B. Sun et al., Genomic atlas of the human plasma proteome. Nature 558,73–79 13. B. N. Gawande et al., Selection of DNA aptamers with two modified bases. Proc. Natl. (2018). Acad. Sci. U.S.A. 114, 2898–2903 (2017). 32. J. D. Vaught et al., Expanding the chemistry of DNA for in vitro selection. J. Am. 14. M. Kimoto, R. Yamashige, K. Matsunaga, S. Yokoyama, I. Hirao, Generation of high- Chem. Soc. 132, 4141–4151 (2010). affinity DNA aptamers using an expanded genetic alphabet. Nat. Biotechnol. 31, 33. S. K. Wolk et al., Modified nucleotides may have enhanced early RNA catalysis. Proc. – 453 457 (2013). Natl. Acad. Sci. U.S.A. 117, 8236–8242 (2020). 15. V. B. Pinheiro et al., Synthetic genetic capable of and evolution. 34. F. Pfeiffer et al., Identification and characterization of nucleobase-modified aptamers – Science 336, 341 344 (2012). by click-SELEX. Nat. Protoc. 13, 1153–1180 (2018). 16. A. I. Taylor, G. Houlihan, P. Holliger, Beyond DNA and RNA: The expanding toolbox of 35. K. F. Biegasiewicz, J. R. Griffiths, G. P. Savage, J. Tsanaktsidis, R. Priefer, Cubane: synthetic . Cold Spring Harb. Perspect. Biol. 11, a032490 (2019). 50 years later. Chem. Rev. 115, 6719–6745 (2015). 17. P. A. Lichtor, Z. Chen, N. H. Elowe, J. C. Chen, D. R. Liu, Side chain determinants of 36. T. A. Reekie, C. M. Williams, L. M. Rendina, M. Kassiou, Cubanes in medicinal chem- – function during selection and replication. Nat. Chem. Biol. 15, 419 426 istry. J. Med. Chem. 62, 1078–1095 (2019). (2019). 37. Y. P. Auberson et al., Improving nonspecific binding and solubility: Bicycloalkyl groups 18. S. Arangundy-Franklin et al., A synthetic genetic with an uncharged back- and cubanes as para-phenyl bioisosteres. ChemMedChem 12, 590–598 (2017). bone chemistry based on alkyl phosphonate nucleic acids. Nat. Chem. 11, 533–542 38. S. D. Houston et al., The cubane paradigm in bioactive molecule discovery: Further (2019). scope, limitations and the cyclooctatetraene complement. Org. Biomol. Chem. 17, 19. H. Yu, S. Zhang, J. C. Chaput, Darwinian evolution of an alternative genetic system 6790–6798 (2019). provides support for TNA as an RNA progenitor. Nat. Chem. 4, 183–187 (2012). 39. S. S. Kuduva, D. C. Craig, A. Nangia, G. R. Desiraju, Cubanecarboxylic acids. Crystal 20. Z. Liu, T. Chen, F. E. Romesberg, Evolved polymerases facilitate selection of fully 2′- engineering considerations and the role of C−H···O hydrogen bonds in determining OMe-modified aptamers. Chem. Sci. (Camb.) 8, 8179–8182 (2017). O−H···O networks. J. Am. Chem. Soc. 121, 1936–1944 (1999).

8of9 | www.pnas.org/cgi/doi/10.1073/pnas.2003267117 Cheung et al. Downloaded by guest on September 29, 2021 40. K. J. Flanagan, S. S. R. Bernhard, S. Plunkett, M. O. Senge, Not your usual bioisostere: 52. Z. Chen, P. A. Lichtor, A. P. Berliner, J. C. Chen, D. R. Liu, Evolution of sequence- Solid state study of 3D interactions in cubanes. Chemistry 25, 6941–6954 (2019). defined highly functionalized nucleic acid polymers. Nat. Chem. 10, 420–427 (2018). 41. R. M. Dirkzwager, A. B. Kinghorn, J. S. Richards, J. A. Tanner, APTEC: Aptamer- 53. D. Kong, W. Yeung, R. Hili, In vitro selection of diversely functionalized aptamers. tethered enzyme capture as a novel rapid diagnostic test for malaria. Chem. Com- J. Am. Chem. Soc. 139, 13977–13980 (2017). mun. (Camb.) 51, 4697–4700 (2015). 54. M. Kimoto, K. Matsunaga, I. Hirao, DNA aptamer generation by genetic alphabet 42. R. M. Dirkzwager, S. Liang, J. A. Tanner, Development of aptamer-based point-of-care expansion SELEX (ExSELEX) using an unnatural system. Methods Mol. Biol. diagnostic device for malaria using 3D printing rapid prototyping. ACS Sens. 1, 1380,47–60 (2016). – 420 426 (2016). 55. D. A. Malyshev et al., A semi-synthetic organism with an expanded genetic alphabet. 43. Y. W. Cheung et al., Aptamer-mediated Plasmodium-specific diagnosis of malaria. Nature 509, 385–388 (2014). – Biochimie 145, 131 136 (2018). 56. L. Zhang et al., Evolution of functional six-nucleotide DNA. J. Am. Chem. Soc. 137, 44. L. A. Fraser et al., A portable microfluidic Aptamer-Tethered Enzyme Capture (APTEC) 6734–6737 (2015). for malaria diagnosis. Biosens. Bioelectron. 100, 591–596 (2018). 57. V. T. Dien, M. Holcomb, F. E. Romesberg, Eight-letter DNA. 58, 45. B. A. Chalmers et al., Validating Eaton’s hypothesis: Cubane as a benzene bioisostere. 2581–2583 (2019). Angew. Chem. Int. Ed. Engl. 55, 3580–3585 (2016). 58. W. Kabsch, Integration, scaling, space-group assignment and post-refinement. Acta 46. P. Röthlisberger, F. Levi-Acobas, M. Hollenstein, New synthetic route to ethynyl-dUTP: Crystallogr. D Biol. Crystallogr. 66, 133–144 (2010). A means to avoid formation of acetyl and chloro vinyl base-modified triphosphates 59. P. R. Evans, G. N. Murshudov, How good are my data and what is the resolution? Acta that could poison SELEX experiments. Bioorg. Med. Chem. Lett. 27, 897–900 (2017). Crystallogr. D Biol. Crystallogr. 69, 1204–1214 (2013). 47. D. Turgut-Balik et al., Cloning, sequence and expression of the lactate dehydrogenase gene 60. A. J. McCoy et al., Phaser crystallographic software. J. Appl. Cryst. 40,658–674 from the human malaria parasite, Plasmodium vivax. Biotechnol. Lett. 26,1051–1055 (2004). 48. S. S. Kuduva, D. Bläser, R. Boese, G. R. Desiraju, Crystal engineering of primary cu- (2007). banecarboxamides: Repetitive formation of an unexpected N-H...O hydrogen-bonded 61. P. Emsley, K. Cowtan, Coot: Model-building tools for molecular graphics. Acta Crys- – network. J. Org. Chem. 66, 1621–1626 (2001). tallogr. D Biol. Crystallogr. 60, 2126 2132 (2004). 49. D. Das, R. K. R. Jetti, R. Boese, G. R. Desiraju, Stereoelectronic effects of substituent 62. G. Bricogne et al., Buster (Version 2.11.1, Global Phasing Ltd, Cambridge, UK, 2011). groups in the solid state. Crystal chemistry of some cubanecarboxylic and phenyl- 63. P. V. Afonine et al., Towards automated crystallographic structure refinement with propiolic acids. Cryst. Growth Des. 3, 675–681 (2003). phenix.refine. Acta Crystallogr. D Biol. Crystallogr. 68, 352–367 (2012). 50. G. R. Desiraju, The C-H···O hydrogen bond: Structural implications and supramolecular 64. E. F. Pettersen et al., UCSF Chimera–A visualization system for exploratory research design. Acc. Chem. Res. 29, 441–449 (1996). and analysis. J. Comput. Chem. 25, 1605–1612 (2004). 51. J. W. Jang, C. H. Cho, E. T. Han, S. S. An, C. S. Lim, pLDH level of clinically isolated 65. Y. Cheung et al, Structural insights into cubane-modified aptamer recognition of a Plasmodium vivax and detection limit of pLDH based malaria rapid diagnostic test. malaria biomarker. Protein Data Bank. https://www.rcsb.org/structure/unreleased/ Malar. J. 12, 181 (2013). 6TXR. Deposited 15 January 2020. CHEMISTRY

Cheung et al. PNAS Latest Articles | 9of9 Downloaded by guest on September 29, 2021