Abrogation of Heat Shock Protein 70 Induction As a Strategy to Increase Antileukemia Activity of Heat Shock Protein 90 Inhibitor 17-Allylamino-Demethoxy Geldanamycin

Research Article

Abrogation of Heat Shock Protein 70 Induction as a Strategy to Increase Antileukemia Activity of Heat Shock Protein 90 Inhibitor 17-Allylamino-Demethoxy Geldanamycin

Fei Guo, Kathy Rocha, Purva Bali, Michael Pranpat, Warren Fiskus, Sandhya Boyapalle, Sandhya Kumaraswamy, Maria Balasis, Benjamin Greedy, E. Simon M. Armitage, Nicholas Lawrence, and Kapil Bhalla

Department of Interdisciplinary Oncology, H. Lee Moffitt Cancer Center, Tampa, Florida

Abstract to maintain a mature, stable, and functional conformation (1, 2). Hsp90 is an ATP-dependent molecular chaperone, which binds and 17-Allylamino-demethoxy geldanamycin (17-AAG) inhibits the releases client proteins, driven by ATP binding and hydrolysis (3). chaperone association of heat shock protein 90 (hsp90) with ATP/ADP binding to the hydrophobic NH terminus pocket alters the heat shock factor-1 (HSF-1), which induces the mRNA and 2 the conformation of hsp90, resulting in its interaction with the protein levels of hsp70. Increased hsp70 levels inhibit death cochaperone complex that protects or stabilizes the client proteins, receptor and mitochondria-initiated signaling for apoptosis. or with an alternative subset of cochaperones that directs the Here, we show that ectopic overexpression of hsp70 in human misfolded proteins to a covalent linkage with polyubiquitin and acute myelogenous leukemia HL-60 cells (HL-60/hsp70) and subsequent degradation by the 26S proteasome (1–4). Benzoqui- high endogenous hsp70 levels in Bcr-Abl-expressing cultured none ansamycin antibiotic geldanamycin and its less toxic ana- CML-BC K562 cells confers resistance to 17-AAG-induced logue 17-allylamino-demethoxy geldanamycin (17-AAG) directly apoptosis. In HL-60/hsp70 cells, hsp70 was bound to Bax, bind to the ATP/ADP binding pocket, thereby replacing the inhibited 17-AAG-mediated Bax conformation change and nucleotide and inhibiting hsp90 function as a molecular chaperone mitochondrial localization, thereby inhibiting the mitochon- for the client proteins (5). By blocking ATP binding to hsp90, 17- dria-initiated events of apoptosis. Treatment with 17-AAG AAG stabilizes the hsp90 conformation that recruits hsp70-based attenuated the levels of phospho-AKT, AKT, and c-Raf but cochaperone complex associated with the misfolded client pro- increased hsp70 levels to a similar extent in the control HL-60/ teins (1, 2, 6). This results in the ubiquitin-dependent proteasomal Neo and HL-60/hsp70 cells. Pretreatment with 17-AAG, which degradation of the client proteins (1, 2). induced hsp70, inhibited 1-B-D-arabinofuranosylcytosine or Recent studies from our laboratory have shown that the etoposide-induced apoptosis in HL-60 cells. Stable trans- antiapoptotic effects of Bcr-Abl in acute leukemia cells are partially fection of a small interfering RNA (siRNA) to hsp70 com- mediated by increased expression of hsp70 (7). Hsp70 is also an pletely abrogated the endogenous levels of hsp70 and blocked ATP-dependent molecular chaperone, which is induced by cellular 17-AAG-mediated hsp70 induction, resulting in sensitizing stress due to misfolded and denatured proteins (8, 9). In normal K562/siRNA-hsp70 cells to 17-AAG-induced apoptosis. This nontransformed cells, the expression of hsp70 is low and largely was associated with decreased binding of Bax to hsp70 and stress inducible (8, 9). However, hsp70 is abundantly expressed in increased 17-AAG-induced Bax conformation change. 17-AAG- most cancer cells (8, 9). Hsp70 has been shown to play an active mediated decline in the levels of AKT, c-Raf, and Bcr-Abl role in oncogenic transformation, and turning off the hsp70 was similar in K562 and K562/siRNA-hsp70 cells. Cotreatment expression was shown to reverse the transformed phenotype of with KNK437, a benzylidine lactam inhibitor of hsp70 in- Rat-1 fibroblasts (10–12). Ectopic overexpression or induced duction and thermotolerance, attenuated 17-AAG-mediated endogenous levels of hsp70 potently inhibits apoptosis (9, 13, 14). hsp70 induction and increased 17-AAG-induced apoptosis and Several reports have documented that hsp70 inhibits the mito- loss of clonogenic survival of HL-60 cells. Collectively, these chondrial pathway of apoptosis by blocking Apaf-1-mediated data indicate that induction of hsp70 attenuates the apoptotic activation of caspase-9 and caspase-3, as well as by repressing effects of 17-AAG, and abrogation of hsp70 induction the activity of caspase-3 (15–17). Additionally, hsp70 can also significantly enhances the antileukemia activity of 17-AAG. inhibit caspase-independent apoptosis by directly interacting with (Cancer Res 2005; 65(22): 10536-44) AIF, thereby preventing nuclear import and DNA fragmentation by AIF (18, 19). Conversely, hsp70 depletion by antisense oligonu- Introduction cleotides or ectopic transfection and expression of a fragment of A number of leukemia associated, newly synthesized, or stress- hsp70 DNA in the antisense orientation has been shown to induce denatured client proteins, including Bcr-Abl, c-Raf, AKT, c-KIT, apoptosis (7, 20, 21). and FLT-3, require interaction with heat shock protein 90 (hsp90) Heat-damaged proteins, reactive oxygen species, or oncogenic stress is known to induce hsp70 levels (8, 9). This is mediated through the transcriptional activity of the heat shock factor-1

Requests for reprints: Kapil Bhalla, Interdisciplinary Oncology Program, Moffitt (HSF-1; refs. 8, 9). Stress-induced activation of HSF-1 involves Cancer Center and Research Institute, University of South Florida, 12902 Magnolia phosphorylation, trimerization, nuclear localization, and binding of Drive, MRC 3 East, Room 3056, Tampa, FL 33612. Phone: 813-903-6861; Fax: 813-903- HSF-1 to the heat shock elements (HSE) in the promoter of the 6817; E-mail: [email protected]. I2005 American Association for Cancer Research. hsp70 gene, resulting in induction of hsp70 levels (9, 22, 23). Hsp90 doi:10.1158/0008-5472.CAN-05-1799 binds and blocks the activation of HSF-1 (22). During stress

Cancer Res 2005; 65: (22). November 15, 2005 10536 www.aacrjournals.org

Downloaded from cancerres.aacrjournals.org on September 29, 2021. © 2005 American Association for Cancer Research. hsp70 Induction by hsp90 Inhibitors response, denatured proteins bind hsp90 and displace HSF-1 from Bax conformation change analysis. Cells were lysed in 3-[(3- hsp90, allowing nuclear localization and activity of HSF-1, resulting cholamidopropyl)dimethylammonio]-1-propanesulfonic acid lysis buffer, in up-regulation of hsp70 levels (9, 22, 23). KNK437 is a novel ben- containing 150 mmol/L NaCl, 10 mmol/L HEPES (pH 7.4), and 1% 3-[(3- zylidine lactam compound, which is known to inhibit the devel- cholamidopropyl)dimethylammonio]-1-propanesulfonic acid] containing protease inhibitors. Immunoprecipitation is done in lysis buffer by using opment of thermotolerance by inhibiting the induction of heat 500 Ag of total cell lysate and 2.5 Ag of anti-Bax 6A7 monoclonal antibody shock proteins, including hsp70 (24, 25). Treatment with 17-AAG (Sigma Chemical). The resulting immune complexes were subjected to disrupts the association between hsp90 and HSF-1, thereby immunoblotting analysis with anti-Bax polyclonal antibody, as described promoting nuclear localization, HSE binding, and activity of previously (32, 33). HSF-1, resulting in induction of hsp70 levels (22, 23, 26). 17-AAG Apoptosis assessment by Annexin V staining. After drug treatments, was shown to induce hsp70 in the transformed fibroblasts derived percentage apoptotic cells (either stained only with Annexin V or with both from mice with wild-type HSF-1 but not from the HSF-1 knockout Annexin V and propidium iodide) were estimated by flow cytometry, as mice (26). Indeed, the hsf-1À/À fibroblasts were significantly more previously described (28, 29). sensitive than hsf-1+/+ fibroblasts to 17-AAG-mediated cytotoxic Colony growth inhibition. Following treatment with the designated effect. Therefore, the question arises whether 17-AAG-induced concentrations of 17-AAG and/or KNK437, untreated and drug-treated cells hsp70 attenuates the apoptotic effect of 17-AAG in human were washed in RPMI 1640. Approximately 200 cells treated under each condition were resuspended in 100 AL of RPMI 1640 containing 10% fetal leukemia cells, and whether pretreatment with 17-AAG, through bovine serum and then plated in duplicate wells in a 12-well plate induction of hsp70, would inhibit apoptosis induced by conven- containing 1.0 mL of Methocult medium (Stem Cell Technologies, Inc., tional antileukemia agents. In the present studies, we examined Vancouver, Canada) per well, according to the manufacturer’s protocol. j these issues, as well as determined whether abrogation of hsp70 The plates were placed in an incubator at 37 C with 5% CO2 for 10 days. induction by small interfering RNA (siRNA) to hsp70 or by co- Following this incubation, colonies consisting of z50 cells, in each well, treatment with KNK437 would sensitize human leukemia cells to were counted by an inverted microscope and % colony growth inhibition 17-AAG and other antileukemia agents. compared with the untreated control cells were calculated. Morphology of apoptotic cells. After drug treatment, 50 Â 103 cells were washed and resuspended in 1Â PBS (pH 7.4). Cytospin preparations of Materials and Methods the cell suspensions were fixed and stained with Wright stain. Cell Reagents and antibodies. 17-AAG was a gift from Kosan Bioscience morphology was determined and the percentage of apoptotic cells was (South San Francisco, CA; ref. 27). KNK437 was a gift from Kaneka Corp. calculated for each experiment, as described previously (29). (Takasago, Japan). Etoposide and 1-h-D-arabinofuranosylcytosine (ara-C) Nuclear and S100 fraction isolation. Cells were lysed in hypotonic were purchased from Sigma Chemical Co. (St. Louis, MO) and prepared as a buffer containing 20 mmol/L HEPES (pH 7.9), 1 mmol/L EDTA, 1 mmol/L 10 mmol/L stock solution in sterile PBS and diluted in RPMI 1640 before EGTA, 20 mmol/L NaF, 1 mmol/L Na4P2O7, 1 mmol/L DTT, and 0.5 mmol/L use. Anti-hsp70, HSF-1, and anti-hsp90 antibodies were purchased from phenylmethylsulfonyl fluoride (PMSF), 0.5 Ag/mL leupeptin, 50 Ag/mL anti- Stressgen Biotechnologies Corp. (Victoria, British Columbia, Canada). pain, and 2 Ag/mL aprotinin. Cell lysates were left on ice for 10 minutes Hsp70 promoter/h-galactosidase (h-gal) reporter construct-containing and then centrifuged at 2,000 Â g for 30 seconds. Pellets were resuspended vector p173OR was also purchased from Stressgen Biotechnologies. The in hypotonic buffer containing 0.05% NP40. The nuclei were released and monoclonal anti-Abl and polyclonal anti-Bax antibody were purchased from pelleted by centrifugation at 2,000 Â g for 2 minutes. Nuclei were re- Santa Cruz Biotechnology (Santa Cruz, CA). Polyclonal anti-poly(ADP- suspended in hypotonic buffer C, containing 20 mmol/L HEPES (pH 7.9), ribose) polymerase (PARP) was purchased from Cell Signaling Technology 420 NaCl, 20% glycerol, 1 mmol/L EDTA, 1 mmol/L EGTA, 20 mmol/L NaF, (Beverly, MA). Anti-phospho-AKT (p-AKT), c-Raf, and anti-AKT antibodies 1 mmol/L Na4P2O7, 1 mmol/L DTT, and 0.5 mmol/L PMSF, 0.5 Ag/mL were procured, as previously described (28). leupeptin, 50 Ag/mL antipain, and 2 Ag/mL aprotinin, mixed well, and Cultured cells. Human chronic myelogenous leukemia blast crisis K562 rotating at 4jC for 30 minutes. Finally, nuclear extracts were collected as and acute myelogenous leukemia HL-60 cells were maintained in culture as supernatant after centrifugation at 12,000 Â g at 4jC for 30 minutes, as previously described (29). Cells were passaged as previously reported (29). previously described (7, 32). S100 fractions were collected as previously Logarithmically growing cells were used for the studies described below. described (7, 32). Creation and culture of HL-60/hsp70 and K562/hsp70AS cells. Heat shock factor-1 immunofluorescence. Approximately 50,000 cells pcDNA3-hsp70 plasmid was kindly provided by Dr. Richard Morimoto were cytospun, immediately fixed with 4% paraformaldehyde, and kept (Northwestern University, Urbana, IL; ref. 30). This construct was stably overnight at 4jC. The cells were then permeabilized in 0.5% Triton X-100/ transfected into HL-60 cells, and the stable clones were selected, subcloned PBS for 15 minutes. After preblocking with 3% bovine serum albumin/PBS, by limiting dilution, and maintained in 500 Ag/mL of G418 (7). To create the cells were incubated with anti-HSF-1 primary antibody (Stressgen, British pcDNA3-hsp70AS construct, pcDNA3-hsp70 was used as a template for Columbia, Canada; 1:100) at room temperature for 1.5 hours followed by PCR amplification using forward primer containing XhoI restriction site three washes in PBS and incubated with FITC-conjugated secondary (5V-CCCTCGAGAGGATGCGGGTGTGATCG-3V) and a reverse primer con- antibody (1:200) at room temperature for 30 minutes. Cells were washed in taining HindIII restriction site (5V-CCCAAGCTTCTTGGCGTCGCGCAGCA- PBS before nuclear staining with 0.1 Ag/mL of 4V,6-diamino-2-phenylindole GAGA-3V; ref. 20). The PCR product was digested with XhoI and HindIII and and analysis by fluorescence microscopy, as described previously (34). subcloned into pcDNA3.1 vector. K562 cells were stably transfected with B-Galactosidase reporter assay. Cells were transfected with hsp70 the pcDNA3-hsp70AS construct and maintained in 500 Ag/mL of G418. promoter/h-gal reporter vector p1730R by nucleofection (Amaxa) and Creation and culture of K562/siRNA-hsp70 cells. K562 cells were incubated at 37jC for 36 hours. Cells were then pretreated with KNK437 transfected by Amaxa nucleofector, using T-16 protocol of the manufacturer (400 Amol/L) for 1 hour followed by KNK437 plus 17 AAG (5 Amol/L) for (Gaithersburg, MD), with the pRNATin-H1.2/Neo vector containing hsp70 6 hours. Alternatively, cells were heat shocked (42jC) for 1 hour followed siRNA GAAGGACGAGTTTGAGCACAA or the control sequence (K562/ by recovery at 37jC for 5 hours. Subsequently, cells were harvested and control cells; Genscript, Piscataway, NJ; refs. 7, 31). Stable clones were total cell lysates obtained. Ten micrograms of the protein were incubated selected and maintained in 500 Ag/mL G418 selection medium. with chlorophenolred-h-D-galactopyranoside (Roche, Indianapolis, IN) for Western analyses of proteins. Western analyses of Bcr-Abl, pAKT, AKT, 4 hours and analyzed using a microplate reader at 570 nm. c-Raf, Caspase-3, PARP, hsp70, hsp90 and HSF-1, and h-actin were done Statistical analysis. Significant differences between values obtained in a using specific antisera or monoclonal antibodies according to previously population of leukemia cells treated with different experimental conditions reported protocols (29, 32). were determined using the Student’s t test. www.aacrjournals.org 10537 Cancer Res 2005; 65: (22). November 15, 2005

Results depleted p-AKT, AKT, and c-Raf levels in both cell types, with Overexpression of heat shock protein 70 confers resistance slightly greater inhibition of p-AKT and AKT levels in HL-60/ against 17-allylamino-demethoxy geldanamycin–induced hsp70 cells (Fig. 1B). A more pronounced effect noted on p-AKT apoptosis of acute leukemia cells. First, we compared the than AKT levels may be due to increased activity of the protein apoptotic effects of 17-AAG in the control (HL-60/Neo) versus the phosphatase 1 (PP1) induced by treatment with 17-AAG (35). HL-60/hsp70 cells with ectopic overexpression of hsp70. As shown in 17-AAG also induced the expression of hsp70, with only a slight Fig. 1A, treatment with 0.5, 2.0, or 5.0 Amol/L of 17-AAG induced increase in hsp90 levels, in both HL-60/Neo and HL-60/hsp70 cells significantly less apoptosis in HL-60/hsp70 compared with HL-60/ (Fig. 1C). Neo cells. This was associated with reduced processing of PARP Hsp70 inhibits 17-allylamino-demethoxy geldanamycin– in HL-60/hsp70 cells (Fig. 1C). However, exposure to 17-AAG induced Bax conformation change and localization to the mitochondria. In unperturbed cells the multi-Bcl-2 homology domain-containing proapoptotic molecule Bax is predominantly localized in the cytosol (36). Following exposure to an apoptotic stimulus, Bax undergoes a conformational change, detected by the 6A7 antibody, leading to exposure of its NH2 and COOH ter- mini and localization to the mitochondria (33, 37). This results in mitochondrial permeabilization and release of the pro-death molecules cytochrome c, Smac, Omi, and AIF (27, 33, 38). Com- pared with HL-60/Neo, in HL-60/hsp70 cells, more hsp70 could be coimmunoprecipitated with intracellular Bax, with or without treatment with 17-AAG (Fig. 2A). These results are consistent with a recent report, where hsp70 was shown to inhibit endo- plasmic reticulum stress-induced apoptosis by binding to Bax and preventing its translocation to the mitochondria (39). A dose-dependent increase in 17-AAG-mediated Bax conformation change in HL-60/Neo cells was observed, which was markedly inhibited in HL-60/hsp70 cells (Fig. 2B). Consistent with the reduced 17-AAG-induced Bax conformation change, 17-AAG also did not attenuate Bax levels in the cytosolic S100 fraction or increased Bax levels in the mitochondria that are present in the heavy membrane fraction of HL-60/hsp70 cells, as was seen in HL-60/Neo cells (Fig. 2C). Abrogation of heat shock protein 70 induction sensitizes 17-allylamino-demethoxy geldanamycin-induced apoptosis. We had previously reported that Bcr-Abl-expressing chronic myelogenous leukemia cells (e.g., K562 cells) possess markedly higher expression of hsp70 but not hsp90 (7). The direct role of hsp70 in mediating resistance to apoptosis was determined in K562 cells stably transfected with the siRNA to hsp70 (K562/siRNA- hsp70), or in K562 cells with stable transfection of the cDNA of hsp70 in the reversed orientation (K562/hsp70AS cells). Figure 3A shows that, compared with the control K562, untreated K562/ siRNA-hsp70 cells do not express hsp70. Notably, treatment with 17-AAG induced marked induction of hsp70 levels in the control K562 but not in K562/siRNA-hsp70 cells. Concomitantly, exposure to 17-AAG induced significantly more Bax conformation change in K562/siRNA-hsp70 versus the control K562 cells (Fig. 3A). Con- sistent with this, compared with K562/control, K562/siRNA-hsp70 cells were more sensitive to 17-AAG-induced apoptosis (Fig. 3B). Despite this, treatment with 17-AAG caused similar decline in the levels of Bcr-Abl, AKT, and c-Raf levels in both cell types (Fig. 3C). These data indicate that induction of hsp70 by 17-AAG inhibits Figure 1. Hsp70 confers resistance against 17-AAG-induced apoptosis in Bax-mediated signaling for apoptosis induced by 17-AAG, without HL-60 cells. A, HL-60/Neo and HL-60/hsp70 cells were treated with 17-AAG at abrogating 17-AAG-mediated depletion of hsp90 client proteins indicated concentrations for 48 hours. Following this treatment, the percentage of apoptotic cells was determined by Annexin V staining and flow cytometry. c-Raf, AKT, and Bcr-Abl in K562/control cells. Treatment with Points, mean of three experiments; bars, FSE. B, HL-60/Neo and HL-60/hsp70 17-AAG also induced hsp90 but failed to induce hsp70 in K562/ cells were treated with 17-AAG at indicated concentrations for 24 hours. Following this treatment, total cell lysates were immunoblotted with anti-p-AKT, hsp70AS cells (Fig. 4A). Consequently, as in K562/siRNA-hsp70 AKT, or anti-c-Raf antibody. h-Actin levels were used as a loading control. cells, the sensitivity to 17-AAG-induced apoptosis was markedly C, HL-60/Neo and HL-60/hsp70 cells were treated with 17-AAG at indicated restored in K562/hsp70AS cells (Fig. 4B). There was no significant concentrations for 24 hours. Following this treatment, total cell lysates were immunoblotted with anti-hsp70, hsp90, and anti-PARP antibodies. h-Actin levels difference in Bcr-Abl, c-Raf, p-AKT, or AKT levels in K562/hsp70AS were used as a loading control. versus K562/control cells (data not shown).

Cancer Res 2005; 65: (22). November 15, 2005 10538 www.aacrjournals.org

Figure 2. Hsp70 binds to Bax and inhibits the conformational change and translocation of Bax to the mitochondria. A, HL-60/Neo and HL-60/hsp70 cells were treated with 17-AAG for 24 hours. Following this treatment, the cell lysates were immunoprecipitated with anti-Bax antibody and immunoblotted with either anti-hsp70 or anti-Bax antibody. B, HL-60/Neo and HL-60/hsp70 cells were treated with 17-AAG at indicated concentrations for 24 hours. Following this treatment, cell lysates were first immunoprecipitated with the 6A7 antibody that detects the conformationally changed Bax and immunoblotted with polyclonal anti-Bax antibody. C, HL-60/Neo and HL-60/hsp70 cells were treated with 17-AAG at indicated concentrations for 24 hours. Following this treatment, the cytosolic (S100) and heavy membrane fractions (HMF) were separated and immunoblotted with anti-Bax antibody. h-Actin levels were used as a loading control.

Pretreatment with 17-allylamino-demethoxy geldanamycin induces heat shock protein 70 and confers resistance to apoptosis due to antileukemia agents. We next determined the sequence-dependent effects of cotreatment with 17-AAG on the cytotoxic effects of etoposide (1.0 Amol/L) or ara-C (1.0 Amol/L; data not shown) on human acute myelogenous leukemia HL-60 cells. Whereas exposure to etoposide had no effect, treatment with 0.5 Amol/L of 17-AAG for 24 hours induced hsp70 levels in HL-60 cells, which were unaffected by exposure to etoposide before or Figure 3. Ectopic expression of siRNA-hsp70 depletes hsp70 levels and after 17-AAG treatment (Fig. 5A). Similar effects of ara-C on hsp70 sensitizes cells to 17-AAG-induced apoptosis. A, control K562 and K562/siRNA-hsp70 cells were treated with 17-AAG for 24 hours. Following this induction were observed (data not shown). Concomitantly, treatment, the cell lysates were immunoprecipitated with anti-Bax antibody and apoptosis following sequential treatment with etoposide followed immunoblotted with either hsp70 or Bax antibodies. Alternatively, the cell lysates were immunoprecipitated with 6A7 antibody and immunoblotted with anti-Bax by 17-AAG (each for 24 hours) was significantly more than the antibodies. B, control K562 and K562/siRNA-hsp70 cells, created by stably sequential treatment with 17-AAG followed by etoposide, or fol- expressing pRNATin-H1.2/Neo vector containing hsp70 siRNA sequence, were lowing treatment with either drug alone for 24 hours followed by treated with the indicated concentrations of 17-AAG for 48 hours. Following these treatments, the percentage of apoptotic cells was determined by Annexin V culture of the cells in the drug-free medium for 24 hours (P < 0.05; staining and flow cytometry. Points, mean of three experiments; bars, FSE. Fig. 5B). A similar sequence-dependent effect of 17-AAG was also C, following treatment of the control K562 and K562/siRNA-hsp70 cells with the indicated concentrations of 17AAG for 24 hours, Western analyses of the observed with ara-C (data not shown). These data suggest that expressions of Bcr-Abl, AKT, and c-Raf were done using specific antibodies. induction of hsp70 levels by 17-AAG pretreatment may confer h-Actin levels were used as a loading control. www.aacrjournals.org 10539 Cancer Res 2005; 65: (22). November 15, 2005

(P < 0.05; Fig. 6D). We next determined the effect of KNK437 on 17-AAG-induced hsp70 and apoptosis. HL-60 cells were pretreated with KNK37 (100 or 400 Amol/L) for 1 hour and then cotreated with 17-AAG and KNK437 for 24 hours. Figure 7A shows that pretreatment and cotreatment with KNK437 inhibited 17-AAG- mediated hsp70 induction in HL-60 cells. Compared with treatment with KNK437 (100 or 400 Amol/L) or 17-AAG (0.5 or 2.0 Amol/L) alone, each of the combinations of treatments with KNK437 and 17-AAG, as indicated, induced significantly more apoptosis of HL-60 cells (P < 0.05; Fig. 7B). Notably, cotreatment with KNK437 and 17-AAG also significantly increased the loss of clonogenic survival of HL-60 cells compared with the treatment with either agent alone (P < 0.01; Fig. 7C).

Discussion Previous reports have clearly established that stress-induced ectopic or endogenous expression of hsp70 exerts an antiapoptotic effect upstream and downstream of the mitochondria and inhibits apoptosis due to a variety of antileukemia agents (13–17, 20, 21).

Figure 4. Ectopic expression of cDNA in the reverse orientation depletes hsp70 levels and sensitizes CML-BC cells to 17-AAG-induced apoptosis. A, K562 and K562/hsp70 AS cells were treated with 17-AAG at indicated concentrations for 24 hours. Following these treatments, total cell lysates were immunoblotted with hsp70 and hsp90 antibodies. h-Actin levels were used as a loading control. B, control K562 and K562/hsp70 AS cells were treated with the indicated concentrations of 17-AAG for 48 hours. Following these treatments, the percentages of apoptotic cells were determined by Annexin V staining and flow cytometry. Points, mean of three experiments; bars, FSE. resistance to apoptosis secondary to a subsequent treatment with etoposide or ara-C. Cotreatment with KNK437 inhibits 17-allylamino-demethoxy geldanamycin mediated heat shock protein 70 induction but enhances 17-allylamino-demethoxy geldanamycin-induced apoptosis. Previous reports have indicated that the induction of hsp70 expression is dependent on the phosphorylation, oligomerization, nuclear localization, and binding of HSF-1 to the HSEs present upstream of the hsp70 promoter (8, 9, 22, 23, 26). Because KNK437 pretreatment has been shown to inhibit the induction of the mRNA and protein levels of hsp70 following heat shock (24, 25), we determined the mechanism by which KNK437 inhibits 17-AAG-mediated hsp70 induction, as well as evaluated the effect of cotreatment with KNK437 on 17-AAG-induced apoptosis. Figure 6A shows that treatment with KNK437 did not inhibit the phosphorylation of HSF-1 in K562 cells, based on the absence of any inhibitory effect on the slower migrating band on the immunoblot of HSF-1, which is abolished by cotreatment with PP1 (Calbiochem, San Diego, CA; data not shown). Pretreatment for 1 hour followed by cotreatment with KNK437 did not inhibit 17-AAG-mediated Figure 5. Pretreatment with 17-AAG inhibits etoposide-induced apoptosis in increase in HSF-1 in the nuclear and the concomitant decrease in HL-60 cells. A, HL-60 cells were treated with 17-AAG (0.5 Amol/L) for 24 hours followed by incubation in drug-free medium for 24 hours or washed and the cytosolic S100 fraction of K562 cells (Fig. 6B). Using immu- treated with etoposide (1.0 Amol/L) for 24 hours. Drugs were also administered in nofluorescence microscopy, we were able to confirm that KNK437 the reverse sequence. Following these treatments, the levels of hsp70 were observed by Western blot analysis. h-Actin levels were used as a loading control. did not inhibit 17-AAG or heat shock–mediated increase in the B, HL-60 cells were treated with 17-AAG (0.5 Amol/L) for 24 hours followed nuclear HSF-1 immunofluorescence (Fig. 6C). In contrast, in cells by either incubation in drug-free medium for 24 hours or washed and treated transfected with the hsp70 promoter/h-gal reporter plasmid, with etoposide (1.0 Amol/L) for 24 hours. Drugs were also administered in the reverse sequence. Following these treatments, the percentage of apoptotic pretreatment and cotreatment with KNK437 significantly inhibited cells was determined at 48 hours by Annexin V staining and flow cytometry. heat shock– or 17-AAG-induced h-gal expression in K562 cells Columns, mean of three experiments; bars, FSE.

Cancer Res 2005; 65: (22). November 15, 2005 10540 www.aacrjournals.org

Figure 6. KNK437 inhibits transactivation of hsp70 by HSF-1 without affecting phosphorylation and nuclear localization of HSF-1. A, K562 cells were treated with KNK437 at the indicated concentrations for 24 hours. Following this treatment, total cell lysates were immunoblotted with the anti-HSF-1 antibody. h-Actin levels were used as a loading control. B, K562 cells were treated with KNK437 (400 Amol/L) for 1 hour followed by 17-AAG (5 Amol/L) plus KNK437 for 4 hours. Following this treatment, the S100 and nuclear fractions were separated and immunoblotted with anti-HSF-1 antibody. Histone H1 and h-actin levels were used as loading controls. C, K562 cells were treated with KNK437 (400 Amol/L) for 1 hour followed by 17-AAG (5 Amol/L) plus KNK437 for 4 hours. Following this treatment, cells were immunostained with anti-HSF-1 antibody then incubated in FITC-conjugated secondary antibody. Nuclear material was stained with 4V,6-diamino-2-phenylindole and visualized with immunofluorescent microscopy. D, K562 cells were transfected with the hsp70 promoter/h-gal reporter construct-containing vector p173OR by nucleofection (Amaxa) and incubated at 37jC for 36 hours. Following this, cells were treated with the indicated concentrations of either KNK437 for 7 hours, 17-AAG for 6 hours, heat shock of 42jC for 1 hour, or KNK437 for 1 hour followed by KNK437 plus 17-AAG or heat shock. Columns, mean levels (of three experiments) of h-gal determined by a colorimetric assay; bars, FSE.

Hsp70 has also been reported to bind AIF and abrogate the in the promoter region of hsp70, leading to the transcriptional execution of the non–caspase-dependent nuclear DNA fragmenta- activation of hsp70 (9, 23). This is assisted by HSF-2, which keeps tion triggered by the release of AIF from the mitochondria (18, 19). the promoter region of hsp70 uncompacted, a phenomenon Additionally, hsp70 has been shown to promote cell survival by known as bookmarking (42). Notwithstanding hsp70 induction, inhibiting lysosomal membrane permeabilization (40). Conversely, 17-AAG-mediated Bax confirmation change, coupled with 17-AAG- attenuation of hsp70 levels has been shown to sensitize human mediated attenuation of AKT and c-Raf, triggers the mitochondrial leukemia cells to conventional and novel antileukemia agents pathway of apoptosis (43). Present studies show for the first time (e.g., etoposide, ara-C, and tumor necrosis factor [TNF]–related that the abrogation of hsp70 induction in human leukemia cells by apoptosis-inducing ligand; ref. 7). In addition, a lack of hsp70 a variety of maneuvers (e.g., siRNA to hsp70), ectopic expression of expression is known to confer increased radiosensitivity (41). the cDNA of hsp70 in the reverse orientation or treatment with 17-AAG binds to the ATP-binding pocket of hsp90 and inhibits its KNK437, sensitizes human leukemia cells to 17-AAG-induced Bax ATPase activity and chaperone function for hsp90 client proteins conformation change and apoptosis. Conversely, ectopic or high (1, 2). 17-AAG also disrupts the association of hsp90 with HSF-1, endogenous expression of hsp70 inhibits 17-AAG-induced Bax which promotes its nuclear localization and binding to the HSEs conformation change, mitochondrial localization, and apoptosis, www.aacrjournals.org 10541 Cancer Res 2005; 65: (22). November 15, 2005

Downloaded from cancerres.aacrjournals.org on September 29, 2021. © 2005 American Association for Cancer Research. Cancer Research without affecting 17-AAG-mediated hsp90 inhibition and attenu- mediated apoptosis in human leukemia cells through multiple ation of the levels of the progrowth and prosurvival proteins AKT mechanisms. They also show that attenuating hsp70 induction and c-Raf. and targeting these mechanisms could potentially amplify the Recent reports have shown that TNF-a-mediated activation of antileukemia activity of 17-AAG. c-Jun NH2-terminal kinase (JNK) induces caspase-8-independent Presumably because in tumor cells hsp90 is more ATP bound cleavage of Bid into jBid at a distinct site, which results in the and complexed with its cochaperones and client proteins on translocation of jBid to the mitochondria with the selective release which the tumor cells are dependent for their growth and survival, of Smac form the mitochondria into the cytosol (44). Although 17-AAG has been recently shown to have a greater affinity for hsp90 overexpression of hsp70 inhibits JNK activation and Bid cleavage, from tumor versus normal cells (50). Because of a greater depen- JNK inhibition was shown to be insufficient for the antiapoptotic dency on the progrowth and prosurvival signaling mediated by function of hsp70 (45–47). Apoptosis signal-regulating kinase1 the hsp90 client proteins Bcr-Abl, FLT-3, c-Kit, AKT, and c-Raf, the (ASK1) is a serine/threonine kinase, which functions in apoptosis leukemia progenitors may also be more vulnerable to the effects induced by TNF-a and agonistic antibody to Fas (48). Hsp70 was mediated by hsp90 inhibitors through the attenuation of the hsp90 also shown to inhibit the homo-oligomerization of ASK1 and ASK1- client proteins, which could be another basis for the relatively dependent apoptosis (49). Conversely, antisense oligonucleotides selective preclinical antitumor activity of hsp90 inhibitors. 17-AAG to hsp70 were shown to derepress JNK- and ASK1-induced apo- is currently being evaluated in phase I and II clinical trials admin- ptosis (46, 49). However, the role of JNK and ASK1 in regulating istered alone or in combination with other anticancer agents 17-AAG-induced apoptosis is not known. Ectopic overexpression (51, 52). It is clearly important to design combinations in which or high endogenous levels of hsp70 were also recently shown to the sequence of administration of 17-AAG with the other agents up-regulate signal transducers and activators of transcription 5 (e.g., etoposide and ara-C) is optimal and the combination exerts (STAT5) and the antiapoptosis genes transactivated by it (e.g., potent antileukemia effects. Indeed, our findings show that pre- Bcl-xL and Pim-2), thereby conferring resistance to apoptosis treatment with 17-AAG induces hsp70, which inhibits apoptosis induced by antileukemia agents (7). Conversely, the dominant- due to etoposide and ara-C. The reversed sequence of administra- negative STAT5 sensitized these cells, albeit not completely, to tion of etoposide or ara-C followed by 17-AAG induces more apoptosis induced by the antileukemia agents (7). These reports apoptosis than either agent alone or 17-AAG followed by etoposide. further highlight how induction of hsp70 could attenuate 17-AAG- It is possible that, when administered after etoposide or ara-C,

Figure 7. Pretreatment with KNK437 down-regulates hsp70 levels and sensitizes HL-60 cells to 17-AAG-induced apoptosis. A, cells were treated with KNK437 at the indicated concentrations for 1 hour followed by 17-AAG plus KNK437 for 24 hours. Hsp70 levels were detected by Western blot analysis. h-Actin levels were used as a loading control. B, cells were treated with KNK437 at indicated concentrations for 1 hour followed by 17-AAG plus KNK437 for 72 hours. Following these treatments, the percentage of apoptotic cells was determined by Annexin V staining and flow cytometry. Columns, mean of three experiments; bars, FSE. C, cells were treated with KNK437 at the indicated concentrations for 1 hour followed by 17-AAG plus KNK437 for 72 hours. Following these treatments, colony culture growth in the methyl cellulose medium was determined. Columns, percentage of control colony growth, following exposure to each of the culture conditions (bottom); bars, FSE.

Cancer Res 2005; 65: (22). November 15, 2005 10542 www.aacrjournals.org

17-AAG lowers the threshold of apoptosis due to attenuation of the survival due to treatment with 17-AAG. It is obviously important to prosurvival AKT and c-Raf, thereby enhancing the apoptotic effects develop more specific and potent inhibitors of hsp70 induction, of etoposide and ara-C. Similar to 17-AAG, the other analogues which could potentially increase the sensitivity of tumor cells to of geldanamycin (e.g., 17-DMAG and IPI504), or radicicol, inhibit 17-AAG and the other hsp90 inhibitors. One avenue would be to ATP binding and ATPase activity of hsp90, thereby inhibiting the inhibit the serine phosphorylation of monomeric HSF-1, which chaperone function of hsp90 (1, 2, 53–55). These hsp90 inhibitors may affect its nuclear localization, oligomerization, and/or trans- induce hsp70 levels (1, 2). Recently, treatment with the hydroxamic activation of the heat shock proteins (8, 9, 22, 23). Under phy- acid analogue histone deacetylase inhibitors has been shown to siologic and stress conditions, multiple protein kinases are likely induce acetylation of hsp90 and inhibit its chaperone function to be involved in phosphorylating HSF-1 (8, 9, 22, 23). Among these, (28, 34). They also induce the intracellular levels of hsp70. There- JNK and Plk1 activities may be relevant (59, 60). Therefore, inhib- fore, it is conceivable that strategies that would lead to the itors of these kinases may undermine HSF-1-mediated transcrip- abrogation of hsp70 induction would further increase the tional activation of hsp70. Parenthetically, we recently reported antileukemia efficacy of all of these hsp90 inhibitors. Consistent that the endogenous or ectopic expression of Bcr-Abl in human with this, in a recent report through a cell-based screen, it has been leukemia cells leads to increased mRNA and protein levels of possible to identify hsp90 inhibitors that are more effective as hsp70, and inhibition of Bcr-Abl tyrosine kinase activity with antitumor agents, because they inhibit the chaperone function of imatinib resulted in attenuation of p-HSF and hsp70 levels. How- hsp90 without inducing the levels of hsp70 (56). ever, a direct mechanistic link between Bcr-Abl and the down- Unlike hsp90, thus far, inhibitors of the ATP binding pocket of stream phosphatidylinositol 3-kinase/AKT to the phosphorylation hsp70 have not been developed. However, inhibitors of the of HSF-1 and induction of hsp70 in Bcr-Abl-expressing acute transcriptional activation of hsp70 have been reported (24, 57). leukemia cells remains to be established. Collectively, whether it is Although it is a weak inhibitor, KNK437 partially down-regulates through inhibition of HSF-1 phosphorylation or through attenua- the transcriptional activation and induction of hsp70 (24, 25). tion of the transcriptional activation of hsp70, these hsp70-targeted However, the effect of KNK437 on HSF-1 phosphorylation, nuclear strategies are likely to enhance the antileukemia effects of hsp90 localization, HSE-binding, and hsp70 induction had not been inhibitors, especially where the mutant versions of the client comprehensively reported. Our present studies show that KNK437 proteins (e.g., Bcr-Abl, FLT-3, and c-Kit) are responsible for the attenuates heat shock– or 17-AAG-induced hsp70 through HSEs, phenotype of the leukemia (2, 61, 62). without affecting the phosphorylation and nuclear localization of HSF-1. In our studies, why heat shock is more potent than 17-AAG Acknowledgments in inducing hsp70 may possibly be due to the distinct stimulus- specific histone modifications at the hsp70 chromatin targeted by Received 5/26/2005; revised 8/15/2005; accepted 8/26/2005. The costs of publication of this article were defrayed in part by the payment of page HSF-1 (58). However, clearly, cotreatment with KNK437 partially charges. This article must therefore be hereby marked advertisement in accordance sensitizes leukemia cells to apoptosis and loss of clonogenic with 18 U.S.C. Section 1734 solely to indicate this fact.

References 10. RohdeM,DaugaardM,JensenMH,HelinK, is independent of caspases and bypasses Bcl-2. Proc Natl Nylandsted J, Jaattela M. Members of the heat-shock Acad Sci U S A 2000;97:7871–6. 1. Isaacs JS, Xu W, Neckers L. Heat shock protein 90 as a protein 70 family promote cancer cell growth by distinct 21. Nylandsted J, Wick W, Hirt UA, et al. Eradication of molecular target for cancer therapeutics. Cancer Cell mechanisms. Genes Dev 2005;19:570–82. glioblastoma, and breast and colon carcinoma xeno- 2003;3:213–7. 11. Volloch VZ, Sherman MY. Oncogenic potential of grafts by Hsp70 depletion. Cancer Res 2002;62:7139–42. 2. Bagatell R, Whitesell L. Altered Hsp90 function in Hsp72. Oncogene 1999;18:3648–51. 22. Zou J, Guo Y, Guettouche T, Smith DF, Voellmy R. cancer: a unique therapeutic opportunity. Mol Cancer 12. Seo JS, Park YM, Kim JI, et al. T cell lymphoma in Repression of heat shock transcription factor HSF1 Ther 2004;3:1021–30. transgenic mice expressing the human Hsp70 gene. activation by HSP90 (HSP90 complex) that forms a 3. Prodromou C, Roe SM, O’Brien R, Ladbury JE, Piper Biochem Biophys Res Commun 1996;218:582–7. stress-sensitive complex with HSF1. Cell 1998;94:471–80. PW, Pearl LH. Identification and structural character- 13. Beere HM. ‘‘The stress of dying’’: the role of heat 23. Morimoto RI. Regulation of the heat shock tran- ization of the ATP/ADP-binding site in the Hsp90 shock proteins in the regulation of apoptosis. J Cell Sci scriptional response: cross talk between a family of heat molecular chaperone. Cell 1997;90:65–75. 2004;117:2641–51. shock factors, molecular chaperones, and negative 4. Riggs D, Cox M, Cheung-Flynn J, Prapapanich V, 14. Takayama S, Reed JC, Homma S. Heat-shock proteins regulators. Genes Dev 1998;12:3788–96. Carrigan P, Smith D. Functional specificity of co- as regulators of apoptosis. Oncogene 2003;22:9041–7. 24. Yokota S, Kitahara M, Nagata K. Benzylidene lactam chaperone interactions with Hsp90 client proteins. 15. Saleh A, Srinivasula SM, Balkir L, Robbins PD, compound, KNK437, a novel inhibitor of acquisition of Crit Rev Biochem Mol Biol 2004;39:279–95. Alnemri ES. Negative regulation of the Apaf-1 apopto- thermotolerance and heat shock protein induction in 5. Neckers L. Development of small molecule Hsp90 some by Hsp70. Nat Cell Biol 2000;2:476–83. human colon carcinoma cells. Cancer Res 2000;60:2942–8. inhibitors: utilizing both forward and reverse chemical 16. Beere HM, Wolf BB, Cain K, et al. Heat-shock protein 25. Koishi M, Yokota S, Mae T, et al. The effects of genomics for drug identification. Curr Med Chem 2003; 70 inhibits apoptosis by preventing recruitment of KNK437, a novel inhibitor of heat shock protein 10:733–9. procaspase-9 to the Apaf-1 apoptosome. Nat Cell Biol synthesis, on the acquisition of thermotolerance in a 6. Pratt WB, Toft DO. Regulation of signaling pro- 2000;2:469–75. murine transplantable tumor in vivo. Clin Cancer Res tein function and trafficking by the hsp90/hsp70- 17. Jaattela M, Wissing D, Kokholm K, Kallunki T, 2001;7:215–9. based chaperone machinery. Exp Biol Med 2003;228: Egeblad M. Hsp70 exerts its anti-apoptotic function 26. Bagatell R, Paine-Murrieta GD, Taylor CW, et al. 111–33. downstream of caspase-3-like proteases. EMBO J 1998; Induction of a heat shock factor 1-dependent stress 7. Guo F, Sigua C, Bali P, et al. Mechanistic role of heat 17:6124–34. response alters the cytotoxic activity of hsp90-binding shock protein 70 in Bcr-Abl-mediated resistance to 18. Ravagnan L, Gurbuxani S, Susin SA, et al. Heat-shock agents. Clin Cancer Res 2000;6:3312–8. apoptosis in human acute leukemia cells. Blood 2005; protein 70 antagonizes apoptosis-inducing factor. Nat 27. Nimmanapalli R, O’Bryan E, Huang M, et al. 105:1246–55. Cell Biol 2001;3:839–43. Molecular characterization and sensitivity of STI-571 8. Jolly C, Morimoto RI. Role of the heat shock response 19. Gurbuxani S, Schmitt E, Cande C, et al. Heat shock (imatinib mesylate, Gleevec)-resistant, Bcr-Abl-positive, and molecular chaperones in oncogenesis and cell protein 70 binding inhibits the nuclear import of human acute leukemia cells to SRC kinase inhibitor death. J Natl Cancer Inst 2000;92:1564–72. apoptosis-inducing factor. Oncogene 2003;22:6669–78. PD180970 and 17-allylamino-17-demethoxygeldanamy- 9. Creagh EM, Sheehan D, Cotter TG. Heat shock 20. Nylandsted J, Rohde M, Brand K, Bastholm L, Elling F, cin. Cancer Res 2002;62:5761–9. proteins: modulators of apoptosis in tumour cells. Jaattela M. Selective depletion of heat shock protein 70 28. Nimmanapalli R, Fuino L, Bali P, et al. Histone Leukemia 2000;14:1161–73. (Hsp70) activates a tumor-specific death program that deacetylase inhibitor LAQ824 both lowers expression www.aacrjournals.org 10543 Cancer Res 2005; 65: (22). November 15, 2005

and promotes proteasomal degradation of Bcr-Abl and CHOP-induced apoptosis by inhibiting translocation 52. Goetz MP, Toft D, Reid J, et al. Phase I trial of induces apoptosis of imatinib mesylate-sensitive or- of Bax to mitochondria. Cell Death Differ 2004;11: 17-allylamino-17-demethoxygeldanamycin in patients refractory chronic myelogenous leukemia-blast crisis 390–402. with advanced cancer. J Clin Oncol 2005;23:1078–87. cells. Cancer Res 2003;63:5126–35. 40. Nylandsted J, Gyrd-Hansen M, Danielewicz A, et al. 53. Sydor JR, Pien CS, Zhange Y, et al. Anti-tumor activity 29. Fang G, Kim C, Perkins C, et al. CGP57148 (STI-571) Heat shock protein 70 promotes cell survival by of a novel, water soluble Hsp90 inhibitor IPI-504 in induces differentiation and apoptosis and sensitizes inhibiting lysosomal membrane permeabilization. multiple myeloma [abstract]. Proc Am Assoc Cancer Res Bcr-Abl positive human leukemia cells to apoptosis due J Exp Med 2004;200:425–35. 2005;45:6160. to antileukemic drugs. Blood 2000;96:2246–56. 41. Hunt CR, Dix DJ, Sharma GG, et al. Genomic 54. Hollingshead M, Alley M, Burger AM, et al. In vivo 30. Mosser DD, Caron AW, Bourget L, et al. The instability and enhanced radiosensitivity in Hsp70.1- antitumor efficacy of 17-DMAG (17-dimethylaminoethy- chaperone function of hsp70 is required for protection and Hsp70.3-deficient mice. Mol Cell Biol 2004;24: lamino-17-demethoxygeldanamycin hydrochloride), a against stress-induced apoptosis. Mol Cell Biol 2000;20: 899–911. water-soluble geldanamycin derivative. Cancer Chemo- 7146–59. 42. Xing H, Wilkerson DC, Mayhew CN, et al. Mechanism ther Pharmacol 2005;56:115–25. 31. Guo F, Sigua C, Tao J, et al. Cotreatment with histone of hsp70i gene bookmarking. Science 2005;307:421–3. 55. Soga S, Shiotsu Y, Akinaga S, Sharma SV. Develop- deacetylase inhibitor LAQ824 enhances Apo-2L/tumor 43. Nimmanapalli R, O’Bryan E, Kuhn D, Yamaguchi H, ment of radicicol analogues. Curr Cancer Drug Targets necrosis factor-related apoptosis inducing ligand- Wang H-G, Bhalla K. Regulation of 17-AAG-induced 2003;3:359–69. induced death inducing signaling complex activity and apoptosis: role of Bcl-2, Bcl-xL, and Bax downstream of 56. Zhang H, Yang Y-C, Le D, Tsurumoto S, Win V, apoptosis of human acute leukemia cells. Cancer Res 17-AAG-mediated down-regulation of Akt, Raf-1, and Burrows F. The two faces of Hsp90: dissecting the 2004;64:2580–9. Src kinases. Blood 2003;102:269–75. cytotoxic and cytoprotective responses with selective 32. Wittmann S, Bali P, Donapaty S, et al. Flavopiridol 44. Deng Y, Ren X, Yang L, Lin Y, Wu X. A JNK-dependent Hsp90 modulators [abstract]. Proc Am Assoc Cancer downregulates antiapoptotic proteins and sensitizes pathway is required for TNFa-induced apoptosis. Cell Res 2005;46:1527. human breast cancer cells to epothilone B-induced 2003;115:61–70. 57. Hosokawa N, Hirayoshi K, Kudo H, et al. apoptosis. Cancer Res 2003;63:93–9. 45. Gabai VL, Mabuchi K, Mosser DD, Sherman MY. Inhibition of the activation of heat shock factor 33. Yamaguchi H, Bhalla K, Wang HG. Bax plays a pivotal Hsp72 and stress kinase c-jun N-terminal kinase in vivo and in vitro by flavonoids. Mol Cell Biol 1992; role in thapsigargin-induced apoptosis of human colon regulate the bid-dependent pathway in tumor necro- 12:3490–8. cancer cells by controlling Smac/Diablo and Omi/HtrA2 sis factor-induced apoptosis. Mol Cell Biol 2002;22: 58. Thomson S, Hollis A, Hazzalin CA, Mahadevan LC. release from mitochondria. Cancer Res 2003;63:1483–9. 3415–24. Distinct stimulus-specific histone modifications at 34. Fuino L, Bali P, Wittmann S, et al. Histone deacetylase 46. Park HS, Lee JS, Huh SH, Seo JS, Choi EJ. Hsp72 hsp70 chromatin targeted by the transcription factor inhibitor LAQ824 down-regulates Her-2 and sensitizes functions as a natural inhibitory protein of c-Jun N- heat shock factor-1. Mol Cell 2004;15:585–94. human breast cancer cells to trastuzumab, taxotere, terminal kinase. EMBO J 2001;20:446–56. 59. Dai R, Frejtag W, He B, Zhang Y, Mivechi NF. c-Jun gemcitabine, and epothilone B. Mol Cancer Ther 2003;2: 47. Mosser DD, Caron AW, Bourget L, et al. The NH2-terminal kinase targeting and phosphorylation of 971–84. chaperone function of hsp70 is required for protection heat shock factor-1 suppress its transcriptional activity. 35. Xu W, Yuan X, Jung YJ, et al. The heat shock protein against stress-induced apoptosis. Mol Cell Biol 2000;20: J Biol Chem 2000;275:18210–8. 90 inhibitor geldanamycin and the ErbB inhibitor 7146–59. 60. Kim SA, Yoon JH, Lee SH, Ahn SG. Polo-like kinase 1 ZD1839 promote rapid PP1 phosphatase-dependent 48. Hatai T, Matsuzawa A, Inoshita S, et al. Execution of phosphorylates heat shock transcription factor 1 and inactivation of AKT in ErbB2 overexpressing breast apoptosis signal-regulating kinase 1 (ASK1)-induced mediates its nuclear translocation during heat stress. cancer cells. Cancer Res 2003;63:7777–84. apoptosis by the mitochondria-dependent caspase J Biol Chem 2005;280:12653–7. 36. Cory S, Huang DC, Adams J. The Bcl-2 family: roles in activation. J Biol Chem 2000;275:26576–81. 61. George P, Bali P, Cohen P, et al. Co-treatment with 17- cell survival and oncogenesis. Oncogene 2003;22:8590–607. 49. Park HS, Cho SG, Kim CK, et al. Heat shock protein allylamino-demethoxygeldanamycin (17-AAG) and FLT- 37. Yamaguchi H, Paranawithana S, Lee M, Huang Z, hsp72 is a negative regulator of apoptosis signal- 3 kinase inhibitor PKC412 is highly effective against Bhalla K, Wang HG. Epothilone B analogue (BMS247550)- regulating kinase 1. Mol Cell Biol 2002;22:7721–30. human AML cells with mutant FLT-3. Cancer Res 2004; mediated cytotoxicity through induction of Bax confor- 50. Kamal A, Thao L, Sensintaffar J, et al. A high-affinity 64:3645–52. mational change in human breast cancer cells. Cancer Res conformation of Hsp90 confers tumour selectivity on 62. Gorre ME, Ellwood-Yen K, Chiosis G, Rosen N, 2002;62:466–71. Hsp90 inhibitors. Nature 2003;425:407–10. Sawyers CL. BCR-ABL point mutants isolated from 38. Wang X. The expanding role of mitochondria in 51. Grem JL, Morrison G, Guo XD, et al. Phase I and patients with imatinib mesylate-resistant chronic mye- apoptosis. Genes Dev 2001;15:2922–33. pharmacologic study of 17-(allylamino)-17-demethoxy- loid leukemia remain sensitive to inhibitors of the BCR- 39. Gotoh T, Terada K, Oyadomari S, Mori M. hsp70- geldanamycin in adult patients with solid tumors. J Clin ABL chaperone heat shock protein 90. Blood 2002;100: DnaJ chaperone pair prevents nitric oxide- and Oncol 2005;23:1885–93. 3041–4.

Cancer Res 2005; 65: (22). November 15, 2005 10544 www.aacrjournals.org

Downloaded from cancerres.aacrjournals.org on September 29, 2021. © 2005 American Association for Cancer Research. Abrogation of Heat Shock Protein 70 Induction as a Strategy to Increase Antileukemia Activity of Heat Shock Protein 90 Inhibitor 17-Allylamino-Demethoxy Geldanamycin

Fei Guo, Kathy Rocha, Purva Bali, et al.

Cancer Res 2005;65:10536-10544.

Updated version Access the most recent version of this article at: http://cancerres.aacrjournals.org/content/65/22/10536

Cited articles This article cites 61 articles, 37 of which you can access for free at: http://cancerres.aacrjournals.org/content/65/22/10536.full#ref-list-1

Citing articles This article has been cited by 44 HighWire-hosted articles. Access the articles at: http://cancerres.aacrjournals.org/content/65/22/10536.full#related-urls

E-mail alerts Sign up to receive free email-alerts related to this article or journal.

Reprints and To order reprints of this article or to subscribe to the journal, contact the AACR Publications Subscriptions Department at [email protected].

Permissions To request permission to re-use all or part of this article, use this link http://cancerres.aacrjournals.org/content/65/22/10536. Click on "Request Permissions" which will take you to the Copyright Clearance Center's (CCC) Rightslink site.