The Biological Object Notation (BON): a Structured Fle Format for Biological Data Received: 19 January 2018 Jan P
Total Page:16
File Type:pdf, Size:1020Kb
Load more
Recommended publications
-
De Novo Genomic Analyses for Non-Model Organisms: an Evaluation of Methods Across a Multi-Species Data Set
De novo genomic analyses for non-model organisms: an evaluation of methods across a multi-species data set Sonal Singhal [email protected] Museum of Vertebrate Zoology University of California, Berkeley 3101 Valley Life Sciences Building Berkeley, California 94720-3160 Department of Integrative Biology University of California, Berkeley 1005 Valley Life Sciences Building Berkeley, California 94720-3140 June 5, 2018 Abstract High-throughput sequencing (HTS) is revolutionizing biological research by enabling sci- entists to quickly and cheaply query variation at a genomic scale. Despite the increasing ease of obtaining such data, using these data effectively still poses notable challenges, especially for those working with organisms without a high-quality reference genome. For every stage of analysis – from assembly to annotation to variant discovery – researchers have to distinguish technical artifacts from the biological realities of their data before they can make inference. In this work, I explore these challenges by generating a large de novo comparative transcriptomic dataset data for a clade of lizards and constructing a pipeline to analyze these data. Then, using a combination of novel metrics and an externally validated variant data set, I test the efficacy of my approach, identify areas of improvement, and propose ways to minimize these errors. I arXiv:1211.1737v1 [q-bio.GN] 8 Nov 2012 find that with careful data curation, HTS can be a powerful tool for generating genomic data for non-model organisms. Keywords: de novo assembly, transcriptomes, suture zones, variant discovery, annotation Running Title: De novo genomic analyses for non-model organisms 1 Introduction High-throughput sequencing (HTS) is poised to revolutionize the field of evolutionary genetics by enabling researchers to assay thousands of loci for organisms across the tree of life. -
MATCH-G Program
MATCH-G Program The MATCH-G toolset MATCH-G (Mutational Analysis Toolset Comparing wHole Genomes) Download the Toolset The toolset is prepared for use with pombe genomes and a sample genome from Sanger is included. However, it is written in such a way as to allow it to utilize any set or number of chromosomes. Simply follow the naming convention "chromosomeX.contig.embl" where X=1,2,3 etc. For use in terminal windows in Mac OSX or Unix-like environments where Perl is present by default. Toolset Description Version History 2.0 – Bug fixes related to scaling to other genomes. First version of GUI interface. 1.0 – Initial Release. Includes build, alignment, snp, copy, and gap resolution routines in original form. Please note this project in under development and will undergo significant changes. Project Description The MATCH-G toolset has been developed to facilitate the evaluation of whole genome sequencing data from yeasts. Currently, the toolset is written for pombe strains, however the toolset is easily scalable to other yeasts or other sequenced genomes. The included tools assist in the identification of SNP mutations, short (and long) insertion/deletions, and changes in gene/region copy number between a parent strain and mutant or revertant strain. Currently, the toolset is run from the command line in a unix or similar terminal and requires a few additional programs to run noted below. Installation It is suggested that a separate folder be generated for the toolset and generated files. Free disk space proportional to the original read datasets is recommended. The toolset utilizes and requires a few additional free programs: Bowtie rapid alignment software: http://bowtie-bio.sourceforge.net/index.shtml (Langmead B, Trapnell C, Pop M, Salzberg SL. -
Treebase: an R Package for Discovery, Access and Manipulation of Online Phylogenies
Methods in Ecology and Evolution 2012, 3, 1060–1066 doi: 10.1111/j.2041-210X.2012.00247.x APPLICATION Treebase: an R package for discovery, access and manipulation of online phylogenies Carl Boettiger1* and Duncan Temple Lang2 1Center for Population Biology, University of California, Davis, CA,95616,USA; and 2Department of Statistics, University of California, Davis, CA,95616,USA Summary 1. The TreeBASE portal is an important and rapidly growing repository of phylogenetic data. The R statistical environment has also become a primary tool for applied phylogenetic analyses across a range of questions, from comparative evolution to community ecology to conservation planning. 2. We have developed treebase, an open-source software package (freely available from http://cran.r-project. org/web/packages/treebase) for the R programming environment, providing simplified, programmatic and inter- active access to phylogenetic data in the TreeBASE repository. 3. We illustrate how this package creates a bridge between the TreeBASE repository and the rapidly growing collection of R packages for phylogenetics that can reduce barriers to discovery and integration across phyloge- netic research. 4. We show how the treebase package can be used to facilitate replication of previous studies and testing of methods and hypotheses across a large sample of phylogenies, which may help make such important reproduc- ibility practices more common. Key-words: application programming interface, database, programmatic, R, software, TreeBASE, workflow include, but are not limited to, ancestral state reconstruction Introduction (Paradis 2004; Butler & King 2004), diversification analysis Applications that use phylogenetic information as part of their (Paradis 2004; Rabosky 2006; Harmon et al. -
Large Scale Genomic Rearrangements in Selected Arabidopsis Thaliana T
bioRxiv preprint doi: https://doi.org/10.1101/2021.03.03.433755; this version posted March 7, 2021. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made available under aCC-BY 4.0 International license. 1 Large scale genomic rearrangements in selected 2 Arabidopsis thaliana T-DNA lines are caused by T-DNA 3 insertion mutagenesis 4 5 Boas Pucker1,2+, Nils Kleinbölting3+, and Bernd Weisshaar1* 6 1 Genetics and Genomics of Plants, Center for Biotechnology (CeBiTec), Bielefeld University, 7 Sequenz 1, 33615 Bielefeld, Germany 8 2 Evolution and Diversity, Department of Plant Sciences, University of Cambridge, Cambridge, 9 United Kingdom 10 3 Bioinformatics Resource Facility, Center for Biotechnology (CeBiTec, Bielefeld University, 11 Sequenz 1, 33615 Bielefeld, Germany 12 + authors contributed equally 13 * corresponding author: Bernd Weisshaar 14 15 BP: [email protected], ORCID: 0000-0002-3321-7471 16 NK: [email protected], ORCID: 0000-0001-9124-5203 17 BW: [email protected], ORCID: 0000-0002-7635-3473 18 19 20 21 22 23 24 25 26 27 28 29 30 page 1 bioRxiv preprint doi: https://doi.org/10.1101/2021.03.03.433755; this version posted March 7, 2021. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made available under aCC-BY 4.0 International license. -
An Open-Sourced Bioinformatic Pipeline for the Processing of Next-Generation Sequencing Derived Nucleotide Reads
bioRxiv preprint doi: https://doi.org/10.1101/2020.04.20.050369; this version posted May 28, 2020. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made available under aCC-BY 4.0 International license. An open-sourced bioinformatic pipeline for the processing of Next-Generation Sequencing derived nucleotide reads: Identification and authentication of ancient metagenomic DNA Thomas C. Collin1, *, Konstantina Drosou2, 3, Jeremiah Daniel O’Riordan4, Tengiz Meshveliani5, Ron Pinhasi6, and Robin N. M. Feeney1 1School of Medicine, University College Dublin, Ireland 2Division of Cell Matrix Biology Regenerative Medicine, University of Manchester, United Kingdom 3Manchester Institute of Biotechnology, School of Earth and Environmental Sciences, University of Manchester, United Kingdom [email protected] 5Institute of Paleobiology and Paleoanthropology, National Museum of Georgia, Tbilisi, Georgia 6Department of Evolutionary Anthropology, University of Vienna, Austria *Corresponding Author Abstract The emerging field of ancient metagenomics adds to these Bioinformatic pipelines optimised for the processing and as- processing complexities with the need for additional steps sessment of metagenomic ancient DNA (aDNA) are needed in the separation and authentication of ancient sequences from modern sequences. Currently, there are few pipelines for studies that do not make use of high yielding DNA cap- available for the analysis of ancient metagenomic DNA ture techniques. These bioinformatic pipelines are tradition- 1 4 ally optimised for broad aDNA purposes, are contingent on (aDNA) ≠ The limited number of bioinformatic pipelines selection biases and are associated with high costs. -
Sequence Alignment/Map Format Specification
Sequence Alignment/Map Format Specification The SAM/BAM Format Specification Working Group 3 Jun 2021 The master version of this document can be found at https://github.com/samtools/hts-specs. This printing is version 53752fa from that repository, last modified on the date shown above. 1 The SAM Format Specification SAM stands for Sequence Alignment/Map format. It is a TAB-delimited text format consisting of a header section, which is optional, and an alignment section. If present, the header must be prior to the alignments. Header lines start with `@', while alignment lines do not. Each alignment line has 11 mandatory fields for essential alignment information such as mapping position, and variable number of optional fields for flexible or aligner specific information. This specification is for version 1.6 of the SAM and BAM formats. Each SAM and BAMfilemay optionally specify the version being used via the @HD VN tag. For full version history see Appendix B. Unless explicitly specified elsewhere, all fields are encoded using 7-bit US-ASCII 1 in using the POSIX / C locale. Regular expressions listed use the POSIX / IEEE Std 1003.1 extended syntax. 1.1 An example Suppose we have the following alignment with bases in lowercase clipped from the alignment. Read r001/1 and r001/2 constitute a read pair; r003 is a chimeric read; r004 represents a split alignment. Coor 12345678901234 5678901234567890123456789012345 ref AGCATGTTAGATAA**GATAGCTGTGCTAGTAGGCAGTCAGCGCCAT +r001/1 TTAGATAAAGGATA*CTG +r002 aaaAGATAA*GGATA +r003 gcctaAGCTAA +r004 ATAGCT..............TCAGC -r003 ttagctTAGGC -r001/2 CAGCGGCAT The corresponding SAM format is:2 1Charset ANSI X3.4-1968 as defined in RFC1345. -
Ade4: Analysis of Ecological Data: Exploratory and Euclidean Methods
Package ‘ade4’ September 16, 2021 Version 1.7-18 Title Analysis of Ecological Data: Exploratory and Euclidean Methods in Environmental Sciences Author Stéphane Dray <[email protected]>, Anne-Béatrice Du- four <[email protected]>, and Jean Thioulouse <[email protected]>, with con- tributions from Thibaut Jombart, Sandrine Pavoine, Jean R. Lobry, Sébastien Ollier, Daniel Bor- card, Pierre Legendre, Stéphanie Bougeard and Aurélie Siberchicot. Based on ear- lier work by Daniel Chessel. Maintainer Aurélie Siberchicot <[email protected]> Depends R (>= 2.10) Imports graphics, grDevices, methods, stats, utils, MASS, pixmap, sp Suggests ade4TkGUI, adegraphics, adephylo, ape, CircStats, deldir, lattice, spdep, splancs, waveslim, progress, foreach, parallel, doParallel, iterators Description Tools for multivariate data analysis. Several methods are provided for the analy- sis (i.e., ordination) of one-table (e.g., principal component analysis, correspondence analy- sis), two-table (e.g., coinertia analysis, redundancy analysis), three-table (e.g., RLQ analy- sis) and K-table (e.g., STATIS, multiple coinertia analysis). The philosophy of the package is de- scribed in Dray and Dufour (2007) <doi:10.18637/jss.v022.i04>. License GPL (>= 2) URL http://pbil.univ-lyon1.fr/ADE-4/ BugReports https://github.com/sdray/ade4/issues Encoding UTF-8 NeedsCompilation yes Repository CRAN Date/Publication 2021-09-16 11:30:02 UTC R topics documented: ade4-package . .8 1 2 R topics documented: abouheif.eg . .8 acacia . .9 add.scatter . 10 aminoacyl . 13 amova............................................ 14 apis108 . 15 apqe............................................. 16 aravo............................................. 17 ardeche . 18 area.plot . 19 arrival............................................ 21 as.taxo . 22 atlas . -
HMMER User's Guide
HMMER User’s Guide Biological sequence analysis using profile hidden Markov models http://hmmer.org/ Version 3.0rc1; February 2010 Sean R. Eddy for the HMMER Development Team Janelia Farm Research Campus 19700 Helix Drive Ashburn VA 20147 USA http://eddylab.org/ Copyright (C) 2010 Howard Hughes Medical Institute. Permission is granted to make and distribute verbatim copies of this manual provided the copyright notice and this permission notice are retained on all copies. HMMER is licensed and freely distributed under the GNU General Public License version 3 (GPLv3). For a copy of the License, see http://www.gnu.org/licenses/. HMMER is a trademark of the Howard Hughes Medical Institute. 1 Contents 1 Introduction 5 How to avoid reading this manual . 5 How to avoid using this software (links to similar software) . 5 What profile HMMs are . 5 Applications of profile HMMs . 6 Design goals of HMMER3 . 7 What’s still missing in HMMER3 . 8 How to learn more about profile HMMs . 9 2 Installation 10 Quick installation instructions . 10 System requirements . 10 Multithreaded parallelization for multicores is the default . 11 MPI parallelization for clusters is optional . 11 Using build directories . 12 Makefile targets . 12 3 Tutorial 13 The programs in HMMER . 13 Files used in the tutorial . 13 Searching a sequence database with a single profile HMM . 14 Step 1: build a profile HMM with hmmbuild . 14 Step 2: search the sequence database with hmmsearch . 16 Searching a profile HMM database with a query sequence . 22 Step 1: create an HMM database flatfile . 22 Step 2: compress and index the flatfile with hmmpress . -
Validation and Annotation of Virus Sequence Submissions to Genbank Alejandro A
Schäffer et al. BMC Bioinformatics (2020) 21:211 https://doi.org/10.1186/s12859-020-3537-3 SOFTWARE Open Access VADR: validation and annotation of virus sequence submissions to GenBank Alejandro A. Schäffer1,2, Eneida L. Hatcher2, Linda Yankie2, Lara Shonkwiler2,3,J.RodneyBrister2, Ilene Karsch-Mizrachi2 and Eric P. Nawrocki2* *Correspondence: [email protected] Abstract 2National Center for Biotechnology Background: GenBank contains over 3 million viral sequences. The National Center Information, National Library of for Biotechnology Information (NCBI) previously made available a tool for validating Medicine, National Institutes of Health, Bethesda, MD, 20894 USA and annotating influenza virus sequences that is used to check submissions to Full list of author information is GenBank. Before this project, there was no analogous tool in use for non-influenza viral available at the end of the article sequence submissions. Results: We developed a system called VADR (Viral Annotation DefineR) that validates and annotates viral sequences in GenBank submissions. The annotation system is based on the analysis of the input nucleotide sequence using models built from curated RefSeqs. Hidden Markov models are used to classify sequences by determining the RefSeq they are most similar to, and feature annotation from the RefSeq is mapped based on a nucleotide alignment of the full sequence to a covariance model. Predicted proteins encoded by the sequence are validated with nucleotide-to-protein alignments using BLAST. The system identifies 43 types of “alerts” that (unlike the previous BLAST-based system) provide deterministic and rigorous feedback to researchers who submit sequences with unexpected characteristics. VADR has been integrated into GenBank’s submission processing pipeline allowing for viral submissions passing all tests to be accepted and annotated automatically, without the need for any human (GenBank indexer) intervention. -
Biocreative 2012 Proceedings
Proceedings of 2012 BioCreative Workshop April 4 -5, 2012 Washington, DC USA Editors: Cecilia Arighi Kevin Cohen Lynette Hirschman Martin Krallinger Zhiyong Lu Carolyn Mattingly Alfonso Valencia Thomas Wiegers John Wilbur Cathy Wu 2012 BioCreative Workshop Proceedings Table of Contents Preface…………………………………………………………………………………….......... iv Committees……………………………………………………………………………………... v Workshop Agenda…………………………………………………………………………….. vi Track 1 Collaborative Biocuration-Text Mining Development Task for Document Prioritization for Curation……………………………………..……………………………………………….. 2 T Wiegers, AP Davis, and CJ Mattingly System Description for the BioCreative 2012 Triage Task ………………………………... 20 S Kim, W Kim, CH Wei, Z Lu and WJ Wilbur Ranking of CTD articles and interactions using the OntoGene pipeline ……………..….. 25 F Rinaldi, S Clematide and S Hafner Selection of relevant articles for curation for the Comparative Toxicogenomic Database…………………………………………………………………………………………. 31 D Vishnyakova, E Pasche and P Ruch CoIN: a network exploration for document triage………………………………................... 39 YY Hsu and HY Kao DrTW: A Biomedical Term Weighting Method for Document Recommendation ………... 45 JH Ju, YD Chen and JH Chiang C2HI: a Complete CHemical Information decision system……………………………..….. 52 CH Ke, TLM Lee and JH Chiang Track 2 Overview of BioCreative Curation Workshop Track II: Curation Workflows….…………... 59 Z Lu and L Hirschman WormBase Literature Curation Workflow ……………………………………………………. 66 KV Auken, T Bieri, A Cabunoc, J Chan, Wj Chen, P Davis, A Duong, R Fang, C Grove, Tw Harris, K Howe, R Kishore, R Lee, Y Li, Hm Muller, C Nakamura, B Nash, P Ozersky, M Paulini, D Raciti, A Rangarajan, G Schindelman, Ma Tuli, D Wang, X Wang, G Williams, K Yook, J Hodgkin, M Berriman, R Durbin, P Kersey, J Spieth, L Stein and Pw Sternberg Literature curation workflow at The Arabidopsis Information Resource (TAIR)…..……… 72 D Li, R Muller, TZ Berardini and E Huala Summary of Curation Process for one component of the Mouse Genome Informatics Database Resource ………………………………………………………………………….... -
RNA Ontology Consortium January 8-9, 2011
UC San Diego UC San Diego Previously Published Works Title Meeting report of the RNA Ontology Consortium January 8-9, 2011. Permalink https://escholarship.org/uc/item/0kw6h252 Journal Standards in genomic sciences, 4(2) ISSN 1944-3277 Authors Birmingham, Amanda Clemente, Jose C Desai, Narayan et al. Publication Date 2011-04-01 DOI 10.4056/sigs.1724282 Peer reviewed eScholarship.org Powered by the California Digital Library University of California Standards in Genomic Sciences (2011) 4:252-256 DOI:10.4056/sigs.1724282 Meeting report of the RNA Ontology Consortium January 8-9, 2011 Amanda Birmingham1, Jose C. Clemente2, Narayan Desai3, Jack Gilbert3,4, Antonio Gonzalez2, Nikos Kyrpides5, Folker Meyer3,6, Eric Nawrocki7, Peter Sterk8, Jesse Stombaugh2, Zasha Weinberg9,10, Doug Wendel2, Neocles B. Leontis11, Craig Zirbel12, Rob Knight2,13, Alain Laederach14 1 Thermo Fisher Scientific, Lafayette, CO, USA 2 Department of Chemistry and Biochemistry, University of Colorado, Boulder, CO, USA 3 Argonne National Laboratory, Argonne, IL, USA 4 Department of Ecology and Evolution, University of Chicago, Chicago, IL, USA 5 DOE Joint Genome Institute, Walnut Creek, CA, USA 6 Computation Institute, University of Chicago, Chicago, IL, USA 7 Janelia Farm Research Campus, Howard Hughes Medical Institute, Ashburn, VA, USA 8 Wellcome Trust Sanger Institute, Wellcome Trust Genome Campus, Hinxton, Cambridge, UK 9 Department of Molecular, Cellular and Developmental, Yale University, New Haven, CT, USA 10 Howard Hughes Medical Institute, Yale University, New -
"Introduction to Inferring Evolutionary Relationships". In: Current
Introduction to Inferring Evolutionary UNIT 6.1 Relationships Much of bioinformatics is essentially comparative biology. Inferences based on compari- sons between entities such as motifs, sequences, genomes, and molecular structures are made. Given that living organisms and their constituent components have an evolutionary history, phylogeny properly lies at the heart of comparative biology (Harvey and Pagel, 1991). Increasingly, researchers in bioinformatics are realizing that phylogeny-based comparisons can yield important insights that can be missed using other techniques (Eisen, 1998; Rehmsmeier and Vingron, 2001). For example, a knowledge of phylogeny is vital in determining whether a set of sequences are orthologous or paralogous (Page and Charleston, 1997; Yuan et al., 1998; Storm and Sonnhammer, 2001; Zmasek and Eddy, 2001), which in turn has implications for predicting the function of a novel sequence (Eisen, 1998). Indeed, it is increasingly common for protein family databases to include gene phylogenies in addition to alignments. Examples include HOVERGEN (http://pbil.univ-lyon1.fr/databases/hovergen.html; Duret et al., 1994), SYSTERS (http://systers.molgen.mpg.de; Krause et al., 2000), and COPSE (http://copse.molgen. mpg.de). Phylogenetic analysis at the level of whole genomes poses new analytical challenges (Kim and Salisbury, 2001; Korbel et al., 2002; Wang et al., 2002), but promises new insights into genomic evolution. In some cases, the role of phylogeny might not be either obvious or explicit, so that many people may well have built phylogenetic trees without necessarily realizing it. The popular multiple sequence alignment program Clustal (UNIT 2.3) builds a phylogeny (the “guide tree”) every time it aligns sequences.