TFE3 Xp11.2 Translocation Renal Cell Carcinoma Mouse Model Reveals

Published OnlineFirst May 1, 2019; DOI: 10.1158/1541-7786.MCR-18-1235

Cancer Genes and Networks Molecular Cancer Research TFE3 Xp11.2 Translocation Renal Cell Carcinoma Mouse Model Reveals Novel Therapeutic Targets and Identiﬁes GPNMB as a Diagnostic Marker for Human Disease Masaya Baba1,2, Mitsuko Furuya3,Takanobu Motoshima4, Martin Lang2, Shintaro Funasaki1, Wenjuan Ma1, Hong-Wei Sun5, Hisashi Hasumi2,6, Ying Huang2, Ikuma Kato3, Tsuyoshi Kadomatsu7, Yorifumi Satou8, Nicole Morris9, Baktiar O. Karim10, Lilia Ileva11, Joseph D. Kalen11, Luh Ade Wilan Krisna1, Yukiko Hasumi2, Aiko Sugiyama12, Ryoma Kurahashi4,7, Koshiro Nishimoto13, Masafumi Oyama13, Yoji Nagashima14, Naoto Kuroda15, Kimi Araki16, Masatoshi Eto17, Masahiro Yao6, Tomomi Kamba4, Toshio Suda18,19, Yuichi Oike7, Laura S. Schmidt2,20, and W. Marston Linehan2

Abstract

Renal cell carcinoma (RCC) associated with Xp11.2 trans- Moreover, we found that Gpnmb (Glycoprotein nonmetastatic location (TFE3-RCC) has been recently defined as a distinct B) expression was notably elevated in the TFE3-RCC mouse subset of RCC classified by characteristic morphology and kidneys as seen in human TFE3-RCC tumors, and confirmed clinical presentation. The Xp11 translocations involve the that GPNMB is the direct transcriptional target of TFE3 fusions. TFE3 transcription factor and produce chimeric TFE3 proteins While GPNMB IHC staining was positive in 9/9 cases of TFE3- retaining the basic helix–loop–helix leucine zipper structure RCC, Cathepsin K, a conventional marker for TFE3-RCC, was for dimerization and DNA binding suggesting that chimeric positive in only 67% of cases. These data support RET as a TFE3 proteins function as oncogenic transcription factors. potential target and GPNMB as a diagnostic marker for TFE3- Diagnostic biomarkers and effective forms of therapy for RCC. The TFE3-RCC mouse provides a preclinical in vivo advanced cases of TFE3-RCC are as yet unavailable. To facil- model for the development of new biomarkers and targeted itate the development of molecular based diagnostic tools and therapeutics for patients affected with this aggressive form of targeted therapies for this aggressive kidney cancer, we gener- RCC. ated a translocation RCC mouse model, in which the PRCC- TFE3 transgene is expressed specifically in kidneys leading to Implications: Key findings from studies with this preclinical the development of RCC with characteristic histology. Expres- mouse model of TFE3-RCC underscore the potential for RET as sion of the receptor tyrosine kinase Ret was elevated in the a therapeutic target for treatment of patients with TFE3-RCC, kidneys of the TFE3-RCC mice, and treatment with RET and suggest that GPNMB may serve as diagnostic biomarker inhibitor, vandetanib, significantly suppressed RCC growth. for TFE3 fusion RCC.

1Laboratory of Cancer Metabolism, International Research Center for Medical Kyushyu University, Fukuoka, Japan. 18Laboratory of Stem Cell Regulation, Sciences (IRCMS), Kumamoto University, Kumamoto, Japan. 2Urologic Oncol- International Research Center for Medical Sciences (IRCMS), Kumamoto Uni- ogy Branch, Center for Cancer Research, National Cancer Institute, National versity, Kumamoto, Japan. 19Cancer Science Institute of Singapore, National Institutes of Health, Bethesda, Maryland. 3Department of Molecular Pathology, University of Singapore, Centre for Translational Medicine, Singapore. 20Basic Yokohama City University, Yokohama, Japan. 4Department of Urology, Kuma- Science Program, Frederick National Laboratory for Cancer Research, Frederick, moto University, Kumamoto, Japan. 5Biodata Mining and Discovery Section, Maryland. NIAMS, NIH, Bethesda, Maryland. 6Department of Urology, Yokohama City University, Yokohama, Japan. 7Department of Molecular Genetics, Kumamoto Note: Supplementary data for this article are available at Molecular Cancer University, Kumamoto, Japan. 8Laboratory of Retroviral Genomics and Tran- Research Online (http://mcr.aacrjournals.org/). scriptomics, International Research Center for Medical Sciences (IRCMS), Center for AIDS Research, Kumamoto University, Kumamoto, Japan. 9Laboratory Corresponding Authors: W. Marston Linehan, National Cancer Institute, 10 Animal Sciences Program, Frederick National Laboratory for Cancer Research, Center Drive MSC 1107, Bethesda, MD 20892-1107. Phone: 240-858-3700; Frederick, Maryland. 10Pathology/Histotechnology Laboratory, Frederick Fax: 301-402-0922; E-mail: [email protected]; Laura S. Schmidt, Phone: National Laboratory for Cancer Research, Frederick, Maryland. 11Small Animal 240-858-3939; Fax: 301-480-3195; E-mail: [email protected]; and Masaya Imaging Program, Frederick National Laboratory for Cancer Research, Frederick, Baba, Kumamoto University, 2-2-1 Honjo, Chuo-ku, Kumamoto 860-0811, Japan. Maryland. 12DSK Project, Medical Innovation Center, Kyoto University Graduate Phone: 81-96-373-6836; Fax: 81-96-373-6869; E-mail: School of Medicine, Sakyo-ku, Kyoto, Japan. 13Department of Uro-Oncology, [email protected] Saitama Medical University International Medical Center, Saitama, Japan. Mol Cancer Res 2019;XX:XX–XX 14Department of Surgical Pathology, Tokyo Women's Medical University, Tokyo, 15 Japan. Department of Pathology, Kochi Red Cross Hospital, Kochi, Japan. doi: 10.1158/1541-7786.MCR-18-1235 16Division of Developmental Genetics, Institute of Resource Development and Analysis, Kumamoto University, Kumamoto, Japan. 17Department of Urology, 2019 American Association for Cancer Research.

www.aacrjournals.org OF1

Baba et al.

Introduction targeting vector, pRosa26-DEST (Addgene plasmid # 21189; Xp11.2 translocation, t(X;1)(p11.2;q21.2), was first ref. 28), which has a LoxP-Stop-LoxP (LSL) cassette preceding described in a pediatric renal cell carcinoma (RCC) case in the gene of interest, using the Gateway Protein Expression System 1986, and the fusion gene was confirmed to be PRCC-TFE3 in according to the manufacturer's protocol. The targeting vector 1995 (1, 2). TFE3 Xp11.2 translocation RCC (TFE3-RCC) was (pRosa26-DEST- PRCC-TFE3) was electroporated into mouse defined as an independent subtype of RCC by WHO in 2004 embryonic stem (ES) cells and selected for G418 resistance as and is characterized by distinctive morphologic features and described previously. ES cells (LSL-PRCC-TFE3), in which the fi Xp11.2 rearrangements that create TFE3 gene fusions with a Rosa26 locus was correctly targeted, were identi ed by Southern variety of partner genes (PRCC, SFPQ, ASPSCR, CLTC, NONO, blot analysis and injected into blastocysts to produce chimeras. RBM10, PARP14, LUC7L3, KHSRP etc.; refs. 2–17). TFE3 Backcrossing to C57BL/6 mice produced heterozygous F1 off- encodes a transcription factor that has a basic helix–loop–helix spring with germline transmission of the Rosa26-LSL-PRCC-TFE3 leucine zipper (bHLH-Zip) structure through which TFE3 knockin (KI) allele. Cadherin 16 (KSP)-Cre transgenic mice, which dimerizes and interacts with M-box DNA sequences express Cre recombinase under the cadherin 16 promoter specif- (TCAYRTGA) in transcriptional target genes. All TFE3 fusion ically in renal epithelial cells (29), were crossed with Rosa26-LSL- PRCC-TFE3 KI (LSL-PRCC-TFE3) mice to generate PRCC-TFE3; genes encode in-frame chimeric proteins, which retain the þ bHLH-Zip domain of TFE3 (16, 18). Nuclear accumulation of KSP-Cre mice. Mice were housed in Frederick National Labora- TFE3 is one of the most significant histopathologic character- tory for Cancer Research animal facilities and euthanized by CO2 istics of TFE3-RCC (19, 20). The evidence is strong for TFE3 asphyxiation for analyses according to the NCI-Frederick Animal fusions to be oncogenes with constitutively active transcrip- Care and Use Committee guidelines. Animal care procedures tional activity. followed the NCI-Frederick Animal Care and Use Committee TFE3-RCC is more common than was previously thought, guidelines. comprising from 2% to 5% of adult cases (21, 22) and from 25% to 40% of pediatric RCC cases (14, 23). TFE3-RCC is known Drug treatment for its aggressive malignant nature with a propensity to metasta- All animal studies were conducted in accordance with the size when the primary tumor is small. There is currently no institutional guidelines for animal care and experimental neo- standard or effective form of therapy for patients with advanced plasia and according to a protocol approved by the Animal Care disease (4, 16). Reduced awareness of TFE3-RCC and the technical and Use Committee of the Frederick National Laboratory for þ – complexity of diagnosis including TFE3 staining and TFE3 gene Cancer Research. PRCC-TFE3;KSPCre mice, 6 12 months of age, ¼ break-apart FISH have led to a decrease in awareness and early were randomly assigned to vandetanib-treated group (n 4) and ¼ diagnosis of this disease (21, 24–26). It is, therefore, important to vehicle-treated group (n 4). Vandetanib-treated animals develop novel diagnostic methods for TFE3-RCC. Although sev- received vandetanib at 100 mg/kg by oral gavage 5 days/week eral diagnostic markers for TFE3-RCC have been reported, such as for 16 weeks. Control animals received vehicle (PBS) by oral Cathepsin K, melan A, and HMB45, the sensitivity and specificity gavage at the same volume and frequency. MRI scans were of these conventional markers are limited and not robust enough obtained at 4-week intervals and maximum tumor dimensions to confirm the diagnosis of TFE3-RCC (20, 26, 27). Transcrip- were measured from the scans using Image J software and plotted tional target genes of TFE3 that are upregulated following TFE3 to calculate tumor growth rates. nuclear localization and activation could potentially be useful markers for the diagnosis of TFE3-RCC. MRI In this study, we have generated a TFE3-RCC mouse model that MRI was implemented for noninvasive detection of kidney expresses PRCC-TFE3, which is the first reported TFE3 fusion lesions as described previously (30, 31), monitoring their partner and frequently observed in human disease, specifically progression and following the therapeutic response. The in kidney epithelial cells, and develops a variety of kidney epi- images were acquired on a 3.0T Clinical Scanner (Philips Intera thelial neoplastic lesions including hyperplastic cysts, adenomas, Achieva) using a 40-mm diameter mouse-dedicated solenoid and solid tumors. This mouse model provides a preclinical in vivo receiver coil (Philips Research). A T2 weighted (T2w) Turbo system for development of new diagnostic markers and targeted Spin Echo (TSE) sequence was acquired with an in-plane therapeutics. Genes that were upregulated in the kidneys of this resolution of 0.180 0.180 mm and 0.5-mm slice thickness. mouse model were identified. We determined that GPNMB (gly- A contrast medium gadolinium chelate, Dotarem, (Guerbet) coprotein nonmetastatic B) is directly transcribed and upregu- was administrated intravenously at 0.1 mmol/kg and a post- lated by chimeric TFE3 and performed GPNMB IHC staining in contrast T1weighted (T1w) image was obtained using a gradi- human TFE3-RCCs to investigate its potential in the diagnosis of ent echo scan with the same geometry as the T2w sequence. A this form of RCC. fat saturation technique (Spectral Presaturation with Inversion Recovery, SPIR) was implemented for both T1w and T2w sequences to suppress the fat and create a dark background around the kidneys to enhance contrast and distinguish fat Materials and Methods from cystic and tumor masses in the kidneys. Generation of TFE3-RCC mouse model The cDNA of the human PRCC-TFE3 chimeric gene, which is DNA microarray analysis composed of exon 1 of PRCC and exons 4–10 of TFE3, was Total RNA was isolated from flash-frozen mouse kidneys using generated by overlap extension PCR, subcloned into an entry TRIzol reagent (Invitrogen). cDNA preparation and hybridization vector of the Gateway Protein Expression System (Invitrogen), of the probe arrays were performed according to the manufac- and sequence verified. PRCC-TFE3 cDNA was cloned into a turer's instructions (Affymetrix). Affymetrix GeneChip Mouse

OF2 Mol Cancer Res; 2019 Molecular Cancer Research

TFE3-RCC Mouse: A Model for Human Disease

Gene 2.0 ST Arrays were applied. Partek Genomics Suite 6.6 was subdivided into papillary type I (161 samples) and papillary type used for RMA-based data normalization and the subsequent data II RCC (79 samples). analysis, including PCA and ANOVA. Data are available at the NCBI GEO database under accession number (GSE130072). Luciferase reporter gene assay Gene set enrichment analysis (GSEA) was performed with GSEA A 527bp fragment of the 50 region of the human GPNMB gene software as described previously (32, 33). was amplified by PCR using KOD-Plus-Neo from the human BAC clone (RP11-469O17; Advanced Geno Techs Co.). The PCR Cell lines and biochemical analysis product amplified with primers containing restriction enzyme HEK293 cell lines that express HA-TFE3 and HA-PRCC-TFE3 in site (forward, ATGTACATGCTAGCACATAGTGAAACCTGCCTC- a doxycycline-dependent manner were established using the Flp- TACT; reverse, AACTTGATAAGCTTTGAATTCTCACGGACG- In T-Rex System (Invitrogen) as described previously (34) and CAGG) was digested by NheI and HindIII, and ligated into a cultured in DMEM with 10% tetracycline-free FBS (Clontech) and pGL3-Basic Vector (Promega). Two M-box sequences in the selection antibiotics, 15 mg/mL blasticidin S and 150 mg/mL GPNMB promoter construct were mutated using PrimeSTAR Hygromicin B (Invitrogen). UOK109, UOK120, UOK124, and Mutagenesis Basal Kit (Takara) following the manufacturer's UOK146 cell lines were derived from primary tumors of 4 patients protocol. Primers for mutagenesis were as follows: M-box Mt1 with TFE3-RCC treated in the Urologic Oncology Branch (UOB), Forward: TAAGCTCGAGAGTTGTAAGAGGTTGAA, M-box Mt1 NCI (Bethesda, MD) and carry the NONO-TFE3 or PRCC-TFE3 Reverse: CAACTCTCGAGCTTATGACTCACTCCTT; M-box Mt2 gene fusions, as described previously (3, 8, 15). UOK111, Forward: CCATCTCGAGATCCTCCCCGAGGCCCT, M-box Mt2 UOK115, and UOK140 are cell lines derived from ccRCC tumors Reverse: AGGATCTCGAGATGGTATTAAGCGGCAC. Reporter with VHL gene mutations that were established in the UOB, plasmids were cotransfected with phRL vector as an internal NCI (35, 36). All cell lines were maintained in vitro in DMEM control into a HEK293-Dx-PRCC-TFE3 cell line, which expresses media supplemented with L-glutamine (4 mmol/L), sodium PRCC-TFE3 in a doxycycline-dependent manner. Luciferase activ- pyruvate (110 mg/L), glucose (4.5 g/L), and 1X essential amino ity was measured using Dual-Luciferase Reporter Assay System acids, Penicillin–Streptomycin (100 U/mL; Gibco), with 10% FBS according to the manufacturer's protocols (Promega). (Sigma Aldrich). Cell lines were authenticated using short tandem repeat DNA profiling (Genetica DNA Laboratories) and con- Chromatin immunoprecipitation assay firmed to be Mycoplasma free. For gene expression profiling, HEK293-Dx-HA-PRCC-TFE3 cell lines were cultured with or HEK293 cell lines were cultured with or without 250 ng/mL without doxycycline for 24 hours, and cross-linked with 1% doxycycline. For qRT-PCR, total RNA was isolated using TRIzol formaldehyde at room temperature for 5 minutes followed by reagent (Invitrogen) and was reverse transcribed to cDNA using incubation with 125 mmol/L glycine. Nuclear lysates were son- ReverTra Ace qPCR RT Master Mix (Toyobo). qRT-PCR was icated with a Bioruptor USD-200 (Diagenode) for 10 minutes performed with a LightCycler 96 Instrument (Roche) using twice. To purify HA-PRCC-TFE3–bound chromatin, 50 mgof THUNDERBIRD SYBR qPCR Mix (Toyobo) as described previ- chromatin was subjected to immunoprecipitation with Anti-HA ously (37). All reactions were performed with RPS 18 as an Affinity Matrix (Roche) at 4C overnight. Immunoprecipitates internal control. Primer sequences are as follows: Gpnmb for- were washed five times, eluted, and reverse–cross-linked. DNA ward, 50- GCTACTTCAGAGCCACCATCACAA -30; Gpnmb was purified with NucleoSpin Gel and PCR Clean-up (Takara) reverse, 50- GGAGATGATCGTACAGGCTTCCA -30; Ret forward, following the manufacturer's protocol. DNA enrichment in the 50- CCACATGTTACCCGTGCAGTTC -30; Ret reverse, 50- CCAGG- chromatin immunoprecipitation (ChIP) samples was determined CAGTCTGGGTCACAA -30; Nr4a1 forward, 50-AAACAAGGATT- by qRT-PCR with THUNDERBIRD SYBR qPCR Mix (Toyobo) and GCCCTGTGG-30; Nr4a1 reverse, 50-CGCCCTTTTAGGCTGTC- a LightCycler 96 Instrument (Roche) following the manufac- TGT-30; Rps18 forward, 50- TTCTGGCCAACGGTCTAGACAAC turer's protocol. Primers for the GPNMB promoter region contain- -30; Rps18 reverse, 50- CCAGTGGTCTTGGTGTGCTGA -30. West- ing two M-box motifs are as follows: forward, GATGCCAAGAAG- ern blotting analysis was performed as described previously (34). GAGTGAGTCATA; reverse, ATCTGTGGTGCCTCCCTCTC. As an Primary antibodies were used as follows: GPNMB (R&D Systems) internal negative control, a 142 bp region, which is 2 kbp 1:2,000 dilution, b-actin (Cell Signaling Technology) 1:1,000 upstream from the aforementioned GPNMB promoter region dilution. was selected. Primers for this negative control region are as follows: forward, TCACTGGGACTTCAGGTACACATC; reverse, TCGA data analysis AGGGCCATTTTGGGTAAAGAA. Data are expressed as percentage The Cancer Genome Atlas (TCGA; refs. 12, 38) dataset was used of input DNA. to validate candidate transcriptional target genes of chimeric TFE3, which were identified by RNAseq analysis. Case selection The dataset of four TFE3-RCC samples [TCGA-AK-3456-01, TFE3-immunoreactive RCCs were collected through consulta- TCGA-BP-4756-01, TCGA-B8-5546-01 (all SFPQ-TFE3), TCGA- tion systems by The Japanese Society of Pathology (http://pathol CJ-5681-01 (KHSRP-TFE3)] was compared with the dataset of ogy.or.jp/). Histologic features were evaluated by two patholo- 465 ccRCC for gene expression levels of candidate genes using gists with expertise in renal tumors (N. Kuroda and Y. Naga- cBioPortal (39) and six TFE3-RCC samples [TCGA-BQ-5882-01, shima). Clinicopathologic findings including immunostaining TCGA-BQ-5887-01, TCGA-BQ-7050-01 (all PRCC-TFE3), TCGA- were summarized in Table 1. Sporadic clear cell RCCs (n ¼ 56) DZ-6131-01 (RBM10-TFE3), TCGA-G7-7501-01 (SFPQ-TFE3), and papillary RCCs (n ¼ 20), among which 20 ccRCC and 11 TCGA-J7-8537-01 (DVL2-TFE3)] were compared with the papillary RCC were previously reported by us (40), were used for remaining 283 samples with gene expression data within the comparison of GPNMB staining. The possibility that these papillary RCC dataset. The papillary RCC dataset was further cases represented patients with von Hippel–Lindau disease,

www.aacrjournals.org Mol Cancer Res; 2019 OF3

Baba et al.

Birt–Hogg–Dube (BHD) syndrome, tuberous sclerosis complex, (Abcam), and 1:500 for TFE3 (Sigma,). The GPNMB immuno- hereditary papillary RCC, or hereditary leiomyomatosis RCC was staining was scored as (), (1þ), and (2þ) according to the carefully examined and excluded in all patients by thorough method described previously (40). medical examination and family history. This study was approved by the Institutional Review Board of the Kumamoto University Statistical analysis (Kumamoto, Japan; #1245), Yokohama City University Experimental data are summarized as the mean values with SD. (Yokohama, Japan), Saitama Medical University International Statistical analyses were performed using a two-tailed unpaired t Medical Center (Saitama, Japan; #16-226), and Kochi Red Cross test with or without Welch correction using GraphPad Prism 6. Hospital (Kochi, Japan). When the P value of the F test was less than 0.05, Welch correction was applied. Differences were considered to be statistically sig- FISH nificant at a value of P less than 0.05. Survival data were estimated To assess the status of TFE3 in the TFE3-RCCs, FISH analysis was and plotted with the Kaplan–Meier method; differences between performed by using a dual-color TFE3 break-apart probe (GSP survival groups were assessed with the log-rank test. Nonlinear 0 Laboratory), which was labeled with FITC at 5 side (550 kb) and regression analysis for % tumor growth was performed with 0 with Texas Red at 3 side (570 kb) of TFE3. In each case, at least 60 GraphPad Prism 6. nonoverlapping nuclei in the tumor area were counted. The signal pattern of a normal cell depends on sex, that is, one fused signal in men, and two fused signals in women. Typical TFE3 rearrange- Results ment pattern of a TFE3-RCC cell is one split signal in men, and one PRCC-TFE3 expression in mouse kidney epithelial cells split signal and one fused signal in women. The split signal was produces RCC defined according to the evaluation method described in previous PRCC-TFE3 knockin mice, generated by inserting human studies (25, 27). When the case exhibited a TFE3 split but did not PRCC-TFE3 cDNA preceded by a loxP-flanked neomycin cassette show a chimeric band of known partners in RT-PCR, a dual-color into the Rosa26 locus, were crossed with cadherin 16-Cre (KSP- SFPQ-TFE3 fusion FISH Probe (Cyto Test Inc) was used. If a yellow Cre) transgenic mice to express PRCC-TFE3 specifically in mouse signal was observed in 30% or more of 100 counted cells, the þ kidney epithelial cells (Fig. 1A). PRCC-TFE3;KSP-Cre mice and tumor was defined as harboring SFPQ-TFE3. PRCC-TFE3;KSP-Cre littermate control mice were evaluated for þ their phenotype. PRCC-TFE3;KSP-Cre mice showed significantly RT-PCR larger and heavier kidneys at 4 and 7 months of age (Fig. 1B and RNAs were extracted from the 9 TFE3-RCCs using QIAGEN C). MRI imaging revealed a disorganized kidney structure, mul- þ RNeasy FFPE Kit (Qiagen) according to the manufacturer's tiple cysts, and renal tumors in PRCC-TFE3;KSP-Cre mice fi instructions. Gene fusion products were ampli ed by RT-PCR (Fig. 1D). Histopathologic analysis revealed a variety of prolifer- using the following primers: ASPSCR1 (exon 7) forward, 50- 0 0 ating morphologies, dilation of tubules, cystic lesions, neoplastic CCAAGCCAAAGAAGTCCAAG-3 ; SFPQ (exon 9) forward, 5 - regions protruding into the cystic lumen, and solid tumors of AGGTGGTGGTGGCAT AGGTT-30; PRCC (exon 3) forward, 0 0 various sizes (Fig. 1E). Complete necropsy with histopathology 5 -ATGCCTAAGCCTGGGGACGACTA-3 ; TFE3 reverse (exon revealed no metastasis or primary tumors in organs other than 4), 50-TGGACAGGTACTGTTTCACCTG-30; and TFE3 reverse 0 0 kidney. All pathologic lesions in kidneys showed strong nuclear (exon 6), 5 -CCTTGACTACTGTACACATC-3 . staining of TFE3 (Fig. 1F). TFE3 nuclear staining was observed without obvious phenotype in renal papillae, pelvis, and ureter, IHC but not in bladder, consistent with the CDH16-Cre (KSP-Cre) The resected tissues were fixed with 10% formalin and embed- expression pattern (Supplementary Fig. S1A–S1F; ref. 29). The ded in paraffin. Four-micron–thick paraffin sections were sub- cyst lumens were lined by monolayers of cuboidal and/or hyper- jected to IHC. Sections were autoclaved at 121C for 15 minutes. plastic cells with occasional adenomatous lesions proliferating in The sections were treated with the diluted antibodies at 4C multiple layers (Fig. 1E). Solid tumors displayed characteristics of overnight. Working dilutions were 1:200 for GPNMB (goat poly- RCC with eosinophilic cytoplasm, clear cytoplasm, and occasion- clonal antibody AF-2550 from R&D Systems) and Cathepsin K al mixture of both populations (Fig. 1G and H). The eosinophilic

Table 1. Summary of clinicopathologic information of patients with TFE3-RCC Case Size Fuhrman Cathepsin # Sex Age (cm) Stage grade Histologic finding FISH Fusion TFE3 GPNMB K RET 1 M 11 2.2 pT1a-Nx-Mx 3 Clear and papillary þ ASPL-TFE3 2 2 - 1 2 F 16 9.0 pT2a-pN1-cM1 2 Clear and tubular þ ASPL-TFE3 2 1 1 2 3 F 19 2.5 pT1a-Nx-Mx 2 Clear and papillary, calcification þ SFPQ-TFE3 2 2 1 2 4 F 20 6.0 pT1b-Nx-Mx 3 Eosinophilic, alveolar, tubular þ PRCC-TFE3 2 2 - 1 5 M 26 3.3 pT1a-Nx-Mx 2 Eosinophilic, alveolar, tubular þ PRCC-TFE3 2 2 2 - 6 F 33 1.0 pT1a-Nx-Mx 2 Clear and alveolar þ SFPQ-TFE3 2 1 1 - 7 M 52 2.7 pT1a-pN12-cM0 2 Clear and papillary þ PRCC-TFE3 2 2 - 1 8 F 66 5.5 pT1b-Nx-Mx 1 Clear and multicystic, calcification þ SFPQ-TFE3 1 2 2 2 9 F 73 2.5 pT3-Nx-Mx 3 Alveolar, papillary, mixed clear and þ ASPL-TFE3 2 2 1 2 eosinophilic, psammoma body

OF4 Mol Cancer Res; 2019 Molecular Cancer Research

TFE3-RCC Mouse: A Model for Human Disease

cells tended to be arranged in tubules, trabeculae, and lobules, proto-oncogene, a receptor tyrosine kinase that shares down- and were supported by a fine fibrovascular stroma. On the other stream signaling with EGFR, including the Kras pathway, was þ hand, clear cells were arranged in lobules, and frequently exhib- significantly higher in PRCC-TFE3;KSP-Cre kidneys than in ited an alveolar and/or multicystic pattern. Psammoma bodies, control kidneys (Fig. 2B, C, and G). IHC staining revealed robust calcified lesions that are characteristic of TFE3-RCC (41), were Gpnmb staining that overlapped with strong TFE3 nuclear stain- þ occasionally observed (Fig. 1I). An increased cell proliferation rate ing in kidneys from PRCC-TFE3;KSP-Cre mice, while control þ in the kidneys of PRCC-TFE3;KSP-Cre mice was indicated by a kidneys demonstrated negative staining for both TFE3 and significantly increased BrdU incorporation (Fig. 1J and K) as well Gpnmb (Fig. 2H–M; Supplementary Fig. S4). In addition, IHC þ as higher number of Ki67 cells (Supplementary Fig. S1G and staining demonstrated strong Ret expression in kidney tumors of þ þ S1H). Increased BrdU incorporation and Ki67 cells in cyst-lining PRCC-TFE3;KSP-Cre mice and negative staining in control kid- cells indicated that the cystic regions were produced by uncon- neys (Fig. 2N and O; Supplementary Fig. S4), which motivated us trolled hyperproliferation of tubular epithelial cells. Intriguingly, to test therapeutic agents that target Ret in this TFE3-RCC mouse multiple stages of RCC development from cystic regions with model. Vandetanib is a multiple tyrosine kinase inhibitor that abnormally proliferating monolayers to solid tumors were efficiently inhibits EGFR, VEGFR, and RET. We administered þ þ observed in a single kidney of PRCC-TFE3;KSP-Cre mice. The vandetanib to PRCC-TFE3;KSP-Cre mice. Vandetanib treatment renal tumor growth rate was calculated from MRI measurements (100 mg/kg) demonstrated a therapeutic effect on tumor growth (Fig. 1L and M). Renal neoplastic lesions in this mouse model compared with vehicle treatment with no evidence of toxicity display heterogeneous histologic features, which are also seen in (Fig. 2P–U). Nonlinear regression analysis demonstrated statis- human TFE3-RCC. As expected, growth rates of individual tumors tically significantly reduced tumor growth in the vandetanib- measured by MRI imaging were variable, probably because of treated group compared with the control-treated group their heterogeneous features. As indicated from the histology and (Fig. 2V). These data underscore the usefulness of this TFE3-RCC MRI imaging, kidney structures were disorganized because of mouse model not only for the development of biomarkers and abnormal epithelial cell proliferation and enlarged tumors in targeted therapeutics but also as a preclinical model to test drugs aged mice, resulting in renal failure and early death compared or imaging methods. Furthermore, we have performed IHC with control PRCC-TFE3;KSP-Cre mice. The mean survival of staining of RET on human TFE3-RCC samples and found that þ PRCC-TFE3;KSP-Cre mice was 11 months (Fig. 1N). The blood 7 of 9 cases (77.8%) were positive for RET staining urea nitrogen (BUN) levels were significantly higher in PRCC- (Fig. 2W; Table 1), potentially supporting further evaluation of TFE3;KSP-Cre(þ) mice when moribund over the age of 10 vandetanib treatment in advanced human TFE3-RCC cases. months, compared with PRCC-TFE3;KSP-Cre(-) control mice þ (Fig. 1O). This newly established PRCC-TFE3;KSP-Cre mouse GPNMB is a direct transcriptional target gene of chimeric TFE3 model will be useful for development of novel therapeutics, To investigate the molecular mechanisms of Gpnmb overexpres- þ identification of potential diagnostic biomarkers, and as a pre- sion in PRCC-TFE3;KSP-Cre kidneys, we established stable cell clinical model for testing new therapies for TFE3-RCC. lines derived from HEK293 cells, which express wild-type TFE3 or PRCC-TFE3 in a doxycycline-dependent manner (Fig. 3A and B). Identification of GPNMB and RET as upregulated genes in Induced wild-type TFE3 localized predominantly in the cyto- þ PRCC-TFE3;KSP-Cre kidneys plasm. On the other hand, PRCC-TFE3 localized predominantly To identify candidate genes for biomarkers or therapeutic target in the nucleus (Fig. 3A). These results support the concept that the molecules that could be useful for the diagnosis or molecular PRCC-TFE3 chimeric protein works as an oncoprotein with con- based therapy of TFE3-RCC, we performed microarray analysis of stitutively active transcriptional activity. Induction of PRCC-TFE3 kidneys from 4-month-old and 7-month-old PRCC-TFE3;KSP- and, to a lesser extent, wild-type TFE3, resulted in upregulated þ Cre mice and control PRCC-TFE3;KSP-Cre mice (Fig. 2A). Most GPNMB expression at both mRNA and protein levels (Fig. 3C and of 78 significantly upregulated genes in kidneys from 4-month- D). To determine whether GPNMB is the direct transcriptional þ old PRCC-TFE3;KSP-Cre mice were also upregulated in kidneys target of chimeric TFE3, we inserted the promoter region of þ from 7-month-old PRCC-TFE3;KSP-Cre mice (Fig. 2A; Supple- human GPNMB, from 467 to the transcription start site (TSS), mentary Table S1A; Table S2A). A previous report of a TFEB-driven into a luciferase reporter plasmid. Two M-box motifs (M-box1 RCC mouse model demonstrated activation of the Wnt-b catenin and M-box2), which are putative TFE3-binding sequences, were and ErbB signaling pathways (42). However, GSEA analysis did included in this construct. We transfected reporter plasmids not demonstrate either a Wnt-b catenin or ErbB activation signa- carrying wild-type or mutant M-box motifs into doxycycline- þ ture in PRCC-TFE3;KSP-Cre mouse kidneys, indicating that TFEB inducible PRCC-TFE3–expressing HEK293 cells (Fig. 3E). As and PRCC-TFE3 have distinct oncogenic functions (Supplemen- shown in Fig. 3F, the promoter activity of GPNMB was upregu- tary Fig. S2). One of the most significantly elevated genes in lated by the induced expression of PRCC-TFE3. Importantly, this kidneys from both 4 month and 7-month-old PRCC-TFE3;KSP- PRCC-TFE3–dependent GPNMB promoter activity was attenuat- þ Cre mice was Gpnmb that encodes a type I transmembrane ed in cells transfected with mutated M-box1 or M-box2 reporter glycoprotein (Fig. 2B–D; Supplementary Table S1A; Table plasmids. Furthermore, complete absence of PRCC-TFE3– S2A). GSEA analysis demonstrated significant enrichment of dependent promoter activity was seen in cells transfected with genes associated with EGFR signaling activation and RET signaling a reporter plasmid in which both M-box1 and M-box2 were activation among those genes upregulated in kidneys from PRCC- mutated (Fig. 3F). These findings indicate that GPNMB is tran- þ TFE3;KSP-Cre mice (Fig. 2E and F). In addition, a Kras-activated scriptionally upregulated by PRCC-TFE3 through both M-box þ signature was seen in PRCC-TFE3;KSP-Cre mouse kidneys (Sup- motifs in its promoter. In addition, we have confirmed the direct plementary Fig. S3). Although Egfr was not significantly upregu- binding of PRCC-TFE3 to the minimal GPNMB promoter region lated in PRCC-TFE3–expressing kidneys, expression of the Ret containing these two M-box motifs by ChIP followed by qPCR

www.aacrjournals.org Mol Cancer Res; 2019 OF5

Baba et al.

OF6 Mol Cancer Res; 2019 Molecular Cancer Research

TFE3-RCC Mouse: A Model for Human Disease

(Fig. 3G and H). These experimental data clearly indicate that significantly higher (P < 0.0001) in TFE3-RCC than in either GPNMB is a direct transcriptional target gene of PRCC-TFE3. papillary type I RCC, papillary type II RCC (P < 0.0001), or total papillary RCC (P < 0.0001), there were no statistically signif- Specific expression of GPNMB in TFE3-RCC icant differences in Cathepsin K expression between TFE3-RCC Because GPNMB was proven to be a direct transcriptional target and either papillary type I RCC, papillary type II RCC, or total of chimeric TFE3, we evaluated the utility of GPNMB as a diag- papillary RCC. (Fig. 4D). These data show that GPNMB expres- nostic marker for TFE3-RCC. To determine whether GPNMB sion is a useful biomarker for distinguishing TFE3-RCC from expression was specific for TFE3-RCC, we compared GPNMB other types of RCCs. expression in RCC cell lines established from human TFE3-RCCs, and in cell lines from sporadic clear cell RCCs (ccRCC). The TFE3 GPNMB immunostaining as potential diagnostic marker for RCC cell lines UOK109, which we developed from tumor material TFE3-RCC removed from a 39-year-old female (15), UOK120, developed To evaluate the IHC expression pattern of GPNMB in formalin- from tumor material from a 30-year-old male (3), UOK124, fixed paraffin-embedded (FFPE) TFE3-RCCs, we collected 9 cases developed from a 21-year-old female (3), and UOK146, devel- with characteristic histologies of TFE3 translocation RCC. They oped from tumor material from a 45-year-old male (3, 35), displayed papillary, tubular, or alveolar histology with frequent expressed significantly higher amounts of GPNMB protein, while calcification and were composed of clear cells or mixtures of clear ccRCC cell lines UOK111, UOK115, and UOK140 (15) expressed cells and eosinophilic cells (Fig. 5A–C). All cases demonstrated no detectable GPNMB (Fig. 4A and B). To further confirm the nuclear TFE3 immunoreactivity, and were confirmed to be TFE3- specificity of GPNMB expression in TFE3-RCC, we utilized the RCC by FISH and RT-PCR analyses (Fig. 5D–F). Clinicopathologic gene expression database for ccRCC (KIRC) from TCGA proj- findings are summarized in Table 1. All cases of TFE3-RCC were ect (12, 38) from which there were 4 cases of TFE3-RCC. We confirmed to have nuclear TFE3 staining (Table 2). All TFE3-RCCs compared the GPNMB mRNA expression levels in 465 cases of showed positive immunoreactivity for GPNMB (Fig. 5G– ccRCC with 4 cases of TFE3-RCC. GPNMB expression levels were I; Table 2), two cases with 1þ staining, and 7 cases with 2þ statistically significantly higher (P < 0.0001) in TFE3-RCC than staining. Cathepsin-K was positively stained in only 6 of 9 TFE3- ccRCC (Fig. 4C). We also compared the expression levels of RCC cases (Fig. 5J–L; Table 2). There was no obvious correlation Cathepsin K, which has been used as a diagnostic marker for between Fuhrman grade and immunoreactivity of GPNMB or TFE3-RCC, but were unable to see statistically significant Cathep- Cathepsin-K (Table 1). To further confirm the specificity of sin K expression differences between ccRCC and TFE3-RCC GPNMB immunostaining as a potential diagnostic marker for (Fig. 4C), thereby underscoring the utility of GPNMB as a diag- TFE3-RCC, we have stained 56 ccRCCs and 20 papillary RCCs for nostic marker. Although TFE3-RCC can present with a variety of GPNMB [(40) and this report]. Comparisons between TFE3-RCC histologies, the most frequently observed histologic character- and ccRCC and between TFE3-RCC and papillary RCC were istics are papillary, tubular, or alveolar structures composed of statistically significant (P < 0.0001) for GPNMB staining (Table 3). clear cells, which may lead to misdiagnosis of TFE3-RCC as Interestingly, the 4 cases from a total of 76 clear cell and papillary ccRCC or papillary RCC. Hence, we compared GPNMB mRNA RCC that were positive for GPNMB were also positive for nuclear expression in TFE3-RCC and papillary RCC using the TCGA TFE3 staining, which suggests that GPNMB positivity is the gene expression database for papillary RCC (KIRP; ref. 14) consequence of TFE3 activation by an unknown mechanism other comprised of 6 cases of TFE3-RCC, 161 cases of papillary type than Xp11.2 translocation. Overall, these data demonstrate that I RCC, and 79 cases of papillary type II RCC. As shown GPNMB immunostaining can be a useful diagnostic marker for in Fig. 4D, while GPNMB expression levels were statistically TFE3-RCC.

Figure 1. Generation and characterization of TFE3-RCC mouse model. A, A schematic diagram showing the generation of kidney-specific PRCC-TFE3–expressing mice. A floxed neomycin resistance cassette with stop codon, followed by a human PRCC-TFE3 cDNA, was inserted into the Rosa26 locus (PRCC-TFE3). Kidney-specific PRCC-TFE3 expression was obtained by crossing PRCC-TFE3 mice with Cadherin 16-Cre (KSP-Cre) mice. B, Macroscopic appearance of PRCC-TFE3;KSP-Cre [Cre(-)] and PRCC-TFE3;KSP-Creþ [Cre(þ)] mouse kidneys at the age of 7 months. C, Relative ratio of kidney to body weight (100 kidney weight/BW) of 4-month-old mice [4M; n ¼ 8forPRCC-TFE3;KSP-Cre (Cre(-)); n ¼ 8forPRCC-TFE3;KSP-Creþ (Cre(þ)), unpaired t test: , P ¼ 0.0002] and 7-month-old mice [7M; n ¼ 12 for (Cre(-)); n ¼ 16 for (Cre(þ)), unpaired t test: , P <0.0001] was calculated. Data are presented as mean with SD. D, T2 weighted coronal MRI image (top) and corresponding Gadolinium-enhanced T1 weighted MRI image (bottom) of 7-month-old PRCC-TFE3;KSP-Cre and PRCC-TFE3;KSP-Creþ mice. The cysts appear bright on the T2w image and dark on the T1w. The tumor (red arrow) is well distinguished on both type of images. E, A representative histology of hematoxylin and eosin (H&E)-stained kidney from a 7-month-old PRCC-TFE3;KSP-Creþ mouse. Bottom panels are higher magnified images of the rectangular areas in top panel. F, Representative images of TFE3 IHC of a kidney from a 7-month-old PRCC-TFE3;KSP-Creþ mouse. Bottom panels are higher magnified images of the rectangular areas in top panel. G–I, Representative H&E staining of solid tumors in 7-month-old PRCC-TFE3;KSP-Creþ mice. Solid tumors are composed of two types of cells with eosinophilic cytoplasm (G) and large clear cytoplasm (H). I, Psammoma body, a characteristic calcified lesion seen in human TFE3-RCC, was occasionally seen. J,5-Bromo-2-deoxyuridine (BrdU; 100 mg/g body wt) was injected intraperitoneally into 7-month-old PRCC-TFE3;KSP-Cre mice and PRCC-TFE3;KSP-Creþ mice 2 hours before euthanization. BrdU staining detects few proliferating cells in PRCC-TFE3;KSP-Cre kidneys (left) and many proliferating cells in PRCC-TFE3;KSP-Creþ kidneys (right). K, Greater than 8-fold more BrdU-incorporated cells were detected in PRCC-TFE3;KSP-Creþ mouse kidneys compared with PRCC-TFE3;KSP-Cre mouse kidneys (n ¼ 4 for each group, mean ¼ 10.0/mm2 vs. 84.4/mm2, unpaired t test: , P < 0.0001). BrdU- positive cells per field were counted in four randomly selected fields from 4 mice for each group. Data are represented as means and SD. L and M, Representative MRI images of and tumor (red arrow) diameters in PRCC-TFE3;KSP-Creþ mouse kidneys, which were chronologically examined at 9.5, 10.5, and 11.3 months of age. N, Kaplan–Meier survival analysis shows a statistically significant difference between PRCC-TFE3;KSP-Cre and PRCC-TFE3;KSP-Creþ mice (n ¼ 31 for [Cre (-)]; n ¼ 24 for [Cre(þ)], log-rank test, , P < 0.0001). Median survival time of PRCC-TFE3;KSP-Creþ mice is 11 months. O, PRCC-TFE3;KSP-Creþ mice die of renal failure. Blood urea nitrogen (BUN) levels were determined for PRCC-TFE3;KSP-Creþ mice when moribund at ages ranging from 10 months to 12 months. Statistically significant elevation of BUN levels was observed in PRCC-TFE3;KSP-Creþ mice compared with PRCC-TFE3;KSP-Cre mice (n ¼ 4 for each group, mean ¼ 133.8 mg/dL vs. mean ¼ 15.8 mg/dL, unpaired t test: , P < 0.017). Data are presented as mean with SD.

www.aacrjournals.org Mol Cancer Res; 2019 OF7

Baba et al.

Figure 2. Overexpression of Gpnmb and Ret in TFE3-RCC mouse model. A, Numbers of genes differentially expressed between PRCC-TFE3;KSP-Creþ kidneys and PRCC- TFE3;KSP-Crekidneys. Volcano plot of gene expression changes for 4-month-old (4M; B) and 7-month-old (7M; C) PRCC-TFE3;KSP-Cre kidneys and PRCC-TFE3; þ KSP-Cre kidneys. The x-axis specifies the fold changes [log2(Cre(þ)/Cre(-))] and the y-axis specifiesthenegativelogtothebase10ofthet test q-values. Red and blue dots represent genes expressed at significantly higher or lower levels (>2-fold vs. < -2-fold) in PRCC-TFE3;KSP-Creþ (Continued on the following page.)

OF8 Mol Cancer Res; 2019 Molecular Cancer Research

TFE3-RCC Mouse: A Model for Human Disease

Discussion many putative transcription factors, which may regulate Ret TFE3 Xp11.2 translocation RCC (TFE3-RCC) was initially transcription, Nr4a1 expression was dramatically elevated in described in 1996 (3, 43) and established as an independent PRCC-TFE3–expressing kidneys (Supplementary Fig. S5). Nr4a1 subtype of RCC in 2004 by the World Health Organization (44). expression was significantly higher in TFE3-RCC than ccRCC and Because of the relatively low incidence of TFE3-RCC (14), the papillary RCC (Supplementary Fig. S5). It will be of great impor- biological characteristics of TFE3-RCC have not been fully clar- tance to clarify the details of the transcriptional network, includ- ified and effective forms of therapy for patients with advanced ing Nr4a1, perturbed by chimeric TFE3. disease have yet to be established (16). Although many cases of Another type of translocation RCC has been described involv- TFE3-RCC display the characteristic histology, other cases of TFE3- ing chromosome 6p21 translocation, in which a second MIT RCC are misdiagnosed as ccRCC, papillary RCC, or unclassified family transcription factor, TFEB, is fused to and transcribed by RCC (12, 25, 26). Given the aggressive nature of this disease, it is a strong promoter of the MALAT1 gene (47, 48). In chromosome of great importance to develop a concise, sensitive, and specific 6p21 translocation RCC, overexpression of wild-type TFEB drives method for diagnosis and treatment of TFE3-RCC. Here, we have RCC development. Indeed, kidney-specific overexpression of generated the first TFE3-RCC mouse model, which we have wild-type TFEB in a transgenic mouse model produced clear cell utilized to further characterize the chimeric PRCC-TFE3 protein and papillary RCCs (42). This mouse model displays aberrant and identify a robust and reliable diagnostic marker for TFE3- activation of the Wnt signaling and ErbB signaling pathways, RCC, and as a model for the development of targeted therapeutic which was not observed in our PRCC-TFE3 mouse model by GSEA approaches for this disease. analysis (Supplementary Fig. S2). The difference between these Results from the evaluation of our PRCC-TFE3–expressing two models might reflect differences between wild-type TFEB and mouse model have confirmed that chimeric PRCC-TFE3 is an chimeric PRCC-TFE3. As we have shown, PRCC-TFE3 localizes in oncogene, which is responsible for RCC development in vivo. the nucleus in most of the cells, whereas wild-type TFE3 and TFEB Because all the chimeric genes reported to date in TFE3-RCC localize predominantly in the cytoplasm under normal condi- encode the carboxy-terminal half of TFE3, which retains the basic tions (37, 49–51). In addition, PRCC that displaces the N-termi- helix–loop–helix leucine zipper structures through which TFE3 nal half of TFE3 may contribute to altered transcriptional activity dimerizes and binds to DNA (16, 18), it is predicted that these affecting different transcriptional targets compared with wild-type chimeric genes function as oncogenic transcription factors (45, TFE3. Indeed, when we compared significantly upregulated genes 46). Indeed, overexpressed PRCC-TFE3 and SFPQ-TFE3 (data not in PRCC-TFE3–expressing kidneys and TFEB-expressing kid- shown) demonstrated predominant nuclear localization, while neys (42), less than 10% of PRCC-TFE3 upregulated genes were overexpressed wild-type TFE3 localized in the cytoplasm of HEK commonly upregulated in TFEB-expressing kidneys (Supplemen- 293 cells. This finding suggests that chimeric TFE3 proteins tary Table S3). Our unique PRCC-TFE3 mouse model will provide acquire the ability to localize in the nucleus and function as a powerful tool for further clarification of molecular mechanisms constitutively active transcription factors. Aberrant upregulation responsible for TFE3-RCC development. of PRCC-TFE3 transcriptional target genes, followed by pertur- In this TFE3-RCC mouse model, PRCC-TFE3 expression was bation of the transcriptional network is most likely responsible for induced by cadherin 16 promoter–driven Cre recombinase TFE3-RCC development. Further analysis of the transcriptional with broad expression in the distal nephron and some regions network alterations caused by PRCC-TFE3 expression may pro- of the proximal tubules (29, 30). Notably, PRCC-TFE3–expres- vide clues to understanding the molecular mechanisms of TFE3- sing kidneys demonstrated different histologic features, dilated RCC development. Indeed, our TFE3-RCC mouse model dem- monolayer tubules with hyperproliferation, adenomatous epi- onstrated Ret overexpression and therapeutic responses to van- thelial cells growing as multiple layers into the lumen of dilated detanib treatment. We utilized publicly available databases tubules, and solid tumors with a variety of sizes. The diversity of and searched for putative transcription factors, which may regu- histologic features resulting from PRCC-TFE3 expression in late Ret gene expression (data not shown). There was no clear mouse kidney may represent different stages of RCC develop- evidence for TFE3 mediated Ret regulation. However, among the ment, which have acquired further genetic and/or epigenetic

(Continued.) kidneys (q < 0.05). Gpnmb was one of the most significant genes showing increased expression in both 4-month-old and 7-month-old PRCC-TFE3; KSP-Creþ kidneys. Ret was identified as one of the highly expressed and druggable receptor tyrosine kinases in both 4-month-old and 7-month-old PRCC-TFE3; KSP-Creþ kidneys. D, Expression of Gpnmb was quantified by qRT-PCR analysis of 8-month-old PRCC-TFE3;KSP-Cre mouse kidneys (n ¼ 6) and PRCC-TFE3; KSP-Creþ mouse kidneys (n ¼ 7). Data are represented as a box-and-whisker plot (unpaired t test). E and F, GSEA of microarray data from 4-month old PRCC- TFE3; KSP-Creþ mouse kidneys (n ¼ 4) versus 4-month-old PRCC-TFE3; KSP-Cre mouse kidneys (n ¼ 4; E) and 7-month-old PRCC-TFE3; KSP-Creþ mouse kidneys (n ¼ 4) versus 7-month-old PRCC-TFE3; KSP-Cre mouse kidneys (n ¼ 3; F). Significant enrichment of genes associated with EGFR activation (E)and RET activation (F) was seen in kidneys from PRCC-TFE3; KSP-Creþ mice. NES, normalized enrichment score; NOM P value, Nominal P value. G, Expression of Ret was quantified by qRT-PCR analysis of 8-month-old PRCC-TFE3;KSP-Cre mouse kidneys (n ¼ 6) and PRCC-TFE3;KSP-Creþ mouse kidneys (n ¼ 7). Data are represented as a box-and-whisker plot (unpaired t test). H and I, H&E staining of 7 month-old PRCC-TFE3;KSP-Cre (H)andPRCC-TFE3;KSP-Creþ mouse kidneys (I). (J–O) Representative immunostaining for TFE3 (J and K), Gpnmb (L and M), and Ret (N and O) on serial sections of 7-month-old PRCC-TFE3;KSP-Cre (J, L, N)andPRCC-TFE3;KSP-Creþ (K, M, O) kidneys. Bottom panels are higher magnified images of the rectangular areas in top panels. (P–V)TreatmentofPRCC-TFE3; KSP-Creþ mice with vandetanib, an inhibitor of RET. Representative coronal T2 weighted MRI images of vehicle-treated (P and Q) and vandetanib-treated (100 mg/kg; R and S) PRCC-TFE3;KSP-Creþ mice chronologically taken on day 0 and day 116 of the study. Red arrows indicate the tumors that were tracked for growth. Representative tumor growth curves of vehicle-treated (T) and vandetanib-treated (U) PRCC-TFE3;KSP-Creþ mice shown in P and Q,andR and S, respectively. The largest dimension of each tumor was measured from sequential MRI images taken on day 0, 30, 60, 95, and 116 of treatment. V,Nonlinear regression analysis of % tumor growth in the vehicle-treated group (black dots) and vandetanib-treated group (red square; , P < 0.0001) W,Representative immunostaining for RET on human TFE3-RCC demonstrates significant cytoplasmic staining.

www.aacrjournals.org Mol Cancer Res; 2019 OF9

Baba et al.

A B C D WT-TFE3 PRCC-TFE3 GPNMB

8 Doxy − ++− Doxy (−) Doxy (+) Doxy −−++ TFE3 6 25 mm25 mm P = 0.0092 HA 4 GPNMB P = 0.0084

Actin 2

H3 Relative expression Relative 25 mm 25 mm WT-TFE3 PRCC-TFE3 0 WT-TFE3 PRCC-TFE3 WT-TFE3 PRCC-TFE3

E F M-box1:CACATGA Relative luciferase activity M-box2:TCACATGA Vec n.s. –467 M-box1 M-box2 TSS Wt Luciferase Wt

Mt1 Luciferase Mt1 Doxy (−) Mt2 Luciferase Mt2 Doxy (+)

n.s. Mt1/2 Luciferase Mt1/2

0 5 10 15

G H 0.03 Doxy (−) Doxy (+)

M-Box1/2 0.02

% Input % 0.01

Control M-Box n.s.

0.00 Control M-Box

Figure 3. Gpnmb is a direct transcriptional target of PRCC-TFE3. A, ICC using anti-HA antibody on HEK293-derived stable cell lines, which express HA-tagged wild-type TFE3 and PRCC-TFE3 in a doxycycline-dependent manner. B, Western blotting with anti-TFE3, anti-HA, and anti-b actin on HEK293-derived doxycycline- inducible cell lines cultured without and with doxycycline. C, GPNMB expression was quantified by qRT-PCR on HEK293-derived doxycycline-inducible cell lines, which were cultured without (open bar) and with doxycycline (solid bar). Data represent means SD (triplicate, unpaired t test: WT-TFE3 , P ¼ 0.0084, PRCC- TFE3 , P ¼ 0.0092). Representative data from at least three independent experiments are shown. D, Western blotting with anti-GPNMB and anti-histone H3 on HEK293-derived doxycycline-inducible cell lines cultured without and with doxycycline. E, Scheme of Luciferase reporter constructs with human GPNMB promoter. Putative TFE3 consensus sequences are listed as M-box1 (CACATGA) and M-box2 (TCACATGA). Wt, wild-type GPNMB promoter construct; Mt1: M-box1 is mutated to CTCGAGA; Mt2: M-box2 is mutated to TCTCGAGA; M-box1/2: both M-box1 and M-box2 are mutated to CTCGAGA and TCTCGAGA, respectively. F, Each Luciferase reporter construct and pGL4 as a negative control were transfected into PRCC-TFE3 doxycycline-inducible HEK 293 cell line with phRL internal control. Twelve hours after transfection, medium was changed to new medium with or without doxycycline, followed by additional 24-hour incubation and harvest. The x-axis displays relative Luciferase activity. GPNMB promoter activity is upregulated by PRCC-TFE3 induction in an M-Box–dependent manner. Data represent means SD (triplicate, unpaired t test: n.s., not significant; , P <0.01; , P <0.001). Representative data from at least three independent experiments are shown. G and H, ChIP was performed using anti-HA antibody on PRCC-TFE3 doxycycline-inducible HEK 293 cells cultured with or without doxycycline, followed by qPCR on ChIP samples. G, Scheme indicating the primer sets used for qPCR. H, ChIP-qPCR results demonstrate PRCC-TFE3 specifically binds to M-Box containing sequence in GPNMB promoter. Y-axis indicates % of input. Data represent means SD (triplicate, unpaired t test: n.s., not significant; , P <0.001).

changes in addition to PRCC-TFE3 expression. Of note, recent of driver gene mutations. In fact, our TFE3-RCC mice developed advances in next-generation sequencing technology have variable histologies, tumor doubling times, and responses to revealed the heterogeneity of cancer. Clonal heterogeneity with targeted therapeutics. This diverse phenotype may result from a different combinations of driver gene mutations has been well variety of driver gene mutations. Identiﬁcation and character- characterized in clear cell RCC (52, 53). We hypothesize that ization of additional TFE3-RCC driver gene mutations will TFE3-RCC may also display clonal heterogeneity with a variety contribute to a better understanding of the causes of TFE3-

OF10 Mol Cancer Res; 2019 Molecular Cancer Research

TFE3-RCC Mouse: A Model for Human Disease

A Cell line Age Sex Cytogenetics Fusion B GPNMB

β-Actin

UOK140

UOK115

UOK111

UOK109

UOK124

UOK146 UOK120 Xp11.2tRCC ccRCC

CDKIRP KIRC P < 0.0001 n.s.

P < 0.0001 n.s. 20 P < 0.0001 n.s. P < 0.0001 n.s. 20 15 15 10 10 5

Relative expression Relative 5

0 expression Relative ccRCC TFE3-RCC TFE3-RCCccRCC 0

GPNMB CTSK

TFE3-RCC

Total-pRCC

Type2-pRCC

Type1-pRCC

Type2-pRCC Type1-pRCC GPNMB CTSK

Figure 4. GPNMB overexpression differentiates TFE3-RCC from clear cell RCC and papillary RCC. A, Detailed information of four TFE3-RCC cell lines. B, Western blotting analysis demonstrates signiﬁcantly higher GPNMB expression in TFE3-RCC cell lines compared with ccRCC cell lines. C, Comparison of GPNMB and Cathepsin K (CTSK) expression in TFE3-RCC (n ¼ 4) and ccRCC (n ¼ 465). The gene expression database for ccRCC (KIRC) from TCGA project, which contained 4 cases of TFE3-RCC was utilized for analysis. D, The gene expression database for papillary RCC (KIRP) from TCGA containing 6 cases of TFE3-RCC was utilized to compare GPNMB and Cathepsin K (CTSK) expression in TFE3-RCC and papillary RCC. Total papillary RCC (n ¼ 283 without TFE3-RCC) includes 161 cases of type I papillary RCC and 79 cases of type II papillary RCC. Data are represented as a box-and-whisker plot. (unpaired t test with or without Welch correction, based on P value of the F test: n.s., not signiﬁcant).

RCC heterogeneity and facilitate the development of effective because the antigenicity of TFE3 can be easily altered by targeted therapeutics. This PRCC-TFE3 mouse model can be improper fixation and sample storage conditions. Therefore, utilized in future studies to evaluate potential driver gene pathologists often face difficulties to evaluate TFE3 staining (24, mutations by crossing with genetically engineered mice for 26). The break-apart FISH assay is recommended to augment selective gene deletion. the histopathologic diagnosis of TFE3-RCC (25, 27). However, Because the chimeric TFE3 proteins responsible for TFE3-RCC the FISH result may be judged as negative in cases in which the development act as oncogenic transcription factors, transcription- partner localizes to the vicinity of TFE3 on the short arm of ally upregulated direct targets of chimeric TFE3 could be prom- chromosome X (54). Hence, a surrogate marker that can be ising candidates for TFE3-RCC diagnostic markers. Gpnmb was used for routine pathologic diagnosis in FFPE tissues is desired. one of the most significantly upregulated genes in PRCC-TFE3– We found that GPNMB immunostaining using FFPE tissues was expressing kidneys, and, with luciferase reporter assays and ChIP- positive in all 9 human TFE3-RCCs in this study. Furthermore, qPCR, we have shown that GPNMB is a direct transcriptional our study showed that 55 of 56 (98.2%) sporadic ccRCCs and target of PRCC-TFE3. GPNMB expression was significantly higher 17 of 20 (85.0%) sporadic papillary RCCs were negatively in human TFE3-RCCs than in clear cell or papillary RCCs, thereby stained for GPNMB (Table 3). Although sporadic chromo- demonstrating high sensitivity and specificity as a biomarker for phobe RCCs and hybrid oncocytic tumors associated with BHD TFE3-RCC. syndrome also stain for GPNMB (40), these tumors are histo- In pathologic diagnosis of TFE3-RCCs using FFPE tissues, logically distinctive and rarely need to be distinguished from strong TFE3 nuclear immunostaining is considered the diag- TFE3-RCCs. Pathologists may find GPNMB immunostaining nostic gold standard (19), but TFE3 IHC can be problematic useful in diagnosing TFE3-RCC when tumors have papillary

www.aacrjournals.org Mol Cancer Res; 2019 OF11

Baba et al.

H&E TFE3 GPNMB Cathepsin K A DGJ Case 1 male ASPL-TFE3

100 μm

B EHK Case 4 female PRCC-TFE3

50 μm

CF I L Case 8 female SFPQ-TFE3

50 μm

Figure 5. Immunostaining of TFE3, GPNMB, and Cathepsin K in human TFE3-RCCs. A–L, Histology, IHC (TFE3, GPNMB, and Cathepsin K), and TFE3 gene break-apart FISH on representative cases of human TFE3-RCC with different TFE3 fusion genes (Cases #1, 4, 8 in Table 1). A–C, H&E staining displays characteristic histology resembling clear cell RCC and papillary RCCs composed of epithelioid clear cells and eosinophilic cells. Occasional psammoma bodies are seen. D–F, IHC shows nuclear staining for TFE3. Representative images of TFE3 gene break-apart FISH are inserted. All cases show TFE3 translocations represented by separation of green and red probes. The male case has a split (D) and the female cases have split and fused signals (E and F). G–I, Immunostaining for GPNMB demonstrates signiﬁcant cytoplasmic staining. J–L, IHC of Cathepsin K demonstrates either negative staining (J and K) or positive staining (L).

and/or clear cell morphologies with indefinite TFE3 staining. target for advanced TFE3-RCC. An antibody–drug conjugate This histopathologic study was based on a limited number of (ADC) targeting GPNMB, glembatumumab vedotin, comprised human TFE3-RCC cases. Amassing additional clinicopathologic of an anti-GPNMB antibody conjugated to a cellular toxin, data will be necessary for a better understanding of the clin- monomethylauristatin E (MMAE), causes death of GPNMB-pos- icopathologic signature of TFE3-RCC, which will contribute to itive cells. Indeed, glembatumumab vedotin is being evaluated in the design of potential therapeutic agents for treating advanced clinical trials for several cancers, including advanced melanoma cases of TFE3-RCC. and breast cancer (56). It would be of interest to test this ADC in a Our study provides a valuable model for the development of preclinical study in the PRCC-TFE3 mouse model. GPNMB is also targeted therapies for advanced TFE3-RCC. PRCC-TFE3 mouse known to promote tumor growth and invasion through model kidneys and human TFE3-RCC samples demonstrate sig- integrin signaling, VEGFR activation, or EGFR activation (45, 57). nificant elevation of RET expression. Moreover, the RET inhibitor Targeting GPNMB signaling may also be a promising strategy for vandetanib significantly suppressed TFE3-RCC growth in mice. treatment of advanced TFE3-RCC. Our current work has provided The receptor tyrosine kinase inhibitor vandetanib is FDA the basis for the development of effective therapies against approved for the treatment of advanced cases of medullary advanced TFE3-RCC that eventually could lead to clinical thyroid carcinoma (55). Because there is no established treatment trials that may benefit patients with this very aggressive form of for advanced TFE3-RCC with poor prognosis, vandetanib or other RCC. multiple tyrosine kinase inhibitors that target RET could be promising candidates as effective therapeutic agents for advanced Disclosure of Potential Conflicts of Interest TFE3-RCC. In addition, GPNMB itself could be a therapeutic M. Baba reports receiving commercial research grant from Ono Pharmaceu- tical Co. Ltd and Bristol-Myers Squibb K.K. No potential conflicts of interest were disclosed by the other authors.

Table 2. Summary of IHC ﬁndings in patients with TFE3-RCC Negative Positive 1þ 2þ Disclaimer ﬂ TFE3 0%(0/9) 100%(9/9) 1 8 The content of this publication does not necessarily re ect the views or GPNMB 0%(0/9) 100%(9/9) 2 7 policies of the Department of Health and Human Services, nor does mention of Cathepsin K 33%(3/9) 67%(6/9) 4 2 trade names, commercial products, or organizations imply endorsement by the US Government. All the funding sources had no involvement in study design, data collection, data interpretation, report writing, or decision to submit the Table 3. Summary of GPNMB staining on human RCC samples paper for publication. NCI-Frederick at the Frederick National Laboratory for Negative Positive 1þ 2þ Cancer Research is accredited by AAALAC International and follows the Public TFE3-RCC 0%(0/9) 100%(9/9) 2 7 Health Service Policy for the Care and Use of Laboratory Animals. Animal care Clear cell RCC 98.2%(55/56) 1.8%(1/56) 1 0 was provided in accordance with the procedures outlined in the "Guide for Care Papillary RCC 85.0%(17/20) 15.0%(3/20) 3 0 and Use of Laboratory Animals (National Research Council; 1996; National Academy Press; Washington D.C.).

OF12 Mol Cancer Res; 2019 Molecular Cancer Research

TFE3-RCC Mouse: A Model for Human Disease

Authors' Contributions # 18K19619, #18K19553), Grant-in -Aid for Scientific Research on Innovative fi Conception and design: M. Baba, M. Furuya, H. Hasumi, Y. Huang, Areas (#16H06276), Grant-in-Aid for Scienti c Research (C; #18K09140), Y. Nagashima, M. Yao, L.S. Schmidt, W.M. Linehan Novartis Research Grant, a Research grant from Ono Pharmaceutical Co. Ltd Development of methodology: M. Baba, M. Furuya, H. Hasumi, Y. Huang, and Bristol-Myers Squibb K.K. Grant, the Joint Usage/Research Center Program I. Kato, J.D. Kalen, W.M. Linehan of the Advanced Medical Research Center, Yokohama City University (Yoko- Acquisition of data (provided animals, acquired and managed patients, hama, Japan), and the program of the Joint Usage/Research Center for Devel- provided facilities, etc.): M. Baba, M. Furuya, T. Motoshima, M. Lang, opmental Medicine, Institute of Molecular Embryology and Genetics, Kuma- W. Ma, H. Hasumi, T. Kadomatsu, L. Ileva, J.D. Kalen, L.A.W. Krisna, moto University (Kumamoto, Japan). M. Furuya was supported by JSPS fi Y. Hasumi, R. Kurahashi, M. Oyama, Y. Nagashima, K. Araki, M. Eto, KAKENHI, Grant-in-Aid for Scienti c Research (C; #17K08745). T. Motoshima fi M. Yao, T. Kamba, Y. Oike, L.S. Schmidt, W.M. Linehan was supported by JSPS KAKENHI, Grant-in-Aid for Scienti c Research (C; Analysis and interpretation of data (e.g., statistical analysis, biostatistics, #16K11013) and AKUA (Asahi Kasei pharma Urological Academy) Research computational analysis): M. Baba, M. Furuya, M. Lang, S. Funasaki, W. Ma, H.- Grant. T. Kadomatsu was supported by JSPS KAKENHI, Grant-in-Aid for fi W. Sun, H. Hasumi, I. Kato, Y. Satou, A. Sugiyama, K. Nishimoto, Y. Nagashima, Scienti c Research (C; #18K07236). H. Hasumi was supported by JSPS fi T. Kamba, L.S. Schmidt, W.M. Linehan KAKENHI, Grant-in-Aid for Scienti c Research (C; #16K11020). Y. Nagashima fi Writing, review, and/or revision of the manuscript: M. Baba, M. Furuya, was supported by JSPS KAKENHI, Grant-in-Aid for Scienti c Research (C; M. Lang, H. Hasumi, I. Kato, K. Nishimoto, Y. Nagashima, N. Kuroda, #17K11162). T. Kamba was supported by JSPS KAKENHI, Grant-in-Aid for fi M. Yao, L.S. Schmidt, W.M. Linehan Scienti c Research (C; #18K09140). T. Suda was supported by a JSPS KAKENHI fi Administrative, technical, or material support (i.e., reporting or organizing Grant-in-Aid for Scienti c Research (S), (#18H05284, #26221309), and the data, constructing databases): M. Baba, M. Furuya, H. Hasumi, N. Morris, National Medical Research Council grant of Singapore Translational T. Suda, L.S. Schmidt, W.M. Linehan Research Investigator Award (NMRC/STaR/0019/2014). Y. Oike was sup- Study supervision: M. Baba, M. Furuya, H. Hasumi, Y. Oike, W.M. Linehan ported in part by a JSPS KAKENHI Grant-in-Aid for Challenging Research Others (assistance of the development of mouse model in this manuscript): (Exploratory; # 18K19519). This research was supported, in part, by the H. Hasumi Intramural Research Program of NIH, Frederick National Laboratory, Center Others (pathology services): B.O. Karim for Cancer Research. This project has been funded, in part, with Federal funds from the Frederick National Laboratory for Cancer Research, NIH, under contract HHSN261200800001E. Acknowledgments We thank Maria Merino for informative in-depth discussions of comparative human/mouse normal and abnormal histopathology, Nobuko Irie for excellent The costs of publication of this article were defrayed in part by the technical support and acknowledge the support provided to us by the University payment of page charges. This article must therefore be hereby marked of Texas Southwestern O'Brien Kidney Research Core Center and Peter Igarashi advertisement in accordance with 18 U.S.C. Section 1734 solely to indicate for Cadherin 16 (KSP)-Cre transgenic mice. pRosa26-DEST was a gift from Nick this fact. Hastie and Peter Hohenstein (Addgene plasmid # 21189). M. Baba was supported, in part, by a JSPS KAKENHI Grant-in-Aid for Scientific Research (S), (#18H05284, #26221309), Grant-in-Aid for Scientific Research (B; # Received November 19, 2018; revised March 12, 2019; accepted April 26, 15H04975, # 18H02938), Grant-in-Aid for Challenging Research (Exploratory; 2019; published first May 1, 2019.

References 1. de Jong B, Molenaar IM, Leeuw JA, Idenberg VJ, Oosterhuis JW. Cytoge- 10. Huang W, Goldfischer M, Babayeva S, Mao Y, Volyanskyy K, Dimitrova N, netics of a renal adenocarcinoma in a 2-year-old child. Cancer Genet et al. Identification of a novel PARP14-TFE3 gene fusion from 10-year-old Cytogenet 1986;21:165–9. FFPE tissue by RNA-seq. Genes Chromosomes Cancer 2015;54:500–5. 2. Shipley JM, Birdsall S, Clark J, Crew J, Gill S, Linehan WM, et al. Mapping 11. Argani P, Lui MY, Couturier J, Bouvier R, Fournet JC, Ladanyi M. A novel the X chromosome breakpoint in two papillary renal cell carcinoma cell CLTC-TFE3 gene fusion in pediatric renal adenocarcinoma with t(X;17) lines with a t(X;1)(p11.2;q21.2) and the first report of a female case. (p11.2;q23). Oncogene 2003;22:5374–8. Cytogenet Cell Genet 1995;71:280–4. 12. Creighton CJ, Morgan M, Gunaratne PH, Wheeler DA, Gibbs RA, Robertson 3. Sidhar SK, Clark J, Gill S, Hamoudi R, Crew J, Gwilliam R, et al. The t(X;1) A, et al. Comprehensive molecular characterization of clear cell renal cell (p11.2;q21.2) translocation in papillary renal cell carcinoma fuses a novel carcinoma. Nature 2013;499:43–9. gene PRCC to the TFE3 transcription factor gene. Hum Mol Genet 1996;5: 13. Malouf GG, Su X, Yao H, Gao J, Xiong L, He Q, et al. Next-generation 1333–8. sequencing of translocation renal cell carcinoma reveals novel RNA splic- 4. Ross H,Argani P. Xp11 translocation renal cell carcinoma. Pathology 2010; ing partners and frequent mutations of chromatin-remodeling genes. 42:369–73. Clin Cancer Res 2014;20:4129–40. 5. Weterman MA, Wilbrink M, Dijkhuizen T, van den Berg E, Geurts van Kessel 14. Cancer Genome Atlas Research Network, Linehan WM, Spellman PT, A. Fine mapping of the 1q21 breakpoint of the papillary renal cell Ricketts CJ, Creighton CJ, Fei SS, et al. Comprehensive molecular charac- carcinoma-associated (X;1) translocation. Hum Genet 1996;98:16–21. terization of papillary renal-cell carcinoma. N Engl J Med 2016;374: 6. Ladanyi M, Lui MY, Antonescu CR, Krause-Boehm A, Meindl A, Argani P, 135–45. et al. The der(17)t(X;17)(p11;q25) of human alveolar soft part sarcoma 15. Clark J, Lu YJ, Sidhar SK, Parker C, Gill S, Smedley D, et al. Fusion of splicing fuses the TFE3 transcription factor gene to ASPL, a novel gene at 17q25. factor genes PSF and NonO (p54nrb) to the TFE3 gene in papillary renal Oncogene 2001;20:48–57. cell carcinoma. Oncogene 1997;15:2233–9. 7. Argani P, Antonescu CR, Couturier J, Fournet JC, Sciot R, Debiec-Rychter M, 16. Kauffman EC, Ricketts CJ, Rais-Bahrami S, Yang Y, Merino MJ, Bottaro DP, et al. PRCC-TFE3 renal carcinomas: morphologic, immunohistochemical, et al. Molecular genetics and cellular features of TFE3 and TFEB fusion ultrastructural, and molecular analysis of an entity associated with the t kidney cancers. Nat Rev Urol 2014;11:465–75. (X;1)(p11.2;q21). Am J Surg Pathol 2002;26:1553–66. 17. Argani P, Olgac S, Tickoo SK, Goldfischer M, Moch H, Chan DY, et al. Xp11 8. Weterman MA, Wilbrink M, Geurts van Kessel A. Fusion of the transcription translocation renal cell carcinoma in adults: expanded clinical, pathologic, factor TFE3 gene to a novel gene, PRCC, in t(X;1)(p11;q21)-positive and genetic spectrum. Am J Surg Pathol 2007;31:1149–60. papillary renal cell carcinomas. Proc Natl Acad Sci U S A 1996;93:15294–8. 18. Hemesath TJ, Steingrimsson E, McGill G, Hansen MJ, Vaught J, 9. Argani P, Antonescu CR, Illei PB, Lui MY, Timmons CF, Newbury R, et al. Hodgkinson CA, et al. Microphthalmia, a critical factor in melanocyte Primary renal neoplasms with the ASPL-TFE3 gene fusion of alveolar soft development, defines a discrete transcription factor family. Genes Dev part sarcoma. Am J Pathol 2001;159:179–92. 1994;8:2770–80.

www.aacrjournals.org Mol Cancer Res; 2019 OF13

Baba et al.

19. Argani P, Lal P, Hutchinson B, Lui MY, Reuter VE, Ladanyi M. Aberrant 38. Ricketts CJ, De Cubas AA, Fan H, Smith CC, Lang M, Reznik E, et al. The nuclear immunoreactivity for TFE3 in neoplasms with TFE3 gene fusions: a Cancer Genome Atlas comprehensive molecular characterization of renal sensitive and specific immunohistochemical assay. Am J Surg Pathol 2003; cell carcinoma. Cell Rep 2018;23:313–26. 27:750–61. 39. Cerami E, Gao J, Dogrusoz U, Gross BE, Sumer SO, Aksoy BA, et al. The cBio 20. Kuroda N, Mikami S, Pan CC, Cohen RJ, Hes O, Michal M, et al. Review of cancer genomics portal: an open platform for exploring multidimensional renal carcinoma associated with Xp11.2 translocations/TFE3 gene fusions cancer genomics data. Cancer Discov 2012;2:401–4. with focus on pathobiological aspect. Histol Histopathol 2012;27:133–40. 40. Furuya M, Hong SB, Tanaka R, Kuroda N, Nagashima Y, Nagahama K, et al. 21. Komai Y, Fujiwara M, Fujii Y, Mukai H, Yonese J, Kawakami S, et al. Adult Distinctive expression patterns of glycoprotein non-metastatic B and Xp11 translocation renal cell carcinoma diagnosed by cytogenetics and folliculin in renal tumors in patients with Birt-Hogg-Dube syndrome. immunohistochemistry. Clin Cancer Res 2009;15:1170–6. Cancer Sci 2015;106:315–23. 22. Zhong M, De Angelo P, Osborne L, Paniz-Mondolfi AE, Geller M, Yang Y, 41. Kuroda N, Katto K, Tanaka Y, Yamaguchi T, Inoue K, Ohara M, et al. et al. Translocation renal cell carcinomas in adults: a single-institution Diagnostic pitfall on the histological spectrum of adult-onset renal carci- experience. Am J Surg Pathol 2012;36:654–62. noma associated with Xp11.2 translocations/TFE3 gene fusions. Med Mol 23. Cajaiba MM, Dyer LM, Geller JI, Jennings LJ, George D, Kirschmann D, et al. Morphol 2010;43:86–90. The classification of pediatric and young adult renal cell carcinomas 42. Calcagni A, Kors L, Verschuren E, De Cegli R, Zampelli N, Nusco E, et al. registered on the children's oncology group (COG) protocol AREN03B2 Modelling TFE renal cell carcinoma in mice reveals a critical role of WNT after focused genetic testing. Cancer 2018;124:3381–9. signaling. Elife 2016;5:e17047. 24. Srigley JR, Delahunt B, Eble JN, Egevad L, Epstein JI, Grignon D, et al. The 43. Weterman MA, Wilbrink M, Janssen I, Janssen HA, van den Berg E, Fisher International Society of Urological Pathology (ISUP) Vancouver Classifi- SE, et al. Molecular cloning of the papillary renal cell carcinoma-associated cation of Renal Neoplasia. Am J Surg Pathol 2013;37:1469–89. translocation (X;1)(p11;q21) breakpoint. Cytogenet Cell Genet 1996;75: 25. Green WM, Yonescu R, Morsberger L, Morris K, Netto GJ, Epstein JI, et al. 2–6. Utilization of a TFE3 break-apart FISH assay in a renal tumor consultation 44. Lopez-Beltran A, Scarpelli M, Montironi R, Kirkali Z. 2004 WHO classifi- service. Am J Surg Pathol 2013;37:1150–63. cation of the renal tumors of the adults. Eur Urol 2006;49:798–805. 26. Kuroda N, Tanaka A, Ohe C, Nagashima Y. Recent advances of immu- 45. Tanaka M, Homme M, Yamazaki Y, Shimizu R, Takazawa Y, Nakamura T. nohistochemistry for diagnosis of renal tumors. Pathol Int 2013;63: Modeling alveolar soft part sarcoma unveils novel mechanisms of metas- 381–90. tasis. Cancer Res 2017;77:897–907. 27.RaoQ,WilliamsonSR,ZhangS,EbleJN,GrignonDJ,WangM,etal. 46. Kobos R, Nagai M, Tsuda M, Merl MY, Saito T, Lae M, et al. Combining TFE3 break-apart FISH has a higher sensitivity for Xp11.2 translocation- integrated genomics and functional genomics to dissect the biology of a associated renal cell carcinoma compared with TFE3 or cathepsin K cancer-associated, aberrant transcription factor, the ASPSCR1-TFE3 fusion immunohistochemical staining alone: expanding the morphologic oncoprotein. J Pathol 2013;229:743–54. spectrum. Am J Surg Pathol 2013;37:804–15. 47. Davis IJ, Hsi BL, Arroyo JD, Vargas SO, Yeh YA, Motyckova G, et al. Cloning 28. Hohenstein P, Slight J, Ozdemir DD, Burn SF, Berry R, Hastie ND. High- of an Alpha-TFEB fusion in renal tumors harboring the t(6;11)(p21;q13) efficiency Rosa26 knock-in vector construction for Cre-regulated over- chromosome translocation. Proc Natl Acad Sci U S A 2003;100:6051–6. expression and RNAi. Pathogenetics 2008;1:3. 48. Kuiper RP, Schepens M, Thijssen J, van Asseldonk M, van den Berg E, Bridge 29. Shao X, Somlo S, Igarashi P. Epithelial-specific Cre/lox recombination in J, et al. Upregulation of the transcription factor TFEB in t(6;11)(p21;q13)- the developing kidney and genitourinary tract. J Am Soc Nephrol 2002;13: positive renal cell carcinomas due to promoter substitution. Hum Mol 1837–46. Genet 2003;12:1661–9. 30. Baba M, Furihata M, Hong SB, Tessarollo L, Haines DC, Southon E, et al. 49. Hong SB, Oh H, Valera VA, Baba M, Schmidt LS, Linehan WM. Inactivation Kidney-targeted Birt-Hogg-Dube gene inactivation in a mouse model: of the FLCN tumor suppressor gene induces TFE3 transcriptional activity by Erk1/2 and Akt-mTOR activation, cell hyperproliferation, and polycystic increasing its nuclear localization. PLoS One 2010;5:e15793. kidneys. J Natl Cancer Inst 2008;100:140–54. 50. Sardiello M, Palmieri M, di Ronza A, Medina DL, Valenza M, Gennarino 31. Hasumi H, Baba M, Hasumi Y, Lang M, Huang Y, Oh HF, et al. Folliculin- VA, et al. A gene network regulating lysosomal biogenesis and function. interacting proteins Fnip1 and Fnip2 play critical roles in kidney tumor Science 2009;325:473–7. suppression in cooperation with Flcn. Proc Natl Acad Sci U S A 2015;112: 51.Roczniak-FergusonA,PetitCS,FroehlichF,QianS,KyJ,AngarolaB, E1624–31. et al. The transcription factor TFEB links mTORC1 signaling to 32. Subramanian A, Tamayo P, Mootha VK, Mukherjee S, Ebert BL, Gillette MA, transcriptional control of lysosome homeostasis. Sci Signal 2012;5: et al. Gene set enrichment analysis: a knowledge-based approach for ra42. interpreting genome-wide expression profiles. Proc Natl Acad Sci U S A 52. Gerlinger M, Horswell S, Larkin J, Rowan AJ, Salm MP, Varela I, et al. 2005;102:15545–50. Genomic architecture and evolution of clear cell renal cell carcinomas 33. Mootha VK, Lindgren CM, Eriksson KF, Subramanian A, Sihag S, Lehar J, defined by multiregion sequencing. Nat Genet 2014;46:225–33. et al. PGC-1alpha-responsive genes involved in oxidative phosphorylation 53. Turajlic S, Xu H, Litchfield K, Rowan A, Horswell S, Chambers T, et al. are coordinately downregulated in human diabetes. Nat Genet 2003;34: Deterministic evolutionary trajectories influence primary tumor growth: 267–73. TRACERx renal. Cell 2018;173:595–610. 34. Baba M, Hong SB, Sharma N, Warren MB, Nickerson ML, Iwamatsu A, et al. 54. Argani P, Zhang L, Reuter VE, Tickoo SK, Antonescu CR. RBM10-TFE3 renal Folliculin encoded by the BHD gene interacts with a binding protein, cell carcinoma a potential diagnostic pitfall due to cryptic intrachromo- FNIP1, and AMPK, and is involved in AMPK and mTOR signaling. somal Xp11.2 inversion resulting in false-negative TFE3 FISH. Am J Surg Proc Natl Acad Sci U S A 2006;103:15552–7. Pathol 2017;41:655–62. 35. Anglard P, Trahan E, Liu S, Latif F, Merino MJ, Lerman M, et al. Molecular 55. Valerio L, Pieruzzi L, Giani C, Agate L, Bottici V, Lorusso L, et al. and cellular characterization of human renal cell carcinoma cell lines. Targeted therapy in thyroid cancer: state of the art. Clin Oncol 2017; Cancer Res 1992;52:348–56. 29:316–24. 36. Sourbier C, Srivastava G, Ghosh MC, Ghosh S, Yang Y, Gupta G, et al. 56. Rose AAN, Biondini M, Curiel R, Siegel PM. Targeting GPNMB with Targeting HIF2alpha translation with Tempol in VHL-deficient clear cell glembatumumab vedotin: current developments and future opportunities renal cell carcinoma. Oncotarget 2012;3:11. for the treatment of cancer. Pharmacol Ther 2017;179:127–41. 37. Baba M, Endoh M, Ma W, Toyama H, Hirayama A, Nishikawa K, et al. 57. Taya M, Hammes SR. Glycoprotein non-metastatic melanoma protein B Folliculin regulates osteoclastogenesis through metabolic regulation. (GPNMB) and cancer: a novel potential therapeutic target. Steroids 2018; J Bone Miner Res 2018;33:1785–98. 133:102–7.

OF14 Mol Cancer Res; 2019 Molecular Cancer Research

TFE3 Xp11.2 Translocation Renal Cell Carcinoma Mouse Model Reveals Novel Therapeutic Targets and Identifies GPNMB as a Diagnostic Marker for Human Disease

Masaya Baba, Mitsuko Furuya, Takanobu Motoshima, et al.

Mol Cancer Res Published OnlineFirst May 1, 2019.

Updated version Access the most recent version of this article at: doi:10.1158/1541-7786.MCR-18-1235

Supplementary Access the most recent supplemental material at: Material http://mcr.aacrjournals.org/content/suppl/2019/05/01/1541-7786.MCR-18-1235.DC1

E-mail alerts Sign up to receive free email-alerts related to this article or journal.

Reprints and To order reprints of this article or to subscribe to the journal, contact the AACR Publications Subscriptions Department at [email protected].

Permissions To request permission to re-use all or part of this article, use this link http://mcr.aacrjournals.org/content/early/2019/05/22/1541-7786.MCR-18-1235. Click on "Request Permissions" which will take you to the Copyright Clearance Center's (CCC) Rightslink site.