Characterization of Microbial Contaminants

Associated with Floor Material Types

Dissertation

Presented in Partial Fulfillment of the Requirements for the Degree Doctor of Philosophy in the Graduate School of The Ohio State University

Mridula Gupta Graduate Program in Public Health

The Ohio State University

2017

Dissertation Committee:

Michael S. Bisesi

Jiyoung Lee

John Mac Crawford

Judith Schwartzbaum Copyright by

Mridula Gupta 2017

Abstract

People spend a major part of their time indoors, including time spent at their workplace and residence. Indoor environmental quality plays a vital role contributing to human health and wellbeing. Part of the indoor environment is flooring. Although the type of flooring material has been regarded to be an influencing factor for indoor air quality, there is a dearth of studies comparing the contribution of several flooring types in environmental contamination.

The primary goal of this dissertation was to compare the various floor materials and their potential contribution to fate of environmental microbial contaminants. To achieve this goal, studies were designed to determine: a) the most efficient surface sampling method to estimate microbiological composition; b) Survivability of S. aureus and spores of A. niger on five common floor materials; c) Survivability of soil microbes on two common floor materials. and d) Bacterial microbiome analysis of floor samples in three buildings.

Comparison of three surface sampling methods on five floor materials found that the bulk-rinsate sampling method was the most sensitive and efficient method to quantify microbial contaminants from floor surfaces. The bulk-rinsate method uses the entire floor sample material and thus measures total biocontaminants associated with the floor surface.

Five floor materials (commercial carpet, residential carpet, vinyl tile, wood, and porcelain tile) were inoculated with known bacteria (Staphylococcus aureus) and fungi (Aspergillus

niger) as well as composite of microbes (bacteria and fungi) extracted from soil for survivability studies. Carpets both residential and rubber backed commercial showed a decline in survivability of both S. aureus and spores of A. niger in the absence of nutrition.

While in the presence of additional nutrient (simulated in-use) S. aureus showed growth on carpets. In addition, A. niger spores which completely disappeared without nutrition, was viable up to day 28 in the presence of nutrition.

Hard surface floor materials -- vinyl, wood and porcelain-- had similar survivability patterns of both S. aureus and spores of A. niger. Both S. aureus and spores of A. niger had higher and longer survivability on vinyl in the presence of additional nutrient. This additional nutrient (Nutrient broth and 1XPBS) was a simulation for in-use condition and represents the potential of floor surfaces, especially if labile nutrient sources are present, to sustain microbial growth. Similar results were obtained with bacteria and fungi from soil inoculate. Soil bacteria on both carpets and floors survived for day 28.

Microbiome analysis for bacterial composition of actual in use floor materials was carried out using surface samples from floors located in a human hospital, a veterinary hospital and an office. Culture independent next generation sequencing was performed to identify the bacterial composition. The bacterial composition of the carpets and vinyl floors did not differ statistically. Both floor samples had bacterial composition enriched with soil bacteria. Proteobateria was the major phylum on all the floors. The composition also did not differ between the three buildings. However, traffic patterns were found to be significant for the Operational Taxonomic Unit (OTU) level. Higher traffic area had higher OTUs as well as high number of antibiotic resistance gene (tetQ) copies per floor sample.

iii

The studies conducted to fulfill the requirements for this dissertation attempted to fill in the knowledge gap of survivability of bacteria and fungi on various environmental surfaces, such as floors. The survivability of clinically important bacteria and fungi for four weeks on floors may contribute significantly to environmental contribution Finally, as evident from the study, floors surfaces could be enriched with soil microbes containing pathogenic bacteria and antibiotic resistance organisms which pose a significant public health risk.

Dedication

I dedicate this dissertation to my family: my parents, for instilling me the value of education,

my husband, for his continued support & encouragement, and my children, who kept me

cheerful throughout pursuit of my degree.

Acknowledgments

I feel very humble and seek great pleasure to thank everyone who helped and inspired me for successful completion of my dissertation. I am extremely grateful to the support and suggestions I received from my dissertation committee. I am forever indebted to my advisor, Dr. Michael Bisesi for his financial support throughout my degree. I am also very thankful to my co-advisor Dr. Jiyoung Lee for inspiring me to do microbiome study which was a new addition to my study. I am grateful to Dr. J. Mac Crawford for his support and inspiration. Dr. Judith Schwartzbaum: thank you for agreeing to be in my committee in my last hour.

I am very thankful to my friends especially Seonjoong Lee and Grace Park for their support for microbiology work. I could not have done without them. I would also like to thank faculty and staff of College of Public Health, and friends who helped me one way or another in due course of study.

Vita

1997……………………………………………………….. High School Birat Science College, Nepal

2001………………………………………………………..B.S. Biology/Zoology, Tribhuvan University, Nepal

2004……………………………………………………….M.Sc. Zoology/Parasitology Tribhuvan University, Nepal

2008……………………………………………………… MPH, Public Health, The University of Georgia

2009- present……………………………………………… Doctoral student, The Ohio State University

2007-2008……………………………………….………….Graduate Teaching Assistant The University of Georgia

2009-2010 ……………………………………..…………...Graduate Fellow, The Ohio State University

2010-2014…………………………………………………. Graduate Teaching Assistant, The Ohio State University

Fields of study

Major Field: Public Health

Specializations: Epidemiology, Environmental Health Sciences

vii

Table of contents

Abstract...... ii Dedication...... v Acknowledgments...... ,.vi Vita...... vii Fields of Study...... vii List of Tables...... ix List of Figures...... xi

Chapter 1: Introduction...... 1

Chapter 2: Comparison of surface sampling across multiple floor material……...... 18 (Manuscript 1)

Chapter 3: Survivability of Staphylococcus aureus and Aspergillus niger spores on various floor materials (Manuscript 2 )…...... ………………...... 31

Chapter 4: Survivability of staphylococcus aureus and Aspergillus niger on floor materials with and without nutrient…………………………………………………….. 48

Chapter 5: Survivability of soil bacteria and fungi on floor materials and identification of survived bacteria ……………...………………………………………………………... 64

Chapter 6: Bacterial composition of floors in three different building types……….…. 77

Chapter 7: Synthesis and Discussion……………….…………………………………. 103

References...... 108

Appendix A: Additional Microbiome Data analysis…………………………………. .124

viii

List of Tables

Chapter 2

Table 2.1: Bacterial log10 mean cfu/25 cm2 of different floor materials measured by three different sampling methods ……………………………………………………………….……...25

Table 2.2: Fungal log10 mean cfu/25 cm2 of different floors measured by three different sampling methods ………………………………………………………………..……………...26

Chapter 3

Table 3.1. Inoculation concentration and change in Staphylococcus aureus levels on different floor material types from Day 0 to Day 28. ……………………………………….…………..... 39

Table 3. 2. Inoculation concentration and change in the levels of Aspergillus niger culturable spores on different floor material types from Day 0 to Day 28 ………………………...………..42

Chapter 4

Table 41: Sample size, Inoculation volume, Nutrient volume information…………….………..50

Table 4.2: Mean change in log10 cfu/25cm2 of S. aureus on tested days comparing nutrition .. 54.

Table 4.3: Mean change in log10 cfu/25cm2 of A. niger on tested days comparing nutrition.....57

Table 4.4: Mean change in log10 cfu/25cm2 of S. aureus on tested days comparing floor ….….59

2 Table 4.5 Mean change in log10 cfu/25cm of A. nigers on tested days comparing floor ……….60

Chapter 5

Table 5. 1: Sample size, Inoculation volume, and Nutrient volume ………...... 67

Table 5.2: Change in soil bacteria on selected floor materials………………………………,.....70

Table 5.3: Change in soil fungi on selected floors….. ………………………………………...... 70

Table 5.4: Bacterial species identified from floor surface after 14 days of soil inoculation…...... 75

Chapter 6

Table 6. 1: Sampling location details for microbiome samples………………..……………...... 82

Table 6.2: Bacterial diversity of the microbiome samples…………………………………….…88

Appendix

Table A.1: Permanova Table to test the similarity in bacterial composition………………...….124

Table A.2 Analysis of Similarity (ANOSIM) to test the similarity in bacterial composition….126

List of Figures

Chapter 2

Fig 2.1: Bacterial CFU measured by three different surface sampling method…. ….…..24

Fig 2.2: Fungal CFU measured by three different surface sampling method…………... 24

Chapter 3

Fig 3.1 Comparison of survivability of S. aureus on different floor material types for day 0 to day 28. …………………………………………..……..…………………….. …… 40

Fig 3.2. Comparison of the survivability of A. niger spores on different floor material types for 28 days. …………………………………………..…………………………... 43

Chapter 4

Fig: 4.1 Survivability of S. aureus on floor materials in the presence of nutrient broth ..55

Fig: 4.2 Survivability of A.. niger on floor materials in the presence of nutrient broth…57

Chapter 5

Fig 5.1: Surviavability of soil microbes on floor ……………………………………… 69

Chapter 6

Fig 6.1 OTUs levels according to Floor, Traffic, and Building types…....……………...87

Fig 6.2: Predictive margins for OTU levels of floor based on traffic. …………………..88

Fig 6.3 Boxplot of diversity indices as measured by Shannon diversity index according to the Building, Traffic, and Floor types…………………………………...... ……..89

Fig 6.4 Boxplot of diversity indices as measured by Simpson diversity index according to the Building, Traffic, and Floor types…………………………………...... 90

Fig 6.5 Relative abundance of top 6 Phylum according to Building types….………...... 92

Fig 6.6: Absolute abundance of top 15 order of individual samples………………..…...93

Fig 6.7: Absolute abundance of top 50 genus according to Building types…………..…94

Fig 6.8 Principle coordinate analysis of the individual samples………………………....96

Fig 6.9. Abundance of tetQ gene present in individual floor samples………….....… .. .97

xii

CHAPTER 1: INTRODUCTION

Background

Since most people spend more than 85% of their time indoors, it is intuitive that indoor environmental quality may affect human health. Floor surface contamination is an important part of indoor environmental quality. The various types of floor materials available these days may differ in supporting, inhibiting, or accumulating biological contamination. From the environmental contamination standpoint, there is limited research comparing effects of different floor material types on types and numbers of microbiological contaminants. Accordingly, this research was designed to study the influence of various floor materials on microbiological contaminants in the indoor environment.

Purpose and Rationale

Various researchers have found conflicting results when comparing microbial contaminants on floor materials. Most floor material studies include “smooth” carpets versus “hard”, non-carpet surfaces, like vinyl and wood. Rylander et al. (1974) reported higher bacterial counts on vinyl tiles than on carpets. However, Anderson et al. (1984) reported higher microbial counts of E. coli, S. aureus, P. aeruginosa on carpets.

Similarly, Foarde and Berry (2004) reported higher bacterial counts on carpet surfaces than on vinyl surfaces in schools. In a Turkish hospital study, researchers sampled various areas of the hospital floor and found vinyl surfaces to be more susceptible to colonization of Staphylococcus aureus than ceramic tiles (Yazgi et al.

2009) and Harris et al. (2010) found higher levels of pathogenic bacteria on vinyl surfaces than on carpets. They also observed that vinyl surfaces harbor fewer bacterial genera than carpets do. Carpet surfaces may therefore be suitable for the growth of a more diverse group of bacteria than vinyl is. In terms of fungal contamination, carpets surfaces have been studied extensively. Dust samples collected from carpet surfaces has been found to be contaminated with toxigenic Aspergillus spp. (Englhart et al. 2002;

Macher 2001). Limited research is available for Vinyl surfaces in relation to fungal contamination. Few studies focused on collecting dust samples for fungal contamination involve sampling from vinyl floors. (Lee et al. 2006; Yamamoto et al. 2011). Yamamoto et al. (2011) assessed and reported allergenic fungal contamination in house dust, collecting samples from vinyl using wipe methods.

The role of floor surface is of higher significance in healthcare industries because of its possible role in contributing to nosocomial infections. In a literature review for evidenced-based healthcare design, Ulrich et al. (2008) identified many studies that examined the relationship between airborne infections and environmental factors in hospital buildings, including floorings. They acknowledge that very little is known about the role of carpets in environmental contamination. The Center for Health Care Design identifies flooring as an important part of patient care quality and has highlighted an

urgent need of evidenced-based research on floor surface contamination and the potential

risk of Healthcare Associated Infections (Nanda et al. 2012).

As identified, there are only few comparative studies on floor materials. The

results of which are insufficient, are too contradictory, and inconsistent to draw any

conclusions on the effect of various floor material surfaces on biological contaminants.

The present study was designed to fill this knowledge gaps by comparing the various

floor materials and their contribution to biological contamination of indoor air quality.

Specific Aims

Specific Aim 1: Conduct lab study to compare surface sampling methods on selected

floor materials. Although there are several types of floor materials available, for this

study purpose, four major floor types will be chosen for study; vinyl, porcelain tile,

wood, and carpet. The microbial load measured under each sampling method will be

compared for each floor materials. The result will test the following hypothesis.

Hypothesis 1: Different sampling methods will measure the bacterial and fungal

load differently across selected floor materials.

Specific Aim 2A: Conduct lab study to compare microbial survivability of known

bacteria and fungi on selected floor materials. Floor materials will be inoculated with

Staphylococcus aureus and spores of Aspergillus niger. Similar experiment will be

repeated for simulated in-use condition with addition of extra nutrients.

Specific Aim 2B: One of the major source of biological agents in indoor environment is

outdoor source. This include soil particles tracked inside the house. To understand the

differential survivability of soil microbes on floor materials, floor materials will be

inoculated with soil bacteria and fungi.

The survivability of these microbes (S. aureus, spores of A. niger, soil bacteria,

and soil fungi) will be determined on Day 0, Day 2, Day 7, Day 14 and Day 28. Changes

in the concentration of these organisms on each floor over the test days will determine the

differential impact of various floor materials in sustaining (or inhibiting) microbes.

The result from these experiments will be tested for following hypotheses.

Hypothesis 2a: Survivability of bacteria and fungal spores (measured by

culturable spores) count will differ across selected floor materials

Hypothesis 2b: Survivability of bacteria and fungal spore (measured by

culturable spores) will differ with and without added nutrient for each floor material.

Hypothesis 2c: Survivability of soil bacteria and fungal spore (measured by

culturable spores) will differ across selected floor materials.

Specific Aim 3 (SA3): Bacterial composition of floors in different built environment may

differ because of the difference in usage pattern and varying occupants. An exploratory

study is designed to explore and compare bacteria composition (microbiome) on two

different floor materials of various built environment testing the following hypothesis.

Hypothesis 3: Bacterial composition of in-use carpet and vinyl tile in built environmental will differ.

The research work related with each Specific Aim and Hypothesis is described in

Chapters 2 to 6. Hypothesis 1 is described in chapter 2, Hypotheses 2a, 2b, and 2c are described in Chapters 3, 4, and 5 respectively. Chapter 6 contains research performed for

Hypothesis 3. The final Chapter summarizes all the findings and includes conclusion, public health significances and limitations of the study.

LITERATURE REVIEW

Indoor Environmental Quality

A national survey conducted by Klepeis and his group (2001) estimates that

Americans spend almost 87% of their time indoors, including time spent at their workplace, and residence. Accordingly, indoor environmental quality is a relevant public health issue. Although several regulations and guidelines exist for outdoor air and environmental quality, no laws or enforcement procedures exist to control the indoor air or environmental quality in residential settings. There are, however, applicable regulations and guidelines for indoor workspaces, which, at times, are applied to residential settings.

Indoor environmental quality depends upon, and is affected by, several factors. Airborne gases or particles, and bioaerosols released from indoor sources are important components that affect indoor air quality. Airborne particles may contain numerous

compounds, both chemical and biological in nature, including particulate matter, volatile organic compounds, bacteria, allergens, viruses and fungi (Macher et al. 2005; Miller

1992; Owen et al. 1992; Whitehead et al. 2011; Wolkoff P. .2012). One of the major reservoirs of airborne particles is flooring materials. Floors are generally made up of one of the followings: wood, ceramic or porcelain tiles, wool or synthetic-backed carpets, vinyl, and linoleum.

Carpet is one of the main popular flooring choices for residential and commercial buildings (World Floor Covering Association (WFCA). According to the carpet and rug industry, about 51% of US floorings comprise of carpets. Carpets provide both functional value and aesthetic appeal to interior space and come in various designs and shapes that suit virtually every sort of need for different types of indoor settings. It also reduces noise and provide non-slip surfaces, ideal for places like hospitals and schools. In the US, more than 90% of carpets are produced by tufting various layers of yarns onto a backing system (WFCA; Carpet Buyer’s Handbook). The arrangement of the yarn might be in different styles, giving carpets various surfaces and textures. Fabrics used in carpet are chiefly plastic, nylon, olefin, jute, and wool systems (WFCA; Carpet Buyer’s Handbook;

Fine Flooring 2012; You H. 2008) Backing system can be made of synthetic latex, adhesive or bonding layer, and a secondary fabric layer. It might have additional features like anti-microbial or anti-static. Commercial carpet tiles come with a rubber backing which can be glued onto the surface directly.

Contaminants in or on floor surfaces, potentially affecting indoor air quality, are categorized as chemical or biological contaminants.

Chemical contaminants: Chemical contaminants associated with floor materials can be

divided into two sub-categories. The first one refers to chemicals that are used during the

manufacturing and installation process. The second one deals with the contaminants that

result from the normal wear and tear process.

Floor materials are treated with various chemicals during manufacturing process

as well as during installation. In order to achieve certain properties like flame resistance,

stain resistance, longevity, and microbial growth resistance, often these floor materials

are treated with chemicals.. Various adhesives and glues are also used during installation.

Several researchers have characterized chemicals present in carpets, wood, and vinyl

tiles, particularly volatile organic compounds or VOCs which are important contaminants

releasing especially from carpets and woods (Owen et al. 1992; Whitehead et al. 2011;

Wolkoff P. 2012; Mendell J. 2007; EPA-VOC). These gaseous chemicals, off-gassed

during and after installation, give a “new carpet smell”. Airborne VOCs are associated

with eye, nose and throat irritation, allergy, dizziness, and fatigue to name a few

(Wolkoff P. 2012). Mendell (2007) reported growing bodies of epidemiological evidence

outside of the US showing an association between indoor chemical emissions and

respiratory and allergic health effects.

The second concern with respect to chemical contaminants results from normal

in-use conditions. Most flooring materials have a lifespan of ten years or more (World

Floor Association). According to the Carpet Buyer’s Handbook, average floor carpets

have a life span of 7–20 years depending upon the usage pattern and setting. With normal

wear and tear, dust and moisture can build up on floor materials. The dust particles settle

on floor materials until cleaned off. On carpets, especially, these dust particles and

associated chemicals can settle on the backing system and remain there until the carpet is

removed entirely. Hence, dust building up, and can eventually become a sink for

particulate matter (PM) and dust-bound chemicals.

Biological contaminants: Biological contaminants consist of viruses, bacteria, fungi,

spores, toxins, allergens, pollens, etc. (Douwes 2003). Bacteria are simple

microorganisms that are made up of single cells. They are an integral part of nature,

present virtually everywhere, and play an important role in the health of human beings.

Broadly speaking, bacteria are classified into two groups, based on the Gram stain: Gram

positive and Gram negative. Both Gram positive and Gram negative bacteria are found in

indoor environments; however, many Gram positive bacteria dominate the indoor

environment (Rintala et al. 2008; Narui et al. 2008). The proportion of Gram positive and

Gram negative bacteria on floor surface materials may differ depending on type of

building like offices, hospitals, or schools (Rintala et al. 2008; Narui et al. 2008;

Khojasteh. et al. 2012). Clinically important bacteria found mainly in the indoor

environment, including floors, are Staphylococcus aureus, Staphylococcus epidermis,

Corynebacterium diphtheroides, Escherichia coli, Klebsiella pneumonia, Pseudomonas

aeruginosa, Proteus mirabilis, Salmonella typhi and Shigella dysenteriae. (Anderson et

al. 1982; Boyce 2007; Rintala et al. 2008; Harrison et al.1992; Narui et al. 2009;

Khojasteh et al. 2005). On floor surfaces especially, Bouillard et al. (2005) reported about

175 bacterial species with almost 70% being gram positive cocci. Others have reported antibiotic-resistant bacteria like Methicillin-resistant Staphylococcus aureus (MRSA) on common household environmental surfaces, including carpets (Davis et al. 2012).

Fungi are simple multicellular organisms with a true nucleus capable of forming fungal spores that can germinate under suitable circumstances. Fungal spores are associated with various health effects, including allergic reactions, irritation, and respiratory health effects. Some fungi can produce a fungal toxin known as mycotoxin, which can cause respiratory allergies and can also weaken the immune system in humans.

Typical fungi associated with floor materials are Aspergillus niger, Penicillium funiculosum, Cladosporium herbarum, Candida albicans, Epidermophyton floccosum and Trichophyton rubrum. (Goebes et al. 2011; Hicks et al. 2005; Buttner et al. 2002).

Toxigenic fungi, Aspergillus versicolor was found in the carpet dust from a damp indoor environment in Germany (Engelhart et al. 2002).

Other biological agents commonly found in the indoor environment are endotoxins and allergens of different types (cats, mice, dogs, etc.) (Macher et al. 2005;

Miller 1992; Wolkoff 2012). These biological agents are either products of plants or animals that can elicit a response in a susceptible population. Allergens are associated with asthma and various respiratory illnesses in children and immune-compromised adults (EPA; Biological Pollutants n: d).

There is a concern for exposure to biological agents from biocontaminants present on floor materials (Allerman et al. 2006; Anderson et al. 1982; Boyce, 2007; Douwes

2003; Rintala et al. 2008; Rylander & Myrback 1974). Dust and soil particles settle on

floor surfaces during normal usage which can potentially lead to accumulation of organic and inorganic dust particles. Biological agents present in indoor air which come from various sources like humans, pets, indoor built environment, and outdoors can settle on these floors. The floor surfaces, along with moisture and dust particles, can thus become excellent nutrient surfaces, promoting microbial growth. Fungal contamination is a common occurrence in moisture damaged buildings.

Floors like carpets have a larger surface area compared to other floor materials because carpets have several layers of fibers arranged in various formats. Dust and particles can easily settle on carpet surface, be trapped and get attached to the fibers, and settle into the backing fabric. Since carpets are generally difficult to clean, these microbes continue to grow, potentially resulting in a reservoir of microbes. Like particulate matter, these microbes can be released from floor surfaces into the air as a result of various human activities like walking and vacuuming (Cheong et al. 2004; Jacky et al. 2004;

Vicendese et al. 2014). Biological agents that are released and suspended in air are known as bioaerosols. Bioaerosols can also, as in the case of particulate matter, be classified on the basis of size which ranges from less than 1 micron to 100 micron.

Smaller bioaerosols are a major health concern as they can potentially be inhaled deeply into the lungs, leading to clinical infections. Bioaerosols have been studied extensively for a number of respiratory health conditions like influenza, allergies, asthma and sick building syndrom (Douwes et al. 2003; Heederik 2012; Jaakkola 2004). Exposure to biological contamination associated with floor surfaces can occur in two ways. It can either occur from direct exposure to biocontaminants present on surface of floor materials

or exposure can occur by inhaling bioaerosols generated from contaminated floor surfaces.

Significance of floor surface in indoor air quality in healthcare settings

Healthcare facilities are of special importance because they host the most vulnerable group of the population: sick and immune-compromised people. Additionally, healthcare is a large industry employing thousands of people. Recently, Healthcare associated Infections (HAIs) have been on the rise. In 2002 alone, 1.7 million HAIs were documented in the US (MarCannell et al. 2011), and HAIs are one of the leading causes of deaths in the US, more than the deaths caused by automobile accidents (Monina et al.

2002; Ulrich & Zimring 2008). According to the Center for Disease Control (CDC), the direct annual hospital cost associated with HAIs is between $35 billion and $45 billion.

Environmental contamination plays a significant role in contributing to HAIs

(Boyce 2007; Haiden 2009; Harris et al. 2010). Various researchers have studied floor materials and other upholstery in hospital settings as a part of environmental contamination (Boyce 2007; Dietze et al. 2001; Goebes at al. 2011; Haiduven, 2009).

Norovirus, and MRSA have been found on floors, and other environmental surfaces

(Coughenour et al. 2011; Dancer 2009). Hambraeus et al. (2009) estimated that almost

15% of the bacteria recovered from air in the Operating Rooms (OR) in hospitals was dispersed from floors. In other studies, the bacterial CFU has been found to range from a low count of 3.3 CFU/10cm2 to 488 CFU/10 cm2, depending upon the type of cleaning agents used on the hospital floor (Coughenour et al. 2011; Dancer 2009). In another

study, Daling (2004) evaluated five outbreaks of Norovirus in the US, where 36% of the fomites were contaminated with the virus. Several other researchers have found environmentally hardy organisms like VRE, MRSA, and Norovirus on hospital surfaces

(Barker et al. 2004; Boyce et al. 1997; Dailing 2004; Narui et al. 2009; Scott 2009; Yazgi et al. 2009).

Healthcare facilities have an infection control department that is responsible for preventing nosocomial infection. Proper cleaning and disinfection of floors is an integral part of infection control. The Center for Disease Control and Prevention (CDC) presents evidence-based recommendations for infection control in healthcare settings. The guidelines recommend hospital floors to be cleaned with disinfectants, along with detergents. Environmental Protection Agency (EPA) also recommends the use of EPA- registered disinfectants of various types and strengths. Some of the disinfectants that can be used for flooring surfaces are hypochlorites (bleach), phenols, and quaternary ammonium compounds (EPA, Disinfectant n:d). These disinfectants are intermediate- to low-level disinfectants that kill most bacteria and viruses, making them suitable for non- critical areas like floors. Cleaning procedures will differ, depending upon the type of flooring materials as well. Hard surfaces such as vinyl tiles, stone, and wood can be cleaned with dusting and wet mopping, while soft surfaces, such as carpets, need to be vacuumed and washed with shampoo. Disinfectants can be used for both soft and hard surfaces, where they can be sprayed on or used along with detergent solutions. Despite such routine practices in the healthcare settings, floor surfaces have been found to be contaminated with clinically relevant pathogens (Ayliffe et al.1966; Lankford et al.

2006). Regular, routine cleaning and vacuuming of floors has been identified as an

important step in infection control (Barker et al. 2004; Rutala & Weber 2008; Ulrich et

al. 2008; Yazgi et al. 2009).

Although the link between environmental contamination, especially of floors, and

infection has not been fully established, there is indirect evidence suggesting

environmental contamination links to nosocomial infection (Coughenour et al. 2011;

Dancer 2009; Hambreus et al. 1978; Hota 2004). Thus, a very plausible case can be made

against flooring acting as a reservoir for nosocomial infection.

Microbiome in indoor environment

Microbes are ubiquitous in the environment. Humans thus live in conjunction

with this diverse and complex soup of microbes, spending almost 80%–90% of the time

indoors, and are destined to be affected by the indoor environment (Dominguez-Bello et

al. 2010; Kelley & Gilbert 2013; Kembel et al. 2012; Tringe et al. 2008).

The built environment consists of all the environments surrounding

humans and it plays a significant role in the indoor microbiome. . The microbiological

composition of a habitat is controlled by many factors including building material, and is

environmental surface specific like floors vs. counter top (Meadow 2014). Several

pathogenic bacteria have been found to survive on indoor surfaces (Anderson et al. 1982;

Boyce 2007; Bouillard et al. 2005; Davis et al. 2012; Harrison et al. 1992; Khojasteh et

al. 2005; Narui et al. 2009; Rintala et al. 2008). The need to understand the totality of the

microbial compositions surrounding humans is of utmost significance for a microbiome

study. One of the main focuses of microbiome research is to identify and establish connections between the composition of various microbiomes and the resultant medical implications. For example, a recent study found the presence of Fusobacteria increased significantly in patients suffering from colorectal cancer (Casterllarin 2012). Thus, knowledge of microbial compositions may be very significant in providing insight for medical conditions of patients.

As important it is to identify the medical implications of the microbial composition, it is equally important to identify how this microbial composition is affected. The factors that build up a specific microbial composition need to be identified in order to take corrective action. It has been well established that the habitat, and specific areas of the habitat, colonize themselves with specific microbiological compositions. For example, human-associated fecal bacteria have been found frequently on restroom floors (Flores et al. 2011; Gibbons et al. 2015). Another study by Lax et al.

(2012) found common surfaces that are hand touched, such as door-knobs and kitchen handles, share similar microbial compositions, but differ from surfaces like floors. An article published last year reported on a meta-analysis of microbiome studies performed in various built environments (Adams et al. 2015). These studies covered various residences like hospitals, homes, cheese making factories, athletic facilities, museums, subways, etc. The indoor microbiome of the built environment has been found to be highly diverse and distinct from one another. Although many microbiome studies have been carried out in various distinct habitats, comparison of microbial composition across the habitat is rather difficult to perform because of the technical variations in sampling

method, specific sampling site, sampling media etc. (Adms et al. 2015, Dunn et al. 2013;

Hewitt et al. 2013; Kelly & Gilbert 2013; Rintala et al. 2008).

Microbiome composition has been found to differ so much across various habitats

that many researchers agree with the need to study diverse habitats (Flores 2011;

Meadow 2014). The present study was designed to compare the microbial composition of

floor samples collected from different built environments. Different types of floor

materials have been found to affect the microbial growth in different ways. Hard floor

surfaces, like vinyl, differ significantly from soft floor types, like carpets, in terms of

number and types of bacterial growth (Anderson et al. 1984; Foarde & Berry et al. 2004;

Harris et al. 2010). Studies performed in hospitals have found different bacterial genera

on vinyl and carpet floor types (Harris et al. 2010; Yazgi et al. 2009). Most of these

studies were based on a culture-dependent method which is known to under-represent

actual composition (Ramos et al. 2014; Toivola et al. 2002). Hence, there are limited

numbers of studies indicating the true microbial composition of floor surfaces

exclusively. The study was thus designed to identify the differential impact of floor

material types on microbial contamination, using both culture-dependent and culture-

independent methods.

MATERIALS AND METHODS

Floor materials

Commercial and residential flooring were purchased from home improvement

stores. Different variants of carpets, loop-pile carpets (synthetic-backed) and rubber-

backed carpets are frequently used in residential and commercial settings. All the flooring

materials were considered for study, based on standard sizes available. However, for the

purpose of analysis, all the carpets and vinyl sheets were cut into an equal size of 25 cm2.

Once purchased, the flooring materials were securely placed in a plastic container at a

room temperature until further analysis.

Floor materials used for this study were:

1. Vinyl Composition Tile (VCT) (Home Depot, manufactured by TrafficMaster Allure

tile, GripStrip resilient tile flooring; Color: Livorno Onyx),

2. Hardwood floor (Wood) (Bargain Outlet, Armstrong; Color: Ash gunstock)

3. Porcelain tile (PT): (Home Depot, Marazzi Brazilian)

4. Residential Broadloom Carpet (BC) (Bargain Outlet: Mohawk Thunderbolt Cat-tail,

nylon fiber): These broadloom carpets are installed wall-to-wall. The backing on these

carpets is made of fabric and bonding agent.

5. Rubber-backed Commercial Carpet (RCT): (Shaw Carpet Ecoworx product, W5840,

nylon fiber). The backing on these carpets is thermoplastic polyolefin.

Sample size: Samples of four (n=4) for each flooring material was calculated, based on

studies by Foarde and Berry (2004) and Buttner et al. (2002). The American Society of

Testing Materials and (ASTM) and American Association of Textile Chemists and

Colorist (AATCC) recommend a minimum of duplicate samples for antimicrobial testing

on carpeting (AATCC Test Method 174, and ASTM method 2471-05). In order to be

consistent with the test methods, each of the floor materials were sampled in duplicates.

Sample size and sampling frequency for each specific aim is presented in tables in the

respective chapters.

Statistical analysis: The normality test of the data was run to evaluate data distribution.

Based upon the distribution of data obtained, transformation of data was performed to run

statistical analyses. In most microbial studies, the data tends to have log normal

distribution. All the microbial growth was measured quantitatively. The bacterial and

fungal counts were calculated in Colony Forming Units (CFU) per sample area.

Microbial growth too numerous to count “TNTC” was reported “out” for statistical

analyses. Appropriate statistical tests were employed to test the differences in sampling

efficiency of different floor materials. Analysis of variance (ANOVA) or Kruskal-Wallis

tests were employed to test the different microbial growth on different floor materials. As

required, the various tests were either performed in MS Excel (Microsoft Suite, Office

2010) and STATA 12 (Statistical Corp). Microbiome data analysis was performed in Past

3 (Hammer et al. 2001).

CHAPTER 2

Comparison of Surface Sampling Method Across Multiple Floor Material

(Manuscript 1)

Abstract

Although flooring material has an important influence on indoor air quality, there have been very few studies comparing sampling methods on various floor materials. Sampling methods do not have the same efficiency across multiple floor materials. The aim of this study was to compare multiple microbial sampling methods across different floor materials. Three sampling methods, Contact sampling, Vacuum sampling, and Bulk- rinsate sampling were used on five different floor materials. Twelve floor samples of each flooring material were tested for each sampling method. In general, the Bulk-rinsate method was found to be the most sensitive and efficient method of measuring both bacterial and fungal contamination across all floor materials. For bacterial contamination,

Bulk-rinsate measured at least 1.5 times higher than Contact plates, and twice as high as

Vacuum sampling. Similarly, Bulk-rinsate sampling measured almost two to three times the levels of fungal CFUs than Contact and Vacuum sampling, respectively. Since these methods inherently measure microbial loads in different ways, surface sampling methods, must be selected based on the type of surface, goals of sampling, and the organism of interest.

Introduction

Surface sampling as an evaluation mode remains an important part of many environmental assessments (Moore & Griffiths 2007). It has been integrated mainly into the food industry to ensure the cleanliness and safety of food handling and manufacturing processes (Ismaïl et al. 2013; Moore & Griffiths 2002). However, surface sampling is used in a variety of other industries to ensure the safety of human health and wellbeing

(Moore & Griffiths 2007), including the healthcare industry which now is very focused on limiting Healthcare Associated Infections (HAIs) (Gibbons et al. 2015; Harris,

Pacheco & Linder 2010; Méheust, Le Cann & Gangneux 2013; Weber, Rutala, Miller,

Huslage & Sickbert-Bennet 2010). HAIs have been on the rise for the last decade and the healthcare industry is looking for various effective surface sampling devices to identify and minimize the infection incidences (Claro, O’Reilly, Daniels & Humphreys 2015;

D’Alessandro et al. 2013; Dolan, Bartlett, McEntee, Creamer & Humphreys 2011;

Haiduven 2009; Mulvey et al. 2011; Weber et al. 2010).

The influence of flooring type on indoor air quality has been a contentious issue

(Harris et al. 2010; Lankford, Collins, Youngberg, Rooney, Warren & Noskin 2006).

Hambreus et al. (1978) estimated almost 15% of the bacteria recovered from the air in the operating rooms in hospitals was dispersed from floors. In other studies, bacterial CFU has been found to range from a low count of 3.3 CFU/10cm2 to 488 CFU/10 cm2 depending upon the type of cleaning agents used on the hospital floor (Suzuki,

Yoshimichi, Matsuura & Horisawa 1984;). Norovirus and MRSA have been reported on floors as well as on other environmental surfaces (Dancer 2009; Coughenour, Stevens &

Stetzenbach 2011). Thus, a very plausible case can be made that flooring acts as a reservoir for nosocomial infection. Although the link between environmental contaminations, especially floors and infection, has not been fully established yet, there is indirect evidence suggesting environmental contamination links to nosocomial infection

(Coughenour et al. 2011; Dancer 2009; Hambreus et al. 1978; Hota 2004).

Most of the surface sampling studies have been performed on materials that have traditionally been used in the food industry (Moore & Griffiths 2002; Ismail et al. 2013).

Many studies focusing on recovery and survivability of microbes are mainly from glass and stainless steel surfaces (Ismail et al. 2013; Edmonds 2009). However, in a real world scenario, as expressed by Edmond (2009), more complex materials like carpets, clothes, paper, etc. need to be studied to gain a more comprehensive understanding of contamination and exposure.

Sampling methods do not have the same efficiency across multiple floor materials. Most of the literature on the microbiological aspect of flooring has defined different floor surfaces as either “soft” or “hard” types, or have merely used the term

“flooring” without any clear explanation of what floor material was studied (Vandini

2014).

This study identifies the most efficient and sensitive surface sampling methods to compare different floor materials. Five of the most commonly used floor materials were chosen for the study.

Study material and methods

Study material: All flooring materials were purchased from a local home improvement store, except one sample which was received from the building facility manager. Five materials used were:

1. Vinyl Composition Tile (VCT) (Home Depot, Traffic Master Allure tile, GripStrip resilient tile flooring, Color: Livorno Onyx)

2. Hardwood floor (Wood): (Bargain Outlet, Armstrong, Color: Ash gunstock)

3. Porcelain tile (PT): (Home Depot, Marazzi Brazilian)

4. Residential Broadloom Carpet (BC) (Bargain Outlet, Mohawk Thunderbolt cat-tail, nylon fiber): These are broadloom carpets that are installed wall-to-wall. The backing on these carpets is fabric and bonding agent.

5. Rubber-backed Commercial Carpet (RCT): (Shaw Carpet Ecoworx product W5840, nylon fiber). The backing on these carpets is thermoplastic polyolefin.

All floor materials were cut into 5 x 5 cm square tiles. There was no information on the shelf life of these products. The rationale for using these new floor materials was to test the sensitivity of the sampling procedures at minimal use. However, our preliminary test of the floor materials showed that the new store-purchased floor materials were contaminated. Previous studies which have tested for microbial contaminants at time “0” for baseline concentration have found the floor materials to be significantly contaminated

(Carpentier 1998).

Sampling methods: The three surface sampling methods used in this study were:

A) Contact Plate: Contact RODAC (Replicate Organism Detection and Counting) plates

(Becton Dickinson, BBL) have a raised upper surface to ensure proper contact with the surface. The sampling surface area of a RODAC plate is about 25 cm2. These plates were filled with sterilized tryptic soy agar (TSA) (Fisher Scientific, Pittsburgh, PA) and potato dextrose agar (PDA) (Fisher Scientific, Pittsburgh, PA) for bacterial and fungal colonies respectively. The RODAC plates were impressed upon floor surfaces for 20 seconds, using three fingers. Sampling was done in duplicate and the plates were incubated directly at 37°C and 24°C for TSA and PDA plates respectively.

B) Vacuum sampling: A polycarbonate 47 mm in-line filter holder (Pall Corporation) was modified to work as a vacuum sampler for the floor. These inline filter holders are autoclavable and are suitable for both indoor and outdoor air sampling. A 5 cm length of sterilized Tygon tubing was attached to the inlet to draw air from surfaces close enough.

Millipore Mixed Cellulose Ester (MCE) filters with 45 µm pore sized filters were placed in the filter holder to collect the aerosol. The filter was connected to a QuickTake 30

(SKC Inc. PA, USA) air sampling pump with Tygon tubing. Thus, a vacuum sampling kit was constructed that was similar to a carpet sampling kit commercially available (Zefon

Inc. Ocala, FL). The floor materials were sampled for one minute at the air flow rate of

10 L/minute. The inlet tube was moved across in a zigzag fashion from top to bottom and left to right, covering the entire surface area. After sampling the surfaces, the filters were

placed directly on the TSA and PDA plates and incubated at 37°C and 24°C (room temperature) respectively.

C) Bulk-rinsate sampling: This method of sampling uses an entire floor sample or a portion of a floor sample submerged and rinsed in physiological saline (Verdier et al.

2014.). The rinsate is then diluted and plated on the either TSA or PDA plates. This sampling method is one of the most widely used and accepted methods for building materials. The floor samples were submerged in 25–45 ml sterilized 1x phosphate buffered saline and shaken vigorously with sterilized forceps for two minutes. The rinsed buffer was collected in a 50 ml centrifuge tube (Fisher Scientific, Pittsburgh, PA), vortexed for 20 seconds and plated in duplicates, using serial dilution when appropriate.

All the TSA plates were incubated at 37°C for 24–48 hours while PDA plates were incubated at room temperature (24°C) for 3–5 days. The colony forming units

(CFU) were counted after 24–48 hours for TSA, and on the second, third and fifth days for PDA plates.

For each floor material, 12 floor samples were tested for each sampling method, giving a total of 180 floor samples (5 types of floor material x 12 floor samples of each flooring material x 3 sampling methods =180). All the data were log-transformed and reported as colony forming units (CFU)/25 cm2. Statistical analysis was performed in

STATA 12 (Stata Corp. Inc.) and a Kruskal-Wallis test was used to statistically compare the sampling efficiency of the three methods on each individual floor type.

Fig 2.1: Bacterial CFU measured by three different surface sampling methods

Fig 2.2: Fungal CFU measured by three different surface sampling methods

Table 2.1: Bacterial log10 mean cfu/25 cm2 of different floors measured by three different sampling methods

2 Mean bacterial log10 cfu/25cm ± SE (n=12) Floor Bulk Contact Vacuum Bulk-Rinsate Bulk-Rinsate Contact/ Vacuum Rinsate /Contact /Vacuum after removing B- Rinsate # Carpet 3.6± 0.01 1.6 ± 0.1 1.4 ± 0.07 2.2* 2.5* 1.2 RCT 3.1 ±0.14 1.4 ± 0.1 1.3 ± 0.12 2.2* 2.5* 1.1 Wood 2.9 ± 0.18 1.5 ± 0.18 1 ± 0.13 2* 2.9* 1.4 P. tile 3 ± 0.06 1.8 ±0.1 0.6 ± 0.16 1.7* 4.7* 2.8* V.tile 2.7 ± 0.18 1.6 ± 0.18 0.6 ± 0.12 1.7* 4.5* 2.7*

Footnotes: Kwallis test performed to compare statistical difference between the three sampling methods for the floors. It was significant for all floor types. Individual comparison of sampling methods was done by Bonferroni method. #After removing Bulk-Rinsate, Contact and Vacuum sample were tested using Kwallis test. * Significant at (p ≤ 0.05) as measured from Kwallis test

Bacterial and fungal counts measured by a single sampling method cannot be compared across these five floor materials. All these floor materials were obtained from different places and therefore no information was available on storage conditions or length of shelf life, which could have affected the microbial count of each of these floor materials. A comparison of sampling methods for each floor type can only be performed

2 Table 2.2: Fungal log10 mean cfu/25 cm of different floors measured by three different sampling methods

2 Floor Mean fungal log10 cfu/25cm ± S.E

Bulk Rinsate Contact Vacuum Buk-Rinsate Bulk- Contact/ Vacuum n=12 n=8 n=8 /Contact Rinsate after removing B- /Vacuum Rinsate # Carpet 2.4 ± 0.18 0.9 ± 0.23 1 ± 0.20 2.6* 2.3* 0.90

RCT 2.0± 0.14 0.6 ± 0.11 0.6 ± 0.17 3* 3.6* 1.20

Wood 2.8 ± 0.03 1.2 ± 0.10 1.4 ± 0.14 2.4* 2* 1.00

P. tile 2.0 ± 0.08 0.8 ± 0.21 0.4 ± 0.15 2.4* 5.7* 2.3

V.tile 2.0 ± 0.10 0.6 ± 0.05 0.2 ± 0.12 3.3* 11.60* 3.5*

Results

The mean bacterial and fungal log10 CFU of each floor sample as measured using the three different methods mentioned above are given in Tables 2.1 and 2.2 and presented in Figures 2.1 and 2.2. All the floor samples showed positive growth for bacterial and fungal contamination. In general, the Bulk-rinsate method was found to be the most sensitive and efficient method for measuring both bacterial and fungal contamination for all floor material types. For bacterial contamination, the Bulk-rinsate method measured at least 1.5 times higher than contact plates and two times higher than

Vacuum sampling. Similarly, Bulk-rinsate sampling measured almost two to three times 26

the levels of fungal CFUs compared to Contact and Vacuum sampling, respectively.

After removing Bulk-rinsate data, statistical analysis found no significant difference between Vacuum and Contact sampling for the bacterial and fungal counts across all floor types. On porous surfaces like carpets and wood, vacuum sampling and contact sampling were statistically comparable. However, for non-porous surfaces like porcelain and vinyl tiles, contact sampling performed better than vacuum sampling for both bacterial and fungal counts. The data was combined for both commercial (RCT) and residential (BC) carpets into “soft-floor”, and wood, porcelain and vinyl tiles into “hard floors” on the basis of the surface (Fig 2.1). Bulk-rinsate sampling had statistically different (p <0.05) sampling efficiency for each floor surface for bacteria and fungi, while contact and vacuum were very similar for bacterial concentration, and statistically different for fungal concentration (Table 2.1 and 2.2).

Discussion

In general, bacterial and fungal CFU counts were low, and varied widely as measured by different sampling methods. These were new floor materials and hence higher loadings of microbes were not expected. All the sampling methods were used in specific scenarios with their own sampling protocols. Contact plates are routinely carried out to test for sterile environmental surfaces post-disinfection in food industry and healthcare settings. Vacuum sampling is commonly used for inspection of mold contamination. Bulk-rinsate sampling was found to be the most effective and sensitive

sampling method for all floor material types. A similar study performed by Buttner et al.

(2001) compared swab, sponge, bulk, and quantitative PCR (QPCR) for detection of bacteria on variants of carpet and vinyl tile. Although QPCR enhanced detection of micro-organisms on carpets and floor, it was not statistically different from swab or sponge methods, which are both a type of contact sampling. The study also showed that bulk sampling was moderately more sensitive than QPCR in detecting bacteria on carpets

(Buttner et al. 2001).

Although Bulk-rinsate sampling is not practical for a routine inspection, this experiment does give an estimate of how other surface sampling methods grossly underestimate the true microbial load. It is, however, to be noted that these sampling procedures measure microbial loads in inherently different ways. Contact plate and Bulk- rinsate sampling are passive sampling methods, while vacuum sampling is an active sampling method. Additionally, while Contact plate, and Vacuum sampling measures mostly the upper surface (top surface), Bulk-rinsate sampling measures the microbial load from the entire surface. It is also possible that a longer sampling time for both

Contact and Vacuum sampling could have presented a different microbial count.

However, the study was performed according to sampling guidelines of each of the sampling methods. In Contact RODAC plate sampling, 5–10 seconds of sampling time is preferred (Lutz, Crawford, Hoet & Lee 2013; Buttner et al. 2001). In Vacuum sampling, the standard practice is to sample a 100 cm2 area at 10 L/min of air volume, with a sampling time ranging from few seconds to three minutes (Bryne 2000; Environmental

Protection Agency 2013). Comparable standard practices were followed in this study for

a sampling area of 24 cm2. Additionally, variability in sampling the floor materials was minimized because all experiments were performed by a single person.

The study is consistent with other studies where fungal spores were measured comparatively by contact sampling and vacuum sampling (air sampling) (Meheust, Cann,

Gangneux 2013; Wickens, Siebers, Ingham & Crane 2004). In a study by Meheust et al.

(2013), there was no difference between the fungal count measured by solid phase cytometry and swab sampling. Solid phase cytometry involves air sampling of a sample on a liquid collecting medium and then laser counting, while swab sampling is a type of contact sampling.

Conclusion

The aim of the study was to identify the most sensitive method of determining the microbial load of various floor materials. Bulk-rinsate sampling was found to be the most sensitive and effective method for all floor materials studied. The study also showed that for soft surfaces like carpets, vacuum sampling has slightly better sampling efficiency than contact sampling. Although Bulk-rinsate sampling is not practical for assessing microbial contamination in an actual environmental setting, it does indicate that other ready-to-use contact pates (RODAC), and vacuum sampling underestimates the actual microbial contamination.

Where there is a concern for contamination from fungal spores, vacuum sampling might be more effective. The fungal spores can be counted by placing the filters under a microscope. Vacuum sampling is also more effective for carpets, which are

comparatively dense and have a higher surface area (Ashley, Applegate, Wise, Fernback

& Goldcamp 2007; Claro et al. 2015; Lutz et al. 2013). Since most hospitals have vinyl tiles in patient areas, contact sampling might be practical for measuring and identifying microbes in a relatively shorter time (Claro et al. 2015; Asheley et al. 2007; Lutz et al.

2013)

As echoed by various researchers, surface sampling methods must be selected based on the type of surface concerned, the goals of sampling, and the organism of interest (Lemmen et al. 2001; Wickens et al. 2004; Asheley et al. 2007; Lutz et al. 2013).

The strength of this study lies in the fact that this is the first study, as far as we know, that has compared different sampling methods for five different floor materials. The study helps to decrease the wide gap of knowledge for sampling surfaces as discussed by

Edmond et al. (2009). Future studies can focus on estimating the efficiency of these sampling methods in a real-world scenario, as well as in a laboratory, simulating in-use conditions.

CHAPTER 3

Comparison of Survivability of Staphylococcus aureus and Spores of

Aspergillus niger on Commonly Used Floor Materials

(Manuscript 2)

Abstract

Various types of indoor flooring materials may differ in supporting microbial growth.

Survivability of Staphylococcus aureus and spores of Aspergillus niger was compared on five common floor materials: vinyl composition tile (VCT), hardwood (Wood), porcelain tile (PT), residential broadloom carpet (BC), and rubber-backed commercial carpet

(RCT)

Floor materials were inoculated with a known concentration of S. aureus and spores of A. niger on Day 0. Their survivability was measured on Days 2, 7, 14, and 28.

Bulk-rinsate method was used to retrieve the surviving microbes which were enumerated using the culture-based method.

The difference in change of S. aureus levels was statistically significant for all tested days (P <0.001) for all floor materials. VCT and PT had statistically similar survivability for all days, except Day 14, and were statistically different from BC and

RCT on all days. A. niger spores were undetected on BC and RCT after Day 2 but survived on VCT, PT, and Wood until Day 28. In conclusion, floor materials with hard

and smooth surfaces, like VCT and PT, can enable the survival of S. aureus and A. niger for up to four weeks. These findings imply that floor materials play a major role in preserving microbial contaminants in built environments.

Introduction

Flooring material and its contribution to indoor air quality (IAQ), has been a contentious issue (Harris & Lindner, 2010; Lanford et al. 2006). IAQ continues to attract much interest since it has been identified as an important influence on human health, especially since most people spend more than 85% of their time indoors (Meadow et al.

2014; Lax & Smith 2012). Many microbes responsible for healthcare-acquired infections

(HAIs), including Norovirus and MRSA, have been found on floors, as well as other environmental surfaces (Dancer 2009; Coughner & Stetzenbach 2011; Hambreus et al.

1978; Suzuki et al. 1984). Hambraeus et al. (1978) estimated that almost 15% of airborne bacteria recovered in the operating rooms of hospitals were re-suspended from the floor.

In another study, bacterial levels were found to range from 3.3 colony forming unit

(CFU)/10cm2 to 488 CFU/10 cm2 on hospital floors (Suzuki et al. 1984).

Although the link between environmental contamination, especially floors, and infection has not been fully established, there is indirect evidence suggesting a link between environmental contamination and nosocomial infections (Coughner &

Stetzenbach 2011; Hambreus et al. 1978; Suzuki et al. 1984). Ulrich et al. (2008) identified many studies that examined the relationship between airborne infections and environmental factors in hospital buildings, including floors. They acknowledge that very

little is known about the role of floors in environmental contamination. In addition, a recent report by the Center for Health Design indicated that flooring is an important component in patient care quality and have highlighted an urgent need for evidence-based research on floor surface contamination and the potential risk of HAIs (Nanda et al.

2012).

Floors are generally composed of one of the following: wood, laminate, ceramic or porcelain tiles, carpets, vinyl, and linoleum. Carpet is popular and the main flooring choice for residential and commercial buildings. Carpets account for almost 51% of total

US flooring market. (Carpet and Rug industry, 2015 data). A wide estimate indicates almost 70% US houses have carpets as a flooring surface. (Highbeam 2012). Carpets are popular choice because they provide functional value and aesthetic appeal to interior space, reduce noise, and provide non-slip surfaces, which are ideal for places like hospitals and schools. Most of the studies focusing on the microbiological aspect of flooring have used the term “floor” without differentiating between various floor material types. Various other terms like “soft” surface types have been used for carpets, while

“hard or bare” floor types are used for vinyl tiles (Vandani et al. 2014). Few researchers have compared microbial contamination on a variety of floor material types, like carpets and vinyl tiles. Rylander et al. (1974) reported higher surface bacterial levels on vinyl tiles than on carpets, but Anderson et al. (1982) reported higher counts of Escherichia coli, Staphylococcus aureus, and Pseudomonas aeruginosa on carpets. Similarly, Foarde and Berry (2004) reported higher bacterial levels on carpet surfaces than on vinyl tiles in schools. In another study, researchers investigated the colonization of S. aureus on vinyl

and ceramic tile floors in a Turkish hospital (Yazgi et al. 2009). They sampled various areas of the hospital floor and found vinyl floor surfaces were more suitable for colonization by S. aureus than ceramic tiles. They did not compare carpets, but emphasized the need to investigate the role of different floor material types in the growth or survival of bacteria. Harris et al. (2010) found higher levels of pathogenic bacteria on vinyl surfaces than carpets, but generally lower numbers of bacterial genera on vinyl surfaces compared to carpets. However, these inconsistent results, and the lack of enough comparative studies for different floor materials, make it challenging to draw any general or strong conclusions, and necessitate comparative studies to understand microbial survivability on different floor materials better.

The aims of this study were to compare the survivability of S. aureus and spores of A. niger on five different, commonly-used floor materials over a four-week period.

Two different variants of carpets, residential and commercial types, were included.

Materials and Methods:

Floor materials: The five different floor materials were

1. Vinyl Composition Tile (VCT) (Home Depot, Traffic Master Allure tile, GripStrip resilient tile flooring, Color: Livorno Onyx)

2. Hardwood floor (Wood): (Bargain Outlet, Armstrong, Color: Ash gunstock)

3. Porcelain tile (PT): (Home Depot, Marazzi Brazilian)

4. Residential Broadloom Carpet (BC) (Bargain Outlet, Mohawk Thunderbolt cat-tail, nylon fiber)

5. Rubber-backed Commercial Carpet (RCT): (Shaw Carpet Ecoworx product W5840, nylon fiber)

Sample size: In the first set of experiment, twenty sets of each floor material type were inoculated on Day 0, and then the samples were tested for microbial survivability on

Days 2, 7, 14, and 28. The same set of the experiment was repeated two more times.

Thus, a total of 300 floor samples were tested (5 floor material × 4 samples of each floor material × 5 sampling days × 3 experiments = 300 floor samples in total)

Preparation of microorganisms: Staphylococcus aureus and Aspergillus niger were ordered through American Type Culture Collection (ATCC).

S. aureus (ATCC 6538): A fresh culture of S. aureus was prepared in tryptic soy broth (Fisher Scientific, Pittsburgh, PA.) and incubated at 37°C and 200 rpm for 18–24 hours in a shaking incubator. The tube was then centrifuged at 6000 rpm for 10 minutes to collect the bacterial cells. The cells were finally re-suspended in nutrient broth (Fisher

Scientific, Pittsburgh, PA). Proper dilution was made to obtain an approximate final concentration of 1.6x108 CFU/ml, using a cell density meter (Model CO8000, Biochrom

UK).

A. niger (ATCC 9642): A niger spores obtained from ATCC were inoculated on a

PDA plate (Fisher Scientific, Pittsburgh, PA.) The plate was incubated in a dark place at

24°C. The fungal spores were harvested after two weeks of growth by scraping the growth from the agar plate and collecting it in a 50 ml centrifuge tube (Fisher Scientific,

Pittsburgh, PA.). The tube was vortexed for about 20 minutes and strained through sterile gauze to remove agar particles. After filtering out the agar particles and other debris, a homogenous spore suspension was obtained. The spores were counted using a hemocytometer under a light microscope (Fisher Scientific, Pittsburgh, PA) at 400X magnification. The final concentration prepared was 7.6x106 spores/ml.

Inoculation and survivability test: In the first experiment, a total of twenty sets of each sterilized floor material type were placed in a pre-sterilized petri dish (Fisher Scientific,

Pittsburgh, PA). On Day 0, each of these 25 cm2 floor samples was inoculated with either

0.25 or 0.5 ml suspensions of S. aureus and A. niger spores. From a bacterial suspension of approximately 1.6cx108 CFU/ml concentration, RCT and BC were inoculated with

0.5 ml (or 8x107 CFU) of the suspension, while VCT, PT and Wood with 0.25 ml (or

4x107 CFU). A. niger spore suspension of 7.6x106 spores/ml was used for inoculation. On

Day 0, both BC and RCT were inoculated with 0.5 ml or (3.8x106 spores) and VCT, PT and Wood with 0.25 ml (1.9x106 spores).

The inoculum was added on floor samples at six spots in an ‘X’ pattern. The inoculated floor samples were then covered with a lid and placed at room temperature of

24°C for subsequent days of testing. On Day 0, right after inoculation, four of the inoculated floor samples from each floor material types were rinsed and washed with sterilized 1x phosphate buffer saline. The typical volume of PBS was 25 ml for RCT, V, and PT, and 30 ml for carpet and Wood. The floor samples were submerged and shaken vigorously with sterilized forceps for two minutes. The floor samples were held with

forceps and rinsate was collected in a sterile 50 ml centrifuge tube, mixed by vortexing for one minute, properly diluted, and plated on TSA (Fisher Scientific, Pittsburgh, PA,

USA) and PDA (Fisher Scientific, Pittsburgh, PA, USA) for S .aureus and A. niger, respectively. Afterward, on Days 2, 7, 14, and 28, four samples from each of the inoculated floor material types were collected and the same method was used to determine microbial survivability. All the counts were measured in CFU per 25 cm2. An uninoculated and sterilized floor sample for each floor material types was rinsed and plated on Day 0 to ensure sterility. The uninoculated floor samples on Day 0 did not produce any growth, confirming the sterility of the floor materials. The temperature was kept at 24oC throughout the study period, while relative humidity remained in the range of 30–70%, reflecting the typical indoor environment condition. The collected data were log-transformed and were analyzed with STATA12 (Stata Corp. Inc.) and MS Excel

(Microsoft Corp. Office 2013).

Results

Survivability of S. aureus: Table 3.1 shows the initial bacterial concentrations right after inoculation on Day 0. The inoculum levels on Day 0 were between 5x106 CFU

7 2 (log10 6.7) and 1.5x10 (log10 7.2) per 25 cm for all the floor samples. On Day 2, increased growth of S. aureus was observed on PT (1.7 log10 increase) and VCT (1 log10 increase) compared to Day 0, whereas the S. aureus concentrations decreased on

BC and RCT (Fig 3.1).

For both carpet types, there was a sharp decline in S. aureus numbers from Day 2 to

Day 14 and they could not be detected on Day 28. However, for VCT, PT and Wood, there was positive growth on Day 2 and a steady decline afterward, but bacteria were still detected on Day 28 (Fig 3. 1).

The mean change in S. aureus levels for all the tested days was compared for each floor material type using the Kruskal-Wallis test and Analysis of Variance(ANOVA).

Changes in mean CFU from Day 0 to Days 2, 7, 14, and 28 were calculated by:

Individual log10 CFU of Day(x) - mean log10 CFU of Day 0

(“x” being 2, 7, 14, and 28)

The result shows that the difference in S. aureus concentrations was statistically significant for all the tested days (Table 3.1, p <0.001). Multiple comparisons with the

Bonferroni test revealed that VCT and PT were statically similar for all days, except Day

14, and statistically different than BC and RCT on all days. There was a greater decline on PT than VCT on Day 14, but these two floor samples (both of which can be classified as “hard and smooth” surfaces) behaved similarly (Fig 3.1). RCT and BC were statistically different on Day 2, when a steep decline was observed on BC compared to

RCT (Fig 3.1). However, by Day 7, these two floor samples showed a similar pattern of steep decline. By Day 14, S. aureus was undetectable on RCT, and by Day 28 was undetected on both BC and RCT.

Table 3.1. Inoculation concentration and change in Staphylococcus aureus levels on different floor material types from Day 0 to Day 28.

Floor Inoculum mean (sd) of change in CFU/25cm 2 conc. (log10) Day 0 Day 2-Day0 Day 7-Day0 Day 14- Day 28-Day0 Day0

PT 7.6 7.1 (0.2)A 1.7(0.4) A -0.2(1.2) A -2.8 (2.5) A -3.6 (1.8) A

VCT 7.6 7.2 (0.2) A 1 (0.7) A 0.1 (1.1) A -2 (0.8) A -3.9 (2.1) A

Wood 7.6 7.1(0.1) A -0.6 (0.4) C -2.3 (0.8) C -3.8 (1.3) A$ -4.9 (1.1) A

BC 7.9 6.9 (0.2)B -3.7 (1.3) D -5.4 (2.3) B -6.1(1.3) Undetected

RCT 7.9 6.7(0.2) B -2.5 (0.6) E -3.7 (2.3) B Undetected Undetected

Kwallis P value 0.002* 0.0001* 0.0001* 0.02* 0.15** Footnotes: * K wallis testing difference on mean CFU change across all floor material types on the indicated ** Kwallis tested for VCT, PT and Wood only. Not significant. $ Marginally different as calculated by Kwallis †As determined from Bonferroni multiple comparison, different Capital superscripts in each Day column represents statistical difference, sharing same Capital letter represents no statistical different.

Figure 3.1 Comparison of survivability of S. aureus on different floor material types from Day 0 to Day 28. Error bars represent Std error of the mean

For Wood samples, a small decline was observed from Day 0 to Day 28, remaining detectable until Day 28. It is also important to note that no nutrition was added to the inoculated floor samples, other than the inoculating medium (nutrient broth). BC and

RCT received a double inoculation volume, compared to VCT, PT and Wood. Not all the inoculated floor samples remained positive for S. aureus on successive days of testing.

Less than 50% of the BC and RCT samples showed positive counts (≥ 1 CFU) of S. aureus on Day 2, whereas 80% of VCT and PT samples were positive on Day 28 (Fig.

3.1).

Survivability of A. niger spores: The final inoculum (measured by CFU of culturable

6 6 spores) on Day 0 for all the floor samples was between 1.6x10 (log10 6.3) to 1.9x10

(log10 6.6) CFU (Table 3.2). The Day 0 spore concentration did not differ statistically on the five floor material types (Table 3.2). There was a slight decline (about 0.3 log10) compared to the number of spores inoculated on Day 0 on both RCT and BC, whereas there was little or no decline on VCT, PT and Wood. This implies carpet fibers may hinder release of some fungal spores compared to other floor materials.

By Day 2, A. niger spores were almost undetected on BC and RCT. The testing of these floor samples was discontinued after Day 2. Statistical analysis was used to compare the change in culturable spores for VCT, PT and Wood. For Days 7, 14, and 28,

VCT and PT yielded similar survivability (Fig.3.2).

Table 3. 2. Inoculation concentration and change in the levels of Aspergillus niger culturable spores on different floor material types from Day 0 to Day 28.

Inoculum Floor mean (sd) of change in CFU/25cm2 conc. spores (log10 ) Day 0 Day 2-Day0 Day 7-Day0 Day 14-Day0 Day 28-Day0

P tile 6.3 6.2(0.08) A 0.6 (0.5) A -1.6(1.6) A -1.4(1.3) A -2.8(2.4) A

V tile 6.3 6.1(0.2) A -0.2(0.3) A -1.3(0.8) A -1.5(0.3) A -2.2(.7) A

Wood 6.3 6.3(0.3) A -0.8(0.4) B -2.2(1.3) A -2.8(1.2) B $ -3.3(1.5) A

BC 6.6 6.3(0.3) A -4.7(1.8) C Undetected Undetected Undetected

RCT 6.6 6.2(0.3) A Undetected Undetected Undetected Undetected

Kwallis P value 0.1 0.001* 0.042* 0.02* 0.05**

Footnotes: * K wallis testing difference on mean CFU change across all floor material types on the indicated ** Kwallis tested for VCT, PT and Wood only. Not significant. $ Marginally difference as calculated by Kwallis †As determined from Bonferroni multiple comparison, different Capital superscripts in each Day column represents statistical difference, sharing same Capital letter represents no statistical different.

Figure 3.2. Comparison of the survivability of A. niger spores on different floor material from Day 0 to Day 28. Error bars represent Std error of the mean

Discussion

A comprehensive comparative study was performed to determine the survivability of S. aureus and spores of A. niger on five different common floor materials. Floor materials that were hard with smooth top surfaces, such as VCT and PT, showed almost identical patterns of survivability for both S. aureus and A. niger spores. On both these floor materials, S. aureus showed longer survivability than on BC and RCT. These observations are similar to those reported by Zarpellon et al. (2015), where several S. aureus strains were found to survive on vinyl flooring for 40 days. Shorter survivability of S. aureus has been observed on clothes compared to plastics by Huang et al. (2006).

Neely and Maley (2003) have also found longer survivability of Staphylococcus spp on polythene plastic compared to fabrics. The result is also similar to observations made by

Harris et al. 2014 and Rylander et al. 1974, both of who reported higher bacterial counts on vinyls compared to carpets.

In our study, BC (residential) and RCT (commercial) also showed similar shorter survivability for S. aureus and A. niger spores. S. aureus survived up to seven days on

RCT and up to 14 days on BC. The spores of A. niger were undetected on Day 2 on RCT, while the spores remained viable until Day 2 on BC on Day 2, but were undetectable by

Day 7. The carpet surface was found to inhibit survivability of fungal spores as evident from the fact that by Day 2, no viable spores were retrieved from carpets. Carpets have fibrous surfaces that could trap the spores resulting in lower counts. The lower count of culturable spores on RCT compared to BC may also result from the fact that RCT are practically sealed on the back side by rubber backing. This could have hindered the release of bacteria or fungal spores from RCT compared to BC, which has a fabric

backing, making it comparatively easier to remove. Both carpet types did not differ statistically, except for Day 2.

Based on these results, floor materials with a smooth surface, such as vinyl tiles, porcelain tiles, or ceramic tiles can be classified as “hard floor” types. All carpets, whether rubber-backed carpet tiles or broadband residential carpets, can be classified as

“soft floor” types.

Wood, being a natural product, showed a different survivability pattern for both organisms and should be categorized separately. Miling et al. (2005), reported different survivability of Escherichia coli and Enterococcus faecium on different species of wood.

Thus, when assessing biocontaminants from wood, the characteristics of the wood should be taken in consideration.

In this study, all the floor samples were inoculated without additional nutrient and survivability was observed for four weeks. The only source of nutrition and moisture was the inoculum media (contained in the nutrient broth), so desiccation and depletion of nutrient would obviously affect the survivability of microbes. It is important to note that, for the same size of sampling area, the actual surface areas of RCT and BC were greater than VCT and PT. Both carpet types are made of nylon fibers that are hydrophobic, but the carpets have numerous fibers and are able to absorb more liquid than VCT and PT.

Thus, when the RCT and BC were inoculated, the inoculum was absorbed between and under the fibers. However, on smooth surfaces like VCT and PT, the small droplets of inoculum aggregate and form bigger droplets because of the surface tension, and the hydrophobicity of the VCT and PT. Despite having a double volume of inoculum on Day 0, moisture and nutrient media would perhaps desiccate faster on BC and RCT, than on VCT and PT, because of the larger surface area of the carpets and the small droplets of inoculum which were not able to aggregate. This could be one of the reasons for the shorter survivability of S. aureus and A. niger on RCT and BC.

Floors have been extensively scrutinized for their contribution to indoor air quality. This is particularly important with regard to their potential role in nosocomial infections, where flooring might serve as a source of infection (Hamraeus et al. 1978;

Kramer 2006; Suzuki et al. 1984; Yazgi et al. 2009). Asthma, both initiated and exacerbated, has been linked strongly to indoor concentrations of fungal spores, including

A. niger (Sharpe et al. 2015). Goebes et al. (2010) showed re-suspension of A. niger spores from hospital carpets as the result of foot traffic. Another researcher compared the re-suspension of particulate matter from carpets and VCT, and found that a higher resuspension of larger particles occurs from carpets (Qian Ferro, 2008).

In the real, practical world, floor materials are exposed to continuous dirt and moisture, which builds up differently on different floor materials. Floor contamination is not very uniform, which can also affect the cleaning efficacy on various floor types

(Anderson et al. 2009; Franke et al. 1997; Sattar & Maillard 2013; Whitehead et al.

2001). Hard floor surfaces have been found to have lower dust loadings than carpets

(Franke et al. 1997), which means that hard floors, like VCT and PT, would have less organic matter for microbes to grow on than carpets would (Huang et al. 2006).

Conclusion

The results of this study show longer survivability of bacterial and fungal spores on

VCT and PT than on carpets. The present study for the first time, compared survivability of S. aureus and A. niger spores on five different floor materials. The results show that

floor materials with hard and smooth surfaces, such as VCT and PT, allow survival of the S. aureus and A. niger spores for up to four weeks and are thus become a potential source of exposure to microbial pathogens. The study also suggests that attempts to extract bacterial and fungal spores from carpets may result in lower levels than from smooth surfaces like vinyl and wood. However, various other factors, such as dirt and organic buildup, cleaning, and disinfecting practices play a major role in influencing surface contamination and actual exposure of the occupants to such microbes.

CHAPTER 4

Survivability of Staphylococcus aureus and Aspergillus niger on Floor Materials With and Without Nutrient

Introduction

Staphylococcus aureus and Aspergillus niger are found in natural environment, both indoor and outdoor. Many studies have shown that S. aureus survives on environmental surfaces (Dancer 2009; Coughner & Stetzenbach 2011; Hambreus et al.

1978; Suzuki et al. 1984; Zarpellon et al. 2015) while Aspergillus niger is a common fungus found in natural as well as indoor environments (Hota 2004; Martin 2012;

Yamanto et al. 2011)

An initial study was performed to compare survivability on various floor materials as described in the previous chapter (Chapter 3). S. aureus and spores of A. niger were inoculated on new, sterilized floor materials. It was observed that “hard surfaces” like vinyl tiles (VCT) or porcelain tiles (PT) allow S. aureus and A. niger to survive for over four weeks (Chapter 3). In comparison, carpets, both broadloom residential carpets (BC) and rubber backed commercial carpet (RCT), had similar and shorter survivability. The microbes were inoculated onto new floor materials without additional nutrient. In the real world, dust and soil particles, moisture, dead cells from

and pets are deposited on floors. Thus, floor surfaces are enriched with organic and inorganic wastes that could affect the survivability of microbes. To test the survivability of S. aureus and A. niger on floor surfaces in in-use conditions (or nutrient rich state) a follow-up study was designed. To simulate the in-use condition of new floor materials in a laboratory, additional nutrient was added to the floor materials on Day 0 and Day 14.

The additional nutrient was a nutrient broth (Fisher Scientific, PA) which, according to the The American Association of Textile Chemists and Colorists (AATCC) method, can be used to simulate in-use conditions. The floor materials were kept at a humidity level of

70–80% using a timed humidifier. The temperature was maintained constant at 24οC throughout the experiment.

Materials and methods

Floor materials:

1. Vinyl Composition Tile (VCT) (Home Depot, Traffic Master Allure tile, GripStrip resilient tile flooring, Color: Livorno Onyx)

2. Residential Broadloom Carpet (BC) (Bargain Outlet, Mohawk Thunderbolt cat-tail, nylon fiber)

Nutrition: Nutrient broth (NB) is used for testing in-use conditions for carpets as described in the AATCC Test Method 174-2011. The nutrient for this study was modified, based on this method. During this experiment, besides the nutrient broth contained in inoculating media, additional nutrient broth was added to both the floor

samples. First, the floor samples were wetted with pre-sterile 1XPBS (Fisher Scientific,

Pittsburgh, PA), then additional 100% Nutrient Broth (Fisher Scientific, Pittsburgh, PA) was added to the floor materials. Table 4.1 shows the sample size, inoculation volume and rinsate volume for each floor material.

Table 4. 1: Sample size, Inoculation volume, and Nutrient broth volume information

Floor Sample size Inoculation Rinsate volume Day 0 Day 2 Day 7 Day 14 Day 28 Total S. aureus A.niger 3 repeats Carpet 4 4 4 4 4 20x3=60 0.5 ml of 1.6x107 0.5 ml of 25 ml (BC) (log10 6.9) 7.6x10^6 7 (log10 6.6)

VCT 4 4 4 4 4 20x3=60 0.1 ml of 1.6x107 0.1 ml of 15 ml (log10 6.2) 7.6x10^6 7 (log10 5.9)

Notes: - 5ml PBS+5ml Nutrition broth added on Carpet Nutrition -100ul PBS + 100ul NB on V tile added Day 0 and Day 14

Preparation and inoculation of microorganism:

On Day 0, BC and VCT were inoculated with 0.5 ml and 0.1 ml of 1.6x107

S. aureus suspension respectively. The inoculated volume was lower for the VCT because the droplets of the inoculum would run down the VCT. On Day 0, 5 ml of

NB+5 ml of 1xPBS was added on BC samples. The BC were wetted and supplied with

nutrient, simulating in-use conditions. Inoculated VCT had 0.1 ml of NB+ 0.1 ml of

1XPBS added. The volume for the additional nutrient broth was reduced for VCT to match the lower inoculating level of bacteria and fungi. Relative humidity was maintained at 70–80%.

Right after inoculation on Day 0, four floor samples from each type were rinsed in pre-sterile 1XPBS.The rinsate was collected in a 50 ml centrifuge tube (Fisher Scientific,

Pittsburg, PA), serially diluted and plated on TSA and PDA plates. A similar process was performed on Day 2, Day 7, Day 14 and Day 28. Thus, growth and survivability of

S. aureus and A. niger was calculated by counting colony forming units, CFU/25 cm2.

Blank uninoculated floor samples were tested for microbial growth on Day 0.

Statistical analysis: Statistical work was carried out by log transformation analysis using

STATA 12 (STATA Corp., Inc.) and MS Excel (Microsoft Corp., Office 2012). The mean change in S. aureus levels for all the tested days was compared for each floor type using the Kruskal-Wallis test and two sample T-test.

Changes in mean CFU from Day 0 to Days 2, 7, 14, and 28 were calculated by:

Individual log10 CFU of Day(x) - mean log10 CFU of Day0

(“X” being 2, 7, 14, and 28)

The effect of nutrition was compared both within the floor material types and across the floor material types.

Data from the previous study (Chapter 3) with BC and VCT without nutrition was compared side by side (Fig 4.1 and Fig 4.2). The blank un-inoculated floor samples, BC

and VCT did not show any growth of either bacteria or fungi indicating sterility of the floor materials.

For notation, from here on, floors materials will be labelled as:

Carpets with nutrient broth: BCwN

Carpets without nutrient broth: BCw/oN

Vinyl composition tile with nutrient broth: VCTwN

Vinyl composition tile without nutrient broth: VCTw/oN

Results

Survivability of S. aureus on carpets and vinyl with and without nutrition.

Carpets: The baseline Day 0 concentration was log10 6.9 for carpets without nutrient

(BCw/oN) and log10 6.2 for carpets with additional nutrient (BCwN). The carpet samples without nutrient (BCw/oN ) showed a steep decline in S. aureus colonies by Day 2 (Table

4.2). By the end of Day 14, the colonies were almost undetected. However, on Day 2,

BCwN showed an increase of almost 2.5 log10 in S. aureus concentration (Fig. 4.1). The concentration remained about the same by the end of Day 7. By Day 14, the concentration had declined but it was 1 log10 above Day 0 count. Data from Day 28 were not clear because after Day 14, in addition to S. aureus colonies, other colonies grew on the TSA plates (Appendix B). However, no other bacterial colony grew on BCw/oN on any tested days.

The colonies for Days 0, 2, 7, 14 and 28 were also tested on Mannitol Salt Agar

(MSA) plates along with Tryptic Soy Agar (TSA) plates. While TSA is a general media

for bacterial growth, MSA is selective and a differential media for S. aureus (Koch 1942;

Mannitol Salt Agar). S aureus colonies grow and ferment mannitol which changes the color of the colony and surrounding media to yellow after 48 hours.

On Day 0 and Day 2, both TSA and MSA plates showed growth of S. aureus only. However, from Day 7, Day 14 and Day 28, there was growth of other unidentified colonies on the TSA plates. Colonies from TSA plates were cross-checked with MSA plates which allowed growth of S. aureus with a surrounding yellow color of media.

However, along with S. aureus (ATCC 6538), there were growths of pink colonies on

MSA that did not ferment mannitol. It can be inferred that pink colonies were

Staphylococcus epidermis which grows on MSA, but does not change color (Becton

Dicken: n:d). However, we did not perform any additional tests to confirm it.. The growth of these unidentified bacteria almost formed a “lawn type” growth, thus, making it impossible to count colonies of S. aureus. As a result, only yellow colonies of S. aureus were counted from MSA plates for quantitative analysis. For BCwN, by Day 28, only four carpet samples out of twelve (30%) showed the presence of yellow S. aureus colonies and rest samples were covered with unidentified pink colonies. The data for Day 28 for carpet samples were discarded for comparison.

2 Table 4.2: Mean change in log10 cfu/25cm of S. aureus on tested days comparing nutrition.

Flo or Inoculum mean (sd) of change in CFU/25cm 2 conc. Log10 Day 0 Day 2- Day 7-Day0 Day 14-Day0 Day 28-Day0 Day0 S. aureus on BC

BCw/oN 7.9 6.9 (0.2) -3.7 (1.3) -5.4(2.3) Undetected Undetected

BCwN 6.9 6.2(0.2) 2.6(0.4) 2.6(0.3) 0.9(0.3) Undetected

Kwallis P value 0.0001* 0.0001* 0.0001* 0.0001* (comparing nut ) S. aureus on VCT

* A VCTw/o 7.6 7.2(0.2) 1(0.7) 0.1(1.1) -2(0.8) -3.9(2.1) N VCTwN 6.2 5.5(0.2)* 2.9(0.3) 3.2(0.3) 2.8(0.3) 0.67(0.6)

Kwallis P value P=0.0001* 0.0001* 0.0001* 0.0001* 0.0001* (comparing nut.) FootNote: *Significant at p<0.05. Growth of S. aureus significantly longer with nutrition on both BC and VCT.

Vinyl tiles: For VCT samples, the baseline Day 0 concentration for S. aureus was log10

5.5 with nutrient (VCTwN ) and log10 7.2 without nutrient (VCTw\oN). On Day 2, samples both with and without nutrition VCT showed positive growth (Table 4.2). There was an almost 3 log10 increase in VCTwN, and a 1 log10 increase in VCTw\oN. The growth on the

VCTwN was even higher by Day 7. On Day 14 there was a 2 log10 increase compared to

Day 0, but by Day 28, the growth had slowed down to log10 0.6. This is in contrast to the

VCTw/oN where there was an increase of 1 log10 by Day 2 compared to Day 0, followed by a gradual decline on Days 7, 14, and 28. No other colonies were reported from

VCTw/oN on any day of testing. However, as with the BCwN samples, VCTwN showed growth of another pink colony besides yellow colonies of S. aureus on Day 14 and Day

28 on both TSA and MSA plates. The concentration of pink colonies increased from Day

7 to Day 28 for VCTwN. Only the yellow colony counts were used for statistical analysis.

Unlike BCwN, on Day 28, all the VCTwN (12 out of 12) had yellow colonies of S. aureus on MSA plates.

Fig: 4.1 Survivability of S. aureus on floor materials with and without nutrient broth. Error bars are std error of mean

Survivability of spores of Aspergillus niger on floors with and without nutrition:

Carpets: The Day 0 concentration for BCwN was log10 6.1 and log10 6.6 for BCw/oN. For

VCT, it was log 10 5.5 for VCTwN, and log10 6.3.on VCTw/oN .

Without additional nutrient, the survivability of spores declined rapidly on BCw/oN and was undetected by Day 7 (Fig 4.2). However, in the presence of NB, spores survived on BCwN until Day 28 There was only a 2.4 log 10 decline by Day 28 on BC wN. (Table

4.3).

Vinyl tile: VCT showed similar survivability with and without nutrition. The spores remained viable until Day 28 in both scenarios. There was a gradual decline in survivability of on both VCTwN and VCTw/oN. However a smaller decline was observed on VCTwN than on VCTw/oN.

With additional nutrient on floor materials, the spores survived well up to Day 28.

Although, the survivability was statistically higher on VCTwN than on BCwN, by Day 28, there was decline of approx. 2 log10 in both floor materials (Fig 4.2). The extended survivability of spores on both floors in a nutrient and moisture-rich environment, especially carpets, can explain the mold formation and contamination in moisture- damaged building.

Fig: 4.2 Survivability of A. niger on floor materials in with and without nutrient broth. Error bars are std error of mean

2 Table 4.3: Mean change in log10 cfu/25cm of A. niger on tested days comparing nutrition.

Floor Inoculum mean (sd) of change in CFU/25cm 2 conc. Log10 Day 0 Day 2-Day0 Day 7-Day0 Day 14-Day0 Day 28-Day0 A niger on BC BC without 6.6 6.3(0.3) -4.7(1.8) Undetected Undetected Undetected nut BC With nut 6.6 6.1(0.2) -0.8(0.4) -0.8(02) -1.3(0.2) -2.4(0.3)

Kwallis P value 0.0001 0.0001 0.0001 0.0001 0.0001 (comparing nut ) A niger on VCT VCT without 6.3 6.1(0.2) -0.2(0.3) -1.3(0.8) -1.5(0.3) -2.2(.7) Nut VCT with 5.9 5.(0.1) -0.3(0.2) -0.4(0.2) 0.4(0.2) -1.7(1.2) nut Kwallis P value 0.0209* 0.2983 0. 0001* 0.0001* 0001* (comparing nut)

FootNote: *Significant at p<0.05. Spores of A .niger survived significantly longer with nutrition on both BC and VCT. 57

Comparison of survivability of S. aureus on carpet vs. vinyl, in the presence of nutrition: The growth and survivability of S. aureus with nutrient broth was compared on the two floor types (Table 4.4). The mean log10 cfu for S. aureus was log10 6.9 for

BCwN and log10 6.2 for VCTwN. Both VCTwN and BC showed positive growth on Day 2.

Despite a lower initial baseline, Day 0 concentration on VCTwN compared to BCwN,

VCTwN and BCwN had a statistically similar growth of about 3 log10 on Day 2. However, the growth continued to be > 2 log10 for VCTwN until Day 14, followed by a decline on

Day 28, while the mean log10 CFU on VCTwN for Day 28 remained similar to Day 0. For,

BCwN, the greatest increase was observed on Day 2, followed by a gradual decline on and after Day 7.

The change in mean log10 CFU on Day 2 was similar for both VCTwN and BCwN, but the growth was statistically larger in VCTwN on Days 7 and 14. Although BCwN samples were supplied with a larger volume of nutrient broth because of higher inoculating volume, drying of this nutrient broth and moisture from the carpet samples could have occurred, resulting in lower CFU counts.

In the absence of additional nutrient, BCw/oN showed a steep decline in survivability and S.aureus was undetected by Day 14, while, in VCTw/oN, S. aureus was detected until Day 28.

2 Table 4.4: Mean change in log10 cfu/25cm of S. aureus on tested days comparing floor

Inoculum Floor conc. mean (sd) of change in CFU/25cm 2 Log10 Day 0 Day 2-Day0 Day 7-Day0 Day 14-Day0 Day 28-Day0

S. aureus without Nutrient broth Undetected Undetected BC 7.9 6.9 (0.2) -3.7 (1.3) -5.4(2.3) w/oN (-6.9) (-6.9) A VCTw/oN 7.6 7.1(0.2) 1(0.7) 0.1(1.1) -2(0.8) -3.9(2.1) Kwallis P value 0.0001* 0. 0243* 0.0001* 0.0001* 0.0001* (comparing floor) S. aureus with Nutrient broth Undetected BC 6.9 6.2(0.2)* 2.6(0.4) 2.6(0.3) 0.9(0.3) wN (-6.2)

VCTwN 6.2 5.5 (0.2)* 2.9(0.3) 3.2(0.3) 2.8(0.3) 0.67(0.6) Kwallis P value P=0. 0.165 0.0002* 0.0002* 0.0001* (comparing floor) 0001*

2 Table 4.5: Mean change in log10 cfu/25cm of A. nigers on tested days comparing floor.

Floor Inoculum mean (sd) of change in CFU/25cm 2 conc. Log10 Day 0 Day 2-Day0 Day 7-Day0 Day 14--Day0 Day 28-Day0

A. niger without Nutrition BC 6.6 Undetected Undetected (- Undetected w/o 6.3(0.3) -4.7(1.8) N (-6.3) 6.3) (-6.3) VCT 6.3 w 6.1(0.2) -0.2(0.3) -1.3(0.8) -1.5(0.3) -2.2(.7) //oN (Kwallis P value P=0.009 0.0001* 0.0001* 0.0001* 0.0001* (comparing floor) * A. niger with Nutrition

BCwN 6.6 6.1(0.2) -0.8(0.4) -0.8(02) -1.3(0.2) -2.4(0.3) VCT 5.9 w 5.5(0.1) -0.3(0.2) -0.4(0.2) 0.4(0.2) -1.7(1.2) N Kwallis P value 0.018 0.0026* 0.0001* 0.0005* (comparing floor)

Comparison of survivability of spores of A.niger on carpet vs. vinyl, in presence of nutrition: In the presence of NB, spores survived on both on carpets and vinyl until Day

28. By Day 28, the culturable spores on BCwN declined by only 2.4 log 10, while the decline on VCTwN was about 1.7 log 10 by Day 28. The mean change in culturable spores of A. niger was statistically higher for BCwN than VCTwN on all tested days (Table 4.5)

Thus, the spores had longer survivability on VCTwN.

Discussion and conclusion

Both the representative floors, carpets as “soft” flooring materials and vinyl tile represented the smooth and “hard” type floor surfaces. These are the two most widely used floor materials in US homes (WFA..n.d). Both S. aureus and spores of A. niger had better survivability on carpets and vinyl tiles in the presence of nutrient broth. This is the first study comparing these two floor materials with simulated dirty, in-use-condition floors. Although the nutrition levels were not similar for both the floor types, the test provides a picture of a real-world scenario where the floors accumulate moisture, organic and inorganic dust, and particles that could function as nutrient for microbes (Whitehead et al. 2001; Franke et al. 1997; Sattar & Maillard 2013; Anderson et al. 2009). In general, carpets have higher loads of dust and organic buildup, justifying the use of higher loads of nutrient broth (Boor et al. 2013; Chunag et al. 1995). Carpets have also been found to have higher level of humidity compared to the air above them. (Arlian 1992).

The relative humidity during the study was between 40–80% which is a typical of an indoor environment. Maus et al. (2001) found that atmospheric dust could serve as a nutrient in high RH conditions, enabling mold spores growth and fungal contamination in moisture-damaged buildings, where it is a common occurrence. In the present study, the spores of A. niger survived well in conditions with high nutrition.

Many authors in multiple settings have recovered S. aureus, along with many other bacterial species on vinyl tiles and carpets. This study differs in comparing survivability of S. aureus and A. niger spores for an extended period of time on two common floors. It is also important to note that the study compared only for additional

nutrient on Day 0 and Day 14. In the real world, the floors would receive deposition of dust and particles continuously affecting the nutrient level. Additionally, floors are cleaned and disinfected routinely. This activity may affect the survivability as well as affect the contamination level differentially on floors.

The blank un-inoculated and sterilized carpet samples on Day 0 did not show any kind of microbial growth. However, on Day 7 and onwards, there was growth of unidentified bacterial colonies along with S. aureus. It could be interpreted that these unidentified bacteria were either below detection limit on Day 0 or the floor materials got contaminated from other sources. Inoculated floor materials might have been contaminated with bacteria from other sources during inoculation, like air, or air present in the petri dish. However, we do not anticipate contamination from other sources because inoculated floor samples were placed in covered petri dishes and were stored in plastic containers for the entire experimental period. Inoculation was carried out under a biosafety hood, eliminating the possibility of cross-contamination. If the first scenario is to be considered, it is very likely that, in the presence of nutrition, these unidentified bacteria (those perhaps below Limit of Detection), started to grow and multiply. The growth occurred to a level where the colonies were detected even at a dilution of 1x10-5, by Day 7. This also indicates the potential of floor materials which may seem clean or disinfected may still harbor bacterial contamination, which , in the presence of conducive environment like enough moisture and nutrition, could possibly grow and form a reservoir. This is very plausible scenario especially for carpets, where all these factors could occur. Presence of fibrous surface matrix can allow accumulation of dust and soil

particles, along with moisture and humidity. Once the bacterial contamination occurs, it is very possible, that these bacteria will settle down, grow and act as reservoir or sink.

In conclusion, the study found that nutrient and moisture increase the survivability of S. aureus on both floor types. The viability of fungal spores is also extended with extra added nutrition.

CHAPTER 5

Survivability of Soil Bacteria and Fungi on Floor Materials and Identification

of Survived Bacteria

Introduction:

Floor material types may support the growth of microbes differentially. A

previous study of survivability on different floor materials was performed with the known

organisms, Staphylococcus aureus and Aspergillus niger. In addition, an experiment to

test the survivability of naturally occurring soil microbes on floor materials was designed

for this study.

Soil is very rich in microbes. It is estimated that one gram of soil may contain

almost a million bacteria (Gans et al. 2005). Many indoor bioaerosols, especially fungal

spores, have outdoor sources (Frank et al. 2012; Meadow et al. 2010). Hunt et al. (2006)

developed models to study mass transfer of soil on footwear from outdoors to indoors and

found floor dust particles inside the building to be heavily influenced by outdoor soil.

Along with the outdoor soil, the bacteria in the soil can be tracked into houses. Floor

materials may thus support these microbes in different ways. Hence, the rationale for

using outdoor soil to inoculate selected flooring materials was to simulate the in-use

pattern of floor materials.

The selected floor materials were pre-wetted with nutrient broth to simulate in-use conditions as described in the AATCC-174 method. Along with the survivability, the most persistent bacteria surviving on the floor materials after two weeks (Day 14) were subjected to identification using culture-independent techniques.

Study materials and methods

Floor materials

1. Vinyl Composition Tile (VCT) (Home Depot, Traffic Master Allure tile, GripStrip resilient tile flooring, Color: Livorno Onyx)

2. Residential Broadloom Carpet (BC) (Bargain Outlet, Mohawk Thunderbolt cat-tail, nylon fiber)

Sample size: In the first set of experiments, twenty sets of each floor type were inoculated on Day 0. The floor samples were tested for microbial survivability on Days 2,

7, 14, and 28. The same set of experiments was repeated twice more. Thus, a total of 120 floor samples were tested (2 floor types × 4 samples of each floor × 5 sampling days × 3 experiments = 120 floor samples in total). Table 5.1 describes sample size, inoculation volume and rinsate volume for each floor material.

Soil sample: Top soil was collected from a residential and a commercial site. The residential site included a neighborhood garden area, while the commercial area included the garden area near OSU hospitals. In each site, three different locations were selected one meter apart. The leaf and debris was removed from the area. With a clean and disinfected hand shovel, top soil from a depth of 5–6 cm was collected. From each location, approximately 200 gm of soil was collected. Soil samples were stored in a new whirl pack plastic bag and transported to the laboratory the same day to be stored at 40οC.

In the laboratory, soil samples were mixed well and made homogenous by applying pressure on the bag. The soil was then sieved through a soil sieve to obtain a fine soil sample. All the soil samples from the three residential site locations were combined.

Similarly, all three soil samples from the commercial site were combined.

Preparation of inoculum: A soil slurry was prepared with 10 gm soil in 10 ml sterilized

1XPBS (Fisher Scientific, Pittsburgh, PA). From this soil slurry, 5 ml was mixed with

50 ml of 10% nutrient broth (NB) (Fisher Scientific, Pittsburgh, PA). Thus, the soil concentration was 1gm soil/10ml of NB10%. This soil suspension was used as the inoculum.

Table 5. 1: Sample size, Inoculation volume, and Nutrient volume

Floor sample size Inoculation Additional with soil nutrient on Day 0 and Day 14 Day 0 Day 2 Day 7 Day 14 Day 28 Total S. aureus 3 repeats A.niger

Carpet 4 4 4 4 4 20x3=60 0.5 gm soil in 5 ml 5 ml NB10%

(BC) NB10%

VCT 4 4 4 4 4 20x3=60 0.01 gm of soil in 0.1 ml NB10%

0.1 ml NB10%

Inoculation and enumeration of soil bacteria and fungi

In the first experiment, a total of twenty sets of each sterilized floor type was placed in a pre-sterilized petri dish (Fisher Scientific, Pittsburgh, PA). On Day 0, each of these 25 cm2 floor samples was inoculated with 0.5 ml soil inoculation suspensions on

BC, and 0.1 ml on VCT.

The inoculum was added on floor materials at six spots in an ‘X” pattern. The inoculated floor materials were then covered with a lid and placed at a room temperature of 24°C for the subsequent days of testing. On Day 0, right after inoculation, four of the inoculated floor materials were rinsed and washed with sterilized 1x phosphate buffer saline. The floor samples were submerged and shaken vigorously with sterilized forceps for two minutes. The floor materials were held with forceps and the rinsate was collected in a sterile 50 ml centrifuge tube (Fisher Scientific, Pittsburgh, PA), mixed by vortexing

for one minute, properly diluted, and plated on TSA (Fisher Scientific, Pittsburgh, PA) and PDA (Fisher Scientific, Pittsburgh, PA , USA) for bacterial and fungal growth respectively. Afterwards, on Days 2, 7, 14, and 28, four samples from each of the inoculated floor materials were collected and treated using the same method to determine microbial growth. All the counts were measured in CFUs per 25 cm2. An inoculated and sterilized floor sample for each floor material was rinsed and plated on Day 0 to ensure sterility. The inoculated floor samples on Day 0 did not result in any growth, confirming the sterility of the floor materials. The temperature was constant at 24oC throughout the study period, while relative humidity remaining within a range of 50%–70%, reflecting the typical indoor environmental conditions. The collected data were log transformed and were analyzed with STATA12 (Stata Corp., Inc.) and MS Excel (Microsoft Corp., Office

2013).

Results

Bacterial growth: The bacterial count was measured as CFU/25 cm2 for floor samples.

The Day 0 count was log10 6.4 for BC, and 5.2 for VCT. The growth in soil bacteria was positive on both floor materials, increasing to about 2 log10 CFU by Day 2. After Day 2, growth slowed down for both floor materials until Day 28. The bacterial CFU count on

Day 28 was similar to the Day 0 count. The mean difference in CFUs on Days 2, 7, 4 and

28 was compared with Day 0 for BC and VCT. The statistical test revealed a similar growth rate in bacterial CFU on VCT and BC until Day 2. Later, the floor materials showed different growth rates on all other tested days (Table 5.2). Although the Day 0

concentration was lower on VCT, the bacterial growth was generally greater than BC.

Similar to the artificial inoculation of Staphylococcus aureus (Chapter 4), there was a 2 log10 growth on both of the floor types. It is to be noted that although additional nutrient was added on Day14 as well as on Day 0, a sharp increase in bacterial CFU was not observed for Day 28. This can be partly attributed to the fact that bacterial growth was not determined for at least two weeks after Day 14. Thus, we might have missed seeing any rapid growth pattern that could have occurred in between Day 14 and Day 28.

Fig 5.1: Surviavability of soil microbes on floor materials

Fungal growth: The Day 0 concentration was about log10 4.7 for BC, log10 4.6 for VCT

(Table 5.3 and Fig 5.1). The fungal growth was reported on both floor materials, until

Day 28, with a decline of about one log10 by Day 28. There was a small positive growth on Day 2 and a small decline afterwards. The mean change in fungal CFU was small for both floor types and both floor types showed statistically similar survivability.

Table 5.2: Change in soil bacteria on selected floor materials

Floor Bacterial CFU change from Day 0 in CFU/25cm2

Day 0 Day2-Day0 Day7-Day0 Day14- Day0 Day28- Day0

6.4 (0.14) 1.94(0.13) 1.4(0.04) 0.6 90.05) -0.4(0.06) Carpet

5.2 (0.18) 2.1 (0.2) 1.6(0.12) 0.8(0.12) 0.1(1.7) VCT K-Wallis testing for mean 0.0001* 0.165 0.0005* 0.0007* 0.0015* difference on floors

Table 5.3: Change in soil fungi on selected floor materials Floor Fungal CFU change from Day 0 in CFU/25cm2

Day 0 Day2-Day0 Day7-Day0 Day14- Day0 Day28- Day0

-0.56(0.13) 4.7 (0.4) 0.02(0.5) -0.7(0.16) -0.9(0.16) Carpet -1.5(0.18) 4.6 (0.2) 0.278 (0.17) -0.5(0.08) -1(0247) VCT K-Wallis testing for mean 0.8493 0.45 1 0.0002 0.9 difference on floors

Discussion and conclusion The survival of soil microbes in the presence of moisture and nutrient for up to four weeks on both VCT and BC indicates the potential for these floor surfaces to act as a source for microbial contamination in an indoor environment. It is also to be understood that soil microbes were inoculated only once on Day 0 whereas, in everyday life, contamination of floor occurs daily. In a study, Hunt et al. (2009) estimated that 34–85% of soils adhering to footwear are deposited on floors. It is estimated that average dust in a household can vary from around 0.04–14gm/m2 for vinyl and 0.1–99gm/m2 for carpets, depending on the age of the floor and the total vacuuming time (Boor et al. 2013; Chuang et al. 1995; Robert et al. 2004). Studies that looked at re-suspension of soil from floors found that walking-induced re-suspension is greater for carpets than for vinyl flooring.

(Boor et al. 2012; Qian & Ferro 2008; Mukai et al. 2009). The carpet and rug industry recommends daily vacuuming in high traffic areas, twice per week for medium traffic, and once per week for low traffic areas. However, vacuuming once per week is the most realistic and popular choice. In schools, it is recommended daily and with a time of

1min/m2 (Roberts et al. 2004). However, depending upon the type of vacuum, frequency of vacuuming, time spent on vacuuming, and cleaning practices, the removal of dust particles varies. This is also true for vinyl floors which are dusted and wiped with cloths or mops. It has been shown that even wiping fails to remove all the soil (Lioy et al.

2002). Instead, the soil particles become attached and clumped on the floor. These soil particles are not removed completely until they are dry and mechanically removed. It may become a significant source of exposure for children who play on the ground and are in constant contact with the floor. 71

The cleaning and disinfecting factors were not considered in this lab study; cleaning practices, which vary widely, will certainly have a different impact on microbial concentrations. Cleaning varies, based upon the cleaning method, the time spent on cleaning, and the frequency of cleaning. In the case of carpets, it is a common practice to vacuum once a week in homes. However, given what the study showed, it is plausible that both carpets and vinyl tiles can act as sinks in which soil microbes can grow.

However, on vinyl, the built-up dust is visible, and hence it is removed promptly and easily. But in the case of carpets, the buildup of dust is continuous, without being efficiently removed owing to the variations in vacuuming practices. Also, because carpets have a life span of 10 years on average, it is intuitive to assume that these carpets can store and accumulate a significant amount of dust. Thus, although both the floor types show a similar survivability of soil microbes, vinyl floor materials still seem to provide a better choice of floor for improving indoor air microbial quality.

Sub study: Identification of soil bacteria surviving on floor material surfaces after

Day 14:

The soil bacteria that were persistent on the floor after 14 days of soil inoculation were subjected to identification through genetic analysis. Although many studies have focused on identifying the whole genera of indoor bacteria collected from indoor surfaces, like dust and bioaerosols, tests on outdoor soil bacteria surviving on floors for at least two weeks have not been performed. Our study tried to subculture all the different bacterial colonies that persisted on floors after two weeks of soil inoculation. TSA plates

that were used to culture bacterial count on Day 14 from the floor samples were used for this study.

Methods: After all the soil-inoculated floor materials were rinsed with 1xPBS after Day

14 inoculation, the rinsate was plated on TSA plates. The TSA plates with the bacterial colonies were saved for identification of all the surviving bacterial colonies and the plates were refrigerated at 4oC. The individual, visibly distinct colonies were sub-cultured on

TSA plates and the sub-culturing was repeated until single and pure growth was observed for each colony type. A total of nine different bacterial colonies were identified from both floor types. These colonies were then used to extract DNA using colony PCR.

DNA extraction and PCR: The colony PCR method was used to extract DNA.

The V4 region of the 16S rRNA gene was amplified using universal primers: forward primer (27F, AGAGTTTGATCMTGGCTCAG) and reverse primer (1492R,

TACGGYTACCTTGTTACGACTT) (Lane 1991). Gradient PCR was performed with these primers to optimize the temperature. A PCR master mix (ThermoFisherscientific

Inc. PA) was used to prepare a PCR reaction. Each PCR reaction for an individual colony was prepared as follows: 2 µl of 10x PCR buffer, 0.1 µl of forward primer, 0.1 µl of reverse primer, 0.5 µl of 10 mM dNTPs, 0.1 µl of Taq Polymerase, and 15.2 µl of sterile distilled water. To each cold PCR tube containing the PCR reaction, a small amount of colony was added by picking up with sterile pipette tube, and mixing well. The temperature for gradient PCR was set for between 55°C and 65οC with eight different temperatures in a Multigene PCR Thermocycler (Multigene Inc.). PCR conditions were

as follows: 5 minutes at 95°C for initial cell breakage and DNA denaturation into single strands; 35 cycles 95°C; 1.5 minute at 54°C–65°C for primers annealing; 1 minute at

72°C- primers extension; 10 minutes at 72°C for final extension to ensure complete amplification. The PCR product was confirmed for amplification by 2% gel electrophoresis, and 2 µl loading buffer, plus 5 µl of PCR product was loaded in the well and run for 10 minutes. The bands were visualized under UV in an illuminator chamber.

The PCR products with clear bands were chosen for PCR-DNA purification. QIA-Quick

PCR purification kit (Qiagen, Valencia, CA, and USA) was used to purify the amplified product. The purified PCR-DNA was stored in the freezer at -20oC until it was sent for sequencing. Samples were prepared for shipment for sequencing as follows: 1 µl of purified PCR product, 0.1 µl of forward primer and 4.9 µl of water in a 0.2 ml PCR tubes. These were placed in an ice box and transferred to the sequencing facility. The

PCR-DNA products were sent to the Microbe Genomics Facility (PMFG) at Ohio State

University for gene sequencing.

PMGF uses an Applied Biosystems 3730 DNA Analyzer and BigDye™ cycle sequencing terminator chemistry. The sequencing reaction uses dye labeled- dideoxynucleotides, a heat-stable DNA polymerase, and a thermal cycler to generate the extension products that are separated by capillary electrophoresis on the Analyzer. The extension products are detected by exciting the unique dyes attached to each dideoxynucleotide with a laser, followed by a measurement of the fluorescent emission with a charge-coupled device (CCD) camera. Subsequently, the signal is interpreted by

the Applied Biosystems Sequencing Analysis program in order to determine the sequence of the nucleotides in the DNA template.

Result:

Bacterial identification: The gene sequence was analyzed for similarity score values accordingly to BLAST to identify bacteria to the genus and species level. A similarity of

97% was sufficient to identify to the genus and species level.

Table 5.4: Bacterial species identified from floor surface after 14 days of soil inoculation.

Serial Name Notes 1 Pseudomonas syringae pv. syringae Proteobacteria, Gram-negative rod B728a Plant pathogen 2 Xanthomonas campestris pv. campestris Proteobacteria, Gram-negative rod str. Plant pathogen to cruciferous plants 3 Pseudoxanthomonas spadix BD-a5 Proteobacteria, Gram-negative rod It t has been isolated from gasoline- contaminated sediment. 4 Achromobacter xylosoxidans A8 Proteobacteria, Gram- negative Degrading haloaromatic acid (chlorobenzoate and dichlorobenzoate) Contain genes associated with pathogenesis and toxin production in humans 5 Bacillus thuringiensis serovar konkukian Firmicutes, Gram positive rod str. One case of human pathogenic 6 Staphylococcus aureus subsp. Aureus Firmicutes, Gram positive rod Human pathogen

Discussion and conclusion

The six different types of bacteria identified were either proteobacteria or firmicutes. These are common soil bacteria which have been identified from indoor environments before (Dunn et al. 2013; Da Fonseca et al. 2016; Flores et al. 2011;

Gibbons et al. 2015). Staphyococcus aureus is a known human pathogen. Other species, such as Pseudoxanthomonas spadix BD-a5, is reported in soil mainly contaminated with oil (Lee et al. 2012). Achromobacter xylosoxidans A8 was also isolated from PCB- contaminated soil (Duggan et al. 1996). All other bacteria isolated were either human or plant pathogenic. Most of the isolated bacteria were gram negative rods which have been reported to occur commonly indoors. (Alyff et al. 1966; Neely et al. 2000)

Soil contains billions of bacteria. Although we observed only six different species

of persistent bacteria from our samples, there could be many more species which were

not identified. Culture dependent methods have been known to under-represent the actual

bacterial composition (Ramos et al. 2014; Toivola et al. 2002). It is estimated that only

1% of soil bacteria is actually culturable (Suwa et al. 2012; Toivola et al. 2002). Thus, it

is very possible that there are many more bacterial species that remain unidentified.

However, the study demonstrates how clinically relevant bacterial species can originate

from outdoor soil sources and survive on indoor environmental surfaces.

CHAPTER 6

Bacterial Composition of Floors in Three different Building Types (Manuscript 3)

Abstract The built environment affects the health and well-being of the occupants, and the

microbiological composition of a building can be influenced by many factors, including

building usage patterns, building materials, occupants etc. In the present study, we

explored the bacterial composition of floors in three building types with different traffic

levels.

Swab samples were collected from carpet and vinyl floors in three different

buildings: a medical center, veterinary hospital and office. The samples were collected

from both high-traffic and low-traffic areas. Collected swab samples were processed for

DNA extraction and purification. Cultural-independent, next-generation sequencing using

a MiSeq platform was performed to determine bacterial microbiome composition. An

antibiotic-resistant gene (tetQ) was quantified by qPCR method.

Proteobacteria (40%) was the most abundant phylum from all samples combined.

The bacterial composition of floor samples was enriched with soil bacteria. Traffic level

was found to affect the number of OTUs significantly, where high traffic had higher

OTUs. Other factors, like building types or floor types, did not differ in terms of bacterial

diversity or composition. Carpet samples in the medical center had the highest number of

Streptomyces spp, which indicates potentially moisture-related issues. Detection of the

tetQ gene was also related to traffic level: high traffic levels had a significantly higher

level of tetQ.

This exploratory study concludes that floor surfaces are enriched with soil

bacteria. Traffic levels can affect the number of OTUs, and for the first time, this study

shows the detection of the tetQ gene to be impacted by traffic levels.

Introduction

Human beings, in conjunction with a diverse and complex soup of microbes,

spend almost 80%–90% of their time indoors (Dominguez-Bello, 2010; Kelley & Gilbert

2013; Prussin & Marr 2015). A built environment consists of all the environments

surrounding humans and plays a significant role in the indoor microbiome which affects

the health and well-being of humans (Kembel et al. 2012; Tringe et al. 2008). The

microbiological composition of a habitat is controlled by many factors, including

building materials, occupants, outdoor air, pets, etc. (Coughner et al. 2011; Flores et al.

2011; Kembel et al. 2012; Lax et al. 2012; Meadow et al. 2014; Narui et al. 2009).

Adams et al. (2015) performed a meta-analysis of microbiome studies in various built

environments like hospitals, homes, cheese-making factories, athletic facilities, museums

and subways, and concluded that geographic and building types heavily influence

microbial composition. Studies in offices in Finland and the US have found vastly

different bacterial composition (Hewitt et al. 2012; Rintala et al. 2008). Healthcare facilities harbor their own bacterial composition where several pathogenic bacteria have been found to survive on various indoor surfaces (Coughner et al. 2011; Da Fonesca et al.

2016; Harris et al. 2000; Narui et al. 2009; Yazgi et al. 2009). The microbiome composition not only differs between building types, but has been found to differ within building types, thus creating a microhabitat. Even within a single building, different surfaces exhibit different bacterial compositions. For example, human-associated fecal bacteria have been found on restroom floors (Flores et al. 2011; Gibbons et al. 2015).

Various common surfaces that are touched frequently, like door knobs and kitchen handles, share a similar microbial composition, while differing from surfaces like restroom floors (Lax et al. 2012). The difference between the surfaces in terms of the composition may be influenced by many factors including surface types, surface materials, usage pattern, occupants, pets, etc. (Chase et al. 2016; Dunn et al. 2013; Brent

2016).

Floors have been found to be colonized by various bacterial compositions. Since floor surfaces might be constructed of various kinds of material, we wished to see if various floor materials differed in terms of bacterial composition. The present study additionally explores and compares the microbiome of three building types with samples collected from different floor material types.

Antibiotic resistance in microbes is an emerging problem. According to CDC, almost 23,000 deaths result from antibiotic-resistant infections per year (CDC, 2016).

The ubiquitous use of antibiotics on farms, antimicrobials in healthcare facilities and homes, and overuse of antibiotics has led to increase in multi-drug resistant microbes.

Antibiotic-resistant genes (ARGs) have been studied in various indoor habitats (Kuk, K.

2004; Zhang & Zhang 2011; Smith et al. 2004; Ling et al. 2013; Armand-Lefevre et al.,

2005; Roberts 2005), especially in specialized buildings like meat-producing facilities,

Concentrated Animal Feeding Operations (CAFOs), waste water treatment facilities, hospitals, etc. (Kuk , K. 2004; Lavilla Lerma et al.2014; Zhang & Zhang 2011). Some studies have also been performed on farm workers and people living near farms (Ling et al. 2013). Ling et al. (2013) undertook a comparative study of tetracycline resistance genes in aerosolized bacteria of indoor and outdoor environments and CAFO. They found

10 to 100 times more tetracycline resistance genes in CAFOs than in human-occupied indoor/outdoor settings. However, there have not been enough studies on ARGS in other commercial buildings, like offices. Most of these studies focused on airborne microbes; studies comparing ARGs on floor surfaces in indoor habitats are scant and therefore, this study, in addition to the study of bacterial composition of the floor samples, also attempts to identify ARGs in the floor samples collected from the three different building types.

Tetracycline is one of the most commonly used antibiotics for both human and veterinary medicine. At least 40 types of tetracycline-resistant genes (tet) have been characterized and tetQ has been detected in various environmental surfaces and media

(Roberts 2005). This study attempts to identify and quantify tetQ gene as a representative

ARG.

Study design and methods

For the study, two different floor types were selected in three building types.

Floor types: Samples were collected from carpets and vinyl tiles from both low- and

high-traffic areas of each building type.

Building types: The three building types studied were

a) Medical center: The patient registration area is a high-traffic area. Patients’ rooms

and the nurses’ offices were low-traffic areas. Both these areas were selected for

carpets and vinyl.

b) Veterinary hospital: Small-animal clinic area with vinyl tiles, and offices with

carpets were selected. These were comparatively high traffic areas. Samples from

big farm-animal clinics had lower traffic.

c) Offices: Carpet sample was selected from a regular academic building hall with

classrooms, laboratories and offices. Samples for high traffic area were collected

from classrooms. Offices and laboratory rooms had lower traffic area. Samples for

vinyl flooring were collected from laboratory rooms with low traffic.

Table 6. 1: Sampling location details for microbiome samples

Floor Location Traffic Vet. Hospital Carpet Small animal office High Carpet Large farm animal clinic Low VCT Small animal clinic High Large farm animal clinic VCT Low office Medical center Carpet Main entrance High Carpet Office Low VCT Main entrance High VCT Patient room Low Offices

Carpet Classroom High Carpet Office Low VCT Laboratory room (Least used) Low (Lower than other lab VC T VCT Laboratory room Low

Traffic types: The floor swab samples collected were from three different building types:

a veterinary clinic, a hospital, and an office building. Each building differed in terms of

the number of visitors it had in a day, the number of which was was confirmed personally

as well as counted visually, and the sample classified as a high- or low-traffic area

depending upon the number of people walking on the sampling area. Low-traffic areas

were places with 15 or fewer visitors per day. High-traffic areas had 100 or more visitors

per day. The veterinary hospitals for large animals (mostly farm animals) had approximately 10–15 visitors per day. The small-animal clinic, which saw almost 100 visitors every day, dealt with many pets, and thus the higher volume of patients. The entrance of the human hospital entrance was the busiest location, with hundreds of people walking over the sampling area every day, while the patient's room had four to six people per day. The classroom had a seating capacity of 80 people and three to four classes were held every day. Thus, there was a high level of traffic there, while the faculty office had low traffic. Laboratory rooms had low traffic, with only a few people working every day.

Surface sample collection: Samples for microbial analysis were collected using surface swab sampling (Copan nylon flocked swabs (MicroRheologics SRL, Copan, Brescia,

Italy). The swab was moistened by dipping in a centrifuge tube containing sterile 1XPBS before sampling. The swab was soaked in the sterile PBS, shaken profusely to remove the dripping PBS, and placed back in the transport tube provided with the swab. An area of 5 x 5 cm was selected for each floor area and the swab was run in zigzag fashion vertically and horizontally, ten times, covering the entire 25 cm2 square area. After sampling, the swab was transported in an ice box and stored at -20oC within 30 minutes of sampling.

Two samples were collected from each sampling area. Composite sampling was used for

DNA extraction.

Extraction and purification of DNA from swab samples: Genomic DNA of the samples was extracted directly from the swabs using a Mo Bio Power Soil DNA isolation kit (MO

BIO Laboratories, Carlsbad, CA Cat: no 12888). The tip of the swab was placed in the bead tube of the extraction kit. All the procedures were followed according to the instruction manual provided. The extracted DNA was purified using Mo Bio Power

Clean® DNA Clean-Up Kit (MO BIO Laboratories, Carlsbad, CA Cat: no 12877) according to the instructions provided. The purified DNA was stored at -80°C.

Sequencing for Microbiome analysis: Purified DNA was sent for next generation analysis to Chunlab, Korea. The Purified DNA was amplified using 16S rRNA gene (V1-V3 region) with 10% Bifidobacterium bacteria specific primer for bacterial community analysis. The amplification, sequencing, and basic analysis were conducted by Chunlab

Inc. (Seoul, Korea) using a Miseq Platform. Low-quality sequences with less than 300 bp and less than 25 average quality score were filtered and discarded. ChunLab uses

EzTaxon-e database coupled with the BLASTIN search tool for taxonomic classification of individual sequence for each read. The similarity cutoff value for determining valid similarities between species was at 97%. The richness and diversity of samples were determined by Chao1 estimation and the Shannon Diversity Index at 3% distance. The bacterial composition analysis and diversity indices were calculated by CL community software (Chunlab Inc., Seoul, Korea).

Sequencing for antibiotic resistance gene (tetQ): The sequences of the primers that were used to detect tetracycline resistance gene (tetQ) were: tetQF

CATGGATCAGCAATGTTCAATATCGG and tetQR

CCTGGATCCACAATGTATTCAGAGCGG. All experiments were conducted in triplicate using the CFX96 TouchTM real-time PCR detection system (Bio-Rad, Hercules,

CA, USA) (Smith). The total volume of qPCR mixture was 20 µL, including 2 µL DNA template, 10 µL SYBR Green PCR Master Mix (Applied Biosystems, Foster City, CA,

USA), and 500 nM primers. A mixture of all PCR regaents with nuclease-free water

(Fisher Scientific, Fair Lawn, New Jersey, USA) was used as a negative control for each

PCR reaction. The PCR cycling conditions were composed of an initial cycle at 50°C for

2 minutes and 95°C for 10 minutes, followed by 40 cycles of denaturation at 95°C for

15 seconds, annealing and extension followed by reference conditions(Nikolich et al.

1994 ). After amplification, a melting curve analysis was performed by heating samples to 95°C for 30 seconds, cooling them to 62°C for 1 minute, and then heating them to

95°C at a rate of 0.2°C/s (Lee et al, 2012).

The data was grouped by building type, traffic type, and floor type for statistical testing. The statistical testing was performed in STATA 12 (STATA corp.). Principal coordinates analysis (PCoA) was applied to visualize data similarities in beta diversity using the PAST3 (Ver. Past 3.1 Ųyvind Hammer, Natural History Museum, University of

Oslo)

Results

Microbiome analysis: A total of 1,79,398 reads were obtained from all samples

combined. Quality filtering of data was applied to remove low-quality sequences

and the remaining sequences, numbering 179 368 (>99%), were used for

computation. The CD-HIT (Cluster Database at High Identity with Tolerance)

program was used to define OTUs (Li & Godzik 2006). The Shannon and

Simpson Diversity Index was pre-calculated in the CL community software

(Chunlab, Korea) using the mother program (Schloss et al. 2009).Operational

Taxonomic Units refers to a group of sequences that are mathematically defined

with a sequence similarity of 97% (the cut-off boundary). With known database.

Thus, the species may or may not be the same as the OTU.

OTU analysis: A minimum of 6100 OTUs and a maximum of 6700 OTUs were found

from samples collected. The lowest OTU number was found on the vinyl tile of the least-

used laboratory and the highest count for OTU was found in the carpet from a high-traffic

area in a classroom office

The number of OTUs was significantly higher in high-traffic samples compared

to low-traffic samples. (Matched pair t-test P value= 0.018, Fig 6.1). Carpet samples had

higher OTU levels with higher traffic (Fig 6.2). Both low- and high-traffic areas in the

veterinary hospital had similar OTU levels, possibly because the veterinary area was not

cleaned as regularly as the medical center and offices. The low-traffic farm animal areas

were especially and visibly dirty compared to areas in the medical center and offices.

Other factors, such as building types and floor types did not differ significantly with

respect to the number of OTUs.

. Fig 6.1 OTUs according to Floor, Traffic, and Building types

Predictive Margins with 95% CIs 6800 6600 6400 Linear Prediction 6200 6000 Low High Traffic

Vinyl Carpet

Fig 6.2: Predictive margins for OTU levels of floor based on traffic level .

Table 6.2: Bacterial diversity of the microbiome samples

Factors ACE Chao1 OTUs

Floor type Carpet 24625(2174) 15667(936)) 6415(217) Vinyl 26016(1446) 16172(518) 6402(159)

Traffic High 25237(1842) 16097(511) 6548(99) Low 25380(2093) 15794(928) 6308(160)

Building type Medical 25097(2353) 15958(904) 6387(213) Vet 25603(1569) 16117(442) 6479(41) Office 25261(2265) 15685(1010) 6358(251)

Species richness: Species richness measures the total number of species present in a community. Species richness estimates like Chao1 and ACE (Table 6.2) along with observed OTUs was calculated. Chao1 and ACE estimates are based on the number of rare classes (OTUs) found in the sample (Chao 1984). In this study, Chao1 was at least

2–3 times the observed OTUs. This indicates presence of significantly higher number of singleton and doubleton species in the sample. None of the factors, traffic, and building or floor types differed significantly.

Fig 6.3 Boxplot depicting diversity indices as measured by Shannon diversity index according to the Building, Traffic, and Floor types

Fig 6.4 Boxplot depicting diversity indices as measured by Simpson Index according to the Building, Traffic, and Floor types

Bacterial diversity: Commonly used alpha-diversity like Shannon and Simpson’s Index were pre-calculated in CL community software. All the samples had a Shannon Diversity

(H) Index of 8 and above. The Simpson Index (λ) is a dominance index. Simpson

Diversity index (D) is calculated as (D=1-λ) and the Simpson Diversity (D) values were all above 0.99, indicating a very high diversity in the samples. Of the buildings, the medical center had more diverse bacterial composition than the other building types, and the carpet had a higher diversity than vinyl tiles (Fig 6.3, 6.4). The Simpson Index (λ) in floors was not significantly different (p value=0.054); the carpet had a comparatively higher diversity compared to vinyl, but carpets also had higher OTU levels. This is reflected in the higher diversity in carpets. 90

Bacterial composition: A total of 64 phyla was reported from all samples combined.

The major phyla were Proteobacteria (40%), Actinobacteria (19%), Acidobacteria (14%)

Bacteriodetes (6%), Clantmytocytes (5%), Chloroflexi (4.%), Firmicutes (2.24%) (Fig

6.5). Only nine major phyla were reported with a population greater than 1%, Another phylum, TM7 was reported from three samples accounting for 0.9% of all population.

The distribution of the phylum among the various building types did not differ much. The most abundant class was Alphaproteobacteria in Proteobacteria, followed by

Actinobacteria and unclassified EU686603 in Acidobacteria phylum. Hospital floors had a higher percentage of Actinobacteria and Gammproteobacteria. The order level bacterial composition is shown in Fig. 6.6. Rhizobiales were the most abundant order, followed by an unclassified order, EU686603. Floor samples from the hospital had a higher percentage of bacteria of Streptomycelatles order from Actinobacteria.

Almost 8000 species of bacteria were reported from all the samples combined.

The carpet ssample from the medical center was dominated by species, Streptomyces

ubrinus (3–4% of total species) (Fig 6.7). Other Streptomyces species were also high in

the carpet samples from medical center, compared to other floor samples. Other floor

samples were dominated by unclassified bacteria (DQ984612) from the steroidobacter

order by followed by Planctomycetaceae spp.

Fig 6.5: Relative abundance of top 6 Phylum according to Building types to Building according 6 Phylum top of Relative abundance 6.5: Fig

Fig 6.6: Relative abundance of top 15 order of individual sample individual of 15 ordertop of Relative abundance 6.6: Fig

Fig 6.7 Absolute abundance of top 50 genus according to Building types Building to according 50 genus of top abundance Absolute 6.7 Fig

Principle Coordinate Analysis (PCoA) of the samples. Data were visualized by Principal

Coordinate Analysis (PCoA) a weighted Fast Unifrac distance matrix obtained from

ChunLab community software. The UniFrac distance metric (Lozupone & Knight, 2005) is widely used in the comparison of two or more microbial communities. Uni-Frac is a phylogeny based distance metric comparing the composition between two samples.

PCoA was drawn in PAST3 (Hammer et al. 2001).The first two cordinates of the PCoA explained about 32% of the variation in community structure (Fig. 6.8). The UniFrac distance did not detect any meaningful clustering of samples based on building types, or traffic types, or floor types. However, both high-traffic and low-traffic carpet samples collected from the medical center were found to be very close to each other and distant from most of the other samples. In addition, the statistical test, PERMANOVA was performed to compare the beta diversity, that is, the variation in species abundance and composition among building, floor types, and traffic types. (Permonova P value, p=.0.54,

Table A.1) Similar to the PCoA analysis, none of the factors, building, floor or traffic types was significant, indicating a similar bacterial composition among the samples. The species diversity among the groups was bigger than between groups for buildings and traffic types (indicated by negative r value in ANOSIM, Table A.2). Floor types actually had a positive, albeit small, r value indicating some difference in the bacterial composition, but it was not statistically different.

Fig 6.8: Principle coordinate analysis of the individual samples. (Blue color: Vet, Purple: Office, Black: Medical center, Triangle ( Carpet), Square ( Vinyl), Filled (High traffic), Unfilled (Low traffic)

Antibiotic-resistance gene: The tetQ gene was determined as number of gene

copies per sample. was present in all the samples except samples obtained from the vinyl

tiles of the office room (Fig. 6.9) which was a laboratory room with the lowest traffic

level.

The samples were grouped according to building, traffic, and floor types. The

tetQ genes were found to be most abundant on the carpet swab samples from the

veterinary building. Floor samples for the veterinary hospital generally had higher copies

of tetQ compared to other building types. However, the difference was not statistically

significant, but the traffic pattern showed a significant difference. The tetQ genes were

significantly higher in the high-traffic area than in the low-traffic area. The result is

similar to the OTU level, which was higher for high-traffic areas. The number of OTUs

was lowest in the floor sample of the least-traffic area laboratory as well.

Figure 6.9. Abundance of tetQ gene present in individual floor samples. The horizontal bars indicate mean values

Discussion

The was an exploratory study comparing the microbial profile of three different building types, but the same location: the floor. Each sample chosen for study was, in a way, unique. The floors were either vinyl or carpet, either from high-traffic or low-traffic areas, and either veterinary hospital, human hospital, or office. All the floor samples had more than 6000 OTUs. The extremely high OTUs, Chao1 value, and alpha diversity indices indicate the richness and diversity of the floor bacterial microbiome. Floors have been reported to have a richer community and composition than ceilings and walls described in a previous study (Chase et al. 2016).

This is not surprising because of the nature of surface samples. Dust and soil particles from outdoors and indoors are deposited on the floor, along with bacterial cells from humans and pets (Kelley & Gilbert 2013; Prussin & Marr 2015; Stephens 2016).

Various researchers have estimated that about 20–85% of indoor soils come from outdoors (Hunt et al. 2006). Floors can also become enriched with organic and inorganic waste and can serve as a reservoir of microbes (Layton et al. 2009).The bacterial composition of the samples obtained in this study was very diverse and enriched with soil bacteria. This was similar to a study by Flores et al. (2011) who reported highest OTU levels on floor samples. They also reported that floor samples from restrooms had a bacterial composition related to soil, differing from toilet surfaces which had more of a gut-related bacterial composition (Flores et al. 2011). This study supports similar findings where the floor samples, irrespective of building types, tend to be heavily colonized by soil bacteria. The study was also in agreement with findings by Chase et al. (2016), who

reported surface material did not differ in terms of bacterial composition. They studied bacterial composition from floors and ceilings with carpet and tiles. Although locations

(ceiling vs. floor) had a different bacterial composition, the floor surface material did not differ (Chase et al. 201). This study was able to replicate the result, despite the smaller sample size.

Traffic plays a significant role in the number of bioaerosols generated. There have not been many studies comparing the difference in bacterial numbers in relation to traffic.

This study found a significantly higher OTU level for higher traffic samples. Higher traffic brings a higher amount of outdoor soil, and visitors and occupants, along with pets, shed bacterial cells as well (36), hence a higher number of microbes or bacteria is expected for areas with a higher volume of traffic. However, higher OTUs, which generally mean species or individual bacterial types in higher traffic areas, implies people carry different types of bacteria, resulting in higher OTU levels.

There was not much apparent difference in the phylum or class level composition in the buildings or floor types. However, this study found a higher percentage of

Rhizobiales in all of the samples. Rhizobiales are the most common Proteobacteria in soil. It is not surprising to see the higher level of Rhizobiales in the samples because all the samples were from the floor where a high amount of soil from outdoors gets deposited. Another difference observed was that many microbiome studies in indoor settings have found Firmicutes as a major phylum, but this study did not find it so. A fair comparison cannot be made, because most of the microbiome studies for indoor microbiomes collect samples from all of the surfaces like door-knobs, kitchen counters,

sinks, including floors. (Adams et al. 2015; Gibbons et al. 2015; Hewitt et al. 2012; Lax

et al. 2012; Rintala et al. 2008). It is also important to understand that in indoor settings,

most of the surfaces, like kitchen knobs, faucets, doorknobs, or kitchen counters are hand

touched directly, unlike floors. Many indoor bacterial studies with surfaces touched

directly by hands or skins have found Firmicutes as the most abundant phylum (Da

Fonseca et al. 2016; Gibbons et al. 2015; Rintala et al. 2008). In this study, Firmicutes

composed only 2.5% of the total composition. Firmicutes are most abundant in the

human gut, so the presence of firmicutes on the hand-touched surfaces explains their

abundance on such surfaces. Surfaces not touched by hand directly, like floors, have a

bacterial composition similar to soil. Even toilet flush handles were reported to have an

abundance of soil bacteria, implying the use of shoes on handles (Flores et al. 2011).

Dunn et al. (2013) found samples from exterior door trims to be abundant locations of

soil bacteria. In another study of classrooms, floor and wall samples had higher

Cyanobacteria, reflecting soil and bioaerosol as a source (Meadow et al. 2016).

Although a difference in microbial profile was expected for various building types, the

study did not find it so. One of the reasons could be the small sample size. A study with

larger sample size could probably identify distinct clustering.

The dominance of Streptomyces species in the medical center is a concern and

needs further examination. Streptomyces is a ubiquitous bacteria found in an indoor

environment with soil as its source. It has been reported in vacuum dust and has also been

found to be higher in moisture-damaged buildings (Rintala et al. 2008; Suihko et al.

2009; Schafer et al. 2010). The carpets with such a high number of Streptomyces in

100

hospitals may be the result of more frequent carpet cleaning in medical center compared to other buildings. The moisture left behind after carpet cleaning is perhaps not dried effectively.

It is to be noted that samples were collected in a single day without any knowledge of cleaning practices at any of the buildings. It is possible that cleaning practices will affect the microbial composition. The study also focused on bacterial composition, but the fungal microbiome is equally important to study in order to get a full picture.

Antibiotic resistance is a growing issue and there is need to understand the mechanism and transfer of ARGs in the environment (Sanderson et al. 2016). The presence of the tetQ gene in all the samples except those obtained from vinyl tiles of the laboratory room indicates that most indoor environments can harbor antibiotic-resistant genes. This is a concern for possible transfer of these ARGs to other organisms posing a significant risk. The complete absence of tetQ genes from the laboratory vinyl floor samples indicates the stringent level of biosafety measures taken in our biological labs.

Traffic patterns showed a significant difference. The tetQ genes were significantly higher in the high-traffic areas. The result is similar to the OTU levels which were higher for high-traffic areas. The number of OTUs was lowest in the floor sample of the laboratory, as well.

Although building types did not differ significantly, generally, veterinary samples had higher copies of tetQ, the genes of which were also found to be most abundant on carpet samples from the veterinary building. It is known that tetracycline is a commonly

101

used antibiotic in agricultural practices (Chopra 2001), and hence, tetQ genes have been reported at higher levels in CAFOs and farms and feedlots (Smith et al. 2004).

Conclusion:

Studies performed in hospitals have found different bacterial genera on vinyl and carpet floor types (Harris et al. 2010; Yazgi et al. 2009). The methods used in those studies were mostly based on the culture methods and very few on culture-independent molecular methods. Culture-based methods are limited to viable organism, and thus under-represent the actual bacterial community (Amann et al. 1995; Ramos et al. 2014).

The present study, although limited by a small sample size, revealed an extremely vast and diverse bacteriological composition on floors. Floor samples were heavily colonized by soil bacterial profile. The floor types, vinyl and carpet, did not differ in terms of OTU numbers, species richness, diversity or bacterial composition. Traffic type was found to be an important factor, differing significantly in terms of OTU numbers. For the first time, this study also demonstrated the role of traffic in the presence of tetQ genes. This is important in understanding the transfer mechanisms of ARGs in the environment.

Neither floor nor building types found a difference in terms of richness or diversity. However, this was a one-time sampling event, and it is possible to find a different result with a larger sample size and repeated longitudinal sampling events.

The abundance of moisture-related bacteria Streptomycetes spp on carpet samples from, hospitals, needs further investigation. The fact that there could be fungal contamination on the carpets warrants further study.

102

CHAPTER 7

CONCLUSIONS

Major Findings

The principle aim of the study was to understand the role of different floor materials in the biological component of indoor environmental quality. To quantitatively and qualitatively assess the this aim, we performed a series of experiments, from identifying the most efficient surface sampling method to estimating the biological composition on various floors in existing built environments.

The study reported major findings in relation to work specified in specific aims.

The first hypothesis was designed to evaluate the most effective and sensitive method for surface sampling. Since not all the surface sampling methods have similar efficiency, three sampling methods were compared in this study as the first hypothesis. The Bulk- rinsate sampling method measured at least 2-3 times the bacterial concentration compared to Contact and Vacuum sampling for each of the floor materials. Bulk-rinsate sampling method was found to be most sensitive and efficient method to quantify microbial contaminants from floor surfaces. Contact plates and Vacuum sampling method primarily sampled the upper “top” surface of the floor. However, the Bulk-rinsate method uses the entire sample material and thus measures total bio-contaminants

103

associated with the surface. The Bulk-rinsate method is used in many research experiments and is recommended for occupational studies (AIHA, 1996; Verdier et al.

2014). However, surface sampling method should be considered, based upon on the type of surface concerned, the goals of sampling, together with the organism of interest.

For Hypotheses 2, we studied the role of various floor materials by assessing the survivability of bacteria and fungi on the floor materials. Different floor materials commonly used in US homes and commercial buildings were subjected to experiments.

Five floor materials, commercial and residential carpets, Vinyl, Wood, and Porcelain tile were inoculated with known bacteria (S. aureus) and fungi (A. niger) as well as soil microbes (bacteria and fungi).

The Hypothesis 2a, was expected to find any differential survivability of S. aureus and spores of A. niger on different floors. Carpets, both residential and rubber- backed commercial, showed a declining survivability of both S. aureus and spores of A. niger in the absence of nutrition. S. aureus showed growth on floors with “hard” top surfaces like Vinyl, Wood, and Porcelain tile for about two days and remained viable until Day 28. Spores of A. niger were also viable on these “hard” top floor materials. The survivability pattern of both S. aureus and spores of A. niger on Vinyl, Porcelain and

Wood were statistically similar, while differing statistically from both carpet variants (BC and VCT). Further experiments were repeated with additional nutrients (Nutrient Broth) on inoculated floor materials to test Hypothesis 2b. Both S. aureus and spores of A. niger had higher and longer survivability on Carpets and Vinyl tile in the presence of additional nutrient. This additional nutrient (Nutrient Broth and 1XPBS) was a simulation for in-use

104

conditions and represented the potential of floor surfaces to sustain microbial growth.

Similar results were obtained for research study performed for Hypothesis 2c, which tested the survivability of soil- composite bacteria and fungi on floor materials. Almost 2 log10 cange in CFU was observed for S. aureus and soil bacteria by Day 2. The growth rate decreased after Day 2, though the CFU counts on Day 28 were similar to Day 0. The

A niger spores which completely disappeared without nutrition, were viable up to Day 28 in the presence of nutrition. Some vinyl floor materials actually showed growth of the spores into fungal hyphae. Both floor materials were found to survive bacteria and spores of fungi for a period of 4 weeks.

For the 3rd hypothesis, the bacterial composition of actual in-use floor materials was carried out using surface samples of floors in various buildings, which included a human hospital, a veterinary hospital and an office. Culture-independent, next-generation sequencing was performed to identify the bacterial composition. Additional factors like traffic pattern, presence of an antibiotic resistance gene (tetQ) were also considered for these samples.

The bacterial composition of the carpets and vinyl floors obtained from the three buildings did not differ statistically. Both floor samples showed bacterial composition enriched with soil bacteria. Proteobacteria was the major phylum in all the floor samples.

The composition also did not differ between the three buildings either. However, traffic patterns were found to be significant for the OTU level. Higher traffic areas had higher

OTU, as well as a significantly high number of antibiotic-resistant gene (tetQ) copies per floor sample.

105

Public Health Implications

The most significant finding of this work is the differential survivability of bacteria S. aureus and A niger spores on carpet and vinyl floors. These are the two most commonly used floor materials in the US. This was an extensive study, including five different floor materials for survivability of common bacteria and fungi. The study thus attempts to fill in the knowledge gap of survivability of bacteria and fungi on environmental surfaces as identified by Edmond (2009).

Floor contamination is a real environmental issue. As indicated by Otter et al.

(2013), contaminated surfaces play an important role in the transmission of hospital pathogens. From both soil inoculation and microbiome analysis, it was evident that floor surfaces are enriched with soil microbes. Some of these bacteria are pathogenic to humans. Soil is also known to harbor antibiotic-resistant organisms. Antibiotic-resistant genes were detected in almost all the floor samples. The presence and longer survival of pathogenic bacteria along with the presence of resistant organisms on floors pose significant public health risk.

Study Limitations

This study focused testing susceptibility of different floor materials to promote or inhibit microbial growth and survivability. For this, series of experiments with inoculation study was performed with one time inoculation with known microbes (S. aureus or spores of A. niger) or soil composite microbes. In environment, there is

106

deposition of microbes on floors regularly. Similarly, there is deposition of dust and organic particles daily, which may act as nutrient for the microbes. These both factor will affect the microbial contamination on the floor materials. Additionally, as cleaning practices for various floors differ significantly, routine cleaning and disinfecting practices will significantly affect the level of bio-contaminants on floors. The current did not study the effect of cleaning and disinfection process and or repeated inoculation that mimics real world. Future studies should address this issue to understand complete exposure risk.

The study also failed to identify the bacterial composition difference in three buildings. The three buildings chosen were very distinct and were anticipated to have different bacterial compositions. The small sample size for the microbiome study (n=12,

4 for each building) could possibly account for this failure. The surface samples for this study were collected one time, without any knowledge of cleaning or disinfecting practices. Repeated and longitudinal sampling of the floor surface might be able to detect any differences. We also did not compare the fungal composition of the floors. Fungal and viral analysis should be included in future studies to obtain the total microbial composition of the different built environments, and, to get a complete picture of risk of exposure from indoor environmental contamination.

107

REFERENCES

Adams, R. I., Bateman, A. C., Bik, H. M., & Meadow, J. F. (2015). Microbiota of the indoor environment: a meta-analysis. Microbiome, 3(1), 49. http://doi.org/10.1186/s40168-015 0108-3

American Industrial Hygiene Association (1996) Viable fungi and bacteria in air, bulk, and surface samples. In: Dillon, H.K., Heinsohn, P.A. and Miller, J.D. (eds) Field Guide for the Determination of Biological Contaminants in Environmental Samples, Fairfax, VA, AIHA 37–74

Alex Berezow. (2012). Soil Bacteria give pathogen antibiotic. Accessed online on May11th, 2013 from http://www.realclearscience.com/blog/2012/08/friendlysoil- bacteria-give-pathogens-antibiotic-resistance.html

Allermann, L., Wilkins, C. K., & Madsen, a M. (2006). Inflammatory potency of dust from the indoor environment and correlation to content of NAGase and fungi. Toxicology in vitro : an international journal published in association with BIBRA, 20 (8), 1522–31. :10.1016/j.tiv.2006.06.0

Amann, R. I.; Ludwig, W.; Schleifer, K. H. Phylogenetic identification and in-situ detection of individual microbial cells without cultivation (1995). Microbiol. Rev., 59 (1), 143−169.

American Association of Textile Chemists and Colorists “Antimicrobial Activity Assessment of New Carpets”. (2011).

American Society of Testing material Method. “Standard Test Method for Using Seeded-Agar for the Screening Assessment of Antimicrobial Activity In Carpets” (April 2011), 2011–2013. doi:10.1520/E2471-05R11E01.Copyright

An Introduction to Indoor Air Quality (IAQ) Biological Pollutants: Environemntal Protection Agency. Accessed online on Nov. 20, 2015 from http://www.epa.gov/iaq/biologic.html

Anderson, R. L., Mackel, D. C., Stoler, B. S., & Mallison, G. F. (1982). Carpeting in hospitals: an epidemiological evaluation. Journal of clinical microbiology, 15(3),

108

Anne Chao Non-parametric estimation of the number of classes in a population. Scandinavian Journal of Statistics. (1984) 11(4):265-270 ·

Armand-Lefevre, L., Ruimy, R., & Andremont, A. (2005). Clonal Comparison of Staphylococcus aureus Isolates from Healthy Pig Farmers, Human Controls, and Pigs. Emergent Infectious Disease, 11(5), 711-714.

Ashley, K., Applegate, G.T., Wise, T.J., Fernback, J.E., & Goldcamp, M.J. (2007). Evaluation of a standardized micro-vacuum sampling method for collection of surface dust. Journal of Occupational and Environmental Hygiene, 4(3), 215–23.

Ayliffe, G. a, Collins, B. J., & Lowbury, E. J. (1966). Cleaning and disinfection of hospital floors. British Medical Journal, 2(5511), 442–5

Barker, J., Vipond, I. B., & Bloomfield, S. F. (2004). Effects of cleaning and disinfection in reducing the spread of Norovirus contamination via environmental surfaces. The Journal of hospital infection, 58(1), 42–9. doi:10.1016/j.jhin. 2004.04.021

Becton, Dickinson and Company. (2005) “Mannitol Salt Agar”

Boor BE, Siegel J a., Novoselac A.(2013). Monolayer and Multilayer Particle Deposits on Hard Surfaces:Literature Review and Implications for Particle Resuspension in the Indoor Environment. Aerosol Sci ;47(8):831–47.

Bouillard, L., Michel, O., Dramaix, M., & Devleeschouwer, M. (2005). Bacterial contamination of indoor air, surfaces, and settled dust, and related dust endotoxin concentrations in healthy office buildings. Annals of Agricultural and Environmental Medicine, 12(2), 187-192.

Boyce, J. M. (2007). Environmental contamination makes an important contribution to hospital infection. The Journal of hospital infection, 65 Suppl 2, 50–4. doi: 10.1016/S0195-6701(07)60015-2

Boyce, J. M., Potter-Bynoe, G., Chenevert, C., & King, T. (1997). Environmental contamination due to methicillin-resistant Staphylococcus aureus: possible infection control implications. Infection Control and Hospital Epidemiology, 18(9), 622–627

Buttner, M. P., Cruz-perez, P., Stetzenbach, L. D., Garrett, P. J., & Luedtke, A. E. (2002). Measurement of airborne fungal spore dispersal from three types of flooring materials, 1–11.

109

Byrne, M. a. (2000). Suction methods for assessing contamination on surfaces. The Annals of Occupational Hygiene, 44(7), 523–8. doi:10.1016/S0003- 4878(00)00038-7

Carpentier, B. (1998). Variations over Time of Microbial Load and Physicochemical Properties of Floor Materials after Cleaning in Food Industry Premises. Journal of Food Protection, 61(1), 57–65.

Carpet buyer handbook. Accssed on Nov 9, 2012 ://www.carpetbuyershandbook.com/carpet-basics/styles/ Carpets” 1, 05(April 2011), 2011–2013. doi:10.1520/E2471-05R11E01.Copyright

Carpet and Rug industry: Quick Facts about carpet industry; Accessed online on Nov 21, 2016 from http://www.carpet-rug.org/carpet-statistics.html

California Department of Resources Recycling and Recover:Residential and Commercial Carpet Case Study. Accessed online Nov, Dec 2016, from http://www.calrecycle.ca.gov/publications/Documents/1434/20121434.pdf

Castellarin, M., Warren, R., Freeman, J., Dreolini, L., Krzywinski, M., Strauss, J., Barnes, R., Watson, P., Allen-Vercoe, E., Moore, R., et al. (2012). Fusobacterium nucleatum infection is prevalent in human colorectal carcinoma. Genome Res., 22(2), 299–306

Center of Disease control and prevention “Antibiotic/Antimicrobial resistance)” Access online on Sep 22, 2016 from https://www.cdc.gov/drugresistance/

Center of Disease control. Aspergillos Accessed on March 11, 2013 from http:// www.cdc.gov/fungal/aspergillosis/

Center of Disease control and Prevention. Scott II, DR. "The direct medical costs of healthcare-associated infections in U.S. hospitals and the benefits of prevention." CDC, DHQP. 2009;(March).

Chase J, Fouquier J, Zare M, Sonderegger DL, Knight R, Kelley ST, Siegel J, Caporaso JG. 2016. Geography and location are the primary drivers of office microbiome c omposition.Systems 1(2):e00022-16. doi: 10.1128/mSystems.00022-16.

Cheong CD, Kemp PC, Dingle PW, Hardy GSJ. The influence of simulated activity & disturbance on levels of Indoor fungi. Conf Pap. 2004;( American Conference of Governmental Industrial Hygienists ( 1999).

110

Cho, I. and Blaser, M. (2012). The human microbiome: at the interface of health and disease. Nat. Rev. Genet., 13(4), 260–270.

Chopra, I., & Roberts, M. (2001). Tetracycline Antibiotics: Mode of Action, Applications, Molecular Biology, and Epidemiology of Bacterial Resistance. Microbiology and Molecular Biology Reviews, 65(2), 232–260. http://doi.org/10.1128/MMBR.65.2.232-260.2001

Chuang, J. C., Callahan, P. J., Menton, R. G., Gordon, S. M., Lewis, R. G., and Wilson, N. K. (1995). Monitoring Methods for Polycyclic Aromatic Hydrocarbons and Their Distribution in House Dust and Track-in Soil. Environ. Sci. Technol., 29:494–500.

Claro, T., O’Reilly, M., Daniels, S., & Humphreys, H. (2015). Surface microbial contamination in hospitals: A pilot study on methods of sampling and the use of proposed microbiologic standards. American Journal of Infection Control, 43(9), 1000–1002. doi:10.1016/

Commercial applications green building and the environment. Accssed on Nov 9, 2012 from http://www.fine-flooring.com/Education-CommercialCarpet.htm

Coughenour, C., Stevens, V., & Stetzenbach, L.D. (2011). An Evaluation of Methicillin- Resistant Staphylococcus aureus Survival on Five Environmental Surfaces, 17(3). doi:10.1089/mdr.2011.0007

D’Alessandro, D., Cerquetani, F., Deriu, M.G., Montagna, M.T., Mura, I., Napoli, C., Vescia, N. (2013). Evaluation of fungal contamination in operating rooms using a dusting cloth pad: Comparison among different sampling methods. American Journal of Infection Control, 41(7), 658–660. doi:10.1016/j.ajic.2012.10.006

Da Fonseca TAP, Pessôa R, Felix AC, Sanabani SS. Diversity of bacterial communities on four frequently used surfaces in a large Brazilian teaching hospital. Int J Environ Res.Public Health. 2016;13(2):1–11

Dalling J. A review of environmental contamination during outbreaks of Norwalk-like virus. Br J Infect Control (2004);5(2): 9–13.

Dancer, S.J. (2009). The role of environmental cleaning in the control of hospital- acquired infection. The Journal of Hospital Infection, 73(4), 378–85. doi:10.1016/j.jhin.2009.03.030

111

Davis, M. F., Iverson, S. A., Baron, P., Vasse, A., Silbergeld, E. K.,Lautenbach,E.,&Morris,D.(2012). Household transmission of meticillin- resistant Staphylococcus aureus and other staphylococci. The Lancet infectious diseases,12(9), 703–16. doi:10.1016/S1473-3099(12)70156-

De Lorenzi S, Finzi G, Parmiggiani R, Cugini P, Cacciari P, Salvatorelli G. Comparison of floor sanitation methods. Journal of Hospital Infection. 2006;62(3):346–8.

Dharan, S., Mourouga, P., Copin, P., Bessmer, G., Tschanz, B., & Pittet, D. (1999). Routine disinfection of patients’ environmental surfaces. Myth or reality? The Journal of hospital infection, 42(2), 113–7. doi:10.1053/jhin.1999.0567 doi:10.1111/j.1600-0668.2007.00478.x

Dietze, B., Rath, a, Wendt, C., & Martiny, H. (2001). Survival of MRSA on sterile goods packaging. The Journal of Hospital Infection, 49(4), 255–61. doi:10.1053/jhin.2001.1094

Dolan, A, Bartlett, M., McEntee, B., Creamer, E., & Humphreys, H. (2011). Evaluation of different methods to recover meticillin-resistant Staphylococcus aureus from hospital environmental surfaces. The Journal of Hospital Infection, 79(3), 227–30. doi:10.1016/j.jhin.2011.05.011

Dominguez-Bello, M. et al. (2010). Delivery mode shapes the acquisition and structure of the initial microbiota across multiple body habitats in newborns. Proc. Natl. Acad. Sci. U. S. A., 107(26), 11971

Douwes, J. (2003). Bioaerosol Health Effects and Exposure Assessment: Progress and Prospects. Annals of Occupational Hygiene, 47(3), 187–200. doi:10.1093/annhyg/meg032

Duggan, J.M.; Goldstein, S.J.; Chenoweth, C.E.; Kauffman, C.A.; Bradley, S.F (1996). "Achromobacter xylosoxidans bacteremia: report of four cases and review of the literature". Clinical Infectious Diseases. 23 (3): 569–doi: 10.1093/clinids/23.3.569 . PMID 8879782

Dunn RR, Fierer N, Henley JB, Leff JW, Menninger HL. Home Life: Factors Structuring the Bacterial Diversity Found within and between Homes. Bertilsson S, editor. PLoS One Public Library of Science; 2013 May 22. Available from: http://dx.plos.org/10.1371/journal.pone.0064133

Edmonds, J.M. (2009). Efficient methods for large-area surface sampling of sites contaminated with pathogenic microorganisms and other hazardous agents: current state, needs, and perspectives. Applied Microbiology and Biotechnology, 84(5), 811–6. doi:10.1007/s00253-009-2136-z 112

Engelhart, S., Loock, A., Skutlarek, D., Lommel, A., Färber, H., Exner, M., Sagunski,H., et al. (2002). Occurrence of Toxigenic Aspergillus versicolor Isolates and Sterigmatocystin in Carpet Dust from Damp Indoor Environments. doi:10.1128/AEM.68.8.3886

Environmental Protection Agency “In introduction to Indoor air quality: Volatile organic compound” Accessed online on Nov. 11 from http://www.epa.gov/iaq/voc.html

Environmental Protection Agency, U. S., & Homeland, N. (2013). Evaluation of Vacuum-based sampling Devices for Collection of Bacillus Spores from Environmental Surfaces, Accessed on Augut2015 from http://cfpub.epa.gov/si/si_public_record_report.cfm?dirEntryId=257475

Flores, G. E., Bates, S. T., Knights, D., Lauber, C. L., Stombaugh, J., Knight, R., & Fierer, N. (2011). Microbial biogeography of public restroom surfaces. PloS One, 6(11), e28132. http://doi.org/10.1371/journal.pone.0028132

Foarde, K., & Berry, M. (2004). Comparison of biocontaminant levels associated withhard vs. carpet floors in nonproblem schools: results of a year long study.Journal of exposure analysis and environmental epidemiology, 14 Suppl 1, S41–8. doi:.1038/sj.jea.7500357

Frankel M, Bekö G, Timm M, Gustavsen S, Hansen EW, Madsen AM. Seasonal variations of indoor microbial exposures and their relation to temperature, relative humidity, and air exchange rate (2012). Appl Environ Microbiology.. 2012 Dec 78(23):8289–97. Available from: http://www.ncbi.nlm.nih.gov/pubmed/23001651

Gans J, Wolinsky M, Dunbar J. 2005. Computational improve- ments reveal great bacterial diversity and high metal toxicity in soil. Science 309:1387–139

Gibbons, S.M., Schwartz, T., Fouquier, J., Mitchell, M., Sangwan, N., Gilbert, J.A., & Kelley, S.T. (2015). Ecological Succession and Viability of Human-Associated Microbiota on Restroom Surfaces. Applied and Environmental Microbiology, 81(2), 765–773. doi:10.1128/AEM.03117-14

Goebes, M. D., Boehm, A. B., & Hildemann, L. M. (2011). Contributions of Foot Traffic and Outdoor Concentrations to Indoor Airborne Aspergillus. Aerosol Science and Technology, 45(3), 352–363. doi:10.1080/02786826.2010.537712

Haiduven, D. (2009). Nosocomial aspergillosis and building construction. Medical Mycology : Official Publication of the International Society for Human and Animal Mycology, 47 Suppl 1(January 2008), S210–6. doi:10.1080/13693780802247694 113

Hambreus A, Bengtsson S, Laurell G. Bacterial contamination in a modern operating suite. 3. Importance of floor contamination as a source of airborne bacteria. Journal of Hygiene (Lond) 1978;80:169–174.

Hammer, Ř., Harper, D.A.T., Ryan, P.D. 2001. PAST: Paleontological statistics software package for education and data analysis. Palaeontologia Electronica 4(1): 9pp

Harris, D. D., Pacheco, A., & Lindner, a. S. (2010). Detecting Potential Pathogens on Hospital Surfaces: An Assessment of Carpet Tile Flooring in the Hospital Patient Environment. Indoor and Built Environment, 19(2), 239–249. doi: 10.1177/1420326X09347050

Harrison, J., Pickering, C. a, Faragher, E. B., Austwick, P. K., Little, S. a, & Lawton, L.(1992). An investigation of the relationship between microbial and particulate indoor air pollution and the sick building syndrome. Respiratory medicine, 86 (3), 225–35. Retrieved from http://www.ncbi.nlm.nih.gov/pubmed/1620910

Haysom, I. W., & Sharp, K. (2003). The survival and recovery of bacteria in vacuum cleaner dust. The journal of the Royal Society for the Promotion of Health, 123(1), 7537–7541. http://doi.org/10.1128/AEM.01541-09 .

Heederik D, von Mutius E. Does diversity of environmental microbial exposure matter for the occurrence of allergy and asthma? J Allergy Clin Immunol [Internet]. Elsevier Ltd; 2012 Jul [cited 2013 Feb 26];130(1):44–50. Available from: http://www.ncbi.nlm.nih.gov/pubmed/22502794

Herruzo, R., Vizcaíno, M. J., Herruzo, I., & De la Cruz, J. J. (2009). Can the antibiotic resistance of a microorganism predict decreased bactericidal efficacy of disinfectants? Application to OPA and other products. European journal of clinical microbiology &

Hewitt KM, Gerba CP, Maxwell SL, Kelley ST. 2012. Office space bacterial abundance and diversity in three metropolitan areas. PLoS One 7:e37849. http://dx.doi.org/10.1371/journal.pone.0037849.

Hicks, J. B., Lu, E. T., De Guzman, R., & Weingart, M. (2005). Fungal types and concentrations from settled dust in normal residences. Journal of occupationaland environmental hygiene, 2(10), 481–92. doi:10.1080/15459620500252860

Highbeam Business (2012). Industry Reports: SIC 5713. Gale Group, Farmington Hills, Michigan Hong, T., & Gurian, P L. (2012). Characterizing bioaerosol risk from environmental sampling. Environmental Science & Technology, 46(12), 6714–22. doi:10.1021/es300197

114

Hota, B. (2004). Contamination, disinfection, and cross-colonization: are hospital surfaces reservoirs for nosocomial infection. Clinical Infectious Diseases : An Official Publication of the Infectious Diseases Society of America, 39(8), 1182– 1189. http://doi.org/10.1086/424667

Humphreys, H.; Marshall, R. J.; Ricketts, V. E.; Russell, A. J.; Reeves,D.S. Theatre over- shoes do not reduce operating theatre floor bacterial counts. J. Hosp. Infect.1991, 17 (2), 117–23.

Hunt, A.; Johnson, D. L.; Griffith, D. A. Mass transfer of soil indoors by track-in on footwear (2006). Sci. Total Environ., 370, 360–371.

Ismaïl, R., Aviat, F., Michel, V., Le Bayon, I., Gay-Perret, P., Kutnik, M., & Fédérighi, M. (2013). Methods for Recovering Microorganisms from Solid Surfaces Used in the Food Industry: A Review of the Literature. International Journal of Environmental Research and Public Health. 10(11), 6169–6183. http://doi.org/10.3390/ijerph10116169

Jaakkola JJK, Parise H, Kislitsin V, Lebedeva NI, Spengler JD. Asthma, wheezing, and allergies in Russian schoolchildren in relation to new surface materials in the home. Am J Public Health 2004 Apr;94(4):560–2.

Jacky A. Rosati, Jonathan Thornburg, Charles Rodes. (2008). Resuspension of Particulate Matter from Carpet Due to Human ActivityAerosol Science and Technology Vol. 42, Iss. 6, 2008

Kelley, S. T., & Gilbert, J. A. (2013). Studying the microbiology of the indoor environment. Genome Biology, 14(2), 202. http://doi.org/10.1186/gb-2013-14-2- 202

Kembel SW, Jones E, Kline J, Northcutt D, Stenson J, Womack AM, Bohannan BJ, Brown GZ, Green JL. 2012. Architectural design influences the diversity and structure of the built environment microbiome. ISME J 6:1469 –1479. http://dx.doi.org/10.1038/ismej.2011.211

Khojasteh, V. J., Edwards-Jones, V., Childs, C., & Foster, H. a. (2007). Prevalence of toxin producing strains of Staphylococcus aureus in a pediatric burns unit. Burns : journal of the International Society for Burn Injuries, 33(3), 334–40. doi:10.1016/j.burns.2006.07.009

Klepeis, N. E., Nelson,W. C., Ott,W. R., Robinson, J. P., Tsang, A. M., Switzer, P., Behar, J. V., Hern, S. C., and Engelmann,W. H. (2001). The National Hu- man Activity Pattern Survey (NHAPS): A Resource for Assessing Exposure to Environmental Pollutants, J. Exp. Anal. Env. Epid. 11:231 25 115

Koch, F.E. 1942. Electivnahrboden fur Staphylokok ken. Zentr. Bakt. Parasitenk., I, Orig. 149:122-124. (Crossed ref. from BD. 2005)

Konya T, Scott JA. Recent Advances in the Microbiology of the Built Environment. 2014;35–42.

Kümmerer, K. (2004). Resistance in the environment. The Journal of antimicrobial chemotherapy, 54(2), 311–20. doi:10.1093/jac/dkh325

Lankford MG, Collins S, Youngberg L, Rooney DM, Warren JR, Noskin G (2006).. Assessment of materials commonly utilized in health care: implications for b acterial survival and transmission. Am J Infect Control 2006 Jun [cited 2012 Sep 26];34(5):258–63. Available from: http://www.ncbi.nlm.nih.gov/pubmed/16765202

Lavilla Lerma L, Benomar N, Knapp CW, Correa Galeote D, G??lvez A, Abriouel H. Diversity, distribution and quantification of antibiotic resistance genes in goat and lamb slaughterhouse surfaces and meat products. PLoS One. 2014;9(12):1–17.

Layton DW, Beamer PI. Migration of contaminated soil and airborne particulates to indoor dust. Environ Sci Technol [Internet]. 2009 Nov 1;43(21):8199–205. http://www.pubmedcentral.nih.gov/articlerender.fcgi?artid=2782798&tool=pmce ntrez&rendertype=abstract

Lee, C., Agidi, S., Marion, J. W., & Lee, J. (January 01, 2012). Arcobacter in Lake Erie beach waters: an emerging gastrointestinal pathogen linked with human- associated fecal contamination. Applied and Environmental Microbiology, 78, 16, 5511-9.

Lee, S. H., Jin, H. M., Lee, H. J., Kim, J. M., & Jeon, C. O. (2012). Complete Genome Sequence of the BTEX-Degrading Bacterium Pseudoxanthomonas spadix BD- a59. Journal of Bacteriology, 194(2), 544. http://doi.org/10.1128/JB.06436-11

Lemmen, S.W., Häfner, H., Zolldann, D., Amedick, G., & Lütticken, R. (2001). Comparison of two sampling methods for the detection of Gram-positive and Gram-negative bacteria in the environment : moistened swabs versus Rodac plates. International Journal of Hygiene. And Envionmental Health., 248, 245– 248.

Li, W. & Godzik, A. (2006). Cd-hit: a fast program for clustering and comparing large sets of protein or nucleotide sequences. Bioinformatics 22, 1658-1659.

116

Ling AL, Pace NR, Hernandez MT, Lapara TM. Tetracycline Resistance and Class 1 Integron Genes Associated with Indoor and Outdoor Aerosols. 2013; May 7;47(9):4046-52. doi: 10.1021/es400238g.

Lioy PJ, Freeman NCG, Millette JR. Review Dust : A Metric for Use in Residential and Building Exposure Assessment and. 2002;110(10):969–83.

Lutz, E. a, Sharma, S., Casto, B., Needham, G., & Buckley, T. J. (2010). Effectiveness of UV-C equipped vacuum at reducing culturable surface-bound microorganisms on carpets. Environmental science & technology, 44(24), 9451–5. doi:10.1021/es1015982

Lutz, J. K., Crawford, J., Hoet, A.E., Wilkins, J R., & Lee, J. (2013). Comparative performance of contact plates, electrostatic wipes, swabs and a novel sampling device for the detection of Staphylococcus aureus on environmental surfaces. Journal of Applied Microbiology, 115(1), 171–8. doi:10.1111/jam.12230

MacCannell, T., Umscheid, C. A., Agarwal, R. K., Lee, I., Kuntz, G., Stevenson, K. B.,& Rajender, K. (2011). Guideline for the prevention and control of norovirus gastroenteritis outbreaks in healthcare settings. Infection control and hospital epidemiology : the official journal of the Society of Hospital Epidemiologists of America, 32(10), 939–69. doi:10.1086/662025

Macher, J. M., Tsai, F. C., Burton, L. E., & Liu, K. (2005). Concentrations of cat and dust mites allergen in 92 large office buildings from BASE study. . Indoor Air, Supp( 9)82-88. doi: 10.1111/j.1600-0668.2005.00347.

Maus, R., Goppelsro, A., & Umhauer, H. (2001). Survival of bacterial and mold spores in air " lter media, 35.

Meadow, J. F., Altrichter, A. E., Kembel, S. W., Moriyama, M., O’Connor, T. K., Womack, A. M., … Bohannan, B. J. M. (2014). Bacterial communities on classroom surfaces vary with human contact. Microbiome, 2(1), 7. http://doi.org/http://dx.doi.org/10.1186/2049-2618-2-7

Méheust, D., Le Cann, P., & Gangneux, J.P. (2013). Rapid quantification of viable fungi in hospital environments: analysis of air and surface samples using solid-phase cytometry. The Journal of Hospital Infection, 83(2), 122–6. doi:10.1016/j.jhin.2012.10.004

Mendell MJ. Indoor residential chemical emissions as risk factors for respiratory and allergic effects in children: a review. Indoor Air.. 2007 Aug];17(4):259–77. Available from: http://www.ncbi.nlm.nih.gov/pubmed/17661923

117

Microvacuum Cassettes for Surface Sampling Efficient Collection of Asbestos or Fungal Spores. http://www.skcinc.com/prod/225-9541.asp

Miller, J. D. (1992). Fungi as contaminants in indoor air. Indoor Air, 26(12).

Milling, A., Kehr, R., Wulf, A., & Smalla, K. (2005). Survival of bacteria on wood and plastic particles: Dependence on wood species and environmental conditions. Holzforschung, 59(1), 72–81. doi:10.1515/HF.2005.012

Moore, G., & Griffith, C. (2002). A comparison of surface sampling methods for detecting coliforms on food contact surfaces. Food Microbiology, 19(1), 65–73.

Moore, G., & Griffith, C. (2007). Problems associated with traditional hygiene swabbing: the need for in-house standardization. Journal of Applied Microbiology, 103(4), 1090–103. http://doi.org/10.1111/j.1365-2672.2007.03330.x

Morgan EE, Morgan EE. Tetracycline resistance gene tet (W) abundances in settled dust of North Carolina residences. 2015;

Mulvey, D., Redding, P., Robertson, C., Woodall, C., Kingsmore, P., Bedwell, D., & Dancer, S. J. (2011). Finding a benchmark for monitoring hospital cleanliness. Journal of Hospital Infection, 77(1), 25–30. doi:10.1016/j.jhin.2010.08.006

Narui, K., Noguchi, N., Matsunaga, N., Namiki, Y., Yamanaka, Y., Kumaki, Y., Suwa, J., et al. (2009). Change in environmental bacterial flora in a new hospital building. The Journal of hospital infection, 73(1), 24–33. doi:10.1016/j.jhin 2009.05.019

Neely, A. N., & Maley, M. P. (2000). Survival of Enterococci and Staphylococci on Hospital Fabrics and Plastic. Journal of Clinical Microbiology, 38(2), 724–726.

Nikolich, M. P., Hong, G., Shoemaker, N. B., & Salyers, A. A. (January 01, 1994). Evidence for natural horizontal transfer of tetQ between bacteria that normally colonize humans and bacteria that normally colonize livestock. Applied and Environmental Microbiology, 60, 9, 3255

Otter JA, Yezli S, Salkeld JAG, French GL. Evidence that contaminated surfaces contribute to the transmission of hospital pathogens and an overview of strategies to address contaminated surfaces in hospital settings. Am J Infect Control [Internet]. Elsevier Inc; 2013;41(5 SUPPL.):S6–11. Available from: http://dx.doi.org/10.1016/j.ajic.2012.12.004

118

Owen, M. ., Ensor, D. ., & Sparks, L. . (1992). Airborne particle sizes and sources found in indoor air. Atmospheric Environment. Part A. General Topics, 26(12),2149– 2162. doi:10.1016/0960-1686(92)90403-8

Owyang C, Wu GD. The Gut Microbiome in Health and Disease. Gastroenterology. AGA Institute; 2014;146(6):1433–6. Available from http://linkinghub.elsevier.com/retrieve/pii/S0016508514003813

Prussin AJ, Marr LC. (2015) “Sources of airborne microorganisms in the built environment. Microbiome [Internet]. Microbiome; 2015;3(1):78. Available from: http://microbiomejournal.biomedcentral.com/articles/10.1186/s40168-015-0144-z

Qian J, Ferro AR. Resuspension of Dust Particles in a Chamber and Associated Environmental Factors. Aerosol Sci Technol [Internet]. 2008 May 29 [cited 2012 Nov 13];42(7):566–78. Available from: http://www.tandfonline.com/doi/abs/10.1080/02786820802220274

R. Monina Klevens, J. R. Edwards, C. L. Richards, T.. Horan, R. Gaynes, D. Pollock, D. M. Cardo “Estimating Health Care-Associated Infections and Deaths in US hospitals, 2002”. Research article. Public Health Reports /Volume 122(April),160–166.

Ramachandran, G., Adgate, J. L., Banerjee, S., Church, T. R., Jones, D., Fredrickson,A., & Sexton, K. (2005). Indoor air quality in two urban elementary schools-- measurements of airborne fungi, carpet allergens, CO2, temperature, andrelative humidity. Journal of occupational and environmental hygiene, 2(11), 553–66. doi:10.1080/15459620500324453

Ramos T, Stephens B. Tools to improve built environment data collection for indoor microbial ecology investigations. Build Environ [Internet]. 2014 Jul [cited 2014 Jul 22]; Available from: http://www.sciencedirect.com/science/article/pii/S0360132314002200

REED (Residential Energy Effeciency Database) (n.d). Residential indoor air quality.

Rintala H, Hyvarinen A, Paulin L, Nevalainen A. Detection of streptomycetes in house dust - Comparison of culture and PCR methods. Indoor Air. 2004;14(2):112–9.

Rintala H, Pitkäranta M, Toivola M, Paulin L, Nevalainen A. 2008. Diversity and seasonal dynamics of bacterial community in indoor environment. BMC Microbiol 8:56. http://dx.doi.org/10.1186/1471-2180-8 -56.

119

Roberts JW, Glass G, Mickelson L. A pilot study of the measurement and control of deep dust, surface dust, and lead in 10 old carpets using the 3-spot test while vacuuming. Arch Environ Contam Toxicol. 2004;48(1):16–23.

Roberts, J. W., Clifford, W. S., Glass, G., & Hummer, P. G. (1999). E nvironmental C ontamination a n d T oxicology Reducing Dust , Lead , Dust Mites , Bacteria , and Fungi in Carpets by Vacuuming, 484, 477–484

Roberts, M. C. Update on acquired tetracycline resistance genes. FEMS Microbiol. Lett. 2005, 245, 195–203

Russell, A. D., & I, C. C. F. (1999). Bacterial resistance present knowledge to disinfectants: and future problems, 43(I 998), 57–68.

Rutala, W. A., & Weber, D. J. (January 01, 2001). Surface disinfection: should we do it?.Journal of Hospital Infection: Supplement A, 48.

Rutala, W. A., Barbee, S. L., Aguiar, N. C., Sobsey, M. D., & Weber, D. J. (2013). Antimicrobila activity of home disinfectants,, 21(1), 33–38.

Rutala, W. A., Ph, D., & Weber, D. J. (2008). Guideline for Disinfection and Sterilization in Healthcare Facilities , 2008.

Rylander, R., & Myrback, K. (1974). Investigation of Wall-to-Wall Carpeting. American Journal of Public Health,

Sanderson1 H, Fricker C, Brown RS, Majury A, Liss SN. Antibiotic Resistance Genes as an Emerging Environmental Contaminant Haley. Environ Rev. 2016;218(February):27–39.

Schafer J, Jackel U, Kampfer P. Analysis of Actinobacteria from mould-colonized water damaged building material. Syst Appl Microbiol. 2010;33(5):260–8.

Schloss, P. D., Westcott, S. L., Ryabin, T., Hall, J. R., Hartmann, M., Hollister, E. B., … Weber, C. F. (2009). Introducing mothur: Open-Source, Platform-Independent, Community-Supported Software for Describing and Comparing Microbial Communities . Applied and Environmental Microbiology, 75(23),

Shaughnessy, R., & Vu, H. (2012). Particle loadings and resuspension related to floor coverings in chamber and in occupied school environments. Atmospheric Environment, 55, 515–524. doi:10.1016/j.atmosenv.2012.04.008

120

Simon Lax, 1, 2* Daniel P. Smith, 1 2. Longitudinal analysis of microbial interaction between humans and the indoor environment. Science (80- ). 2012;12702(2009).

Skoutelis, A. T., Westenfelder, G. O., Beckerdite, M., & Phair, J. P. (1994). Hospital carpeting and epidemiology of Clostridium Difficile. American Journal of Infection Control, 22(4), 212–217

Smith MS, Yang RK, Knapp CW, Peak N, Hanfelt MM, Galland JC, et al. Quantification of Tetracycline Resistance Genes in Feedlot Lagoons by Real-Time PCR Quantification of Tetracycline Resistance Genes in Feedlot Lagoons by Real- Time PCR. Appl Environ Microbiol. 2004;70(12):7372–7

Stephens B. 2016. What have we learned about the microbiomes of indoor environments? mSystems 1(4):e00083-16. doi: 10.1128/mSystems.00083-16.

Suihko ML, Priha O, Alakomi HL, Thompson P, Mälarstig B, Stott R, et al. Detection and molecular characterization of filamentous actinobacteria and thermoactinomycetes present in water-damaged building materials. Indoor Air. 2009;19(3):268–77

Suwa, M., Oie, S., & Furukawa, H. (2013). Efficacy of disinfectants against naturally occurring and artificially cultivated bacteria. Biological & pharmaceutical bulletin, 36(3), 360–3. Retrieved from http://www.ncbi.nlm.nih.gov/pubmed/23449324

Suzuki A, Yoshimichi N, Matsuura M, Horisawa A. Bacterial contamination of floors and other surfaces in operating rooms: A five-year survey The Journal of hygiene ( Camb)1984;93:559–566

Toivola, M., Alm, S., Reponen, T., Kolari, S. and Nevalainen, A. (2002) Personal exposures and microenvironmental concentrations of particles and bioaerosols, J. Environ. Monit., 4, 166–174

Tringe SG, Zhang T, Liu X, Yu Y, Lee WH, Yap J, et al. 2008.The airborne metagenome in an indoor urban environment. PLoS One. 2008;3:e1862

Ulrich, R. S., & Zimring, C. (2008). Healthcare Leadership Healthcare Leadership, Review of the Research Literature on Evidence-Based Healthcare

Vacuuming 101: Carpet and Rug Industry; Accessed online on Nov. 2016 fro http://www.carpet-rug.org/vacuuming-home.html

121

Vandini, A., Temmerman, R., Frabetti, A., Caselli, E., Antonioli, P., Balboni, P.G., … Mazzacane, S. (2014). Hard Surface Biocontrol in Hospitals Using Microbial Based Cleaning Products. PLoS ONE, 9(9), e108598. doi:10.1371/journal.pone.0108598

Verdier T, Coutand M, Bertron A, Roques C. A review of indoor microbial growth across building materials and sampling and analysis methods. Build Environ [Internet]. Elsevier Ltd Available from: http://linkinghub.elsevier.com/retrieve/pii/S0360132314001802

Vicendese D, Dharmage SC, Tang ML, Olenko A, Allen KJ, Abramson MJ, et al. Bedroo m air quality and vacuuming frequency are associated with repeat child asthma hospital admissions. J Asthma [Internet]. 2014 Dec 24 [cited 2015 Jan 22];1–17. Available from: http://www.ncbi.nlm.nih.gov/pubmed/25539399

Weber, D.J., Rutala, W.A., Miller, M.B., Huslage, K., & Sickbert-Bennett, E. (2010). Role of hospital surfaces in the transmission of emerging health care-associated pathogens: Norovirus, Clostridium difficile, and Acinetobacter species. American Journal of Infection Control, 38(5), S25–S33. doi:10.1016/j.ajic.2010.04.196

Wellington, E. M. H., Boxall, A. B., Cross, P., Feil, E. J., Gaze, W. H., Hawkey, P. M., Johnson-Rollings, A. S., et al. (2013). The role of the natural environment in the emergence of antibiotic resistance in gram-negative bacteria. The Lancet infectious diseases, 13(2), 155–65. doi:10.1016/S1473-3099(12)70317-1

Whitehead, T., Metayer, C., Buffler, P., & Rappaport, S. M. (2011). Estimating exposures to indoor contaminants using residential dust. Journal of exposure science environmental epidemiology, 21(6), 549–64. doi:10.1038/jes.2011.11

Whitman, W. B., Oxides, N., Cook, A. M., Alexander, M., Tyson, G. W., Delong, E.F.,Mckay, R. M. L., et al. (2012). The Shared Antibiotic Resistome of, 337(August)1107–1111.

Wickens, K., Lane, J., Siebers, R., Ingham, T., & Crane, J. (2004). Comparison of two dust collection methods for reservoir indoor allergens and endotoxin on carpets and mattresses. Indoor Air, 14(3), 217–22. doi:10.1111/j.1600-0668.2004.00253.x

Wolkoff, P. (2012). Indoor air pollutants in office environments: Assessment of comfort, health, and performance. International journal of hygiene and environmental health,1–24. doi:10.1016/j.ijheh.2012.08.001

World Floor covering associatio. Accssed on Nov 9, 2012 from http:// www.wfca.org/Pages/flooring-comparison.aspx

122

Yazgi, H., Uyanik, M. H., & Ayyildiz, a. (2009). Comparison of slime-producing coagulase-negative Staphylococcus colonization rates on vinyl and ceramic tile flooring materials. The Journal of international medical research, 37(3), 668–73. Retrieved from http://www.ncbi.nlm.nih.gov/pubmed/19589249

Yezli S, Barbut F, Otter J a. Surface contamination in operating rooms: a risk for transmission of pathogens? Surg Infect (Larchmt) [Internet]. 2014 Dec [cited 2015 Feb 9];15(6):694–9. Available

You Hong (2008). The effect of chemical finishing on microbial transfer from carpets to hum an skin and selected fabrics (Doctor dissertation) Accessed online on May 2013, from http://athenaeum.libs.uga.edu/handle/10724/24336 .

Zhang XX, Zhang T. Occurrence, abundance, and diversity of tetracycline resistance genes in 15 sewage treatment plants across china and other global locations. Environ Sci Technol. 2011;45(7):2598–604.

123

Appendix A: Microbiome Analysis.

Table A.1: Permanova Table to test the similarity in bacterial composition Note: There was no difference statistically

PERMANOVA

Permutation N: 9999 Total sum of squares: 0.0061 Within-group sum of squares: 0.005024 F: 0.9636 p (same): 0.5461

med vet off med 0.4797 0.1471 vet 0.4797 0.8385 off 0.1471 0.8385

124

Table. A.2: Analysis of Similarity (ANOSIM) to test the similarity in bacterial composition

A. ANOSIM by Building type B) ANOSIM by floor type

Group 1: Med, 2=vet and 3= off Group 1, or a: Vinyl ANOSIM Group 2: or b= Carpet Permutation N: 9999 Mean rank within: 34.28 ANOSIM Mean rank between: 33.21 R: -0.03241 Permutation N: 9999 p (same): 0.5507 Mean rank within: 33.17

med vet off Mean rank between:; 33.78

med 0.4638 0.544 R: 0.01852

vet 0.4638 0.4019 p (same): 0.402 off 0.544 0.4019 Vinyl carpet

Vinyl 0.4036

Carpet 0.4036

125

Table A.2 Conti.

C) ANOSIM according to traffic

Group 1= high, 2=low ANOSIM

Permutation N: 9999 Mean rank within: 34.29 Mean rank between: 32.8 R: -0.04516

p (same): 0.5854

Foot notes: Note: There was no difference statistically between A) building types or B) floor types or c) traffic types

126