BIOLOGICAL, EPIDEMIOLOGICAL and MOLECULAR INSIGHTS INTO THRIPS-IRIS YELLOW SPOT TOSPOVIRUS PEST COMPLEX by SUDEEP BAG a Dissert

BIOLOGICAL, EPIDEMIOLOGICAL AND MOLECULAR INSIGHTS

INTO THRIPS-IRIS YELLOW SPOT TOSPOVIRUS

PEST COMPLEX

SUDEEP BAG

A dissertation submitted in partial fulfillment of the requirements for the degree of

DOCTOR OF PHILOSOPHY

WASHINGTON STATE UNIVERSITY Department of Plant Pathology

May 2013

To the Faculty of Washington State University:

The members of the Committee appointed to examine the dissertation of

SUDEEP BAG find it satisfactory and recommend that it be accepted.

Hanu R. Pappu, Ph.D., Chair

Amit Dhingra, Ph.D.

Kenneth C. Eastwell, Ph.D.

Neena Mitter, Ph.D.

George J. Vandemark, Ph.D.

ACKNOWLEDGEMENTS

I take this opportunity to thank my major advisor Dr. Hanu R. Pappu, for believing, trusting, and accepting me into his program. I am very grateful for being able to work with him who provided me with support, encouragement, and motivation throughout my research and studies. I really appreciate his willingness to discuss any difficult situations with me and give advice from the bottom of their hearts. He gave me every opportunity to build up a strong network and encouraged me to attend scientific conferences to present my research. I have valued him mentoring and encouragement in my life, both professionally and personally since my first day in the United States.

I would like to express my gratitude to my committee members, Drs Amit

Dhingra, Kenneth C. Eastwell, Neena Mitter and George J. Vandemark for their support, feedback and patience during the whole process. I am very fortunate to have such a nice committee members. Special thanks to Dr. Neena Mitter, for her guidance and valuable suggestions to my research difficulties. Even though from another continent and different time zone, she was always there to respond my quarries.

I would also like to extend my gratitude to Plant Pathology staff Cheryl

Hagelbanz, Mary Stormo, Robin Stratton, and Mike Adams for their generous support and advises through the amazing process of graduate school. I would like to thank the faculty of the Department of Plant Pathology for their continuous support, teaching and inspiration to continue in the field of Plant Pathology. I would like to thanks the funding agencies for financial supports for my research and education. Special thanks to all my lab members and friends, for making my stay in Pullman memorable experience and helpful discussions in research.

iii

No words can express my deepest sense of thank my parents, didi, dada and relatives for their continuous blessings, sacrifices and support throughout my career and life. Special acknowledgements to my wife Saritha for her support, understanding and love, for being with me throughout the process even though staying so far. Lots of love to our loving son Mihir, missed all our loving moments with hope to being together soon.

sudeepbag

BIOLOGICAL, EPIDEMIOLOGICAL AND MOLECULAR INSIGHTS

INTO THRIPS-IRIS YELLOW SPOT TOSPOVIRUS

PEST COMPLEX

Abstract

by Sudeep Bag, Ph.D. Washington State University May 2013

Chair: Hanu R. Pappu

Iris yellow spot tospovirus (IYSV) (genus Tospovirus, family Bunyaviridae), transmitted by Thrips tabaci L. causes an economically important disease in both onion bulb and seed crop in the USA and other onion-growing regions of the world. Onion thrips as a pest alone can cause up to >60 % crop loss. Besides Allium spp, several weeds were found to be hosts of IYSV.

IYSV isolates collected from different states in the USA were evaluated to determine the existence of biologically distinct strains. On the basis of the ability to cause systemic infection, disease severity, senescence and death of the inoculated plants, isolates were delineated as mild or severe isolates.

Since the genome structure of only the small (S) RNA of IYSV was known, the large (L) and medium (M) RNAs of the virus were sequenced. The L RNA was 8,880 nucleotides in length, coding the 331.17 kDa RNA-dependent RNA polymerase in the viral complementary (vc) strand. The M RNA was 4,817 nucleotides long coding the

v movement protein (34.7kDa) in the viral sense and the glycoprotein precursor (128.4 kDa) in the vc strand.

An ELISA protocol was developed for detecting IYSV in single adult thrips using a polyclonal antiserum produced against the nonstructural protein (NSs) coded by the small (S) RNA. The approach enabled estimating the proportion of viruliferous thrips among the field-collected thrips. This will help better understand the epidemiology of

IYSV.

To understand the molecular basis of the emergence of new tospoviruses, a system was developed to study virus-virus interactions. It was found that two distinct and economically important tospoviruses, IYSV and Tomato spotted wilt virus (TSWV) complement each other to overcome host defense. The small RNA expression profiles of

IYSV and TSWV in single-and dually-infected datura plants showed that systemic leaves of dually-infected plants had reduced levels of TSWV N gene-specific small interfering

RNAs (siRNAs). This identifies a new role for the viral gene silencing suppressor in potentially modulating the biology and host range of viruses and underscores the important role of virally-coded suppressors of gene silencing in virus infection of plants.

TABLE OF CONTENTS

ACKNOWLEDGEMENTS…………………………………………………………………..…..………..…..iii

ABSTRACT……………………………………………………………………………...……………………..……v

LIST OF TABLES…………………………………………………………………………………..…………..…x

LIST OF FIGURES……………………………………………………………………………..…………………xi

DEDICATION……………………………………………………………………………………….……………..xv

PREFACE……………………………………………………………………………………………………………xvi

CHAPTER 1:

Introduction…………………………………………………………………………………………….….1

Physical Properties…………………………………………..………………………....……………….7

Genome Organization..……………………………………….………………………….…………….8

Transmission……………………………………………………..………………………………………10

Symptomatology……………………………………………..………………………………………….11

References………………………………………………………..……………………….………..……..14

CHAPTER 2: Biological characterizations of Iris yellow spot virus infecting onion seeds

and bulb crops in the Pacific northwest USA.

Abstract…………………………………………………………………………………………..………..22

Introduction……………………………………………………………………………………….….….24

Materials and Methods……………………………………………………………………………….25

Results………………………………………………………………………………….………..…………28

Discussion………………………………………………………………………………..……………….32

References…………………………………………………………………………………………………45

vii

CHAPTER 3: Molecular characterization of Iris yellow spot virus infecting onion bulb

and seed crops from the Pacific Northwest.

Abstract…………………………………….………………………………………………………………49

Introduction………………………………………….…………………………………………………..51

Materials and Methods……………………………………………………………………..……..…53

Results…………………………………………………………………………………………..………….56

Discussion……………………………………………………………………………….……………..…61

References………………………………………………………………………………….……..………73

CHAPTER 4: Seasonal dynamics of thrips (Thrips tabci) transmitters of Iris yellow spot

virus, a serious viral pathogen.

Abstract…………………………………………………………………………………….……..……….79

Introduction…………………………………………………………………………….………..………80

Materials and Methods……………………………….………………………………….…..………83

Results………………………………………………….……………………………….………….………88

Discussion…………………………………………………………………………….………….……….90

References…………………………………………………………………………………………….…..96

CHAPTER 5: Genetic complementation between two tospoviruses facilitates the

systemic movement of a plant virus silencing suppressor in an otherwise

restrictive host

Abstract…………………………………………………………………………………….….………….102

Introduction……………………………………………………………….…………………………...104

Materials and Methods…………………………………………………………….………….…….118

Results……………………………………………………..………………………….………………….107

Discussion…………………………………………………….…….…………………….…….…….…112

viii

References……………………………….………………………………………………………………131

CHAPTER 6

General Conclusions………………..…………………………………..……..…………………….136

APPENDIX 1

Buffer Formulation for ELISA………………………………………..….…………………..….141

LIST OF TABLES

Table 1.1. List of various Allium and non-allium species reported as host from allium

growing regions of the world.………………………………………………….……..……………..4

Table 2.1. List of samples collected from different geographical regions of Pacific

Northwest (PNW)………………………………………………………………………….…….….…37

Table 2.2. Symptoms of Iris yellow spot virus (IYSV) in various plant species in

response to mechanical inoculation………………………………………………..……….…..38

Table 3.1. Primers used for the amplification of the large (L) and Medium (M) RNA of

Iris yellow spot virus (IYSV)………………………………………………………..…………..…64

Table 3.2. Comparison of the large (L) RNA and the encoded RNA-dependent RNA

polymerase (RdRp) of Iris yellow spot virus with the corresponding gene and

protein sequences of known tospoviruses….………………………………………………….65

Table 5.1. Detection of Iris yellow spot virus (IYSV) and Tomato spotted wilt virus

(TSWV) in Datura stramonium plants…..………………………………..…………….…..122

Table 5.2. List of primers used in reverse transcription-polymerase chain reaction..…123

LIST OF FIGURES

Fig. 1. Schematic representation of the genome organization of tospovirus……..…………..9

Fig. 2.1. Symptoms associated with infection of Iris yellow spot virus (IYSV) in onion

collected from Pacific Northwestern states of California, Idaho and

Washington……………………………………………………………………………………………….39

Fig. 2.2. Symptoms associated with infection of Iris yellow spot virus (IYSV) in garlic

collected from commercial seeded crop in Oregon……………….………..………...…...39

Fig. 2.3a. Symptoms associated with infection of Iris yellow spot virus (IYSV) in foxtail

collected from Utah.……………………………………………………….…….…………………...40

Fig 2.3b. Symptoms associated with infection of Iris yellow spot virus (IYSV) in

twoscale saltbrush collected from Utah……………………………….…….………..…….…40

Fig 2.4. Symptom development following inoculation by Iris yellow spot virus (IYSV) in

local lesion host, Datura stramonium..…………………….…...... …….…………………41

Fig. 2.5. Symptom development and disease progression following inoculation by Iris

yellow spot virus (IYSV) in systemic host Nicotiana benthamiana...………………42

Fig. 2.6. Symptoms on indicator hosts following mechanical inoculation with Iris yellow

spot virus (IYSV)………………………….………………..……………….…………………..……..43

Fig. 2.7. Comparison of various Iris yellow spot virus (IYSV) isolates based on the

symptom development and disease progression ………………………………….……….44

Fig. 3.1. Schematic representation of genome organization and replication strategy of

Tospoviruses, showing the three RNAs: Large (L), Medium (M) and Small (S)..66

Fig. 3.2. Conserved motifs in RNA-dependent RNA polymerase (RdRp) of members of

the family Bunyaviridae……………………………………………………………………………...67

Fig. 3.3. Phylogenetic tree based on the deduced amino acid sequence of the RNA-

dependent RNA polymerase (RdRp) protein……….………..………………………...……68

Fig. 3.4. Schematic representation of amplicons generated for cDNA cloning and

sequence determination of Iris yellow spot virus medium RNA. ….…….…..……..69

Fig. 3.5. Clustal dendrogram showing the relationship of Iris yellow spot virus (IYSV) to

representatives of other species within the genus Tospovirus based on the amino

acid sequence of the non-structural protein NSm…………………………………….……70

Fig. 3.6. Clustal dendrogram showing the relationship of Iris yellow spot virus (IYSV) to

representatives of other species within the genus Tospovirus based on the amino

acid sequence of the glycoprotein precursor…..…………………..…………………………71

Fig. 3.7. Clustal dendrogram showing the relationship of Iris yellow spot virus (IYSV)

isolates reported around the world based on the complete and partial

nucleocapsid (N) protein gene…..……………………………….…………………………....….72

Fig. 4.1. Schematic representation of cloning strategy of the nonstructural protein (NSs)

coded by the small (S) RNA of Iris yellow spot virus (IYSV)…..…..………………….93

xii

Fig. 4.2. Western-immunoblotting showing the specificity of the antiserum to the non-

structural protein (NSs) of Iris yellow spot virus (IYSV)………………………………. 93

Fig. 4.3. Bar graph showing the reaction of Iris yellow spot virus (IYSV) NSs antiserum

with different tospovirus-infected plant samples and thrips.…….……………………94

Fig. 4.4. Graphical representation of thrips analysis from field A and B for the years 1

and year 2…….…………………………. ………………….…………………….………………...…..95

Fig. 5.1. Schematic representation of Datura stramonium as a differential host to Iris

yellow spot virus (IYSV) and Tomato spotted wilt virus (TSWV)………….….…..124

Fig. 5.2. Datura stramonium is a restrictive host to infection by Iris yellow spot virus

(IYSV).……..……………………………………………………………………………….…...….…...124

Fig. 5.3. Datura stramonium is a permissive host for Tomato spotted wilt virus

(TSWV)……………………………………………………………………………………………………126

Fig. 5.4. Datura stramonium plants co-inoculated with Iris yellow spot virus (IYSV)

and Tomato spotted wilt virus (TSWV)………………………………………………………127

Fig. 5.5. Detection of nucleocapsid (N) gene and non-structural (NSs) genes in

inoculated and uninoculated systemic leaves of Datura stramonium plants

infected with Iris yellow spot virus (IYSV) and Tomato spotted wilt virus

(TSWV) in plants inoculated with either IYSV, TSWV or both.………………..…….128

xiii

Fig. 5.6. Expression of N and NSs genes of Iris yellow spot virus (IYSV) and Tomato

spotted wilt virus (TSWV) in single or dually infected Datura stramonium plants

using gene-specific cDNA probes…………………………………………………….………….129

Fig. 5.7. Small interfering (si)RNAs of N and NSs genes of Tomato spotted wilt virus

(TSWV) in single or dually infected Datura stramonium plants...…………….…..130

xiv

DEDICATION

This dissertation is dedicated to my respected sir Dr. H.R.Pappu, respected loving parents, loving wife Saritha, and son Mihir.

PREFACE

The research presented in this thesis has been published or submitted in peer- reviewed scientific journals.

The results based on biological characterizations of Iris yellow spot virus discussed in chapter two were published in European Journal of Plant Pathology 2012,

134:97–104; Plant Disease 2011, 95:1319; Plant Health Progress 2009 doi:

10.1094/PHP-2009-0824-01-BR; Plant Disease 2009, 93:839; Plant Disease 2009,

93:674; Plant Disease 2009, 93:670, and Plant Disease 2009, 93:430.

The results based on molecular characterizations of Iris yellow spot virus described in chapter three were published in Archives of Virology 2010, 155:275-279, and Archives of Virology 2009, 154:715-718.

The results based on seasonal dynamics of Thrips tabaci on onion discussed in chapter four was submitted as research article to Journal of Economical Entomology.

The results based on genomic complementation between two different tospoviruses described in chapter five were published in PLOS ONE 2012, 7(10): e44803. doi:10.1371/journal.pone.0044803.

Citation within each chapters ware included in the “Reference” section of the corresponding chapter and formatted according to the specification of the respective journals or PLOS ONE.

xvi

CHAPTER ONE

INTRODUCTION

Plants growth and development are constantly exposed to various biotic and abiotic factors influencing plant health. Most of the plant diseases are caused by the biotic factors such as plant pathogens including-fungi, bacteria, viruses and nematodes, and causing major economic loss in almost every agricultural crop. Of the thousands of plant viruses known to cause disease in various crops of economic importance, viruses in the genus Tospovirus causes significant loss worldwide in both vegetable and ornamental crops. Tospoviruses are the only viruses of the vertebrate or insect infecting family Bunyaviridae that infect the plants. The genus name is derived from type isolate

Tomato spotted wilt virus (TSWV) first observed in Australia in 1915 associated with spotted wilt disease of tomato. Until recently, there were only three tospoviruses reported from United States namely Tomato spotted wilt virus (TSWV), Impatiens necrosis spot virus (INSV) and Iris yellow spot virus (IYSV). But, since 2010, two more tospoviruses was reported from the USA namely Groundnut ringspot virus (GRSV)

(Webster et al., 2010) and Soybean vein necrosis virus (SVNV) (Zhou et al., 2011).

IYSV was one of the tospoviruses to be reported to cause economic loss in a wide variety of monocotyledonous plants, particularly onion seed and bulb crops in the USA and many parts of the world (Gent et al., 2006; Pappu et al., 2009; Mandal et al., 2012).

The disease is most damaging to onion crops where it can reduce the bulb size (Gent et al., 2004) and may cause crop loss upto 100% (Pozzer el al., 1999). IYSV is transmitted by onion thrips (Thrips tabaci L.), and more recently, it has been shown that tobacco

1 thrips (Franklienella fusca) are capable of transmitting IYSV, albeit at much lower efficiency compared to T.tabaci (Srinivasan et al., 2012).

The disease was first reported in onion stalk from Brazil in 1981 (de Avila et al.,

1981) referred to as “sapeca”. The disease was characterized by the diagnostic symptoms of a chlorotic and necrotic eye with green island at the centre, known as diamond eye, but the pathogen was not reported. It was much later that similar symptoms were observed in onion growing regions of Treasure Valley of Idaho and Oregon in the USA during cropping season of 1989 (Hall et al., 1993; Moyer and Mohan, 1993), and referred to as “straw bleaching” (Gent et al., 2006). Derks and Lemmers (1996) and

Cortes et al., (1998) described IYSV in the Netherland as a new tospovirus infecting iris

(Iris hollandica) from field and in leek in the greenhouse under natural conditions and named it as Iris yellow spot virus. During same time researchers from the USA described the onion disease earlier reported from Brazil and Treasure Valley as IYSV based on biological, serological and molecular characters (Gera et al., 1998; Moyer et al., 2003). The virus was known to cause major economic loss in the region for a couple of years but remained dormant. It reemerged as an epidemic in the Pacific Northwest of the USA in 2002, when it was reported from onion (Allium cepa) growing regions of

California and Arizona (Bag et al., 2009a; Moyer et al., 2003; Pool et al., 2007) and

Utah (Abad et al., 2003). Since then, the virus spread to the other states of the western

USA and caused severe damage to both onion seeds and bulb crops. To our knowledge, the virus was reported from Arizona (Pappu and Matheron, 2008), Colorado (Schwartz et al., 2002), Georgia (Mullis et al., 2004), Hawaii (Sether et al., 2010), Michigan

(Hausbeck, 2007), Nevada (Bag et al., 2009a), New Mexico (Creamer et al., 2004),

New York (Hoepting et al., 2007), Oregon (Crowe et al., 2005), Texas (Miller et al.,

2006), Washington (du Toit el al., 2004), and more recently from Pennsylvania

(Hoepting and Fuchs, 2012).

Apart from the cultivated onion (Allium cepa), IYSV was also reported from wild onion A. altaicum, (Washington: Pappu et al., 2006; Cremer et al., 2011) and other allium species as A. galanthum (New Mexico: Cramer et al., 2011), A. porrum

(Colorado: Schwartz et al., 2007; Oregon: Gant et al., 2007), A. pskemense

(Washington: Pappu et al., 2006), A. roylei (New Mexico: Cramer et al., 2011), A. sativum (Oregan: Bag et al., 2009b), A. schoenoprasum and A. tuberosum (New

Mexico: Cramer et al., 2011) and A. vavilovii (Washington: Pappu et al., 2006; New

Mexico: Cramer et al., 2011). Apart from the USA, IYSV was also reported from different countries around the world from twelve different Allium and non-allium species (Table

1.1).

Besides onion, other susceptible crops and several ornamentals and weeds could also be serving as potential reservoir sources of virus inoculum. Sampangi et al., (2007) reported IYSV from Idaho from a number of weed hosts as including Ameranthus retroflexus, Chenopodium album, Kochia scoparia, Lactuca serriola, and Tribulus terrestris. Evans et al., (2009 a&b) reported natural infection of IYSV on Atriplex micrantha and Setaria viridis from Utah and Nischwitz et al., (2007) in spiny sowthistle (Sonchus asper) from Georgia in the USA.

Under experimental conditions Bag and Pappu (2009) reported IYSV infection on Datura stramonium, Nicotiana benthamiana, Vigna unguiculata, Capsicum annuum and Chenopodium quinoa, and Srinivasan et al., (2011), reported Eustoma

Table 1.1: List of various Allium and non-allium species reported as host from allium growing regions of the world.

Host Common Location Year of first observed/Report Name Allium cepa Onion Brazil 1994 (Pozzer et al., 1999) Israel 1998 (Gera et al., 1998) Japan 1999 (Kumar & Rawal, 1999) Slovenia 2000 (Mavric & Ravnikar, 2000) Italy 2003 (Cosmi et al., 2003) Australia 2003 (Coutts et al., 2003) Tunisia 2005 (Moussa et al., 2005) Spain 2005 (Cordoba-Selles et al., 2005) Chile 2005 (Rosales et al., 2005) India 2006 (Ravi et al., 2006) Rèunion Island 2006 (Robene-Soustrade et al., 2006) Peru 2006 (Mullis et al., 2006) Guatemala 2006 (Nischwitz et al., 2006) France 2007 (Huchette et al., 2008) Canada 2007 (Hoepting et al., 2008) Serbia 2007 (Bulajic et al., 2008) South Africa 2007 (du Toit et al., 2007) New Zealand 2007 (Ward et al., 2008) Greece 2008 (Chatzivassiliou et al., 2009) Mauritius 2010 (Lobin et al., 2010) Uruguay 2010 (Colnago et al. 2010) Mexico 2010 (Velasquez-V & Reveles-H, 2011)

Host Common Location Year of first observed/ Name Report Austria 2011 (Plenk et al., 2011) Kenya 2011 (Birithia et al., 2011) Uganda 2011 (Birithia et al., 2011) Bosnia and 2012 (Trkulja et al., 2013) Herzegovina A. ampeloprasum Egyptian Egypt 2011 (Hafez et al., 2011) leek A. cepa var.ascalonicum Shallot Rèunion Island 2005 (Robene-Soustrade et al., 2006) A. galanthum Snowdrop New Mexico 2010 (Cramer et al., 2011) Onion A. porrum Leek Australia 2003 (Coutts et al., 2003) Rèunion Island 2005 (Robene-Soustrade et al., 2003) Colorado 2006 (Schwartz et al., 2007) Greece 2008 (Chatzivassiliou et al., 2009) Germany 2010 (Krauthausen et al., 2012) Sri Lanka 2009 (Widana Gamage at al., 2010) A. sativum Garlic Rèunion Island 2005 (Robene-Soustrade et al., 2003) India 2010 (Gawande et al., 2010) Egypt 2011 (Hafez et al., 2011)

Host Common Location Year of first observed/ Name Report Non-Allium Species Alstroemeria sp. Alstroemeria Japan 2001 (Okuda & Hanada, 2001) Bessera elegans Bessera Japan 2005 (Jones, 2005) Clivia minata Clivia Japan 2005 (Jones, 2005) Cycas sp. Cycad Iran 2005 (Ghotbi et al.,2005) Eustoma grandiflorum Lisianthus Japan 2003 (Doi et al.,2003) E. russellianum Lisianthus Israel 2000 (Kritzman et al.,2000) Hippeastrum hybridum Amaryllis Israel 1998 (Gera et al.,1998) Iris hollandica Iris The 1996 (Derks & Lemmers, Netherlands 1996) Pelargonium hortorum Geranium Iran 2005 (Ghotbi et al.,2005) Petunia hybrida Petunia Iran 2005 (Ghotbi et al.,2005) Portulaca sp. Purslane Italy 2003 (Cosmi et al.,2003) Rosa sp. Rose Iran 2005 (Ghotbi et al.,2005) Scindapsus sp. Pothos Iran 2005 (Ghotbi et al.,2005) Vigna unguiculata Cowpea Iran 2005 (Ghotbi et al.,2005)

6 russellianum acts as a good experimental host for various biological and molecular research.

Due to ever increasing globalization and trade in agricultural crops and widespread presence of insect vector Thrips tabaci, new reports of IYSV occurrence began to emerge from all the continents except Antarctica (Table 1). With the advancement in diagnostic techniques and the increasing trade in agricultural commodities the virus is being detected from different countries and hosts.

IYSV is a major cause of concern in onion bulb and seeded crops. In USA onion is a high value crop generating around $900 million annually in farm receipts from 2005-

2010. Pacific northwestern states (ID, OR, WA) cultivate around 54,000 hectares contributing nearly 80% of total US summer production. IYSV emerged as a devastating new disease on onion, with projected economic impact of 60-90 million USD, with 7.5-

12.5 million USD additional for pesticide control for thrips vector. http://www.waaesd.org/iris-yellow-spot-virus-thrips-in-onions.

Physical Properties

Hall et al., (1993), using transmission electron microscopy from symptomatic onion samples, were able to reveal the presence of virion particle similar to other tospoviruses reported. The virus was 80-120nm pleomorphic particles. The virions consist of RNA and proteins, carbohydrate and lipids. Cortes et al., (1998), purified the nucleocapsid protein and subsequently applied to cesium sulfate gradient and extracted the viral (v) RNA. On electrophoresis the RNAs corresponding to sizes of S (2.9kb), M

(4.8 kb), and L (8.9kb) were observed (Cortes et al., 1998).

Genome Organization

To understand the basic pathogenic properties of the pathogen, the complete genome of the virus was sequenced. Like other tospoviruses of the genus, IYSV consists of three segmented RNAs, namely large (L), medium (M) and small (S) single stranded

RNA molecules. The RNAs were either negative (L) or ambisense (M & S) coding orientation.

L RNA is 8,880 nucleotides (nt) long in length and contains a single open reading frame of 8,621 nt in the viral complementary (vc) strand (Bag et al., 2010). The ORF codes for a protein of 2,873 aminoacids with a predicted molecular mass of 331.17 kDa and shares many of the features of the viral RNA-dependent RNA polymerase (RdRp) coded by L RNAs of known tospoviruses. The 5’ and 3’ termini of IYSV L RNA (vc) contain two untranslated regions of 33 and 226 nucleotides, respectively, and both termini have conserved terminal nucleotides, as common feature of tospovirus genomic

RNAs (Bag et al., 2010).

The M RNA is 4,821 nucleotides long, with two ORFs in an ambisense arrangement. The smaller ORF of 935 nucleotides was located at the 5’ end of the v- sense strand, potentially encoding a 311 amino-acid protein with a predicted molecular mass of 34.7 kDa, potentially a non-structural movement protein. The second ORF, the glycoprotein precursor (Gn/Gc), is in the vc-sense, was 3,410 nt in length potentially coding for 1,136 amino acid protein of 128.84 kDa. The two open reading frames are separated by a 380 nucleotide intergenic region (Bag et al., 2009c; Cortes et al., 2002).

The S RNA segment of IYSV was 3,105 nucleotides (Cortes et al., 1998), codes two non-overlapping ORF in ambisense arrangement. The ORF in viral sense is 1,329 nt

long coding a potential 50.1 kDa non-structural protein (NSs), and the second ORF in vc-sense 816 nt long and potentially codes for nucleo protein of 30.5 kDa (Cortes et al.,

1998).

RdRp Translation

Transcription vRNA 5’ 3’ Replication

vcRNA 3’ 5’ L RNA

N GnGc Translation Translation

Transcription Transcription 5’ 3’ vRNA 5’ 3’ vRNA

Replication Replication 3’ 5’ 3’ 5’ vcRNA vcRNA

Transcription Transcription

Translation Translation M RNA NSs S RNA NSm

Fig.1.1: Schematic representation of the genome organization of tospovirus.

All three RNAs share some similar characteristics of other tospoviruses: The first eight nucleotides of the terminal sequences are identical at the 5’ and 3’ terminal of all the segments of RNA; the RNA segments have complementary ends in all the cases, forming stable panhandle termini; and both coding ORFs of S and M RNA are preceded by non-coding leader sequence and separated by intergenic regions.

Transmission

Under natural conditions, the virus is transmitted from plant-to-plant exclusively by thrips (Thysanoptera:Thripidae). Until recently, out of the ten thrips reported to transmit tospoviruses, only onion thrips (Thrips tabaci L.) was confirmed vector for

IYSV (Cortez et al., 1998; Nagata et al., 1999; Pozzer et al., 1999; Kritzman et al., 2001).

Srinivasan et al., (2012), reported that tobacco thrips (Frankliniella fusca (Hinds)) can also transmit IYSV to a limited extent under greenhouse experimental conditions.

Compared to other thrips, Thrips tabaci is reported to have a wide host range. Ghabn

(1948) listed 141 plant species from 41 families; Morison (1957) listed more than 355 species whereas 140 plant species in 40 families were reported as host by

Ananthakrishnan, (1973). Despite this wide host range Allium cepa is one of the most favored host for the thrips, and infects onion grown between sea level and 2000 m

(Lewis 1973, 1997; Pappu et al., 2009; Mandal et al., 2012). Like many different virus- vector specific interaction, tospovirus-thrips interaction is also very specific. Incidence of Thrips tabaci correlated with higher incidence of IYSV in onion fields has been reported from different studies (Kritzman et al., 2001). T. tabaci overwinters as adults

(Shirck, 1951; Lewis, 1973; North and Shelton, 1986; Sites and Chamber, 1990) and lays eggs at the feeding sites (Theunissen and Legutowska 1991). Compared to onion bulbs, development on onion leaves is faster (Gawaad and El-Shazli 1970). Similar to other tospoviruses (Ullman et al., 1993), IYSV was also thought to be acquired at early larval stages (Jones, 2005; Whitefield et al., 2005) and its acquisition rate decreases as larvae matures (Negata et al., 1999; van de Wetering et al., 1999; Chatzivassiliou et al., 2002) and then transmitted as instar and adult thrips, in a propagative persistent manner.

Once acquired in larval stages, viruliferous thrips were capable of transmitting virus throughout their lives (Ullman et al., 2002; Jones, 2005; Whitefield et al., 2005). Thrips cannot acquire a tospovirus once it passes larval and first instar stages (Jones, 2005;

Whitefield et al., 2005). Apart from being a vector for IYSV, onion thrips also act a pest for onion crops and can cause upto 60% yield loss (Waiganjo et al., 2008), or if combined with IYSV, it can cause 100% crop loss (Pozzer et al., 1999). There is no report of seed and bulb transmission of IYSV (Kritzman et al., 2001; Robene-Soutrde et al.,

2006) but recently Weilner and Bedlan (2013), detected IYSV in bulbs by ELISA only.

Symptomatology

IYSV infection of onion plants produces a wide range of symptoms. Initially, characteristic yellow to straw colored chlorotic or necrotic lesions appears, usually elongated or spindle shaped. These are mainly observed in mid-to-lower portions of the infected plants. As the disease develops and the plants grow, the lesions elongate and coalesce together completely covering the leaves and stalks. Often, there is green tissue in the centre of lesions giving a diamond ring structure and, often considered as diagnostic symptom for IYSV. In some cases, the seed stalk may swell at the point of infection. Later in the season the coalesced lesions cause the seed head and leaf to collapse and topple over. IYSV on onion is not found to be systemic (Gent et al., 2006), and the highest virus titer was usually in inner leaves at the centre, site where the thrips resides and feeds (Kritzman et al., 2001). In the stalks and leaves the virus titer decreases away from the point of infection. The symptoms described were due to the combination of virus and vector feeding. The feeding produces silvery leaf spots which, due to the removal of cellular contents, turns to white and causes curling of leaves

(Bailey, 1938). This subsequently reduces the photosynthetic ability of plants by reducing the chlorophyll rich area that may interfere the nutrient transportations to the bulb (Molenaar 1984; Parrella and Lewis 1997) resulting in reduced bulb size and weight

(Diaz-Montano et al., 2010; Fournier et al., 1995; Kendall and Capinera 1987; Rueda et al., 2007). In A. sativum, chlorosis with irregular circular spots (Bag et al., 2009) and other similar symptoms were observed from other allium hosts whereas in weeds marginal chlorosis, necrosis, streaking, purpling, was observed (Evens et al., 2009 a & b).

In various indicator hosts the disease mainly develops chlorotic ring spot, chlorotic local lesions, necrotic spots, which merges together and leads to early senescence of the infected leaves. The virus is mostly localized in indicator hosts, except

Nicotiana benthamiana (Bag and Pappu 2009) and in Eustoma russellianum

(Srinivasan et al., 2011) where it produces necrosis in veins, stem and buds, leading to lodging and early senescence of the plants.

Thrips tabaci, has emerged as a worldwide pest, and it is ubiquitous in every allium growing place. In case of onion it can cause >60% of crop loss, and as a vector, in combination of IYSV, it causes addition loss that can rise to 100% crop loss. Since it was first reported in Treasure valley in Pacific Northwestern USA in 1989, it emerged as a major cause of concern causing economic loss for both onion bulb and seed crops. Being a new virus reported in the onion growing regions, much information was not available about its biological and molecular characteristics. Moreover it was also reported to infect a host common to another tospovirus Tomato spotted wilt virus (TSWV) in

Georgia. TSWV has not been reported in onion from the western states of the USA. With

12 this in view my research was designed to understand the epidemiology of virus in the western USA with the following objectives:

 Biological characterization of IYSV infecting onion seeds and bulb crops in

the western USA.

 Molecular characterization of IYSV infecting onion bulb and seed crops

from the western USA.

 Seasonal dynamics of onion thrips (Thrips tabci) transmission of IYSV

using a serological assay.

 Understanding the complementation between two tospoviruses IYSV and

TSWV in controlled conditions.

REFERENCES

Abad JA, Speck J, Mohan SK, Moyer JW (2003) Diversity of the Iris yellow spot virus N gene in the USA. Phytopathology 93:S1.

Ananthakrishnan TN (1973) Thrips: biology and control. MacMillan, New Delhi, India.

Bag S, Pappu HR (2009) Symptomatology of Iris yellow spot virus in selected indicator hosts. Plant Health Progress Doi:10.1094/PHP-2009-0824-01-BR

Bag S, Druffel KL, Pappu HR (2010) Structure and genome organization of the large RNA of Iris yellow spot virus (genus Tospovirus, family Bunyaviridae). Archives of Virology 155:275-279.

Bag S, Singh J, Davis RM, Chounet W, Pappu HR (2009a) Iris yellow spot virus in onion in Nevada and northern California. Plant Disease 93:674.

Bag S, Rogers P, Watson R, Pappu HR (2009b) First report of natural infection of garlic with Iris yellow spot virus in the United States. Plant Disease 93:839.

Bag S, Druffel KL, Salewsky T, Pappu HR (2009c) Nucleotide sequence and genome organization of the medium RNA of IYSV (genus Tospovirus, family Bunyaviridae) from the Unites States. Archives of Virology 154:715–718.

Bailey SF (1938) Thrips of economic importance in California. University of California, Collage of Agricultural Experimentation Station Circular. 346.

Moussa BA, Marrakchi M, Makni M (2005) Characterisation of Tospovirus in vegetable crops in Tunisia. Infection, Genetics and Evolution 5:312-322.

Birithia R, Subramanian S, Pappu HR, Sseruwagi P, Muthomi JW, Narla RD (2011) First report of Iris yellow spot virus infecting onion in Kenya and Uganda. Plant Disease 95:1195.

Bulajic A, Jovic J, Krnjajic S, Petrov M, Kjekic I, Krstic B (2008) First report of Iris yellow spot virus on onion (Allium cepa) in Serbia. Plant Disease 92:1247.

Chatzivassiliou, E K, Peters D, Katis NI (2002) The efficiency by which Thrips tabaci populations transmit Tomato spotted wilt virus depends on their host preference and reproductive strategy. Phytopathology 92: 603-609.

Chatzivassiliou EK, Giavachtsia V, Mehraban AH, Hoedjes K, Peters D (2009) Identification and incidence of Iris yellow spot virus, a new pathogen in onion and leek in Greece. Plant Disease 93:761.

Colnago P, Achigar R, Gonzalez PH, Peluffo S, Gonzalez IH, Pianzzola MJ, Galvan GA (2010) First report of Iris yellow spot virus on onion in Uruguay. Plant Disease 94:786.

Córdoba-Sellés C, Martínez-Priego L, Muńoz-Gómez R, Jordá-Gutiérrez C (2005) Iris yellow spot virus: A new onion disease in Spain. Plant Disease 89:1243.

Cortês I, Aires A, Pereira AM, Goldbach R, Peters D, Kormelink R (2002) Genetic organisation of Iris yellow spot virus M RNA: Indications for functional homology between the G(C) glycoproteins of tospoviruses and animal-infecting bunyaviruses. Archives of Virology 147:2313-2325.

Cortês I, Livieratos IC, Derks A, Peters D, Kormelink R (1998) Molecular and serological characterization of Iris yellow spot virus, a new and distinct tospovirus species. Phytopathology 88:1276-1282.

Cosmi T, Marchesini E, Martini G (2003) Presence and spread of tospovirus and thrip vectors in Veneto. Infomatore Agrario 59:69-72.

Coutts BA, McMichael LA, Tesoriero L, Rodoni BC, Wilson CR, Wilson AJ, Persley DM, Jones RAC (2003) Iris yellow spot virus found infecting onions in three Australian states. Australasian Plant Pathology 32:555-557.

Cramer CS, Bag S, Schwartz, HF, Pappu HR (2011) Susceptibility of onion relative (Allium spp) to Iris yellow spot virus. Plant Disease 95:1319.

Creamer R, Sanogo S, Moya A, Romero J, Molina-Bravo R, Cramer C (2004) Iris yellow spot virus on onion in New Mexico. Plant Disease 88:1049.

Crowe F J, Pappu HR (2005) Outbreak of Iris yellow spot virus in onion seed crops in central Oregon. Plant Disease 89:105. de Avila AC, Gama MICS, Kitajima EW, and PereiraW (1981) Um virus do grupo vira- cabeca do tomateiro isolado de cebola (Allium cepa L.) Fitopatologia Brasileira. 6:525.

Derks AFLM, Lemmers MEC (1996) Detection of tospoviruses in bulbous crops and transmissibility by vegetative propagation. Acta Horticulture 432:132-137.

Diaz-Montano J, Fuchs M, Nault BA, Shelton AM (2010) Evaluation of onion cultivars for resistance to onion thrips (Thysanoptera: Thripidae) and Iris yellow spot virus. Journal of Economic Entomology 103: 925-937.

Doi M, Zen S, Okuda M, Nakamura H, Kato K, Hanada K (2003) Leaf necrosis disease of lisianthus (Eustoma grandiflorum) caused by Iris yellow spot virus. Japanese Journal of Phytopathology 69:181-188. du Toit LJ, Burger JT, McLeod A, Englebrecht M, Viljoen A (2007) Iris yellow spot virus in onion seed crops in South Africa. Plant Disease 91:1203. du Toit LJ, Pappu HR, Druffel KL, Pelter GQ (2004) Iris yellow spot virus in onion bulb and seed crops in Washington. Plant Disease 88:222.

Evans CK, Bag S, Frank E, Reeve JR, Drost D, Pappu HR (2009a) Natural infection of Iris yellow spot virus in twoscale saltbush (Atriplex micrantha) growing in Utah. Plant Disease 93:430.

Evans CK, Bag S, Frank E, Reeve JR, Ransom C, Drost D, and Pappu HR (2009b) Green foxtail (Setaria viridis), a naturally infected grass host of Iris yellow spot virus in Utah. Plant Disease 93:670.

Fournier F, Boivin G, Stewart R K (1995) Effect of Thrips tabaci (Thysanoptera: Thripidae) on yellow onion yields and economic thresholds for its management, Journal of Economic Entomology 88: 1401-1407.

Gawaad AAA, El-Shazli AY (1970) Studies on Thrips tabaci Lindman. VI. New stage in life cycle. Zeitschrift für Angewandte Entomologie 66: 395-398.

Gawande SJ, Khar A, Lawande KE (2010) First report of Iris yellow spot virus on garlic in India. Plant Disease 94:1066.

Gent DH, du Toit L, Fichtner SF, Krishna Mohan S, Pappu HR, Schwartz HF (2006) Iris yellow spot virus: An emerging threat to onion bulb and seed production. Plant Disease 90:1468-1479.

Gent DH, Martin RR, Ocamb CM (2007) First report of Iris yellow spot virus on onion and leek in western Oregon. Plant Disease 91:468.

Gent DH, Schwartz HF, Khosla R (2004) Distribution and incidence of Iris yellow spot virus and its relation to onion plant population and yield. Plant Disease 88:446- 452.

Gera A, Cohen J, Salomon R, Raccah B (1998) Iris yellow spot tospovirus detected in onion (Allium cepa) in Israel. Plant Disease 82:127.

Gera A, Kritzman A, Cohen J, Raccah B (1998) Tospoviruses infecting bulb crops in Israel. Pages 86-87 in: Recent Progress in Tospovirus and Thrips Research. D.

Peters and R. Goldbach, (eds). IVth Int. Symp. on Tospoviruses and Thrips in Floral and Vegetable Crops, Wagengingen, The Netherlands.

Ghabn AAAE (1948) Contribution to the knowledge of the biology of Thrips tabaci Lind. in Egypt. Bulletin de la Société Fouad Ier d'Entomologie 32: 123-174.

Ghotbi T, Shahraeen N, Winter S (2005) Occurrence of tospoviruses in ornamental and weed species in Markazi and Tehran provinces in Iran. Plant Disease 89:425-429.

Hafez EE, Abdelkhalek AA, El-Morsi AA, and El-Sbahaby OA (2011) First report of Iris yellow spot virus infection of garlic and Egyptian leek in Egypt. Plant Disease 96:594.

Hall JM, Mohan K, Knott EA, Moyer JW (1993) Tospoviruses associated with scape blight of onion (Allium cepa) seed crops in Idaho. Plant Disease 77:952.

Hausbeck M (2007) Iris yellow spot virus: A New Threat to Michigan Onion Producers? Great Lakes Fruit, Vegetable & Farm Market EXPO. December 4-6, 2007. Grand Rapids, MI.

Hoepting CA, Allen JK, Vanderkooi KD, Hovius MY, Fuchs MF, Pappu HR, McDonald MR (2008) First report of Iris yellow spot virus on onion in Canada. Plant Disease 92:318.

Hoepting CA, Fuchs MF (2012) First report of Iris yellow spot virus infecting onion in Pennsylvania. Plant Disease 96:1229.

Hoepting CA, Schwartz HF, Pappu HR (2007) First report of Iris yellow spot virus on onion in New York. Plant Disease 91:327.

Huchette O, Bellamy C, Filomenko R, Pouleau B, Seddas S, Pappu HR (2008) Iris yellow spot virus on shallot and onion in France. Plant Health Progress Doi:10.1094/PHP-2008-0610-01-BR.

Jones DR (2005) Plant viruses transmitted by thrips. European Journal of Plant Pathology 113:119-157.

Kendall DM, Capinera JL (1990) Geographic and temporal variation in the sex ratio of onion thrips. Southwest Entomology 15: 80-88.

Krauthausen HJ, Leinhos GME, Muller J, Radtke PC, Jehle J.A. (2012) Identification and incidence of Iris yellow spot virus in Allium field crops in southwest Germany. European Journal of Plant Pathology 134:345-356.

Kritzman A, Beckelman H, Alexandrov S, Cohen J, Lampel M, Zeidan M, Raccah B, Gera A (2000) Lisianthus leaf necrosis: A new disease of lisianthus caused by Iris yellow spot virus. Plant Disease 84:1185-1189.

Kritzman A, Lampel M, Raccah B, Gera A (2001) Distribution and transmission of Iris yellow spot virus. Plant Disease 85: 838-842.

Kumar NKK, Rawal RD (1999) Onion thrips, Thrips tabaci, a vector of onion tospovirus. Insect Environment 5:52.

Lewis T (1973) Thrips: their biology, ecology and economic importance. Academic Press, London, United Kingdom.

Lewis T (1997) Pest thrips in perspective, pp. 1-13. In T. Lewis (ed.), Thrips as crop pests. CAB International, New York.

Lobin K, Saison A, Hostachy B, Benimadhu SP, Pappu HR (2010) First report of Iris yellow spot virus in onion in Mauritius. Plant Disease 94:645.

Mandal B, Jain RK, Krishnareddy M, Krishna Kumar NK, Ravi KS, Pappu HR (2012) Emerging problems of Tospoviruses (Bunyaviridae) and their management in the Indian Subcontinent. Plant Disease 96:468-479.

Mavric I, Ravnikar M (2000) Iris yellow spot tospovirus in Slovenia. Pages 223-225 In: Proc. 5th Congress of the European Foundation for Plant Pathology, Taormina, Italy.

Miller M, Saldana R, Black MC, Pappu HR (2006) First Report of Iris yellow spot virus on onion (Allium cepa) in Texas. Plant Disease 90:1359.

Molenaar ND (1984) Genetics, thrips (Thrips tabaci L.) resistance and epicuticular wax characteristics of nonglossy and glossy onions (Allium cepa L.) Ph.D. Dissertation, University of Wisconsin, Madison.

Morison GD (1957) A review of British glasshouse Thysanoptera. Transactions of the Royal Entomological Society of London. 109: 467-520.

Moyer JW, Abad JA, Ullman D, Mohan K (2003) INSV and IYSV: The other tospoviruses in the United States. Phytopathology 93:S115.

Moyer JW, Mohan SK (1993) Tospoviruses associated with scape blight of onion (Allium cepa) seed crops in Idaho. National Onion Res. Conf., Ithaca, NY. (Abst.).

Mullis SW, Gitaitis RD, Nischwitz C, Csinos AS, Rafael Mallaupoma ZC, Inguil Rojas EH (2006) First report of onion (Allium cepa) naturally infected with Iris yellow spot virus in Peru. Plant Disease 90:377.

Mullis SW, Langston DB Jr, Gitaitis RD, Sherwood JL, Csinos AC (2004) First report of Vidalia onion (Allium cepa) naturally infected with Tomato spotted wilt virus and Iris yellow spot virus (family Bunyaviridae, genus Tospovirus) in Georgia. Plant Disease 88:1285.

Nagata T, Almeida ACL, Resende RdeO, de Avila AC (1999) The identification of the vector species of Iris yellow spot tospovirus occurring on onion in Brazil. Plant Disease 83:399.

Nischwitz C, Gitaitis RD, Mullis SW, Csinos AS, Langston DB, Sparks AN (2007) First report of Iris yellow spot virus in spiny sowthistle (Sonchus asper) in the United States. Plant Disease 91:1518.

Nischwitz C, Mullis SW, Csinos AS, Langston DB, Sparks AN, Torrance RL, Rafael Mallaupoma ZC, Inguil Rojas EH, Gitaitis RD (2006) Phylogenetic analysis of the N gene links Georgia strains of Iris yellow spot virus to strains from Peru. Phytopathology 96:S84.

North RC, Shelton AM (1986) Overwintering of the onion thrips, Thrips tabaci (Thysanoptera: Thripidae), in New York. Environmental Entomology 15: 695- 699.

Okuda M, Hanada K (2001) RT-PCR for detecting five distinct Tospovirus species using degenerate primers and dsRNA template. Journal of Virological Methods 96:149- 156.

Pappu HR, Matheron ME (2008) Characterization of Iris yellow spot virus from onion in Arizona. Plant Health Progress Doi:10.1094/PHP-2008-0711-01-BR.

Pappu HR, Hellier BC, Dugan FM (2006) Wild Allium spp. as natural hosts of Iris yellow spot virus. Plant Disease 90:378.

Pappu HR, Jones RAC, Jain RK (2009) Global status of tospovirus epidemics in diverse cropping systems: Successes gained and challenges that lie ahead. Virus Research 141:219–236.

Parrella MP, Lewis T (1997) Integrated pest management (IPM) in field crops, pp. 595- 614. In T. Lewis (eds.), Thrips as crop pests. CAB International, New York.

Plenk A, Grausgruber-Groger S (2011) First report of Iris yellow spot virus in onions (Allium cepa) in Austria. New Disease Reports 23: 13.

Poole GJ, Pappu HR, Davis RM, Turini TA (2007) Increasing outbreaks and impact of Iris yellow spot virus in bulb and seed onion crops in the Imperial and Antelope Valleys of California. Plant Health Progress Doi:10.1094/PHP-2007-0508-01-BR.

Pozzer L, Bezerra IC, Kormelink R, Prins M, Peters D, Resende R DeO, de Ávila AC (1999) Characterization of a tospovirus isolate of Iris yellow spot virus associated with a disease in onion fields in Brazil. Plant Disease 83: 345-350.

Ravi KS, Kitkaru AS, Winter S (2006) Iris yellow spot virus in onions: A new tospovirus record from India. Plant Pathology 55:288.

Robène-Soustrade I, Hostachy B, Roux-Cuvelier M, Minatchy J, Hédont M, Pallas R, Couteau A, Cassam N, Wuster G (2006) First report of Iris yellow spot virus in onion bulb- and seed-production fields in Réunion Island. Plant Pathology 55:288.

Rosales M, Pappu HR, Mora R, Aljaro A (2005) Iris yellow spot virus in onion in Chile. Plant Disease 89:1245.

Rueda A, Badenes-Perez FR, Shelton AM (2007) Developing economic thresholds for onion thrips in Honduras. Crop Protection 26: 1099-1107.

Sampangi RK, Mohan SK, Pappu HR (2007) Identification of new alternative weed hosts for Iris yellow spot virus in the Pacific Northwest. Plant Disease 91:1683.

Schwartz HF, Brown Jr. WM., Blunt T, Gent DH (2002) Iris yellow spot virus on onion in Colorado. Plant Disease 86:560.

Schwartz HF, Otto K, Pappu HR (2007) First report of Iris yellow spot virus in commercial leek (Allium porrum) in the United States. Plant Disease 91:113.

Sether DM, Borth WB, Shimabuku RS, Pappu HR, Melzer MJ, Hu JS (2010) First report of Iris yellow spot virus in onion in Hawaii. Plant Disease 94:1508.

Shirck FH (1951) Hibernation of onion thrips in southern Idaho. Journal of Economic Entomology 44: 1020-1021.

Sites RW, Chambers WS (1990) Initiation of vernal activity of Frankliniella occidentalis and Thrips tabaci on the Texas south plains. Southwest Entomologist 15: 339- 343.

Srinivasan R, Diffie S, Sundaraj S, Mullis SW, Riley DG, Gitaitis R, and Pappu HR (2011) Evaluation of Lisianthus (Eustoma russellianum) as an indicator host for Iris yellow spot virus. Plant Disease 95:1520-1527.

SrinivasanR, Sundaraj S, Pappu HR, Diffie S, Riley D, Gitaitis R (2012) Transmission of Iris yellow spot virus by Frankliniella fusca and Thrips tabaci (Thysanoptera: Thripidae). Journal of Economic Entomology 105, 40-47.

Theunissen J, Legutowska H (1991) Thrips tabaci Lindeman (Thysanoptera: Thripidae) in leek: within-plant distribution. Journal of Applied Entomology 112: 309-316.

Trkulja V, Mihic Salapura J, Kovacic D, Stankovic I, Bulajic A, Vucurovic A, and Krstic B (2013) First report of Iris yellow spot virus infecting onion in Bosnia and Herzegovina. Plant Disease 97:430.

Ullman DE, Meideros R, Campbell LR, Whitfield AE, Sherwood JL, and German TL (2002) Thrips as vectors of tospoviruses. Advances in Botanical Research 36: 113- 140.

Ullman DE, German TL, Sherwood, JL, Westcot W, Cantone FA (1993) Tospovirus replication in insect vector cells: immuno-cytochemical evidence that the nonstructural protein encoded by the S RNA of Tomato spotted wilt tospovirus is present in the thrips vector cells. Phtyopathology 83: 456-463. van de Wetering F, van der Hoek M, Goldbach R, Mollema C, Peters D (1999) Variation in tospovirus transmission between populations of Frankliniella occidentalis (Thysanoptera: Thripidae). Bulletin of Entomological Research. 89: 579-588.

Velasquez-Valle R, Reveles-Hernandez M (2011) Iris yellow spot virus detection in the onion cultivation of Zacatecas, Mexico. Revista Mexicana de Ciencias Agricolas 2:971-978.

Waiganjo MM, Mueke JM, Gitonga LM (2008) Susceptible onion growth stages for selective and economic protection from onion thrips infestation. Acta Horticulture 767:193-200.

Ward LI, Perez-Egusquiza Z, Fletcher JD, Ochoa Corona FM, Tang JZ, Liefting LW, Martin EJ, Quinn BD, Pappu HR, Clover GRG (2008) First report of Iris yellow spot virus on Allium cepa in New Zealand. New Disease Reports 17:38.

Webster CG, Perry KL, Lu X, Horsman L, Frantz G, Mellinger C, Adkins S (2010) First report of Groundnut ringspot virus infecting tomato in south Florida. Plant Health Progress Doi:10.1094/PHP-2010-0707-01-BR.

Weilner S, and Bedlan G (2013) Detection of Iris yellow spot virus (IYSV) in selected Allium species and overwintering hosts in Austrian onion-producing areas. Journal für Kulturpflanzen 65: 60-67.

Whitefield AE, Ullman DE, German TL (2005) Tospovirus-thrips interaction. Annual Review of Phytopathology 43:459-489.

Widana Gamage SMK, Hassani-Mehraban A, Peters D (2010) Identification of Iris yellow spot virus on Leek (Allium porrum) in Sri Lanka. Plant Disease 94: 1070.

Zhou J, Kantartzi SK, Wen RH, Newman M, Hajimorad MR, Rupe JC, Tzanetakis I E (2011) Molecular characterization of a new tospovirus infecting soybean. Virus Genes 43:289–295.

CHAPTER TWO

BIOLOGICAL CHARACTERIZATION OF IRIS YELLOW SPOT VIRUS

INFECTING ONION SEEDS AND BULB CROPS IN

THE WESTERN USA

Modified version of this chapter was published as:

1. Bag, S., and H.R.Pappu. 2009. Plant Health Progress doi: 10.1094/PHP-2009- 0824-01-BR.

2. Bag, S., H.F.Schwartz, and H.R.Pappu. 2012. European Journal of Plant Pathology 134:97-104.

3. Bag, S., J. Singh, R.M.Davis, W. Chounet, and H.R.Pappu. 2009. Plant Disease 93:674.

4. Bag, S., P. Rogers, R. Watson, and H.R.Pappu. 2009. Plant Disease 93:839.

5. Cramer, C.S., S. Bag, H.F.Schwartz, and H.R.Pappu. 2011. Plant Disease 95:1319.

6. Evans, C.K., S. Bag, E. Frank, J. Reeve, C. Ransom, D. Drost, and H.R.Pappu. 2009. Plant Disease 93:670.

7. Evans, C.K., S. Bag, E. Frank, J. Reeve, C. Ransom, D. Drost, and H.R.Pappu. 2009. Plant Disease 93:430.

ABSTRACT

Iris yellow spot virus (IYSV) (family Bunyaviridae, genus Tospovirus) causes an economically important disease in onion bulb and seed crops in the USA and other parts of the world. While considerable information on the genetic diversity based on the nucleocapsid (N) protein of the virus is available, little is known about the biological variability of the virus. Studies on biological characteristics of the virus have been

limited due to difficulties in obtaining consistent and reproducible mechanical transmission and lack of indicator hosts. The existence of strains, if any, of IYSV is not known though differences in symptomatology, disease severity, and yield losses could be attributed to the presence of different IYSV isolates. To better understand the biological diversity of IYSV, several plant species were evaluated for their response to mechanical inoculation with IYSV under controlled greenhouse conditions. Different indicator hosts develop differential responses to the virus following mechanical inoculation. Although most of the indicator plants show symptoms of chlorotic local lesions, ring spots, veinal necrosis, stem necrosis, drying of the inoculated leaves, only Nicotiana benthamiana shows systemic symptoms in new uninoculated leaves, buds and stem.

Further, using two experimental hosts, N. benthamiana and Datura stramonium, IYSV from naturally infected onion fields was evaluated to determine the existence of biologically distinct isolates using the following criteria: ability to establish infection and become systemic, the severity of the disease caused and ability of the isolate to cause senescence of the inoculated plants.

In order to develop management strategies, the weeds, volunteer onions and other allium species (garlic) were collected from and around onion fields from the western USA. Weeds and volunteer onions act as an alternative host / green bridge for the virus vectors during the harvesting seasons. Apart from garlic and wild onions, some of these weed as foxtail and twoscale saltbrush, were found to be IYSV infected under natural conditions and may play an important role in the virus epidemiology.

INTRODUCTION

Iris yellow spot virus (IYSV) is an economically important virus threat to onion and bulb crops in the United States and several parts of the world (Gent et al., 2006;

Pappu et al., 2009; Mandal et al., 2012). Hall et al., (1993) reported IYSV in onion from the US, and Europe; the virus was isolated and characterized from iris in the

Netherlands (Cortês et al., 1998). In recent years, IYSV spread rapidly in many states in the US and in several European countries. In the US, the most recent report was from

Pensylvania (Hoepting and Fuchs, 2012). In Europe, the virus was reported from France

(Huchette et al., 2008), Germany (Leinhos et al., 2007), Italy (Tomassoli et al., 2009),

Serbia (Bulajić et al., 2008), Spain (Cordoba-Selles et al., 2005, 2007), and UK

(Mumford et al., 2008). Lobin et al., (2010) confirmed the presence of IYSV in onion in

Maurtius, and Gawande et al., (2010) reported IYSV infection of garlic from India. More recently IYSV infected onion was reported from Bosnia and Herzegovina (Trkulja et al.,

2013). The disease is most damaging to onion seed crops where losses may approach up to 100 % (Pozzer et al., 1999). IYSV is a member of the genus Tospovirus, family

Bunyaviridae and is transmitted by onion thrips (Thrips tabaci. L) (Kritzman et al.,

2001) and recently it has been shown that tobacco thrips (Franklienella fusca) are capable of transmitting IYSV, albeit at much lower efficiency compared to T. tabaci

(Srinivasan et al., 2012). The IYSV genome consists of three RNAs: large (L) RNA of

8880 nucleotides (Bag et al., 2010) encoding RNA dependent RNA polymerase (RdRp); medium (M) RNA of 4,821 nucleotides (Bag et al., 2009) coding glycoprotein precursors

(Gn/Gc) and nonstructural protein (NSm); and small (S) RNA of 3,105 nucleotides encoding viral nucleocapsid (N) protein and nonstructural protein (NSs) (Cortês et al.,

1998). The L RNA is in negative sense, whereas M and S RNA have an ambisense genome organization. While much is known about the molecular variability of IYSV isolates from various hosts and geographic regions (Bulajić et al., 2009; Kunkalikar et al., 2011; Nichwitz et al., 2007; Pappu et al., 2009; Smith et al., 2006), no information is available on the biological variability of the virus. Moreover, quite often it is even not possible to diagnose plant virus infection based on the symptoms on host plants since; many viruses produces similar symptoms and even some physiological conditions can cause symptoms similar to virus diseases. As part of my study to understand the biology and disease epidemiology, we evaluated several indicator hosts for their response to

IYSV under controlled growth conditions (Bag and Pappu 2009). Weed samples from and surrounding infected onion fields were collected to finds any alternative host.

Subsequently, several IYSV isolates collected from naturally infected onion fields were evaluated on two experimental hosts D. stramonium and N. benthamiana. D. stramonium is a local lesion host for IYSV as the virus infection is limited to inoculated leaves only, whereas N. benthamiana is a permissive host wherein infection spreads from the inoculated leaf to younger, uninoculated leaves (Bag et al., 2012a). Using these two hosts, we report the identification, and biological characters of IYSV isolates collected from commercial onion fields in the western USA.

MATERIAL AND METHODS

Cultivated onions, wild onions, garlic and weeds such as green foxtail (Setaria viridis (L.) Beauv.) and twoscale saltbrush (Atriplex hortensis) that showed symptoms

suggestive of IYSV were collected from different locations in the western USA (Table

2.1). Double antibody sandwich-ELISA was done to identify the presence of IYSV in these samples using a commercially available kit (Agdia Inc. Elkhart, IN). Readings more than three times of healthy were considered positive. Positive samples were further confirmed by reverse-transcriptase polymerase chain reaction (RT-PCR).

Double Antibody Sandwich-ELISA (DAS-ELISA)

DAS-ELISA was performed using commercially available virus specific antiserum

(Agdia Inc. Elkhart, IN. Catalogue Number: CAB 60500 and ECA 60500) in a 96 well micro titer plate following the manufacturer’s instructions.

1. Coat a 96 well plate with 100 µl IYSV specific capture antibody into each well at a

dilution ratio of 1:100 in coating buffer (Appendix I).

2. Incubate the plate at 37°C for 2 h.

3. Grind plant tissues in sample extraction buffer at a ratio of 1:10 (w/v).

4. Collect sample extracts in microfuge tubes and spin for 1 min at 3000 xg. Store

samples at 4°C.

5. Wash plate from step 2 with 1x PBST three times with 2 min incubation at room

temperature between each wash. Tap plate upside down on paper towel to

remove excess buffer.

6. Dispense 100 µl of test samples into each well.

7. Incubate the plate at 37°C for 2 h.

8. Dilute concentrated alkaline phosphatase enzyme conjugate at a ratio of 1:200 in

antibody dilution buffer. Mix well and store at 4°C. (Prefer to prepare freshly,

while washing plates).

9. Wash plate from step 7, with 1x PBST three times with 2 min incubation at room

temperature between each wash. Tap plate upside down on paper towel to

remove excess buffer.

10. Dispense 100 µl of enzyme conjugate into each well.

11. Incubate the plate at 37°C for 2 h.

12. About 15 min before the end of incubation step, prepare substrate. (0.5-1mg/ml

of p-Nitrophenyl phosphate (pNPP) in substrate buffer). Keep it in dark cool

place.

13. Wash plate from step 11, with 1x PBST three times with 2 min incubation at room

temperature between each wash. Tap plate upside down on paper towel to

remove excess buffer.

14. Dispense 100 µl of pNPP substrate into each well.

15. Incubate the plate at 37°C for 1h.During incubation plate should be protected

from direct light.

16. Examine the plate at A405 nm. Wells with yellow coloration indicates positive

reaction.

Host range and symptomatology

Seeds of Arabidopsis thaliana COL 1, Capsicum annuum (Serrano pepper),

Cerastium glomeratum (mouse ear chickweed), Chenopodium quinoa, D. ferox,

D. innooxia, D. stramonium, N. benthamiana, N. tabacum, Solanum melongena

(eggplant), and Vigna unguiculata (Heirloom variety) were sown in small trays with insert of 36 cells each. Seeding was done in SunShine potting mix LC1. Seedlings at 2 to

6 leaf stage were transplanted to bigger pots 6 to 10 inches in diameter. IYSV-infected onion leaf tissue (Fig. 2.1) was homogenized by grinding in ice cold 0.01M sodium phosphate buffer (pH 7.2) containing 0.4 % β-mercaptoethanol in a chilled mortar pestle, debris was removed by squeezing the extract through a pad of non-absorbent cotton, and sap was used as virus inoculum for mechanical inoculation. Fully expanded

30-40 day old leaves of both D. stramonium and N. benthamiana were dusted with carborandum (600 mesh) and the inoculum was manually applied by rubbing the leaf surface using cotton applicators dipped in inoculum. After inoculation, plants were sprayed with water and kept in a greenhouse with 25/ 18 °C day/night cycle and observed for symptom development. Each experiment was repeated at least three times with six plants of each species inoculated simultaneously each time. Original source plant (onion) that was used as inoculum had symptoms typical of IYSV infection and the presence of IYSV confirmed by DAS-ELISA using a commercially available kit (Agdia

Inc. Elkhart, IN).

RESULTS

Onion samples collected from California, Colorado, Idaho, Oregon, Nevada, New

Mexico, and Washington were collected and checked for the presence of IYSV using serological based DAS-ELISA. Those samples from onion seed and bulb crop found to be positive in DAS-ELISA were further confirmed by RT-PCR. During this experiment

IYSV was found to be naturally infecting onion crops in Nevada and Northern California and were first time reported from these regions.

IYSV in Garlic

Seven garlic samples showing near-diamond shaped lesions (Fig. 2.2) collected from commercial seeded crop in Marion County OR were positive for IYSV by DAS-

ELISA.

IYSV in Wild Onion

Of six Allium species tested, IYSV was detected in symptomatic leaves of A. altaicum, A. roylei, A. schoenoprasum, A. tuberosum,and A. vavilovii, using a commercially available ELISA kits. Of these, A. altaicum, A. pskemense, and A. vavilovii were previously reported from Washington to be infected with IYSV (Pappu et al., 2006). These data expand the list of Allium species that are susceptible to IYSV and underscores the need for continued screening of other members of the genus to find sources of resistance to IYSV.

IYSV in Weeds

Potential symptoms of IYSV were observed on green foxtail and twoscale saltbrush. Leaves of green foxtail plants displayed a range of symptoms that included streaking, purpling, and chlorotic and necrotic lesions along leaf margins oriented along the axis of longitudinal venation (Fig. 2.3a). Leaves of twoscale saltbrush displayed a range of symptoms including spotting, chlorosis, and necrosis (Fig.2.3b). Samples were

positive for IYSV by double-antibody sandwich-ELISA.

Symptomatology and host range studies

IYSV isolates from the western USA were characterized for symptomatology in various indicator hosts (Table 2.2). In D. stramonium, plants showed 25 to 30 small chlorotic local lesions initially of 2 to 5 mm (Fig. 2.4) 8-12 days post inoculation (DPI).

The numbers of local lesions gradually increased and spread throughout the leaves within 20 to 25 days, and as the lesions coalesced, the leaves desiccated 35 to 40 DPI

(Fig. 2.4). The virus remained localized and did not spread systematically. The presence of IYSV in inoculated leaves was confirmed by DAS-ELISA. The virus remains localized and did not spread systematically.

In N. benthamiana, chlorotic local lesion (Fig. 2.5) appeared 7 to 10 DPI which subsequently expanded leading to drying of leaves by 20 to 25 DPI. The virus also spread systematically showing severe veinal necrosis and some stem necrosis (Fig. 2.5).

Infected plants died by 40 to 50 DPI (Fig. 2.5). Infection by IYSV was confirmed by

DAS-ELISA (Table 2.1) both in inoculated and systematically infected leaves.

In V. unguiculata, symptoms appeared as necrotic spots on inoculated leaves 5 to

6 DPI (Fig. 2.6a). There were no clear chlorotic lesion on the inoculated leaves of

Capsicum annuum (Fig. 2.6b) and Chenopodium quinoa (Fig. 2.6c) developed small concentric chlorotic rings spots that, gradually increased in size, symptoms typical of tospovirus infection. Only the inoculated leaves were positive for IYSV in DAS-ELISA and no systemic infection could be detected by serological or molecular detection.

There are no reports of natural infection of C. annuum by IYSV although C. annuum is a host for other tospoviruses such as Capsicum chlorosis virus (CaCV),

Chrysanthemum stem necrosis virus (CSNV), Groundnut bud necrosis virus (GBNV),

Impatiens necrotic spot virus (INSV), Tomato spotted wilt virus (TSWV), Tomato yellow ring spot virus (TYRV), Watermelon bud necrosis virus (WBNV), and

Watermelon silver mottle virus (WSMoV). Our studies showed that C. annuum could be experimentally infected with IYSV. In areas where IYSV is present, future surveys of C. annuum should include testing for IYSV.

Other experimental hosts A. thaliana COL 1, C. glomeratum, D. innooxia, D. ferox, N. tabacum, and S. melongena tested by mechanical inoculation did not exhibit any symptoms and were negative for IYSV when tested by DAS-ELISA (Table 2.1).

Differential response of IYSV isolates on indicator hosts

It was found that two experimental hosts, D. stramonium and N. benthamiana responded differentially to IYSV. D. stramonium is found to be a restrictive local lesion host and the virus is restricted to the inoculated leaves, whereas N. benthamiana is a systemic host, enabling the virus to move from the inoculated to uninoculated tissues of the plant. Various isolates from different geographical regions investigated for their response to both hosts. In D. stramonium, isolates from California (IYSV-CA), Idaho

(IYSV-ID), and Washington (IYSV-WA) were localized to the inoculated leaves and produced similar symptoms that included small necrotic spots uniformly spread throughout the leaves and spots which subsequently coalesced (Fig. 2.4).

In the systemic host, N. benthamiana, all three isolates showed similar symptoms as small chlorotic spots in inoculated leaves after 7-10 DPI, which gradually changed to necrotic spots, and caused veinal necrosis and stem necrosis in later stages of disease development (Fig. 2.5). However, the systemically infected apical leaves showed small necrotic spots 15 DPI in the case of IYSV-ID (Fig. 2.7a) and IYSV-WA (Fig. 2.7b), whereas systemic infection was delayed up to 20-24 DPI in the case of IYSV-CA (Fig.

2.7c).

The slower movement of IYSV-CA compared to IYSV-ID and IYSV-WA was confirmed by DAS-ELISA. Infected plants were kept under observation for further disease development and plants infected with IYSV-ID and IYSV-WA isolates (six out of six plants) were early senescence’s by 50 DPI due to severity of the disease (Fig. 2.7d); whereas plants infected with IYSV-CA, while systemically infected, survived up to 80-90

DPI (Fig. 2.7d). The difference in response of N. benthamiana to these isolates was consistent over time and repetitions.

DISCUSSION

Evolutionary studies of IYSV so far have been based on sequence analysis of the nucleocapsid protein (N) gene to determine genetic diversity (Bulajić et al., 2009; Gent et al., 2006; Nischwitz et al., 2007; Pappu et al., 2006; Smith et al., 2006) or on the serological reaction to antibodies generated against the N gene protein (de Avila et al.,

1993). Some viruses show similar symptoms in different hosts plants, and may even be similar to some physiological conditions which makes virus infection difficult to

identify. Bioassay is a useful procedure for identification, detection and propagation of plant viruses. Over the last few decades serological and molecular based laboratory techniques have become prominently used for virus identification, enabling high throughput of samples and providing rapid results. However, even with advancements of the diagnostic techniques, bio-assays still remain an indispensable tool. In this study, a tospovirus infecting mainly allium species such as IYSV was characterized based on bio-assays, on reaction of different indicator plants that shows characteristic symptoms.

Symptomatic tissues were collected from commercial onion fields from different geographical regions of the western USA and tested for the presence of the virus infection. Samples were subjected to serological analysis and positive samples were further characterized using molecular techniques, discusses in chapter III. During this study IYSV infection was found to be in most of the onion growing regions of the western USA. It was also reported for the first time from the states of Nevada and

Northern California (Bag et al., 2009 a). Apart from onion, IYSV was also found to infect the weeds under natural conditions, collected from surrounding the onion fields although numbers of weeds samples were earlier reported to be carrier of virus (Gent et al., 2006; Pappu et al., 2006; Sampangi et al., 2007). In the present study, Atriplex micrantha and Setaria viridis were found to be naturally infected with IYSV (Evans et al.,

2009 a&b). Additional garlic samples collected from commercial fields in Oregon were also found to be infected under natural conditions (Bag et al., 2009b). While garlic has been listed as a host for IYSV (Gent et al., 2006; Hafez et al., 2012) there have been no confirmed reports of its natural infection with IYSV in the USA. This study is the first confirmed report of IYSV infection of onion from Nevada, Northern California; garlic

from Oregon; twoscale saltbrush and green foxtail from Utah and wild onions (A. tuberosum, A. schoenoprasum and A. roylei) from New Mexico under natural conditions in the USA. Current findings also expand the list of Allium species that are susceptible to IYSV and underscores the need for continued screening of other members of the genus to find sources of resistance to IYSV. Additional surveys and testing are needed to obtain a better understanding of IYSV incidence these crops in order to evaluate its impact on garlic production.

Based on the results obtained from host range studies, C. quinoa, D. stramonium, N. benthamiana, and V. unguiculata could be useful as experimental hosts for biological studies of IYSV. D. stramonium, and N. benthamiana were further used for studies of the differential response of IYSV isolates to indicator hosts.

Biologically distinct isolates were reported for TSWV (Mandal et al., 2006); however no such information is available for IYSV with respect to the prevalence of strains that differ in pathogenicity. We report here the use of two indicator hosts in characterizing and describing biological differences in symptomatology of three naturally occurring isolates of IYSV. Reaction of three IYSV isolates from California, Idaho and Washington was compared following their transfer to D. stramonium (a local lesion host) and N. benthamiana (a systemic host). There was variation in the appearance of local lesions on the inoculated leaves and movement to younger uninoculated leaves among the isolates studied. Progression of local lesions leading to systemic infection in N. benthamiana had a significant effect on plant growth, and the length of plant survival was considered as an expression of the aggressiveness of isolates. Two isolates (IYSV-

WA and IYSV-ID) caused severe systemic necrotic infection with early senescence of the plants (Bag et al., 2012b). IYSV infection is known to cause diverse symptoms on onions under field conditions (Fig. 2.7), which may be due to existence of different strains.

Symptom expression is also affected by time of infection, age of plants, environmental and stress factors and difference in the genetic makeup of cultivars. Evaluating isolates for strain characterization under controlled environmental conditions would facilitate identification of strains that differ in their severity and virulence. We characterized three isolates that are biologically distinct based on differential response of indicator hosts N. benthamiana and D. stramonium. The IYSV-ID and IYSV-WA isolates were more severe/aggressive in virus movement and lethal to N. benthamiana plants compared to the IYSV-CA isolate. Based on the N gene sequence identity, these isolates were 97-99 % identical to one another at both the nucleotide and amino acid sequence levels. The role of the observed sequence differences in symptom modulation is not known. IYSV continues to be a major constraint to onion production in many onion- growing regions of the world. IYSV typically does not kill plants; however, the virus reduces plant vigor and bulb size, reducing seed yield and quality. Additionally, the virus weakens plants, making them more susceptible to other pests and diseases. Economic losses vary among the regions possibly due to differences in climate, vector thrips populations, onion cultivars and virus strains. Our findings suggest that IYSV does exist as biologically diverse isolates that differ in their pathogenicity based on the response of experimental hosts. It remains to be seen if IYSV isolates display similar differences upon infection of onion. Lack of reliable protocols for efficient infection of onion plants with IYSV is a constraint to carrying out such studies under controlled conditions.

Knowledge on the nature and prevalence of these isolates would aid in more effective screening of onion cultivars, breeding material and germplasm to identify and select for

IYSV resistance that is more durable and effective across onion production regions.

Table 2.1: List of samples collected from different geographical regions of the western

USA.

Species Location Symptoms Year of References collection Garlic Oregon (OR) Circular to near 2008 Bag et al., 2009 diamond shaped lesions Onion California (CA), Straw to white 2008-2011 Bag et al., 2009; 2012 Colorado (CO), colored chlorotic Idaho (ID), lesions, Nevada (NE), elongated to New Mexico (NM), diamond shaped Oregon (OR), with or without Washington (WA) green island Weeds Utah (UT) Spotting, 2008 Evans et al., 2009 a & chlorosis and b. necrosis Wild onion New Mexico (NM) Straw colored 2010 Cremer et al., 2011 necrotic lesion on leaves

Table 2.2. Symptoms of Iris yellow spot virus (IYSV) in various plant species in response to mechanical inoculation.

Days to Symptoms* symptom Response to DAS- Host appearance Local Systemic ELISA and RT-PCR 1 Arabidopsis − − − [-] thaliana COL 1 2 Capsicum annuum 7-10 CRS − inoculated leaves [+], systemic [-] 3 Cerastium − − − [-] glomeratum 4 Chenopodium 7-10 CRS − inoculated leaves [+], quinoa systemic [-] 5 Datura 10-12 CLL, DP [+] stramonium [30-45 days] 6 Datura innooxia − − − [-] 7 Datura ferox − − − [-] 8 Nicotiana 7-10 CLL CLL, VN, [+] benthamiana SN, DL, DP 9 Nicotiana tabacum − − − [-] 10 Solanum − − − [-] melongena 11 Vigna unguiculata 5-6 NS [+]

* Symptoms are abbreviated as: CLL = chlorotic local lesion, CRS = chlorotic ring spot, VN = veinal necrosis, SN = stem necrosis, NS = necrotic spot, DP = drying/death of plants, DL = drying of leaves.

Fig. 2.1 Symptoms associated with infection of Iris yellow spot virus in onion. Leaves showing spindle shaped necrotic lesion, diamond shaped lesions, lesions with green islands. Samples collected from the western USA, states of California, Idaho and Washington.

Fig. 2.2. Symptoms associated with infection of Iris yellow spot virus in garlic. Garlic stalk showing near-diamond shaped necrotic lesion, collected from commercial seeded crop in Marion County OR.

Fig. 2.3 a. Symptoms associated with infection of Iris yellow spot virus in foxtail. Leaves of green foxtail plants displayed a range of symptoms that included streaking, purpling, and chlorotic and necrotic lesions along leaf margins oriented along the axis of longitudinal venation were collected from Utah.

Fig 2.3 b. Symptoms associated with infection of Iris yellow spot virus in twoscale saltbrush. Leaves of displayed a range of symptoms including spotting, chlorosis, and necrosis were collected from Utah

Fig 2.4. Symptom development following inoculation by Iris yellow spot virus (IYSV) in local lesion host, Datura stramonium. a) IYSV-infected D. stramonium plant showing localized infection on inoculated leaves and absence of systemic symptoms in younger, uninoculated leaves. b) Disease progression following inoculation by IYSV in local lesion host, D. stramonium. Left to right: from 8 days to 40 days post-inoculation (DPI). Leaves finally drop off due to disease severity, but the virus remains localized to the inoculated leaves.

Fig.2.5. Symptom development and disease progression following inoculation by Iris yellow spot virus (IYSV) in systemic host Nicotiana benthamiana. Disease progression from 8 days to 50 days post-inoculation (DPI). The disease spread from inoculated leaves to younger, uninoculated leaves and buds, and the inoculated plant ultimately died 50 DPI.

Fig. 2.6 Symptoms on indicator hosts following mechanical inoculation with Iris yellow spot virus (IYSV): (a) symptoms on Vigna unguiculata showing diffused necrotic spots; (b) Capsicum annuum and (c) Chenopodium quinoa, both showing development of chlorotic ring spot.

Fig. 2.7 Comparison of various Iris yellow spot virus (IYSV) isolates based on the symptom development and disease progression during 9, 22, and 50 days post inoculation (DPI). IYSV-Idaho (IYSV-ID) and IYSV-Washington (IYSV-WA) isolates had a more severe phenotype 22 DPI compared to the mild isolate, IYSV-California (IYSV-CA). By 50 DPI, IYSV-ID and IYSV-WA isolates were lethal to the plants, whereas the plant infected with IYSV-CA was less severe.

REFERENCES

Bag S, Mitter N, Eid S, Pappu HR (2012a) Genetic complementation between two tospoviruses facilitates the systemic movement of a plant virus silencing suppressor in an otherwise restrictive host. PLOS ONE 7(10): e44803. doi:10.1371/journal.pone.0044803

Bag S, Schwartz HF, Pappu HR (2012b) Identification and virus characterization of biologically distinct of Iris yellow spot virus (genus Tospovirus, family Bunyaviridae), a serious pathogen of onion. European Journal of Plant Pathology 134:97-104.

Bag S, Pappu HR (2009) Symptomatology of Iris yellow spot virus in selected indicator hosts. Plant Health Progress Doi:10.1094/PHP-2009-0824-01-BR.

Bag S, Singh J, Davis RM, Chounet W, Pappu HR (2009a) Iris yellow spot virus in Nevada and Northern California. Plant Disease 93:674.

Bag S, Rogers P, Watson R, Pappu HR (2009b) First report of natural infection of garlic with Iris yellow spot virus in the United States. Plant Disease 93:839.

Bulajic A, Jovic J, Krnjajic S, Petrov M, Djekic I, Krstic B (2008) First report of Iris yellow spot virus on onion (Allium cepa) in Serbia. Plant Disease 92:1247.

Bulajic A, Djekic I, Jovic J, Krnjajic S, Vucurovic A, Krstic, B (2009) Incidence and distribution of Iris yellow spot virus on onion in Serbia. Plant Disease 93:976.

Cordoba-Selles C, Martınez-Priego L, Munoz-Gomez R, Jorda-Gutierrez C (2005) Iris yellow spot virus: a new onion disease in Spain. Plant Disease 89:1243.

Cordoba-Selles C, Cebrian-Mico C, Alfaro-Fernandez A (2007) First report of Iris yellow spot virus in commercial leek (Allium porrum) in Spain. Plant Disease 91:1365.

Cramer CS, Bag S, Schwartz HF, Pappu HR (2011) Susceptibility of onion relative (Allium spp) to Iris yellow spot virus. Plant Disease 95:1319.

de Avila AC, de Haan P, Kormelink R, Resende RO, Goldbach RW, Peters D (1993) Classification of tospoviruses based on phylogeny of nucleoprotein gene sequences. Journal of General Virology 74:153-159.

Evans CK, Bag S, Frank E, Reeve J, Ransom C, Drost D, Pappu HR (2009a) Green Foxtail (Setaria viridis), a naturally infected grass host of Iris yellow spot virus in Utah. Plant Disease 93:670.

Evans CK, Bag S, Frank E, Reeve J, Ransom C, Drost D, Pappu HR (2009b) Natural infection of Iris yellow spot virus in two scale saltbush (Atriplex micrantha) growing in Utah. Plant Disease 93:430.

Gawande SJ, Khar A, Lawande KE (2010) First Report of Iris yellow spot virus on Garlic in India. Plant Disease 94:1066.

Gent DH, Du Toit LJ, Fichtner SF, Krishna Mohan S, Pappu HR, Schwartz HF (2006) Iris yellow spot virus: an emerging threat to onion bulb and seed production. Plant Disease 90:1468-1480.

Hafez EE, Abdelkhalek AA, El-Morsi AA, El-Shahaby OA (2012) First report of Iris yellow spot virus infection of garlic and Egyptian leek in Egypt. Plant Disease 96:594.

Hall JM, Mohan K, Knott EA, Moyer JW (1993) Tospoviruses associated with scape blight of onion (Allium cepa) seed crops in Idaho. Plant Disease 77:952.

Hoepting CA, Fuchs MF (2012) First report of Iris yellow spot virus infecting onion in Pennsylvania. Plant Disease 96:1229.

Huchette O, Bellamy C, Filomenko R, Pouleau B, Seddas S, Pappu HR (2008) Iris yellow spot virus on shallot and onion in France. Plant Health Progress Doi:10.1094/PHP-2008-0610-01-BR.

Kritzman A, Lampel M, Raccah B, Gera A (2001) Distribution and transmission of Iris yellow spot virus. Plant Disease 85:838-842.

Kunkalikar SR, Poojari S, Arun BM, Rajagopalan PA, Chen TC, Yeh SD, Naidu RA, Zehr UB, Ravi KS (2011) Importance and genetic diversity of vegetable-infecting Tospoviruses in India. Phytopathology 101:367-376.

Leinhos G, Müller, J, Heupel, M, Krauthausen HJ (2007) Iris yellow spot virus an Bund- und Speisezwiebeln-erster Nachweis in Deutschland. Nachrichtenbl. Deut. Pflanzenschutzd. 59:310-312.

Lobin K, Saison A, Hostachy B, Benimadhu SP, Pappu HR (2010) First report of Iris yellow spot virus in onion in Mauritius. Plant Disease 94:1373.

Mandal B, Jain RK, Krishnareddy M, Krishna Kumar NK, Ravi KS, Pappu HR (2012). Emerging problems of Tospoviruses (Bunyaviridae) and their management in the Indian Subcontinent. Plant Disease 96:468-479.

Mandal B, Pappu HR, Csinos AS, Culbreath AK (2006). Response of peanut, pepper, tobacco, and tomato cultivars to two biologically distinct isolates of Tomato spotted wilt virus. Plant Disease 90:1150-1155.

Mumford RA, Glover R, Daly M, Nixon T, Harju V, Skelton A (2008). Iris yellow spot virus (IYSV) infecting Lisianthus (Eustoma grandiflorum) in the UK: first finding and detection by real-time PCR. New Disease Reports 16:6.

Nischwitz C, Pappu HR, Mullis SW, Sparks AN, Langston DR, Csinos AS, Gitaitis RD (2007) Phylogenetic analysis of Iris yellow spot virus isolates from onion (Allium cepa) in Georgia and Peru. Journal of Phytopathology 155:531-535.

Pappu HR, Jones RA, Jain RK (2009) Global status of tospovirus epidemics in diverse cropping systems: Successes achieved and challenges ahead. Virus Research 141:219-236.

Pappu HR, Du Toit LJ, Schwartz HF, Mohan SK (2006) Sequence diversity of the nucleoprotein gene of Iris yellow spot virus (genus Tospovirus, family Bunyaviridae) isolates from the western region of the United States. Archives of Virology 151:1015-1023.

Pozzer L, Bezerra IC, Kormelink R, Prins M, Peters D, Resende RDeO, De Ávila AC (1999) Characterization of a tospovirus isolate of Iris yellow spot virus associated with a disease in onion fields in Brazil. Plant Disease 83:345-350.

Sampangi RK, Mohan SK, Pappu HR (2007) Identification of new alternative weed hosts for Iris yellow spot virus in the Pacific Northwest. Plant Disease 91:1683.

Smith TN, Wylie SJ, Coutts BA, Jones RCA (2006) Localized distribution of Iris yellow spot virus within leeks and its reliable large-scale detection. Plant Disease 90:729-733. 47

Srinivasan R, Sundaraj S, Pappu HR, Diffie S, Riley D, Gitaitis R (2012) Transmission of Iris yellow spot virus by Frankliniella fusca and Thrips tabaci (Thysanoptera: Thripidae). Journal of Economic Entomology 105:40-47.

Tomassoli L, Tiberini A, Masenga V, Vicchi V, Turina M (2009) Characterization of Iris yellow spot virus isolates from onion crops in northern Italy. Journal of Plant Pathology 91:733-739.

Trkulja V, Mihić Salapura J, Kovačić D, Stanković I, Bulajić A, Vučurović A, Krstić B (2013) First report of Iris yellow spot virus infecting onion in Bosnia and Herzegovina. Plant disease 97:430.

CHAPTER THREE

MOLECULAR CHARACTERIZATION OF IRIS YELLOW SPOT VIRUS

INFECTING ONION BULB AND SEED CROPS FROM

THE WESTERN USA

Modified version of this chapter was published as:

1. Bag, S., K.L.Druffel, and H.R.Pappu. 2010. Archives of Virology, 155:275-279.

2. Bag, S., K.L.Druffel, T. Salewsky, and H.R.Pappu. 2009. Archives of Virology,

154:715-718.

ABSTRACT

Iris yellow spot virus (IYSV) of the genus Tospovirus family Bunyaviridae causes a serious disease in onion in the USA and other parts of the world. In spite of its economic importance, the complete genomic sequence of IYSV from the USA was not available. IYSV is presumed to share the genomic features of other tospoviruses: a segmented RNA genome of three RNAs referred to as large (L), medium (M), and small

(S). The L RNA is in the negative sense, and the M and S RNAs are ambisense in their genome organization.

The sequence analysis showed IYSV L RNA was 8,880 nucleotides in length and contained a single open reading frame (ORF) in the viral complementary (vc) strand.

The primary translation product of 331.17 kDa shared many of the features of the viral

RNA-dependent RNA polymerase (RdRp) coded by L RNAs of known tospoviruses. The

5’ and 3’ termini of IYSV L RNA (vc) contained two untranslated regions of 33 and 226

nucleotides, respectively, and both termini had conserved terminal nucleotides, another common feature of tospovirus genomic RNAs. Conserved motifs characteristic of RdRps of members of the family Bunyaviridae were present in the IYSV RdRp.

The genome structure and organization of the medium (M) RNA of IYSV showed that the M RNA was 4,817 nucleotides long and potentially coded for the movement protein (NSm) in the viral (v) sense and the glycoprotein precursor (Gn and Gc) in the viral complementary (vc) sense. The predicted sizes of NSm and Gn/Gc precursor were

34.7 and 128.84 kDa, respectively. The two open reading frames were separated by a

380 nucleotide intergenic region. Phylogenetic analysis of the NSm and Gn/Gc genes from the Washington (WA) isolate showed grouping that reflected their respective serogroups.

The S RNA codes for two proteins in ambisense orientation, non-structural protein (NSs) in v-sense and nucleocapsid coat protein (N) protein in vc-sense. Isolates from the western USA were collected and characterize based on complete N gene sequences. Sequence analysis of the US isolates with other isolates available with

GenBank showed clear distinction between American and Eurasian isolates.

INTRODUCTION

The family Bunyaviridae consists of arthropod-borne RNA viruses (Elliot 1990,

Nichol et al., 2005) and members of all but one genus in this family infect humans or mammals. The genus Tospovirus is the only one in this family whose members infect plants. The genus name is derived from its type species, Tomato spotted wilt virus

(TSWV). Tospoviruses are transmitted by thrips in a circulative and propagative manner

(Whitefield et al., 2005), and virions consist of membrane-bound spherical virus particles (80-100 nm) that encapsidate a tripartite genome of single-stranded RNA molecules, small (S), medium (M), and large (L) (Fig. 3.1). The L RNA codes for the

RNA-dependent RNA polymerase (RdRp) in the virion-complementary (vc) sense (de

Haan et al., 1991). The M and S RNAs are ambisense in their genome organization, and each encodes two proteins (Adkins 2000; Cortes et al., 2002; Moyer 1999; Nichol et al.,

2005; Pappu 2008; Tsompana and Moyer 2008). The genus Tospovirus currently includes eight assigned and eight tentative species (Nichol et al., 2005; Lin et al., 2005):

Groundnut bud necrosis virus (GBNV) (Reddy et al., 1992), Groundnut ringspot virus

(GRSV) (de Avila et al., 1993), Impatiens necrotic spot virus (INSV) (Law et al., 1991),

Peanut yellow spot virus (PYSV) (Satyanarayana et al.,1998), Tomato chlorotic spot virus (TCSV) (de Avila et al., 1993), Tomato spotted wilt virus (TSWV) (Brittlebank

1919), Watermelon silver mottle virus (WSMoV) (Yeh 1995), Zucchini lethal chlorosis virus (ZLCV) (Bezerra et al., 1999), Bean necrosis mosaic virus (de Oliveira et al., 2012),

Callalily chlorotic spot virus (CCSV) (Chen et al., 2005; Lin et al., 2005), Capsicum

chlorosis virus (CaCV) (McMichael et al., 2002; Knierim et al., 2006), Chrysanthemum stem necrosis virus (CSNV) (Bezerra et al., 1999), Iris yellow spot virus (IYSV) (Cortez et al., 1998), Melon yellow spot virus (MYSV) (Kato et al., 2000), Peanut chlorotic fan- spot virus (PCFV) (Chen and Chiu 1996; Chu et al., 2001), Soybean vain necrosis virus

(SVNV) (Zhou et al., 2011), Tomato yellow fruit ring virus (TYFRV) (Winter et al., 2006)

[synonym: Tomato yellow ring virus (TYRV] (Hassani et al., 2005), Tomato zonate spot virus (TZSV) (Dong et al., 2008), and Watermelon bud necrosis virus (WBNV) (Jain et al., 1998). Of these 19 known tospoviruses, complete genomic sequence information is available for few tospoviruses as BNMV, CaCV, GBNV, INSV, MYSV, SVNV, TSWV,

TZSV, and WSMoV.

Iris yellow spot virus (IYSV), is a tentative species in the genus Tospovirus, is the most economically important virus of onion in the US and several parts of the world

(Gent et al., 2006; Pappu et al., 2009). IYSV is transmitted by onion thrips (Thrips tabaci L.) (Kritzman et al., 2001; Nagata et al., 1999). Genomic sequences of S RNA

(AF001387) of IYSV are known. However, despite its economic importance, the complete genomic sequence of IYSV L and M RNA is not available from the USA sources. The only reports on the genome structure and organization of IYSV M RNA were from Brazil (Silva et al., 2001) and The Netherlands (Cortes et al., 2002). The present study was undertaken to determine the complete sequence of the M RNA and L

RNA of an onion isolate of IYSV collected from the western USA, a region that has been experiencing severe outbreaks of the virus in both bulb and seed onion crops, and to conduct comparative sequence analyses based on the genes encoded with those of other known tospoviruses.

MATERIALS AND METHODS

IYSV Infected Samples

The IYSV isolates were collected from a commercial onion crops grown in

Washington and Arizona states of the USA. The virus isolates were maintained in

N.benthamiana in growth chamber and greenhouse under controlled conditions

(25/18 °C day/night cycle). Virus infection was confirmed using a commercially available double antibody sandwich (DAS)-ELISA kit (Agdia Inc., Elkhart IN, USA;

Catalogue Number: CAB 60500 and ECA 60500). To verify IYSV infection, total nucleic acid extracts from the symptomatic parts of the leaves were prepared using plant

RNeasy mini kit (Qiagen, CA, USA) and tested for the presence of IYSV by reverse transcription (RT)-PCR with gene specific primers (table 3.1) that flank the nucleocapsid (N) gene coded by the small RNA of IYSV. An approximate 1.1-kb amplicon was obtained from all symptomatic plants and cloned pGEM-T Easy PCR cloning vector (Promaga, Madison WI, USA) and sequenced (Sequencing facility, WSU,

Pullman WA, USA).

Cloning and Sequencing of L RNA

Total nucleic acid was extracted using a RNeasy Plant Mini kit (Qiagen,

Chatsworth CA USA; Catalogue No. 74904) according to the manufacturer’s instructions. The primers used for amplification of cDNA fragments corresponding to the L RNA segment are presented in table 3.1. The viral genomic sequences were

amplified using two step reverse RT-PCR. cDNA copies of the L RNA were synthesized using Superscript II RT (Invitrogen, Carlsbad CA, USA; Catalogue No.11904) at 42°C with vc-sense strand-specific primers designed from conserved regions from an alignment of known tospovirus L RNA sequences available in GenBank. The first few terminal nucleotides of all tospovirus sequences are conserved, facilitating the design of the primers that could be used to amplify fragments from both the 5’ and 3’ ends.

Subsequently, for amplifying the remaining region of the L RNA, primers were designed from known tospovirus sequences in GenBank. Overlapping fragments of 583, 1812,

2022, 652, 1812, 2952 nucleotides were amplified and cloned into the pGEM-T Easy

PCR cloning vector as per the manufacturer’s instructions. Two recombinant clones of each fragment were sequenced at the sequencing facility of Washington State University

(WSU), Pullman WA, USA.

Cloning and Sequencing of M RNA

To clone the M RNA, total plant RNA was extracted from IYSV-infected onion tissue using the RNeasy Plant Mini kit (Qiagen). A total of three sets of primers (Table

3.1) that would provide overlapping amplicons were initially designed using the M RNA sequences available in GenBank. Following RT-PCR, the resulting overlapping amplicons were cloned into TOPO-TA cloning vector (Invitrogen). Recombinant clones were identified using standard molecular biology techniques, and plasmid DNA templates were sequenced at the sequencing facility of WSU, Pullman WA, USA. At least three clones for each fragment were sequenced for each of the amplicons. From the

overlapping clones, the complete sequence was assembled by using Vector NTI

(Invitrogen).

Cloning and Sequencing of Nucleocapsid (N) gene

Samples showing symptoms similar to IYSV were collected for biological characterizations (described in chapter 2) from different commercial and research onion fields in the western USA. The samples that tested positive for IYSV by ELISA using a commercially available kit (Agdia) as described in chapter 2 were further used as a source for cloning and sequencing. Total nucleic acid extracts from the symptomatic parts of the leaves were prepared and tested for the presence of IYSV using RT-PCR with primers specific to the small (S) RNA of IYSV (Table 3.1). The primer pair flanks the nucleocapsid (N) gene of IYSV. An amplicon of expected size (~1100 bp) was cloned and sequenced at the sequenced.

Sequence Analysis

Pair-wise and multiple alignments with tospovirus L and M RNA and N gene sequences available in GenBank were done using CLUSTAL X (Thompson et al., 1997)

BioEdit (Ibis Biosciences, Carlsbad CA) and Mega 5 (Tamura et al., 2011). Cluster dendrograms were constructed using the full optimal alignment and neighbor-joining method options with 1,000 bootstrap replications available in Mega 5 and TreeView

(Page, 1996). Potential M RNA-encoded peptide cleavage sites, transmembrane domains and N-and O-linked glycosylation sites were predicted using SignalP 3.0

(Bendtsen et al., 2004), TMHMM Server v. 2.0 (Krogh et al., 2001), NetNGlyc 1.0 server

(http://www.cbs.dtu.dk/services/NetNGlyc/) and the NetOGlyc3.1 Server (Julenius et al., 2005) respectively.

RESULTS

L RNA

The L RNA of IYSV was 8,880 nt in length, with 37.53% A, 15.40% C, 18.36% G and 28.71% T. The size was similar to those of other known tospoviruses (Table 3.2).

The 5’ and 3’termini of IYSV L RNA were also conserved; the eight nucleotides at the 5’ terminus (5’-AGAGCAAT-3’) were reverse complementary to the 3’ end (5’-TCTCGTTA-

3’), a feature shared with other tospoviruses RNAs (Nichol et al., 2005; Kato et al.,

2000; Chu et al., 2001). These reverse complementary ends lead to non-covalently closed, pseudo-circularized RNAs (panhandle structures) that, are encapsidated by the

N protein and packaged together with the RdRp into quasi-spherical enveloped particles

(Nichol et al., 2005). The tospovirus L RNAs, including those of IYSV, are substantially longer than those of animal infecting members of the Bunyaviridae, which range from

6,404 to 6,680 nt. The L RNA of IYSV contained a single open reading frame (ORF) in the vc-sense strand starting with an ATG at position 34 and terminating at a TGA stop codon at position 8,655 nt. The ORF coded for a protein of 2,873 amino acids with a predicted molecular mass of 331.17 kDa. The deduced amino acid sequence of the ORF was similar in size to those encoded by known tospovirus L RNAs. No other reading frame in the v- or vc-sense contained ORFs of significant size. Thus, the L RNA of IYSV

appears to function as a negative-sense RNA. The deduced amino acid sequence seemed to be that of the viral RdRp protein based on its similarity to known tospovirus RdRp sequences. Additionally, the presence of the characteristic signature sequences in the core polymerase region that were similar to RdRps of viruses in the family

Bunyaviridae, such as DxxKWS (Motif A); QGxxxYxSS (Motif B); SDD (Motif C); K

(Motif D); and EFxSE (Motif E), (de Haan et al., 1991; Knierim et al., 2006; Dong et al.,

2008; Gowda et al., 1998; Bruenn 2003), were also present in the IYSV RdRp (Fig. 3.2 ).

Furthermore, three motifs, TDF (Motif F1), KxQRTK (Motif F2) and DREIY (Motif F3) that are found in the RdRp of CaCV (Knierim et al., 2006) were also found in the IYSV

RdRp (Fig.3.2 ).

The deduced viral RdRp protein of IYSV was compared with those of known tospovirus RdRps. The degree of conservation varied among various tospoviruses (Table

3.2). The lowest level of identity was observed near the termini of the protein sequence, whereas the core polymerase region shared the highest level of identity. Pair wise alignment showed that the predicted RdRp protein sequence had a sequence similarity of 42% with BNMV and SVNV, 45% with TSWV and INSV, 46% with the recombinant genome of GRSV+TCSV, 65% with TZSV, 67% with GBNV, 68% with CaCV, MYSV,

WSMoV, and (Table 2). Sequence relationships showed that the RdRp of IYSV is more closely related to those of the Eurasian group of tospoviruses (Fig. 3.3) forming a closed clad with Eurasian isolates.

M RNA

The M RNA was 4,821 nucleotides long with 32.90 % (A); 17.57 % (C); 16.26 %

(G); and 33.27% (T). Sequence analysis revealed two non-overlapping ORF with an ambisense arrangement. The smaller ORF of 935 nucleotides was located at the 5’ end of the v-sense strand, potentially encoding a 311-amino-acid protein with a predicted molecular mass of 34.7 kDa. The deduced amino acid sequence of this ORF showed the highest sequence identity with the non-structural protein (NSm) of an IYSV isolate from

Brazil and The Netherlands and thus appeared to be the NSm protein. The larger ORF of

3,410 nt was located at the 5’ end of the vc-strand, potentially encoding a 1,136-amino acid protein with a predicted molecular mass of 128.84 kDa assumed to be the glycoprotein precursor (Gn/Gc) based on the sequence comparison with known tospovirus Gn/Gc gene sequences (Fig. 3.4). The two ORFs were separated by an intergenic region (IGR) of 395 nucleotides. IYSV-WA IGR was 15 nt longer than those reported for The Netherlands isolate and shared 69% identity at the nucleotide level.

The ORF coding for the NSm started at nucleotide position 64 and terminated at nucleotide position 999. Analysis of the amino acid sequence did not reveal any hydrophobic regions that might function as signal or transmembrane spanning segments. There were three N-glycosylation sites predicted in the IYSV-WA isolate as compared to six in other tospoviruses. At the nucleotide level, the NSm gene of IYSV-

WA isolate was 97% identical to both IYSV-The Netherlands and IYSV-Brazil isolates, whereas it shared 73-76% identity with the corresponding region of other known

tospoviruses. The amino acid sequence of the NSm protein shared 94 and 95% identity with the isolates from The Netherlands and Brazil, respectively, while it shared 33-68% identity to NSm protein of other tospoviruses. A cluster dendrogram based on the amino acid sequences of NSm of known tospoviruses showed the formation of two major clusters: IYSV isolates formed a close cluster with CaCV, GBNV, MYSV, WSMoV and

TZSV. The second cluster consisted of CSNV, GRSV, INSV, TCSV, TSWV, and ZLCV, forming a clear distinction from the IYSV cluster (Fig. 3.5). The Gn/Gc ORF in the vc strand of IYSV M-RNA was from nucleotide 1,394 to 4,804 (numbered from the 5’ end of viral RNA), was 3,410 nucleotide in length, potentially coding for a 1,136-amino-acid protein. Comparison of the nucleotide sequence of the IYSV Gn/Gc ORF with that of other tospoviruses revealed that it is 69% identical to IYSV-The Netherlands. In contrast, the sequence identity with other tospoviruses ranged from 53 to 74%.

Similarly, at the amino acid level, it shared 92% identity with IYSV-The Netherlands and

33-to-61% with other tospoviruses. The protein domain prediction showed that the topology of the Gn/Gc precursor is similar to that of other tospoviruses. The Gn/Gc precursor of IYSV-WA possessed two putative peptide cleavage sites located at the N- terminus and five transmembrane domains and seven putative N-glycosylation sites as compared to five in The Netherlands isolate. The IYSV-USA isolate’s Gn/Gc precursor had two O-glycosylation sites as compared to five in the case of The Netherlands isolate and other tospoviruses (Whitfield et al., 2005; Law et al., 1991). The dendrogram based on the Gn/Gc ORF showed clustering similar to the one based on NSm (Fig. 3.6). Some major differences were also observed in the topology of Gn/Gc of IYSV and other

tospoviruses, which are considered to be transmission determinants. The effect of these differences on thrips transmission remain to be seen.

The IGR of the IYSV-WA isolate shared 69% sequence identity with that of the isolate from The Netherlands. IGRs of S and M-RNAs of tospoviruses were found to be useful markers for classifying tospoviruses at the species level (Pappu et al., 2000).

However, some differences were observed in terms of the length and sequence identity of the IGR among IYSV isolates. A definite biological function is yet to be established for

IGRs.

S RNA

Samples collected from the western USA under this study were maintained in indicator hosts N.benthamiana for biological (discussed in chapter 2), and molecular characterization using N gene sequence. The N gene encoded by S RNA was amplified using specific primers (Table 3.1) and cloned in TA cloning vector for further sequencing. The 1.1kb amplicon coded for a single ORF potentially encoding N protein of approximately 32 kDa. Based on these biological and molecular studies of isolates collected, isolates from northern CA, NV and NM (Bag et al., 2009 a; Cramer et al.,

2011), garlic from OR (Bag et al., 2009 b), weeds samples from UT (Evans et al., 2009 a,

& b) were reported to be naturally infected based on the N gene sequence.

To further analyze the N gene diversity within the isolates from the western USA, the sequences were compared with rest of the isolates reported from the USA and other

part of the world, using MEGA 5 software. The isolates from the USA formed a major clade with other ‘American’ isolates different from the ‘Eurasian’ isolates (Fig. 3.7).

Total 186 complete and partial sequences of IYSV isolates were reported from all over the world. These sequences were used for the formation of an uprooted tree. The N gene clearly differentiates the USA isolates from the reminder of the world forming a separate

‘American’ clade distinct from the ‘Eurasian’ isolates (Fig. 3.7).

DISCUSSION

Thrips transmitted IYSV, first described in late 1980s from iris, was later found to infect bulb and seed onion crops in Brazil, Israel and the USA (Gent et al., 2006; Pappu et al., 2009). In the USA, the virus was largely confined till 2000 to a relatively small geographical area in southwestern Idaho and southeastern Oregon known as Treasure

Island. However, due to factors unknown, the virus spread rapidly to other parts of the country since 2002 and began to cause serious economic losses to both seed and bulb crops. Total crop losses were reported in the Columbia Basin of Washington State. The virus infects primarily Alliums species such as onion, garlic, and leek. New reports of

IYSV began to emerge from all onion growing regions. These reports are mainly based on the serological and molecular analysis of the infected tissues targeting the nucleocapsid protein. Although, IYSV was reported from most of the onion growing regions of the world, complete genome sequence of all the three RNA segments was not reported earlier. Here we attempted to sequence the complete large (L) and medium

(M) segments of IYSV isolate from the western USA, and to further characterize the

virus based on the nucleocapsid protein gene from the western USA. Based on N gene protein, the isolates from the western USA formed a close cluster with the other reported isolates from the American continents, distinct from the European and Asian isolates. Recently, Krauthausen et al., (2012), reported close evolutionary relation among 46 German isolates, also within that four isolates shows some genetic diversity.

For an evolution study of tospoviruses, RdRp encoded by L RNA was considered as the hallmark gene and an excellent predictor of tospovirus phylogeny. Due to a lack of a significant number of completely sequenced tospoviruses, the nucleoprotein (N) encoded by S RNA segment was also used for phylogenic placement of IYSV isolates reported from the western USA. When different proteins encoded by IYSV were compared with the other reported tospoviruses, a similar clustering was also observed

(Knierin et al., 2006; Dong et al., 2008; Bag et al., 2009; Saritha and Jain 2007). IYSV formed a close association with the Eurasian group, whereas the other tospovirus reported from the USA such as GRSV, INSV, SVNV, and TSWV formed a different clade.

The ‘American’ and ‘Eurasian’ groups were distinguished on the basis of differences in their geographical prevalence, N and NSm protein sequences (Silva et al.,

2001), and 3’UTR length of the M RNA (Lovato et al., 2004). The tospoviruses CaCV

(Thailand), GBNV (India), MYSV (Japan), WSMoV (Taiwan), and TZSV (China), all seem to have their origins in Asia or Central Asia were grouped as Eurasian, whereas

INSV and TSWV formed a different cluster as American (Dong et al., 2008; Knierim et al., 2006). Recently, Oliveira et al., (2012) and Zhou et al., (2011) reported that SVNV

and BNMV formed a new distinct clade intermediate between the Eurasian and

American populations.

Tospoviruses causes significant loss to agricultural industries, engaged in food, oilseeds, vegetable, ornamental or seeds crops. Some members of tospoviruses such as

TSWV and INSV cause infection in both dicot as well as monocot causing 100% of crop loss. Onion is a high value crop in PNW, and IYSV is a major concern of economic crop loss in the region because it not only reduces the marketable price of onion bulb by reduced size but also cause 100% crop loss for the onion seed industry (Pozzer et al.,

1999). International trade of alliums and other cultivated crops combined with the advancement in the diagnostic technologies might have contributed to the increased number of reports of IYSV incidence from various parts of the world. The potential socio-economic impact of IYSV on alliums in these regions remains to be seen.

Table 3.1: Primers used for the amplification of the large (L) and Medium (M) RNA of Iris yellow spot virus (IYSV).

Primer pair Sequence (5′-3′) ** Amplicon size

IYSV-L RNA 1F AGAGCAATCGTGCAACAA 583 bp IYSV-LRNA 583C ACTTTCCARTCATATATCATCA IYSV-L RNA 562F TGATGATATATGATTGGAAAGT 1812 bp IYSV-L RNA 2374C CCATCTCCTTTGAATGC IYSV-L RNA 2178F TTGATTGAAACTGAAGTTAACA 2022 bp IYSV-L RNA 4200C ACTGGGTTCATTAGAACAGC IYSV-L RNA 3837F TCATCRGARTGBACMATCCATCT 688 bp IYSV-L RNA 4525C CCTTTAACAGTDGAAACAT IYSV-L RNA 4319 F GGATCTTATGGAACTGCAAT 1842 bp IYSV-L RNA 6161C GTATATTAAATATCTGTCATA IYSV-L RNA 5927F GGATTGAAAAGAATGCCG 2952 bp IYSV-L RNA 8879C TTCATKATATCATGYTCTTCWCC IYSV-M RNA 5F CAATCGGTGCAGCAATCAA 2005 bp IYSV-M RNA 2010C CAAGAGTCACTTGTTCTGGGTGTA IYSV-M RNA 1796F TTCTGGGACAACTTTAATGG 2205 bp IYSV-M RNA 4001C TGACGAACTAGATGGCAACC IYSV-M RNA 3790F CATTTTTTGTCTTCCAAAGT 1016 bp IYSV-M RNA 4806C CAAACAATCAGCCTAAGATG IYSV-N-F CTCTTAAACACATTTAACAAGCA 1100bp IYSV-N-R TAAAACAAACATTCAAACAA

** R- A/G; B- C/G/T; M- A/C; K- G/T; Y-C/T; W-A/T

Table 3.2: Comparison of the large (L) RNA and the encoded RNA-dependent RNA polymerase (RdRp) of Iris yellow spot virus with the corresponding gene and protein sequences of known tospoviruses. Virus acronyms are explained in the text.

Virus Genbank L RNA RdRp Protein accession number Nt % Length % % length identity (aa) identity identity (nt) (nt) (aa) IYSV FJ623474 8880 100 2873 100 100 CaCV DQ256124 8912 34 2877 79 68 GBNV AF025538 8911 68 2877 79 67 INSV DQ425094 8780 34 2865 62 45 MYSV AB061774 8918 34 2870 79 68 TSWV AB198742 8913 33 2879 62 45 TZSV EF552435 8919 34 2885 77 65

WSMoV AF133128 8917 67 2878 79 68

RdRp Translation

Replication

vcRNA 5’ L RNA

N GnGc Translation Translation

Transcription Transcription 5’ 3’ vRNA 5’ 3’ vRNA

Replication Replication 3’ 3’ 5’ vcRNA 5’ vcRNA

Transcription Transcription

Translation Translation M RNA

S RNA NSm NSs

Fig. 3.1: Schematic representation of genome organization and replication strategy of Tospoviruses, showing the three RNAs: Large (L), Medium (M) and Small (S). The rectangular box shows the protein coded.

Motif A Motif B Motif C

1376………………1389 1463…………………………………1483 1501……1510 INSV LSADQSKWSASDLT MNWLQGNLNYLSSVYHSCAMK WIVHSDDNAT TSWV LSADQSKWSASDLT MNWLQGNLNYLSSVYHSCAMK WIVHSDDNAT GBNV LSADQSKWSASDLT MNWLQGNLNYLSSVYHSCAMM WMVHSDDNAT WSMoV LSADQSKWSASDLT MNWLQGNLNYLSSVYHSCAMI WMVHSDDNAT CaCV LSADQSKWSASDLT MNWLQGNLNYLSSVYHSCAMM WMVHSDDNAT TZSV LSADQSKWSASDLT MNWLQGNLNYLSSVYHSCAMM WMVHSDDNAT MYSV LSADQSKWSASDLT MNWLQGNLNYLSSVYHSCAML WMVHSDDNAT IYSV LSADQSKWSASDLT MNWLQGNLNYLSSVYHSCAML WMVHSDDNAT Uukuniemi TSDDAAKWN-QCHH TGMMQGILHYTSSLLHTLLQE VLQSSDDSGM RVFV TSDDARKWN-QGHF TGMMQGILHYTSSLLHTIHQE MMQGSDDSSM RSV TSDDASKWN-QGHY TGMMQGILHYTSSLFHAIFLD NMESSDDSSF Bunyamwera INADMSKWSAQDVF RNWLQGNFNYISSYVHSCAML SMVHSDDNQT Hanta VSADATKWSPGDNS GNWLQGNLNKCSSLFGVAMSL FAHHSDDALF Consensus Tospovirus DXXKWSXQXL QGXXXYXSSVYHS SDD Consensus Bunyaviridae DXXKWSXSXH QGXXXYXSSLLHS SDD

Motif D Motif E Motif F1 Motif F2 Motif F3 1545………1555 1558…………1570 1285…………………………….. ..1311 INSV FCITLNPKKSY SSEVEFISERIVN ASDAIDFLVSVFEKMQRTKTDREIYLM TSWV FCITLNPKKSY SSEVEFISERIVN VTGSVDFLVSVFEKMQRTKTDREIYLM GBNV YCITLNPKKSY ESEVEFISERIIN NAGNTDFLVSVFEKMQRTKMDREIYLM WSMoV YCITLNPKKSY ESEVEFISERIIN NAGNTDFLVSVFEKMQRTKMDREIYLM CaCV YCITLNPKKSY ESEVEFISERIIN NAGNTDFLVSVFEKMQRTKMDREIYLM TZSV YCITLNPKKSY ESEVEFISERIIN NAGNTDFLVSVFEKMQRTKMDREIYLM MYSV YCITLNPKKSY ESEVEFISERIIN NAGNTNFLVSVFEKMQRTKMDREIYLM IYSV YCITLNPKKSY ESEVEFISERIIN NAGNTDFLVSVFEKMQRTKMDREIYLM Uukuniemi LGIYSSVKSTN LHLLEFNSEFFFH VESQGCMHVCLFKKPQHGG-LREIYVL RVFV LAIYPSEKSTA DFVMEYNSEFYFH IESQGCMHICLFKKQQHGG-LREIYVM RSV LGIYKSPKSTT LFVMEFNSEFFFS LNKNECMHICIFKKNQHGG-LREIYVL Bunyamwera CQANMNMKKTY HTCKEFVSLFNLH MKNHKEFSFTFFNKGQKTAKDREIFVG Hanta GSIKISPKKTT PTNAEFLSTFFEG ETREQKAMARIVRKYQRTEADRGFFIT Consensus Tospovirus TXXXK EFXSE TDF KMQRTKXDREIY Consensus Bunyaviridae YXXXK EFXSE KEX KXQRTGXDREIY

Fig. 3.2: Conserved motifs in RNA-dependent RNA polymerase (RdRp) of members of the family Bunyaviridae. The Bunyaviridae and the tospovirus consensus sequences are shown. RdRps were from phlebovirus Uukuniemi virus (Uukuniemi, D10759), the tenuivirus Rice stripe virus (RSV, D31879), the bunyavirus Bunyamwera virus (Bunyamwera, X14383), the hantavirus Hantaan virus (Hanta, X55901) and the phlebovirus Rift Valley fever virus (RVFV, X564664). The source and abbreviations of tospoviruses are given in the text.

GBNV WSMoV MYSV

CaCV 972

1000

TZSV 1000 IYSV

Eurasian group

American group

1000

TSWV INSV

0.1

Fig. 3.3: Phylogenetic tree based on the deduced amino acid sequence of the RNA- dependent RNA polymerase (RdRp) protein. Bootstrap values on the branches represent the number out of 1,000 bootstrap replicates. The source and abbreviations of tospoviruses are given in the text.

Fig.3.4: Schematic representation of amplicons generated for cDNA cloning and sequence determination of Iris yellow spot virus medium RNA. The arrows indicate the position and direction of various primers (Table 2.1) used. Boxes show the open reading frame encoded by M RNA and its similarity with the other reported IYSV isolates from the Netherland and Brazil.

Fig. 3.5: Clustal dendrogram showing the relationship of Iris yellow spot virus (IYSV) to representatives of other species within the genus Tospovirus based on the amino acid sequence of the non-structural protein NSm.

Fig. 3.6: Clustal dendrogram showing the relationship of Iris yellow spot virus (IYSV) to representatives of other species within the genus Tospovirus based on the amino acid sequence of the glycoprotein precursor.

Fig. 3.7: Unrooted clustal dendrogram showing the relationship of Iris yellow spot virus (IYSV) isolates reported around the world based on the complete and partial nucleocapsid (N) protein gene.

REFERENCES

Adkins S (2000) Tomato spotted wilt virus-positive steps towards negative success. Molecular Plant Pathology 1:151-157.

Bag S, Druffel KL, Salewsky T, Pappu HR (2009) Nucleotide sequence and genome organization of the medium RNA of Iris yellow spot virus (genus Tospovirus, family Bunyaviridae) from the Unites States. Archives of Virology 154:715-718.

Bag S, Singh J, Davis RM, Chounet W, Pappu HR (2009a) Iris yellow spot virus in Nevada and Northern California. Plant Disease 93:674.

Bag S, Rogers P, Watson R, Pappu HR (2009b) First report of natural infection of garlic with Iris yellow spot virus in the United States. Plant Disease 93:839.

Bendtsen JD, Nielsen H, Heijne G, Brunak S (2004) Improved prediction of signal peptides: SignalP 3.0. Journal of Molecular Biology 340:783-795.

Bezerra IC, Resende RO, Pozzer L, Nagata T, Kormelink R, de Avila AC (1999) Increase of tospoviral diversity in Brazil, with the identification of two new tospovirus species, one from chrysanthemum and another from zucchini. Phytopathology 89:823-830.

Brittlebank CC (1919) Tomato diseases. Journal of Agriculture Victoria 17:231-235.

Bruenn JA (2003) A structural and primary sequence comparison of the viral RNAdependent RNA polymerases. Nucleic Acids Research 31:1821-1829.

Chen CC, Chen TC, Lin YH, Yeh SD, Hsu HT (2005) A chlorotic spot disease on calla lilies (Zantedeschia spp.) is caused by a tospovirus serologically but distantly related to Watermelon silver mottle virus. Plant Disease 89:40-445.

Chen CC, Chiu RJ (1996) A tospovirus infecting peanut in Taiwan. Acta Horticulture 431:57-67.

Chu FH, Chao CH, Chung MH, Chen CC, Yeh SD (2001) Completion of the genome sequence of Watermelon silver mottle virus and utilization of degenerate primers for detecting tospoviruses in five serogroups. Phytopathology 91:361-368.

Cortes I, Aires A, Pereira AM, Goldbach R, Peters D, Kormelink R (2002) Genetic organization of Iris yellow spot virus M RNA: indications for functional homology between the G(C) glycoproteins of tospoviruses and animal-infecting bunyaviruses. Archives of Virology 147:2313-2325.

Cortez I, Livieratos J, Derks A, Peters D, Kormelink R (1998) Molecular and serological characterization of Iris yellow spot virus, a new and distinct tospovirus species. Phytopathology 88:1276-1282.

Cramer CS, Bag S, Schwartz HF, Pappu HR (2011) Susceptibility of onion relative (Allium spp) to Iris yellow spot virus. Plant Disease 95:1319. de Avila AC, de Haan P, Kormelink R, Resende RO, Goldbach RW, Peters D (1993) Classification of tospoviruses based on phylogeny of nucleoprotein gene sequences. Journal of General Virolology 74:153-159. de Haan P, Kormelink R, Resende RO, van Poelwijk F, Peters D, Goldbach R (1991) Tomato spotted wilt virus L RNA encodes a putative RNA polymerase. Journal of General Virology 72:2207-2216. de Oliveira AS, Melo FL, Inoue-Nagata AK, Nagata T, Kitajima EW, Resende RO (2012) Characterization of Bean necrotic mosaic virus: A member of a novel evolutionary lineage within the genus Tospovirus. PLOS ONE 7(6): e38634. doi:10.1371/journal.pone.0038634

Dong JH, Cheng XF, Yin YY, Fang Q, Ding M, Li TT, Zhang LZ, Su XX, McBeath JH, Zhang ZK (2008) Characterization of Tomato zonate spot virus, a new tospovirus in China. Archives of Virology 153:855-864

Elliot RM (1990) Molecular biology of the Bunyaviridae. Journal of General Virology 71:501-522

Evans CK, Bag S, Frank E, Reeve J, Ransom C, Drost D, Pappu HR (2009a) Green Foxtail (Setaria viridis), a naturally infected grass host of Iris yellow spot virus in Utah. Plant Disease 93:670.

Evans CK, Bag S, Frank E, Reeve J, Ransom C, Drost D, Pappu HR (2009b) Natural infection of Iris yellow spot virus in two scale saltbush (Atriplex micrantha) growing in Utah. Plant Disease 93:430.

Gent DH, du Toit LJ, Fichtner SF, Krishna Mohan S, Pappu HR, Schwartz HF (2006) Iris yellow spot virus: an emerging threat to onion bulb and seed production. Plant Disease 90:1468-1480.

Gowda S, Satyanarayana T, Naidu RA, Mushegian A, Dawson WO, Reddy DVR (1998) Characterization of the large (L) RNA of Peanut bud necrosis tospovirus. Archives of Virology 143:2381-2390.

Krauthausen HK, Leinhos GME, Müller J, Radtke PC, Jehle JA (2012) Identification and incidence of Iris yellow spot virus in Allium field crops in Southwest Germany. European Journal of Plant Pathology 134:345-356.

Hassani MA, Saaijer J, Peters D, Goldbach R, Kormelink R (2005) A new tomato infecting tospovirus from Iran. Phytopathology 95:852-858.

Jain RK, Pappu HR, Pappu SS, Reddy MK, Vani A (1998) Watermelon bud necrosis tospovirus is a distinct virus species belonging to serogroup IV. Archives of Virolology 143: 1637-1644.

Julenius K, Mølgaard A, Gupta R, Brunak S (2005) Prediction, conservation analysis and structural characterization of mammalian mucin-type O-glycosylation sites. Glycobiology 15:153-164.

Kato K, Hanada K, Kameya-Iwaki M (2000) Melon yellow spot virus: a distinct species of the genus Tospovirus isolated from melon. Phytopathology 90:422-426.

Knierim D, Blawid R, Maiss E (2006) The complete nucleotide sequence of a Capsicum chlorosis virus isolate from Lycopersicum esculentum in Thailand. Archives of Virology 151:1761-1782.

Kritzman A, Lampal M, Raccah B, Gera A (2001) Distribution and transmission of Iris yellow spot virus. Plant Disease 85:838-842.

Krogh A, Larsson B, von Heijne G, Sonnhammer ELL (2001) Predicting transmembrane protein topology with a hidden Markov model: application to complete genomes. Journal of Molecular Biology 305:567-580.

Law MD, Speck J, Moyer JW (1991) Nucleotide sequence of the 3′ non-coding region and N gene of the S RNA of a serologically distinct tospovirus. Journal of General Virology 72:2597-2601.

Lin YH, Chen TC, Hsu HT, Liu FL, Chu FH, Chen CC, Lin YZ, Yeh SD ( 2005) Serological comparison and molecular characterization for verification of Calla lily chlorotic spot virus as a new tospovirus species belonging to Watermelon silver mottle virus serogroup. Phytopathology 95:1482-1488.

Lovato FA, Nagata T, Resende RO, de Avila AC, Inoue Nagata AK (2004) Sequence analysis of the glycoproteins of Tomato chlorotic spot virus and Groundnut ringspot virus and comparison with other tospoviruses. Virus Genes 29:321-328.

McMichael LA, Persley DM, Thomas JE (2002) A new tospovirus serogroup IV species infecting capsicum and tomato in Queensland, Australia. Australasian Plant Pathology 31:231-239.

Moyer JW (1999) Tospoviruses (Bunyaviridae). In: Encyclopedia of virology. Academic Press, New York, pp 1803-1807.

Nagata T, Almeida ACL, Resende R deO, de Avila AC (1999) The identification of the vector species of Iris yellow spot tospovirus occurring on onion in Brazil. Plant Disease 83:399.

Nichol ST, Beaty BJ, Elliott RM., Goldbach R, Plyusnin A, Schmaljohn CS, Tesh RB (2005) Bunyaviridae. In: Fauquet, C.M., Mayo, M.A., Maniloff, J., Desselberger, U., Ball, L.A. (Eds.), Virus taxonomy, VIIIth Report of the ICTV Elsevier/Academic Press, San Diego, pp 695-716.

Page RDM (1996) Tree View: an application to display phylogenetic tree on personal computers. Computer Application in the Biosciences 12:357-358.

Pappu H R (2008) Tomato spotted wilt virus (Bunyaviridae). In: Mahy, B.W.J., Van Regenmortel, M.H.V. (Eds.), Encyclopedia of Virology. 3rd edition, Vol. 5. Elsevier Ltd, Oxford, UK. pp 133-138.

Pappu HR, Jones RAC, Jain RK (2009) Global status of tospovirus epidemics in diverse cropping systems: Successes gained and challenges ahead. Virus Research 141:219-236.

Pappu HR, Matheron ME (2008) Characterization of Iris yellow spot virus from onion in Arizona. Plant Health Progress Doi:10.1094/PHP-2008-0711-01-BR

Pappu SS, Bhat AI, Pappu HR, Deom CM, Culbreath AK (2000) Phylogenetic studies of tospoviruses (Family: Bunyaviridae) based on intergenic region sequences of small and medium genomic RNAs. Archives of Virology 145:1035-1045.

Reddy DVR, Ratna AS, Sudarshana MR, Poul F, Kumar IK (1992) Serological relationships and purification of bud necrosis virus, a tospovirus occurring in peanut (Arachis hypogaea L.) in India. Annals of Applied Biology 120:279-286.

Saritha R K, Jain RK (2007). Nucleotide sequence of the S and M RNA segments of a Groundnut bud necrosis virus isolate from Vigna radiata in India. Archives of Virology 152:1195-1200.

Satyanarayana T, Gowda S, Reddy KL, Mitchell SE, Dawson WO, Reddy DVR (1998) Peanut yellow spot virus is a member of a new serogroup of tospovirus genus based on small (S) RNA sequence and organization. Archives of Virology 143:353-364.

Silva, MS, Martins CRF, Bezerra IC, NagataT, de A´vila AC, Resende RO (2001) Sequence diversity of NSm movement protein of tospoviruses. Archives of Virology 146:1267-1281.

Tamura K., Peterson D, Peterson N., Stecher G., Nei M., and Kumar S. (2011) MEGA 5: molecular evolutionary genetics analysis using maximum likelihood, evolutionary distance, and maximum parsimony method. Molecular biology and Evolution 28:2731-2739.

Thompson JD, Gibson TJ, Plewniak F, Jeanmougin F, Higgins DG (1997) The ClustalX windows interface: flexible strategies for multiple sequence alignment aided by quality analysis tools. Nucleic Acids Research 25:4876-4882.

Thompson JD, Higgins DG, Gibson TJ (1994) CLUSTAL W: Improving the sensitivity of progressive multiple sequence alignment through sequence weighting, positions- specific gap penalties and weight matrix choice. Nucleic Acid Research 22:4673- 4680.

Tsompana M, Moyer JW (2008) Tospoviruses. In: Mahy, B.W.J., Van Regenmortel, M. H.V. (Eds.), Encyclopedia of Virology. 3rd edition. Elsevier Ltd, Oxford, UK. Volume 5, pp. 157-162.

Whitfield AE, Ullman DE, German TL (2005) Tospovirus-thrips interactions. Annual Review Phytopathology 43:459-489.

Winter S, Shahraeen N, Koerbler M, Lesemann DE (2006) Characterization of Tomato fruit yellow ring virus: a new tospovirus species infecting tomato in Iran. Plant Pathology 55:287.

Yeh SD, Chang TF (1995) Nucleotide sequence of the N gene of Watermelon silver mottle virus, a proposed new member of the genus tospovirus. Phytopathology 85:58-64.

Zhou J, Kantartzi SK, Wen RH, Newman M, Hajimorad MR, Rupe JC, Tzanetakis IE (2011) Molecular characterization of a new tospovirus infecting soybean. Virus Genes 43:289-295.

CHAPTER FOUR

SEASONAL DYNAMICS OF THRIPS (THRIPS TABCI L.) TRANSMITTERS

OF IRIS YELLOW SPOT VIRUS, A SERIOUS VIRAL PATHOGEN

OF ONION BULD AND SEED CROPS

Bag, S., S. I. Rondon, K. L.Druffel, D. G.Riley, and H. R.Pappu (2013): Journal of

Economic Entomology. (Manuscript submitted)

ABSTRACT

Thrips-transmitted Iris yellow spot virus (IYSV) is an important economic constraint to the production of bulb and seed onion crops in the United States and many parts of the world. Since the virus is exclusively spread by thrips, the ability to rapidly detect the virus in thrips vectors would facilitate studies on the role of thrips in virus epidemiology and formulate better vector management strategies. Using a polyclonal antiserum produced against the recombinant, E. coli-expressed nonstructural protein

(NSs) coded by the small (S) RNA of IYSV, an ELISA assay was developed for detecting

IYSV in single as well as group of adult thrips. The approach enabled estimating the proportion of thrips transmitters in a large number of field-collected thrips colonizing onion plants. Availability of a practical and inexpensive test to identify thrips vectors would be useful in epidemiological studies to better understand the role of thrips vectors in outbreaks of this economically important virus of onion.

INTRODUCTION

Thrips (Thysanoptera,Thripdae) are cosmopolitan insects and act as both pest and virus vector thus causing serious economic damage to numerous horticultural and field crops in many parts of the world (Montano et al., 2011). For example, Thrips tabaci L. (onion thrips) can cause yield losses of >50% in onion (Fournier et al., 1995).

It is considered as indirect pest of dry bulb onion as it feeds on leaves rather than on bulb. The feeding injury reduces the photosynthetic ability of the plant (Molenaar 1984;

Parrella and Lewis 1997) by destroying the chlorophyll rich leaf mesophyll (Molenaar

1984) which interferes with nutrient transportation to bulb (Parrella and Lewis 1997). In addition to being a serious pest, it also transmits Iris yellow spot virus (IYSV) (family

Bunyaviridae, genus Tospovirus) a serious viral pathogen of onion (Gent et al., 2006;

Pappu et al., 2009). Increasing incidence of IYSV has been reported in the US and other parts of the world in recent years (Bag et al., 2009b; Bulajic et al., 2008; Huchette et al.,

2008;Pappu and Matheron, 2008; Pappu et al., 2009; Sether et al., 2010; Ward et al.,

2008). IYSV is predominantly transmitted by onion thrips, Thrips tabaci (Kritzman et al., 2001; Nagata et al., 1999). Recently, Frankliniella fusca (tobacco thrips) was shown to transmit IYSV albeit with much lower efficiency compared to onion thrips (Srinivasan et al., 2012). The virus is not transmitted through the egg and there is no evidence of virus transmission through seed. Hence, infected plants and viruliferous thrips are the primary source and means of virus spread. At present, there are limited options available for managing IYSV outbreaks (Pappu et al., 2009). The ability to rapidly and accurately detect IYSV in thrips vectors for the purpose of estimation of the proportion

of viruliferous thrips from the field could potentially provide information that would be useful in managing this pest complex.

The family Bunyaviridae consists of arthropod-borne RNA viruses (Elliott 1990;

Nichol et al., 2005) and all but one genus Tospovirus in this family infect animals or humans. Genus Tospovirus, is the only genus in this family whose members infect plants. Tospoviruses developed a close biological association with their thrips vectors: adult thrips transmits the virus only if the virus was acquired during the larval stage

(Sakimura 1962; Ullman et al., 1992a), with the majority of thrips becoming viruliferous

(=transmitters) in the second larval stage (Wijkamp and Peters, 1993). The frequency of emergence of viruliferous thrips depends on the duration of ingestion by the first instar larvae on infected plants (Wijkamp and Peters, 1993) and may be affected by the amount of virus particles acquired by larvae. Even though the virus replicates in its thrips vector, transmission of virus by the adult thrips occurs intermittently for the duration of their lives (Ullman et al., 1992b; Wijkamp et al., 1993). Adult thrips that fed on virus-infected plants for the first time do not transmit the virus (Assis et al., 2005;

Wetering et al., 1996). However, the relationship between the virus accumulation in the plant and the acquisition rate is not well known.

Control of tospovirus epidemics by managing thrips populations with insecticides has been difficult because of the wide and diverse host range of both tospoviruses and thrips vectors (Cho et al., 1989; Pappu et al., 2009). Still, pest manager practitioners recommend the use of insecticide applications and/or rotating the cropping systems to avoid thrips infestation (Mautino et al., 2011).

The ability to determine the proportion of thrips transmitters in a population would facilitate a better understanding of the role of a particular thrips species in tospovirus epidemiology and may help refine vector management tactics to increase their efficiency and effectiveness. Information on thrips transmitters could be a useful parameter in developing a forecasting system for disease outbreaks. One approach to identify viruliferous thrips population is to conduct a bioassay using plant hosts as indicators (Allen and Matteoni, 1991; Cho et al., 1989, 1991). Other methods that were used for the detection of viruliferous thrips include serological methods such as enzyme- linked immuno-sorbent assay (ELISA) (Bandla at al., 1994; Cho et al., 1989; Ullman et al., 1992c), electron microscopy (Ullman et al., 1992a), nucleic acid dot blots (Rice et al.,

1990), immunological squash blot (Aramburu et al., 1996) and real-time quantitative

PCR (Boonham et al., 2002). ELISA-based testing of thrips using antiserum against the viral structural protein (nucleoprotein) for determining potential virus transmitters likely overestimates the proportion of transmitters since a given field-originated thrips population may contain both transmitters (that acquired the virus in their larval stage) and those that ingested the virus as adults. Still, use of biological assays to identify the transmitters is effective but is expensive and time consuming.

The complete genomes of IYSV L and M RNA were cloned and sequenced (Bag et al., 2009a; 2010). The L RNA is in negative sense and potentially codes for the RNA- dependent RNA polymerase (RdRp) in virion complementary sense (Bag et al., 2010; de

Haan et al., 1991). The M and S RNAs are ambisense in their genome organization and code for two proteins each (Bag et al., 2009a; Cortez et al., 2002). The S RNA of

tospoviruses encodes the viral structural nucleocapsid protein (N) and a nonstructural protein (NSs). NSs was found in infected plant cells and thrips transmitters but not in assembled virions or healthy plants (de Avila et al., 1990; de Haan et al., 1990;

Kormelink et al., 1991).

A serological assay that can facilitate high throughput testing, and is sensitive, rapid and specific to the virus is more desirable as it is likely to be cost effective also. An

ELISA-based assay that would detect a non-structural protein of IYSV would be a useful tool. Detection of NSs would then be indicative of virus replication and suggesting that the thrips that test positive could potentially transmit the virus as opposed to those that carry the virus as a contaminant. Thus the objective of this research was to develop materials (NSs-specific antibodies) and methodology (an ELISA-based assay) and apply in identification of potential thrips transmitters from field collected adult thrips.

MATERIALS AND METHODS

Onion samples from various commercial fields in the states of California (IYSV-

CA), Idaho (IYSV-ID) and New York (IYSV-NY) were collected and tested for the presence of IYSV infection by ELISA using a commercially available ELISA kit (Agdia

Inc., Elkhart, IN) or RT-PCR (Pappu et al., 2006). Uninfected, healthy onion plants grown in a growth chamber were used as negative controls.

The NSs gene (1331 nt) was amplified using gene specific primers 5’ CCT TTT

TTT TTT CAT ATG TCT ACC GTT AGG ACT ACG GC 3’ (forward primer) and 5’ TTA

TGG ATC CTC ACT GCA GCT CTT CTA CA 3’ (reverse primer) with Nde I and BamH I

restriction sites (underlined) at 5’ end of forward and reverse primers, respectively. The amplicon was cloned into TOPO-TA cloning vector (Invitrogen, CA, USA) (Fig. 4.1).

Recombinant clones were identified using colony PCR and restriction analysis and the

NSs gene was released by restriction digestion with Nde I and Bam HI , sub-cloned into expression vector pET15b containing the N terminal His-Tag sequence (Novagen,

Germany) (Fig. 4.1). The recombinant pET15b clone was mobilized into the E. coli following standard molecular biology protocols (Sambrook and Russell, 2001).

Transformants were screened and maintained on Luria agar plates containing appropriate antibiotics (50 µg/ml ampicillin and 34µg/ml chloroamphenicol).

Expression of fusion protein was induced by 100 mM Isopropyl β-D-1- thiogalactopyranoside (IPTG) and was purified using nickel (Ni) column following manufacturer’s instructions. Fractions were analyzed by sodium dodecyl sulfate- polyacrylamide gel electrophoresis (SDS-PAGE; Laemmli, 1970) using 5% stacking gel and 12% resolving gel.

The recombinant NSs protein was purified from SDS-PAGE gel and emulsified with an equal volume of Freund’s incomplete adjuvant and injected intramuscularly

(100 µg/animal) into two rabbits. Four additional booster doses were given at weekly intervals. Rabbits were first bled 14 days after every booster dose and the serum was collected and stored at 4C.

The antiserum produced in response to immunization with the fusion protein was first tested for reactivity against E. coli expressed recombinant IYSV-NSs protein.

The recombinant protein from SDS-PAGE was electro-blotted (30v/3h) onto nitrocellulose membrane (Amersham Biosciences, NJ USA.) using TBE buffer. The membrane was kept in blocking solution (3% BSA in TBS) for 1h and probed with the antiserum produced against the NSs fusion protein at 1:4000 dilution for 120 min. The bound antibodies were detected with anti-rabbit IgG alkaline phosphatase conjugate

(1:5,000 dilution; Sigma, St. Louis, MO, USA) and 0.33 mg/ml Nitro blue tetrazolium chloride (NBT) (Sigma, MO, USA.) and 0.175 mg/ml 5-Bromo-4-chloro-3-indolyl phosphate, (BCIP) toluidine salt (Sigma, MO, USA.) as substrate.

The polyclonal antiserum against the NSs protein was also used in Antigen coated plate (ACP)-ELISA (Clark and Bar-Joseph, 1984) to detect IYSV in various onion plant samples that were previously confirmed to be IYSV-infected. Plant samples infected with Impatiens necrotic spot virus (INSV) and Tomato spotted wilt virus (TSWV) were included to identify possible cross reactivity of the antiserum to these two viruses. A dilution series of the antiserum, ranging from 1:200-1:6000, was used to determine the optimal titer of the antiserum for use in ACP-ELISA for detecting IYSV.

For the detection of IYSV NSs protein in thrips, ACP-ELISA (Bandla et al., 1994;

Clark and Bar-Joseph, 1984) was used to test thrips collected from three different sources. A fine-tipped brush was used in collecting, transferring, and removing thrips from plants. Thrips were placed in vials containing 100 µl of extraction buffer (0.01 M sodium-potassium phosphate buffer, pH 7.4, containing 0.02% sodium azide [w/v];

0.8% sodium chloride [w/v], 0.05% Tween 20 [v/v] and 2% polyvinylpyrrol-idone, mol

wt 40,000 [w/v] (Sigma) and stored at -20C until analysis. Individual thrips were removed from the storage vials with a fine-tipped camel’s hair brush, placed onto

separate micro centrifuge tube, triturated in 50 µl of ELISA extraction buffer with a sterile blunt end plastic pestle. The suspension was transferred to a flat bottom polycarbonate-ELISA plate and incubated overnight at 4C. Plates were washed three times with Phosphate buffered saline [PBS] containing 0.05% Tween 20 (PBS-T) and blocked with 75µl of 1% bovine serum albumin (BSA) for 2 h at 37C. After washing the plates, 50 µl of polyclonal anti-NSs antibody diluted (1:4000) in antigen dilution buffer

(0.2 % BSA, 2% Polyvinylpyrrolidone (PVP) MW 40,000, and 0.02% sodium azide, pH

7.4) was added to the wells, and the plates were incubated at 37C for 2 h. Plates were washed three times with PBS-T and 50 µl of goat anti-rabbit IgG-alkaline phosphatase

(Sigma) in antibody dilution buffer (0.2 % BSA, 2% PVP MW 40,000, and 0.02% sodium azide, pH 7.4) (1:5000) was added to each well and the plates were incubated at

37C for 2h. Colorometric reactions were read at 405 nm after addition of 0.5 mg/ml substrate (p-nitrophenyl phosphate disodium, in 1M diethanolamine buffer containing

0.5 mM MgCl2 and 0.02% sodium azide) to each well. Absorbance values (A405) were taken at 1h and 2h after the addition of substrate on ELISA plate reader (Bio-Tek instruments, Winooski, VT).

Collection of Thrips tabaci

To standardize the detection technique in individual thrips, thrips samples were collected from various locations in Georgia, USA. The samples were collected from

onion cull piles (TtR), imported onion plants that were tested for and infected with IYSV

(TtT), and T. tabaci maintained under controlled greenhouse conditions (TtC).

To further strengthen our diagnosis of IYSV in individual thrips, the experiment was performed on thrips collected from IYSV-infected onion fields. During the cropping seasons 2008 and 2009, T. tabaci were collected from two different experimental fields: one adjacent to an overwintering field and another field 2 km away from any other onion fields. Both fields were located at the Oregon State University (OSU) Hermiston

Research and Extension Center, Hermiston, OR. The soil was an Adkins fine sandy loam

(coarse-loamy, mixed mesic Xerollic Camborthid). The area was fumigated in the fall with Sectagon applied at 40 gpa. ‘Vision’ onions were seeded on 6 Apr, 2008, 2-30' beds/plot, 34" between beds, 4 rows/bed, with a Monosem vacuum precision planter.

On 11 Apr Dacthal (DCPA) was broadcast at 6 lb/acre for weed control and fertilizer (10-

35-0 N-P2O5-K2O) was banded over the seed rows. Lorsban (chlorpyrifos) was banded over the planting rows at 3 pt/acre to control seed corn maggot. In 2008, poor stand resulted in plots being rototilled and replanted on 4 May. Dacthal and Lorsban were applied at 6 lb/a and 1 qt/a, respectively, on 8 May. On Jun 7 Prowl (pendimethalin) herbicide was applied 1.2 pt/a, along with Goal 2XL (oxyfluorfen) @ 0.5 pt/a and Buctril

(bromoxynil) @ 1.2 pt/a. Additional nitrogen was applied through the center pivot irrigation system. Same procedure was follow in 2009, no seed corn maggot issues. The crop was grown following normal commercial production practices. Field A was located next to an overwintering trial both years; field B was located at least 2 kilometers away from any overwintering onion field. Beginning early June, ten plants per field were

removed weekly, bagged, and transferred to the laboratory, leaves were examined for damage, and thrips counted.

Thrips were collected at an interval of seven days from ten different plants per field, sorted, and stored in 100 ml of 0.1M phosphate buffer at -20oC until further analysis. T. tabaci were identified and tested for the presence IYSV by DAC-ELISA using antiserum specific to the non-structural protein (NSs) of IYSV.

RESULTS

The antiserum produced to the recombinant fusion protein of NSs was first tested for specificity against the homologous purified protein. The antiserum produced was found to be specific to gel-purified IYSV-NSs protein used as immunogen, and IYSV infected onion sample in Western blot assay. A clear band of expected ~50kDa, absent in the healthy control (Fig. 4.2) suggested specific reactivity of the antiserum produced.

To further validate the specificity of the antiserum, onion samples collected from different parts of the USA were subjected to test the detection level of the antiserum produced. The antiserum could detect IYSV in a wide range of onion samples collected from California, Idaho, New York and Washington. The antiserum did not react with

INSV or TSWV-infected plant samples suggesting the specificity of the antiserum to

IYSV and the lack of cross reactivity to the corresponding proteins coded by INSV and

TSWV (Fig. 4.3 A). The absorbance reading after 1h of incubation was able to differentiate between healthy and infected samples (Fig 4.3 A). Usually, there was significance increase in the absorbance values after 2 h of incubation.

Individual thrips were then tested using this ELISA assay for its ability to detect

IYSV in adults collected from the fields in Georgia. The antiserum was able to detect

IYSV-NSs protein in individual thrips thus potentially differentiating the viruliferous

(transmitters) adults from the non-viruliferous (non-transmitters) (Fig. 4.3 B). Of the total thrips tested, 35.7 % from onion cull piles and 58.9% thrips from a colony maintained on IYSV-infected onions tested positive with the NSs antiserum. Thrips maintained on healthy plants and used as negative control did not react to the antiserum (Fig. 4.3 B). There is a significant increase in color development after 2 h of incubations, and provided clear differentiation between the viruliferous and non- viruliferous thrips.

In the field plot of OSU, Hermiston, thrips collected from the onion fields were identified to the species level to determine the proportion of onion thrips and western flower thrips, the two major pests on vegetables in the region. A sub-sample of thrips were slide-mounted to verify their identification. 99% of the thrips collected were T. tabaci; the remaining 1% were identified as F. occidentalis

(http://www.ento.csiro.au/thysanoptera/worldthrips.php). To validate the specificity of antiserum and its ability to detect IYSV in individual thrips, thrips collected were tested by ACP-ELISA, to determine the proportion of potential transmitters. Thrips were collected at weekly intervals from different locations within the fields. In field A located next to an overwintering field and field B located at least 2 kilometers away from any other onion field, the highest incidence of thrips was during middle of July, for both years 2008 and 2009. From field A, the maximum number of viruliferous thrips (75%

and 35%) and thrips incidence was found on July 22, 2008 and July 21, 2009 respectively.

For field B, which was far from any overwintering onion field, even with the presence of infected onion in 2008 the thrips collected during the experimental period were non-viruliferous as none of the thrips tested were found to be positive to IYSV-

NSs. However, during the cropping season of 2009, the maximum numbers of viruliferous thrips were present in early (June 23, 2009) and well as mid season (July

21, 2009). The percentage of viruliferous thrips decreased late in the season (Fig.4.4 a- d). The antiserum was able to detect the virus in individual thrips collected from IYSV- infected onion fields.

DISCUSSION

The ability to quickly establish potential transmitter and field collected thrips populations facilitates a better understanding of vector dynamics in a given cropping system. ELISA using polyclonal antibody raised against the non-structural protein (NSs) was able to diagnose the IYSV infection in onion samples and was able to differentiate between the viruliferous and non-viruliferous thrips vectors. The antiserum was able to detect the virus in individual thrips collected from onion cull pile in an open field. In a similar study, Bandla et al., (1994), produced a monoclonal antibody to the NSs protein of TSWV and showed that the detection of NSs in adult thrips was correlated with the ability to transmit the virus.

Thrips collected from the two fields yielded variable results. Although the antiserum was able detect IYSV in individual thrips. In field A close to an overwintering field, where higher proportion of viruliferous thrips were detected both years, but in field B, viruliferous thrips were not detected in 2008, but detected in 2009, this can be due to different environmental condition that influence the disease and thrips incidence as larval densities per plant were reported to be at peak during early season mid July and late August, the time when thrips acquire the virus (Hsu et al., 2010).

Monitoring thrips in greenhouse or in the field either by the use of sticky traps or manual counting is an important component of IPM strategy for managing thrips populations to reduce their impact as a pest as well as virus vector (Morsello et al.,

2008; Olatinwo et al., 2010). However, this gives no indication of viruliferous thrips at any given time point. A rapid and cost effective method for the reliable detection of virus in individual thrips would aid in the understanding the factors leading to IYSV epidemics. The ELISA-based method facilitates estimation of IYSV transmitters among thrips populations collected from plants grown either in protected or open field conditions. The antiserum could potentially differentiate transmitters from non- transmitters since NSs is not part of the virion (Kormelink et al., 1991) and is expressed in plants and thrips vectors only upon virus replication. Thus, detection of NSs in the insect is an indication of the virus replication and only those thrips in which virus had replicated are capable of transmitting the virus.

Results from this study suggested the antiserum produced to a non-structural protein of IYSV is effective in detecting the virus in plants and single thrips using ELISA.

The E.coli-based protein expression systems offer a major advantage in obtaining proteins for antibody production since it is difficult to purify these proteins from virus- infected plant tissue as these proteins are not part of the virions. The antiserum produced was found to be specific to IYSV and it did not react with two other distinct tospovirus species, INSV and TSWV. The antibody-based assay described here is being used to conduct studies on the seasonal dynamics of IYSV transmitters among onion thrips collected from onion fields.

Information on the seasonal dynamics of viruliferous thrips could be useful in refining thrips management tactics as part of an IPM strategy for reducing the impact of thrips-transmitted IYSV. This along with other control tactics such as manipulating planting and harvest dates (Hsu et al., 2010) and other cultural practices could enhance the existing IPM programs for reducing the impact of thrips and IYSV in onion.

BamH I Nde I

NSs

Fig. 4.1: Schematic representation of cloning strategy of the nonstructural protein (NSs) coded by the small (S) RNA of Iris yellow spot virus (IYSV)

M 1 2 3 M

50kDa

Fig. 4.2: Immunoblotting showing the specificity of the antiserum to the non-structural protein (NSs) of Iris yellow spot virus (IYSV). M: protein marker, Lane 1: E. coli- expressed, purified NSs protein; lane 2: total protein extract from IYSV-infected onion plant, and lane 3: total protein extract from a healthy onion plant. Arrow on the left indicates the molecular weight of purified protein.

Absorbance (OD 405 nm) 405 Absorbance(OD

Plant samples A

nm) 405 Absorbance(OD

Thrips samples

Fig. 4.3: Bar graph showing the detection of the NSs protein of Iris yellow spot virus (IYSV) in plant and thrips samples using ELISA. Various groups of samples were on the X axis and the absorbance values (A 405) on Y axis. Data shown are net absorbance values for means of total thrips after deducting the mean absorbance values for buffer controls. The values for 1 h and 2 h were shown with standard deviation error bars.

(A) Infected plant samples: plant samples infected with Tomato spotted wilt virus (TSWV), Impatiens necrotic spot virus (INSV), and Iris yellow spot virus (IYSV). (B) Onion thrips samples: TtC-virus-free adult Thrips tabaci as negative control; TtR- adult T.tabaci from onion cull piles; TtT- adult T. tabaci collected from imported onion; NSs-purified protein.

Thrips Thrips

Year 1 (Field B) A Year 1 (Field A) B

Thrips Thrips

Year 2 (Field A) C D Year 2 (Field B)

Fig. 4.4 (A-D): Seasonal dynamics of Thrips tabaci populations and potential IYSV transmitters from two onion fields near Hermiston OR. (A) Year 1 Field A; (B) Year 1 Field B; (C) Year 2 Field A; (D) Year 2 Field B. Days of collection on X axis and mean numbers of thrips per plants, numbers of thrips tested, total number of positive thrips and percentage of viruliferous thrips on Y axis.

REFERENCES

Allen, W.R., and J. A. Matteoni. 1991. Petunia as an indicator for use by the grower to monitor for thrips carrying the Tomato spotted wilt virus in green house. Plant Dis. 75: 78-82.

Aramburu, J., J. Riudavets, J. Arno, A. Lavina, and E. Moriones. 1996. Rapid serological detection of Tomato spotted wilt virus in individual thrips by squash- blot assay for use in epidemiological studies. Plant Pathol. 45:367-374.

Assis Filho, F.M .de., C.M.Deom, and J.L.Sherwood.2004. Acquisition of Tomato spotted wilt virus by adults of two thrips species. Phytopathol. 94:333- 336.

Bag, S., K.L.Druffel, T. Salewsky, and H.R. Pappu. 2009a.Nucleotide sequence and genome organization of the medium RNA of Iris yellow spot virus (genus Tospovirus, family Bunyaviridae) from the Unites States. Arch. Virol. 154:715- 718.

Bag, S., J. Singh, R.M. Davis, W. Chounet, and H.R. Pappu. 2009b. Iris yellow spot virus in Nevada and Northern California. Plant Dis. 93: 674.

Bag, S., K.L. Druffel, and H.R.Pappu. 2010. Structure and genome organization of the large RNA of Iris yellow spot virus (genus Tospovirus, family Bunyaviridae). Arch. Virol. 155:275-279.

Bandla, M.D., D.M. Westcot, K.D. Chenault, D.E.Ullman, T.L.German, and J.L. Sherwood 1994. Use of monoclonal antibody to the nonstructural protein encoded by the small RNA of Tomato spotted wilt tospovirus to identify viruliferous thrips. Phytopathol. 84: 1427-1431.

Boonham, N., P. Smith, K. Walsh, J. Tame, J. Morris, N. Spence, J. Bennison, and I. Barker. 2002. The detection of Tomato spotted wilt virus (TSWV) in individual thrips using real time fluorescent RT-PCR (TaqMan). J. Virol. Methods 101:37-48.

Bulajic, A., J.Jovic, S. Krnjajic, M. Petrov, I. Djekic, and B. Krstic. 2008. First report of Iris yellow spot virus on onion (Allium cepa) in Serbia. Plant Dis. 92:1247.

Campbell, L.R., K.L.Robb, and D.E. Ullman. 2005. The complete Tospovirus host list. http://www.oznet.ksu.edu/tospovirus/host list.html

Cho, J. J., R.F.L. Mau, D.E. Ullman, and D.M. Custer. 1991. Detection of tomato spotted wilt virus within thrips. Virus-plant interaction of Tomato spotted wilt virus USDA Workshop ARS-87:144-152.

Cho, J. J., R.F.L. Mau, T.L.German, R.W.Hartmann, L.S. Yudin, D. Gonsalves, and R. Provvidenti. 1989. A multidisciplinary approach to management of Tomato spotted wilt virus in Hawaii. Plant Dis. 73: 375-383.

Clark, M.F., and M. Bar-Joseph. 1984. Enzyme immunosorbent assays in plant virology. In: Maramorsch, K., Koprowski, H. (eds.), Methodsin Virology, vol. II. Academic Press, New York, pp. 51-85.

Cortez, I, A. Aires, A.M. Pereira, R. Goldbach, D.Peters, and R. Kormelink. 2002. Genetic organization of Iris yellow spot virus M RNA: indications for functional homology between the G/C glycoproteins of tospoviruses and animal- infecting bunyaviruses. Arch. Virol. 147: 2313-2325. de Avila, A.C., C. Hugenot, O. de Resende, E.W. Kitajima, R.W. Goldbach, and D. Peter. 1990. Serological differentiation of 20 isolates of Tomato spotted wilt virus. J. Gen. Virol. 71, 2801-2801. de Haan, P., L.Wagemakers, D.Peters, and R. Goldbach. 1990. The S RNA segment of Tomato spotted wilt virus has an ambisense character. J. Gen. Virol. 71: 1001-1007. de Haan, P., R.Kormelink, R.O. Resende, F. van Poelwijk, D. Peters, and R. Goldbach. 1991. Tomato spotted wilt virus L RNA encodes a putative RNA polymerase. J.Gen. Virol. 72: 2207-2216.

Elliott, R.M.1990. Molecular biology of the Bunyaviridae. J. Gen. Virol. 72: 501-522.

Fournier, F., G. Boivin, and R. K. Stewart. 1995. Effect of Thrips tabaci (Thysanoptera: Thripidae) on yellow onion yields and economic thresholds for its management. J. Econ. Entomol. 88: 1401-1407.

Gent, D.H., L.J.du Toit, S.F. Fichtner, S. KrishnaMohan, Pappu, H.R. and H.F. Schwartz. 2006. Iris yellow spot virus: an emerging threat to onion bulb and seed production. Plant Dis. 90: 1468-1480.

Hsu, C.L., C.A. Hoepting, M. Fuchs, A.M. Sheltom, and B.A. Nault. 2010. Temporal dynamics of Iris yellow spot virus and its vector, Thrips tabaci (Thysanoptera: Thripidae), in seeded and transplanted onion fields. Environ. Entomol, 39:266-277.

Huchette, O., C.Bellamy, R. Filomenko, B. Pouleau, S. Seddas, and H.R. Pappu. 2008. Iris yellow spot virus on shallot and onion in France. Plant Health Progress Doi:10.1094/PHP-2008-0610-01-BR

Kormelink, R., E.W. Kitajima, P. de Haan, D. Zuidema, D.Peters, and R. Goldbach. 1991. The non structural protein (NSs) encoded by ambisense S RNA segment of Tomato spotted wilt virus is associated with fibrous structures in infected plant cells. Virology. 181:459-468.

Kritzman, A., M. Lampal, B. Raccah, and A. Gera. 2001. Distribution and transmission of Iris yellow spot virus. Plant Dis. 85: 838-842.

Laemmli, U.K. 1970. Clevage of structural proteins during the assembly of the bacteriophage T4. Nature. 227: 680-685.

Mandal, B., R.K.Jain, M. Krishnareddy, N.K.Krishna Kumar, K.S.Ravi, and H.R.Pappu. 2012. Emerging Problems of Tospoviruses (Bunyaviridae) and their Management in the Indian Subcontinent. Plant Disease 96:468-479.

Mautino,G.C., L. Bosco, and L. Tavella. 2012. Integrated management of Thrips tabaci (Thysanoptera:Thripidae) on onion in north-western Italy: basic approaches for supervised control. Pest Manag Sci. 68:185-193.

Molenaar, N. D. 1984. Genetics, thrips (Thrips tabaci L.) resistance and epicuticular wax characteristics of nonglossy and glossy onions (Allium cepa L.) Ph.D. Dissertation, University of Wisconsin, Madison.

Montano, J.D., M. Fuchs, B.A.Nault, J.Fail, and A.M.Shelton. 2011. Onion thrips (Thysanoptera:Thripidae); a global pest of increasing concern in Onion. J Eco Entomol. 104: 1-13.

Morsello, S.C., R.L.Groves, B.A.Nault, and G.C.Kennedy. 2008. Temperature and precipitation affect seasonal patterns of dispersing Tobacco thrips, Frankliniella fusca, and Onion thrips, Thrips tabaci (Thysanoptera: Thripidae) caught on sticky traps. Enviorn. Entomol. 37:79-86.

Moyer, J.W. 1999. Tospoviruses (Bunyaviridae). In: Encyclopedia of virology. Academic Press, NewYork, pp 1803-1807.

Nagata, T., and A.C.L. Almeida, R.de O. Resende, and A.C. de Avila. 1999. The identification of the vector species of Iris yellow spot tospovirus occurring on onion in Brazil. Plant Dis. 83: 399.

Nichol, S.T., B.J. Beaty, R.M. Elliott, R. Goldbach, A. Plyusnin, C.S. Schmaljohn, and R.B. Tesh. 2005. Bunyaviridae. Pp 695-716. In: Fauquet, C.M., M.A. Mayo., J. Maniloff, U. Desselberger, and L.A. Ball. (eds.); Virus taxonomy, VIIIth Report of the ICTV Elsevier/Academic Press, San Diego.

Olatinwo, R.O., Prabha, T., Pez, J.O., Riley, D.G., and G. Hoogenboom. 2011. The weather research and forecasting (WRF) model: application in prediction of TSWV vector populations. J.Appl.Entomol. 135:81-90.

Pappu, H.R., and M.E. Matheron. 2008. Characterization of Iris yellow spot virus from onion in Arizona. Plant Health Progress. doi:10.1094/PHP-2008-0711-01- BR.

Pappu, H.R., L.J. du Toit, H.F. Schwartz and K. Mohan. 2006. Sequence diversity of the Nucleoprotein gene of Iris yellow spot virus (genus Tospovirus, family Bunyaviridae) isolates from the western region of the United States. Arch. Virol. 151:1015-1023.

Pappu, H.R., R.A.C. Jones, and R.K. Jain. 2009. Global status of tospovirus epidemics in diverse cropping systems: Successes gained and challenges ahead. Virus Res. 141: 219-236.

Parrella, M. P., and T. Lewis. 1997. Integrated pest management (IPM) in Þeld crops, pp. 595-614. In T. Lewis (ed.), Thrips as crop pests. CAB International, New York

Rice, D. J., T. L. German, R.F.L.Mau, and F.M.Fujimoto.1990. Dot blot detection of Tomato spotted wilt virus-RNA in plant and thrips tissues by cDNA clones. Plant Dis. 74:274-276.

Sakimura, K., 1962. The present status of thrips-borne viruses. Pp 33-40. In: Biological Transmission of Disease Agents, (eds.); K. Maramorosch, Academic Press, New York.

Sambrook, J., and D.W. Russell. 2001. Molecular Cloning: A laboratory manual. Cold Spring Harbor Laboratory Press, New York.

Sether, D. M., W. B. Borth, R. S. Shimabuku, H. R. Pappu, M. J. Melzer and J. S. Hu, 2010. First Report of Iris yellow spot virus in Onion in Hawaii. Plant Dis. 94, 1508.

Srinivasan, R., S. Sundaraj, H. Pappu, S. Diffie, D. Riley, and R. Gitaitis. 2012. Transmission of Iris yellow spot virus by Frankliniella fusca and Thrips tabaci (Thysanoptera: Thripidae). J Eco. Ento.105, 40-47.

Tsompana, M. and J.W. Moyer. 2008. Tospoviruses. Pp 157-162 In: Mahy, B.W.J. and M.H.V. Van Regenmortel, (eds.); Encyclopedia of Virology, vol. 5, 3rd ed. Elsevier Ltd., Oxford, UK.

Ullman, D.E., D.M. Westcot, F.A. Cantone, J.L. Sherwood, and T.L. German. 1992c. Immunocytochemical evidence for Tomato spotted wilt virus (TSWV) replication in cells of the western flower thrips, Frankliniella occidentalis (Pergande). Phytopathol.82:1087.

Ullman, D.E., J.J. Cho, R.F.L.Mau, D.M. Westcot, and D.M.Custer. 1992a. A midgut barrier to Tomato spotted wilt virus acquisition by adult western flower thrips. Phytopathol. 82:1333-1342.

Ullman, D.E., J.J. Cho, R.F.L. Mau, W.B. Hunter, D.M. Westcot, and D.M.Custer. 1992b. Thrips-Tomato spotted wilt virus interactions: morphological, behavioral and cellular components influencing thrips transmission. pp 195-240. In: K.F.Harris (eds.); Advances in Disease Vector Research, Vol 9 Springer-Verlag, New York.

Ward, L.I., Z, Perez-Egusquiza, J.D. Fletcher, C.F.M. Ochoa, J.Z. Tang, L.W. Liefting, E.J.Martin, B.D.Quinn, H.R. Pappu, and G.R.C. Clover. 2008. First Report of Iris yellow spot virus on Allium cepa in New Zealand. New Dis. Rep. 17:38.

100

Wetering. F., R. Goldbach, and D. Peter. 1996. Tomato spotted wilt tospovirus ingestion by first instar larvae of Frankliniella occidentalis is a prerequisite for transmission. Phytopathol. 86: 900-905.

Wijkamp, I. and D. Peters. 1993. Determination of the median latent period of two tospoviruses in Frankliniella occidentalis, using a novel leaf disk assay. Phytopathol. 83: 986-991.

Wijkamp, I., J. van Lent, R. Kormelink, R. Goldbach, and D. Peters. 1993. Multiplication of Tomato spotted wilt virus in its insect vector, Frankliniella occidentalis. J. Gen. Virol. 74: 341-349.

101

CHAPTER FIVE

GENETIC COMPLEMENTATION BETWEEN TWO TOSPOVIRUSES

FACILITATES THE SYSTEMIC MOVEMENT OF A PLANT

VIRUS SILENCING SUPPRESSOR IN AN OTHERWISE

RESTRICTIVE HOST

Bag, S., N. Mitter, S. Eid, and H.R.Pappu. 2012. PLOS ONE 7(10): e44803. doi:10.1371/journal.pone.0044803

ABSTRACT

New viruses pathogenic to animals, humans or plants continue to emerg under natural conditions. This variability is attributed to mutation, recombination, or reassortment among genomic segments among individual viruses. Tospoviruses cause significant economic damage to a wide range of field and horticultural crops in many parts of the world. New tospoviruses are frequently being described and new hosts are being reported for known tospoviruses. The genetic or molecular basis of the continued emergence of new tospoviruses is not well understood though it is generally accepted that reassortment and/or genetic complementation among the three genomic segments of individual viruses could contribute to this variability since plants infected with more than one tospovirus are not uncommon in nature.

We used two distinct and economically important tospoviruses, Iris yellow spot virus (IYSV) and Tomato spotted wilt virus (TSWV), to investigate inter-virus interactions at the molecular level in dually-infected plants. Datura (Datura

102 stramonium) is a permissive host for TSWV, while it restricts the movement of IYSV to inoculated leaves. In plants infected with both viruses, however, TSWV facilitated the selective movement of the viral gene silencing suppressor (NSs) gene of IYSV to the younger, uninoculated leaves, thus turning a restrictive host into a more permissive one for IYSV. The small RNA expression profiles of IYSV and TSWV in single-and dually- infected datura plants showed that systemically infected leaves of dually-infected plants had reduced levels of TSWV N gene-specific small interfering RNAs (siRNAs). No TSWV

NSs-specific siRNAs were detected either in the inoculated or systemically infected leaves of dually-infected datura plants indicating a more efficient suppression of host silencing machinery in the presence of NSs from both viruses as compared to the presence of only TSWV NSs. Moreover, siRNAs of neither IYSV N nor NSs genes in single-as well as dually-infected plants could be detected.

Our study identifies a new role for the viral gene silencing suppressor in potentially modulating the biology and host range of viruses and underscores the important role of virally-coded suppressors of gene silencing in virus infection of plants.

This is the first experimental evidence of genetic complementation between two distinct tospoviruses in the family Bunyaviridae.

103

INTRODUCTION

The virus family Bunyaviridae consists of five genera of viruses with negative- stranded RNA genomes. All but one genera cause serious diseases in animals and humans [1]. Only one genus, Tospovirus, in this family consists of viruses that infect plants. Tospoviruses cause some of the most destructive diseases in important crop plants and world-wide annual losses could be as high as U.S. $1 billion [2]. Tospoviruses are delineated to the species level based on serological relationships and N gene sequence homologies among the viruses. Tomato spotted wilt virus (TSWV) was the first tospovirus described and is one of the most-studied tospoviruses [3, 4, 5].

Tospoviruses are transmitted by thrips (Thysanoptera: Thripidae) in a persistent and propagative manner [6, 7], and only about 10 of the 5500 known species of

Thysanoptera are reported to be vectors of tospoviruses [8].

For many years, genus Tospovirus was thought to be a monotypic genus consisting of only TSWV until a second tospovirus, Impatiens necrotic spot virus

(INSV), was described [9]. Currently more than 20 distinct tospoviruses are reported from different parts of the world [2, 10]. In the US, besides TSWV and INSV, Iris yellow spot virus (IYSV) was the third tospovirus to be reported [11]. Most recently, a fourth tospovirus, Groundnut ring spot virus (GRSV), was described in tomato in Florida [12].

The increasing diversity of tospoviruses has been attributed to shifts in crop production, differing specificity of thrips vectors, and the segmented nature of the viral genome which could result in genetic reassortants. Moreover, it is generally accepted that tospoviruses, like other RNA viruses, show high mutation rates because of the lack

104 of proofreading ability of their replicases [13]. Genetic reassortment among genomic components of viruses with divided genomes is known to take place in nature [14]. This is likely to contribute to the natural variation and subsequent evolution of viral genomes as in the case of segmented, positive-stranded RNA viruses, bromoviruses, cucumoviruses and nepoviruses [15]. Viruses with segmented RNA genomes use reassortment as a mechanism of genetic divergence and virus variability, i.e. the exchange of genomic segments among different parents. This is facilitated by the presence of mixed infections in plants under natural conditions.

The genome of tospoviruses consists of three RNAs, large (L), medium (M) and small (S). The L RNA is organized in negative sense orientation, whereas the M and S

RNAs are in ambisense [5, 16]. The L RNA codes for the RNA dependent RNA polymerase (RdRp) in negative sense, the M RNA codes for a nonstructural protein,

NSm, in sense direction and the glycoprotein precursor (Gn/Gc) in antisense orientation. The S RNA codes for a non-structural protein (NSs) in sense direction and the nucleocapsid protein (N) in antisense direction. The NSm and Gn/Gc proteins coded by the M RNA play important roles in cell to cell virus movement in plant host, and in vector transmission, respectively [17, 18]. The N protein and NSs protein encoded by the

S RNA serve as the nucleoprotein and suppressor host-mediated gene silencing, respectively [3-5, 20].

The segmented genome of tospoviruses facilitated genetic reassortment studies to map genetic determinants for symptomatology [21], virus resistance [22], and thrips transmission [19]. These studies utilized isolates of the same virus and the

105 reassortments were the result of intra-species exchange of genomic RNAs.

Mixed infections of two distinct tospoviruses in the same host plant have been known to occur in commercial production systems. Kunkalikar et al. [23] reported the mixed infection of watermelon (Citrullus lanatus) plants by Groundnut bud necrosis virus (GBNV) and Watermelon bud necrosis virus (WBNV) under field conditions in central India. Similarly, TSWV and IYSV were shown to infect and co-exist in onion plants under field conditions in Georgia, where 7% of the onion (Allium cepa) plants tested were dually infected with these two distinct tospoviruses [24]. To investigate the nature and extent of interaction between two distinct tospoviruses in dually-infected plants, we utilized an experimental host system under controlled conditions wherein infection of a host plant with two distinct viruses and the subsequent intra-plant spread of infection was monitored. Datura is a differential host for IYSV and TSWV. It is considered a permissive host for TSWV and a restrictive host for IYSV with respect to virus movement following infection (Fig.5.1). Following mechanical inoculation of datura, TSWV invaded the plant and caused a systemic infection by moving from the inoculated leaves to younger, uninoculated leaves. However, IYSV infection of datura remained localized to inoculated leaves [25]. Using virus species-specific probes for each of the viral genes, we showed that in a mixed infection, TSWV facilitated the systemic movement of the silencing suppressor gene of a distinct tospovirus, IYSV, and resulted in more severe systemic symptoms compared to those produced by TSWV infection alone. This is the first experimental evidence of inter-species interaction at the genetic level facilitating systemic movement of a viral suppressor in an otherwise restrictive host. The observed phenomenon could be one of the mechanisms operating through

106 which tospovirus diversity is generated and may explain the continued emergence of new tospoviruses and the expansion of the host range of this economically important group of plant viruses.

RESULTS

Datura is a restrictive host for IYSV

When healthy Datura stramonium leaves are mechanically inoculated with IYSV, infection and subsequent symptom development remained confined to inoculated leaves. Leaves showed 25 to 30 chlorotic local lesions of 2 to 5 mm in diameter 10 to 12 days post inoculation (DPI) (Fig. 5.2A). By 20-25 DPI, the number of local lesions gradually increased and spread. As the lesions coalesced, the inoculated leaves dried 35 to 40 DPI. Throughout this infection process, the virus remained localized and did not spread systematically to younger, un-inoculated leaves; and these younger and uninoculated (=systemic) leaves remained symptomless and virus-free (Fig 5.2B). The virus was detected only in the inoculated leaves by ELISA using the N protein-or NSs protein-specific antisera (Table 5.1). This was further confirmed by RT-PCR using N and

NSs gene-specific primers that would produce 1.1kb and 1.3kb amplicons, respectively, which was amplified from the total RNA from inoculated leaves, but not from the younger, un-inoculated leaves (Fig. 5.2C, lane: N 1 and 2). The presence of the remaining two RNAs of the IYSV genome, M and L RNAs, was confirmed by RT-PCR using primers specific to each of these two RNAs. The various coding regions (NSm,

Gn/Gc and RdRp) of these two RNAs were amplified from inoculated leaves but not

107 from uninoculated systemic leaves (data not shown); further confirming that IYSV was restricted to only inoculated leaves (Fig. 5.2C, lane NSm, Gn/Gc, and RdRp).

Datura is a permissive host for TSWV

D. stramonium plants, when mechanically inoculated with TSWV, first showed a few small concentric ring symptoms, 10-12 DPI on inoculated leaves (Fig. 5.3A). These lesions increased in size and coalesced with others. Infection then spread to younger and uninoculated leaves (=systemic leaves). Systemic symptoms included necrotic spots, curling, yellowing, greening and mottling that spread rapidly throughout the plant (Fig.

5.3B). The emerging buds, flowers and fruits also showed severe necrosis (Fig.5.3B), ultimately leading to senescence of the infected plants by 60-80 DPI. Virus was detected by ELISA 10-12 DPI in both inoculated and younger, uninoculated leaves. To further confirm that the virus became systemic in datura, the presence of all three genomic

RNAs was tested in both inoculated and uninoculated symptomatic leaves. Genes encoded by S (N and NSs), M (NSm and Gn/Gc) and L (RdRp) RNA were amplified using gene-specific primers. Both inoculated (Fig. 5.3C) and systemic leaves were found to contain all five genes. The resulting amplicons were cloned and sequenced to confirm the systemic nature of TSWV infection in datura.

Datura becomes permissive host for IYSV in the presence of TSWV

When leaves of healthy datura were mechanically inoculated with a mixture of

IYSV and TSWV, symptoms first appeared as small chlorotic spots, which gradually developed into mixtures of necrotic spots and concentric rings 7-10 DPI (Fig. 5.4A, B).

108

Symptoms subsequently spread throughout the inoculated leaves and then spread to younger, uninoculated leaves resulting in systemic infection. Systemic symptoms appeared 15-20 DPI that included severe curling, mottling, yellowing and greening (Fig.

5.4C, D). The newly emerging leaves as well as buds showed severe necrotic symptoms and plant growth was severely affected. The symptoms in co-infected plants were much more severe (Fig 5.4) as compared to plants inoculated with TSWV or IYSV only (Fig.

5.2 a & b and 5.3 a & b). The plants also succumbed faster to the dual infection and senesced by 45-50 DPI, as compared to those with TSWV alone which survived 80 DPI.

Detection of IYSV and TSWV in inoculated and systemically infected leaves of dually inoculated datura

The inoculated and systemic leaves of dually inoculated datura plants were separately tested for the presence of both viruses 10-12 DPI by ELISA and RT-PCR. Both

IYSV N and TSWV N proteins could be detected in the inoculated leaves by ELISA. As

TSWV becomes systemic in datura, TSWV N was detected in the systemic leaf. IYSV N was not detected in the systemic leaves indicating that IYSV infection remained localized to the inoculated leaf in datura. However, interestingly, the IYSV NSs protein was detected by ELISA in the systemic leaves of dually inoculated plants using NSs- specific antisera (Table 5. 1).

The uninoculated younger, systemic leaves of dually inoculated datura plants with severe curling and mottling were tested for the presence of S, M and L RNAs of

IYSV and TSWV by RT-PCR using gene-specific primers (Table 5.2). As expected, the systemic leaves of a dually inoculated plant tested at 25-30 DPI showed the presence of

109 all five genes of TSWV (Fig. 5.3F). In the case of IYSV in the same samples, N, NSm,

Gn/Gc or RdRp genes could not be detected. Interestingly, of all the IYSV-coded genes, only the NSs gene was amplified (Fig. 5.3E). All amplification products were cloned and sequenced to confirm the identity of each amplicon.

Expression of N and NSs genes in dually infected datura plants

RT-PCR with specific primers showed that TSWV N and NSs could be detected in inoculated leaves of single and co-infected plants, as well as systemic leaves of a co- infected plant (Fig. 5.5). IYSV N and NSs were also expressed in inoculated leaves of single-or dually-inoculated plants; however, only IYSV NSs was expressed in systemic leaves of a co-infected plant (Fig. 5.5). All the genes that could be amplified were cloned and sequenced to confirm the identity of each amplicon. To determine the relative levels of the viral genomic RNA transcripts, the inoculated and systemic leaves of D. stramonium from single and dually infected plants (IYSV+TSWV) were analyzed for

IYSV and TSWV N and NSs gene expression using gene-specific cDNA probes (Fig. 5.6).

The results confirmed the specificity of the probes for IYSV and TSWV as no bands were detected for IYSV when probed with TSWV and vice versa. In agreement with the results obtained with RT-PCR, the IYSV N gene expression could be detected in inoculated leaves of IYSV and was absent in systemic leaves (Fig. 5.6) in plants inoculated with

IYSV only. Again, in agreement with the RT PCR results, in the case of plants inoculated with both IYSV and TSWV, the IYSV N gene was detected only in inoculated leaves (Fig.

5.6), and was absent in the younger, uninoculated leaf. Moreover, Northern blots showed that the IYSV N gene expression was higher in inoculated leaves in the case of

110 dually infected plants as compared to those inoculated with IYSV alone (Fig.5.6).

In the case of IYSV NSs, the gene expression was detected only in inoculated leaves of singly infected plants and was absent in systemic leaves (Fig. 5.6), which was in agreement with the results obtained by RT-PCR. However, in the case of dually infected plants, NSs transcript was detected in both inoculated and systemic leaves (Fig. 5.6), indicating that only IYSV NSs is selectively translocated and expressed in systemic leaves in the presence of TSWV.

As expected, the TSWV N and NSs gene expression was detected in inoculated and systemic leaves of plants with single and dual infection (Fig. 5.6), and the N gene expression pattern of TSWV was similar in both single and dually infected plants, with expression being higher in inoculated leaves as compared to systemic leaves (Fig. 5.6).

However, TSWV NSs expression showed variation in the presence of IYSV. The relative level of TSWV NSs was much higher in systemic leaves of dually infected plants (Fig.

5.6) compared to leaves from plants infected with TSWV only. These results showed that the IYSV NSs gene is expressed only in systemic leaves of plants inoculated with both

IYSV and TSWV, and also that the expression of TSWV NSs in systemic leaves is much higher in the presence of IYSV NSs.

Small RNA expression of N and NSs genes

Small RNAs corresponding to N and NSs genes were analyzed by Northern blot analysis for single and dual infections in inoculated as well as systemic leaves. The small

RNA fraction from infected samples was subjected to polyacrylamide gel electrophoresis

111 and Northern hybridization using gene-specific probes to detect the presence of 21-24 nucleotide siRNAs. TSWV N gene-specific siRNAs were detected in both inoculated and systemic leaves of plants in the case of single as well as dual infection (Fig. 5.7A). The probes used were specific for TSWV and did not hybridize with any of the samples from

IYSV-inoculated plants (Fig. 5.7A, lanes 2, 3). In the case of NSs, interestingly, we detected the siRNAs in leaf samples inoculated with TSWV only (Fig. 5.7B, lanes 8, 9); while we did not detect TSWV NSs siRNAs either in the inoculated or systemic leaves of plants inoculated with both TSWV and IYSV (Fig. 5.7B, lanes 5, 6). This suggested that the silencing suppressor (NSs) of TSWV was not subjected to the plant’s silencing machinery in the presence of silencing suppressor of IYSV. The blots were also probed with IYSV N-and NSs-specific probes and we could not detect siRNAs for either gene in single or dually inoculated plants.

DISCUSSION

Mixed infections of plants with viruses is a natural phenomenon, and the outcome of this inter-virus interaction is influenced by several factors including the host plant’s genetic background and growth stage, genetic relatedness of the viruses, and environmental conditions. The outcomes include elimination of one virus from the mixed infection by the second virus, co-existence and continued replication of both viruses for the remainder of the plant’s life, or increased titer of one virus resulting in more severe symptoms (synergism). Mixed infections could also result in genetic recombination or genetic reassortment between the co-infecting viruses that would lead to generation of new viruses or strains with a subsequent expansion of the host range

112

[26-28]. Recently Webster et al., [15] reported emergence of a new tospovirus

Groundnut ring spot virus (GRSV) in the USA due to genome reassortment of two viruses, GRSV and Tomato chlorotic spot virus (TCSV), with the large (L) and small (S)

RNAs coming from GRSV and the medium (M) RNA from TCSV (i.e., LGMTSG). This exchange of genetic material and interaction between co-infecting viruses resulting in synergism or complementation could lead to changes in biological properties and increased diversity of viruses, especially those with segmented genomes due to genetic reassortment [21]. A related phenomenon is transcomplementation, in which a viral protein, usually expressed from a transgene, enhances or supports the infection of another virus from a distinct species [29].

Synergistic interactions between viruses leading to more severe disease have been described for positive-stranded RNA viruses and DNA viruses [30-39]. Although synergism and transcomplementation are very common among viruses, there are no reports of ambisense or negative sense viruses showing this phenomenon [29]. We present the first report of genetic complementation in ambisense tospoviruses. Our finding that TSWV is potentially facilitating the movement of a viral protein of another distinct tospovirus, IYSV, from point of inoculation to younger, systemic leaves of an otherwise restrictive host is the first instance of such an interaction between viruses in the genus Tospovirus.

We utilized a model system wherein the experimental host, datura, responds differentially to two distinct tospoviruses, IYSV and TSWV. While this host is susceptible to infection by both viruses, it is a permissive host to TSWV (where the virus

113 invades the plant and causes systemic infection), whereas IYSV infection is confined to inoculated leaves and fails to move to younger, uninoculated leaves [25]. There are more than 24 distinct tospoviruses known to date and mixed infections of tospoviruses are taking place under natural conditions [23-24]. However, there has been so far no experimental evidence of genetic complementation between two distinct tospoviruses.

The differential response of datura to IYSV and TSWV allowed us to investigate if such an interaction at the genetic level takes place in dually infected plants.

Datura plants inoculated with IYSV alone showed symptoms of infection only on the inoculated leaves, with younger systemic leaves remaining symptomless. On the other hand, TSWV inoculation resulted in symptoms on the inoculated as well as systemic leaves (Fig. 5.3). This was also corroborated in terms of gene expression, with young systemic leaves in the case of plants inoculated with IYSV remaining negative for all genes tested and TSWV showing positive gene expression of all three RNAs (S, M and

LRNA) in inoculated as well as systemic leaves.

Dual infection of datura plants with IYSV and TSWV resulted in an increase in the symptom severity of the inoculated as well as the systemic leaves with plants succumbing to the virus 40 days post-inoculation (DPI) as compared to 80 dpi in the case of single infection with TSWV. In addition, the IYSV NSs was selectively expressed in the younger, uninoculated leaves of dually infected D. stramonium. NSs have been reported as the silencing suppressor in tospoviruses [20].

Availability of antisera specific to each of the TSWV and IYSV N proteins and the

IYSV NSs protein enabled us to determine the expression of these genes in individually

114 and dually infected plants. While the relative levels of these proteins as reflected by the absorbance values varied among individual plants within a treatment, we were able to consistently detect these proteins. TSWV N could be detected in inoculated as well as systemic leaves as expected. IYSV N and NSs could be found only in inoculated leaves in singly infected plants (since the virus is confined to inoculated leaves in datura). In case of dually infected plants, the IYSV NSs protein was expressed in uninoculated leaves, albeit to a lower level.

Hassani-Mehraban [40] obtained transgenic plants resistant to five different tomato-infecting Tospovirus spp. including TSWV and a tomato-infecting strain of

Tomato yellow ring virus (TYRV-t) using partial N gene sequences. They showed that transgenic resistance against TYRV-t does not hold against the soybean strain (TYRV-s) and is broken by TYRV-t when co-inoculated with TYRV-s. TYRV-t could be detected in the systemic leaves of a resistant line in co-inoculated plants implying a transcomplementation event involving a protein of TYRV-s. They further showed that the presence of TYRV-s encoded silencing suppressor (NSs) was crucial for rescuing of

TYRV-t. The severe symptoms in datura plants dually infected with TSWV and IYSV, compared to those individually infected either with TSWV or IYSV, could be explained by the fact that the level of the silencing suppressor, NSs, of both viruses was much higher in dually infected than in singly infected Datura (Fig. 5.7). Even in the case of

TSWV, which causes systemic infection in datura, the presence of IYSV in the same plant resulted in more severe systemic symptoms. This could be due to the selected movement and subsequent accumulation of NSs of IYSV in the younger, uninoculated

115 leaves. This is the first experimental evidence of synergistic interactions between two distinct viruses in the genus Tospovirus.

TSWV NSs has been shown to be a strong suppressor of RNA silencing not only in plants but also in Tick cells [41]. Oliveira et al., [42] reported that NSs of TSWV enhanced baculovirus replication in permissive and semi-permissive insect cell lines. A recombinant baculovirus with TSWV NSs was inserted into the viral genome and the construct replicated to higher titers than the wild type in permissive and semipermissive lepidopteron insect cell lines tested. In addition, it also infected a non- permissive host cell line in the presence of NSs. This suggests that NSs plays an important role in enhancement of gene expression during tospovirus infection in its thrips vector. In our study, we found that TSWV NSs facilitated the selective translocation and expression of IYSV NSs in the systemic leaves of a dually infected plant. Also, the presence of the NSs from both viruses in inoculated as well as systemic leaves enhanced the severity of symptoms as well as virus titers. The N as well as NSs gene expression of IYSV in inoculated leaves of datura was enhanced in the presence of

TSWV (Fig. 5.6). The TSWV NSs expression was also higher in the systemic leaf of a dually infected plant. These results are of significance in terms of field infections by multiple tospoviruses even in restricted or non-permissive hosts. It was recently shown that NSs encoded by GBNV is a bifunctional enzyme and could participate in viral movement, replication and suppression of host defense mechanism [43]. One experimental approach to verify the observed interaction between the silencing suppressors is to use NSs-deficient mutant TSWV or IYSV. However, lack of infectious clones of these viruses is a constraint to carrying out such an experiment.

116

In terms of small RNA expression in single versus dually infected datura plants, it was observed that systemically infected leaves of dually infected plants showed reduced levels of TSWV N gene specific siRNAs (Fig. 5.7, compare lanes 6 and 9). No TSWV NSs- specific siRNAs were detected in inoculated nor systemic leaves of dually infected datura plant (Fig.5.7, lanes 5 and 6 compared to lanes 8 and 9) indicating a more efficient suppression of host silencing machinery in the presence of NSs from both viruses as compared to the presence of only TSWV NSs. Also, we did not detect siRNAs of IYSV N or NSs genes in single as well as dually infected plants. This suggests that the IYSV NSs is a strong suppressor of RNA silencing and could be functioning by sequestering the siRNAs or may also have affinity for long dsRNAs. Schnettler et al., [44] showed that

NSs from different tospoviruses interfere with RNA silencing pathway by sequestering siRNAs and microRNA duplexes. In addition, NSs from TSWV, INSV and GRSV was shown to have affinity for long dsRNA, whereas TYRV NSs did not. It was suggested that

TSWV NSs may bind to the ambisense S-RNA encoded hairpin structure to prevent its recognition and subsequent degradation in plants by Dicer-like proteins, while simultaneously supporting translational enhancement of viral transcripts by circularization [45]. Our results also show that NSs of IYSV and TSWV in a dually infected plant may have escaped the plant RNA silencing machinery as indicated by absence of NSs-specific siRNAs in inoculated as well as systemic leaves.

Genetic reassortment has long been accepted as one of the means by which new viruses or strains are generated among viruses with segmented genomes. Such a naturally occurring genetic reassortant between GRSV and Tomato chlorotic spot virus

(TCSV) has recently been described [15]. Tobacco plants infected with Tobacco mosaic

117 virus and Cucumber mosaic virus produce a synergistic disease with severe malformations [46]. They have further shown that the effect appears to be a result of joint action of the viral silencing suppressors, CMV 2b protein and TMV162kDa replicase subunit, on the plant silencing machinery. Our findings suggest that the genetic complementation could result in expanding the host range of a particular virus by turning a restrictive host into a permissive one. Hassani Mehraban et al., [40] showed that isolates with even less than 20% sequence divergence can break down RNA silencing-mediated resistance to tospoviruses as a result of NSs expression. This has consequences for the use of RNA-mediated resistance against Tospovirus spp. such as

TYRV and IYSV with N gene variation of only 10 to 15%.

The model system we developed facilitates further studies on the nature of protein-protein interactions between the silencing suppressors of distinct tospoviruses in dually infected plants, the nature of the plant factors that interact with the viral proteins, and the effect of dual infection on the profile of virus-specific small RNAs produced as a result of host-induced gene silencing.

MATERIALS AND METHODS

Viruses

IYSV and TSWV originally isolated from naturally infected onion and peanut

(Arachis hypogaea) plants respectively, were maintained on experimental hosts,

Datura stramonium and Nicotiana benthamiana under controlled conditions in a greenhouse.

118

Virus inoculations of host plants

Virus-infected tissue was homogenized by grinding in 0.01 M sodium phosphate buffer (pH 7.0) containing 0.4% β-Mercaptoethanol and the homogenate was used as the inoculum for mechanical inoculation to experimental hosts. Fully expanded leaves

(25-30 days old) of D. stramonium and N. benthamiana were dusted with silicon carbide (600 mesh) and the homogenate was manually applied using cotton buds.

Inoculated plants were maintained at 25/18°C (day/night), 14 h day light and observed for development of symptoms. For establishing mixed infections, leaves from D. stramonium plants individually infected with TSWV or IYSV were homogenized together in equal amount of tissue and mechanically inoculated on to healthy

D.stramonium and N. benthamiana plants as stated earlier. All experiments were repeated at least three times. The inoculated as well as systemically infected leaves of both hosts were harvested 25-30 days after inoculation, and stored at 4°C for further analysis.

ELISA

Virus infection of inoculated plants was confirmed by ELISA using commercially available kits for TSWV and IYSV (Agdia Inc., Elkhart IN, USA) following manufacturer’s instructions. IYSV NSs-specific polyclonal antiserum was made to E. coli-expressed NSs protein which was used in a direct antigen-coated ELISA format

[47].

119

RT-PCR

Total plant RNA was extracted separately from the symptomatic and asymptomatic IYSV and TSWV-infected plant tissue using the Plant RNeasy mini kit

(Qiagen, Valencia CA, USA). RT-PCR was performed to detect the presence of various genomic RNAs (L, M, and S) of TSWV and IYSV using gene-specific primers (Table 5.2).

RNA extraction and analysis

Symptomatic tissues were collected from inoculated and systemic leaves from co- infected datura plants and snap frozen immediately in liquid nitrogen. Frozen leaf tissue was homogenized in liquid nitrogen using a mortar and pestle. Total RNA was extracted using TRIZOL reagent (Life Technologies, Green Island NY USA) following the manufacturer’s instructions. Low molecular weight RNAs were selectively precipitated by PEG8000/NaCl as described previously [48], except that the low molecular weight

RNA was resuspended in 100 % deionised formamide. The concentration of low molecular weight RNA was determined using Nano Drop spectrophotometer (Thermo

Fisher Scientific, Barrington IL USA) and visualized on agarose gel to enable equal loading.

Total RNA (20 µg) from plant samples was subjected to Northern blot analysis

[49]. RNA blots were probed with full-length TSWV N and NSs and IYSV N and NSs genes radiolabeled with 32P dATP. Small RNA was separated on a 17% polyacrylamide-

7M urea gel and transferred to positively charged nylon membrane (Roche, San

Francisco, CA USA) by the semi-dry blot method [50]. Hybridization was done at 40C

120 using UltraHyb buffer (Life Technologies, Green Island NY USA) and 32P-radiolabeled probes by end-labeling with T4 polynucleotide kinase enzyme for oligo probes and random-priming method with Megaprime kit (GE Healthcare, USA) for larger double- stranded DNA probes following manufacturer’s instructions. The radiolabeled probes were column-purified. The blots were washed twice in 2x SSC, 0.1 % SDS at 400C for 10 minutes, exposed to X-ray film (Agfa-Curix Ortho HT-G, Mortsel, Belgium), and the film was developed. Blots were stripped in boiling 2x SSC, 0.1% SDS for 10-15 minutes, and verified for residual radiation by overnight exposure before re-probing with a different probe.

121

Table 5.1: Detection of Iris yellow spot virus (IYSV) and Tomato spotted wilt virus (TSWV) in Datura stramonium plants.

Treatment Absorbance values A405* IYSV TSWV N NSs N IYSV inoculated 1.96 0.79 N/A IYSV systemic 0.12 0.20 N/A TSWV inoculated N/A N/A 3.6 TSWV systemic N/A N/A 4.0 IYSV+TSWV inoculated 0.22 0.97 3.8 IYSV+TSWV systemic 0.38 0.65 4.0

* D. stramonium plants infected with IYSV or TSWV alone, or co-inoculated were tested for the presence of IYSV non structural protein (NSs) using direct antigen coated- enzyme linked immunosorbent assay, and the IYSV and TSWV nucleocapsid (N) proteins using double antibody sandwich enzyme-linked immunosorbent assay. N/A: not applicable as the antisera are specific to homologous antigens and do not cross react. The A405 values of uninfected (healthy) controls ranged from0.12 for 0.14 for all three antisera.

122

55 55 55 55 55 65 52 52 64 60 Tm Tm 52.5

Size bp 1100 1330 994 1016 711 777 462 1512 909 976 780

Gene N NSs NSm Gn/Gc RdRp N N NSs NSm Gn/Gc RdRp

IYSV CTCTTAAACACATTTAACAAGCA TAAAACAAACATTCAAACAA CCTTTTTTTTTTCATATGTCTACCGTTAGG ACTACGGC TTATGGATCCTCACTGCAGCTCTTCTACA ATGTCTCTCCTAACTAACGTG CATACTTCATTAAATCTGTTCT CATTTTTTGTCTTCCAAAGT CAAACAATCAGCCTAAGATG ATACAATGTCAAGCACTTAG TGTACAGATTGGTTAGTATG TSWV ATGTCTAAGGTTAAGCTCACTA TTAAGCAAGTTCTGTGAGTTTT CAGACAGGATTGGAGCCACT TCACTGTAATGTTCCATAGCAA AGAGCAATTGTGTCATAATT TTATAAGTAAAGAAAGAAAA ATGTTGACTCTTTTCGGT CTATATTTCATCAAAGGATAA CCTGTATAATCCGAAAACCC GCATCACTAGCCCTGAG TCCTGGTGAAGTGAATGATA AAACCACCTGAAATTGTAGT

5883C

3050F 4025C

- - 4893F 5581C - 3790F 4806C

1F 909C

- - - 4870F

- - -

1F 1531C - - - F R

- -

1F 777C 248F 710C - - - - F R RdRp - - N N N N NSs NSs NSm NSm Gn/Gc Gn/Gc RdRp RdRp ------N N NSs NSs NSm1F NSm994C Gn/Gc Gn/Gc RdRp ------Primer pairs Primer IYSV IYSV IYSV IYSV IYSV IYSV IYSV IYSV IYSV IYSV TSWV TSWV TSWV TSWV TSWV TSWV TSWV TSWV TSWV TSWV TSWV TSWV

RNA S RNA M RNA RNA L S RNA M RNA RNA L Table 5.2: List of primers used oftranscription-polymerase reverse used primers in List 5.2: Table reaction. chain

123

A B C

Fig 5.1: Schematic Representation of Datura stramonium as a differential host to

Iris yellow spot virus (IYSV) and Tomato spotted wilt virus (TSWV). (A): IYSV infection is localized in inoculated leaves; (B): TSWV causes systemic infection; (C): Co-inoculation of IYSV and TSWV results in severe systemic infection.

124

N NSs NSm GnGc RdRp

M 1 2 1 2 1 2 1 2 1 2

1.5 kb 1 kb

0.75 kb C

Fig 5.2: Datura stramonium is a restrictive host to infection by Iris yellow spot virus (IYSV). (A): Inoculated leaves with local lesions as a result of virus

infection;(B): Younger, uninoculated leaves of the same plant remain symptomless;(C) : Detection of IYSV genes in inoculated leaves of D. stramonium using reverse transcription-polymerase chain reaction. Total RNA was used as a template for amplifying the genes using specific primers as described in Table 1. Lane M: 1 kb Marker; Lane 1: Leaf from uninoculated plant as negative control; Lane 2: IYSV inoculated leaf. Lane N: IYSV nucleocapsid (N) protein gene; Lane NSs: IYSV nonstructural (NSs) protein gene; Lane NSm:

IYSV nonstructural (NSm) protein gene; Lane GnGc: IYSV Glycoprotein precursor (GnGc); Lane RdRp: IYSV RNA dependent RNA polymerase (RdRp).

125

A B

N NSs NSm GnGc RdRp

M 1 2 1 2 1 2 1 2 1 2

1.5 kb

0.75 kb 0.5 kb C

Fig. 5.3: Datura stramonium is a permissive host for Tomato spotted wilt virus (TSWV). D.stramonium is infected with TSWV (A): Inoculated leaves with local lesions as a result of virus infection; (B): Younger, uninoculated leaves of the same plant shows severe necrotic symptoms; (C): Detection of TSWV genes in inoculated leaves of D. stramonium using reverse transcription-polymerase chain reaction. Total RNA was used as a template for amplifying the genes using specific primers as described in Table 1. Lane M: 1 Kb Marker; Lane 1: TSWV inoculated leaf; Lane 2: Leaf from uninoculated plant as negative control. N: TSWV nucleocapsid (N) protein gene; NSs: TSWV nonstructural (NSs) protein gene; NSm: TSWV nonstructural (NSm) protein gene; GnGc: TSWV Glycoprotein precursor (GnGc); RdRp: TSWV RNA dependent RNA polymerase (RdRp).

126

A B

C D

IYSV TSWV M N NSs NSm GnGc RdRp M N NSs NSm GnGc RdRp

1.5 kb 1.5 kb

1 kb 1 kb

0.75 kb 0.75 kb

0.5 kb 0.5 kb E F

Fig.5.4: Datura stramonium plants co-inoculated with Iris yellow spot virus (IYSV)

and Tomato spotted wilt virus (TSWV). Dual infection results in more severe systemic symptoms. (A and B): Necrotic spots and concentric rings on inoculated leaves; (C and D): Systemic symptoms including leaf curling, severe venial chlorosis, and yellowing on younger un-inoculated leaves. (E): Co-infected systemic leaves: Lane M: Marker; Lane N: IYSV-nucleocapsid (N) protein gene; Lane NSs: IYSV-nonstructural (NSs) protein gene; Lane NSm: IYSV-nonstructural (NSm) protein gene; Lane GnGc: IYSV- Glycoprotein precursor (GnGc); Lane RdRp: IYSV-RNA dependent RNA polymerase

(RdRp). (F):Co-infected systemic leaves: Lane M: Marker; Lane N: TSWV- nucleocapsid (N) protein gene; Lane NSs: TSWV-nonstructural (NSs) protein gene; Lane NSm: TSWV-nonstructural (NSm) protein gene; Lane GnGc: TSWV- Glycoprotein precursor (GnGc); Lane RdRp: TSWV-RNA dependent RNA polymerase (RdRp). 127

Fig 5.5:Detection of nucleocapsid (N) protein gene and non-structural (NSs) protein genes in inoculated and uninoculated systemic leaves of Datura stramonium plants infected with Iris yellow spot virus (IYSV) and Tomato spotted wilt virus (TSWV) in plants individually or co-infected.

128

Fig.5.6: Expression of N and NSs gene of Iris yellow spot virus (IYSV) and Tomato spotted wilt virus (TSWV) in single and dual infected Datura stramonium plants using gene specific cDNA probes. The leaf samples were harvested 15-20 days post inoculation from inoculated and systemic leaves

Gel A: IYSV nucleocapsid (N) protein gene expression Gel B: IYSV nonstructural (NSs) protein gene gene expression Gel C: TSWV nucleocapsid (N) protein gene expression Gel D: TSWV nonstructural (NSs) protein gene gene expression Lane 1: Healthy uninfected control; Lane 2: IYSV only inoculated leaf; Lane 3: IYSV only systemic leaf; Lane 4: TSWV only inoculated leaf; Lane 5: TSWV only systemic leaf; Lane 6: IYSV+ TSWV inoculated leaf;

Lane 7: IYSV+ TSWV systemic leaf.

129

1 2 3 4 5 6 7 8 9

Fig 5.7: Small RNA expression of nucleocapsid (N) protein gene and nonstructural (NSs) protein gene of Iris yellow spot virus (IYSV) and Tomato spotted wilt virus (TSWV) in single and dual infected Datura

stramonium plants. The leaf samples were harvested 25-30 days after inoculation from inoculated and systemic leaves. (Gel A): TSWV N gene specific small interfering RNAs. (Gel B): TSWV NSs gene specific small interfering RNAs. (Gel U6): Control

Lane 1: Healthy uninfected control; Lane 2: IYSV inoculated leaf; Lane 3: IYSV systemic leaf; Lane 4: Blank; Lane 5: IYSV+TSWV inoculated leaf; Lane 6: IYSV+TSWV systemic leaf; Lane 7: Blank; Lane 8: TSWV inoculated leaf; Lane 9: TSWV systemic leaf.

130

REFERENCES

1. Elliott RM (1997) Emerging Viruses: The Bunyaviridae. Molecular Medicine 3: 572- 577.

2. Pappu HR, Jones RAC, Jain RK (2009) Global status of tospovirus epidemics in diverse cropping systems: Successes gained and challenges ahead. Virus Research 141:219-236.

3. Tsompana M, Moyer JW (2008) Tospoviruses. In: Mahy BWJ, Van Regenmortel, MHV editors. Encyclopedia of Virology. 3rd Edn. Vol 5. Elsevier Ltd, Oxford, UK. pp 157-162.

4. Pappu HR (2008) Tomato spotted wilt virus (Bunyaviridae). In: Mahy BWJ, Van Regenmortel, MHV editors. Encyclopedia of Virology. 3rd Edn., Vol 5. Elsevier Ltd, Oxford, UK. pp 133-138.

5. Adkins S (2000) Tomato spotted wilt virus-positive steps towards negative success. Molecular Plant Pathology 1:151-157.

6. Ullman DE, Meideros R, Campbell LR, Whitfield AE, Sherwood JL, et al. (2002) Thrips as vectors of tospoviruses. Advances in Botanical Research 36:113-140.

7. Whitfield AE, Ullman DE, German TL (2005) Tospovirus-thrips interactions. Annual Review Phytopathology 43:459-489.

8. Mound LA (2001) So many thrips-so few tospovirus. In: Marullo R, Mound LA, editors. Thrips and Tospoviruses: Proceedings of the 7th International Symposium on Thysanoptera. pp 17-18.

9. Law MD, Moyer JW (1990) A tomato spotted wilt-like virus with a serologically distinct N protein. Journal of General Virology 71:933-938.

10. Mandal B, Jain RK, Krishnareddy M, Krishna Kumar NK, Ravi KS, et al.(2012) Emerging problems of Tospoviruses (Bunyaviridae) and their management in the Indian subcontinent. Plant Disease 96:468-479.

11. Hall JM, Mohan K, Knott EA, Moyer JW (1993) Tospoviruses associated with scape blight of onion (Allium cepa) seed crops in Idaho. Plant Disease 77:952.

12. Webster CG, Perry KL, Lu X, Horsman L, Frantz G, et al. (2010) First report of Groundnut ringspot virus infecting tomato in south Florida. Plant Health Progress. doi: 10.1094/PHP-2010-0707-01-BR.

131

13. Zhou J, Kantartzi SK, Wen RH, Newman M, Hajimorad MR, et al. (2011) Molecular characterization of a new tospovirus infecting soybean. Virus Genes. 43:289–295.

14. Moya A, Elena SF, Bracho A, Miralles R, Barrio E (2000) The evolution of RNA viruses: A population genetics view. Proc Natl Acad Sci USA, 97: 6967-6973.

15. Webster CG, Stuart RR, Perry KL, Scott A (2011) A natural M RNA reassortant arising from two species of plant- and insect-infecting bunyaviruses and comparison of its sequence and biological properties to parental species. Virology 413:216-225.

16. Roossinck MJ (1997) Mechanisms of plant virus evolution. Annual Review of Phytopathology 35:191-209.

17. Moyer JW (2000) Tospoviruses. In: Hull R, editor. Encyclopedia of Microbiology. Vol. 4. Academic Press. pp. 592-597.

18. Kormelink R, Storms M, van Lent J, Peters D, Goldbach R (1994) Expression and subcellular location of the NSm protein of Tomato spotted wilt virus (TSWV), a putative viral movement protein. Virology 200: 56-65.

19. Sin SH, McNulty BC, Kennedy GG, Moyer JW (2005) Viral genetic determinants for thrips transmission of Tomato spotted wilt virus. Proc Natl Acad Sci USA, 102:5168- 5173.

20. Takeda A, Sugiyamaa K, Naganob H, Moric M, Kaidoa M, et al.(2002) Identification of a novel RNA silencing suppressor, NSs protein of Tomato spotted wilt virus. FEBS Letters 532:75-79.

21. Qiu WP, Geske SM, Hickey CM, Moyer JW. (1998) Tomato spotted wilt Tospovirus genome reassortment and genome segment-specific adaptation. Virology 244:186- 194.

22. Hoffmann K, Qiu WP, Moyer JW (2001) Overcoming host and pathogen mediated resistance in tomato and tobacco maps to the M RNA of Tomato spotted wilt virus. Molecular Plant Microbe Interaction 14:242-249.

23. Kunkalikar SR, Poojari S, Arun BM, Rajagopalan PA, Chen TC, et al.(2011) Importance and genetic diversity of vegetable-infecting tospoviruses in India. Phytopathology 101:367-376.

24. Mullis SW, Langston Jr DB, Gitaitis RD, Sherwood JL, Csinos AC (2004) First report of Vidalia onion (Allium cepa) naturally infected with Tomato spotted wilt virus and Iris yellow spot virus (family Bunyaviridae, genus Tospovirus) in Georgia. Plant Disease 88:1285.

132

25. Bag S, Pappu HR (2009) Symptomatology of Iris yellow spot virus in selected indicator hosts. Plant Health Progress. Doi:10.1094/PHP-2009-0824-01-BR.

26. Palukaitis P, Garcı´a-Arenal F (2003) Cucumoviruses. Advances in Virus Research 62: 241-323.

27. Wege C, Siegmund D (2007) Synergism of a DNA and a RNA virus: enhanced tissue infiltration of the begomovirus Abutilon mosaic virus (AbMV) mediated by Cucumber mosaic virus (CMV). Virology 357:10-28.

28. Webster CG, Turechek WW, Mellinger HC, Frantz G, Roe N, et al. (2011) Expansion of Groundnut ringspot virus host and geographic ranges in solanaceous vegetables in Peninsular Florida. Plant Health Progress. Doi: 10.1094/PHP-2011-0725-01-BR.

29. Latham JR, Wilson AK (2008) Transcomplementation and synergism in plants: implications for viral transgenes? Molecular Plant Pathology 9:85-103.

30. Calvert LA, Ghabrial S (1983) Enhancement by Soybean mosaic virus of Bean pod mottle virus titer in doubly infected soybean. Phytopathology 73:992-997.

31. Choi SK, Yoon J Y, Ryu KH, Choi JK, Palukaitis P, et al. (2002) Systemic movement of a movement-deficient strain of Cucumber mosaic virus in zucchini squash is facilitated by a cucurbit infecting potyvirus. Journal of General Virolology 83:3173- 3178.

32. Goldberg KB, Brakke MK (1987) Concentration of Maize chlorotic mottle virus increased in mixed infections with Maize dwarf mosaic virus, strain B. Phytopathology 77:162-167.

33. Ilenia RC, Beatriz XC, Roberto RM, Rafael FRB (2011) Geminivirus mixed infection on pepper plants: Synergistic interaction between PHYVV and PepGMV. Virology Journal 8:104.

34. Malyshenko SI, Kondakova OA, Taliansky M, Atabekov JG (1989) Plant virus transport function: complementation by helper viruses is non-specific. Journal of General Virology 70:2751-2757.

35. Mascia T, Fabrizio C, Fanelli V, Sialer MMF, De Stradis A, et al. (2010) Characterization of the interactions between Cucumber mosaic virus and Potato virus Y in mixed infections in tomato. Molecular Plant Microbe Interaction 23:1514- 1524.

36. Palukaitis P, Kaplan IB (1997) Synergy of virus accumulation and pathology in transgenic plants expressing viral sequences. In: Tepfer M, Balázs E. editors. Virus-

133

Resistant Transgenic Plants: Potential Ecological Impact. Springer-Verlag, Berlin. pp 77-84.

37. Pruss G, Ge X, Shi XM, Carrington JC, Vance BV (1997) Plant viral synergism: The potyviral genome encodes a broad range pathogenicity enhancer that trans-activates replication of heterologous viruses. Plant Cell 9:859-868.

38. Vance VB (1991) Replication of Potato virus X RNA is altered in coinfections with Potato virus Y. Virology182:486-494.

39. Wang Y, Gaba V, Yang J, Palukaitis P, Gal-on A (2002) Characterization of synergy between Cucumber mosaic virus and potyviruses in cucurbit hosts. Phytopathology 92:51-58.

40. Hassani-Mehraban A, Brenkman A B, van den Broek NJF, Goldbach R, Kormelink R (2009) RNAi-mediated transgenic tospovirus resistance broken by intraspecies silencing suppressor protein complementation. Molecular Plant Microbe Interaction. 22:1250-1257.

41. Garcia S, Billecocq A, Crance JM, Prins M, Garin D, et al. (2006) Viral suppressors of RNA interference impair RNA silencing induced by a Semliki Forest virus replicon in tick cells. Journal of General Virology 87:1985-1989.

42. Oliveira VC, Bartassona L, de Castrob MEB, Corrêaa JR, Ribeiroa BM, et al.(2011) A silencing suppressor protein (NSs) of a tospovirus enhances baculovirus replication in permissive and semipermissive insect cell lines Virus Research 155:259-267.

43. Lokesh B, Rashmi PR, Amruta BS, Srisathiyanarayanan D, Murthy MRN et al. (2010) NSs encoded by Groundnut bud necrosis virus is a bifunctional enzyme. PLoS ONE 5:e9757.

44. Schnettler E, Hemmes H, Huismann R, Goldbach R, Prins M et al. (2010) Diverging Affinity of Tospovirus RNA silencing suppressor proteins, NSs, for various RNA duplex molecules. Journal of Virology 84:11542-11554.

45. Geerts-Dimitriadou C, Lu Y-Y, Geertsema C, Goldbach R, Kormelink R (2012) Analysis of the Tomato spotted wilt virus ambisense S RNA-encoded hairpin structure in translation. PLoS ONE 7:e31013.

46. Siddiqui SA, Valkonen JPT, Rajamäki ML, Lehto K (2011) The 2b silencing suppressor of a mild strain of Cucumber mosaic virus alone is sufficient for synergistic interaction with Tobacco mosaic virus and induction of severe leaf

134

malformation in 2b-Transgenic Tobacco Plants. Molecular Plant Microbe Interaction 24:685-693.

47. Bag S, Druffel KL, Rondon S, Riley DG, Pappu HR (2009) A serological assay for the detection of the nonstructural protein (NSs) of Iris yellow spot virus and its use in virus detection in plant and thrips vectors. Journal of Insect Science 10:166.

48. Hamilton AJ, Voinnet O, Chappell L, Baulcombe DC (2002) Two classes of short interfering RNA in RNA silencing. EMBO 21:4671-4679.

49. Sambrook J, Fritsch, EF, Maniatis T (2001) Molecular Cloning: A Laboratory Manual. 3rd (Ed). Cold Spring Harbor Laboratory Press, New York.

50. Mitter N, Sulistyowati E, Dietzgen RG (2003) Cucumber mosaic virus infection transiently breaks dsRNA-induced transgenic immunity to Potato virus Y in tobacco. Molecular Plant Microbe Interactions 16:936-944.

135

CHAPTER SIX

CONCLUSIONS

Onion (Allium cepa) is a high value crop cultivated in around 54,000 hectare in

Pacific northwestern (PNW) states of the United States, contributing nearly 80% of total

US summer production. Onion is under tremendous disease pressure from wide range of pathogens. Iris yellow spot virus (IYSV) member of family Bunyaviridae; Genus

Tospovirus causes serious disease and economic loss in allium growing regions of the

US and around the world. Transmitted by Thrips tabaci L. (onion thrips), it can cause up to 100 percentage crop loss. Due to lack of any resistant varieties, presently it is controlled by application of insecticides to control the virus vector, onion thrips, which further adds to crop cost.

Under the present investigation onion samples were collected from commercial onion fields from different geographical regions of the western USA. The isolates were characterized on the basis of the host range, their ability to cause infection and movement of viruses along the plant. Based on symptom development, in indicator hosts Nicotiana benthamiana and Datura stramonium were found to be differential hosts for IYSV. IYSV is systemic in N. benthamiana resulting on senescence of the plants whereas it remains localized to inoculated leaves of D. strominium and the plants were able to survive the infection. Based on the disease severity on N. benthamiana, isolates from California (CA), Idaho (ID), and Washington (WA) were differentiated as severe and mild isolates. IYSV-ID and IYSV-WA were found to be severe isolates as the test plants senescence earlier relative to the IYSV-CA isolate that survives the infection.

136

Our findings suggested that IYSV does exist as biologically diverse isolates that differ in their pathogenicity. It remains to be seen if IYSV isolates display similar differences upon infection of onion. Lack of reliable protocols for efficient infection of onion plants with IYSV is a constraint to carrying out such studies under controlled conditions.

Knowledge on the nature and prevalence of these isolates would aid in more effective screening of onion cultivars, breeding material and germplasm to identify and select for

IYSV resistance that is more durable and effective across onion production regions.

IYSV was first reported from Treasure valley in PNW in 1989, it was characterized only on basis of the nucleocapsid (N) gene sequences and its complete genome organization was not determined from the USA. In this study the Medium (M) and Large (L) RNAs were sequenced and analyzed. IYSV M RNA codes for two proteins: the non-structural movement (NSm) and glycoprotein (Gn/Gc) precursor in ambisense orientation, whereas L RNA encodes for RNA-dependent-RNA polymerase (RdRp) in negative orientation similar to other tospoviruses reported. Infected samples including onion, weeds along the onion fields and wild onions collected from various geographical regions of the USA were characterized based on the N gene. N gene coded by small (S)

RNA was amplified and sequenced from all the positive isolates and analyzed. The isolates from the PNW form a close cluster with other isolates reported from other allium growing regions in the USA, suggesting similar evolutionary origin.

To develop efficient control methods, a diagnostic assay was developed. In absence of any genetic resistance, control measures are concentrated on use of chemical based insecticides, applied on regular basis adding extra costs to crop production. The

137 assay developed was able to detect virus and differentiate between viruliferous and non- viruliferous individual thrips. By understanding the thrips life cycle, following the time of incidence in field, the chemical spray can be controlled and there can be better management strategies for disease.

Plant viruses are continuously evolving in agricultural system, these can be either due to introductions to new areas or by genetic recombination among different viruses.

In tospoviruses, there are reports on continuous emergence of new strains and the presence of two or more viruses in a single crop. IYSV and Tomato spotted wilt virus

(TSWV) both were reported to infect onion in some parts of the USA. In biological studies, it was found that D. stramonium is a selective host where IYSV is restricted to inoculated leaves whereas TSWV is systemic. But it was observed that when both viruses infect D. stramonium simultaneously, the disease severity is much higher showing severe symptoms. On molecular analysis it was found that all three RNA encoding five genes of both TSWV and IYSV were present in inoculated leaves, but in systemically infected leaves all TSWV RNAs were present, but only one IYSV-non-structural (NSs) encoded by small (S) RNA was present. NSs is known to function as a silencing suppressor. Suggesting that in the presence of TSWV, IYSV overcomes the plant defense system and IYSV-silencing suppressor was able to move systematically causing more severe disease infection. Results showed that the IYSV NSs gene is expressed only in systemic leaves of plants inoculated with both IYSV and TSWV, and also that the expression of TSWV NSs in systemic leaves is much higher in the presence of IYSV NSs.

Small RNAs for N and NSs genes were analyzed by Northern blot analysis for

138 single and dual infections in inoculated as well as systemic leaves. The small RNA fraction from infected samples was subjected to polyacrylamide gel electrophoresis and

Northern hybridization using gene-specific probes to detect the presence of 21-24 nucleotide siRNAs. TSWV N gene-specific siRNAs were detected in both inoculated and systemic leaves of plants in the case of single as well as dual infection. The probes used were specific for TSWV and did not hybridize with any of the samples from IYSV- inoculated plants. In the case of NSs, we could detect the siRNAs in leaf samples inoculated with TSWV only; while we could not detect TSWV NSs siRNAs either in the inoculated or systemic leaves of plants inoculated with both TSWV and IYSV. This suggested that the silencing suppressor (NSs) of TSWV was not subjected to the plant’s silencing machinery in the presence of silencing suppressor of IYSV.

IYSV continues to be a major constraint to onion production in the USA and is becoming increasingly important in other parts of the world. IYSV typically does not kill plants; however, the virus reduces plant vigour and bulb size, reducing seed yield and quality. Additionally, the virus weakens plants, making them more susceptible to other pests and diseases. A better understanding of the genome structure, organization, and sequence divergence of IYSV isolates from different production systems and geographic regions would potentially provide tools and technologies for developing management options for reducing the impact of this economically important virus. It will facilitate further biochemical and molecular studies for a better understanding of virus-plant and virus-vector interactions. Economic losses vary among the regions possibly due to differences in climate, vector thrips populations, onion cultivars and virus strains.

139

For further management strategies, different isolates and new hosts found were needed to include for screening of resistant verities. The implication of complementation under natural condition is yet to be investigated.

140

APPENDIX 1

Buffer Formulations Coating Buffer (1X) Dissolve in distilled water to 1000 ml: Sodium carbonate (anhydrous) 1.59 g Sodium bicarbonate 2.93 g Sodium azide 0.2 g Adjust pH to 9.6. Store at 4° C. Wash Buffer (1X-PBST) Dissolve in distilled water to 1000 ml: Sodium chloride 8.0 g Sodium phosphate, dibasic (anhydrous) 1.15 g Potassium phosphate, monobasic (anhydrous) 0.2 g Potassium chloride 0.2 g Tween-20 0.5 g Adjust pH to 7.4 Extract Buffer (EB 1X) Dissolve in 1000 ml of 1X PBST: Sodium sulfite (anhydrous) 1.3 g Polyvinylpyrrolidone (PVP) MW 24-40,000 20.0 g Sodium azide 0.2 g Powdered egg (chicken) albumin, Grade II 2.0 g Tween-20 20.0 g Adjust pH to 7.4. Store at 4°C. Antibody dilution buffer (1X) Add to 1000 ml 1X PBST: Bovine serum albumin (BSA) 2.0 g Polyvinylpyrrolidone (PVP) MW 24-40,000 20.0 g Sodium azide 0.2 g Adjust pH to 7.4. Store at 4° C. Substrate Buffer (1X) Dissolve in 800 ml distilled water: Magnesium chloride hexahydrate 0.1 g Sodium azide 0.2 g Diethanolamine 97.0 ml Adjust pH to 9.8 with hydrochloric acid. Adjust final volume to 1000 ml with distilled water. Store at 4° C.

142