IDENTIFICATION OF FUNGI CAUSING LEAF SPOT ON BERMUDAGRASS IN FLORIDA, AND SENSITIVITY OF BIPOLARIS CYNODONTIS TO AZOXYSTROBIN

By

PRASERT STAVORNVISIT

A THESIS PRESENTED TO THE GRADUATE SCHOOL OF THE UNIVERSITY OF FLORIDA IN PARTIAL FULFILLMENT OF THE REQUIREMENTS FOR THE DEGREE OF MASTER OF SCIENCE

UNIVERSITY OF FLORIDA

2015

© 2015 Prasert Stavornvisit

To my family and friends

ACKNOWLEDGMENTS

I would like to thank Dr. Phil Harmon, my major advisor and Dr. Jeff Rollins, committee member for all their guidance and support throughout this process. I thank Dr. Brian Schwartz from University of Georgia for project support. I thank my colleagues, Brenda Rutherford, Anne

Vitoreli, Dr. Sladana Bec, Jerry Dewberry and Lydia Munday for their help and instruction.

Lastly I would like to thank my family for their patience and understanding.

4

TABLE OF CONTENTS

page

ACKNOWLEDGMENTS ...... 4

LIST OF TABLES ...... 7

LIST OF FIGURES ...... 8

ABSTRACT ...... 9

CHAPTER

1 LITERATURE REVIEW ...... 11

Brief History of Fungicide Use in Turfgrass ...... 11 Fungicide Resistance ...... 13 History of Fungicide Insensitivity in Turfgrass Pathogens ...... 13 Fungicide Resistance Concept ...... 14 Pathogen Fitness ...... 15 Mechanisms of Resistance ...... 15 Bipolaris Leaf Spot and Melting Out on Bermudagrass ...... 19 Bipolaris Leaf Blotch and Melting Out ...... 20 Pathogen, Host, Disease Cycle ...... 20

2 SURVEY OF BIPOLARIS SPECIES ISOLATED FROM BERMUDAGRASS GOLF COURSES IN FLORIDA ...... 22

Introduction ...... 22 Materials and Methods ...... 23 Sample Collection, Isolation and Storage of Fungal Pathogens ...... 23 DNA Extraction and Amplification ...... 24 Sequence and Phylogenetic Analysis ...... 25 Results...... 25 Isolate Collection ...... 25 Molecular and Morphological Identification of Bipolaris spp...... 26 Discussion ...... 27

3 EVALUATION OF AZOXYSTROBIN RESISTANCE IN BIPOLARIS CYNODONTIS ...... 34

Introduction ...... 34 Materials and Methods ...... 35 Whole Genome Sequencing ...... 35 Primers Sets Used to Attempt Amplification of The Cytochrome b Gene ...... 37 Amended Agar Assays ...... 38 Fungicide Sensitivity Assays ...... 38

5

In vivo Sensitivity of Bipolaris Isolates to Azoxystrobin Fungicides ...... 38 Results...... 40 Sequencing of Cytb Gene in Bipolaris cynodontis ...... 40 Azoxystrobin Sensitivity Assay ...... 40 Pathogenicity Test ...... 41 Discussion ...... 41

APPENDIX

A: SURVEY FOR BIPOLARIS SPECIES ISOLATED FROM BERMUDAGRASS GOLF COURSES IN FLORIDA ...... 50

B: EVALUTION OF AZOXYSTROBIN RESISTANCE IN BIPOLARIS CYNODONTIS ....52

LIST OF REFERENCES ...... 55

BIOGRAPHICAL SKETCH ...... 66

6

LIST OF TABLES

Table page

2-1 Culture collection used in this study ...... 29

2-2 References culture and accession number used in this study ...... 30

2-3 Number of samples with the indicated fungal species isolated by month ...... 32

3-1 The primer sets from related fungi ...... 43

3-2 The primer sets designed base on Cochliobolus heterostrophus, scaffold_47:34321- 34542...... 43

3-3 The primer sets designed using R_2014_07_11_13_39_47_user_LIL- 46_Rollins_contig_474 contig (Bipolaris cynodontis cytochrome b gene sequence) ...... 43

3-4 Results of azoxystrobin amended media assay ...... 44

3-5 Results of azoxystrobin amended media assay for species other than Bipolaris cynodontis ...... 45

7

LIST OF FIGURES

Figure page

2-1 Distribution of the species identified in the samples submitted from golf course in 22 Florida counties ...... 32

2-2 The phylogenetic tree constructed using studied isolates, reference sequences, and the maximum likelihood method ...... 33

3-1 DNA sequence of the contig containing a partial cytochrome b gene sequence of Bipolaris cynodontis isolate 1318 (exon in red and intron in black). Primer Cytbfwd 4 is highlighted in yellow and Cytbrvs 4 reverse complement is highlighted in green. ....46

3-2 Alignment of DNA sequences coding for amino acid residues 127 to 143 of the cytochrome b gene of 38 Bipolaris cynodontis isolates ...... 47

3-3 Partial amino acid sequences including residues 127 through 143 of the cytochrome b gene from 38 Bipolaris cynodontis isolates. Line 13 shows the F129L mutation found in isolate 1344 ...... 48

3-4 Levels of disease severity from isolate 1326, 1344, and 1375. Control pots were inoculated with water only. The w treated pots were sprayed with water and the a treated pots were treated with Heritage fungicide (azoxystrobin)...... 49

8

Abstract of Thesis Presented to the Graduate School of the University of Florida in Partial Fulfillment of the Requirements for the Degree of Master of Science

IDENTIFICATION OF FUNGI CAUSING LEAF SPOT ON BERMUDAGRASS IN FLORIDA, AND SENSITIVITY OF BIPOLARIS CYNODONTIS TO AZOXYSTROBIN

By

Prasert Stavornvisit

December 2015

Chair: Philip F. Harmon Major: Plant Pathology

Bipolaris leaf blotch and melting out are destructive diseases of bermudagrass, paspalum, and zoysiagrass maintained as golf course putting greens and fairways. Bipolaris cynodontis is the most common fungal pathogen reported to cause the disease on bermudagrass (Cynodon spp.). In 2012, golf course superintendents who utilized the UF IFAS Plant Diagnostic Center

(PDC) Rapid Turfgrass Diagnostic Service reported difficulty managing leaf spot and crown rot symptoms despite fungicide applications that, in previous years, had provided acceptable disease control. Possible explanations included particularly favorable conditions for disease, a shift in the predominant Bipolaris species causing disease, and the potential development of fungicide resistance in pathogen populations. In 2013, 81 single-spore isolates were obtained from samples submitted to the PDC from golf courses in 22 Florida counties. Isolates that produced characteristic conidia, and that were associated with leaf spot symptoms on bermudagrass, were identified through comparison of DNA sequence with reference strains. The pathogen B. cynodontis was the predominate species identified. Other pathogens and saprobes including

Curvularia hawaiiensis, C. verruculosus, C. papendorfii, C. spicifera, and Exerohilum rostrata also were isolated and identified infrequently. The sensitivities of B. cynodontis isolates to the fungicide azoxystrobin were evaluated with amended media assays; however, inhibition of

9

growth ranged between 7.8% and 53% and was lower than expected at concentrations tested with no clear dose response identified. Whole genomes from 2 isolates of B. cynodontis were sequenced. The assembly was searched with blast using Phaeosphaeria nodorum SN15 mitochondrion sequence. The cytochrome b gene sequences containing the three QoI mutation sites were amplified from 38 isolates, and only one mutation previously associated with a fungicide insensitivity phenotype was identified in isolate 1344 at position 129. The isolate containing the mutation (F129L) caused greater disease severity on bermudagrass treated with azoxystrobin than isolates without the mutation but was also more aggressive in the absence of the fungicide as well. The pathogen B. cynodontis was found to be the predominate leaf spot pathogen of bermudagrass on golf courses in Florida, but reported management failures were not due to widespread accumulation of mutations currently known to confer QoI fungicide insensitivity. The isolate with the F129L mutation could not be differentiated from sensitive isolates in the amended media assays evaluated and additional work is needed.

10

CHAPTER 1 LITERATURE REVIEW

Brief History of Fungicide Use in Turfgrass

The use of fungicides to control turfgrass diseases was researched as early as 1917 in

trials funded by the Green Section of the United States Golf Association. These studies evaluated

the efficacy of Bordeaux mixture for management of “brown patches” of fescue at the Arlington

Turf Gardens (Kellerman, 1931). During the 1920s, mercurous chloride (Calo-clor) and

chlorophenyl mercury (Semesan) were introduced and used to control brown patch and dollar

spot. Other toxic elemental mixtures also were used that included arsenic and sulfur (Latin,

2011).

During the 1930s, thiram, a dithiocarbamate fungicide that is still used to some extent

today, was developed and was shown to have greater efficacy and less potential for phytotoxicity

than mixtures containing copper and other elemental fungicide mixtures (Russell et al., 1995).

Tersan OM was a product that contained a mixture of thiram and mercury that was widely used until 1970 when the registration of this product was cancelled by the EPA along with all toxic mercury-based pesticides (Latin, 2011).

The 1950s and 1960s saw the registration of several new fungicides for controlling turf diseases including active ingredients such as chloroneb, etridiazol, and pentachloronitrobenzene

(PCNB). The fungal antibiotic cyclohexamide was used to control dollar spot during this period as well. Two important fungicides still used to manage turfgrass diseases today that were developed in the 1960s include mancozeb and chlorothalonil (Latin, 2011). In the late 1960s, the

first fungicides with the ability to penetrate the plant surface (systemic) were developed and

included benomyl and thiophanate-methyl. Benomyl was the first fungicide that was capable of

11

moving between cells and upward throughout the plant in water conducting tissues (Couch,

1995).

Additional systemic fungicides with very good turfgrass disease efficacy were developed in the 1970s and 1980s including dicarboximide fungicides such as iprodione and vinclozolin, and several demethylation inhibitor (DMI) fungicides (triadimefon, propiconazole, and fenarimol) (Latin, 2011). Azoxystrobin was the first of the respiration inhibiting fungicides known as the quinone-outside-inhibitors (QoI) introduced in 1992 by Syngenta. Soon after,

BASF announced kresoxim-methyl, and both of these fungicides became commercially available in 1996. There are currently 20 known QoI fungicides and four of those are available in commonly used turfgrass fungicides (FRAC, Bartlett et al., 2002).

The group of fungicides that includes azoxystrobin is also known as the strolilurins, and they include natural derivitives of β-methoxyacrylic acid that include strobilurin A, oudemansin

A, and myxothiazol A. These natural compounds are produced by the Basidiomycete fungi

Strobilurus and Oudemansiella and by the gliding bacterium Myxococus fulvus. (Anke et al.,

1977; Kraiezy et al., 1996). The natural compounds can be toxic to non-target organisms and were never developed into agriculture fungicides. However, from 1400 synthetic derivatives evaluated in a research program within Syngenta, azoxystrobin was discovered to have a favorable toxicity profile and was developed first among the group (Barlett et al., 2002).

These fungicides bind to the Qo site (the outer quinol-oxidation site) of cytochrome b, which is part of the cytochrome bc complex (complex III) located in the inner mitochondrial membrane of fungi. The fungicides₁ inhibit electron transfer between cytochrome b and cytochrome c terminating the ATP supplies of fungal cells (Becker et al., 1981; Clough, 1998;

Barlett et al., ₁2002).

12

Fungicide Resistance

History of Fungicide Insensitivity in Turfgrass Pathogens

The occurrence of fungicide insensitivity in populations of turfgrass was documented as early as 1960 and followed closely behind the introduction of new chemistries with new modes of action. By 1966, several cases of Sclerotinia homoeocarpa insensitivity to cadmium-based fungicide had been reported in multiple locations in the eastern part of the United States (Couch,

1973). The dollar spot pathogen was confirmed resistant to benomyl in 1974 (Warren et al.,

1974). Vargas published the occurrence of fungicide failure to control powdery mildew due to insensitivity of Erysiphe graminis to benomyl in 1978 in the north-central and eastern regions of the United States as well. Resistance to iprodione was found in Microdochium nivale in 1980 and was reported in S. homoeocarpa three years later (Chastagner and Vassey, 1982; Detweiler et al.,

1983). Pythium resistance to metalaxyl was documented in 1984 (Sanders, 1984). Cross- resistance among DMI fungicides in S. homoeocarpa was discovered in the 1990s in Michigan and Ohio (Golembiewski et al., 1995). Within the last 20 years, Colletotrichum cereale has been reported to have multiple resistances to benomyl and DMI fungicides (Burpee et al., 2004; Wong at al., 2008; Wong and Mildland, 2007).

The first turfgrass pathogen documented to have resistance to the QoI group of fungicides was Pyricularia grisea causing gray leaf spot of perennial ryegrass (Vincelli and Dixon, 2002).

In addition, the anthracnose pathogen, C. cereale, and the Pythium blight pathogen, Pythium aphanidermatum, also have developed resistance to QoI fungicides (Avila-Adame et al., 2003;

Olaya et al., 2003).

13

Fungicide Resistance Concept

Fungicide resistance to modern, single-site chemistries in species of fungi is often

associated with genetic mutations affecting the enzymes targeted by the fungicides (Latin, 2011;

Dekker, 1995). Mutations that reduce the effect of the fungicides on the metabolism or life cycle of the pathogens give a competitive advantage to individuals in the populations when selection pressures are applied. Fungicide applications exert this selection pressure and result in shifts in the populations from sensitive to insensitive individuals. When insensitive individuals cause unacceptable levels of disease severity despite the application of the fungicide, the result is fungicide resistance.

When a mutation completely eliminates the negative effect of a fungicide on a pathogen, the resulting resistance cannot be overcome by using higher rates or shorter spray intervals.

Products that contain the ineffective active ingredient become useless as management tools for the disease, as is the case with dollar spot and anthracnose pathogens resistance to the benzimidazole fungicides (Hutson and Miyamoto, 1998; Latin, 2011; Kendall 1998; McGrath,

2001).

Quantitative, multi-step resistance refers to the accumulation of several minor mutations or adaptations that contribute to small reductions in the sensitivity of individuals. With this type of resistance in a fungal population, there can be a range of individuals from completely

insensitive to completely sensitive, and others with varying degrees of sensitivity in between.

Fungicide applications select for individuals that are less sensitive to the fungicide, but

individuals with a range of sensitivities survive resulting in a shift toward resistance in the

population that can be relatively slow. In some cases, a fungicide may still effectively manage

disease for a time if reapplication intervals are shortened or if rates are increased. These

14

practices exert additional selection pressure on the pathogen population and will not provide satisfactory levels of disease control indefinitely (Latin 2011; Hutson and Miyamoto, 1998).

Pathogen Fitness

Persistence of resistance in a pathogen population is determined by the impact of the mutation on the competitive ability of the pathogen in the absence of the selection pressure exerted by the fungicide. Apparent fitness penalties removed resistant individuals from some crop pathogen populations after several years of not using the fungicides, resulting in diseases being controlled by dicarboximide fungicides after the period of discontinued use (Latin, 2011).

Conversely, benomyl fungicide resistance was documented to persist in strains of Cercospora arachidicola causing early leaf spot of peanut in the southeastern region of the United States for many years after the fungicide was no longer used on the crop (Clarke et al., 1974; Littrell 1974).

Mechanisms of Resistance

Resistance mechanisms involve the modification of target sites, the influx or efflux membrane transport systems, or an avenue for metabolic detoxification (Ma and Michailides,

2005; Latin, 2002; Hewitt, 1998; Dekker, 1995).

The term “target site” is used to describe the particular protein where a fungicide active ingredient disrupts normal function. If specific mutations occur at the target site, the fungicide active ingredient may no longer be able to disrupt the metabolic or structural function of the protein within the fungal cell. For example, resistance to benzimidazole fungicides is due to one or more mutations in the gene that codes for β-tubulin (Ma et al., 2003; McKay et al., 1998;

Davidse, 1997; Gafur et al., 1998; Li et al., 1996; Luck and Gillngs, 1995; Albertini et al., 1999;

Koenraadt et al., 1992; Ma et al., 2005; Hollomon et al., 1998). Various codon mutations and the associated amino acid residue changes have been associated with pathogen resistance and include: codon 6 in Cochliobolus heterostrophus (Gafur et al., 1998) and codon 198 in

15

Helminthosporium solani and S. homoeocarpa (McKay and Cooke, 1997; Koenraadt et al.,

1992).

Mutations that affect mitochondrial respiration including the electron transport chain also have been documented to affect several classes of fungicides. Carboximide fungicides disrupt this process where succinate and coenzyme Q interact within Complex II. Specific mutations in the succinic dehydrogenase complex of Ustilago maydis, Mycospharella graminicola, Alternaria alternata, Botrytis cinerea, and S. sclerotiorum result in insensitivity (Georgopoulos and Ziogas,

1977; Mowey et al., 1977; Georgopoulos, 1982; Keon et al., 1991; Broomfield and Hargreaves,

1992; Skinner et al., 1998; Avenot et al., 2008; Avenot et al., 2009; Stammler et al., 2007;

Glaettli et al., 2009).

Resistance to the QoI fungicides has been associated with site mutations of many plant pathogens. Amino acid substitutions at three locations within cytochrome b have been demonstrated to confer resistance. The most common occurs at amino acid position 143 when a codon for glycine changes to one for an alanine (G143A). An amino acid change from phenylalanine to leucine at position 129 (F129L) also can confer resistance. A third and less common mutation was documented at position 137 where the codon for glycine is substituted for a codon for arginine (G137R) (Sierotzki et al., 2006). The G143A mutation confers complete resistance and loss of QoI fungicide efficacy. The F129L and G137R confer partial resistance that may not necessarily affect field efficacy of QoI fungicides (Fernández-Ortuño et al., 2008b;

Pasche et al., 2002; Kim et al., 2003). Although the G143A mutation is the most common and has occurred in numerous basidiomycetes and ascomycetes, no fungal species with a type I intron located directly after the codon position 143 has been reported. It is thought the mutation

16

may prevent the splicing of the intron from the cytochrome b gene, a lethal condition (Grasso et al., 2006; Chao-Xi et al., 2010; Stylianos et al., 2011).

Other mechanisms that can reduce fungicide sensitivity do so by preventing fungicides from reaching or accumulating at target sites. Modifications to influx and efflux mechanisms may prevent the fungicide from entering through the membrane, or they may result in a rapid export of fungicides from or compartmentalization within fungal cells (Dekker, 1995; Latin,

2002). The pear pathogen Alternaria kikuchiana exhibits resistance to polyoxin B, which inhibits

chitin production. The resistance has been associated with a modification in the fungal

membrane that limits uptake of the fungicide (Misato et al., 1977; Latin, 2002). Ustilago avenae

can relocate fungicides into vacuoles (Hewitt, 1998).

Membrane transporters play a role in preventing a wide range of natural toxic compounds

and fungicides from accumulating in filamentous fungi (De Waard et al., 1996; Stergiopoulos et

al., 2003; Del Sorbo et al., 1997). The two major families involved in these transport processes

are the ATP-binding cassette (ABC) transporter family, and the major facilitator superfamily

(MFS) of transporters. The major differences between ABC and MFS transporters are the energy

required, the ability to hydrolyze ATP, and the number of efflux pumps. ABC transporters are capable of binding to and hydrolyzing nucleotide triphosphates (mainly ATP) to produce energy which is used to move compounds across cell membranes. ABC transporters are considered to be the primary active transporter systems as the transport of compounds can occur even against an electrochemical gradient. ABC transporters are able to transport a large amount of toxicants because they consist of the largest number of efflux pumps. Aspergillus nidulans has an energy dependent efflux mechanism documented to discharge fungicide from the mycelium (de Waard

and Fuchs, 1982; Del Sorbo et al., 2000).

17

MFS transporters, on the other hand, utilize proton-motive force to transport compounds

across cell membranes, and therefore do not hydrolyze ATP. As a result, MFS transporters are

regarded as secondary active transporter systems (Del Sorbo et al., 2000). There are only a few

examples showing that efflux transporters play a role in QoI resistance. One example is MgMfs1, a MFS transporter gene in Mycosphaerella graminicola (Roohparvar et al., 2007) and

Pyrenophora tritici-repentis (Reimann and Deising, 2005).

Mechanisms of fungicide metabolism or the development of alternative pathways to negate the toxic effects of fungicides have been observed in Pyricularia oryzae (Uesugi and

Sisler, 1978). In the case of QoI fungicides, when electron transport in fungal mitochondria is

inhibited, an alternative pathway using alternative oxidase can provide ATP to fungal cells by

diverting electrons from the cytochrome pathway. Alternative oxidase is cyanide resistant and is

inhibited by salicylhydroxamic acid (SHAM); it is also an inefficient mechanism of energy

production (Vanlerberghe and McIntosh, 1997). This phenomenon allows several pathogens to

grow saprophyticaly in vitro but does not provide enough energy for pathogenesis in planta.

Examples include Botrytis cinerea, Gaeumannomyces graminis var tritici, Magnaporthe grisea,

Mycosphaerella fijiensis, Mycosphaerella graminicola, and Venturia inaequalis. (Wood and

Hollomon, 2003). In other examples, including Podoshaera fusca and Venturia inaequalis,

reductions in efficacy of QoI fungicides have been attributed to the reliance of alternative

oxidase mechanisms for ATP production (Steinfeld et al., 2001; Fernández-Ortuño et al., 2008a).

Sensitivity to some fungicides may be reduced by overexpression of genes related to the

target enzymes. Overexpression of CYP51 in Candida glabrata, Penicillium digitatum and

Venturia inaequalis have been shown to play a part in resistance to DMI fungicides (Marichal et al., 1997; Hamamoto et al., 2000; Schnabel and Jones, 2001).

18

Bipolaris Leaf Spot and Melting Out on Bermudagrass

Bermudagrass species (Cynodon spp.) are important turfgrass species used for lawns,

parks, and sport fields. Bermudagrass is the primary turf species used for golf courses in the

Southern region of the United States as well as the tropical and subtropical regions of the world

including Australia, Africa, and South Asian counties. Bermudagrass is also known as

kweekgrass in South Africa, couch grass in Australia and Africa, devil’s grass in India, and

gramillia in Argentina. Common bermudagrass (Cynodon dactylon [L.] Pers) is the most widely

used bermudagrass in the United States (Christian, 2011). Bermudagrass can be propagated by

stolons, rhizomes and/or seeds. Most Bermudagrass varieties used for golf course turfgrass is a sterile hybrid of common bermudagrass and African bermudagrass (C. transvaalensis) propagated only by vegetative sprigs or sod. Fine texture cultivars of hybrid bermudagrasses

(Cynodon dactylon [L.] Pers. X Cynodon transvaalensis) used on golf courses include

Champion, FloraDwarf, FloraTex, Midiron, Midlawn, Midfield, Pec Dec, Santa Ana, Sunturf,

Tiffine, TifGrand, Tifgreen, Tifdwarf, TifEagle, Tiflawn, Tifway and Tifsport (Beard and Sifer,

1996; Christian, 2011). Bermudagrass grows well in tropical and subtropical climates where the optimal daytime temperature is between 35 and 37 °C.

The identifying characters of C. dactylon include presence of both rhizomes and stolons, a folded vernation, and a ligule afringe of hairs. Bermudagrasses vary in leaf texture from coarse to very fine, and seedheads have three to five racemes from one or occasionally two whorls. The roots of Bermudagrass are deep, fibrous, and perennial (Christian, 2011).

Plant breeding efforts have focused on improving the quality of golf putting surfaces formed by intense management of varieties that can specifically tolerate low mowing heights and that have a high shoot density. Those hybrid Bermudagrasses, known as “ultradwarf” include

19

Champion, FloraDwarf, MiniVerde, MS Supreme, and TifEagle can be maintained as low as 0.3

cm (Cowan, 2001; Hollingsworth et al., 2005).

TifEagle was developed by the USDA-ARS and the University of Georgia at the Coastal

Plain Experiment Station and was launched in 1997 (Hannah and Elsner, 1999). In 1995, The

University of Florida introduced FloraDwarf, which was a natural selection from Tifgreen

(Dudeck and Murdock, 1998). TifEagle and Floradwarf can be tolerant to low mowing heights of

0.3 and 0.48 cm, respectively (McCarty and Miller, 2002).

Bipolaris Leaf Blotch and Melting Out

Bipolaris leaf blotch and melting out are destructive diseases of warm season grasses, including Bermudagrass, Zoysiagrass, and Paspalum. Of several fungal species known to occur on warm season grasses, B. cynodontis is the most common pathogen on C. dactylon (Nelson,

1964). In general, the disease is active from the fall through the spring seasons in Florida.

Pathogen, Host, Disease Cycle

Leaf spot diseases in bermudagrass can be caused by Bipolaris, Exserohilum, Drechslera and Marielliottia species. The genus Bipolaris belongs to the phylum Ascomycota, class

Dothideomycetes, order Pleosporales. Bipolaris spp. not only cause diseases of grasses, but also other plants and in humans (K.C. da Cunha, 2012; N. El Khizzi, 2010). The genera Bipolaris is an asexual stage (anamorph) of the fungus Cochliobolus (teleomorph) (Smiley, 2005).

Bipolaris, generic description (Sivanesan, 1987)

Mycelium brown, grey or black. Conidiophores straight or flexuous, multiseptate, usually simple, smooth, macronematous, mononematous, often geniculate, sometimes nodose, cylindrical. Conidiogenous cells cylindrical, integrated, terminal or intercalary, proliferating sympodially, cicatrized. Conidia acropleurogenous, fusoid, obpyriform, navicular, oblong, cylindrical, obclavate, clavate, ovoid, solitary, curved to straight, mostly smooth, rarely echinulate to rough-walled, 2- or more distoseptate, septa sometimes thickened and dark, pale brown, olivaceous brown, reddish brown or dark brown, germinating principally from one or both polar cells with the basal germ tube originating close to the hilum

20

and growing semiaxially, hilum associated with a slightly protruding, truncate section of the wall, and often visible as two dark lenticular spots in optical section arranged close together and separated by a small obscure narrow canal, or rarely protuberant, first conidial septum median to submedian, second septum delimiting the basal cell, the third septum distal, conidiogenous nodes rough to smooth.

Bipolaris spp. survive the winters as conidia and as dormant mycelium in infected leaves and plant debris in the soil (Smiley, 2005). Mycelium from infected leaves and conidia in the soil

are the primary source of inoculum for this pathogen (Murray et al, 1998). The infection process

starts with the conidia coming into contact with a susceptible host. Bipolaris can penetrate plant

tissue directly through the epidermal cell wall, through natural openings, or through wounds

(Mathre, 1987; Kumar et al., 2002). Once the conidia land on a leaf surface, they release a

conidial mucilage, which is extracellular material, to adhere conidia onto the leaf surfaces

(Apoga and Jansson, 2000). The conidia germinate and form an appressorium at the apex of the

germ tube, which is used to penetrate the cell wall (Kumar et al., 2002). Forming an

appressorium in some fungi by a germ tube involves the use of a variety of chemical signals,

namely K+, Ca++, sucrose, phenolics, and plant extracts (Hoch et al., 1991). In 1964, Endo and

Amacher indicated that the appressorium formation of Cochliobolus species is induced by

guttation fluid. Once inside the plant, Bipolaris spp. produce toxins that disrupt host cellular

functions and allow the fungi to grow and reproduce in the plant (Gayad, 1961; Briquet et al.,

1998; Wisniewska et al., 1998).

Bipolaris spp. can cause leaf spots and crown rot symptoms on warm season grasses year

round, but are most severe from fall through spring. In cool season grasses, leaf spot lesions and

leaf blights are most severe during warm, wet weather in midsummer. The aggressiveness of this disease is increased when temperatures rise from 20 to 35 °C (Smiley, 2005).

21

CHAPTER 2 SURVEY OF BIPOLARIS SPECIES ISOLATED FROM BERMUDAGRASS GOLF COURSES IN FLORIDA

Introduction

In Florida, the majority of golf course greens are established with cultivars of hybrid bermudagrass (Cynodon dactylon [L.] Pers. X Cynodon transvaalensis Burtt-Davy), such as

FloraDwarf, Champion, MiniVerde, TifDwarf, and TifEagle. Bermudagrass provides a consistent putting surface, and compared to TifDwarf, the other newer varieties, sometimes referred to as Ultradwarf, can tolerate a lower mowing height and have a higher shoot density

(McCarty and Miller, 2002). Due in part to increasing demands from golfers for faster putting speeds and more uniform putting surfaces, shifts in agronomic practices have trended towards reducing fertilizer, lowering mowing heights, and increasing the use of growth regulators. These practices can result in plant stress and increased susceptibility to disease, or increased disease pressure (Latin, 2011). Leaf spot, crown rot, and root rot diseases caused by various fungal pathogens previously referred to as “Helminthisporium species” can be destructive during fall winter and spring on Florida putting greens.

The genus Bipolaris contains more than 100 species and belongs to phylum Ascomycota,

class Dothideomycetes, order Pleosporales, and family Pleosporaceae (Shoemaker, 1959).

Manamgoda et al. (2014) examined the genus Bipolaris by using phylogenetically informative

DNA sequences of ITS, GPDH, and TEF to reconstruct the phylogeny of 47 Bipolaris species.

The authors transferred B. hawaiiensis and B. spicifera as well as some other species to the genus

Curvularia. Most species in this genus are saprobes, some species of which are potentially

infectious to humans and animals (Sivanesan, 1987). The genus Bipolaris also includes

devastating plant pathogens of food crops. One example is Bipolaris sorokiniana which causes

root rot and leaf-spot on wheat and barley and is considered a destructive plant pathogen of

22

wheat in warm regions (Duveiller and Gilchrist, 1994). Bipolaris zeicola causes northern leaf

spot and ear rot diseases in maize. Southern corn leaf blight, on the other hand, is caused by

Bipolaris maydis. Many Bipolaris anamorphs have teleiomorphs in the Cochilobolus genus.

The predominant leaf spot and melting out pathogen of bermudagrass is B. cynodontis

(Brecht, 2007; Couch, 1995; Vargas, 1994). The typical morphological features of Bipolaris

cynodontis include conidia ranging in length from 11-14 by 27-80 µm with three to nine septa

(Smiley et al., 2005). The germination of Bipolaris species can be from one or both polar cells.

The majority of Bipolaris species have a flush hilum, whereas the others have a protuberant hilum (Sivanesan, 1987). Bipolaris cynodontis has inconspicuous or slightly protuberant hilum

3-4 µm wide (Manamgoda et al., 2014).

In Florida, leaf spot and crown rot diseases are common on bermudagrass putting greens.

Turfgrass managers rely on fungicide applications to maintain turfgrass quality during extended

periods of disease-favorable environmental conditions. From January 2013 through June 2013,

Florida golf course superintendents that use the UF Rapid Turfgrass Diagnostic Service reported

difficulty managing leaf spot and crown rot disease symptoms despite fungicide use. Our

objective was to collect and identify the leaf spot and crown rot pathogens in bermudagrass

samples we received from Florida to determine if B. cynodontis is still the predominant species

causing leaf spot and crown rot diseases on bermudagrass putting greens, and to create and

maintain a culture collection for additional research.

Materials and Methods

Sample Collection, Isolation and Storage of Fungal Pathogens

Bipolaris leaf spot and melting out samples were submitted from golf courses and

research plots maintained at the Plant Science Research and Education Unit (PSREU) in Citra,

Florida (Table 2-1). Symptomatic leaves from the samples were rinsed with sterilized, de-ionized

23

water and blotted dry with a sterile Kimwipe (Kimberly-Clark, GA). Leaves were placed onto culture plates of water agar, Acidified Potato Dextrose Agar (APDA), and thiophanate-methyl amended media (see Appendix for media recipe). The leaf tissues were incubated in a controlled environment chamber at 24°C for 5 days with 12 h fluorescent light per day. A single spore was transferred by using needle or scalpel to water agar and incubated at room temperature (24 °C).

Within 3 to 5 days, a 4 mm plug was transferred to a culture plate of water agar overlaid with a disk of sterile Whatman Filter paper and returned to the incubator until the filter paper was completely covered by mycelia of the fungus. The filter paper was dried at room temperature (24

°C), cut into pieces 5 by 5 mm, placed in a coin envelope, and stored in a refrigerator at 4 °C for long term storage.

DNA Extraction and Amplification

A 5 by 5 mm square of colonized Whatman filter paper for each isolate was ground using a pestle and mortar in liquid nitrogen, and DNA was extracted using a Qiagen DNeasy Kit

(Qiagen Santa Clarita, CA) according to the manufacturer’s directions. To disintegrate the cell wall and cell membrane, 400 µl of Buffer AP1 and 4 µl of RNase A stock solution were added to

20 mg of dried fungal tissue and vortexed vigorously followed by incubation of the mixture for

10 minutes at 65 °C with inverting 2-3 times during incubation. The remaining steps were performed according to the manufacturer’s instruction.

Oligonucleotide primers (Integrated DNA Technology Inc, IA) ITS1F (Gardes and

Bruns, 1993) and ITS4 (White et al., 1990) were used in a polymerase chain reaction (PCR) for each isolate. The reaction mixture was comprised of 40 pmole ITS1F and ITS4 primers, 6 µl of extracted DNA and 10 µl of REDExtract-N-Amp PCR Reaction Mix (Sigma-Aldrich St. Louis,

MO). The PCR conditions for the amplification were set as follows: initial denaturation at 94°C for 3 min; 45 cycles at 94°C for 1 min, 55°C for 1 min, and 72°C for 1 min; final extension at

24

72°C for 10 min; then amplification products were held at 4°C. Amplicons produced from each

isolate were then separated by gel electrophoresis using Tris Borate EDTA buffer (TBE,

Promega Corporation, Madison, WI) and a 1.75% agarose gel (Fisher Scientific Fair Lawn, NJ.)

amended with 0.5μg/mL of ethidium bromide. Amplicons were visualized with UV light.

Purification of PCR products was done using the MinElute PCR Purification Kit (Qiagen Santa

Clarita, CA). The Purified PCR products were submitted for bidirectional DNA sequencing to

Eurofins MWG Operon (Huntsville, AL).

Sequence and Phylogenetic Analysis

Bidirectional sequences of good quality and sufficient overlap were aligned and trimmed manually to obtain a consensus sequence for each isolate using MEGA version 6.06. The consensus sequences and 70 reference sequences (Manamgoda et al., 2014; da Cunha et al.,

2013; Sharma et al., 2014) (Table 2-2) were aligned using the ClustalW method in MEGA 6.06.

Alignment parameters were set as follows: the pairwise and multiple alignments were set with

the gap opening penalty at 15 and the gap extension penalty at 6.66, the DNA weight matrix at

IUB, and the transition weight at 0.5. The phylogeny was constructed using the maximum

likelihood method and the Kimura 2-parameter model with default settings in Mega 6.06. A

bootstrap analysis with 700 replicates was performed to estimate the reliability of the tree.

Identities of our isolates were inferred from their placement on clades with reference strains in

the phylogeny.

Results

Isolate Collection

Among the 94 samples examined, 85 were state-wide samples submitted to the UF Plant

Diagnostic Center, and 9 samples were collected from PSREU. We attempted to get one fungal isolate from each sample, and 81 isolates were obtained. Culture plates from the remaining

25

samples either did not produce Bipolaris-like fungi with multi-celled spores or were overrun with saprobes such that Bipolaris could not be isolated. Successful isolations were made from samples submitted from golf courses in 22 Florida counties distributed primarily in the coastal areas of the Florida peninsula (Figure 2-1).

These isolates were morphologically identified to genus based on major characteristics of

conidia. These characteristics of the conidia included fusiform to ellipsoidal shape with taper on

both ends and three to thirteen pseudo septa. Targeted symptoms included irregularly shaped and

brownish-green to black leaf lesions.

Molecular and Morphological Identification of Bipolaris spp.

The PCR products amplified with ITS primers described above ranged from 550 to 671

bp in length. Sequence results returned for 74 of the isolates were of sufficient quality and

overlap to form consensus sequences that were used for phylogenetic analysis. The phylogenetic

tree with the highest log likelihood is given in Figure 2-2. Reference sequences formed three groups representing species of Bipolaris, Exserohilum, and Curvularia.

The largest group of our isolates (48, 65%) claded with the reference strains of B. cynodontis (CBS 109894 and WM 13.307) and B. coffeana (BRIP 14845). Ten isolates grouped with reference strains of C. dactyloctenii BRIP 12913 and C. hawaiiensis BRIP 15933. Another

10 isolates grouped with C. verruculosus CBS148.63. Three additional isolates grouped with the

Exserohilum rostrata isolate P1 isolated from Tigergrass, Thysanolaena latifolia. A single isolate claded with a reference sequence for C. papendorfii CBS308.67, and one with C. spicifera. The final isolate, 1306, was determined to be a mixed culture of a Bipolaris species and a

Leptosphaerulina species that served as an outgroup.

The distribution of the species identified in the samples by county was color-coded onto the map (Figure 2-1). The date of isolation by species was tabulated in Table 2-3.

26

Discussion

A sizeable number of leaf spot and crown rot samples were received during this study

from golf course personnel around the state of Florida. In several cases, through discussions or

information provided on sample sheets, the clientele conveyed difficulty managing leaf spot and

crown rot diseases despite fungicide application. Although B. cynodontis has been the most

common pathogen reported on bermudagrass (Brecht, 2007; Pratt, 2005), one potential

explanation for the difficulty managing the disease is that pathogen populations have shifted to

different fungal species. However, the majority of the isolates in this study were identified as B.

cynodontis. Other species that were found included those reported to be weakly pathogenic or

saprophytic colonizers of bermudagrass and included C. hawaiiensis, C. spicifera, C.

verruculosus, E. rostrata, and C. papendorfii (Pratt, 2001; Huang et al., 2005; Pratt, 2006). The

straight-spored species C. hawaiiensis and C. spicifera were only recently moved from the

Bipolaris genus, but do clade with other Curvularia species, meaning spore shape is no longer a reliable indicator of genus (Manamgoda et al, 2014).

We identified our isolates by comparing our sequences and reference sequences from a

recent revision of the Bipolaris genus rather than by comparing individual ITS sequences using a

BLAST search of various databases. The ITS regions have been shown to be phylogenetically

informative and a useful way to determine species identification when morphological characters

overlap or are difficult to assess (Chowdhary et al., 2011; Dyer et al., 2008; Fryen et al., 1999).

A previous study investigated pathogenicity of C. hawaiiensis, C. geniculata and C.

lunata, the study concluded that these Curvularia species were not pathogenic to FloraDwarf,

Tifdwarf, or TifEagle bermudagrass in Florida due to disease ratings being very low compared to

B. cynodontis (Brecht et al., 2007). The identities of the fungi were based solely on morphology,

so it is difficult to know if C. verruculosus may have been misidentified as C. lunata, but the two

27

have overlapping spore shapes and sizes, and no C. verruculosus type culture was compared.

Unfortunately, cultures from the Brecht study are no longer available.

Studies in China reported leaf spot disease on bermudagrass caused by C. verruculosus.

Huang et al., 2005 observed leaf spot symptoms on bermudagrass in Wuhan, China. The symptoms of yellow-brown spots of several shapes were found on leaves and sheaths. The size of these spots was less than 1 cm in diameter. Additional research is needed to assess the virulence of C. verruculosus on Bermudagrass in Florida.

The most commonly-isolated pathogen in this study was B. cynodontis, and it was

isolated from samples originating from all regions of the state with no apparent north to south or east to west gradation. Samples that were collected in every month of the study from January to

June, 2013 produced B. cynodontis isolates as well. There were no obvious trends in fungal species distribution through time or by geography within the state. The difficulty managing leaf spot disease conveyed by clientele does not appear to be caused by a change in the predominate, leaf-spot species affecting bermudagrass in Florida. Additional research should focus on the biology of B. cynodontis isolates and other possible explanations.

28

Table 2-1. Culture collection used in this study Species Isolate Location (by county) Date collected Bipolaris cynodontis 1303 Lee 1/22/13 1304 Hillsborough 1/23/13 1305 Lee 1/23/13 1308 Volusia 2/6/13 1310 Volusia 2/6/13 1311 Volusia 2/6/13 1314 Flagler 2/21/13 1318 Palm Beach 2/19/13 1319 Alachua 2/15/13 1325 Lee 1/23/13 1326 St. Lucie 1/23/13 1327 Indian River 2/14/13 1331 Monroe 1/23/13 1333 Polk 1/23/13 1334 Sarasota 1/23/13 1335 Sarasota 1/23/13 1337 Lee 3/12/13 1339 Flagler 3/12/13 1340 Charlotte 3/6/13 1343 Pasco 3/15/13 1344 Pasco 3/15/13 1346 Palm Beach 3/28/13 1347 Palm Beach 3/28/13 1349 Lee 3/26/13 1355 Marion 4/17/13 1357 Oseola 4/19/13 1364 Broward 4/26/13 1365 Broward 4/26/13 1371 Alachua 5/2/13 1373 Hillsborough 5/7/13 1375 Pinnella 5/9/13 1376 Brevard 5/13/13 1377 Duval 5/17/13 1378 Alachua 5/13/13 1385 Alachua 5/30/13 1386 Sumter 5/30/13 1387 Alachua 5/30/13 1388 Palm Beach 5/29/13 1389 Clay 5/29/13 1392 Citrus 6/10/13 Exserohilum rostrata 1348 Duval 3/28/13 1370 Alachua 5/2/13 1382 Marion 5/25/13

29

Table 2-1. Continued Species Isolate Location (by county) Date collected Curvularia papendorfii 1353 Sarasota 4/3/13 C. verruculosus 1249 Marion 12/18/12 1302 Lee 1/22/13 1328 Brevard 2/15/13 1329 Brevard 2/15/13 1341 Palm Beach 3/13/13 1366 Polk 5/1/13 1383 Palm Beach 5/29/13 1369 Alachua 5/6/13 C. spicifera 0920 Collier 2/24/10 C. hawaiiensis 1312 Martin 2/23/13 1313 Lee 2/23/13 1315 Flagler 2/8/13 1358 Flagler 4/19/13 1360 Duval 4/25/13 1362 Broward 4/26/13 1374 Hillsborough 5/7/13 1384 Clay 5/29/13 1396 Alachua 6/12/13

Table 2-2. References culture and accession number used in this study Species Strain no. Accession no. References Bipolaris bicolor CBS 690.96 KJ909762 Manamgoda et al., 2014 B. chloridis CBS 242.77 JN192372 Manamgoda et al., 2014 B. clavata BRIP 12530 KJ415524 Manamgoda et al., 2014 B. coffeana BRIP 14845 KJ415525 Manamgoda et al., 2014 B. cookei AR 5185 KJ922391 Manamgoda et al., 2014 B. cynodontis CBS 109894 KJ909767 Manamgoda et al., 2014 B. cynodontis WM 13.307 KP068719 B. drechsleri CBS 136207 KF500530 Manamgoda et al., 2014 B. heliconiae BRIP 17186 KJ415530 Manamgoda et al., 2014 B. heveae CBS 241.92 KJ909763 Manamgoda et al., 2014 B. gossypina BRIP 14840 KJ415528 Manamgoda et al., 2014 B. luttrellii BRIP 14643 AF071350 Manamgoda et al., 2014 B. maydis CBS 137271 AF071325 Manamgoda et al., 2014 B. microlaenae BRIP 15613 JN601032 Manamgoda et al., 2014 B. microstegii CBS 132550 JX089579 Manamgoda et al., 2014 B. oryzae MFLUCC 10-0715 JX256416 Manamgoda et al., 2012 B. panici-miliacei CBS 199.29 KJ909773 Manamgoda et al., 2014 B. peregianensis DAOM 221998 KJ922393 Manamgoda et al., 2014 B. pluriseptata BRIP 14839 KJ415532 Manamgoda et al., 2014 B. sacchari ICMP 6227 KJ922386 Manamgoda et al., 2014 B. salkadehensis Bi 4 AB675491 Manamgoda et al., 2014

30

Table 2-2. Continued Species Strain no. Accession no. References B. salviniae IMI 228224 KJ922390 Manamgoda et al., 2014 B. salviniae BRIP 12898 JN601035 Manamgoda et al., 2014 B. secalis BRIP 14453 KJ415537 Manamgoda et al., 2014 B. sorokiniana CBS 120.24 KJ909776 Manamgoda et al., 2014 B. urochloae ATCC 58317 KJ922389 Manamgoda et al., 2014 B. victoriae CBS 327.64 KJ909778 Manamgoda et al., 2014 B. yamadae DAOM 147441 KJ922388 Manamgoda et al., 2014 B. zeae AR 3795 KJ909786 Manamgoda et al., 2014 B. zeicola AR 5166 KJ909788 Manamgoda et al., 2014 Curuvlaria australis BRIP 12525 AF081448 Manamgoda et al., 2014 C. australiensis NBRC 100213 JN943410 C. brachyspora CBS 186.50 KJ922372 Manamgoda et al., 2014 C. buchloës CBS 246.49 KJ909765 Manamgoda et al., 2014 C. crustacean 8225-1 AF163070 Manamgoda et al., 2014 C. dactyloctenii BRIP 12913 AF071322 Manamgoda et al., 2014 C. ellisii IMI 75862 KJ922379 Manamgoda et al., 2014 C. geniculata CBS 187.50 KJ909781 Manamgoda et al., 2014 C. gladioli ICMP 6160 JX256426 Manamgoda et al., 2014 C. hawaiiensis BRIP 15933 JN601028 Manamgoda et al., 2014 C. heteropogonis CBS 284.91 JN192379 Manamgoda et al., 2014 C. homomorpha DAOM 63822 KM257055 Manamgoda et al., 2014 C. inaequalis CBS 102.42 KJ922375 Manamgoda et al., 2014 C. ischaemi ICMP 6172 JX256428 Manamgoda et al., 2014 C. kusonoi CBS137.29 JN192381 Manamgoda et al., 2014 C. lunata CBS 730.96 JX256429 Manamgoda et al., 2014 C. miyakei CBS 197.29 KJ909770 Manamgoda et al., 2014 C. neoindica BRIP 17439 AF081449 Manamgoda et al., 2014 C. neergaardii DAOM 228085 KJ909784 Manamgoda et al., 2014 C. nicotiae CBS 655.74 KJ909772 Manamgoda et al., 2014 C. nodulosa CBS 160.58 JN601033 Manamgoda et al., 2014 C. ovariicola CBS 470.90 JN192384 Manamgoda et al., 2014 C. pallescens CBS 156.35 KJ922380 Manamgoda et al., 2014 C. papendorfii CBS 308.67 KJ909774 Manamgoda et al., 2014 C. perotidis CBS 350.90 JN192385 Manamgoda et al., 2014 C. portulacae CBS 239.48 KJ909775 Manamgoda et al., 2014 C. prasadii CBS 143.64 KJ922373 Manamgoda et al., 2014 C. protuberata CBS 376.65 KJ922376 Manamgoda et al., 2014 C. ravenellii BRIP 13165 JN192386 Manamgoda et al., 2014 C. ryleyi CBS 349.90 KJ909766 Manamgoda et al., 2014 C. robusta CBS 624.68 KJ909783 Manamgoda et al., 2014 C. sesuvii Bp Zj 01 EF175940 Manamgoda et al., 2014 C. spicifer DAOM 575355 KJ922377 Manamgoda et al., 2014 C. spicifer CBS 274.52 JN192387 Manamgoda et al., 2014

31

Table 2-2. Continued Species Strain no. Accession no. References C. subpapendorfii CBS 656.74 KJ909777 Manamgoda et al., 2014 C. trifolii ICMP 6149 KM230395 Manamgoda et al., 2014 C. tripogonis BRIP 12375 JN192388 Manamgoda et al., 2014 C. tuberculata CBS 146.63 JX256433 Manamgoda et al., 2014 C. verruculosus CBS:148.63 HF 565480 da Cunha et al., 2013 Exerohilum rostratum P1 KJ830935 Sharma et al., 2014

Table 2-3. Number of samples with the indicated fungal species isolated by month Month of Isolation Species Jan Feb Mar Apr May Jun Bipolaris cynodontis 9 8 10 4 11 6 Curvularia hawaiiensis 0 3 0 3 3 1 Curvularia verruculosus 1 2 1 0 3 2 Exserohilum rostrata 0 0 1 0 2 0

Figure. 2-1. Distribution of the species identified in the samples submitted from golf course in 22 Florida counties

32

Figure. 2-2. The phylogenetic tree constructed using studied isolates, reference sequences, and the maximum likelihood method

33

CHAPTER 3 EVALUATION OF AZOXYSTROBIN RESISTANCE IN BIPOLARIS CYNODONTIS

Introduction

Bipolaris leaf spot and melting out is caused by fungal Bipolaris species (Smiley et al.,

2005). This disease can cause leaf spot and crown and root rot, which reduce turf quality.

Bipolaris leaf spot and melting out can be difficult to control and can require integrating a combination of management approaches including horticultural and chemical control measures.

Proper nutrient management can contribute to minimizing disease pressure. Avoiding excess nitrogen fertilizer application during periods favorable for disease may help limit the severity of possible disease outbreaks. Raising mowing height and diminishing other stresses from turfgrass also may help reduce the likelihood of severe disease (Elliott and Harmon, 2014). Irrigation cycles should be timed such that periods of natural leaf wetness from dew or rain events are not lengthened. For example, avoiding irrigation during the early evening can prevent leaf wetness events that extend into the following morning’s dew period. These horticultural inputs can help reduce the likelihood and severity of disease, but chemical fungicides often are needed as well.

Fungicide options for controlling leaf spot and melting out include dicarboximide fungicides, QoI fungicides (azoxystrobin, pyraclostrobin, trifloxystrobin), DMI fungicides, and various multi-site contact fungicides. Azoxystrobin is one of the most effective QoI fungicides for managing Bipolaris leaf spot (Tomaso-Peterson and Standish, 2014; Payne and Walker,

2014). QoI fungicides also have been determined to have a high risk for resistance development in target fungi. Azoxystrobin and all QoI fungicides have a single-site mode of action with a handful of known mutations conferring resistance in several plant pathogens. Resistance has been documented in Alternaria species (Ma et al., 2003), Blumeria graminis f. sp. tritici

34

(Sierotzki et al., 2000), Pyricularia grisea (Vincelli and Dixon, 2002; Kim et al., 2002), Pythium aphanidermatum (Gisi et al., 2002), and Colletotrichum graminicola (Avila-Adame 2003).

Resistance to QoI fungicides has been demonstrated with biological assays such as radial growth or spore germination on fungicide-amended media (Wong et al., 2007; Dube et al., 2014;

Fernández-Ortuño et al., 2006). Molecular methods also have been developed that employ polymerase chain reaction (PCR) amplification and sequencing of genes that code for portions of the QoI target proteins. Changes in specific nucleic acids have been associated with insensitivity of fungi. Specifically, the QoI fungicides inhibit mitochondrial respiration by binding to and blocking the ubiquinol oxidizing pocket (also known as Qo site) of the cytochrome bc1 enzyme complex (Becker et al., 1981; Clough, 1998; Barlett et al., 2002). Mutations shown to confer

resistance include a glycine to alanine substitution at amino acid codon 143 (G143A), a

phenylalanine to leucine substitution at amino acid codon 129 (F129L), and a glycine to arginine

substitution at amino acid codon 137 (G137R).

The objective of the study was to determine if Bipolaris cynodontis isolates collected

from golf courses across Florida had mutations known to confer azoxystrobin resistance.

Materials and Methods

Whole Genome Sequencing

Single spore transfers of B. cynodontis isolates 1318 and 1349 were cultured on plates of

V8 agar medium overlaid with cellophane (BioRad) for a DNA extraction method modified from

Saghai-Maroof et al. (1984). Plates were incubated in a controlled environment chamber at 24°C and a 12-h diurnal light cycle for 3 days. The mycelia and cellophane were removed from the agar surface and were lyophilized for 12 hours. The lyophilized mycelium was ground using glass beads in a Mini-Beadbeater (BioPointe Scientific, Bartlesville OK) setting 42, for 20

seconds. CTAB solution (see Appendix) was then added into the gridding tube without removing

35

the glass bead. The grinding tube was incubated for 10 minutes at 68 °C and inverted 2-3 times during incubation. The grinding tube with supernatant was centrifuged at 14,000 rpm for 5 minutes. The supernatant was then transferred to a fresh 2 ml tube. To separate proteins and polysaccharides from nucleic acid, chlroform (ChCl3) (Fisher Scientific, Pittsburgh PA) was added to the 2 ml tube at equal volume of supernatant. The supernatant was mixed by inverting the tube until the supernatant became uniformly milky-like. The tube with milky-like supernatant was then centrifuged at 12000 rpm for 5 minutes. The DNA (aqueous phase) was separated from the protein and chloroform after centrifuging. The DNA was then transferred to a fresh 1.5 ml tube. To precipitate nucleic acid, isopropanol (Fisher Scientific, Pittsburgh PA) at 2/3 of the

DNA volume was added to the DNA tube. The solutions were mixed by inverting the tube until nucleic acids became fluffy. The tube was then centrifuged at 6000 rpm for 5 minutes. After centrifuging, the pellet of DNA is located at the bottom of the tube. The liquid in the tube was discarded by pipetting without disturbing the pellet. To remove residual protein and carbohydrate in nucleic acid pellet, 1000 µl of 70% cold ethanol was added to the DNA pellet. To rinse the pellet DNA, the tube was inverted until the DNA pellet was released from the bottom of the tube.

The liquid was discarded by pipetting. The DNA pellet was air-dried in a fume hood for about

30-50 minutes, until the pellet became jelly-like. The DNA pellet was dissolved by adding 25 µl increments of DNA grade water (Fisher Scientific, Pittsburgh PA). The tube was inverted and incubated at 50 °C for 15 minutes, until the DNA is completely dissolved. A 5 µl aliquot of

RNase A stock (Qiagen Santa Clarita, CA) was added to the extracted DNA and incubated at 37

°C for 30 minutes. The genomic DNA from each isolate was submitted for Illumina sequencing to the Interdisciplinary Center for Biotechnology Research (ICBR, University of Florida,

Gainesville, FL).

36

The DNA sequences were assembled into draft genomes by Dr. Jeffrey Rollins. The assembly was searched with Blast using Phaeosphaeria nodorum SN15 mitochondrion sequence

(accession number: EU053989.1). The cytochrome b gene sequence containing the three QoI mutation sites was located on a contig from the isolate 1318 assembly.

Primers Sets Used to Attempt Amplification of The Cytochrome b Gene

Three groups of oligonucleotide primers were tested to amplify sequence of the QoI

mutation sites in the cytochrome b gene of B. cynodontis. The first group of primers was known

to amplify the target sequence in other species of fungi (Table 3-1). The second primer set was

designed using the related fungus Cochliobolus heterostrophus, scaffold_47:34321-34542 (Table

3-2). The third primer set was designed directly from contig_474 from the isolate 1318 genome

assembly provided by Dr. Rollins Table 3-3.

Amplifications took place in 20 µl reaction volume containing 10 µl of REDExtract-N-

Amp (Sigma-Aldrich, St.Louis, MO), 4 µl of primer mix (2 µl of forward primer and 2 µl of

reverse primer) and 6 µl of 20 ng DNA template. PCR reactions were performed using an

Eppendorf thermocycler model ep gradient S, number 5345 026094 (Eppendorf AG, Hamburg,

Germany). The parameters for PCR amplifications were set as follows: an initial denaturation at

95 °C for 3 min, followed by 40 cycles of denaturation at 95 °C for 40 s, annealing at 60 °C for

40s, extension at 72 °C for 45 s, and a final extension at 72 °C for 5 min. PCR products were

separated by electrophoresis in a 1.5% agarose gel in Tris/Borate/EDTA (TBE) buffer, stained

with ethidium bromide, and visualized with UV light. Purification of the PCR products were

performed with an ExoSAP-IT PCR Product Cleanup according to the manufacturer’s directions

(Affymetrix, Santa Clara, CA) and were submitted for bidirectional sequencing to Eurofins

Genomics (Louisville, KY).

37

Amended Agar Assays

The sensitivity of the Bipolaris isolates to azoxystrobin was evaluated using a radial colony growth assay. Quarter strength potato dextrose and V8 juice agar media were assessed with different combinations and concentrations of azoxystrobin.

Stock solutions of fungicides were prepared in sterilized de-ionized water (SD water) by serially diluting to obtain 4 solutions with the concentration increasing in tenfold increments from 1 to 100 mg/ml. 1 ml of each solution was added to 500 ml of autoclaved, cooled to 40 °C, quarter strength potato dextrose or V8 agar to obtain media with fungicide at 1 to 100 µg/ml. The

0 µg/ml treatment was amended with only 1 ml of SD water.

Fungicide Sensitivity Assays

A 4 mm plug from the edge of a 4-day-old culture on V8 juice agar medium of each evaluated isolate was transferred to the center of three replicate plates of non-amended and various concentrations of amended media. Plates were incubated for 4 days at 20°C with 12 hour light cycles. Two perpendicular diameters were averaged from each of three plate replicates

96 hours after inoculation. Growth response for each isolate on each amended medium was expressed as a percent reduction calculated by dividing the average colony diameter on amended media plates by the average colony diameter on non-amended media.

In vivo Sensitivity of Bipolaris Isolates to Azoxystrobin Fungicides

Bipolaris cynodontis isolate and preparation of inoculum. Bermudagrass (Cynodon dactylon x C. transvaalensis cv. TifEagle) stolons were planted in Turface MVP, calcined clay

(Profile Products LLC, Buffalo Grove IL) in 10-cm-diameter plastic pots. Plants were grown in a climate-controlled greenhouse between 24 and 27°C for 8 weeks with natural light supplemented with 120 V, 4 A, 400 W and 60 Hz mercury lamps (Sun System 3, Sunlight Supply Inc,

Vancouver WA). Plants were clipped once per week to maintain a height of 5 cm.

38

Half of the plants were treated with the Heritage WDG fungicide at label rates of 1.5 g/liter 24 hours before inoculation. The fungicide was applied to runoff with a CO backpack boom sprayer, calibrated to deliver fungicides in 2 gallons of water per 1,000 sq ft₂ through two

TeeJet 8002VS flat fan nozzles (R&D Sprayers, Opelousas, LA) at a pressure of 2.0 atm. Check treatment plots were sprayed with water only.

Inoculum of three isolates of B. cynodontis was obtained from colonies grown on Sach’s media, with 10 to 15 autoclaved St. Augustine leaves incorporated in each plate (Dhingra and

Sinclair, 1995), and incubated at 20°C for 7 days with a 12-h light cycle. Inoculum was harvested by flooding the culture plates with sterile distilled water and rubbing the plates by using a glass rod with a gum rubber tip. The conidial suspension was then filtered through a double layer of cheesecloth and adjusted to a concentration of 5.0 x 10 conidia per ml.

Three pots of turfgrass treated with Heritage fungicide, and three⁴ pots of turfgrass treated with water per isolate were clipped prior to inoculation. An aerosol sprayer (Crown Spra-Tool,

Fisher Scientific, Pittsburgh PA) was used to apply the conidial suspension until leaf run-off.

Check pots of grass were sprayed with tween treated water. Pots were enclosed in a polyethylene bag with moist paper towel in the bottom and incubated at 20°C for 24 h in the dark.

Disease severity was evaluated 4 days after inoculation on a 0-100 % scale, where 0 %

equals no leaf infection and 100 % equals every leaf completely covered with leaf spots. The

disease severity was measured with the aid of a dissecting microscope. The experiments were

performed three times. Means of the treatments from each experiment were statistical analyzed

by analysis of variance (ANOVA) and significant differences among means were identified by

Waller-Duncan k-ratio t-test using SAS, statistical analysis software (SAS Institute Inc., Cary

NC).

39

Results

Sequencing of Cytb Gene in Bipolaris cynodontis

Attempts to amplify the cytochrome b gene from B. cynodontis isolates with primers in

Table 3-1 and 3-2 were not successful. Primer Cytbfwd 4 – 5´-

AGGATCGCTACAGACTGGGT-3´ was designed from the coding region of the Cyt b gene

identified from the genome assembly, and Cytbrvs 4 – 5´-AGAGCAATTGGGAGCTGAGA-3´

was design in an intron found after codon 143 of the Cyt b gene from the genome assembly.

Cytbfwd 4 and Cytbrvs 4 did produce an amplicon from 38 of 48 isolates. The amplicon

contained coding sequence for the three known QoI-resistance mutation sites (Figure 3-2). Of the

38 isolates examined, the only mutation previously associated with a fungicide insensitivity phenotype identified from the sequences was in isolate 1344 at position 129, shown in the third column in Figure 3-3. The mutation changed the predicted amino acid from phenylalanine to leucine (F129L). Amino acid sequence at position 143 and 137 contained the conserved Glycine

(G) in isolates sequenced. Determination of the residue at the 137 position was not possible for

four isolates due to poor quality sequence data.

Azoxystrobin Sensitivity Assay

From eighty-one isolates, the lowest percent reduction of mycelial growth (7.80%) was isolate 1243 and the highest percent reduction (52.61%) was isolate 1331. No isolates were completely inhibited by azoxystrobin. Percent reduction for B. cynodontis isolates are shown in

Table 3-4. Percent reduction for other species including Exserohilum rostrata, Curvularia papendorfii, Curvularia verruculosus, Curvularia spicifera, and Curvularia hawaiiensis isolates are shown in Table 3-5.

40

Pathogenicity Test

Isolate 1326 and 1375 were selected for the pathogenicity test based on the known use of

Heritage fungicide on the respective golf courses. Isolate 1344 was added to the pathogenicity

test due to the mutation in the cytochrome b gene at position 129. Inoculated pots of grass that

were not sprayed with Heritage developed leaf lesions characteristic of Bipolaris leaf spot. Of

these, pots inoculated with isolate 1344 developed significantly greater disease severity than

those inoculated with isolate 1326 or 1375 (Figure 3-4). Inoculated pots of grass that were

sprayed with Heritage developed less severe disease symptoms than those not sprayed with

Heritage. Pots inoculated with isolate 1344 after treatment with Heritage did develop disease

(18% disease severity), but symptoms were less severe (P < 0.05) than on those pots not treated

with Heritage (50% disease severity). Pots of grass treated with Heritage and inoculated with

isolate 1326 or 1375 had similar levels of disease severity to uninoculated pots (0% disease

severity) (P < 0.05).

Discussion

The sequence of the cytochrome b gene that encodes mutation sites known to confer

resistance to QoI fungicides was found on a DNA sequence contig of a B. cynodontis draft

genome assembly. Primers from related organisms and other fungi did not amplify the target

sequence from B. cynodontis, because of a large intron in the cytochrome b gene of B.

cynodontis inserted just after codon 143 (Fig 3-1). Of the isolates tested, only one was confirmed to have a mutation previously known to confer partial resistance to QoI fungicides in other plant pathogens.

Amended media assays did not reliably inhibit mycelial growth of B. cynodontis. Percent inhibition of mycelial growth for isolates tested did not correlate to the presence of mutations in the cytochrome b gene sequence. Growth in amended media has limited potential for diagnosing

41

fungicide resistance from disease samples. Tests were also conducted in media amended with

SHAM using 4 isolates of B. cynodontis. Growth of mycelium was inhibited and irregular in media amended with SHAM with and without azoxystrobin (data not shown).

The inoculation experiment showed that the one isolate containing a mutation known to confer partial insensitivity to azoxystrobin in other pathogens did cause disease on bermudagrass treated with Heritage containing azoxystrobin. Disease severity was reduced compared to severity on grass not treated with Heritage. This partial resistance response is consistent with the phenotype of the F129L mutation in other plant pathogens (Pasche et al., 2005; Leiminger et al.,

2014). However, the two isolates thought to be sensitive also were less virulent than the mutated isolate. Additional research is needed to test isolates of the same virulence as the mutated isolate to determine if the difference in disease caused after treating grass with azoxystrobin exists is due to the mutation or due to a generally more virulent isolate. These experiments also must be conducted three times.

In conclusion, only one isolate of B. cynodontis collected from golf courses in Florida as part of this study was confirmed to have a mutation known to confer partial resistance to azoxystrobin fungicide in the QoI class of chemistry. Additional efforts are needed to determine the sequence of several additional isolates. Amended media assays using the concentrations and conditions tested could not differentiate the isolate with the mutation from others as has been reported for some plant pathogens (Cox et al. 2009; Rampersad, 2011; Zhu et al. 2012; Cox et al.

2007). Inoculations of the mutated isolate onto turfgrass treated with azoxystrobin did produce symptoms, but additional research is needed to determine if the reduction observed differs from isolates of equal virulence but without the mutation, and whether or not that difference equates to field resistance for turfgrass managers. In either case, given only one isolate was found to have

42

the mutation, future research on Bipolaris leaf spot of bermudagrass should focus on other potential causes of reported fungicide failures or other mechanisms responsible for fungicide insensitivity.

Table 3-1. The primer sets from related fungi Primer Sequence (5´ to 3´) Reference cytb2f CTATGGATCTTACAGAGCAC Vega, et al. 2012 (Alternaria sp.) DTRcytb2-INTr GTATGTAACCGTCTCCGTC Vega, et al. 2012 (Alternaria sp.) P1 GATCATATAGAGCTCCTCG Avila-Adame et al., 2003

P3 CCACCTCAAATGAATTCAAC Avila-Adame et al., 2003 Cytb-BcF TAAAGTGGTATAACCCGACGG Jiang et al., 2009 (Botrytis sp.) (Botrytis sp.) Cytb-BcR CCATCTCCATCCACCATACCT Jiang et al., 2009 (Botrytis sp.) (Botrytis sp.) Bc-ext13F ATAACCCGACGGGGTTATAGAAT Ashour Amiri, unpublished (Botrytis sp.) Bc-ext13R AACCATCTCCATCCACCATACCTACA Ashour Amiri, unpublished (Botrytis sp.)

Table 3-2. The primer sets designed base on Cochliobolus heterostrophus, scaffold_47:34321- 34542 Primer Sequence Reference Phf 1 CTAATGGGTGGCTGAAATGC scaffold_47:34321-34542 Phr 1 GGGTGTTCTTCTTGGATAACAAGG scaffold_47:34321-34542 Phr 2 AAACTCCTGCAGCTATCGTTC scaffold_47:34321-34542 NCBIf1 AATGGGTGGCTGAAATGCTG scaffold_47:34321-34542 NCBIr1 GCAAACTCCTGCAGCTATCG scaffold_47:34321-34542 NCBIf2 GGTGGCTGAAATGCTGCTTA scaffold_47:34321-34542 NCBIr2 CAAACTCCTGCAGCTATCGT scaffold_47:34321-34542

Table 3-3. The primer sets designed using R_2014_07_11_13_39_47_user_LIL- 46_Rollins_contig_474 contig (Bipolaris cynodontis cytochrome b gene sequence) Primer Sequence Cytbfwd 1 TGCGTGATGTAAACAACGGG Cytbrvs 1 TGCAACTAAATCAGTCATGCTTTCT Cytbfwd 2 GGTTCTAGACAAGCAAAACAAGGT Cytbrvs 2 TAGCGGAACGTCCTCAACAC Cytbfwd 3 AGTCATCCGATTTTAAGATTAGCGA Cytbrvs 3 TTTTCAAGAACAGTAACACCATACA Cytbfwd 4 AGGATCGCTACAGACTGGGT Cytbrvs 4 AGAGCAATTGGGAGCTGAGA

43

Table 3-4. Results of azoxystrobin amended media assay B. cynodontis Diameter of fungal colony (mm) Isolate Reduction (%) Mean STDV 10 µg/ml 0 µg/ml 10 µg/ml 0 µg/ml 10 µg/ml 1303 12 45 40 0.3 4.9 1306 23 55 42 0.4 2.2 1308 11 49 44 0.5 1.4 1310 31 57 40 2.1 1.0 1311 7.9 46 43 1.8 3.2 1314 19 44 36 0.7 1.5 1318 24 58 44 0.9 1.0 1319 27 59 43 1.0 2.0 1325 11 47 42 0.4 0.8 1326 41 58 34 0.1 1.6 1327 16 46 39 1.4 1.1 1331 53 59 28 0.7 1.5 1333 35 58 38 1.4 1.7 1334 31 53 37 0.8 2.7 1335 41 58 34 0.1 3.5 1337 34 52 34 2.2 1.5 1339 22 50 39 0.9 2.2 1340 42 58 34 1.4 3.3 1343 22 50 39 2.2 1.4 1344 41 57 34 0.9 1.9 1347 41 57 34 3.0 1.2 1349 35 58 38 0.3 0.4 1355 32 57 39 1.0 1.4 1357 36 54 35 0.8 0.5 1364 36 62 40 1.1 2.3 1365 29 57 41 1.3 2.2 1371 35 61 40 0.6 1.2 1373 20 49 39 1.0 1.2 1375 33 57 38 1.7 2.0 1376 18 50 41 0.6 1.8 1378 28 67 48 1.2 0.1

44

Table 3-5. Results of azoxystrobin amended media assay for species other than Bipolaris cynodontis Reduction(%) Diameter of fungal colony (mm) Mean STDV 10 µg/ml 0 µg/ml 10 µg/ml 0 µg/ml 10 µg/ml E. rostrata 1348 16 52 44 1.1 1.8 1370 35 61 39 1.1 0.9 C. papendorfii 1353 41 49 28 0.9 1.4 C. verruculosus 1249 34 52 42 1.0 3.2 1302 11 40 35 0.9 2.0 1328 33 55 37 0.5 1.7 1329 31 58 39 1.2 1.5 1341 38 57 35 2.8 2.2 1366 13 67 58 1.8 2.2 C. spicifera 1369 34 57 37 8.1 1.8 C. hawaiiensis 09-20 16 43 36 0.9 2.0 1312 5.5 45 43 2.4 2.8 1313 27 58 42 0.6 1.8 1315 33 58 39 0.1 1.4 1358 41 48 28 2.1 1.1 1360 25 65 48 1.8 2.0 1362 30 62 42 1.8 1.0 1374 19 49 40 2.1 1.6

45

>R_2014_07_11_13_39_47_user_LIL-46_Rollins_contig_474 TTTTTTTTACTTTTTGCGAAGGATAATTATATTATAAGGATATGAAAAGGAAGAAACATTCTAAAGCCCCTGTTGGGGACTAGATATTTTATGATTTAG TAGCCTTTATAGCTCAATGGTAGAGCGGAATACTGTTAATATTCTGATAAATGTTCGATTCATTTTAAAGGCTTGCATTCTTTATAGAAAACACCTTAT GACTATTATATTTAAGTTTAAACGGATATCAAAAGCCTTTTGGTTTAATAATTTTATTTCCGATGCGGGGGGGGGTATATTTCTATTTCAACCATTGTT ACAAATAATTATAGAGCATGCTAAAGTTTAATAGTTATAGAGCATGATAAAGTTTAATAGCTATAGAGCATGCTAAAGTTTAATAGTTAGATGAATA GTTTACCTATACAACTTTACCCTTTCACCTAGCAAATATAAAACTTAATAATAATGCATTGGTCATATATCTATATACTTATGCATATAAATAATAACA GGAAATTTATAAAAGATTTAATGGTTTATAATAAATCCGTTAAATAGTAATAAAGCAGTGTAACTGTTAACATAATTTACTAAATGAAAATAAGATTA AAGCAAAAAAATAAATAAATGAGATTATTTAAAAGTCATCCGATTTTAAGATTAGCGAATTCATACTTAGTTGATTCACCACAACCTATAAACTTAAG TTACATGTGAAATTTTGGTTCTTTATTAGCCTTTTGTTTAATTATACAAATTGTTACTGGTGTAACTTTAGCTATGCACTACAACCCTAGTGTAGCAGAA GCATTTAATAGTGTTGAGCATATTATGCGTGATGTAAACAACGGGTGATTAATACGTTATTTACATAGTAACACTGCTTCAGCATTTTTCTTCATAGTT TACTTACACATAGGTAGAGGTATGTACTATGGATCATATAGAGCACCTAGAACTCTAGTATGAACTATTGGTACTGTTATCTTTATCTTAATGATGGCT AAAGATAAGTGGCCAAATTGAATGTTAATTTCTCATAATAAATGTATCCAATATAACTCATCATCTTATTTCAGTAAATCTAGAACTAAAGCGTTATA TAGAATAGGTCCACATAATAAGGAGGTTTTATCTATTATAATATGCGGTATGCTTGGTGACTGGTGAGCAGACCAAATTAAGGGTCAAACATCTCCAA GTGTAAGATTTAGTATGGAGCAAGGAATAAATAATACTGCTTATATTCATAGTCTTACCTTATATTTTTATAAATTAGGTTATTGTTCTAATATCACTC CTCATCTTGTAAAGAAATCTGATAAAGATAGTGCAAGAGAGTTGGAAGATAGGTTTAATTATAGATTAACTCTATATACTTTTACTTCATTATTGTGA ATTTATGATTCTTTTTATAAAGACGTAAACGGAAAAAAAACAAAAATTATACCTAGCTGAATAGGAGAATATATAACTCCTATAGGTTTAGCTCATTG AATAATGCAAGATGGTTCTAGACAAGCAAAACAAGGTATAAACATTGCAACTAATGGTTTTACTTTTAAAGAATGTACTTTTTTATGTAATATATTAA AAGATAAATATAATCTTAAATGTACTGTTGTAAAAACAGGATTTGCAGATCAATGAAAAATAAGTATTTGAAAAGAAAGCATGACTGATTTAGTTGC AATAGTTAAACCTTATATAATAGATGAGATGAAATATAAATTTATTGGTTACATTTAATATGAAATTAAAAATCAAAGTCCGTCTCCAATAAAAGTAT ATGCAATATGTATATAGAAATATACTAGTAATAAGATATTACTGTGAGATAGTATACCCTGACAGGGGTATAGGATAACTACTAGTTATCTGGCAATG CGGGTGAATACGGTTAAAGACTTGATATCTAAGTTAAGACCGTCGGTTCTATACAGGATCGCTACAGACTGGGTCACCTGTGGGTATCTGAAATGATA TCTAATGTACAGTCGGAAATTTCTATAACAAATTTGTTATACACAAGGCTTTAAATGAGAAATATTATAAAGAGATTTAGCGTGTCTCGGGGACTAAT ATTTTGATAAAGTACAGGCGCGCTATTCAGATAAAATAAAAGGATAGTTAGCGGAAATTTAGACAGCTTTCCTGGGTTATGTATTGCCTACGGGCAA ATGTCACTATGAGGTAAAATTTTTGCCTCAAATGTATAACTAAAAAAAATAAAAAAAAAATAAAAAAATAAAAAAAAAATAAAAAAAAAAATTAAA AAAAAATTGGTGACTTCATCTTTATTTCCTCCAGTACCAAAGATAGTAAGGTACAATTAATGAGGAGAAGTGTATCTCCAATAGCTAAATTTCTCTCC ACCTGCTAAGTATTCCCCACAAAATTCAAACCCTGTTTTTTCCAAAACTCTTATACTTCCTTTGTTACTCATATGGATCTCAGCTCCCAATTGCTCTTTA GCCTCTTGATGGTAAAAAAATTTACCCAATGAGATAGCCTGTACACGCATGCGTGTATTCTCACGTGGCAGACTCCACCAAACACCTAGGAACTCCTT TACAAATTCAGTGGCGTATCCCTTATTCCAATACTCTTTTTTCAAAACATAATAGATCTCAGGCCATTTTTCATCCTTGTTATCCAAGAAGAACACCCC TCCATCTCCAATTAACTCCCCTTCGGTTCCGTCTGGCTTTTTGAGGAAGATTCCGACCATTGCATAGTCGATGAGTTTTCGTTCGAGAAAGTATTCTCG AGTACTTTGAACGAAAGTTTCCAACTGGCTTTGGTTTGGTGTTGAGGACGTTCCGCTATTGGATAGAGATGACTTGTATATGGCAAGGTATACCGTAA AATCCGAGGCAAGAAGCGGTCGAAATATAAGACGTTCGGAAGAAAACCCCATAAGGTTTTTGTGAGAAGGTTTGGTAGTTGATACTTGGACAGAAG AAGGGGTTGAGGAAAGAGTAGAAGACATTGAGGTGCATTTGGTTGATTTTACACGAACTTTTTGAAGTGTAAGTGTGTAAGGTGAACACGAATTAGT TGAGTGAAAAGGGTGGTACTTATACTGTAAAAGGCCAAGCACATACCCACTGTACCAAGCACATAGCCACTGTGCCAAACAGGCAACCGTTGTACCA AGCAGGCAACTATGCAGCCAAGTAGACTAATCTTACAATCATTGAAAGGAGTAGAAGTCATCTGAACAACATAATATAAAACTGAAACCTCCTATTG GTGCATTATTATGTGACTCACATCCATCGGTGATCCGGGAATACAGACACGTCATCCATTCGGAAAAAAGATAAGCTTGTATGTTTTGATTGGTGAGA CTTTATCTATCACGCACAGCAATCGGCGATCTAGGAGAACGGACGTCTTAACGTCTTGGCTAAAGATAAGGCCGCAACCTCCAAATGGTGGAAAGTT ATGTGACCCCTCCCCCACCACATACCTTCTTCTTGGTGGTCGGCTAATACGGAAGGTGGACATATCACCAGATAGAATAAGATAACCTTGAATGATTC GATAGGTGGAGTGTTATATCTGACTCATTAGGTGGAGTGTTATATCTGACTCATTAGGTGGAGTGTTATATCTGACTCATTAGATCGGAGATATCCGG ACTTTGTACCGTAATCAGATAAGTACCCTTCTTTCGATTTGTCCTTTCTATGATACGTTTCATCTTCTTTGTAAGGGAAAAATAGAAAATATAGTTTTTG AAGACGGACTTAGATATAATGCATGTTTTTGGAGATGGTGGATAGGATGATTGGTAAAATAAGGGACCATGTTGTATTTGAAGGTGTTTAAGTTTGTA TTAGTTTTTTTTTTTATTACAAACAAACAGAAGCAAAGCCTATTTGTTTATATTTTTATTAGTTATGTTTTTATTAGTTATATATAGTTGCAGAATCTTTT AAGGCAATATTTATTTAAAACTTATTAGGTCCCCCTTTTAATATAAAAGGACCCAATATGATTTTGCAGCAATGCTTGTGAAAACGGTCAAATATATT TGTTTAGTATAAAGACCGTCGGTATAATAAAATATCGCTACAGACTGGTTCACAGGTGGGTAGCTGAAATGCTGCTTAATGTACAGTCGGAATCTTTT TTCAGTATATATAGGTTTTATATTGAAAAACAAGGCATTATACTGTATTTTATTACAATTATCTTTATAAAGATAAGTATGGTGTACATGATTTACTTA TTTAAACACTAAGAGTTTAAATAAACTATCCCTGTCGGGATGAGCCCCATCGGGGGTCTTCCCAAAGGGTCAGCCCCCTCGGGGCTAGAATAAGTAA ATTGAAGATTTGGCTACAGTTATTACTAACCTTATGAGTGCTATTCCTTGAGTAGGACAAGATATTGTAGAATTTATTTGAGGTGGTTTAAACACAGTT GAACCATATTGCGGCGACGTAATATTAAAAATTTTGCTTAATGCTGGAAAATCCCCTAATTTAGGACTTGCATACGATTTATTCTTTATATTTATAATT ATTTACGTGAAAATTGCAATTACACGGGGACAATCAGCCGGGGTGAGAAGTTTACATACTTCAGAGGCCTCTCAGAGACTACATGCAGAAGATCTCG TATATGCTTATATAGTAGGTTTATTTGAAGGTGACGGTTTTTTTTCTATTACAAAAAAAGGTAAATATATTACATATGAACTAGGTATAGAACTTTCTA TAAAAGACGTTCAATTGATTTATAAAATTAAAAAATTATTAGGTATAGGTGTAGTAAGCTTCAGAACAAGAAAAGAAAGTGAAATGGTATCTTTAAG AATTAGAAATAAAGACCATTTAAAAAATTTTATTATACCTATATTTGACAAATACCCTATGTTTTCTAATAAACAGTATGATTATTTAAGATTTAAAGA CGCTCTATTATCAGGTATTATATATTCAGAAGATTTACCTGAATATACTAGAGATAGCAAACCTATAAATACAATAGAATCTATTACAGGTGCTTCTT ATTTTTCTGCTTGATTAGTAGGGTTTATAGAGGGTGAGGGTTGTTTTAGTGTTTATAAGTTACACGATAATAAAGATTACTTAGTGGCTAGTTTCGATG TTTCTCAAAGAGACGGAGAAATTTTATTATCTGCTATTCGTCAGTATTTATCTTTTACTAATGCTATATATATAGACAAAACGAATTGTTCCAAATTAA AAGTTACAGGAGTAAGATCCATAGAAAATGTTATTAAATTTCTACAAAAAGCTCCTGTTAAATTATTGGGTAATAAGAAATTACAATATTTATTATGA ATTAAACAATTGCGTAAAATAACTAGATATTCAGAAAAAATAAAAATACCTTCAAAATACTAAAAGAGATCAAGATATAGTCCGATCAATGAAGAG ATTCATTGAGTGTAACGATAGTTTGTTTCAAATGAAGTTACCAACATAAATGCTCTGTAAACAATGCAACATTAAATAGATTCTTCTCATTACATTTCG TTTTACCTTTCGTATTAGCTGCTTTAGCACTAATGCACTTAATCGTTTTACACGATACAGCTGGATCAGGAAATCCTTTAGGTGTATCTGGAAACTACG ATAGAATGCCTTTTGCTCCATATTTAATATTTAAAGATCTTATTACAATCTTTGCATTTATATTTGTATTATCTTTATTTGTGTTCTTTATGCCTAATGTA TTAGGAGATAGTGAAAACTATGTTGTGGCAAATCCTATGCAAACTCCTGCAGCTATCGTTCCAGAATGATATCTTCTTCCTTTCTATGCTATATTAAGA TCAATTCCTAACAAATTATTAGGAGTTATAGCAATGTTCGCAGCTATTCTTATATTACTACTATTACCTGTTACAGATGTAAGTAGATCGAGAGGTATG CAATTTAGACCTTTAAGTAAAGCAGCTTTCTTTGCATTTGTTGCTAATTTCTTAATCTTAATGCAATTAGGTGCTAAACACGTTGAGTCTCCATTTATTG AATTTGGACAAATAAGTACCGTATTATACTTCTCTTACTTTACTTTTGTAATGTATGGTGTTACTGTTCTTGAAAATACTTTTGTGGATTTAAGACACAA AAAATAGAAAAAACTTTAAAGTTAAATAGCCCTCCAGTCTTCTTTTAGCCCTCCAGCTACAAGTAGCTGGGG

Figure 3-1. DNA sequence of the contig containing a partial cytochrome b gene sequence of Bipolaris cynodontis isolate 1318 (exon in red and intron in black). Primer Cytbfwd 4 is highlighted in yellow and Cytbrvs 4 reverse complement is highlighted in green.

46

Figure 3-2. Alignment of DNA sequences coding for amino acid residues 127 to 143 of the cytochrome b gene of 38 Bipolaris cynodontis isolates

47

Figure 3-3. Partial amino acid sequences including residues 127 through 143 of the cytochrome b gene from 38 Bipolaris cynodontis isolates. Line 13 shows the F129L mutation found in isolate 1344

48

Figure 3-4. Levels of disease severity from isolate 1326, 1344, and 1375. Control pots were inoculated with water only. The w treated pots were sprayed with water and the a treated pots were treated with Heritage fungicide (azoxystrobin).

49

APPENDIX A SURVEY FOR BIPOLARIS SPECIES ISOLATED FROM BERMUDAGRASS GOLF COURSES IN FLORIDA

Culture media recipes

Water Agar

Ingredients

Distilled water 500 mL

Granulated Agar 3.8 g (Becton Dickinson & Co, MD)

Instructions

1. Mix granulated agar and distilled water

2. Autoclave and cool to 50-55°C

3. Pour into standard sized petri plates

Acidified Potato Dextrose Agar

Ingredients

Distilled water 500 mL

Potato dextrose agar 12.8 g (Becton Dickinson & Co, MD)

50% lactic acid 7 drops (Fisher Scientific, NJ)

Instructions

1. Mix Potato dextrose agar and distilled water

2. Autoclave and cool to 50-55°C

3. Add lactic acid while swirling

4. Pour into petri plates

50

Thiophanate Methyl Agar

Ingredients

Distilled water 500 mL

Granulated agar (Becton Dickinson & Co, MD) 2.5 g

Potato Dextrose Agar 3.8 g (Becton Dickinson & Co, MD)

Ampicillin 0.25 g (Fisher Scientific, NJ)

Rifampicin stock solution 1 mL (Sigma-Aldrich, MO)

Thiophanate methyl solution 1 mL (Cleary Chemicals LLC, NJ)

Stock Solutions

Ingredient for 50mL stock

Clearys 3336 in sterile water 5.0 g

Rifampicin in Methanol 0.25 g

51

APPENDIX B EVALUTION OF AZOXYSTROBIN RESISTANCE IN BIPOLARIS CYNODONTIS

CTAB solution preparation

1000 µl of CTAB extraction buffer was added to a new 1.5 ml tube. In a fume hood, 10

µl of 1% 2-mercaptoethanol was mixed to prepared CTAB extraction buffer. 15 µl of proteinase

K (0.3 mg/ml concentration) was incorporated to achieve a final CTAB solution.

CTAB (Cetyltrimethyl Ammonium Bromide) extraction buffer

100 mM Tris-HCl (pH8.0)

1.4 M NaCl

20 mM EDTA

2% CTAB

2% PVP

0.2% β-mercaptoethanol

1 M solution preparation

Tris base 121.1 g

Sterile distilled water 800 mL

HCl 42 mL

Additional tests of sensitivity to azoxytstrobin and pyraclostrobin

Five isolates, 1105, 1303, 1309, 1326, and 1328, were tested for sensitivity to azoxystrobin and pyraclostrobin. Bipolaris species isolates from filter paper were grown in V8 media to use in sensitivity assay to azoxystrobin and pyraclostrobin. A 4 mm plug from the edge of a 4 day old culture of Bipolaris species isolates grown on non-amended V8 medium was transferred to PDA medium or V8 medium amended with 4 different concentrations (0, 1, 10 and

100 µg/ml) of azoxystrobin and pyraclostrobin. V8 amended with azoxystrobin and

52

pyraclostrobin were poured into 9-cm-diameter petri dishes. Plates were incubated for 4 days at

20 °C in 12 hour darkness. Fungicide sensitivity was evaluated by using the methodology described in fungicide sensitivity assay.

Table A-1 Radial expansion assay of Bipolaris cynodintis. on quarter strength potato dextrose agar amended with three concentrations of azoxystrobin. Radial Growth (mm)a % Growth Reductionb Isolate 0 µg/ml 1µg/ml 10 µg/ml 100 µg/ml 1µg/ml 10 µg/ml 100 µg/ml 09-20 28 ± 0.9 22 ± 0.4 21 ± 0.4 20 ± 0.1 23 24 28 09-21 25 ± 1.3 19 ± 0.5 16 ± 0.5 15 ± 1.4 24 35 39 09-22 21 ± 1.0 12 ± 0.3 3.4 ± 5.9 0 ± 0 42 84 100 1104 34 ± 0.8 13 ± 0.8 16 ± 0.5 4.8 ± 4.5 61 55 86 1105 24 ± 3.6 14 ± 0.9 6.7 ± 6.0 10 ± 1.8 42 72 58 1301 31 ± 0.5 23 ± 0.8 23 ± 0.4 21 ± 0.5 24 24 32 1253 39 ± 1.4 36 ± 0.2 31 ± 0.7 26 ± 0.4 6.2 19 34 a Mean of three replicate plates measured in two directions with standard deviation (n=6). b Compared to the unamended medium.

Table A-2 Radial expansion assay of Bipolaris sp. on V8 agar amended with three concentrations of azoxystrobin. Radial Growth (mm)a % Growth Reductionb Isolate 0 µg/ml 1µg/ml 10 µg/ml 100 µg/ml 1µg/ml 10 µg/ml 100 µg/ml 1105 54 ± 1.3 40 ± 1.5 36 ± 0.5 34 ± 0.5 26 33 36 1303 45 ± 0.3 41 ± 1.2 36 ± 0.4 39 ± 2.9 8.9 20 14 1309 51 ± 0.4 51 ± 1.0 46 ± 0.6 46 ± 0.0 0.2 9.9 10 1326 58 ± 0.1 39 ± 0.9 32 ± 0.7 33 ± 2.2 33 39 43 1328 55 ± 0.5 36 ± 0.7 35 ± 1.1 35 ± 2.4 35 36 36 a Mean of three replicate plates measured in two directions with standard deviation (n=6). b Compared to the unamended medium.

Table A-3 Radial expansion assay of Bipolaris sp. on V8 agar amended with three concentrations of azoxystrobin. Radial Growth (mm)a % Growth Reductionb Isolate 0 µg/ml 1µg/ml 10 µg/ml 100 µg/ml 1µg/ml 10 µg/ml 100 µg/ml 1105 54 ± 1.3 40 ± 1.5 36 ± 0.5 34 ± 0.5 26 33 36 1303 45 ± 0.3 41 ± 1.2 36 ± 0.4 39 ± 2.9 8.9 20 14 1309 51 ± 0.4 51 ± 0.9 46 ± 0.6 46 ± 0 0.2 10 10 1326 58 ± 0.1 39 ± 1.0 35 ± 0.7 33 ± 2.1 33 39 43 1328 54 ± 0.5 36 ± 0.8 35 ± 1.0 35 ± 2.4 35 36 36 a Mean of three replicate plates measured in two directions with standard deviation (n=6). b Compared to the unamended medium.

53

Table A-4 Radial expansion assay of Bipolaris sp. on V8 agar amended with three concentrations of pyraclostrobin. Radial Growth (mm)a % Growth Reductionb Isolate 0 µg/ml 1µg/ml 10 µg/ml 100 µg/ml 1µg/ml 10 µg/ml 100 µg/ml 1105 58 ± 1.8 34 ± 1.5 21 ± 0.4 13 ± 0.5 40 63 77 1303 46 ± 1.0 35 ± 0.1 25 ± 1.5 19 ± 3.93 24 46 54 1309 53 ± 0.4 50 ± 0.5 38 ± 0.5 30 ± 0.9 6 28 42 1326 57 ± 1.0 33 ± 2.3 29 ± 2.4 25 ± 0.7 43 50 56 1328 54 ± 0.9 33 ± 1.4 27 ± 1.0 24 ± 2.0 39 50 56 a Mean of three replicate plates measured in two directions with standard deviation (n=6). b Compared to the unamended medium.

54

LIST OF REFERENCES

Albertini, C., Gredt, M., and Leroux, P. 1999. Mutations of the b-tubulin gene associated with different phenotypes of benzimidazole resistance in the cereal eyespot fungi Tapesia yallundae and Tapesia acutormis. Pestic. Biochem. Physiol. 64:17–23.

Alcorn, J.L. 1976. On the genera Cochliobolus and Pseudocochiliobolus. Mycotaxon 16: 353- 379.

Alcorn, J.L. 1978. Two new Cochliobolus species. Trans. Br. Mycol. Soc. 70: 61-65.

Anke, T., Oberwinkler, F., Steglich, W., Schramm, G. 1977. Strobilurins–New antifungal antibiotics from the basidiomycete Strobilurus tenacellus (Pers. ex Fr.) Sing. J. Antibiot. 30:806-810.

Apoga, D. and Jansson, H.B. 2000. Visualization and characterization of the extracellular matrix of Bipolaris sorokiniana. Mycol. Res. 104:505-575.

Avenot, H.F., Sellam, A., Karaoglanidis, G., and Michailides, T.J., 2008. Characterization of mutations in the iron-sulphur subunit of succinate dehydrogenase correlating with boscalid resistance in Alternaria alternata from California pistachio. Phytopathology 98:736-742.

Avenot, H.F., Sellam, A., and Michailides, T.J., 2009. Characterization of mutations in the membrane-anchored subunits AaSDHC and AaSDHD of succinate dehydrognase from Alternaria alternata isolates conferring field resistance to the fungicide boscalid. Plant Pathol. 58:1134-1143.

Avila-Adame, C., Olaya, G., and Koller, W. 2003. Characterization of Collectotrichum gramnicola isolates resistant to strobilurin-related fungicides. Plant Dis 87:1426-1432.

Bartlett, D.W., Clough, J.M., Godwin, J.R., Hall, A.A., Hamer, M., Parr-Dobrzanski, B. 2002. The strobilurine fungicides. Pest Manag. Sci. 58:649–662.

Baumler, S., Felsenstein, F.G., and Schwarz, G., 2003. CAPS and DHPLC analysis of a single nucleotide polymorphism in the cytochrome b gene conferring resistance to strobilurin in field isolates of Blumeria graminis f. sp. hordei. J. Phytopathol. 151:149-152.

Beard, J.B. and Sifers, S. 1996. Bermudagrass breakthrough: New cultivars for Southern putting greens. GCM 64:58-62.

Becker, W.F., vonJagow, G., Anke, T., and Stegilchd, W. 1981. Oudermansin, Strobilurin A, Strobilurin B and myothiazol: new inhibitors of bc segment of the respiratory chain with an E-β-methoxyacrylate system as common structural element. FEBS Letters 132, 329- 333. ₁

55

Brecht, M.O., Stiles, C.M., and Datnoff, L.E. 2007. Evaluation of pathogenicity of Bipolaris and Curvularia spp. on dwarf and ultradwarf bermudagrasses in Florida. Online. PHP doi:10.1094/PHP-2007-0119-02-RS.

Brent, K J and Hollomon, D.W. 2007. Fungicide resistance: The assessment of risk FRAC Monograph No 2, second revised edition, FRAC, 52pp.

Briquet, M., Vilret, D., Goblet, P., Mesa, M., and Eloy, M.C. 1998. Plant cell membranes as biochemical targets of the phytotoxin helminthosporol. J. Bioe. Biom. 30:285-295.

Broomfield, P.L.E., Hargreaves, J.A. 1992. A single amino-acid change in the iron sulphur protein subunit of succinate dehydrogenase confers resistance to carboxin in Ustilago maydis. Curr. Genetics 2:117-121.

Burpee. L.L., Stephens, S.L., and Martinez-Espinosa, A.D. 2004. Control of anthracnose caused by a benzimidazole- and QoI-resistant isolate of Collectotrichum graminicola, 2003. Fungic. Nematicide Tests 59:T016.

Chastagner, G.A., and Vassey, W.E. 1982. Occurrence of iprodione tolerant Fusarium nivale under field conditions. Plant Dis 66:112-113.

Chowdhary, A., Randhawaa, H.S., Singhb, V., Khanc, Z.U., Ahmadc, S, Kathuriaa, S., Roya, P., Khannad, G., and Chandrab, Jagdish. 2011. Bipolaris hawaiiensis as etiologic agent of allergic bronchopulmonary mycosis: first case in a pediatric patient. Med. Mycol. 49:760- 765.

Christians, N. 2011. Fundamentals of turfgrass management. 4th ed. Wiley, Hoboken, NJ.

Clark, E. M., Backman, P. A., and Rodriguez‐Kabana, R. 1974. Cercospora and Cercosporidium tolerance to benomyl and related fungicides in Alabama peanut fields. 1974. Phytopathology 64:1476‐1477.

Clough, J. M. and Godfrey, C. R. A. 1998. The strobilurin fungicide. In Activity: Wiley & Sons Ltd.

Cowan, T. 2001. Going low with ultradwarf bermudagrass putting greens. USGA Green Section Record. 39: 14-16.

Couch, H.B. 1995. Disease of Turfgrass. Malabar, Florida: Krieger Publishing Company.

Couch, H.B. 1973. Diseases of Turfgrass. Huntington, New York: Krieger Publishing Company.

Cox, K.D., Quello, K., Deford, R.J., and Beckerman, J.L. 2009. A rapid method to quantify fungicide sensitivity in the brown rot pathogen Monilinia fructicola. Plant Dis. 93:328- 331.

56

Cox K.D., Bryson, P.K. and Schnabel, G. 2007. Instability of propiconazole resistance and fitness in Monilinia fructicola. Phytopathology 97:448–453.

Cundliffe, E. 1998. Antibiotics and prokaryotic ribosomes: action, interaction and rsistance. In: Craven, G.R., Davies, J., Davis, K., Kahan, I., and Nomura, M. (eds) Ribosomes: Structure, Function, and Genetics. University Park Press, Baltimore. pp 555-581.

Da, Cunha, K.C., Sutton, D.A., Fothergill, A.W., Cano, J., Gene, J., Madrid, H., De, Hoog, S., Crous, P.W. and Guarro, J. 2012. Diversity of Bipolaris species in clinical samples in the United States and their antifungal susceptibility profiles. J. Clin. Microbiol. 50:4061- 4066.

Davidse, L.C., and Flach, W. 1997. The mechanism of resistance to the antitubulin methyl benzimidazol-2-yl carbamate in the fungus Aspergillus nidulanss. J. Cell Biol. 72:174- 193.

Dekker, J. 1995. Development of resistance to modern fungicides and strategies for its avoidance. In H.E. Lyr (ed.) Modern selective fungicides: Properties, applications, mechanisms of action (2nd edn.). Fischer, Jena pp. 23-38.

Detweiler, A.R., Vargas, J.M., Jr., and Danneberger, T.K. 1983. Resistance of Sclerotinia homoeocarpa to iprodione and benomyl. Plant Dis 67:627-630.

De Waard, M.A. and Fuchs, A. 1980. Resistance to ergosterol biosynthesis inhibitors II. Genetic and physiological aspects. In: Dekker, J. and Georgopoulos, S.G. (eds) Fungicide Resistance in Crop Protection. Centre for Agricultural Publishing and Ducumentation, Wageningen. pp. 87-100.

De Waard, M. A., Van Nistelrooy, J. G. M., Langeveld, C. R., Van Kan, J. A. L., and Del Sorbo, G. 1996. Multidrug resistance in filamentous fungi. In Modern Fungicides and Antifungal Compounds (H. Lyr, P. E. Russell, and H. D. Sisler, Eds.), pp. 293–299. Intercept, Andover, UK.

Del Sorbo, G., Andrade, A. C., Van Nistelrooy, J. G. M., Van Kan, J. A. L., Balzi, E., and De Waard, M. A. 1997. Multidrug resistance in Aspergillus nidulans involves novel ATP- binding cassette transporters. Mol. Gen. Genet. 254: 417–426.

Del Sorbo, G., Schoonbeek, H., and De Waard, M.A. 2000. Fungal transporters involved in efflux of natural toxic compounds and fungicides. Fungal Genet. Biol. 30:1-15.

Dhingra, O.D., and Sinclair, J.B. 1995. Basic Plant Pathology Methods. Second Edition. CRC Press.

Dube, J. P., Truter, M., and Van der Waals, J. E. 2014. First report of resistance to QoI fungicides in Alternaria alternata isolates from potato in South Africa. Plant Dis. 98:1431.

57

Dudeck, A.E., and Murdock, C.L. 1998. Registration of ‘FloraDwarf’ bermudagrass. Crop Sci. 38:538.

Duveiller, E., and Gilchrist, L.I. 1994. Production constraints due to Bipolaris sorokiniana in wheat: current situation and future prospects. Proceedings of the CIMMYT/UNDP workshop, Nashipur (Dinajpur), Bangladesh, February 1994: 343–345.

Dyer, Z.A., Wright, R.S., Rong, I.H., and Jacobs, A. 2008. Back pain associated with endobronchial mucus impaction due to Bipolaris australiensis colonization representing a typical allergic bronchopulmonary mycosis. Med. Mycol.46:589–594.

Eckert, J.W. 1982. Case study 5: Penicillium decay of citrus fruits. In: Fungicide Resistance in Crop Protection, Dekker, J. and Georgopoulos, S. G. eds. Pudoc, Wageningen, 231-250.

El Khizzi, N., Bakheshwain, S., and Parvez, S. 2010. Bipolaris: A Plant Pathogen Causing Human Infection: An Emerging Problem in Saudi Arabia. Res. J. Microbiol. 5:212- 217.

Elliott, M. L., and Harmon, P. F. 2014. Helminthosporium leaf spot. http://edis.ifas.ufl.edu, SS- PLP-9.

Fernández-Ortuño, D., Pérez-García, A., López-Ruiz, F., Romero, D., de Vicente, A., and Torés, J. A. 2006. Occurrence and distribution of resistance to QoI fungicides in populations of Podosphaera fusca in south central Spain. Eur. J. Plant Pathol. 115:215-222.

Fernández-Ortuño, D., Torés, JA., de Vicente, A. and Pérez-García, A. 2008a. Field resistance to QoI fungicides in Podosphaera fusca is not supported by typical mutations in the mitochondrial cytochrome b gene. Pest Manag. Sci. 64:694-702.

Fernández-Ortuño, D., Torés, J.A., de Vicente, A., Pérez-García, A. 2008b. Mechanisms of resistance to QoI fungicides in phytopathogenic fungi. Int. Microbiol. 11:1-9.

Fryen, A., Mayser, P., Glanz, H., Füssle, R., Breithaupt, H., and de Hoog, G.S. 1999. Allergic fungal sinusitis caused by Bipolaris (Drechslera) hawaiiensis. Eur. Arch. Otorhinolaryngol. 256:330–334.

Gafur, A., Tanaka, C., Shimizu, K., Ouchi, S., and Tsuda, M., 1998. Molecular analysis and characterization of the Cochliobolus heterostrophus beta-tubulin gene and its possible role in conferring resistance to benomyl. J. Gen. Appl. Microbiol. 44:217–223.

Gardes, M., and Bruns, T.D., 1993. ITS primers with enhanced specificity for basidiomycetes- application to the identification of mycorrhizae and rusts. Mol. Ecol. 2:113–118.

Gayad, S.K. 1961. Production of Symptoms of bareley leaf spot disease by cultural filtrates of Helminthosporium sativum. Nature 191:725-726.

Georgopoulos, S.G. 1982. Genetical and biochemical background of fungicide resistance. In: Dekker, J., and Georgopoulos, S.G. (Eds.): Fungicide Resistance in Crop Protection Pudoc, Wageningen, pp. 46-52.

58

Georgopoulos, S.G., and Ziogas, B.N. 1977. Anew class of carboxin resistant mutations of Ustilago maydis. Neth J. Plant Pathol. 83:235-242.

Gisi, U., Sierotzki, H., Cook, A., and McCaffery, A., 2002. Mechanisms influencing the evolution of resistance to Qo inhibitor fungicides. Pest Manag. Sci. 58:859–867.

Glaettli, A., Stammler, G., and Schlehuber, S. 2009. Mutations in the target proteins of succinate dehydrogenase inhibitors (SDHI) and 14a-demethylase inhibitors (DMI) conferring changes in the sensitivity e structural insights from molecular modeling. In: 9th International Conference on Plant Diseases, Tours, France, pp. 670-681.

Golembiewski, R.C., Vargas, J.M., Jr., Jones, A.L., and Detweiler, A.R. 1995. Detection of demethylation inhibitor (DMI) resistance in Scerotinia homoeocarpa populations. Plant Dis. 79:491-493.

Grasso, V., Palermo, S., Sierotzki, H., Garibaldi, A. and Gisi, U. 2006. Cytochrome b gene structure and consequences for resistance to Qo inhibitor fungicides in plant pathogens. Pest Manag. Sci. 62:465–472.

Hamamoto, H., Hasegawa, K., Nakaune, R., Lee, Y.J., Makizumi, Y., Akutsu, K., Hibi, T., 2000. Tandem repeat of a transcriptional enhancer upstream of the sterol 14a-demethylase gene (CYP51) in Penicillium digitatum. Appl. Environ. Microbiol. 66:3421–3426.

Hannah, W.W., and Elsner, J.E. 1999. Registration of ‘TifEagle’ Bermudagrass. Crop Sci. 39:1258.

Heaney S. P., Hall A. A., Davis S. A. and Olaya G. 2000. Resistance to fungicides in the QoI- STAR cross resistance group: current perspectives. In Proceedings Brighton Crop Protection Conference- Pests and Diseases 2:755-762.

Hewitt, H. G. 1998. Fungicides in Crop Protection. CABI Publishing, CAB International. Oxon, United Kingdom.

Hoch, H.C., and Howard, R.J., and Staples, R.C. 1991.Signaling for infection structure formation in fungi. In: Cole, G.T., and Hoch, H.C. (eds). The fungal spore and disease initiation in plants and animals. Plenum, New York, pp 25-42.

Hollingsworth, B.S., E.A. Guertal and R.H. Walker. 2005. Cultural management and nitrogen sources effects on ultradwarf bermudagrass cultivars. Crop Sci. 45: 486-493.

Hollomon, D.W., Butters, J.A., Barker, H., and Hall, L., 1998. Fungal β-tubulin, expressed as fusion protein binds benzimidazole and phenylcarbamate fungicides. Antimicrob. Agents Chemother. 42:2171-22173.

Huang, J., Zheng, L., Hsiang, T. 2005. First report of leaf spot caused by Curvularia verruculosa on Cynodon sp. in Hubei, China. Plant Pathol. 54:253.

59

Hutson, D. H., and Miyamoto, J. 1998. Fungicidal activity: chemical and biological approaches to plant protection. Chichester, West Sussex, England: Wiley.

Ishii, H., Fraaije, B.A., Sugiyama, T., Noguchi, K., Nishimura, K.,Takeda, T., Amano, T., and Hollomon, D.W., 2001. Occurrence and molecular characterization of strobilurin resistance in cucumber powdery mildew and downy mildew. Phytopathology 91:1166– 1171.

Kellerman, K.F. 1931 “Russell A. Oakley” The Bulletin of the United States Golf Association Green Section (September 1931): 175.

Kendall, S. J. and Hollomon, D. W. 1998. Fungicide resistance. In Fungicidal Activity Wiley & Sons Ltd.

Keon J.P.R., White, G.A., Hargreaves, J.A. 1991. Isolation, chareacterization and sequence of a gene conferring resistance to the systemic fungicide carboxin from the maize smut pathogen, Ustilago maydis. Curr Genet 19:475-481.

Kim, Y.S., Dixon, E.W., Vincelli, P., and Farman, M.L., 2003. Field resistance to strobilurin (QoI) fungicides in Pyricularia grisea caused by mutations in the mitochondrial cytochrome b gene. Phytopathology 93:891–900.

Koenraadt, H., Somerville, S.C., and Jones, A.L., 1992. Characterization of mutations in the beta tubulin gene of benomyl-resistant field strains of Venturia inaequalis and other plant pathogenic fungi. Phytopathology 82:1348–1354.

Köller, W. 1991. Fungicide resistance in plant pathogens. In CRC Handbook of pest mang. in Agri.

Kraiczy, P., Haase, V., Gencic, S., Flindt, S., Anke, T., Brandkt, V., Von Jagox, G. 1996. The molecular basis for the natural resistance of the cytochrome bc1 complex from strobilurin-producing basidiomycetes to center Qo inhibitors. Eur. J. Biochem. 235:54- 63.

Kumar, J., Schafer, P., Huckelhoven, R., Langen, G., Baltruschat, H., Stein, E., Nagarajan, S., and Kogel, K.H. 2002. Bipolaris sorokiniana, a cereal pathogen of global concern: cytological and molecular approaches towards better control. Mol. Plant Pathol. 3:185- 195.

Latin, R. 2011. A Practical Guide to Turfgrass Fungicides (Vol. 1). APS Press, St. Paul, MN.

Leiminger, J. H., Adolf, B., and Hausladen, H. 2014. Occurrence of the F129L mutation in Alternaria solani populations in Germany in response to QoI application, and its effect on sensitivity. Plant Pathol. 63:640-650.

Leroux, P, Fritz, R, Debieu, Albertini, C, Lanen, C Bach, J, Gredt, M and Chapeland, F. 2002. Mechanism of resistance to fungicides in field strains of Botrytis cinerea. Pest Manag. Sci. 58:876-888.

60

Li , J., Katiyar, S.K., Edlind, T.D., 1996. Site-directed mutagenesis of Saccharomyces cerevisiae β-tubulin, interaction between residue 167 and benzimidazole compounds. FEBS Letters 385:7-10.

Littrell R.H. 1974. Tolerance in Cercospora arachidicola to benomyl and related fungicides. Phytopathology 64: 1377–1378.

Luck, J.E., and Gillings, M.R., 1995. Rapid identification of benomyl resistant strains of Botrytis cinerea using the polymerase chain reaction. Mycol. Res. 99:1483–1488.

Ma, Z., Felts, D., and Michailides, T.J., 2003. Resistance to azoxystrobin in Alternaria isolates from pistachio in California. Pestic. Biochem. Physiol. 77:66–74.

Ma, Z., and Michailides, T.J. 2005. Advances in understanding molecular mechanisms of fungicide resistance and molecular diagnosis of resistant genotypes of phytopathogenic fungi. Crop Prot. 24:853-863.

Ma, Z., Yoshimura, M., Holtz, B.A., Michailides, T.J., 2005. Characterization and PCR-based detection of benzimidazole resistant isolates of Monilinia laxa in California. Pest. Manag. Sci. in press.

Ma, Z., Yoshimura, M., and Michailides, T.J., 2003. Identification and characterization of benzimidazole resistance in Monilinia fructicola from stone fruit orchards in California. Appl. Environ. Microbiol. 69:7145–7152.

Manamgoda, D.S., Rossman, A.Y., Castlebury, L.A., Crous, P.W., Madrid, H., Chukeatirote, E. and Hyde, K.D. 2014. The genus Bipolaris. Stud. Mycol. 79: 221–288.

Marichal, P., Van den Bossche, V., Odds, F.C., Nobels, G., Warnock, D.W., Timmerman, V., Broeckhoven, C., Fay, S., Mose-Larsen, P., 1997. Molecular biological characterization of azole-resistant Candida glabrata isolate. Antimicrob. Agents Chemother. 41:2229– 2237.

Mathre, D.E. 1987. Compendium of Barley Diseases. American Phytopathological Society, St. Paul, MN.

McCarty, L.B., and Miller, G.L. 2002. Managing Bermudagrass Turf: Selection, Construction, Cultural Practices, and Pest Management Strategies. Ann Arbor Press, Chlesea MI p.221.

McGrath, M. T. 2001. Fungicide resistance in cucurbit powdery mildew: Experiences and challenges. Plant Dis. 85:236-245.

McKay, G.J., and Cooke, L.R., 1997. A PCR-based method to characterize and identify benzimidazole resistance in Helminthosporium solani. FEMS Microbiol. Lett. 152:371– 378.

61

McKay, G.J., Egan, D., Morris, E., and Brown, A.E., 1998. Identification of benzimidazole resistance in Cladobotryum dendroides using a PCR-based method. Mycol. Res. 102: 671-676.

Misato, T., Kakiki, K., and Hori, M. 1977. Mechanism of polyoxin resistance. Neth. J. Plant Pathol. 83 Suppl. 1:253-260.

Misato, T., and Ko, K. 1975. The development of resistance to agricultural antibiotics. Environmental quality and safety, suppl. 3:437-440.

Mowey, P.C., Steenkamp, D.J., Ackrell, B.A.C., Singer, T.P., and White, G.A. 1977. Inhibition of Mammalian Succinate Dehydrogenase by Carboxin. Arch. Biochem. and Biophys. 178:495-506.

Murray, T.D., Parry, D.W., and Cattlin, N.D. 1998. A color handbook of disease of small grain cereal crops, Iowa State University Press, Ames, Iowa.

Nelson, R.R. 1959. Cochliobolus carbonum, the perfectstage of Helminthosporium carbonum. Phytopathology 49: 807-810.

Nelson, R.R. 1964. The perfect stage of Helminthosporium cynodontis. Mycologia 56: 64-69.

Olaya, G., Cleere, S., Stanger, C., Burbidge, J., Hall, A., and Windass, J.2003. Anovel potential target site QoI fungicide resistance mechanism in Pythium aphanidermatum (Abstr.) Phytopathology 93:S67.

Olaya, G., and Holm, A., 2001. Sensitivity of Didymella bryoniae isolates to azoxystrobin. Phytopathology 91:S67.

Pasche, J.S., Piche, L. M., and Gudmestad, N. C. 2005. Effect of the F129L mutation in Alternaria solani on fungicides affecting mitochondrial respiration. Plant Dis. 89:269- 278.

Pasche, J.S., Wharam, C.M. and Gudmestad, N.C. 2002. Shift in sensitivity of Alternaria solani (potato early blight) to strobilurin fungicides. Proceedings of the BCPC Conference Pests & Diseases 2002:841-846.

Paul, A.R. and Parbery, D.G. 1966. The perfect state of Helminthosporium bicolor. Trans. Br. Mycol. Soc. 49: 385-386.

Payne, A.F., and Walker, N.R. 2014. Evaluation of fungicides for control of leaf spot on bermudagrass. PDMR 8:T039.

Pratt, R.G. 2001. Occurrence and virulence of Bipolaris hawaiiensis on bermudagrass (Cynodon dactylon) on poultry waste application sites in Mississippi. Plant Dis. 85:1206.

Pratt, R.G. 2005. Variation in occurrence of dematiaceous hyphomycetes on forage ryegrass bermudagrass over years, sampling times, and locations. Phytopathology 95:1183-1190.

62

Pratt, R.G. 2006. Frequency and pathogenicity of dematiaceous hyphomycetes on annual ryegrass overseeded on bermudagrass in Mississippi Plant Dis. 85:1206.

Rampersad, S.N. 2011. A rapid colorimetric microtiter bioassay to evaluate fungicide sensitivity among Verticillium dahliae isolates. Plant Dis. 95:248-255.

Reimann, S. and Deising, H.B. 2005. Inhibition of efflux transporter-mediated fungicide resistance in Pyrenophora tritici-repentis by a derivative of 4′-hydroxyflavone and enhancement of fungicide activity. Appl. Environ. Microbiol. 71:3269-3275.

Roohparvar, R., De Waard, M., Kema, GHJ. and Zwiers, LH. 2007. MgMfs1, a major facilitator superfamily transporter from the fungal wheat pathogen Mycosphaerella gramicola, is a strong protectant against natural toxic compounds and fungicides. Fungal Genet. Biol. 44:378-388.

Russell, P.E., Milling R.J., and Wright, Ken. 1995. Control of fungi pathogenic to plants. In: Hunter, P.A., Derby, G.K., and Russell, N.J. (Eds.), Fifty years of antimicrobials: past perspectives and future trends. MicroSoc., Symposium 53:85-110.

Saghai-Maroof, M.A., Soliman, K.M., Jorgensen, R.A., and Allard, R.W. 1984. Ribosomal DNA spacer-length polymorphisms in barley: mendelian inheritance, chromosomal location, and population dynamics. PNAS 81:8014-8018.

Sanders, P.L. 1984. Failure of metalaxy to control Pythium blight on turfgrass in Pennsylvania. Plant Dis 68:776-777.

Schnabel, G., Jones, A.L., 2001. The 14a-demethylase (CYP51A1) gene is overexpressed in Venturia inaequalis strains resistance to myclobutanil. Phytopathology 91:102–110.

Semar M., Strobel D., Koch A. Klappach K. and Stammler G. 2007. Field efficacy of pyraclostrobin against populations of Pyrenophora teres containing the F129L mutation in the cytochrome b gene. JPDP. 114:117-119.

Shoemaker, R.A. 1959. "Nomenclature of Drechslera and Bipolaris, grass parasites segregated from Helminosporium". Can. J. Bot. 37 5:879–87.

Sierotzki, H., Frey, R., Wullschleger, J., Palermo, S., Karlin, S., Godwin, J. and Gisi, U. 2006. Cytochrome b gene sequence and structure of Pyrennophora teras and P. tritici-repentis and implications for QoI resistance. Pest Manag. Sci. 63:225-233.

Sierotzki, H., Parisi, S., Steinfeld, U., Tenzer, I., Poirey, S., and Gisi, U., 2000a. Mode of resistance to respiration inhibitors at thecytochrome bc1 enzyme complex of Mycosphaerella fijiensis field isolates. Pest Manag. Sci. 56:833–841.

Sierotzki, H., Wullschleger, J., and Gisi, U., 2000b. Point mutation in cytochrome b gene conferring resistance to strobilurin fungicides in Erysiphe graminis f. sp. tritici field isolates. Pestic. Biochem. Physiol. 68:107–112.

63

Sivanesan A. 1987. Gramincolous species of Bipolaris, Curvulari a, Drechslera, Exserohilum and their teleomorphs. J. Mycological 158:1-261.

Skinner, W., Bailey, A., Renwick, A., Keon, J., Gurr, S., and Hargreaves, J., 1998. A single amino-acid substitution in the iron-sulphur protein subunit of succinate dehydrogenase determines resistance to carboxin in Mycosphaerella graminicola. Curr. Genetics 34:393- 398.

Smiley. R.W., Dernoeden, P., and Clarke, B.B. 2005 Compendium of turfgrass diseases. Third ed: The American Phytopathological Society.

Stammler, G., Brix, H.D., Glättli, A., Semar, M., and Schoefl, U., 2007. Biological properties of the carboxamide boscalid including recent studies on its mode of action. In: Proceedings XVI International Plant Protection Congress Glasgow, pp. 40-45.

Stammler G., Strobel D., Semar M. and Klappach K. 2006. Diagnostics of fungicide resistance and relevance of laboratory data for the field. Asp. Appl. Biol. 78:29-36.

Steinfeld, U., Sierotzki, H., Parisi, S., Poirey, S., and Gisi, U. 2001. Sensitivity of mitochondrial respiration to different inhibitors in Venturia inaequalis. Pest Manag. Sci. 57:787-796.

Stergiopoulos, I., Zwiers, L., and De Waard, MA. 2003. Secretion of natural and synthetic toxic compounds from filamentous fungi by membrane transporters of the ATP binding cassette and major facilitator superfamily. Eur. J. Plant Pathol. 108:719-734.

Stevenson, K.L., Langston, D.B., and Seebold, K., 2002. Resistance to azoxystrobin in the gummy stem blight pathogen in Georgia. Resist. Pest Manag. Newslett. 12:35–37.

Taga, M., Nakagwa, H., Tsuda, M., and Uegama, A. 1978. Ascospore analysis of kasugamycin resistance in the perfect stage of Pyricularia oryzae. Phytopathology 68:815-817.

Tomaso-Peterson, M. and Standish, J. 2014. Control of leaf spot on ultradwarf bermudagrass using two spray volumes of BASF fungicides. PDMR 8:T036.

Tsuda, M., Nagakubo, T., Taga, M. and Ueyama, A. 1981. Pseudocochiliobolus australiensis, the ascigerous state of Bipolaris australiensis. Mycologia 73:88-96.

Uesugi, Y., and Sisler, H.D. 1978. Metabolism of a phophoramidate by Pyricularia oryzae in relation to tolerance and synergism by a phosphorothiolate and isoprothiolane. Pesticide Biochem. Physiol. 9:247-254.

Vanlerberghe, G.C., and McIntosh, L. 1997. Alternative oxidase: From gene to function. Annu. Rev. Plant Physiol. Plant Mol. Biol. 48:703–734.

Vargas, J. M. 1978. What’s new in turfgrass fungicides. Proceedings of scotts turfgrass research conference 5:52-56.

Vargas, J. M. 1994. Management of Turfgrass Diseases. CRC Press. Boca Raton, FL.

64

Vargas, J. M., and Detweiler, R. 1992. Dollar spot resistance to DMI fungicide. GCM 60:50-52.

Vincelli, P. and Dixon, E. 2002. Resistance to QoI (strobilurin-like) fungicides in isolates of Pyricularia grisea from perennial ryegrass. Plant Dis. 86:235-240.

Warren, C.G., Sanders, P., and Cole, H. 1974. Sclerotinia homoeocarpa tolerance to benzimidazole configuration fungicides. Phytopathology 64:1139-1142.

White, T.J., Bruns, T.D., Lee, S.B., and Taylor, J.W. 1990. Amplification and direct sequencing of fungal ribosomal RNA genes for phylogenetics, PCR Protocols-a Guide to Methods and Applications, Academic Press, San Diego, CA. pp. 315–322.

Wisniewska, H., Wakulinski, W., Chelkowski, J. 1998. Susceptibility of bareleys to Bipolaris sorokiniana seedling blight determined by disease scoring and electrolyte leakage. J. Phytopathol. 146:563-566.

Wong, F.P., and Midland, S.L. 2007. Sensitivity distributions of California populations of Collectotrichum cereale to DMI fungicides propiconazole, myclobutanil, tebuconazole, and triadimefon. Plant Dis. 91:1547-1555.

Wong, F.P., de la Cerda, K.A., Hernandez-Martinez, R., and Midland, S.L. 2008. Detection and characterization of benzimidazole resistance in California populations of Collectotrichum cereale. Plant Dis. 92:239-246.

Wong, F.P., Midland, S.L., and de la Cerda, K.A. 2007. Occurance and distribution of QoI- resistant isolates of Collectotrichum cereal from annual bluegrass in California. Phytopathology 91:1536-1546.

Wood, P.M., and Hollomon, D.W. 2003. A critical evaluation of the role of alternative oxidase in the performance of strobilurin and related fungicides acting at the Qo site of complex III. Pest Manag. Sci. 59:499-511.

Yamaguchi, J and Fujimura, M. 2005. Recent topics on action mechanisms of fungicides. J. Pestic. Sci. 30:67-74.

Zhang, D., and Köller, W., 1997. Characterization of the mitochondrial cytochrome b gene from Venturia inaequalis. Curr. Genet. 32:361–366.

Zhu, F., Bryson, P.K, and Schnabel, G. 2012. Influence of storage approaches on instability of propiconazole resistance in Monilinia fructicola. Pest Manag. Sci. 68:1003-1009.

65

BIOGRAPHICAL SKETCH

Prasert Stavornvisit earned a Bachelor of Engineering from Mahanakorn University of

Technology in 1994. While at Mahanakorn he completed an undergraduate research project with

Dr. Sujate Jantarang there he implemented transmitted signal module using frequency-shift keying (FSK) technique. His professional career began as an engineer at Essell Engineering

Service gaining experience in planning, implementation and managing the most complex telecommunication systems.

But then his life drastically changed course as he pursued a new adventure. In 2003, he had a unique and challenging opportunity to work in a golf course in Thailand because his relative owned the golf course, and Prasert was asked to work there. This position involved not only general management but golf course turf maintenance. This led him to pursue an advanced degree in turf management.

In 2006, after graduating with a Master of Agriculture in turf management from the

University of Sydney, he completed a one-year internship at Farmlinks Golf Club in Sylacauga,

Alabama and another six-month internship at the prestigious TPC Sawgrass in Ponte Vedra

Beach, Florida. Upon finishing his internship from TPC at Sawgrass he was offered a job as a spray technician. He then worked his way up to second assistant golf course superintendent.

In 2015, Prasert completed his M.S. degree in plant pathology at the University of Florida working with identification of fungi causing leaf spot on bermudagrass and sensitivity of

Bipolaris cynodontis to azoxystrobin under the guidance of Dr. Phil Harmon. Upon completion

M.S. degree, Prasert worked as a Diagnostician at the Plant Diagnostic Center at the University of Florida. He also gained extensive experience in evaluating fungicide efficacy for major turf diseases in Florida.

66