MOLECULAR CHARACTERIZATION OF THE GRAVITY
PERSISTENCE SIGNAL (gps) 2 MUTANT IN ARABIDOPSIS THALIANA
A thesis presented to
the faculty of
the College of Arts and Sciences of Ohio University
In partial fulfillment
of the requirements for the degree
Master of Science
Jennifer McCallister
November 2005
This thesis entitled
MOLECULAR CHARACTERIZATION OF THE GRAVITY
PERSISTENCE SIGNAL (gps) 2 MUTANT IN ARABIDOPSIS THALIANA
by
JENNIFER McCALLISTER
This thesis has been approved
for the Department of Environmental and Plant Biology
and the College of Arts and Sciences by
Sarah E. Wyatt
Assistant Professor of Environmental and Plant Biology
Benjamin M. Ogles
Interim Dean, College of Arts and Sciences
McCALLISTER, JENNIFER M.S. November 2005. Environmental and Plant Biology
Molecular Characterization of the Gravity Persistence Signal (gps) 2 Mutant in
Arabidopsis thaliana (70pp.)
Director of Thesis: Sarah E. Wyatt
A gravity persistence signal (gps) mutant phenotype in Arabidopsis was identified that
shows an abnormal gravity response phenotype - wrong way. The gps2 mutant was
selected from a mutant population generated by a T-DNA insertion. Cloning of the
GPS2-1 gene using thermal asymmetric interlaced polymerase chain reaction (TAIL
PCR) revealed the identity as At5g11150 located on chromosome 5 of Arabidopsis.
At5g11150 is a hypothetical protein proposed to be a synaptobrevin-like/vesicle-
associated membrane protein (VAMP 713). A series of reporter gene constructs were
designed and built to rescue the phenotype of gps2 and to assess subcellular localization of GPS2. Preliminary subcellular localization of the GPS2 protein using the reporter gene, green fluorescent protein (GFP) in BY-2 suspension culture cells appears to be localized in the vesicles of the endomembrane system. By cloning, identifying, and localizing GPS2, components of early signal transduction in the gravitropic pathway may be identified.
Approved:
Sarah E. Wyatt
Assistant Professor of Environmental and Plant Biology
Acknowledgements
I would like to thank my advisor, Dr. Sarah Wyatt, for her support and guidance.
Dr. Wyatt gave me an opportunity to learn how to conduct research in a laboratory setting. She has challenged and inspired me to become a better researcher. Thank you for the opportunity to research, teach, travel, present talks, and network during my time at
Ohio University.
I would also like to thank all of my lab mates for their encouragement and support. I appreciate the advice and technical assistance of Vijayanand Nadella, Matthew
Shipp, and Harjinder Sardar.
5
Table of Contents
Page
Abstract...... 3
Acknowledgements...... 4
List of Tables ...... 7
List of Figures...... 8
Chapter 1 Gravitropism...... 9
The Gravitropic Pathway ...... 10
Perception ...... 10
Auxin Redistribution...... 13
Response ...... 16
Signal Transduction ...... 17
Research Focus...... 22
Bibliography ...... 25
Chapter 2 Characterization of the GPS2 Gene ...... 31
Materials and Methods...... 32
Plant Material, Growth Conditions, and DNA Extraction...... 32
Thermal Asymmetric Interlaced Polymerase Chain Reaction ...... 32
Cloning of the PCR Product ...... 36
Constructs ...... 38
Agrobacterium Transformation ...... 43
Floral Dip and Arabidopsis Transformation...... 43 6
BY-2 Transformation...... 44
Microscopy ...... 45
Results...... 45
Cloning and Gene Analysis ...... 45
Rescuing the Phenotype and Localization ...... 52
Focus for the Future...... 56
Discussion...... 60
Bibliography ...... 64
Final Conclusions...... 66
7
List of Tables
Table Page
1. Progress Toward Complementation...... 58
8
List of Figures
Figure Page
1. The Gravitropic Response Pathway...... 10
2. Auxin Movement Through a Plant ...... 14
3. Model of Plant Gravitropic Pathway and Gravitropic Mutants...... 21
4. The Gravity Persistence Signal (gps) Mutant Phenotypes of gps1, gps2, and gps3 .....23
5. Diagrammatic Representation of the Primers for the TAIL PCR Method ...... 34
6. Analysis of the TAIL PCR Products...... 37
7. Diagrammatic Representation of Sequence Results ...... 45
8. Sequence Similarity Search Results...... 47
9. Arabidopsis Nucleotide Sequence Similarity Results...... 48
10. Diagrammatic Representation of the T-DNA Insertion in At5g11150...... 49
11. TargetP Membrane Target Analysis ...... 50
12. Amino Acid Sequence of At5g11150...... 51
13. Diagram of Reporter Gene Constructs...... 53
14. gps2-1 Arabidopsis Mounds ...... 55
15. Newly Transferred Transformants in Soil ...... 57
16. Subcellular Localization of the GPS2 Protein ...... 59
17. Diagrammatic Representation of the Possible Function of GPS2 ...... 63
18. Root Model ...... 69
19. Shoot Model...... 70 9
Chapter 1
Gravitropism
Gravitropism is the growth of plant organs in response to the gravity vector. The
gravitropic set-point angle (GSA) is a value between 0º (positive gravitropism) and 180º
(negative gravitropism) and represents the angle with respect to gravity at which an organ is maintained because of gravitropism (Digby and Firn, 1995). However, organ position is also dependent on its developmental state and the environmental conditions (Digby and
Firn, 1995). In general, gravitropism orients shoots upward from the Earth (GSA of 180º or negative gravitropism) in order to efficiently proceed with photosynthesis and gas exchange (Digby and Firn, 1995). Roots orient downward toward the Earth (GSA of 0º or positive gravitropism) in order to absorb water and nutrients (Digby and Firn, 1995).
The gravitropic response of a plant organ involves an external stimulus perceived by plant cells, a signal produced and transported to the responding tissue, and a response.
Current understandings of gravitropism has led to a model of the gravitropic response pathway which has been broken into four steps: gravity perception, signal transduction, auxin redistribution and response (Fig.1) (reviewed by Lomax, 1997; Chen et al., 1999;
Morita and Tasaka, 2004). The cellular and molecular mechanisms involved in gravitropism remain a mystery despite studies conducted for many decades on how plants sense and respond to gravity. 10
The Gravitropic Pathway
Stimulus Perception Early Signal Transduction Auxin Redistribution Response
Figure 1: The Gravitropic Response Pathway. Gravity is perceived by sedimenting amyloplasts which trigger a signal that brings about auxin redistribution leading to bending response.
Many studies on Arabidopsis thaliana root gravitropism have been published contributing to the knowledge of gravitropism in roots (Sievers et al., 1996; Blancaflor et al., 1998; Firn et al., 2000; Chen et al., 2002; Blancaflor and Masson, 2003). Whereas, few studies of gravitropism in Arabidopsis inflorescence stems (shoots) have been published leaving gaps in the knowledge of shoot gravitropism (Lomax, 1997; Sack,
1997; Fukaki et al., 1998; Weise and Kiss, 1999; Kato et al., 2002; Muday et al., 2003).
Since gravitropism is an extremely complex process, this review will focus mainly on research studies of inflorescence stem gravitropism.
The Gravitropic Pathway
Perception
Gravitropic perception is an external stimulus sensed by plant cells which leads to
signal transduction and response. Many studies on the perception of gravity have led to
the starch-statolith hypothesis. The starch-statolith hypothesis maintains that gravity is sensed by dense organelles (statoliths) that sediment (reviewed by Sack, 1997).
Amyloplasts, which function as statoliths, are specialized plastids with starch grains in the “endodermis” of the stem that sediment in the direction of gravity (Sack, 1997).
Perception of gravity has been shown to occur within the “endodermis” (starch sheath 11
cell layer in the inner cortex) primarily in the zone of elongation of the inflorescence stems of Arabidopsis (Sack, 1997; Fukaki et al., 1998; Fukaki and Tasaka, 1999; Tasaka
et al., 1999; Weise and Kiss, 1999; Fujihira et al., 2000; Kato et al., 2002; Blancaflor and
Masson, 2003).
In support of the starch-statolith hypothesis, various mutants in Arabidopsis have
been isolated that lack amyloplasts or the starch sheath layer. The endodermal-amyloplast
less1 (eal1) mutant lacks amyloplasts in the starch sheath layer of the hypocotyl (Fujihira
et al., 2000). This mutant lacks the gravitropic response in the shoot and has reduced
response in hypocotyls (Fujihira et al., 2000). The lack of amyloplasts and reduced
gravitropic response could suggest a defect in the development of amyloplasts in the
“endodermal layer” of the hypocotyl causing a disruption in gravitropic perception
(Fujihira et al., 2000). Two shoot gravitropic mutants shoot gravitropic1/scarecrow
(sgr1/scr) and shoot gravitropic7/short-root (sgr7/shr) lack a normal “endodermal” cell
layer and a gravitropic response in hypocotyls and inflorescence stems (Fukaki et al.,
1998). These mutants indicate that the shoot starch sheath layer is essential for
perception in the gravitropic pathway (Fukaki et al., 1998).
Additional support for the starch-statolith hypothesis has been obtained from
starchless and starch-deficient mutants in Arabidopsis. The starchless mutant Arabidopsis
phosphoglucomutase (pgm), which does not synthesize starch, shows reduced gravitropic
curvature of inflorescence stems, hypocotyls, and roots in response to reorientation when
compared to wild-type (Caspar and Pickard, 1989). This reduced response indicates that
starch grains are important in the stimulus perception step of the gravitropic pathway 12
(Caspar and Pickard, 1989). Another example of starchless and starch-deficient mutants includes the acg mutants. Sedimenting amyloplasts were not observed in starchless
mutants (acg 21), but were observed in wild-type and reduced-starch mutants (acg20 and
acg27) (Weise and Kiss, 1999). Starch-filled amyloplasts in acg20 and acg27 led to a
faster gravitropic response than acg21, but acg21 did eventually exhibit a gravitropic
response (Weise and Kiss, 1999). These data are consistent with the starch-statolith
hypothesis that statoliths, although not required for a gravitropic response help to elicit a
full response of inflorescence stems (Weise and Kiss, 1999).
Two other models of gravitropic perception have also been proposed. The first
model is the plastid based model which hypothesizes that gravitropic sensing appears to
rely upon the mass of amyloplasts which sediment (Sack, 1997). The five main ideas of
this model are: “the location of cells with sedimentation is highly regulated, the cells
contain other morphological specializations favoring sedimentation, sedimentation
always correlates with gravitropic competence in wild-type, magnetophoretic movement
of root cap amyloplasts mimics gravitropism, and starchless and intermediate starch
mutants show reduced gravitropic sensitivity” (Sack, 1997). In this “susceptor-receptor”
model, starch-filled plastids (“susceptor”) sense gravity and sediment against a structure
(“receptor”) which converts or triggers a chemical or other signal leading to gravitropic
response (Sack, 1997). Two possible structures that could trigger signal transduction are
the cytoskeleton and the endoplasmic reticulum (Sievers et al., 1996; Sack, 1997). The
second model is the gravitational pressure model which hypothesizes that the entire
protoplast acts as a gravity sensor causing pressure or tension between the plasma 13
membrane and extracellular matrix which then initiates signal transduction (reviewed by
Staves, 1997). Studies leading to this model were done using single celled internodes of the green algae, Chara (reviewed by Staves, 1997).
Most current research evidence supports the starch-statolith model. But gravity sensing in plants is complex and more than one model may be required to explain the mechanisms related to perception.
Auxin Redistribution
Auxin moves from the shoot apex, where it is synthesized, to the base of the plant
(basipetal transport) in a cell to cell manner (Fig. 2). In the root, auxin moves from the
root base to the apex (acropetally) through the vascular tissues and once auxin reaches the
apex it moves from the apex in the outer cortex and epidermis toward the base of the root
(basipetally) (Fig. 2). Auxin movement influences various plant responses including:
differential cell elongation in response to tropisms, overall plant polarity, cell elongation,
and lateral root formation (reviewed by Muday et al., 2003).
Auxin is proposed to move in a cell to cell polar direction with the help of auxin
transport proteins. One auxin transport protein is the auxin influx facilitator, AUX1.
AUX1 belongs to the auxin permease family of proton-driven transporters and has been
localized to the plasma membrane (Swarupa et al., 2004). Auxin resistant1 (aux1)
mutants exhibit agravitropic phenotypes and disrupted basipetal auxin transport in roots
(Swarup et al., 2001). AUX1 has been shown to be required for both acropetal and
basipetal auxin transport in Arabidopsis roots and shoots (Swarup et al., 2001; Swarupa et al., 2004). 14
Shoot
Root
Figure 2: Auxin Movement Through a Plant. Auxin moves basipetally in the shoot (from the shoot apex to the base of the plant). In the root, auxin moves acropetally (from the root base to the apex) and once auxin reaches the apex it moves basipetally (from the apex toward the base of the root. (Auxin shown in red).
15
The second auxin transport protein is the auxin efflux facilitator. A family of genes, the PIN genes which consist of eight family members in Arabidopsis, has been identified as potential auxin efflux facilitators. (reviewed by Friml et al., 2004; Paponov et al., 2005). All of the PIN proteins show asymmetric localization in the plasma membrane, which determines the direction of polar auxin transport and establishes auxin
gradients that influence developmental processes (Friml et al., 2004). Of the eight pin-
formed (pin) mutants, two mutants have been isolated that play a role in shoot
gravitropism. pin1 mutants exhibit abnormal auxin transport in inflorescence stems and
exhibit an agravitropic phenotype (reviewed by Muday, 2001). pin3 mutants exhibit defects in differential cell elongation of the shoot (Friml et al., 2002). The PIN3 protein has been localized to the plasma membrane and vesicles in the starch sheath cells of the shoot inner cortex showing rapid cycling in gravistimulated Arabidopsis (Friml et al.,
2002).
Recently, the gene, TIR1 has been identified as an auxin receptor (Dharmasiri et al., 2005). Transport inhibitor response1 (tir1) mutants exhibit defects in auxin response
(Dharmasiri et al., 2005). TIR1 has been found to be an F-box protein which as an auxin receptor helps regulate degradation of Aux/IAA proteins and auxin-regulated transcription (Dharmasiri et al., 2005). Further studies will be needed to determine how auxin interacts with TIR1.
Although, research in auxin transport has provided information on how auxin moves throughout a plant and influences various plant responses, the mechanisms that lead to these events remain a mystery. 16
Response
The response of a plant to gravity is bending. Bending has been shown to occur in
the zone of elongation of Arabidopsis inflorescence stems (Fukaki et al., 1996). Upward
(away from gravity) bending in Arabidopsis shoots results from differential cell
elongation caused by auxin redistribution (reviewed by Lomax, 1997). Thus, the bending
response of plants is the result of auxin redistribution leading to differential cell
elongation in the zone of elongation.
The Cholodny-Went hypothesis describes how bending occurs during
gravitropism. The Cholodny-Went hypothesis maintains that redistribution of auxin concentration to the lower side of a gravistimulated shoot is responsible for differential cell elongation resulting in gravitropic bending (reviewed by Firn et al., 2000). The basis of the Cholodny-Went hypothesis is that when a signal is perceived, auxin moves laterally from one side of the stem to the other, and a differential distribution of auxin causes cell elongation that leads to bending (reviewed by Lomax, 1997).
Roots bend downward toward gravity while shoots bend upward away from gravity in most cases. However, numerous exceptions to this generality occur in nature including hanging baskets and weeping willow trees. Another example of a plant that is an exception is the peanut. After fertilization, the peanut gynophore moves underground for seed and fruit development (Moctezuma and Feldman, 1999). According to the
Cholodny-Went hypothesis, gravistimulation of a shoot should result in redistribution of auxin to the lower half therefore leading to differential cell elongation on the lower half and exhibiting an upward bending of the shoot. But in peanuts, auxin has been shown to 17
be redistributed to the upper half of the shoot leading to cell elongation on the upper half and resulting in a downward bending of the shoot just like roots (Moctezuma and
Feldman, 1999).
Gravitropic response mutants have been isolated that are abnormal in differential cell elongation. One of these mutants was auxin resistant1/massugul1 (axr1/msg1)
(Watahiki and Yamamoto, 1997). axr1 does not undergo auxin-induced growth curvature in the hypocotyl (Watahiki and Yamamoto, 1997). In addition, other auxin resistant mutants have been identified that exhibit agravitropic roots and shoots: axr2, axr3, axr4/rgr1, dwf, and cop4 (reviewed by Lomax, 1997). These mutants represent the final step in the gravitropic pathway. Most are defective in growth or elongation and the effects on gravitropism is probably an indirect effect of the growth phenotype.
Signal Transduction
Signal transduction links perception and response, but the mechanisms behind this
event are unknown. Research to elucidate components of the signal transduction pathways has been a leading area in molecular plant biology. The events of signal transductions that lead to auxin redistribution are unknown. These studies have used biochemical and cell biology approaches to test for molecules involved in signal transduction of gravitropism. One molecule hypothesized to be involved in gravitropism is calcium. Calcium’s role in gravitropism appears to be mediated by the calcium-binding protein, calmodulin (Raven et al., 2004). The Ca-calmodulin complex influences numerous cellular processes (Raven et al., 2004). Calcium has been suspected to change in concentration in response to gravity but experiments in Arabidopsis roots and other 18
plants have yet to confirm this hypothesis (reviewed by Muday, 2001). The role of calcium has yet to be explained.
Another molecule involved in signal transduction, inositol 1,4,5-trisphosphate
(IP3), has been shown to increase preceding differential growth in gravistimulated maize
pulvini (Perera et al., 1999). “IP3 provides a mechanism to transmit and amplify the signal from the perceiving to the responding cells in the pulvinus, coordinating a synchronized
growth response” (Perera et al., 1999). “IP3 has also been shown to play a role in tissue polarity during cold-perceived gravistimulation retention by providing positional information in the pulvini prior to redistribution of auxin” (Perera et al., 2001). These studies are a good start in discovering how IP3 and signal transduction are involved in the
gravitropic pathway.
In addition to signaling molecules, recent research has indicated that the following are possibly involved in the signal transduction: the cytoskeleton, pH changes, vesicle trafficking, and vacuoles (Johannes et al., 2001; Blancaflor, 2002; Yamamoto and Kiss,
2002; Muday et al., 2003; Surpin and Raikhel, 2004). These experimental studies have provided evidence of possible involvement in signal transduction in the gravitropic pathway but their roles still await resolution.
Few gravity mutants have been isolated that play a role in gravity signal transduction. One mutant that has been identified in signal transduction is altered response to gravity1/root and hypocotyl gravitropism (arg1/rhg). The arg1 mutant is altered in root and hypocotyl gravitropism but is otherwise normal (Sedbrook et al.,
1999). ARG1 was determined to encode a DnaJ-like protein whose sequence was similar 19
to cytoskeleton-interacting proteins which suggested ARG1 might interact with the cytoskeleton (Sedbrook et al., 1999). The cytoskeleton has been suggested as being involved in stimulus perception and signal transduction in relationship to the sedimenting amyloplasts. In addition, ARG1 has been shown to be a peripheral membrane protein which might be involved in the trafficking of the PIN auxin efflux facilitators
(Boonsirichai et al., 2003). ARG1’s possible role in vesicle trafficking suggests a role in the gravity signal transduction step of the gravitropic pathway.
Another mutant that has been identified in signal transduction is roots curl in
NPA1 (rcn1). The rcn1 mutant shows a reduced rate of gravitropic bending in the roots
(Rashotte et al., 2001). rcn1 mutants have a disruption in a protein phosphatase regulatory subunit which leads to reduced protein phosphatase activity resulting in altered regulation of auxin transport (Rashotte et al., 2001). This altered regulation of auxin transport could have been caused by altering the regulation of the PIN auxin efflux facilitators leading to the reduced rate of gravitropic bending in the roots (Rashotte et al.,
2001). Altered regulation in auxin transport suggests a role in the gravity signal transduction step.
Of the seven shoot gravitropism (sgr) mutants, only three mutant genes have been cloned. SGR2 has been determined to encode a phospholipase-like protein and may produce messenger molecules by cleaving phospholipids (Kato et al., 2002). SGR2 was localized to the vacuole membranes located in the endodermal cells of inflorescence stems (Morita et al., 2002). It has been predicted to play a role in signal transduction by regulating membrane systems (Kato et al., 2002). SGR4/ZIG (zigzag) has been 20
determined to encode a Soluble N-ethylmaleimide-Sensitive Fusion Protein Attachment
Protein Receptors (SNARE) which is hypothesized to be involved in vacuolar trafficking
(Kato et al., 2002). In animal systems, SNAREs function in the process of vesicle
trafficking, targeting, and secretion in the endomembrane system. In plants, the role of
SNAREs has yet to be confirmed. Thus, both genes are predicted to be involved in the
vacuolar functions of the endodermal cells in the inflorescence stems during early events
of shoot gravitropism (Kato et al., 2002; Moore, 2002). sgr3 shows a reduced gravitropic
response in inflorescence stems and abnormal sedimentation of amyloplasts in the
endodermal cells of the shoot (Fukaki et al., 1996). SGR3 was identified as a syntaxin
(AtVAM3) which is localized to the prevacuolar compartment and vacuole (Yano et al.,
2003). SGR3 was identified as part of a SNARE complex involved in vesicle trafficking
to the vacuole in the endodermal cells of inflorescence stems (Yano et al., 2003). SGR3’s
involvement in vesicle trafficking suggests a role in signal transduction.
Despite the research gained over the last decade as seen in Figure 3, signal transduction that links stimulus perception and differential cell elongation due to auxin redistribution remains a mystery. Signal transduction may be such a complex process that there are many ways for plants to complete the process. Despite the years of research that has been devoted to the gravitropic pathway, more research in the area is needed to develop a comprehensive picture of signal transduction.
21
Figure 3: Model of Plant Gravitropic Pathway and Gravitropic Mutants. Model of various components involved in the hypothesized gravitropic pathway (Top Panel). Gravitropic mutants involved in gravitropism (Bottom Panel). 22 Research Focus
Recently a group of mutants, the gravity persistence signal (gps) mutants of
Arabidopsis, were isolated that are specific to the signal transduction pathway. The response of Arabidopsis plants can be separated from signal transduction in the gravitropism pathway using cold gravistimulation (Wyatt et al., 2002). Cold gravistimulation was performed by placing plants horizontally at 4°C for 2 hours and returning the plants to vertical at room temperature and watching for a gravitropic
response. Inflorescence stems when gravistimulated at 4°C did not respond to the gravity
signal until returned to vertical at room temperature (Wyatt et al., 2002). Because the
response to gravity occurred after returning to room temperature, perception occurred in
the cold but the response was eliminated (Wyatt et al., 2002).
Three gravity persistence signal (gps) mutant phenotypes were identified using
the cold gravistimulation method: no response to gravity signal (gps1), wrong way in
response to gravity signal (gps2), and the overachiever in response to gravity signal
(gps3) (Fig. 4) (Wyatt et al., 2002). They were selected from a mutant population
generated by a T-DNA insertion. Statolith sedimentation and auxin transport experiments
at 4°C indicated that the cold disrupted an aspect of the gravity signal transduction
pathway after statolith movement but before the redistribution of auxin (Wyatt et al.,
2002). “The gps mutants represent potentially three independent aspects of signal
transduction in the gravitropic response: perception or retention of the gravity signal
(gps1-1), determination of the polarity of the response (gps2-1), and the rate of
response to the signal (gps3-1)” (Wyatt et al., 2002). 23 gps2
Wyatt et al 2002 Figure 4: The Gravity Persistence Signal (gps) Mutant Phenotypes of gps1, gps2, and gps3. Ws was the Wassilewskija ecotype background representing the wild-type Arabidopsis in this experiment. After gravistimulation at 4°C, gps1 did not bend, gps2 bent in the wrong direction, and gps3 over responded but in the correct direction (upper panel). All three gps mutants respond normally to constant gravistimulation at room temperature (lower panel). Scale bar = 1cm. (Wyatt et al., 2002).
24 The focus of this research is gps2, the wrong way mutant. Studies of gps2-1 could lead to greater understanding of how the polarity of the gravitropic response might be determined (Wyatt et al., 2002). “Polar auxin transport and the cellular events downstream seem to be normal in gps2-1, but the mechanism that establishes the direction of lateral auxin redistribution may be reversed after the cold treatment” (Wyatt et al., 2002). By cloning, identifying, and localizing the GPS2-1 gene, components of early signal transduction that link perception to response may be identified.
25 Bibliography
Blancaflor E (2002) The cytoskeleton and gravitropism in higher plants. Journal of Plant
Growth Regulation 21: 120-136
Blancaflor E, Masson P (2003) Plant gravitropism. Unraveling the ups and downs of a
complex process. Plant Physiology 133: 1677-1690
Blancaflor EB, Fasano JM, Gilroy S (1998) Mapping the functional roles of cap cells in
the response of Arabidopsis primary roots to gravity. Plant Physiology 116: 213-
222
Boonsirichai K, Sedbrook J, Chen R, Gilroy S, Masson P (2003) Altered Response To
Gravity is a peripheral membrane protein that modulates gravity-induced
cytoplasmic alkalinization and lateral auxin transport in plant statocytes. The
Plant Cell 15: 2612-2625
Caspar T, Pickard B (1989) Gravitropism in a starch-less mutant of Arabidopsis. Planta
177: 185-197
Chen R, Changhui G, Boonsirichai K, Masson P (2002) Complex physiological and
molecular processes underlying root gravitropism. Plant Molecular Biology 49:
305-317
Chen R, Rosen E, Masson P (1999) Gravitropism in higher plants. Plant Physiology
120: 343-350
Dharmasiri N, Dharmasiri S, Estelle M (2005) The F-box protein TIR1 is an auxin
receptor. Nature 435: 441-445 26 Digby J, Firn R (1995) The gravitropic set-point angle (GSA): the identification of an
important developmentally controlled variable governing plant architecture. Plant,
Cell and Environment 18: 1434-1140
Firn R, Wagstaff C, Digby J (2000) The use of mutants to probe models of
gravitropism. Journal of Experimental Botany 51: 1323-1340
Friml J, Wisniewska J, Benkova E, Mendgen K, Palme K (2002) Lateral relocation of
auxin efflux regulator PIN3 mediates tropism in Arabidopsis. Nature 415: 806-
809
Friml J, Yang X, Michniewicz M, Weijers D, Quint A, Tietz O, Benjamins R,
Ouwerkerk P, Ljung K, Sandberg G, Hooykaas P, Palme K, Offringa R
(2004) A PINOID-dependent binary switch in apical-basal PIN polar targeting
directs auxin efflux. Science 306: 862-865
Fujihira K, Kurata T, Watahiki M, Karahara I, Yamamoto K (2000) An agravitropic
mutant of Arabidopsis, endodermal-amyloplast less 1, that lacks amyloplasts in
hypocotyl endodermal cell layer. Plant and Cell Physiology 41: 1193-1199
Fukaki H, Fujisawa H, Tasaka M (1996) Gravitropic response of inflorescence stems
in Arabidopsis thaliana. Plant Physiology 110: 933-943
Fukaki H, Fujisawa H, Tasaka M (1996) SGR1, SGR2, SGR3: novel genetic loci
involved in shoot gravitropism in Arabidopsis thaliana. Plant Physiology 110:
945-955 27 Fukaki H, Tasaka M (1999) Gravity perception and gravitropic response of
inflorescence stems in Arabidopsis thaliana. Advances in Space Research 24:
763-770
Fukaki H, Wysocka-Diller J, Kato T, Fujisawa H, Benfey P, Tasaka M (1998)
Genetic evidence that the endodermis is essential for shoot gravitropism in
Arabidopsis thaliana. The Plant Journal 14: 425-430
Johannes E, Collings D, Rink J, Allen N (2001) Cytoplasmic pH dynamics in maize
pulvinal cells induced by gravity vector changes. Plant Physiology 127: 119-130
Kato T, Morita M, Fukaki H, Yamauchi Y, Uehara M, Niihama M, Tasaka M
(2002) SGR2, a phospholipase-like protein, and ZIG/SGR 4, a SNARE, are
involved in the shoot gravitropism of Arabidopsis. The Plant Cell 14: 33-46
Kato T, Morita M, Tasaka M (2002) Role of endodermal cell vacuoles in shoot
gravitropism. Journal of Plant Growth Regulation 21: 113-119
Lomax T (1997) Molecular genetic analysis of plant gravitropism. Gravitational and
Space Biology Bulletin 10: 75-82
Lomax TL (1997) Molecular genetic analysis of plant gravitropism. Gravitational and
Space Biology Bulletin 10: 75-82
Moctezuma E, Feldman L (1999) Auxin redistributes upwards in graviresponding
gynophores of the peanut plant. Planta 209: 180-186
Moore I (2002) Gravitropism: lateral thinking in auxin transport. Current Biology 12:
R452-R454 28 Morita M, Kato T, Nagafusa K, Saito C, Ueda T, Nakano A, Tasaka M (2002)
Involvement of the vacuoles of the endodermis in the early process of shoot
gravitropism in Arabidopsis. The Plant Cell 14: 47-56
Morita M, Tasaka M (2004) Gravity sensing and signaling. Current Opinion in Plant
Biology 7: 712-718
Muday G (2001) Auxins and tropisms. Journal of Plant Growth Regulation 20: 226-243
Muday G, Peer W, Murphy A (2003) Vesicular cycling mechanisms that control auxin
transport polarity. Trends in Plant Science 8: 301-304
Paponov I, Teale W, Trebar M, Blilou I, Palme K (2005) The PIN auxin efflux
facilitators: evolutionary and functional perspectives. Trends in Plant Science 10:
170-177
Perera I, Heilmann I, Boss W (1999) Transient and sustained increases in inositol 1,4,5-
trisphosphate precede the differential growth response in gravistimulated maize
pulvini. Proceedings of the National Academy of Sciences of the United States of
America 96: 5838-5843
Perera I, Heilmann I, Chang SC, Boss W, Kaufman P (2001) A role for inositol 1,4,5-
trisphosphate in gravitropic signaling and the retention of cold-perceived
gravistimulation of oat shoot pulvini. Plant Physiology 125: 1499-1507
Rashotte A, DeLong A, Muday G (2001) Genetic and chemical reductions in protein
phosphatase activity alter auxin transport, gravity response, and lateral root
growth. The Plant Cell 13: 1683-1697 29 Raven P, Evert R, Eichhorn S (2004) Biology of Plants, Ed 7th. W. H. Freeman and
Company, New York City
Sack F (1997) Plastids and gravitropic sensing. Planta 203: S63-S68
Sedbrook J, Chen R, Masson P (1999) ARG1 (altered response to gravity) encodes a
DnaJ-like protein that potentially interacts with the cytoskeleton. Proceedings of
the National Academy of Sciences of the United States of America 96: 1140-1145
Sievers A, Buchen B, Hodick D (1996) Gravity sensing in tip-growing cells. Trends in
Plant Science 1: 273-279
Staves M (1997) Cytoplasmic streaming and gravity sensing in Chara internodal cells.
Planta 203: S79-S84
Surpin M, Raikhel N (2004) Traffic jams affect plant development and signal
transduction. Nature Reviews Molecular Cell Biology 5: 100-109
Swarup R, Friml J, Marchant A, Ljung K, Sandberg G, Palme K, Bennett M (2001)
Localization of the auxin permease AUX1suggests two functionally distinct
hormone transport pathways operate in the Arabidopsis root apex. Genes and
Development 15: 2648-2653
Swarupa R, Kargula J, Marchanta A, Zadika D, Rahman A, Mills R, Yemm A, May
S, Williams L, Millner P, Tsurumi S, Moore I, Napier R, Kerr ID, Bennett
MJ (2004) Structure-function analysis of the presumptive Arabidopsis auxin
permease AUX1. The Plant Cell 16: 3069-3083
Tasaka M, Kato T, Fukaki H (1999) The endodermis and shoot gravitropism. Trends in
Plant Science 4: 103-107 30 Watahiki M, Yamamoto K (1997) The massugu1 mutation of Arabidopsis identified
with failure of auxin-induced growth curvature of hypocotyl confers auxin
insensitivity to hypocotyl and leaf. Plant Physiology 115: 419-426
Weise S, Kiss J (1999) Gravitropism of inflorescence stems in starch-deficient mutants
of Arabidopsis. International Journal of Plant Science 160: 521-527
Wyatt S, Rashotte A, Shipp M, Robertson D, Muday G (2002) Mutations in the
gravity persistence signal loci in Arabidopsis disrupt the perception and/or signal
transduction of gravitropic stimuli. Plant Physiology 130: 1426-1435
Yamamoto K, Kiss J (2002) Disruption of the actin cytoskeleton results in the
promotion of gravitropism in inflorescence stems and hypocotyls of Arabidopsis.
Plant Physiology 128: 669-681
Yano D, Sato M, Saito C, Sato MH, Morita M, Tasaka M (2003) A SNARE complex
containing SGR3/AtVAM3 and ZIG/VTI11 in gravity-sensing cells is important
for Arabidopsis shoot gravitropism. Proceedings of the National Academy of
Sciences of the United States of America 100: 8589-8594
31 Chapter 2
Characterization of the GPS2 gene
The mechanisms causing the gravitropic response remain a mystery despite studies conducted for many decades on how plants sense and respond to gravity. The gravitropic response involves an external stimulus perceived by plant cells, a signal produced and transported to the responding tissue, and a response. Current understandings of gravitropism have led to a model of the gravitropic response pathway which has been broken into four steps: gravity perception, early signal transduction, auxin redistribution and response (Lomax, 1997; Sack, 1997; Kiss, 2000; Muday, 2001).
Perception has been described as sedimenting dense organelles (amyloplast) that sense gravity (Sack, 1997). Gravity perception has been shown to occur within the starch sheath cells of the inner cortex in the inflorescence stems (Fukaki et al., 1998).
Sedimenting amyloplasts are proposed to trigger signal transduction events which lead to differential growth caused by auxin redistribution on the lower side of gravistimulated shoots. Signal transduction links perception and response, but the mechanisms behind this event are unknown. Many mutants and genes have been identified in the stimulus perception, auxin redistribution and differential growth steps of the gravitropic response pathway. Very few mutants and genes have been identified in the early signal transduction step of the pathway. Thus, early signal transduction is the least understood step of the gravitropic response pathway.
Recently, the gravity persistence signal (gps) mutants of Arabidopsis have been isolated which are defective specifically in the early events of signal transduction in the 32 inflorescence stem. This research focuses on a gps mutant that shows an abnormal gravity response, gps2 - bending the wrong way. gps2 may play a role in the establishment of polarity of the gravitropic response. The specific aims of the research were to clone, identify and localize the GPS2 gene responsible for the establishment of polarity in the gravitropism pathway. Characterization of gene expression will lead to knowledge of signal transduction in the gravitropic pathway specifically in inflorescence stems.
Materials and Methods
Plant Material, Growth Conditions, and DNA Extraction
Seeds for gps2, provided by Dr. Sarah Wyatt, were identified by the screening of an Arabidopsis mutant population produced by insertional mutagenesis. Seeds were placed in 70% ethanol, mixed vigorously, and soaked for 1 minute. The ethanol was decanted and washed with distilled water three times. The seeds were then suspended in
0.1% agar solution. Seeds were sown using a disposable pipette onto damp potting soil.
The pots were covered with plastic wrap until the seeds germinated. Plants were grown under long day conditions (16 hours of daylight and 8 hours of darkness) at 24˚C. gps2 genomic DNA was extracted from rosette leaf tissue using the CTAB protocol (Weigel and Glazebrook, 2002).
Thermal Asymmetric Interlaced Polymerase Chain Reaction
Thermal Asymmetric Interlaced Polymerase Chain Reaction (TAIL PCR) utilized
three nested sequence-specific primers (TAIL1, TAIL2, and TAIL3) designed from the
T-DNA insertion together with a set of five short random primers (AD1, AD2, AD3, 33 AD4, and AD5) (Fig.5) (Liu et al., 1995; Sessions et al., 2002; Weigel and Glazebrook,
2002). The TAIL1, 2, and 3 primers were designed from the sequence of the left border of the T-DNA inserted in the gps mutants: TAIL1 – 5’ TCTGGGAATGGCGTAACAA
AGGC 3’, TAIL2 – 5’ AACTGTAATGACTCCGCGCAATA 3’ and TAIL3 – 5’ CAG
CCAATTTTAGACAAGTATC 3’. A set of five random primers were designed: AD1 –
5’ NTCGASTWTSGWGTT 3’, AD2 – 5’ NGTCGASWGANAWGAA 3’, AD3 – 5’
TGWGNAGSAGSANCASAGA 3’, AD4 – 5’ AGWGNAGWANCAWAGG 3’, AD5 –
5’ WGTGNAGWANCANAGA 3’(Liu et al., 1995; Weigel and Glazebrook, 2002).
The primary reaction (20µl sample) contained genomic gps2-1 DNA (10 ng/µl) ,
7.5µl of double distilled water, 2µl of 10X Taq ThermoPol buffer (20 mM Tris-HCl pH
8.8, 10 mM(NH4)2SO4, 10mM KCl, 2mM MgSO4, 0.1% Triton X-100) (NEB, Ipswich,
MA), 2µl dNTP’s (10µM each), 4µl of one of the five random primers (0.1µM), 3µl
TAIL1 primer (0.01µM), and 0.5µl Taq Polymerase (NEB, Ipswich, MA). One reaction mixture was made for each of the five random primers. The PCR program run using a MJ
Research PTC-225 Peltier Thermal Cycler (MJ Research, Inc., Waltham, MA) for the
primary reactions was: (1) 4°C for 2 minutes, (2) 92°C for 3 minutes, (3) 95°C for 1
minute, (4) 94°C for 30 seconds, (5) 35°C for 1 minute, (6) 74°C for 2 minutes, (7) Go to
step # 4 and cycle 5 times, (8) 94°C for 30 seconds, (9) 25°C for 2 minutes, (10) Ramp
0.6°/s to 74°C, (11) 74°C for 2 minutes, (12) 94°C for 30 seconds, (13) 35°C for 1
minute, (14) 74°C for 2 minutes, (15) 94°C for 30 seconds, (16) 35°C for 1 minute, 34
Figure 5: Diagrammatic Representation of the Primers for the TAIL PCR Method. Thermal Asymmetric Interlaced Polymerase Chain Reaction (TAIL-PCR) is a method for amplifying unknown sequences (GPS 2-1) flanking known sequences (T-DNA insertion). Three nested primers TAIL1, TAIL2, and TAIL3 designed from the T-DNA insertion along with random primers were used to amplify the genomic DNA flanking the T-DNA insertion in the gps2 mutant.
35 (17) 74°C for 2 minutes, (18) 94°C for 30 seconds, (19) 44°C for 1 minute, (20) 74°C for
2 minutes, (21) Go to step #12 and cycle 15 times, (22) 74°C for 5 minutes, and (23) 4°C infinitely.
The secondary reaction used the template provided by the primary reaction. One microliter of the primary PCR product was diluted with 39µl of double distilled water.
One microliter of that dilution was used as template in the secondary reaction. The secondary reaction (25µl) mixture (one reaction mixture per random primer) contained:
1µl of diluted 1° PCR product, 8.2µl of double distilled water, 2.5µl of 10X Taq
ThermoPol buffer (20 mM Tris-HCl pH 8.8, 10 mM(NH4)2SO4, 10mM KCl, 2mM
MgSO4, 0.1% Triton X-100) (NEB, Ipswich, MA), 2.5µl of dNTP’s (10µM each), 5µl of
TAIL2 primer (0.01µM), 5µl of the random primer yielding the PCR product (0.1µM), and 0.8µl Taq Polymerase (NEB, Ipswich, MA). The PCR program for the secondary
reaction was: (1) 4°C for 2 minutes, (2) 94°C for 30 seconds, (3) 35°C for 1 minute, (4)
72°C for 2 minutes, (5) 94°C for 30 seconds, (6) 35°C for 1 minute, (7) 72°C for 2
minutes, (8) 94°C for 30 seconds, (9) 45°C for 1 minute, (10) 72°C for 2 minutes, (11)
Go to step # 2 and cycle 12 times, (12) 72°C for 5 minutes, and (13) 4°C infinitely.
The tertiary reaction also used the template provided by the primary reaction. One
mircoliter of the primary PCR product was diluted with 9µl of double distilled water. One
microliter of that dilution was used as a template in the tertiary reaction. The tertiary
reaction (50µl) (one reaction mixture per random primer) contained: 1µl of diluted 1°
PCR product, 17.5µl of double distilled water, 5µl of 10X Taq ThermoPol buffer (20 mM
Tris-HCl pH 8.8, 10 mM(NH4)2SO4, 10mM KCl, 2mM MgSO4, 0.1% Triton X-100) 36 (NEB, Ipswich, MA), 5µl of dNTP (10µM each), 10µl of TAIL3 primer (0.01µM), 10µl of the random primer yielding the PCR product (0.1µM), and 1.5µl Taq Polymerase
(NEB, Ipswich, MA). The PCR program for the tertiary reaction was: (1) 4°C for 2 minutes, (2) 94°C for 40 seconds, (3) 35°C for 1 minute, (4) 72°C for 2 minutes, (5) Go to step # 2 and cycle 20 times, (6) 72°C for 5 minutes, and (7) 4°C infinitely.
Cloning of the PCR Product
The PCR products from the primary, secondary and tertiary reactions were run on
1% agarose gels (Fig. 6). The DNA band of interest from the tertiary reaction was gel
extracted using the Qiagen Gel Extraction kit following the product protocol (Qiagen,
Inc., Valencia, CA). The gel extracted PCR product was ligated into TOPO TA cloning
vector pCR®2.1-TOPO® according to the product protocol (Invitrogen, Carlsbad, CA).
The ligated PCR product and vector were transformed into chemically competent TOP10
E.coli cells (Invitrogen, Carlsbad, CA) and plated onto Luria-Bertani (LB) plates with
100mg/L kanamycin and 40mg/ml of 5-bromo-4-chloro-3 indolyl-beta-D- galactopyranoside (X-gal) (Sigma, Atlanta, GA) and incubated at 37°C overnight.
Positive white colonies were selected and cultured in 3ml of LB media with 100mg/L kanamycin for 16 hours at 37°C at 225 rpm in a C24 incubator/shaker (New Brunswick
Scientific, Edison, NJ). The plasmid was extracted using a Qiagen Mini Prep kit according to the product protocol (Qiagen, Inc., Valencia, CA). The extracted plasmid containing gps2 genomic DNA flanking the T-DNA insertion was sequenced using M13 forward and reverse primers. A sequence mixture (20µl) contained: extracted plasmid
DNA (15ng/µl), 1µl of 3.2µM M13 primer, 4µl ABI PRISM® Big Dye® Terminator 37
A B
1000 bp 1500 bp 750 bp ~350bp 1000 bp 500 bp 750 bp 250 bp 500 bp ~350bp
250 bp
Figure 6: Analysis of the TAIL PCR Products. (A) TAIL1 and TAIL2 product analysis of a 1% agarose gel. Lane M = 1kb ladder, Lane T1 = TAIL1 product and Lane T2 = TAIL2 product. (B) TAIL3 product analysis of a 1% agarose gel. Lane M = 1kb ladder and Lane T3 = TAIL3 product. The bottom band on Lane 1 and Lane 2 showed the same fragment size as Lane 3. Lane 3 was chosen for gel extraction and cloned into a TOPO vector. The upper band in Lane 2 was also gel extracted and sequenced. It was clearly a PCR artifact.
38 v3.1 Sequencing Reaction Mixture (Applied Biosystems, Foster City, CA), 2µl ABI
PRISM® Big Dye® Terminator v3.1 Sequencing Reaction 5X Buffer (Applied
Biosystems, Foster City, CA), and 9.8µl of double distilled water. The PCR program for the reaction was: (1) 96°C for 10 seconds, (2) 50°C for 5 seconds, (3) 60°C for 4 minute,
(4) Go to step # 1 and cycle 25 times, and (5) 4°C infinitely.
The amplified DNA was precipitated by 2µl of 3M sodium acetate pH 5.2 and
50µl of 95% ethanol for 15 minutes at room temperature. The mixture was centrifuged for 20 minutes at 13,000 rpm and the supernatant was discarded. The pellet was washed with 250µl of cold 70% ethanol and centrifuged for 5 minutes at 13,000 rpm. The supernatant was discarded and the pellet was air dried. Sequencing was completed with an ABI PRISM® 310 Genetic Analyzer (Applied Biosystems, Foster City, CA).
Sequence analysis was completed using Contig Express software, Vector NTI software, and National Center Biotechnology Information (NCBI) Basic Local Alignment Search
Tool (BLAST) database.
Constructs
The Bacterial Artificial Chromosome (BAC) F2I11 clone containing the
At5g11150 gene of interest was streaked on LB/Kan plates and grown overnight at 37ºC
in an incubator. One colony was selected and cultured in 5ml of LB media with 100mg/L kanamycin for 16 hours at 37°C at 225 rpm in an incubator/shaker. The clone was extracted following the protocol provided by the Arabidopsis Biological Resource Center
(ABRC) DNA Stock Center. The clone identity was checked by restriction enzyme digestion. Six constructs were created using various Gateway vectors (pMDC32, 39 pMDC83, pMDC110, and pMDC99) obtained from Dr. Mark Curtis (Institute of Plant
Biology and Zürich-Basel Plant Science Centre, University of Zürich). pMDC32 vector contains a Cauliflower mosaic virus 35S promoter, which is a strong constitutive promoter. pMDC83 contains a 35S promoter and a green fluorescent protein (GFP). pMDC110 contains a GFP. pMDC99 is a blank construct. In addition, each vector has kanamycin, hygromycin, and chloramphenicol resistance genes along with enzyme restriction sites (AscI and PacI) used to facilitate the insertion of At5g11150 into the
Gateway vectors.
Primers were designed specifically to amplify the At5g11150 gene from the BAC
F2I11 clone. Two primers were created for construct (a) which used the pMDC32 vector.
The forward primer was designed to include an AscI (ggcgcgcc) restriction enzyme digestion site (cccggcgcgcccactctaatcgaatcactttg) and amplify the start codon region. The reverse primer contained the stop codon of At5g11150 and a PacI (ttaattaa) restriction enzyme digestion site (ccttaattaacttacttgaaacaagaaggaagac). Two primers were created for construct (b) which used the pMDC83 vector. The forward primer was designed to amplify the start codon region and included a PacI site (ccttaattaacactctaatcgaatcactttg).
The reverse primer was designed upstream of the stop codon and included an AscI site
(ggcgcgccccttgaaacaagaaggaagac). One primer was created for construct (c) which used the pMDC110 vector. The forward primer included 1835 bp flanking the start codon of
At5g11150 to include the gene’s endogenous promoter region. This primer included a
PacI restriction enzyme digestion site (ttaattaagagtcaatatgcgtccaga). The same reverse primer designed for construct (b) was used for this construct. Two primers were created 40 for construct (d) which used the pMDC99 vector. The forward primer was designed to amplify 1835 bp flanking the start codon of At5g11150 to include the gene’s endogenous promoter region similar to construct (c)’s forward primer only with an AscI site instead of a PacI site (ccggcgcgccgagtcaatatgcgtccaga). The reverse primer was designed to amplify downstream of the stop codon and included a PacI site (ccttaattaagaagaagataagagaatgtc).
Two primers were created for construct (e) which used the pMDC110 vector. The forward primer was designed to amplify 1835 bp flanking the start codon of At5g11150 to include the endogenous promoter region with a PacI site (ccttaattaagagtcaatatgcgtcc aga). The reverse primer was designed upstream of the start codon with an AscI site
(ggcgcgcccttttgttccagctcacttctc). The restriction sites (AscI and PacI) were included to later facilitate the insertion of At5g11150 into the corresponding Gateway vector.
For each construct, the extracted clone was used as template in the amplification of At5g11150 by Touchdown PCR using the specific primers designed for the construct of interest. The PCR mixture (20µl) contained: extracted BAC clone (20ng/µl), 12.5µl of double distilled water, 1ul of forward primer (0.1µM) for the corresponding construct,
1µl of reverse primer (0.1µM) for the corresponding construct, 2µl of dNTP (10µM each), 2µl of 10X Taq ThermoPol buffer (20 mM Tris-HCl pH 8.8, 10 mM(NH4)2SO4,
10mM KCl, 2mM MgSO4, 0.1% Triton X-100) (NEB, Ipswich, MA), and 0.5µl of Taq
Polymerase (NEB, Ipswich, MA). The PCR program for the reaction was: (1) 94°C for 3
minutes, (2) 94°C for 30 seconds, (3) 55°C for 1 minute, (4) 72°C for 3 minutes, (5) 94°C
for 30 seconds, (6) 54°C for 1 minute, (7) 72°C for 3 minutes, (8) 94°C for 30 seconds,
(9) 53°C for 1 minute, (10) 72°C for 3 minutes, (11) 94°C for 30 seconds, (12) 52°C for 1 41 minute, (13) 72°C for 3 minutes, (14) 94°C for 30 seconds, (15) 51°C for 1 minute, (16)
72°C for 3 minutes, (17) 94°C for 30 seconds, (18) 50°C for 1 minute, (19) 72°C for 3 minutes, (20) Go to step # 17 and cycle 35 times, (21) 72°C for 8 minutes, and (22) 4°C infinitely.
The amplified PCR product was ligated into a TOPO TA cloning vector pCR®2.1-
TOPO® according to the product protocol (Invitrogen, Carlsbad, CA). The ligated PCR product and vector were transformed into chemically competent TOP10 E.coli cells
(Invitrogen, USA) and plated onto LB plates with 100mg/L kanamycin and 40mg/ml of
5-bromo-4-chloro-3 indolyl-beta-D-galactopyranoside (X-gal) (Sigma, Atlanta, GA) and
incubated at 37°C overnight in an incubator. Positive white colonies were selected and cultured in 3ml of LB media with 100mg/L kanamycin for 16 hours at 37°C at 225 rpm in an incubator/shaker. The plasmid was extracted using a Qiagen Mini Prep kit according to the product protocol (Qiagen, Inc., Valencia, CA). The extracted plasmid was sequenced and analyzed as described earlier.
For each construct, an AscI/PacI restriction enzyme digest was performed on the plasmid extract containing At5g11150 amplified from the BAC clone ligated into a
TOPO TA cloning vector and on the pMDC vector for that construct. The digestion mixture (15µl) contained: 2.0ng/µl of TOPO TA vector ligated with the PCR product of
interest or 2.0ng/µl of pMDC vector of interest, 3µl of 10X NEBuffer 4 (50 mM
potassium acetate, 20 mM Tris-acetate, 10 mM magnesium acetate, 1 mM dithiothreitol)
(NEB, Ipswich, MA), 2µl of Bovine Serum Albumin (BSA)(20 mM KPO4, 50 mM NaCl
0.1 mM EDTA, 5% glycerol) (NEB, Ipswich, MA), 0.5µl of AscI enzyme (NEB, 42 Ipswich, MA), 0.5µl of PacI enzyme (NEB, Ipswich, MA), and 7µl of double distilled water. The digestion mixture incubated at 37°C in a waterbath for 2 hours then moved to a 65ºC waterbath for 20 minutes. The digestion products were then run on a 1% agarose gels. The DNA band of interest from the pMDC vector and the DNA band of interest from the TOPO TA vector ligated with the At5g11150 gene was gel extracted using the
Qiagen Gel Extraction kit following the product protocol (Qiagen, Inc., Valencia, CA).
The gel extraction sample from the pMDC vector and the amplified At5g1150
gene were ligated together using T4 DNA ligase. The ligation mixture consisted of: 3µl of double distilled water, 5µl of 10X T4 DNA ligase buffer (NEB, Ipswich, MA), pMDC vector purified from gel extraction (20ng/µl), amplified At5g11150 gene purified from gel extraction (15ng/µl), and 2.1µl of T4 DNA ligase (NEB, Ipswich, MA). The ligation mixture was incubated at room temperature to produce the construct of interest. All individual constructs were transformed into Library Efficiency® DB3.1™ competent cells
according to the product protocol (Invitrogen, Carlsbad, CA).
Positive colonies were selected from the LB/Kan plates which contained DB3.1
cells ligated with constructs. The positive colonies were cultured in two types of LB
media. The first LB media contained 100mg/ml kanamycin for positive selection and the
second type of LB media contained 100mg/ml chloramphenicol for negative selection.
Colonies were incubated for 18 hours at 37ºC at 225 rpm in an incubator/shaker.
Plasmids containing the constructs were extracted from the positive colonies by using a
Qiagen Mini Prep kit according to the product protocol (Qiagen, Inc., Valencia, CA). A 43 diagnostic digestion was performed on each construct to confirm proper insertion.
Sequencing and analysis was performed on each construct to check for proper insertion and fusion of GFP if applicable. Each of these six constructs was transformed using the
Agrobacterium transformation method and floral dipped into Arabidopsis gps2 plants.
Agrobacterium Transformation
Five nanograms per microliter of the confirmed construct were added to 20µl of
ElectroMAX™ Agrobacterium tumefaciens LBA4404 Cells (Invitrogen, Carlsbad, CA).
The chilled mixture was electroporated for four seconds at 1.8kV, 200 ohms resistance, and 25 micropores with a Gene Pulser II electroporation machine (BioRad, Hercules
CA). One milliliter of room temperature YM media (0.04% yeast extract, 1.0% mannitol,
1.7 mM NaCl, 0.8 mM MgSO4*7H20, and 2.2 mM K2HPO4*3H2O) was added to the cuvette and incubated at 30ºC for 3 hours at 225 rpm in an incubator/shaker.
Approximately 20µl of each culture was plated onto YM media plates with selected antibiotics (0.04% yeast extract, 1.0% mannitol, 1.7 mM NaCl, 0.8 mM MgSO4*7H20, and 2.2 mM K2HPO4*3H2O, 100 mg/ml streptomycin, and 100 mg/ml kanamycin) and incubated at 30ºC for 48 hours. After 48 hours, the plates were stored at 4ºC.
Floral Dip and Arabidopsis Transformation
A flat of gps2 plants was sown and grown as described above except that the potting soil was molded into a mound shape and covered with mesh. Plants were grown under short day conditions (8 hours of daylight and 16 hours of darkness) at 24˚C until the rosettes were 5 centimeters in diameter and then moved to grow under long day conditions (16 hours of daylight and 8 hours of darkness) at 24ºC until the inflorescence 44 stems were 10-12 cm long. Agrobacterium colonies containing the construct of interest were selected and cultured in 3ml of LB media containing kanamycin for 48 hours at
30ºC at 225 rpm in an incubator/shaker. After incubation, 200µl of each culture was added to 1L of YM media containing 1 µl/ml streptomycin and 1 µl/ml kanamycin and incubated for 48 hrs at 30ºC at 225 rpm in an incubator/shaker. Cultured cells were harvested by centrifugation and resuspended in infiltration media (2.2g MS salts, 50g sucrose, 0.5g 2-[N-Morpholino] ethanesulfonic acid (MES), and 200µl Silwet L-77. Any fully developed flowers on the plants were removed and the plants were dipped into the infiltration media prepared for that construct. The seeds (T1) for each construct were
collected from the transformed (T0) plants. The T1 seeds were plated onto Arabidopsis
growth plates with hygromycin (4.3g MS salts, 1% sucrose, 0.5 g/L MES, 0.8% M agar,
and 60mg/ml hygromycin) for transformant screening. The successfully transformed
plants were transferred to potting soil.
BY-2 Transformation
BY-2 transformation was accomplished by co-incubation of BY-2 suspension
culture cells, provided by Dr. Allan Showalter, with A. tumefaciens containing the
35S::At5g11150::GFP construct. The BY-2 suspension culture cells were maintained in
NT1 media (4.3g/L MS salts, 30g/L sucrose, 3ml Miller’s solution (6% KH2PO4
weight/volume), 100 mg/L myoinositol, 1ml of thiamine HCl (1mg/ml), and 440µl 2,4
dichlorophenol (1mg/ml)). Three day old BY-2 cells (4ml) were incubated with 1ml of
cultured (48 hours at 30ºC at 225 rpm) Agrobacterium containing the 35S:: At5g11150::
GFP construct and acetosyringone (20 mM) were incubated for 72 hours in a Petri dish at
28ºC. One plate containing only BY-2 cells was included as a control. 45 Microscopy
GFP expression of the BY-2 transformed cells involving the 35S::At5g11150 ::
GFP construct was obtained using a Zeiss Laser Scanning Microscope (LSM) 510
upright Confocal microscope.
Results
Cloning and Gene Analysis Results
TAIL PCR was designed for amplifying unknown sequences (gps2) flanking
known sequences (the T-DNA insertion). Based on analysis of the TAIL PCR products, a
~350 base pairs (bp) DNA fragment from the tertiary PCR reaction was chosen for
sequence analysis. Sequencing results were analyzed using Contig Express and
transferred into Vector NTI for an illustrative view of the molecule. The fragment
sequence included the TAIL3 primer, 325 bp of the GPS2-1 gene and the TOPO TA
cloning vector (Fig. 7).
Sequence fragment TAIL3 TOPO TA 325bp vector Primer TOPO TA vector
Figure 7: Diagrammatic Representation of Sequence Results. The PCR product amplified with TAIL3 primer and random primer #1 was extracted and cloned into a TOPO TA vector. Sequence results of the amplified DNA from gps2-1 showed the TAIL3 primer, sequence fragment of 325bp, and the TOPO TA vector. 46 A NCBI BLAST Sequence Similarity Search using the 325 bp of the GPS2-1 gene revealed that the fragment nucleotide sequenced matched (with 100% identity) an
Arabidopsis thaliana BAC (Bacteria Artificial Chromosome) F2I11 located on chromosome 5 of Arabidopsis thaliana (Fig. 8). Further analysis using The Arabidopsis
Information Resource (TAIR http://www.arabidopsis.org/home.html) indicated that the
325 bp fragment matched the Arabidopsis thaliana locus (At5g11150) encoding 4 exons and three introns (Fig. 9). The T-DNA insertion interrupts the last half of the At5g11150 gene located on chromosome 5 (Fig. 10). Gene analysis using TAIR indicated that the protein encoded by At5g11150 is a synaptobrevin/vesicle-associated membrane protein
(VAMP 713) potentially involved in vesicle-mediated transport however the biological and molecular functions are unknown (www.arabidopsis.org). The protein encoded by
At5g11150 is predicted to be a transmembrane protein located in the endomembrane system (www.arabidopsis.org).
TargetP analysis results indicted that At5g11150 is targeted to secretory pathway with a TargetP score of 0.508 and a TargetP reliability class of 4 (Fig. 11) (Emanuelsson et al., 2000). SignalP analysis results revealed no signal peptide. SNARE proteins do not commonly have signal peptides because SNARES are not trafficked themselves in the endomembrane system but traffic other proteins within the endomembrane system. The amino acid sequence of At5g11150 revealed four domains including: Longin Domain,
Synaptobrevin Domain, Transmembrane Region, and V-SNARE Coiled-Coil Homology
(http://www.ncbi.nlm.nih.gov/entrez /protein) (Fig. 12). The transmembrane domain is obvious. The longin domain is found in animals and plants and is likely to be essential for 47
Figure 8: Sequence Similarity Search Results. A NCBI BLAST Sequence Similarity Search using the 325 bp of the GPS2-1 gene revealed that the fragment nucleotide sequenced matched with 100% identity an Arabidopsis thaliana BAC F2I11. 48 A
B
Figure 9: Arabidopsis Nucleotide Sequence Similarity Results. Analysis using TAIR indicated that the 325 bp fragment matched the Arabidopsis thaliana locus (At5g11150). At5g11150 as diagrammatically pictured encodes four exons and three introns (A). The amino acid sequence (dark blue) is shown about the nucleotide sequence which is separated into exons (light blue) and introns (black) (B). Analysis of the 325 nucleotides from the sequences of the GPS2-1 gene matched At5g11150 perfectly using Contig Express software (green box) (B). 49 TAIR Seq Viewer
Chr1 Chr2 Chr3
Chr4
Chr5 www.arabidopsis.org At5g11150 locus 5’ T-DNA 3’ GPS2 gene Tag 3’ 5’
Figure 10: Diagrammatic Representation of the T-DNA Insertion in At5g11150. The T-DNA insertion interrupts the last half of the At5g11150 gene located on chromosome 5. At5g11150 encodes a synaptobrevin / vesicle-associated membrane protein (VAMP) involved in the endomembrane system. VAMPs are a member of the soluble n- ethylmaleimide-sensitive fusion protein attachment protein receptors (SNARE) family. 50
cTP mTP SP other Predicted RC Location
0.135 0.101 0.508 0.166 S 4 (20-40%)
Figure 11: TargetP Membrane Target Analysis. A subcellular localization prediction was made by entering the amino acid sequence of At5g11150 into the TargetP software. TargetP software makes predictions based on the N-terminal targeting region present in the amino acid sequence. At5g11150 was predicted to be localized in the secretory pathway with a 20 to 40% confidence level. cTP = chloroplast transit peptide, mTP = mitochondrial targeting peptide, SP = secretory pathway, and RC = statistical confidence.
51
Figure 12: Amino Acid Sequence of At5g11150 (Top Panel). Diagrammatic representation (Bottom Panel) of the protein structure includes the following regions: Longin Domain, Synaptobrevin Domain, V-SNARE Coiled-Coil homology, and a transmembrane region as predicted by NCBI Entrez Protein. 52 membrane trafficking. The synaptobrevin domain is found in animals and functions in vesicle trafficking but does not yet have a function in plants. The V-SNARE region is conserved through all vesicle SNARES in plants and animals and functions as a region of attachment for other SNARES.
Rescuing the Phenotype and Localization
A series of constructs were designed and built to both rescue the phenotype of
gps2 and to assess the tissue and subcellular localization of the GPS2 product (Fig. 13):
a. 35S Promoter / Wild-type copy of the gene (pMDC32)
Function: Rescue the phenotype
b. 35S Promoter / Wild-type copy of the gene / GFP (pMDC83)
Function: Rescue the phenotype, Subcellular localization
c. Endogenous Promoter / Wild-type copy of the gene / GFP (pMDC110)
Function: Rescue the phenotype, Tissue specificity, Subcellular
Localization
d. Endogenous Promoter / Wild-type copy of the gene (pMDC99)
Function: Rescue the phenotype
e. Endogenous Promoter / GFP (pMDC110)
Function: Tissue specificity
f. Empty Vector Control
Function: Control
Once the seven constructs were built, each construct was transformed into
Agrobacterium and were floral dipped into gps2 Arabidopsis plants (Fig. 14). The seeds
(T1) for each construct were collected and plated onto Arabidopsis hygromycin growth
53 A B
C D
Figure 13 (page 1)
54 E F
Figure 13: Diagram of Reporter Gene Constructs. The 35S Promoter / Wild-type copy of the gene (pMDC32) was built to rescue the phenotype (A). The 35S Promoter / Wild-type copy of the gene / GFP (pMDC83) was built to rescue the phenotype and assess subcellular localization (B). The endogenous promoter / Wild-type copy of the gene / GFP (pMDC110) was built to rescue the phenotype, assess tissue specificity and subcellular localization (C). The endogenous promoter / Wild-type copy of the gene (pMDC99) was built to rescue the phenotype (D). The endogenous promoter / GFP (pMDC110) was built to assess tissue specificity (E). pMDC110 was used as an empty vector control (F).
55
Figure 14: gps2-1 Arabidopsis Mounds. gps2-1 Arabidopsis mounds were used for floral dipping of the series of reporter gene constructs. 56 plates for transformant screening. The successful transformed plants for each construct were transferred to potting soil (Fig. 15). To date, 50% of the T1 seeds from each construct have been plated and screened. Progress toward the phenotypic complementation can be seen in Table1.
Preliminary subcellular localization of the protein produced by At5g11150 was achieved by BY-2 transformation. BY-2 transformation is the co-incubation of BY-2 suspension culture cells and A. tumefaciens containing the 35S::At5g11150::GFP construct (b). Using a Zeiss LSM Confocal microscope, GFP expression of the BY-2 transformed cells was obtained (Fig.16). The GPS2 protein appears to be localized to the vesicles of the endomembrane system (Fig.16).
Focus for the Future
The newly transferred transformants will be allowed to self and the seeds (T2) will
be collected. For each construct, the T2 seeds will be planted and screened. These plants
will be genetically divided into three types (25% wild-type, 50% heterozygous and 25%
homozygous). Once screened, the homozygous plants will be selected and allowed to
self. These seeds (T3) will be planted and evaluated. For each construct, the plants will
undergo a cold gravistimulation. If the phenotype has been rescued with the insertion of
At5g11150, the plant will exhibit a wild-type response when cold gravistimulated. If the
phenotype has not been rescued with the insertion of At5g11150, the plant will exhibit
the gps2 phenotype (wrong way) when cold gravistimulated. In addition, the plants from
the T3 generation will be evaluated for tissue specificity and subcellular localization using
the Confocal microscope at different developmental growth phases. T3 plants with 57
A
B
Figure 15: Newly Transferred Transformants in Soil. A transformant of construct (c) was transferred from Arabidopsis hygromycin growth plates to potting soil (A). A transformant of construct (e) was also transferred to potting soil (B).
58
Table 1. Progress Toward Complementation Construct Amplified Ligated Transformed Transformed Transformed Number of Number Gene into into into gps2-1 into BY-2 Transplanted of and/or pMDC Agrobacterium Plants suspension Seedlings Survived Promoter Vector culture cells Seedlings A X X X X 2 0
B X X X X X 5 0
C X X X X 10 2
D X X X X 1 0
E X X X X 2 0
F X X X X 3 1
X’s are indication of step completion. 59
A B C
Figure 16. Subcellular Localization of the GPS2 Protein. Agrobacterium-mediated transformation of BY2 (Nicotiana tabacum BY2) tobacco cells using the 35S promoter, the GPS2 gene, and the GFP construct. (A) Green fluorescent protein image. (B) Differential interference contrast (DIC) image. (C) Overlay image. GPS2 appears localized to vesicles. 60 constructs (b) and (c) will be evaluated for subcellular localization while constructs (c) and (e) will be evaluated for tissue specificity.
The GPS2 gene is predicted to rescue the gps2 phenotype in the T3 generation of the transformed plants. Preliminary subcellular localization of the GPS2 protein in BY-2 cells appears to be localized in the vesicles of the endomembrane system. Subcellular localization of the GPS2 protein in transformed gps2-1 Arabidopsis plants is predicted to be in the vesicles in the endomembrane system. Tissue specificity is predicted to be located in the starch sheath layer of the inner cortex in the shoot.
Discussion
The gps2-1 mutant phenotype, generated by a T-DNA insertion and identified by
the cold gravistimulation method, is most likely caused by a disruption of the GPS2-1
gene. The GPS2-1 gene appears to play a role in early signal transduction of the
gravitropic signal transduction pathway. Statolith sedimentation and auxin transport
experiments at 4°C indicated that cold disrupted an aspect of the gravity signal
transduction pathway after statolith movement but before the redistribution of auxin
(Wyatt et al., 2002). The gps2 mutant could represent the determination of the polarity of
the gravitropic response in signal transduction of the gravitropic pathway (Wyatt et al.,
2002).
TAIL PCR, cloning, and sequence analysis revealed the GPS2-1 gene
(At5g11150) was located on chromosome 5. The biological process and molecular
functions of the gene are unknown. The GPS2 gene was identified as a synaptobrevin /
vesicle associated membrane protein (VAMP) - VAMP713. Synaptobrevins/VAMPs are 61 members of the SNARE (Soluble N-ethylmaleimide-Sensitive Fusion Protein Attachment
Protein Receptors) family of proteins. SNAREs function in the process of vesicle
trafficking, targeting, and secretion in the endomembrane system. There are two main
types of SNAREs: vesicle membrane (v-SNARE) and target membrane (t-SNARE). The
role of SNAREs appears to be vesicle and target membranes interacting to form the
assembly of a four coiled α-helix SNARE bundle that draws vesicle and target membrane
surfaces together for fusion of the bilayers and release of cargo (Sanderfoot et al., 2000;
Banfield, 2001; Pratelli et al., 2004). The GPS2 protein, which in accordance with the
amino acid sequence is a v-SNARE, is predicted to be involved in protein targeting and
sorting in the endomembrane system.
Recent research on the gps mutants has provided new information about auxin
and the phenotype of gps2. Basipetal auxin transport studies and studies on the assessment of lateral gradients of auxin induced gene expression were conducted on gps2(Nadella et al., 2005). In gps2, no significant difference in basipetal auxin transport as compared to wild-type after cold gravistimulation was found (Nadella et al., 2005).
The auxin-induced gene expression studies in gps2 showed improper redistribution of auxin to the upper side of the inflorescence stem after cold gravistimulation leading to the mutant phenotype when compared to wild-type which has an increase of auxin on the lower side commonly associated with increased elongation and bending of the cold gravistimulated inflorescence stem (Nadella et al., 2005). Thus, the gps2 mutant phenotype was found to be a result of an inversion of lateral auxin redistribution after cold gravistimulation. 62
A possible function of the GPS2-1 gene is the lateral relocation of an auxin efflux
facilitator or other regulators. One auxin efflux facilitator, PIN3, is of particular interest.
PIN3 belongs to the family of PIN genes (auxin efflux facilitators) in Arabidopsis
involved in auxin transport which alters differential cell elongation (Blilou et al., 2005).
PIN3 is a lateral auxin efflux facilitator shown to be involved in shoot gravitropism and
localized to the plasma membrane (Friml et al., 2002; Blilou et al., 2005). During
gravitropic response, the PIN3 gene has been shown to localize to vesicles in the starch
sheath cells of the shoot inner cortex showing rapid cycling in gravistimulated
Arabidopsis (Friml et al., 2002). PIN3’s involvement in lateral auxin transport during
shoot gravitropism and the results from the gps2 auxin experiments combine to make an
intriguing hypothesis for the function of the GPS2 gene (Fig. 17).
In conclusion, the gps2-1 mutant phenotype caused by the disruption of the GPS2
gene is hypothesized to be a result of an inversion of lateral auxin redistribution after cold
gravistimulation caused by the redistribution of an auxin efflux facilitator or other
regulators. Cloning, identifying and characterizing gene expression of the predicted GPS2
gene has lead to new insights in signal transduction of the gravitropic pathway. Although
new information has been gained, more research is needed to investigate GPS2’s role in
early signal transduction. 63
PIN3
GPS2 PIN3 PIN3 PIN3 GPS2 GPS2 GPS2
Figure 17: Diagrammatic Representation of the Possible Function of GPS2. GPS2 might be involved in the lateral relocation of the auxin efflux facilitator PIN3 during shoot gravitropism. GPS2 (purple v-SNARE circle) with the PIN3 protein attached (red rectangle) interacts with three t-SNAREs (blue,green, and yellow-orange lines) forming a SNARE complex that fuse two bilayers together allowing the release of cargo. Picture adapted from http://beagle.colorado.edu/courses/3280/lectures/class10.html. 64
Bibliography
Banfield DK (2001) SNARE complexes - is there sufficient complexity for vesicle
targeting specificity? Trends in Biochemical Sciences 26: 67-68
Blilou I, Xu J, Wildwater M, Willemsen V, Paponov I, Friml J, Heidstra R, Aida M,
Palme K, Schere B (2005) The PIN auxin efflux facilitator network controls
growth and patterning in Arabidopsis roots. Nature 433: 39-44
Emanuelsson O, Nielsen H, Brunak S, von Heijne G (2000) Predicting subcellular
localization of proteins based on their N-terminal amino acid sequence. Journal of
Molecular Biology 300: 1005-1016
Friml J, Wisniewska J, Benkova E, Mendgen K, Palme K (2002) Lateral relocation of
auxin efflux regulator PIN3 mediates tropism in Arabidopsis. Nature 415: 806-
809
Fukaki H, Wysocka-Diller J, Kato T, Fujisawa H, Benfey P, Tasaka M (1998)
Genetic evidence that the endodermis is essential for shoot gravitropism in
Arabidopsis thaliana. The Plant Journal 14: 425-430
Kiss J (2000) Mechanisms of the early phases of plant gravitropism. Critical Reviews in
Plant Sciences 19: 551-573
Liu Y, Mitsukawa N, Oosumi T, Whittier R (1995) Efficient isolation and mapping of
Arabidopsis thaliana T-DNA insert junctions by thermal asymmetric interlaced
PCR. The Plant Journal 8: 457-463
Lomax T (1997) Molecular genetic analysis of plant gravitropism. Gravitational and
Space Biology Bulletin 10: 75-82 65
Muday GK (2001) Auxins and tropisms. Journal of Plant Growth Regulation 20: 226-
243
Nadella V, Shipp M, Muday G, Wyatt S (2005) Evidence for altered polar and lateral
auxin transport in the gravity persistent signal (gps) mutants of Arabidopsis.
Plant, Cell and Environment: Accepted
Pratelli R, Sutter J-U, Blatt MR (2004) A new catch in the SNARE. Trends in Plant
Science 9: 187-195
Sack FD (1997) Plastids and gravitropic sensing. Planta 203: S63-S68
Sanderfoot AA, Assaad FF, Raikhel NV (2000) The Arabidopsis genome. An
abundance of soluble N-ethylmaleimide-sensitive factor adaptor protein receptors.
Plant Physiology 124: 1558-1569
Sessions A, Burke E, Presting G, Aux G, McElver J, Patton D, Dietrich B, Ho P,
Bacwaden J, Ko C, Clarke J, Cotton D, Bullis D, Snell J, Miguel T,
Hutchison D, Kimmerly B, Mitzel T, Katagiri F, Glazebrook J, Law M, Goff
S (2002) A high-throughput Arabidopsis reverse genetics system. The Plant Cell
14: 2985-2994
Weigel D, Glazebrook J (2002) Arabidopsis: a laboratory manual. Cold Spring Harbor
Laboratory Press, Cold Spring Harbor, NY, pp 143-170
Wyatt S, Rashotte A, Shipp M, Robertson D, Muday G (2002) Mutations in the
gravity persistence signal loci in Arabidopsis disrupt the perception and/or signal
transduction of gravitropic stimuli. Plant Physiology 130: 1426-1435
66
Final Conclusions
Gravitropism is the growth of plant organs in response to the gravity vector. The
gravitropic response of a plant organ involves an external stimulus (gravity) perceived by
plant cells, a signal produced and transported to the responding tissue, and a response.
Current understandings of gravitropism have led to a model of the gravitropic response
pathway which has been broken into four steps: gravity perception, signal transduction, auxin redistribution and response. However, this is relatively simplistic. The pathway is much more complex and although many components are similar the mechanism for root and shoot gravitropism are not identical.
Based on my current understandings, I have proposed a detailed model for roots.
In roots, gravity is perceived in the root cap columella cells. Upon gravistimulation,
amyloplasts sediment in these gravity sensing cells. Amyloplasts trigger a signal
transduction cascade intracellularly in the columella cells which lead to auxin
redistribution (Fig. 18). The signal cascade leading to the response has many possible
2+ components such as Ca , vesicle trafficking, IP3, and pH changes. All of these components have been shown to be involved in root gravitropism. Auxin, which is synthesized in the shoot apex, moves in a cell to cell manner acropetally from the base of the shoot to the apex of the root tip through the vascular tissue into the columella cells via the AUX proteins, auxin influx facilitators, and the PIN efflux facilitators (Fig. 18). Once
auxin reaches the tip of the root, it moves from the columella cells via the other PIN
proteins basipetally from the tip of the root (Fig. 18). If gravistimulated, auxin transport
increases to the lower side of the root. This intracellular movement of auxin leads to an 67
accumulation of auxin in the elongation zone cortex and epidermis cells. Here the auxin signal is received. The TIR proteins, auxin receptors, interact with AUX/IAA, auxin transcription repressors (Fig. 18). The AUX/IAA proteins then undergo proteolysis. Once the AUX/IAA proteins are released, the ARF proteins, auxin response factors, initiate transcription within the nucleus of the cell that leads to inhibition of cell elongation on the lower side of the root causing a downward gravitropic bending response by the root.
Although there have been numerous studies conducted on roots, few have been
conducted on shoots. The root and shoot pathways have many components in common,
but other components must be different. Gravity is perceived by the “endodermal” cells
(inner most layer of the cortex referred to as the starch-sheath layer of cells) in the shoot
(Fig. 19). Upon gravistimulation, amyloplasts sediment in the endodermal cells leads to
2+ the intracellular signal transduction cascade. Although Ca , IP3, vesicle trafficking, and
pH changes have not been shown to be involved in the shoot, it is reasonable to think
they could be involved in shoot intracellular cascade. Auxin is synthesized by the shoot
apex and moves in a cell to cell manner basipetally from the apex to the base of the shoot
via AUX and PIN proteins in the vascular tissue (Fig. 19). The intracellular signal
transduction cascade leads to intercellular lateral auxin redistribution via the PIN3
proteins (possibly) from the vascular tissue through the “endodermis” to the cortex and
epidermis cells in the zone of elongation on the lower side of a gravistimulated shoot.
Again once the auxin signal is received, the TIR protein could interact with the
AUX/IAA proteins leading to AUX/IAA proteoylsis (Fig. 19). ARF’s would then be free
to proceed with transcription within the nucleus. However, auxin redistribution to the 68 zone of elongation leads to increased cell elongation on the lower side of the shoot
which causes the gravitropic upward bending of the shoot. Despite the similarities of
gravitropism in roots and shoots, how they lead to inhibition of cell elongation in roots and increased cell elongation in shoots is completely unknown. 69
Figure 18: Root Model. Auxin is shown in red. Vascular tissue is shown in dark green. Columella cells are light blue with dark blue amyloplasts and orange PIN and AUX proteins. The cortex and epidermis is light green. Zone of elongation cells are light blue and contain the TIR proteins along with other proteins involved in auxin regulation.
70
Figure 19: Shoot Model. Auxin is shown in red. AUX and PIN proteins are orange rectangles. Amyloplasts are light blue ovals. The nucleus is yellow. TIR proteins are purple. ARF and AUX/IAA are light blue circles.