This article isprotected bycopyright. Allrights reserved. Accepted Article *Address correspondence to: Sandra Cooper ([email protected]). ([email protected]). Cooper to: Sandra correspondence *Address Australia and Australia, 2006, locations. subcellular specific in events fusion vesicle mediating ferlins different Thus, type-Iandtype-II ferlins segregate asPM/late-endosomal or trans-Golgi/recyclingferlins, consistentwith PM. the into molecules otoferlin of rare incorporation or residence, membrane plasma brief either suggesting otoferlin PM of levels low very with cycling, to PM trans-Golgi shows also Otoferlin endosomes. recycling Rab11 compartment ofthe trans-Golgi/recycling endosome, cycling rapidlybetween this compartment and the PM via potential roles in the late-endosomal pathway. In contrast, Fer1L6 shows concentrated localization to a specific andmyoferlin are abundantly expressed at the PM and cycle to Rab7-positive late endosomes,supporting compartments. Studies of endosomal transit togetherwith 3D-structured illumination microscopy reveals dysferlin Fer1L6 areplasma membrane (PM)ferlins, whereas otoferlin and Fer1L5 localizepredominantly tointracellular specific expression, subcellular localization and endocytic trafficking of the ferlin family.Dysferlin, myoferlin, and cytoplasmic C2 domains, Ca Ferlinsare afamily of transmembrane-anchored vesicle fusion proteins uniquely characterized by 5-7tandem Abstract of Ca family ancient an are Ferlins Synopsis TCooper Sandra Whitchurch; Tu Lynne Sophocleous; Andrew Reece Redpath; Ian Michael Gregory ferlins. or trans-Golgi/recycling endosomal membrane/late Ferlinstissue-specific show expression andsegregate as plasma deafness due to defective Ca establishthat type-Iandtype-II ferlins segregate into late-endosomalrecycling and trans-Golgi compartments. andFer1L6, type-II ferlins,localise to dedicated recycling sub-compartments ofthe trans-Golgi network. We localiseto the plasma membrane and late endosomes,which display potential for occasional recycling. Otoferlin subcellular localizationandendocytic trafficking ofthe humanferlins. Dysferlinmyoferlin, and type-I ferlins, mutationsdysferlin in causemuscular dystrophy and otoferlin cause deafness. Wedetailthe tissue-distribution, defective Ca defective synaptotagminfamily. Inhumans, dysferlinmutations cause limb-girdle muscular dystrophy (LGMD2B) dueto Australia,NSW 2145, Sydney, Westmead,

3 2 1 Institute for Neuroscience and Muscle Research, Kid’s Research Institute, Children's Hospital at Microbial Imaging Facility, the ofUltimo, ithreeUniversity NSW2007, institute, Technology Sydney, Discipline of Paediatrics and Child Health,Faculty of Medicine, University of Sydney, Sydney, NSW article as doi: 10. differencesbetween version lead to this may been through the copyediting, typesetting, pagination andproofreading process, which This article hasbeen accepted for publication andundergone full peer review but has not

2+ -dependent, vesicle-mediatedmembrane repair and otoferlinmutations causenon-syndromic 1111/tra.12370 2+ 2+ -regulatedphospholipid-binding domainsthatregulate vesicle fusionthe in -triggered auditory neurotransmission. In this study, we describe the tissue- the describe we study, this In neurotransmission. auditory -triggered 2+ -binding,multi-C2 domain vesiclefusion proteins. thesix humanferlins, Of

and the Versionof Record. Please cite this rnbull; Cynthia B Cynthia rnbull;

This article isprotected bycopyright. Allrights reserved. Accepted Article defects in in Ca defects The unifying feature of ferlin animal models from invertebrates to humans, are pathologies linked specifically to conserved domains unique tothe ferlin familythat yet are to be structurally orfunctionallydefined (5). Fer1L4 and Fer1L6) are defined bythe absence of the DysF domain. All ferlins also contain Ferdomains, yeast, DysFdomain containing proteins regulate peroxisome size and number (4).Type-II ferlins (otoferlin, themolecule (three C2domains eitherside), anindependentlyfolding domain ofunknownfunction (2,In 3). of the centre in domain DysF the of presence bythe defined are Fer1L5) and myoferlin (dysferlin, ferlins Type-I reticulum; wheat germ agglutinin; isolated C2domains from dysferlin (10, 12, 13) and otoferlin (14) show properties of Ca of Studies (11). lipids charged negatively with interaction mediate to thought groove charged a positively possess C2 domains.Synaptotagmin-1 triggers synaptic vesicle fusion, and the crystal structures andCa two bear proteins fusion vesicle of family synaptotagmin The (6). structure sheet beta 8-stranded characteristic their multiple C2 domains (1).C2 domains consist of around 100 amino acids and fold into a conserved, electrostatic charges on the outer surface of C2A of surface outer the on charges electrostatic dysferlin 1exon leads to twovariant C2 of splicing alternate Interestingly, solved. been have C2A (11) otoferlin C2A (10) and ofdysferlin structures The (9). membrane with the target fusion for vesicle barrier theenergetic overcome shown to bind Ca C2B binds Ca binds C2B In synaptotagmin-1, (6, 7). well characterized been have domains C2 two the of properties phospholipid-binding cancer samples, where it is proposed to be a pseudogene (31, 32). 32). (31, pseudogene a be to proposed is it where samples, cancer in gastric downregulated and tissue stomach healthy in expressed is mRNA Fer1L4 30). (29, inmice disease muscle chronic and (24) adenocarcinoma ductal breast (28), adenocarcinoma pancreatic (27), carcinoma lung (26), biopsies cancer breast in upregulated is expression Myoferlin (25). velocity migration line cell cancer breast reduces and (24), receptors growth-factor of degradation subsequent and endocytosis reduces knockdown No disease-causing mutations have yet been identified in myoferlin, Fer1L4, Fer1L5 or Fer1L6. Myoferlin abo membrane cells, of inner hair C2A, and is likely to be Ca C2A domain functions as a a Ca as functions domain C2A (1). There are six mammalian mammalian six are There (1). fibres display a primary defect in Ca defect a primary display fibres muscle mouse knockout 2BDysferlin 16). (15, type dystrophy muscular limb-girdle cause in dysferlin Mutations classical C2 binding,though structuraldatawas not availableto demonstratewhether purifieddomains have assumed a profoundly deaf, and show a primary defect in Ca defect and a primary show deaf, profoundly cause aninherited form of profound,non-syndromic deafness (21,22). Otoferlin-knockoutmice arealso mutations otoferlin humans, In injury. membrane of sites at fusion vesicle mediating with dysferlin consistent (20), muscle skeletal zebrafish and (19) myotubes human in lesions membrane fill to appears and sites injury C2 domains (Ca domains C2 Ferlinsancient are an familyof vesicle fusion proteins characterized by theunique structure of5-7 cytoplasmic Introduction DYSF Abbreviations: exocytosis to ‘patch’ membrane wounds (18). Dysferlin-laden vesicles show Ca show vesicles Dysferlin-laden (18). wounds membrane ‘patch’ to exocytosis LAMP1 DDK loops that typically contribute to Ca Ca positive charge that enables loop insertion into negatively-charged phospholipid membranes (8). Insertion of 2+ -bound C2 domain loops into phospholipid membranes is proposed to induce membrane curvature and help help and curvature membrane to induce proposed is membranes phospholipid into loops C2 domain -bound : Flag epitope tag; : lysosomal associated membrane protein 1. 1. protein membrane associated : lysosomal GM130 β 2+ -sheet fold. 2+ -dependent vesicle fusion (reviewed (1)). Ferlinsare hypothesised to mediate vesiclefusion via in thetopinloop regionsbinding via a pocket ofconservedaspartic acid residues, acquiringa 2+ 2+ : Golgi matrix protein of 130 kDa; of 130 kDa; protein matrix : Golgi -regulated, phospholipid-binding domains), anchored by a C-terminal transmembrane domain or phospholipid membranes, consistentwith a structural difference observed oneinthe of top : dysferlin; : dysferlin; HEK293 3D-SIM 2+ -independent under physiological conditions (10). In contrast, otoferlin C2A was not not was C2A otoferlin In contrast, (10). conditions physiological under -independent 2+ ferlins - Fer1L1 (dysferlin), Fer1L1 ferlins - : human embryonic kidney 293 cells; -dependent, phospholipid-binding domain. In contrast, due to intrinsic positive lishing neurotrans : three-dimensional structured illumination microscopy; microscopy; illumination structured three-dimensional : MYOF 2+ coordination in other C2 domains (11). Therefore, otoferlin C2A does not not does C2A otoferlin Therefore, (11). domains C2 other in coordination 2+ A -dependent membrane repair (17), a process involving Ca involving process a (17), repair membrane -dependent domains. Structural and thermodynamic analyses indicate the canonical : myoferlin; : myoferlin; v1 mitter release to the auditory nerve (23). releaseto mitter nerve(23). the auditory PM: , this, domain appears asa structural mimicCa of TGOLN2 OTOF 2+ -dependent synaptic exocytosis fromthe basolateral Plasma membrane. membrane. Plasma Fer1L2 (otofe N : neuronal otoferlin; otoferlin; : neuronal : trans-Golgi network integral membrane protein2; IRES rlin), Fer1L3 (myoferlin) and Fer1L4-6. : ribosomeentry internal site; OTOF 2+ -regulated accumulation at Ub : ubiquitous otoferlin; otoferlin; : ubiquitous 2+ - and phospholipid phospholipid and - ER : endoplasmic : endoplasmic 2+ -triggered 2+ 2+ -bound -bound WGA - and :

This article isprotected bycopyright. Allrights reserved. Accepted Article (Figure 1A, OTOF, higher band asterisked), conferringa neuronal specific transmembranedomain (Otof al.,2009), regulated bythe inclusionexclusion or ofexon47(Figure 1B). expressed Exonis 47 onlybrainin et (Choi otoferlin for domains transmembrane ubiquitous and neuronal-specific confers splicing Alternate MYOF). Dysferlin andmyoferlin mRNAs are expressedubiquitously, detectedinall tissues analyzed (Figure 1A, DYSF, saturation. employing 30, 35and 40 cycles of amplification to provide a rudimentarystandard curve and tocontrolfor 3’ region theof gene (with one primerwithin the 3’ UTR). Resultsfrom the 3’ primer pair are shown inFigure 1, of the gene (with one primerwithin the untranslated5’ region, UTR,not shown) and a second pair amplifying the 5’ the region amplifying pair a ferlin, each for specific ofprimers sets two utilized We approach. PCR quantitative We investigated the expressionofeach of the sixmammalian ferlinsacross 12human tissues, using a semi- Tissue-specific expression of each ferlin in human tissues. Results locations. subcellular in specific events fusion vesicle mediating ferlins endosomes, whereas otoferlin and Fer1L6 are trans-Golgi/recycling ferlins. Our data is consistent with different with 3D-structured illuminationmicroscopy (3D-SIM (40)) reveal thatdysferlin myoferlin and transit lateto otoferlin and Fer1L5 predominantly localize to intracellular compartments. Studies of endosomal transit together human ferlinfamily. Weshow that dysferlin,myoferlin, and Fer1L6 are plasma membrane ferlins,whereas the of trafficking endocytic and localization sub-cellular expression, tissue-specific the we describe this study, In specific subcellular locations. at and tissues specific in cargo discrete involving events fusion vesicle mediate will ferlin each synaptotagmins the to analogous that hypothesise We 39). (38, cells islet pancreatic in fusion vesicle glucagon-containing containing vesiclesto synapses in nerves (10,36, 37),while synaptotagmin-VIImediates insulin-containingand neurotransmitter of fusion mediates Synaptotagmin-1 (35). compartments orsubcellular 34) (33, tissues specific in fusion vesicle mediating synaptotagmins different with members, thirteen are there family In the synaptotagmin referthisto otoferlin transcript as ubiquitousotoferlin (Otof is absent) is detectable in all tissues apart from skeletal muscle and kidney (Figure 1A, OTOF, lower band). We Interestingly,otoferlin mRNA bearing the alternate transmembranedomain encodedexon by 48 (where exon 47 membrane, and to trackendosomal retrograde trafficking. No commercial antibodiesare availableto the short plasma the at expressed is ferlin whether a to determine us allow tags epitope These ferlins. membrane plasma for extracellular or ferlins for intracellular luminal are which Fer1L6), and Fer1L5 otoferlin, myoferlin, for MycDDK other ferlins. We derivedferlin expression constructswith C-terminal epitope tags (MycHis for dysferlin or of localization subcellular precise the confirming studies no are there and (42), myoferlin for confirmed previously been has localization membrane (41). Plasma topology membrane to verify epitopes cytoplasmic and luminal using vesicles, endosomal to and membrane plasma the to localizes dysferlin that previously shown have We intracellular predominantly membra plasma are Fer1L6 and myoferlin Dysferlin, http://www.ncbi.nlm.nih.gov/IEB/Research/Acembly. http://www.proteinatlas.org; http://www.gtexportal.org; access; with open available recently data sequencing lung, liver,pancreas, thymus and colon (Figure 1A, L6). These expressiondata are consistentwith RNA in observed with levels lower stomach, and kidney inheart, highest is expression Fer1L6 esophagus). stomach, L5: 1A, 51 (Figure exon band excludes lower the whereas 51, exon includes band the upper pair; primer with 3’ the are observed bands doublet expressed, are of Fer1L5 levels where low esophagus, and stomach In C). 1B, (Figure Fer1L5 of domain luminal predicted the removing and 52 exon in early codon stop alternate an introducing frame-shift, +1 a in results to 52 50 exon from directly Splicing domain. transmembrane the for encodes 51 exon 1, isoform Fer1L5 In B). 1A, (Figure 51 exon removing spliced, alternately is pancreas the in expressed Fer1L5 Interestingly, L5. or Fer1L4 of expression absent or low showing generally analyzed tissues other with L5), 1A, (Figure pancreas the to restricted largely was expression Fer1L5 L4). 1A, (Figure stomach the in primarily observed was expression mRNA Fer1L4 ENSG00000088340). ENSEMBL 80307; Gene: (NCBI RNA coding as anon-protein isannotated Fer1L4 expression. of patterns restricted more L6 show L5and Fer1L4, Ub ). ). ne ferlins, whereas otoferlin and Fer1L5 are are Fer1L5 and otoferlin whereas ne ferlins, N ). This article isprotected bycopyright. Allrights reserved. Accepted Article 2B OTOF labeling of dysferlin and myoferlin vesicles for late endosomal marker Rab7,we observed only occasional co- nm). ~300 z-plane of single resolution 3D-SIM; B, 4A, (Figure organelles positive LAMP-1 observable lumenand range in sizefrom several hundred nanometers to>1micron -comparable into size the cell periphery(Figure 4B, SupplementaryFigure 2B). Dysferlin andmyoferlin endosomes havea clearly in also and region perinuclear the in within endosomes Rab7-positive withlarge co-localization strong showed consistently observedwith endosomal markers Rab5 andRab7 (Figure 4, Supplementary Figure 2). Myoferlin was co-localization prominent more However, 3). Figure TGOLN2-trans-Golgi; GM130-Golgi, (calreticulin-ER, membrane,we observed some co-localization of dysferlinand myoferlin with secretorypathway markers plasma the to with export Consistent 2D). (Figure cytoplasm and region perinuclear the within puncta Dysferlin and myoferlin show widespread labeling of the plasma membrane and bright labeling of vesicular notpresented. is this data therefore and compartments, labeled ferlin localization to peroxisomes using the peroxisome marker Pex-14. No human ferlin co-localized with Pex14 yeast DysF domain-containing proteins Pex30p and Pex31p localize to peroxisomes inyeast we (4) examined endosomes),Rab7 (late endosomes)LAMP1or (lysosomes) presented are Figures in the4, As 5,6and7. (early Rab5 network), trans-Golgi TGN38/46, as known (also TGOLN2 apparatus), (cis-Golgi GM130 reticulum), (endoplasmic calreticulin for markers subcellular with studies co-localization Detailed 2D). (Figure localization subcellular distinct a has ferlin each that shows constructs expression ferlin with our transfected fibroblasts Cos-7 and myoblasts C2C12 epithelia, HEK293 permeabilised and fixed of microscopy Confocal Different ferlinslocalize differentto compartments of thesecretorypathway. only lowlevels of otoferlin are present at the plasma membrane. In summary, dysferlin,myoferlin and Fer1L6are plasma membrane ferlins, Fer1L5an intracellular is ferlin,and withour flow cytometry and confocalmicroscopy results (Figure 2C). Fer1L5 are below the plane of the plasma membrane, consistentwith intracellular localizationand concordant and otoferlin neuronal and ubiquitous cells, permeabilised In 2C). (Figure proteins glycosylated WGA-labeled intercalatewith WGA, indicating that the ferlin C-terminus is in the sameplane of the plasma membrane as the theto plasmamembrane markerwheat germ agglutininIn (WGA).cells, live dysferlin,myoferlin Fer1L6 and nextWe used 3D-structured illuminationmicroscopy (3D-SIM) to compare the surface localization ofeachferlin (Figure 2B, 2B, OTOF (Figure with anti-Myc with cells live of labelling surface performed we membrane, plasma the target ferlins mammalian which determine To deriving such large expression constructs,we did not generatea Fer1L4 construct for localization studies. luminal domain (10-20amino acids) ofanyferlin. Basedthe on limitedexpression profile ofFer1L4 and difficulty coverslips.Confocal microscopy of live cells surface-labeledwith anti-Myc To confirm plasma membrane localization, transfected HEK293s used for flow cytometrywere also plated onto Figure 1A. Supplementary in displayed are data cytometry flow the of dot-plots Representative 1A). Figure Supplementary detectedtheat plasma membrane byflowcytometry (confirmed usingan anti-Flag binding curve shown in cell surface expression of Fer1L5, whereas low levels of the ubiquitous isoform of otoferlin (OTOF otoferlin of isoform ubiquitous the of levels low whereas Fer1L5, of expression surface cell 2A (Figure pellets cell in expression ferlin confirms day same the on performed transfected cells from duplicate samples inasingle experiment.Western blotting from replicatesamples and Fer1L6. Figure 2A Figure Fer1L6. and myoferlin to compared be directly cannot of dysferlin levels membrane plasma relative therefore tags, epitope compared to a MycDDKtag for myoferlin and Fer1L6. Anti-Mycmay exhibit different affinities for the different relative to the EGFP expressed from the same mRNA, over three experiments. Dysferlin has a MycHis tag, the expression vector. Figure 2A within (IRES) site entry ribosome internal the via EGFP of expression by gated were cells transfected and iodide, ofpropidium exclusion on based gated were cells live flow cytometry, 2).For (Figure intracellular predominantly Dysferlin, myoferlinand Fer1L6 are readilydetected the at plasma membrane,whereas otoferlin and Fer1L5 are cell types. For simplicity, onlyresults from HEK293 cells arepresented inFigure 2. transfected HEK293 epithelia and C2C12 myoblasts,with consistency of observations between these disparate L6).We observed weakly positive cell surface labelingforanti-Myc MYOF, DYSF, 2B (Figure EGFP expressing cells transfected in Fer1L6 and myoferlin dysferlin, of expression N , L5), consistent with flow cytometry results. with cytometry flow results. ,L5), consistent 647 647 (for flow cytometry) or anti-Myc or cytometry) flow (for Ub ). We could not detect plasma membrane labeling for Fer1L5 or neuronal otoferlin (Figure (Figure otoferlin neuronal or Fer1L5 for labeling membrane plasma detect not We could ). ii shows the normal distribution of surface-bound anti-Myc of surface-bound distribution normal the shows i shows flowcytometry quantification of levels of surface-bound anti-Myc 555 (for confocal microscopy) at 8 555 in cells transfectedwith ubiquitous otoferlin 555 confirmed robust plasma membrane iii ). Weobtained no evidence for o C for 90 mins.90C for studied We 647

Despite abundant co- abundant Despite amongthe poolof Ub ) can be be ) can 647 , This article isprotected bycopyright. Allrights reserved. Accepted Article Animation 1B). 3D-SIM resolves that otoferlin that resolves 3D-SIM 1B). Animation between the ubiquitous (OTOF localization sub-cellular similar a very observed We 5). (Figure TGOLN2 marker trans-Golgi with the overlap Otoferlin shows limited co-labelingwith ER markers, some co-labeling with GM130 andmore comprehensive Rab7-positive lateendosomes discretefrom LAMP1-positivelysosomes. large of apool label myoferlin and dysferlin Thus 2). Figure Supplementary and B, 1A Animation Supplementary LAMP1; B, 4A, (Figure cells Cos-7 and C2C12 in HEK293, LAMP-1 marker lysosomal the with labeling (Figure 8B,dysferlin and myoferlin). 3D-SIM clarified thatdysferlin and myoferlinwere within thelysosomal shows transit inRab7 late endosomes and eventual labeling of smalla population of LAMP-1 positive lysosomes 15– minutes) from 90 ranging experiments uptake antibody (using myoferlin and dysferlin of tracing Retrograde compartment. perinuclear a broader to traffic retrograde endosomes, Fer1L6 shows concentrated return to adistinct perinuclearcompartment and otoferlin undergoes cytoplasmic label myoferlin and dysferlin Specifically 2D). Figure with (compare ferlin each for staining specificmeans (Figure 8A, Fer1L5). Retrograde tracing experiments recapitulate features of totalintracellular controlfor specificity the of retrograde tracing approach, confirming anti-Myc antibodies are not taken up by non- to used was it membrane, plasma the at not is Fer1L5 As ferlin. each of representative trafficking endocytic whichbinds to the cell surface epitope tagand is co-endocytosedwith the ferlin. Figure 8A image depicts the 37°C, at with anti-Myc incubated were cells Live ferlins. membrane plasma for trafficking retrograde examine The C-terminal epitope tag onthe luminaldomain of our ferlin expression constructs allowsus to specifically ferlins. of the trafficking Endocytic GM130 (Figure 7), TGOLN2 orLAMP1 (data not shown), and its localization remains uncertain. markers andFer1L5were closelyassociated, but did not completelyoverlay. Fer1L5 also did not co-labelwith 7, calreticulin)or calnexin (data not shown) wasweak, byconfocal microscopyand 3D-SIM. Labeling for ER (Figure with calreticulin overlay forfluorescent evidence However, (ER). reticulum theendoplasmic represented likely this surmised we initially and microscopy by confocal reticular appears Fer1L5 of localization The panel). right 6D, (Figure endosome recycling and apparatus trans-Golgi the of sub-compartments specific left twopanels). FerL6 localization isrelatively unperturbedby brefeldin-A, consistent with FerL6 localizationto 6D, (Figure cell the throughout staining GM130 dispersing apparatus, Golgi the disrupts hours 2 for A treatment Brefeldin- (43). complex organization microtubule perinuclear the to collapses TGOLN2 while cytoplasm, and ER the throughout markers cis-Golgi disperses apparatus Golgi of treatment Brefeldin-A brefeldin-A. with apparatus endosome. Toconfirmthat Fer1L6 localizesto atrans-Golgi/recycling compartment,we disruptedthe Golgi recycling the labels which transferrin, endocytosed with co-localisation of degree high a shows Fer1L6 must beperformed with low laser power,whereby the plasma membrane labeling appears faint. imaging permeabilized cells,the intensityof labeling ofthe perinuclearcompartment is so greatthat imaging when 2B), (Figure membrane theplasma labels Fer1L6 although to that note It is important network. Golgi Fer1L6 (SupplementaryAnimation 1D), highlighting the interplaybetween theFer1L6 compartment and trans- (SupplementaryAnimation 1D).TGOLN2-positivevesicles present are within and in-between stacksthe of TGOLN2 confocalinset). 3D-SIM revealsthe Fer1L6 compartment consiststwo of connectedstacks 6A, (Figure compartment Fer1L6 in the is present staining TGOLN2 all, not but some, Conversely positive. TGOLN2 entirely not is but regions, positive TGOLN2 contains compartment Fer1L6 the z-plane, single a In panel). 6C, left (Figure envelope nuclear the to adjacent but from, discrete is compartment furrownucleusin a (Figure6B). Studies usingthe nuclear envelopemarker LaminA/C indicatethe Fer1L6 a induce to appears and expands compartment this where cells over-expressing highly to through nucleus, specific compartmentwas strikingin lesser-transfected which cells a show distinct, piercingadjacent spot theto TGOLN2 (Figure 6A,TGOLN2,3DSIM, Supplementary Figure 3). Concentratedlocalization Fer1L6 of tothis by co-labeled partially is that structure perinuclear distinct a to localization concentrated highly shows Fer1L6 yetsub-compartments. discrete associated data suggest otoferlinand TGOLN2 both localize to thetrans-Golgi network, butseparately label closely cytoplasmic face of the trans-Golgi whilestacks, TGOLN2 junctions of intersectingtubules (Figure 3D-SIM, 5, SupplementaryAnimation 1C). Otoferlin the resideson labels discrete segments of this tubular network,with directoverlay of each fluorescent signal observed at 3D-SIM image of the trans-Golgi network (Supplementary Animation 1C). Generally otoferlin and TGOLN2 each 3D-SIM). These intersecting tubuleswithin are the same z-planeand clearly apparentwithi Ub ) andneuronal ) isoformsotoferlin of (OTOF Ub and TGOLN2 co-label a web ofinterconnected tubules (Figure 5, residesonnuclear the side (Figure5, 3D-SIM). These N - shown - in Supplementary This article isprotected bycopyright. Allrights reserved. Accepted Article (EGFR) degradation,diminishing the cellproliferation response of epidermalgrowth factor (24).Myoferlin receptor growth-factor epidermal decreases cells cancer breast epithelial MDA-231 in knockdown Myoferlin typemyoblasts (44),implicating a forrole dysferlin inreceptortrafficking through the endo-lysosomalpathway. myoblasts, insulingrowth-factor receptor (IGFR) showsgreater accumulation within lysosomescompared wild-to dysferlin-null In maturation. or biogenesis lysosomal in role regulatory a mayplay dysferlin suggesting (44), pathway. Dysferlin null-myoblastshave double the number oflysosomes in comparisonwild-type to myoblasts the endo-lysosomal in myoferlin and for dysferlin roles functional supporting evidence ismounting There membrane of the endosomalvesicle as it matures. the within present been have or be intraluminal) would they (where bodies multivesicular via lysosome the at eventuated have ferlins two these whether illuminates it as localization this in interested specifically were We and lumen. membrane the lysosomal within both are present myoferlin and dysferlin At the lysosome, case. the was not this but lysosomes, within present be to dysferlin and myoferlin of proportion a greater expect dominant feature for myoferlin. The high levelof co-localizationwith late endosomal compartments lead usto aparticularly this is endosomes, late positive Rab7 co-label abundantly myoferlin and dysferlin both Although pathway. late-endosomal to the transit and membrane plasma the at expressed are myoferlin and Dysferlin (Figure 10). ferlins trans-Golgi/recycling are Fer1L6 and otoferlin while ferlins, membrane/endosomal plasma are myoferlin compartments of the secretory pathway. We establish theferlins fall intotwo distinct categories: dysferlin and to oneanother in different celltypes, our results stronglysuggest that different ferlinstarget different luminal domain of ferlins required totrace endosomal passage arenotavailable. Comparing each of the ferlins fibroblasts. Thoughwe acknowledge the caveat of overexpression systems, in thiscase, antibodies to the the human ferlin familyinthree celllines of different lineages (HEK epithelia, C2C12 myoblasts and Cos-7 In this study,we have characterized the mRNA expression, subcellular localization and endocytic trafficking of Discussion population en route tothe trans-Golgi. The precise endocytic pathway of otoferlin remains tobe elucidated. the trans-Golgi network,we could not detect evidence for co-transitwithin the same endosomal vesicle with otoferlin (anti-Myc) andanti-TGOLN2 showedthat although both proteins undergo retrograde transit backto labelingof peripheral vesicles positivefor Rab11a-GFP (data not shown).Furthermore, co-uptake experiments co- strong show not did otoferlin of tracing retrograde Fer1L6, to contrast in Similarly, 9). (Figure endosome also showed some overlay of a perinuclear compartment, suggesting these ferlins mayalso transit the recycling Retrograde tracing of otoferlin,myoferlin and dysferlin (with anti-Myc) togetherwith endocytosed transferrin occurring following additionanti-Myc of to the media for aslittle as 10 minutes (Figure 9B, Fer1L6). rapid, very is compartment endosomal recycling to the transit Fer1L6 compartment. endosomal recycling Fer1L6 compartmentthat we observe inboth intracellular staining andendosomaluptake represents the Rab11a (Figurewhite9B, arrows),transferrin uptake(Figure 9C) TGOLN2. and Therefore,webelieve the periphery (Figure 9B,Fer1L6 inset). Thus, Fer1L6 transitstoa larger perinuclear organelle co-labeledby experiments revealthat Fer1L6 shows abundant co-localizationwith Rab11a-endosomal vesicles in the cell tracing Endocytic endosomes. recycling Rab11a-positive with association showed Fer1L6 whether explored As ourevidence suggestsFer1L6 shuttles toand froma recycling sub-compartmentthe of trans-Golgistack, we structure/stack labeled by TGOLN2. Fer1L6 stacks areintimately associated with the trans-Golginetwork, but separate fromthetrans-Golgi vesicles in and compartmentof the trans-Golgi network (Figure 8B, Fer1L6, Supplementary Animation2D). TGOLN2 labels 8B, otoferlin; SupplementaryAnimation 2C). Retrograde labeling of Fer1L6 intensely highlights a specific sub- labeling of otoferlin highlights a trans-Golgi compartment closelyadjacent to, yet separate from, TGOLN2 (Figure retrograde 5), (Figure staining intracellular with total observed 8B).As (Figure apparatus trans-Golgi the to transit endocytic in results otoferlin and Fer1L6 with experiments uptake antibody myoferlin, and dysferlin to In contrast degradation. to way their on route this transiting merely than rather pathway, late endosomal the within roles dedicated may play myoferlin and intracellular staining and endocytic labeling (Figure 9A, Figure 4 Rab7). Collectively,results our suggest dysferlin staining,with co-localization of dysferlinand myoferlin to Rab7 positive organelles a predominant feature of both and Supplemental Animation 2A and B).Datafrom retrogradetracing was consistentwith total intracellular membrane of some LAMP-1 positive organelles and intraluminalwithin others (Figure 8B, dysferlinand myoferlin between Fer1L6 stacks, consistent with intracellular staining. 3D-SIM analyses confirm the the confirm analyses 3D-SIM staining. intracellular with consistent stacks, Fer1L6 594

This article isprotected bycopyright. Allrights reserved. Accepted Article the trans-Golgi Rab8b (48), consistent with our study. with our study. consistent (48), Rab8b trans-Golgi the with co-localizes cells HEK293 in expressed Otoferlin (54). cells hair inner in syntaxin-16 t-SNARE trans-Golgi the with co-localises otoferlin Endogenous studied. notspecifically were markers endosomal though observe, mousemyoblasts (51-53) and human breast cancer celllines(24); consistentwith the endosomal localizationwe in puncta cytoplasmic in and (27), (myoferlin) lines cell cancer and (50) epithelia lung in primary compartments Golgi GM130-positive in identified been also have myoferlin and Dysferlin (41). myotubes human primary previously shown dysferlin co-labels syntaxin-4-positive and caveolin-3-positive endosomes in C2C12 and Our data are broadly consistent with previously published reports of ferlin subcellular localisation. We have roles forotoferlin in the closelycoupled exocytosis and recyclingof synaptic vesicles in the cochlear. membrane.are Ours onlyanecdotal observations, but perhaps relevantto expanding evidence implicatingdual plasma at the otoferlin of residence transient only in resulting coupled, closely are otoferlin of endocytosis incorporation of otoferlin molecules into the plasma membrane,our datamight suggestthe exocytosis and experiments,given the verylow levelsof plasma membrane labeling. Perhaps rather than reflecting rare wereWe surprised to be able to effectively label the endosomal passage of otoferlin by antibody uptake basolateral plasma membrane compartments (23, 49). localisetheto Golgiapparatus (47),Rab8b-positive trans-Golgi compartmentsboth (48) andapical and cochlear (46). Otoferlin endogenously expressedwithin cochlear inner hair cells has previously been reported to otoferlin isoform bearing the transmembrane domain encoded by exon 48 that is expressed in the human in synaptic exocytosis (23) and synaptic vesicle recycling(45) in cochlear inner hair cells. It is thisubiquitous The trans-Golgi recycling features we identify for ubiquitous otoferlin are consistent with roles defined for otoferlin 10). (Figure membrane plasma the and network trans-Golgi the of sub-compartments different differentendocytic pathway. Thus, our data suggestsotoferlin and Fer1L6each recycle independentlybetween Rab11a/TGOLN2 recyclingendosomal compartment, otoferlin endocytoses to the trans-Golgi network viaa membranes. While Fer1L6 endocytoses via Rab11a-positive endosomes towhat we believe to be the compartment of the trans-Golginetwork that is immediately adjacent yetto, also distinct from TGOLN2-labeled to a localizes also Otoferlin biogenesis. its regulate may Fer1L6 suggesting nucleus, the deforms it that degree transferrin. Overexpression of Fer1L6appears to induceexpansion of this recycling compartmentto sucha compartmentthat ispartially co-labeled by TGOLN2 and Rab 11aand abundantlylabeled byendocytosed endosomal trans-Golgi/recycling the of region resistant a brefeldin-A to localization restricted and profound plasma membrane, only very low levels of otoferlin of levels low very only membrane, plasma the at expressed is abundantly Fer1L6 while However, networks. recycling and trans-Golgi to localise instead In contrast to dysferlin andmyoferlin, otoferlin and Fer1L6 show little labeling of endo-lysosomal organelles, and degradation. for exclusively lysosome the to trafficked being to opposed as trafficking, lysosomal to late-endosomal in roles functional to exert endosomes late Rab7 within primarily localised are myoferlin and dysferlin that We propose lysosome. to the cargo endosomal of transit regulates knockdown does not reduceEGFR endocytosis but prevents EGFRdegradation (24), indicating that myoferlin domain plays a role in endo-lysosomal targeting. Our study represents the first in-depth characterization of the the of characterization in-depth first the represents study Our targeting. endo-lysosomal in a role plays domain DysF the whether will explore now we and domain, the DysF to attributed yet been has Nofunction domain. Structurally,majorthe difference between type-I and type-IIferlins lies type-Iin ferlins possessinga DysF myoferlin, endo-lysosomal)and type-II (otoferlin and Fer1L6,trans-Golgi to plasmamembrane recycling)ferlins. and (dysferlin type-I between routes trafficking endocytic in split a discrete identified has study our In conclusion, presenting Fer1L6 as an interesting new marker of the TGN/recyclingendosome. data with our date, to co-localization sub-cellular Fer1L6 investigated have studies No locale. intracellular resolution 3D-SIM, nor other markers ofthe secretory pathway, and thus wewere unable to accurately refine its Fer1L5 stainingappeared reticular butdid not preciselyco-labelwith markersER calreticulinor calnexin byhigh lines cell three all In membrane. plasma to the ofexport for lack a basis as specifically were not explored proteins recycling protein EHD1 (56), C2C12 express EHD1and othermembers of the EHD family(53) and thus EHD endocytic the of absence in altered be can localization Fer1L5 and although Cos7, or C2C12 HEK293, in Fer1L5 machinery indifferent cell types. Importantly,we could find no evidence for plasma membrane expression of isoformexpressed (in ourcase human Fer1L5 NM_001293083.1) orintrinsic differences inthe trafficking intracellular localizationFer1L5 of in different modelsmay relate tothe antibodyemployed, the specific Fer1L5 not documented in primary myoblasts studied by the same authors (55, 56). Discrepancies between the precise FerL5 labeling near or at the plasma membrane reported in C2C12 (53), though this labeling pattern was also and appearsgener Fer1L5 is similarly reported to show labeling of fine cytoplasmictubules in mouseprimary myoblasts (55, 56), ally cytoplasmic in C2C12 (53). We did not ob not We did inC2C12(53). cytoplasmic ally Ub are detectable at the plasma membrane. Fer1L6 shows shows Fer1L6 membrane. plasma the at detectable are serve the same intense patches of endogenous endogenous patchesof intense the sameserve This article isprotected bycopyright. Allrights reserved. Accepted Article Coverslips were with Coverslips anti-mouse incubated incubated in the indicated organelle markerantibody diluted in blocking buffer at roomtemperature for 1.5 hours. Aldrich) (pH2.2) and fixed3%icecold in PFA.Cellswerepermeabilised with 0.1% saponin (Sigma Aldrich)and coverslip growth media. Following antibody incubation, coverslipswere acid-washed in 0.5 M glycine (Sigma (Sigma-Aldrich), 4 (Sigma-Aldrich), dishesFalcon).(BD Cos-7 were cellstransfected with Lipofectamine® 3000 (Life Technologies)3 cm in hours. Coverslips were incubated with with anti-mouse were incubated hours. Coverslips Cruz) anti-Myc and the indicated organellemarker antibody diluted in blocking buffer at room temperaturefor 1.5 (Santa mouse or (Abcam) inrabbit were incubated Coverslips forRab7). triton 0.3% or for LAMP1 saponin 0.2% Intracellular Staining: asabove. were mounted then Coverslips minutes. for 10 Antibody Endocytosis: Antibody above. HEK293 cells were transfectedwith calcium phosphate or PEI (polyethylenimine Max, Polysciences) in 10 cm Transfection with 15% FBS and 1:200 Gentamycin. Technologies) (Life DMEM/F12 1:1 in cultured were myoblasts C2C12 Technologies). (Life Gentamycin 1:200 and Technologies) (Life 10% FBS with Technologies) (Life DMEM in were cultured cells Cos-7 and HEK293 Culture Cell MaterialsMethods and proteins. fusion vesicle the different cellular cargo that may be regulatedby secretorythe andendocytic roles thisof ancient familyof expressionand subcellular localization for each ferlinfamily memberare important first steps tobeginaddress to recyclesto andfrom trans-Golgi a compartment via recyclingendosomes. Defining specific tissue-specific Fer1L6 and network trans-Golgi from the and to recycles otoferlin endosomes, late to membrane plasma the sub-cellular localizationand trafficking theof humanferlin family. We establish that dysferlinand myoferlintransit PEI transfection, 8.3 For cells. to dropwise to adding minprior 15 for temperature room at and incubated was mixed [Sigma-Aldrich]) removed from plates with Versene Ferlin-pIRES2EGFP transfected HEK293 cellswere trypsinised and replated for 2 hours. Cellswere then Cytometry Flow indicated. where (57) microscope illumination structured 3D V3 Blaze Microscopy: above. as mounted were then Coverslips minutes. for by 10 DAPI C2C12 myoblasts were transfected using GeneJuice® (Merck). For calcium phosphate, 100 100 phosphate, calcium For (Merck). GeneJuice® using were transfected myoblasts C2C12 rabbit (blocking buffer) (Life Technologies) at8°C for1.5 hours. Following blocking, coverslipswere incubatedanti-in Cell surfacestaining: Technologies). (Life reagent antifade Gold ProLong using mounted and Aldrich) (Sigma poly-D-lysine in coated LTD) Equipment Laboratory (TAAB coverslips glass thickness 1 Number on plated were cells protocols, immunocytochemistry all For Immunocytochemistry EGFPwere used to minimizethe effect ofRab over-expression on earlyand recycling endosomalpathways. addition to coverslips. For co-transfection of Rab5/11a-EGFP, 2.75 forminutes 5 at roomtemperature. 0.5 µgDNAwasadded andincubated for minutes, 10 followed bydropwise mixed were Opti-mem® µL of 50 and GeneJuice® µL 1.5 transfection, GeneJuice® For cells. to dropwise adding MEM®,3.75 µg of DNAand5 µL of P3000™ reagentand incubated at roomtemperature for5 minutes prior to µL Opti- of 125 mix towascontaining a master added and Technologies) medium (Life 125 µL Opti-MEM® of with mixed was reagent 3000 Lipofectamine® of µL 7.5 3000, Lipofectamine® For coverslips. to cells of transfer to prior 8hours for transfected were Dishes to cells. dropwise to adding prior min for 15 temperature room 555 diluted in block at 8°C for 1hour.Cells were then fixed in 3%PFA (Sigma Aldrich) andmountedas All microscopy was undertaken using a Leica SP5 confocal microscope, or on a DeltaVision OMX OMX or a on DeltaVision microscope, SP5 confocal a Leica using was undertaken Allmicroscopy μ g DNAand 100 μ L 1mg.mL

Coverslipswere incubated in rabbit anti-Myc (Abcam) diluted2%HBSS BSAin in Coverslips were fixed in 3% PFA and permeabilised in 0.15% triton (Sigma Aldrich) (or (or Aldrich) (Sigma triton 0.15% in permeabilised and PFA 3% in fixed were Coverslips

Rabbit or mouse anti-Myc was diluted in 37°C DMEM + 10% FBS and used to replace toreplace used and FBS +10% DMEM 37°C in diluted was anti-Myc mouse or Rabbit -1 PEI, 3 PEI, TM (Life Technologies) and pelleted. Cell pellets were resuspended in rabbit rabbit in resuspended were pellets Cell pelleted. and Technologies) (Life μ L of BES solution (50 mM BES, 280 mM NaCl, 1.5 mM NaHPO 1.5 NaCl, mM 280 mM BES, (50 BES solution L of μ 488 g DNA and 200 200 g DNA and and anti-rabbit 488 and anti-rabbit and μ L of0.9% NaCl (Baxter)was mixed and incubated at 594

for1 hour at room temperature, followedby DAPI 594 μ g of ferlin DNAand 250 ng ofRab5/11a-

for 1 hour at room temperature,followed μ L of 0.25 M CaCl 0.25 L of 2 dishes. 4 ⋅ 7H 2 O 2 2

This article isprotected bycopyright. Allrights reserved. Accepted Article anti-mouse with anMluI restriction site. A SacII MluI– fragment bearing the C-terminal domain of Otoferlin (NM_001287489.1)was derived via PCRof human braincDNA, with primers replacing theexon 48 stop codon pcDNA4-EGFP-Dysferlin ExpressionConstructs andCloning Technologies). 5a and exon 40a.). Myoferlin (NM_013451.3), Otoferlin BsrG1 andKpnI. The cDNAis dysferlin isoform 1 (NP_003485.1), thatwith is exon1,exon 17 andwithout exon Centre for Life, Newcastle upon Tyne, UK). The wasEGFP removedwith blunt religation following digestionwith anti-rabbit anti-Mycwithin HBSS 2%FBS for 1.5 hours at10°C.Cellswere then pelletedwashed, and and resuspended in Fer1L6 (NM_0010 Technologies); EGFP (1:250); Transferrin from human serum human from Transferrin (1:250); EGFP Technologies); Signaling (Cell 1:25 Rab7 Biological); (Novus 1:200 Calreticulin International); (Chemicon 1:500 Calreticulin Bioscience); (BD 1:250 GM130, Aldrich); Antibodies/Sigma (Prestige 1:1000 Pex14, Aldrich); Antibodies/Sigma (HybridomaBank); TGOLN2/TGOLN2,1:4500 (intracellular)1:250 or (endosomal uptake)(Prestige 1:100 4A3, LAMP1 Bank); (Hybridoma 1:100 1D4B, LAMP1 Cruz); (Santa (intracellular) 1:500 (uptake), 1:100 Rabbitanti-myc, 1:500 (surfaceandendosomal uptake),1:4000 (intracellular) (Abcam);mouse anti-myc9E10 Antibodies and Fluorescent reagents specificity. product to confirm Foundation Research Genome All PCRproductswere excised, purified (QiaexII Gel Purification Kit, Qiagen) and sequencedby theAustralian Rev:CCAAGAAGGGTTGATCTGTCC. Fer1L6 Fer1L6 Fwd: CTGTTGGAAAAGCCCGAAAG, Fer1L5 Rev:GTTGGTAGCAGGAGGAAAGC. Fer1L5 Fwd: CTGGAGATTCTGTCAGAGAAGG, Fer1L4 Rev: GGGTGAGTGTCCAAGGTCAG. Fer1L4 Fwd: AAAGCAGAGGAGGAGGAAGG, Myoferlin TGCAAACGTTGCTTGTTGG. Rev: Myoferlin Fwd: CATGAACCCCAAGCTGGAC, AAGCCACTGAAAGGAAATGC. Rev: Otoferlin Fwd: AGGCAGAGAAGAACCCAGTG,Otoferlin Dysferlin GCCTAGGAGGTCTGGAGGAG.Rev: Dysferlin Fwd: CAAGCTGGAAATGACCTTGG, synthesized by Sigma-Aldrich. and 3.0 Primer using ferlin each of 3` to the were designed Primers Gut Panel). and Panel Immune 1, Panel GAPDH) using Taq DNA polymeraseTechnologies). (Life was cDNA sourcedfrom Clontech (Human MTC wasPCR carried out for 30,35 and40 cycleswith 58°Cannealing and 40second extension(70 secondfor Polymerase ChainReaction Healthcare). (Thermo-Fischer Scientific) for 2 hours atroom temperature.were Blots developed using ECL reagent (GE Tween-20 (block) andincubated inprimary antibody at 4°Covernight, then HRP-conjugated secondaryantibody was transferredontoPVDFmembrane (Merck-Millipore).Membranes wereblocked in5%skimmilk inPBS+ Protein Technologies). gel (Life SDS-PAGE a 4-12% on separated and buffer RIPA in were lysed pellets Cell Blot Western software. Diva with FACS flow cytometer LSRII aBD using were measured cells which following Technologies), (Life iodide propidium with 1:200 in HBSS resuspended and agglutinin (WGA) analysis was undertaken using Graphpad Prism. Prism. Graphpad using undertaken was analysis statistical and Graphing (59). plugin 3D viewer FIJI the and FIJI (58) using were processed images All 3D-SIM Image Processing and StatisticalAnalysis studies. detection membrane plasma for EGFP pIRES2 into were sub-cloned constructs ferlin All pCMV-OtoferlinNeuronal. into 647 488 (Life Technologies) in HBSS with 2% HBSS for1ho in FBS Technologies) (Life , 1:200 (Life Technologies); anti-mouse Technologies); (Life 1:200 , 488 39112.2) were purchased in the pCMV6 My in the pCMV6 were 39112.2) purchased 1:500 (Life Technologies); 4',6-diamidino-2-phenylindole (DAPI)1:5000 (Life Technologies); MycHis

was agenerous giftfrom Kate Bushby (Instituteof HumanGenetics, International 594 Neuronal Neuronal , 1:200 (Life Technologies); anti-rabbit Technologies); (Life 1:200 , 594 (NM_194248.2), Fer1L5 (NM_001293083.1) and and (NM_001293083.1) Fer1L5 (NM_194248.2), , 100 µg.mL ur at 10°C. Cells were again pelleted, washed werepelleted, again Cells at 10°C. ur cDDDK vector from Origene. Otoferlin vector from cDDDK -1 (Life Technologies), Wheat germ germ Wheat Technologies), (Life Ub was subcloned 647 , 1:200 (Life Ubiquitous

This article isprotected bycopyright. Allrights reserved. Accepted Article (G.R.). funding award postgraduate for Sydney of University the and (S.T.C.) Foundation the Jain S.T.C.), Research Council (ProjectGrant APP1048814 to S.T.C.;Career DevelopmentFellowship APP1048816to Medical and Health National Australian work: the our for supporting bodies funding the following acknowledge We advice. technical and constructs Rab expression his for Rodriguez Folres- Neftali Dr. thank We assistance. confocalmicroscopy, andthe Children’s Medical Research Institute Flow CytometryFacility fortheirtechnical with assistance technical for Facility Imaging Cell Hub Research atthe Westmead Cantrill We Laurence thank Acknowledgments This article isprotected bycopyright. Allrights reserved. Accepted Article DFNB9.The American JournalHumanof Genetics 2000;67(3):591-600. Yasunaga Si, Grati Mh, Chardenoux S, Smith TN,Friedman TB,Lalwani AK, Wilcox ER, PetitC. OTOF Encodes Multiple Long and ShortIsoforms: Genetic Evidence That the Long Ones Underlie Recessive Deafness 22. 1999;21(4):363-369. Genet Nat deafness. El-Amraoui M, Cohen-Salmon Mh, Grati Si, Yasunaga Petit C.mutation A in OTOF, encoding otoferlin, aFER-1-like protein, causes DFNB9,a nonsyndromic formof 21. Roostalu U, Strähle U. In Developmental2012;22(3):515-529. Cell Vivo Imaging of Molecular Interactions at Damaged Sarcolemma. 20. Membrane Repair. Journal The Neuroscienceof 2013;33(12):5085-5094. KN, CB, North Whitchurch L, A-K, Turnbull Lueders GMI, Redpath FA, Lemckert FJ, Evesson Lek A, CooperCalpains, ST. CleavedMini-DysferlinC72, andL-TypeChannels UnderpinCalcium-Dependent Muscle 19. Steinhardt AldertonBi G, membrane R,J.Cell resealingvesiculara by mechanism similarto 1994;263(5145):390-393. Science release. neurotransmitter 18. BansalMiyake D, K, Vogel SS, Groh S, ChenC-C, Williamson R,McNeil PL,Campbell KP. Defective membrane repair in dysferlin-deficient muscular dystrophy. Nature 2003;423(6936):168-172. 17. 1998;20(1):37-42. NatGenet 2B. type dystrophy muscular in limb-girdle mutated is fer-1 factor spermatogenesis elegans Bashir R,Britton S,Strachan T, Keers S,VafiadakiE,Lako M, Richard MarchandI, Bourg S, Argov N, Z, SadehMahjneh M, Marconi I, G, Passos-Bueno MR, MoreiraEdS 16. inMiyoshi myopathy and limb girdle muscular dystrophy. Nat Genet 1998;20(1):31-36. 5 Liu J, Aoki M,Illa I, WuFardeau C, M, Angelini C, SerranoC, Urtizberea JA, Hentati F, Hamida MB, Oeltjen J K, AA,Bossie EJ, Amato S, Culper Bohlega 15. 2014;53(30):5023-5033. Biochemistry Domains. PadmanarayanaM, HamsSpeight N, LC, PeterssonMehlRA, EJ, JohnsonCP. Characterizationthe of LipidBinding PropertiesofOtoferlin Reveals SpecificInteractions between PI(4,5)P2 and the C2C and C2F 14. 2384. TherrienFulvioC, Di S,PicklesS, Sinnreich CharacterizationM. ofLipid BindingSpecificities of DysferlinC2Domains Reveals Novel Interactionswith Phosphoinositides†. Biochemistry2009;48(11):2377- 13. AbdullahN, Padmanarayana M,Marty NJ, Johnson CP.Quantitation ofthe calcium and membrane 2014;106(2):382-389. journal Biophysical dysferlin. of domains the c2 of properties binding 12. Helfmann S, Neumann P, Tittmann K, Moser FicnerT, ReisingerR, E. The Crystal Structureofthe C2A Domain of Otoferlin Reveals an Unconventional Top LoopRegion. JMol Biol 2011;406(3):479-490. 11. membrane repair. Structure 2014;22(1):104-115. Fuson K, Rice A,Mahling R, Snow A, Nayak K, Shanbhogue MeyerP, AG, Redpath GM, Hinderliter A, CooperAlternate ST. splicing of dysferlinC2A confersCa 2+-dependent and Ca2+-independentbinding for McMahon HT, KozlovMM, Martens S. Membrane Curvature10. in SynapticVesicle Fusion and Beyond. 2010;140(5):601-605. Cell Chapman ER, Davis AF. DirectInteraction of a Ca2+-binding Loop of Synaptotagmin9. with Lipid Bilayers. 1998;273(22):13995-14001. Chemistry Biological of Journal Xue M, MaC,Craig TK, Rosenmund8. C, Rizo J. The Janus-Faced Nature of the C(2)B Domain Is Fundamentalfor Synaptotagmin-1 Function. Nature structural & molecular biology 2008;15(11):1160-1168. Sutton RB, Davletov BA,Berghuis7. AM, Sudhof TC, SprangSR.Structurethe of first C2domain of synaptotagminI:A novel Ca2+/phospholipid-bindingfold. Cell1995;80(6):929-938. eukaryotic ancient reveals genes ferlin of analysis Phylogenetic S. Cooper K, North M, Lek LekA, 6. 2010;10(1):231. Biology Evolutionary BMC origins. 5. YanRachubinskiM, JoshiRachubinskiDA, S, RA, SubramaniS. Dysferlin Domain-containing Proteins, Peroxisomes inPichia pastoris. Molecular biologytheof cell 2008;19(3):885-898. Pex30p and Pex31p, Localized to Two Compartments, Controlthe Number and Sizeof Oleate-induced DysF inner Dysferlin human the of structures Crystal NH. Keep C, Orengo C, Yeats AR, Cole SulaA, 4. 2014;14(1):3. biology structural BMC domain. 3. Patel P,Harris R,GeddesSM, Strehle E-M,Watson JD, Bashir 2008;379(5):981-990. R,Bushby Biol Mol K,Driscoll2b. J PC, KeepNH. type dystrophy muscular girdle limb for and implications of myoferlin domain DysF theinner of structure Solution auditory for fusion vesicle of regulators Ferlins: ST. Cooper KN, North RB, Sutton FJ, Evesson LekA, 2. trafficking receptor and me neurotransmission, 1. References: mbrane repair. mbrane repair. Traffi , etal. Dysferlin, a novel skeletalmuscle gene, ismutated A, Mustapha M, Salem N, El-Zir E, Loiselet J, J, E, Loiselet N, El-Zir M, Salem Mustapha A, c 2012;13(2):185-194. c 2012;13(2):185-194. , etal. A gene related to Caenorhabditis Caenorhabditis to related gene A This article isprotected bycopyright. Allrights reserved. Accepted Article 2011;20(4):779-789. 2011;20(4):779-789. DemonbreunAR, FahrenbachDeveaux JP, K, Earley JU,Pytel McNally P, Impaired EM. muscle growth Genetics Molecular Human dystrophy. muscular in 1 dysferlin-mediated factor growth toinsulin-like and response 44. ReavesB, Banting G. Perturbation of themorphology ofthetrans-Golgi network following Brefeldin A 1992;116(1):85-94. Biol Cell J TGN38. protein, membrane integral TGN-specific a of redistribution treatment: 43. endothelial in endocytosis for critical is Myoferlin WC. Sessa P, Kodaman A, Sharma PN, Bernatchez 2009;297(3):C484-C492. Physiology Cell - Physiology of Journal American cells. 42. 2010;285(37):28529-28539. Chemistry of Biological Journal Pathway. associated Evesson FJ, Peat RA, Lek A, Brilot LoF, HP, Dale RC, Parton RG, North KN, Cooper ST.Reduced PlasmaMembrane Expression of DysferlinMutants Is AttributedtoAccelerated EndocytosisviaaSyntaxin-4- 41. Biophysical journal 2008;94(12):4957-4970. JW. Sedat DA, WZ, Agard Cande IN, CJR, Golubovskaya PM, Wang Carlton L, Shao MGL, Gustafsson Illumination. Structured by Microscopy Fluorescence Wide-Field in Doubling Resolution Three-Dimensional 40. 6):1169-1178. 2009;587(Pt Physiology of W. Han TC, Südhof P, Rorsman GK, Radda Q, Zhang Y, Lao DN, Hoang S-H, Wei N, Gustavsson Synaptotagmin-7 is aprincipal Ca(2+) sensor forCa(2+)-induced glucagon exocytosis inpancreas. The Journal 39. 2001;114(9):1709-1716. Gut A, KiralyCE, Fukuda M, Mikoshiba K, WollheimLang CB, J. Expression and localisation of ( endocrine in isoforms synaptotagmin 38. 2009;106(38):16469-16474. Sciences to binding Ca2+ of functions convergent but Differential TC. Südhof J, Rizo Xu J, Shin O-H, synaptotagmin-1 C2 domains mediate neurotransmitter release. Proceedings of the National Academy of 37. Nishiki T-i, Augustine GJ.Synaptotagmin I synchronizes transmitter releasemousein hippocampal 2004;24(27):6127-6132. Neuroscience of Journal The neurons. 2002;277(10):7629-7632. Chemistry Biological of Journal Many? So Why Synaptotagmins: TC. Südhof 36. Gauthier BR, Wollheim CB. Synaptotagmins bind calcium to release insulin; 2008. 35. 34. Hudson AW, Birnbaum MJ. Identification of a nonneuronal isoform of synaptotagmin. Proceedings of the 1995;92(13):5895-5899. of Sciences Academy National 33. Dysferlin RH. Brown LS, Krivickas A, R,Boyle Bronson G, K,Krishnan Newton LE, Glover overexpression in skeletal muscleproduces aprogressive myopathy.Annals of Neurology 2010;67(3):384-393. 32. 2013;11(1):225. RNA non-coding Long J. Guo Y, Xi B, Xiao T, Xia S, Zhang Z, Liu X, Ye Ding G, W, Sun H, Song Medicine Translational of Journal significances. clinical its and cancer gastric human in profile expression 31. 2010;123(14):2413-2422. DemonbreunAR, Lapidos KA, Heretis K, LevinDale S, R,Pytel P, SvenssonEC,McNally EM. Myoferlin regulationmusclein by NFAT injury,regeneration and repair. Journalof Cell Science 30. of modifier potential and gene acandidate Myoferlin, EM. McNally CT, Ly AJ, DB, Delmonte Davis musculardystrophy. Human Molecular Genetics2000;9(2):217-226. 29. Proteomics 2013;91(0):453-465. JinD-Y, L-X, W-H, Lou Liu X-H, Liu W-S, Wang of Journal adenocarcinoma. inpancreatic predictor prognostic as a novel myoferlin reveals proteomics 28. 2013;182(5):1900-1909. Pathology LeungYu C, C, Lin MI, Tognon C, Bernatchez P. ExpressionMyoferlin of in Human and Murine of Journal The American Tumorigenesis. and Proliferation, Cell Repair, Membrane in Role Tumors: Carcinoma 27. 2004;64(3):844-856. Research Cancer Genes. Tumor-Specific Identify to and Microarrays Subtraction Amatschek S, Koenig U, Auer H, Steinlein P, PacherGruenfelderM, A, Dekan G, Vogl S, KubistaE, cDNA Using Profiling Expression Tissue-Wide W. M,Sommergruber Schreiber C, Stratowa K-H, Heider 26. Migration. PLoS 2014;9(2):e86110.ONE Volakis LI,Li R, Ackerman WEIV, Mihai C, BechelM, Summerfield TL, Ahn CS, Powell HM, Zielinski R, Collective towards Motility Cell Cancer Breast Redirects Myoferlin of Loss DA. Kniss SN, Ghadiali TJ, Rosol 25. Research 2013;73(17):5438-5448. Turtoi A, BlommeA, BellahcèneA, Gilles C,HennequièreV, PeixotoP, Bianchi E, Noel A, De PauwE, Cancer Cancer. Breast in Activity ofEGFR Regulator aKey Is Myoferlin V. Castronovo P, Delvenne E, Lifrange 24. Exocytosis at the AuditoryRibbon Synapse. Cell 2006;127(2):277-289. Roux I, SafieddineNouvian S, R, GratiMh, Simmler M-C, BahloulA, Perfettini I, Le Gall M, Rostaing P, Hamard G,Triller A, AvanMoser P, T, PetitC. Otoferlin, Defective in aHuman Deafness Form,Is Essentialfor 23. β )-cells: their function in insulin exocytosis. Journal of Cell Science Science of Cell Journal exocytosis. ininsulin function their )-cells: Yang P-Y, Wang X-L. iTRAQ-based quantitative quantitative iTRAQ-based X-L. Wang Yang P-Y, This article isprotected bycopyright. Allrights reserved. Accepted Article for API visualization 3D high-level M. A M, Heisenberg Longair A, Cardona J, Schindelin B, Schmid 2010;11(1):274. Bioinformatics BMC ImageJ. and Java 59. platform for biological-image analysis. Nat Meth 2012;9(7):676-682. Schindelin J, Arganda-Carreras I,Frise E,Kayn P Tomancak K, V, Eliceiri Hartenstein DJ, White J-Y, Tinevez B, Schmid S, Saalfeld 58. Cytokinesis. PLoS Biol 2012;10(9):e1001389. Resolution Super EJ. 3D-SIM Harry LG, Monahan CB, L, Whitchurch Turnbull ATF, MP, Liew Strauss MicroscopyReveals aBead-Like Arrangement for FtsZ and theDivision Machinery: Implications for Triggering 57. 2014;387(2):179-190. Biology Developmental development. PoseyJr AD, Swanson KE, AlvarezMG, KrishnanEarley S, JU, Band H,Pytel P,McNally EM, Demonbreun AR. EHD1 mediates vesicle trafficking required for normal muscle growth and transverse tubule 56. ferlin- promotes GRAF1 JM. Taylor CP, Mack EM, McNally X, Xiao J, Li AL, Becherer KC, Lenhart dependent myoblast fusion. Developmental Biology 2014;393(2):298-311. 55. 2014;205(4):591-606. ReveloD, NH,Kamin Truckenbrodt S,WongRe AB, super-resolutionprobe for imaginew 54. 2011;286(9):7379-7388. Chemistry Biological of Journal EM. McNally H, M, Band M,George AR, Rainey Demonbreun K, P, Gardikiotes Pytel AD, Posey Endocytic Recycling Proteins EHD1Interact andEHD2 with Fer-1-like-5 (Fer1L5) andMediate Myoblast Fusion. 53. Chemistry 2008;283(29):20252-20260. Doherty KR, Demonbreun AR, Wallace GQ, Cave A, PoseyAD, Heretis K, Pytel McNallyP, EM. The Biological of Journal fusion. myoblast to regulate with myoferlin interacts EHD2 protein recycling endocytic 52. Doherty KR, Cave A, Davis DB, DelmonteAJ, PoseyA, Earley JU,Hadhazy M,McNally EM. Normal myoblast fusion requires myoferlin. Development2005;132(24):5565-5575. 51. Epithelium Airway Human in Myoferlin of Expression T-L. Hackett P, Bernatchez F, Shaheen C, Leung 2012;7(7):e40478. ONE PLoS Expression. Occludens-1 Zonula and Adhesion Cell in Role Its and 50. Ca2+ channels. The Journaland of NeuroscienceI type 2014;34(33):10853-10869.vestibular of machineries Exocytotic D. C, Dulon Petit S, Y, Safieddine Bouleau PF, Vincent cochlear ribbon synapses displaysimilar intrinsicotoferlin-dependent Ca2+ sensitivitybut adifferent couplingto 49. deafnessform. HumanMolecular Genetics 2008;17(23):3814-3821. GTPase, Rab8b N. M, Blin Knipper M, Pfister P, Ruth CM, Pusch A, Breß U, Zimmermann P, Heidrych a protein transport regulator, is an interacting partner of otoferlin, defective in a human autosomal recessive 48. 2006;24(12):3372-3380. Neuroscience of Journal European H,Knipper M, Kalbacher N, Pfister Blin P, Ruth H, Winter J, Engel U, Zimmermann C, Braig N, Schug the of rat. cochlea mature and immature system, brain, vestibular in otoferlin of expression M. Differential 47. genetics 2009;75(3):237-243. ChoiBY, Ahmed ZM,Riazuddin S, BhinderM, ShahzadM, Husnain T,GriffithFriedman A, T. Identities andfrequencies mutationsof the ofotoferlin gene (OTOF) causing DFNB9 deafness inPakistan. Clinical 46. replenishmentof synaptic vesicles JS, Bailey hair in LM, cells. Tarantino Nat T, Frank NeurosciD, Riedel 2010;13(7):869-876.M, Schwander H, Takago K, Reuter L, Lasarow T, Pangrsic efficient otoferlin-dependent requires Hearing T. Moser E, Reisinger U, Brose N, Muller N, Strenzke 45. ng of membranes elucid ng of ig V, Longairig V, M, Pietzsch T,PreibischRueden S,C, uter-Jessen K, Reisinger E, Moser T, Rizzoli SO. A A SO. Rizzoli T, Moser E, Reisinger K, uter-Jessen ates trafficking pathways. J Cell Biol Cell Biol J traffickingpathways.ates , et al. Fiji: an open-source open-source an Fiji: This article isprotected bycopyright. Allrights reserved. Accepted Article panels ( panels Figure 1 alternate otoferlin isoform affecting Hy with a positiv p p C C e e b b - erladder I (8 erladder isoform are are isoform : Expressio : the transme the splicing of ot of splicing lontech MTC lontech control,and elow. Align elow. m m m n u o o 0 Panel I, Imm I, Panel water only n water ents were p nderlined. of ferlins ferlins of ferlin and Fe 0, 600, 400 brane doma brane C i e une Panel an Panel une - r1L5 affect th affect r1L5 erformed wit ins of otoferli n human c human n and 200bp Schematic Schematic gative contr D b o h e d of otoferlin a of otoferlin n and Fer1L n and NA panels. ands are pr are ands ls included f included ls ClustalW. transmemb Gut Panel) Panel) Gut T 5 5 r e o f f n nd Fer1L5 p ane domains or 30, 35 35 and or 30, A , with the , with the tr he predicte he sent). r each prim each r - Eachferli B- S c d e a a r . hematic of a n was amplif 40 cycles. G 40 cycles. transmembr r setfor 40c otein structu otein nslated prot nslated e r A l ied from hu ane domains ane domains ycles. Gels a es demonstr es in sequence ternate-splici PDH was a m m s n a r an cDNA for each each for e flanked e flanked g events plified as as plified ting how how ting for each for each

This article isprotected bycopyright. Allrights reserved. Accepted Article

This article isprotected bycopyright. Allrights reserved. Accepted Article each ferlin. Confocal images are presented as single Z-sections. Z-sections. single as are presented images Confocal ferlin. each (bottom panel) cells transfectedwith each ferlin expression construct revealsa unique subcellular localizationfor C2C12 and panel) (middle Cos-7 panel), (top HEK293 permeabilised and fixed of labeling intracellular total of below. membrane basolateral the and above membrane apical with the y-z planes single intracellular staining offixedand permeabilised cells (Right; OTOFUb, OTOFN andFer1L5). Images shownare 3D-structured illuminationmicroscopy (3D-SIM) of live su abundantly expressed at the cell surface. Otoferlin surface. cell atthe expressed abundantly consistentwith flow cytometry results. Imageswere captured using a Leica SP5 confocal. Scalebars: 10 SDS-PAGE and transferred and transferred SDS-PAGE by separated was assay, by BCA as determined lysate, RIPA HEK293 transfected of µg 10 expressed. is ferlin vector –7.38%. –25.5%, Myof –14.6%, Fer1L5 –25.5%, Fer1L6 –6.69% andOtofN– 11.7, %, OtofUb10.2%, – control pIRES single experiment. The transfection efficiency calculated by the GFP-positive gatewith flow cytomterywas: Dysf dissociated from the platewith Versene and labelledwith anti-Myc ribosome entry site (IRES) separately co-translates andEGFP the ferlin from the same mRNA. Live cells were internal tag. The Myc aluminal bearing ferlin mammalian each expressing constructs with pIRES transfected membrane expressionof each ferlinin transfected HEK293 cells quantified by flow cytometry. A ferlins. membrane plasma are Fer1L6 and myoferlin Dysferlin, 2: Figure neuronal isoform of otoferlin of isoform neuronal Myc solutionwith (HBSS 10% FBS).Live cellswere gated byexclusion of propidium iodide and surface boundanti- in duplicate. in duplicate. performed replicates experimental three of S.D. represent Error bars controls. vector-only of staining non-specific subject to surface labeling with anti-Myc (Alexa anti-Myc with labeling surface to subject Alexa647 Alexa647 is plottedis relativeto the EGFP fluorescence foreach sample.The dashed line indicates background ii) The normal distributionof surface anti-Myc iii)

Westernblot of samples probedwith anti-Myc fromthe same experiment confirmingeach onto PVDF membrane. membrane. PVDF onto N and Fer1L5 are not present at levels above background at the plasma membrane, membrane, plasma the at background above levels at present not are Fer1L5 and 555 Ub B- B- is detectableat lowlevels onthe cell surface,whereas the ). Microscopy shows dysferlin, myoferlin and Fer1L6 are are Fer1L6 and myoferlin dysferlin, shows Microscopy ). Additional cellsfrom were‘A’ replated onto coverslips and rface-stained cells (Left;MYOF, DYSF,Fer1L6), total or Alexa647 labelingobserved in duplicate samples from a Alexa647 at 8°C for 90 minutes in blocking blocking in minutes atfor 90 8°C i)

Histogram showing the plasma plasma the showing Histogram D) D) Confocal microscopy microscopy Confocal

HEK293 cellswere μ M. C) C) This article isprotected bycopyright. Allrights reserved. Accepted Article the speci the Alexa re-plated markers Figure 3 (blue). S (GM130) 488

c . : ortrans-Gol onto covers ficity of ficity labeli false coloure false HEK293 cel HEK293

ale bars: 10 10 bars: ale Total intra Total c g n l d l s were were transf s labeli ellular ips overnigh ips μ i (TGOLN2) i (TGOLN2) g by theg byanti red) and c and red) M. Untrans o t - f e ng for dysfe ng for (Alexa . Cells were . Cells ected cells cells ected Myc antibod -stained with cted with dy 488 OR w w y y r s s . ithin imaged imaged ithin lin Alexa fixed, perme fixed, ferlin and m and ferlin markers for MycHis 594 (A) fals y a e abilised and and abilised the endoplas the fields arelab fields oferlin expre nd myoferli coloured gr coloured s s n e m e e labeled with sion constru sion MycFlag en). Nuclei led with an with led an ic reticulum reticulum ic (B) w (B) c w a ith secretor anti-Myc (Al ts (lacking E ts (lacking (calreticulin), ere labeled labeled ere sterisk, dem

y e G w o pathway pathway cis-Golgi xa FP) then FP) then nstrating ith DAPI 594 OR OR This article isprotected bycopyright. Allrights reserved. Accepted Article endoso co-l and transfect (lacking pathwa Figure m m y y 4 4 e e abeled with abeled EGFP) and and EGFP) markers. : Totalintra es (Rab7) or or (Rab7) es d with

Rab5 H - replated ont replated cellular labe lysosomes (L markers for for markers EGFP andEGFP d EK293 cells o y A ling of dysf of ling coverslips early endos early were transf were sferlin/myof MP1) (gree MP1) e e e n e o o o rlin. Dysferlin Dysferlin rlin. cted with with eit cted ) to delineate rlin vernight. Fo mes (in Ra (in mes MycHis (A) r her dysferlin b5-EGFP co b5-EGFP the endo-lys the and myofe detection o detection and myoferli r o - n f earlyendo lin transfected transfected or myoferlin myoferlin or somal pathw were detec were MycFlag (B) s c s c t t a a ed with anti- with endo-l with omes, cells cells omes, ells, anti-E ells, expression y. Scale bar G y y M c s FP), late FP), late were co- were onstructs onstructs sosomal sosomal : 10 : 10 yc (red), yc (red), μ M.

This article isprotected bycopyright. Allrights reserved. Accepted Article (indicate (blue). I reticulu coverslip HEK293 Figure m m m 5 5 d s overnight. overnight. s (calreticulin : Totalintr ages were were c ages right panel, panel, right cells were cells O ) ) a a a z t , cis-Golgi ( ransfected ransfected ptured on a ptured toferlin was toferlin cellular lab cellular -projection). -projection). w G L d e Scale bars: bars: 1 Scale ith eica SP5 co SP5 eica etected with M130) or tr M130) ling of ling of oto ubiquito u u n a 0 f f anti-Myc (red anti-Myc s focal (single (single focal erlin-Ubiqui ns-Golgi (T ns-Golgi

pCMV6-ot μ M. Untran M. G G s o t z ) fected cells ous and co-label and ferlin OLN2) (gre OLN2) -sections pr MycFlag MycFlag (

a a e e e w w lacking EGF re labeled wit labeledre ed with mark sented) or D or sented) n). Nuclei w Nuclei n). ith secreto e e P e e e e h an asterisk. an asterisk. h ry pathway pathway ry ltaVision OM ltaVision rs for the en the rs for ) andre-pl re labeledre w a d d X 3D-SIM X 3D-SIM markers. markers. ted onto onto ted oplasmic oplasmic ith DAPI ith DAPI

This article isprotected bycopyright. Allrights reserved. Accepted Article increasin DeltaVisi trans-Go (blue). overnigh HEK293 6 Figure A t t lgi (TGOLN2) (TGOLN2) lgi - - on OMX3D- : Fer1L6 g levels of g levels . Fer1L6wa cells were cells Cells were MycFl S s S s F c a t t detected in ransfected ransfected g IM (indicated (green). Ima (green). o-labeled wi o-labeled er1L6 expr er1L6 localises t localises e w f t g o a brefeldi a o right panel, ssion (anti- h markers fo ixed, permea ith Fer1L6 es were were es cap M M n n z y y r bilised cells cells bilised tured on a L on tured - -projection). cFlag yc, red) inc red) yc, the endopla A resistant, -pCMV6 -pCMV6 w e r B s easingly lab easingly ica SP5 conf (lacking EG ith anti-Myc transferrin mic reticulu - Represent 5 m m e F 9 a ( ( o o 4 red). Nuclei ls a perinuc a ls tive confocal confocal tive P) then re- P) then (calreticulin -positive re -positive cal (single z (single cal w ) p c - - lear compart lear , cis-Golgi( images portr images sections pre sections lated onto onto lated ere labeled ycling com ycling G s p a m w c M130) or or M130) ented) or or ented) ying how how ying overslips overslips artment. ith DAPI ith DAPI ent that

This article isprotected bycopyright. Allrights reserved. Accepted Article overnigh labeling Figure Untransf I green). pe fixed, incubate very low detected transferri deforms labeled labeled DeltaVisi (GM130) w w 7 7 . e d t t t t rmeabilised rmeabilised on 3D- OMX n (green). Nu mages were were mages

. Fer1L5was : Fer1L5 d Fer1L5 : he nucleus i nucleus he ith an asterisith an laser power power laser with lamin A lamin with cted cells ar in the prese the in 594 HEK293 ce HEK293

(false c o o o a n S S e c e l / k. nce or absen or nce for imaging imaging for es not co-l lored green, green, lored nd labeled labeled nd ls transfecte C (left panel highly expre highly lei were were lab lei detected wit detected labeledwith captured on on captured IM as indica as IM w a o h d e s c t s ith anti-Myc anti-Myc ith nd can precl can nd an asterisk. asterisk. an calise with with calise right panel) panel) right ed (single Z- (single ed anti-Myc (re with Fer1L with led with DA led ). The inten e of5 sing cells. a Leica SP μ g.m C L s s 5 ( P d u 5 - - s s and labels a labels and markers of of markers ity of Fer1L6 Fer1L6 of ity Fer1L6, red) red) Fer1L6, -1 MycFlag

) andco-lab de visibility visibility de ections pres ections Im I (blue). confocal ( confocal Fer1L6, det Fer1L6, brefeldin-A brefeldin-A -pCMV s a e e o 6 t e ingle Z-secti forminut 90 ges were ca and GM130 led forthe E he secretor labeling of t of labeling cted with with an cted f the plasm f the compartmen (lacking E nted). Scale Scale nted). G a e a h R R t o o y t i-Myc, co-loc ptured on a or TGOLN2 s at 37°C (a membrane. e perinuclea e separate t separate FP) were re bar: 10 ns presente ns (calreticulin pathway pathway μ M. o w w s a r ) l - d Untransfecte Leica SP5c the nuclear indicated). indicated). eft and midd D- D- compartme orthe Golgi lises with en plated onto onto plated ith totalint ). Scale ba ). Scale HEK293 HEK293 n C d o c d r r a c l r t requires e panels, panels, e : 10 : 10 cells are are cells ells were were ells envelope envelope acellular acellular nfocal or or nfocal ocytosed ells were were ells overslips overslips pparatus pparatus μ M. M.

This article isprotected bycopyright. Allrights reserved. Accepted Article endocyti Myc det detectio indicated antibody myoferli Figure n n 8 8 e e c c n) or or trans- n) ). Surface bo Surface ). of endocyto of : Retrograd cted with with an cted trafficking, c trafficking, tracing with with tracing G s s e e e t u u i-rabbit Alexa i-rabbit ed anti-Myc. olgi (otoferli lls were were lls incu anti-Myc upt antibody l antibody nd anti-Myc a C w a n, Fer1L6) e Fer1L6) n, bated with with bated a 594 beling of fe ke for 90 m as removed removed as ells were ells th (or Alexa n n 4 e n e n i 88 rlin endocyt rlin nutes. Image by washing c ti-Myc in repl in ti-Myc n fixed with i docytosis. docytosis. false colou false T c i overslips in in 0 overslips s were captu red red). acement me acement c pathways pathways c o labelferlin e-cold PFA, e-cold PFA, A- A- d d T . p endocytic pat red on aLei 5 M pH 2.2 g 2.2 pH M 5 reveals lys ia at 37°Cf ransfected ransfected ermeabilise H o d o d o c h lycine, allowi lycine, r upto m 90 and endocyt and a SP5confo EK293 cells somal (dys ways using using ways n n f r c i o s erlin and and erlin etrograde etrograde nutes (as (as nutes g specific specific g al. Scale al. Scale ubject to to ubject sed anti-

This article isprotected bycopyright. Allrights reserved. Accepted Article fixation fixation presente 10 bars false col permeab otoferlin- 10 bars myoferli otoferlin 9 Figure a n n o o µ µ d Ub ilised then c then ilised : Dysferlin a endocytosi nd permeabil MycFlag MycFlag µM. ured green). ured M. M. . C- MycFlag Note Transfe B- expres Tra ) we : ex o n r s p i i c c nd myoferli sion constru sion Images wer Images sation, intern sation, -labeled for l for -labeled at labeled e sfected C2 sfected eriments we eriments isindepen ted Cos-7 c C n c e e a e y 3 r dent of TG of dent 12 (dysferlin endocytos ts (lacking (lacking ts e performed lls labeled b sosomes (L captured o captured lized anti-M lized 7 o C byanti- O O E E e e y A y n y n M M M c was detect via late en via late for all constr LN2. GFP) and i anti-Myc up a DeltaVisi MP1, Alexa MP1, ycHis yc uptake f uptake yc ormyo A - HE d d n 4 e o K K o t t u u 8 ferlin cubated with with cubated ake at 37°C osomes, Fe osomes, d with d anti-ra n OMX 3D- n OMX r 30 minutes 8 293 cells w cells 293 cts inboth ) or the tra the or ) MycFlag ) S c e o n r r f b b . Cells were were . Cells ell lines, with with lines, ell or 30 minute 30 or 1L6 on recy re transfecte r HEK293 c r HEK293 s-Golgi netw IM (Z-projec bit Alexa anti-Myc in 594 . t s s a a c d o ells (Fer1L6 ells Scale1 bars ions present ions media at 37 at media . Following representati cid washed, ling endos with dysferl with rk (TGOLN

2 2 a M o 0 v e ° in , Alexa cid wash, ycFlag µM. e images e images mes and and mes fixed and d). Scale C for 90 90 C for MycHis and and or or 594

This article isprotected bycopyright. Allrights reserved. Accepted Article endo-lys ferlins. 1 Figure detected 30 for sections Ale and endocyti anti with Rab and uptake green). Myc was minutes markers int an is detected positive become specific tran also localise w m w m x x s B B w w c c o - - t t e e s s 11a with with anti 11a c racellular ferl racellular Dysferlin (yell Dysferlin sit recycling a presented). presented). ith anti-Myci intensely co o label ferlin ferlin o label 0: Schemati 0: with anti-rab ant and Myc at the at the plasm inutes to la to inutes detected wit detected pathways. pathways. somal path ub-compart transferri ith - ndosomes t ndosomes alreticulin or alreticulin 594

Left: Left: (false co HEK w m C m E b b b h b n n - - a o n n p i e 2 in, and thou and in, c diagram c diagram ay accumulat loured green loured ow) and myo EGFP (Alexa EGFP -TGOLN2 to calnexin. el endocytic endocytic el it - Alexa ndocytosed ndocytosed following ret ent ofthet membrane, membrane, the trans-G the centrated. media at 3 at media athways (in athways ndocytic traf ndocytic 93 cells co- Anti-Myca 488 (false co 488 (fal F d 7 n d g g r ) a s l f t f rograde antib rograde ing in Rab7-ping in o 488 though we c though er1L6 under er1L6 epicting the epicting ans-Golgi ne ans-Golgi oured green) oured respectively. °C 10 minut 10 °C erlin (green) (green) erlin icking. Follo icking. ransfected ransfected dtransferrin h showsa by icated ether in me in ether uptake. Foll uptake. e coloured r e coloured nti-Myc and and nti-Myc lgi/recycling ). Right: ?

5 w H w H ) e d a g w e 9 o o r . . . o o o abundantly la abundantly twork that in 4 anti-TGOLN2 s. Endocytoss. All images fo 37°C at ia n readilytrac ith Fer1L6 oes retrogra oes (red Fer1L6 eticular label eticular EK293 cells Scale bars: bars: Scale endosome. endosome. d) and late e late and d) ing acid was acid ing wing acid acid wing (false colou (false dy labelling, intracellula sitive late e late sitive My w n d O O w c 1 1 r h n t e e t ) ) rapidly cycl ) rapidly red green) w green) red ling pattern, pattern, ling r 90 minutes 90 minutes r ash, fixation Flag bel the plas the bel were detect were indicating dy indicating dosomes. Dy dosomes. e transit fro transit e localizatio ransfected w ransfected ertwines wit ertwines 0 ere capture ere nly very low dosomes wi an , fixation d anti-Myc itsendocyti μ and Rab and M. m m m w w n n d d s h e e t 1 e c s ith otoferlin-U ith s does not str not does h anti-Rab7 ( anti-Rab7 h the plasma plasma the andendoc on aLeica a membrane ferlin and and my ferlin and permea and to label both both label to permeabilis as detectedas the recyclin re appliedto d with Alexa 1a-EGFP w 1a-EGFP passageto levels of ot s from the the s from ferlin and m and ferlin o o p a p e y o o m m S b w y y A o t o 4 t 4 b g endosome g ferlin (orang ferlin and transit th lasma mem tion, endocyt tion, oferlin occasi oferlin he trans-Gol he re subject t subject re ngly co-labe otoferlin and the cell medi cell the 88 ilisation anti tic trafficki tic P5 confocal ferlin endos ferlin ith anti-rabb lexa MycFlag embrane vi (false col 594 were were , fals b o e a a o e n o o g , - i o l incubated incubated a at 37°C a at 37°C onally co- onally the rough rane to a antibody antibody t Alexa where it it where ) maybe with ER ER with Rab11a- (single z- (single red) ured Myc was coloured coloured mes may may mes g of the TGOLN2 TGOLN2 i. Fer1L5 sed anti- sed 594