Elizabethtown College JayScholar Landmark Conference Summer Research Landmark Conference Summer Research Symposium Symposium 2019
Jul 11th, 2:45 PM - 3:45 PM The correlation of a novel BIN1 isoform and the expression of SV40 T antigen in human diploid fibroblasts Carli Monostra Elizabethtown College, [email protected]
Follow this and additional works at: https://jayscholar.etown.edu/landmark Part of the Biology Commons
Recommended Citation Monostra, Carli, "The orc relation of a novel BIN1 isoform and the expression of SV40 T antigen in human diploid fibroblasts" (2019). Landmark Conference Summer Research Symposium. 7. https://jayscholar.etown.edu/landmark/2019/july11/7
This Event is brought to you for free and open access by the Programs and Events at JayScholar. It has been accepted for inclusion in Landmark Conference Summer Research Symposium by an authorized administrator of JayScholar. For more information, please contact [email protected]. Carli Monostra . Protein involved in many functions of the cells: . Cell cycle progression . Apoptosis . Tumor Suppressor . Prognostic marker . Function depends on splicing . Numerous known isoforms NMR structure of BIN1 The old nomenclature Protein Domains . Alternative Splicing . One gene codes for multiple proteins . Numerous isoforms with different combinations of exons . N-Bar Domain (exons 1-10) . Ubiquitous Exons . Membrane curvature . Phosphoinositide(PI) binding motif (exon 11) . Muscle cells . Affinity towards membrane compartments Protein Domains . Clathrin and AP2 (CLAP) binding domain (exon 13-16) . Neuronal . Helps bind to clathrin . Myc Binding Domain (exons 17-18) . Binds to myc . Src homology 3(SH3)domain (exon 19-20) Exons . Ubiquitous . Binds to proline rich motifs
. Research has shown reduced BIN1 expression in cancer . Colon, breast, prostate, lung, and liver . Increased metastasis BIN1 Immunofluorescence . Two major tumor suppressor pathways . Myc-dependent and myc-independent . No longer just mutated DNA that can cause cancer . Myc is a gene that codes for transcription factor that promote the cell cycle . BIN1 binds to myc protein and blocks its ability to promote cell cycle . Cell cycle halts . Apoptosis should happen . Cancer results when the myc binding domain (MBD) is spliced out BIN1 interacting with c-myc . Can no longer bind to myc and cell cycle proceeds when it shouldn't cMYC = normal version (protooncogene) . PARP is needed for DNA repair . When BIN1 binds it stops PARP from working . Leads to no DNA repair and apoptosis . Chemotherapeutics . 12% of all cancers are caused by an oncovirus . T antigen transforms via the simian virus 40 (SV40) . Analogous to adenovirus E1a/E1b transformation . Human papilloma virus (HPV) E6/E7 . HPV major cause of cervical cancer T antigen . Four cell lines used . Human diploid fibroblast immortalized with telomerase [HDF(tert)] . Clones 1 and 2 . HDF cells expressing T antigen . HeLa Cells . Sometimes used as a control . Preliminary data suggests a new possible isoform . Believed to have exons 1-12 (without 7) and then spliced into 20 . Transformation resulted in 1 colony and sent for sequencing . Determine if present in HDF(tert) cell line
DNA sequence:
GGGACCCTCTCAGTGAAGTTCTCGGGGAAGACGCCACGGCACTTCTCCAGCTCCTTGTGCTGGTTCC AGTCGCTCTCCTTCACGCCCATGAGCCAGCCTTCATCCTGAGATGGGGACTTGGGGAGGGTGGCCCC GGGCGTGGCCCCGCCAGCCGGCTCTGGCTCGTGGTTGACTCTGATCTCGGGGGTGGCGGCAGGGG AGCCATCTGGAGGCGAAGGGCTCTTGTTCCCTTTTGCAGGC Reverse transcription polymerase Harvest Cells Make RNA/cDNA chain reaction (RT-PCR) Gel Electrophoresis Gel Extraction Polymerase Chain Reaction (PCR)
DNA Purification Ligation Bacteria DNA Purification Enzyme Digest Transformation Our adventures in troubleshooting Markers 60.50C 63.5C BIN1 CAV 190, 191 primers RNA purified and put in one step procedure Cl1 ag Cl2 - BIN Cl Cl BIN 2 Taq T Watercontrol
BIN1 Primers: CAV 190&191
T-antigen Primers: CAV 60&61
63 °C Annealing Eurofins BIN1 Primers 192/ 193
PCR Using cDNA
Preliminary Results: Eurofins BIN1 Primers 192/ 193 Annealing Temp: 60 °C • Band 1 had 1 colony • Band 6 had 1 colony • The rest did not grow • Need to troubleshoot, but first... 100 200 300 400 500 600 700 800 900 1,000 1,200 1,500 2,000
Band 6 pEGFP - N1 uncut Markers
Keep this band pattern in mind... . Low ligation and transformation rates . Altered: . Ratio of insert : vector . Overnight ligation temperature . Made higher DNA concentrations Ideal Transformation Plates 2000
600
PGEM-T easy
Cl1
HeLa 75 bp Markers 1 3 4 5 1 2 3 4 5 1 2 4 5 6 Markers Clone 2 75 bp bands
Clone 1 HDF(Tert)
HeLa False Blue Positives Long Run
Short Run
Pgem vector
3000 2 different isoforms being inserted, so should be white colonies Long Run Short Run Possibly Partial Digests
No 75bp insert ??? . Send out bands for DNA sequencing to figure out what we have been purifying . Make DNA concentrations higher . My fellow researchers, Emma & Sean Special . My SCARP advisor, Dr. Cavender . Ms. Jean Valas thanks . The Summer Scholarship, Creative Arts and Research Projects (SCARP) to... program . Biology Department . Landmark Summer Research Symposium