DOCSLIB.ORG

Description of Lactobacillus Iners Sp. Nov

Total Page：16

File Type：pdf, Size：1020Kb

Download full-text PDF Read full-text
Description of Lactobacillus Iners Sp. Nov International Journal of Systematic Bacteriology (1999), 49, 21 7-221 Printed in Great Britain Phenotypic and phylogenetic characterization of a novel Lactobacillus species from human sources : description of Lactobacillus iners sp. nov. Enevold Falsen,' Christina Pascual,2 Berit Sjbden,' Maria Ohl6nl and Matthew D. Collins't Author for correspondence: Matthew D. Collins. Tel: +44 1189 357000. Fax: +44 1189 267917. e-mail : david .Collins@ bbsrc. ac .uk ~ ~ ~ 1 Culture Collection, Eleven strains of a hitherto undescribed Gram-positive, catalase-negative, Department of Clinical facultatively anaerobic rod-shaped bacterium from human sources and medical Bacteriology, University of Goteborg, Goteborg, care products were characterized by phenotypic and molecular taxonomic Sweden methods. The phenotypic properties of the bacterium were consistent with its 2 BBSRC Institute of Food assignment to the genus Lactobacillus but it was readily distinguished from all Research, Reading currently described species of this genus by its biochemical characteristics and Laboratory, Reading RG6 by SDS-PAGE analysis of its cellular proteins. Comparative 16s rRNA gene 6BZ, UK sequence analysis demonstrated that the unknown bacterium was a member of rRNA group ILactobacillus which includes Lactobacillus delbrueckii, the type species of the genus, and close relatives. Lactobacillus gasseri and Lactobacillus johnsonii were the nearest phylogenetic relatives of the unknown bacterium, but 165 rRNA sequence divergence values of ~4%clearly showed that it represents a distinct species. Based on both phylogenetic and phenotypic evidence, it is proposed that the unknown bacterium should be classified in the genus Lactobacillus, as Lactobacillus hers sp. nov. The type strain of Lactobacillus hers is CCUG 28746T. I Keywords: Lactobacillus iners, taxonomy, phylogeny, rRNA INTRODUCTION for man and animals) (Hammes et al., 1992). Lacto- bacilli are found in a great variety of habitats such as The genus Lactobacillus comprises a phenotypically food, vegetation and sewage (Hammes et al., 1992). heterogeneous group of facultatively anaerobic, Several species of Lactobacillus are also found in catalase-negative, non-spore-forming, Gram-positive, association with humans, for example in the oral rod-shaped organisms which produce lactic acid as a cavity, intestine and vagina. With the possible ex- major end-product of metabolism (Kandler & Weiss, ception of a few isolated reports involving people with 1986). Lactobacillus species generally possess DNA underlying disorders or disease, lactobacilli are con- with a low G + C content (approx. 33-53 mol%) and sidered non-pathogenic for man (Aguirre & Collins, currently over 50 species are recognized. Lactobacilli 1993). are of great commercial importance due to their use in During the course of an investigation of some Gram- the production of a range of fermented dairy, meat and positive, catalase-negative, rod-shaped organisms vegetable products and there is also now a growing from human sources, referred to the Culture Collection interest in their use as probiotics (i.e. dietary adjuncts of the University of Goteborg (CCUG), Sweden, for identification, eleven strains of an unknown Lacto- ..................................................................................... I........................................................... tPresent address: Department of Food Science & Technology, Earley bacillus-like bacterium were allocated to a provisional Gate, University of Reading, Reading RG6 6BZ, UK. group, designated EF group 47. Preliminary pheno- Abbreviations: CCUG, Culture Collection of the University of Goteborg; typic tests indicated that the isolates were possibly RDP, Ribosomal Database Project. related to the genus Lactobacillus, but they could not The GenSank accession number for the 165 rRNA gene sequence of strain be assigned to any recognized species. In this article, CCUG 28746l is Y16329. phenotypic characteristics of these strains and the 00871 0 1999 IUMS 217 E. Falsen and others results of a comparative 16s rRNA phylogenetic RESULTS AND DISCUSSION analysis are reported. Based on the taxonomic results Lactobacillus iners, Nine of the strains examined were isolated from human presented, a new species, is de- sources, i.e. urine (six strains), vaginal discharge (one scribed. strain), endometrial (one strain) and cervical (one strain) specimens, whereas the remaining two isolates METHODS were recovered from medical care products. All eleven Strains. Eleven catalase-negative, Gram-positive, rod- strains were Gram-positive, non-spore-forming, rod- shaped isolates were referred to the CCUG for identification. shaped organisms which occurred as single cells, pairs Strains CCUG 37448, CCUG 24626 and CCUG 38673 were or in short chains. The isolates were facultatively from human endometrial, vaginal discharge and cervical anaerobic and catalase- and oxidase-negative. The (healthy 28-year-old female) specimens, respectively. Strains isolates grew on blood agar but not on MRS agar (pH CCUG 27589, CCUG 28495, CCUG 28718, CCUG 28746T, 6.2 or 7.3) or Rogosa agar. Biochemically, the strains CCUG 35443B and CCUG 37636 were recovered from were relatively homogeneous and produced acid, but human urine, whereas strains CCUG 37287 and CCUG 37289 originated from medical care products. no gas, from glucose. Four out of the eleven strains also produced acid from maltose. However, with the Biochemical tests. All strains were cultured on Columbia exception of these sugars, the strains were asaccharo- agar (Difco) supplemented with 5 % horse blood at 37 “C in lytic and did not produce acid from the following air plus CO,. The strains were biochemically characterized using the API rapid ID32 strep and API ZYM systems substrates : L-arabinose, D-arabitol, cyclodextrin, gly- according to the manufacturer’s instructions (API cogen, N-acetylglucosamine, lactose, mannitol, mel- bioMerieux). ezitose, melibiose, methyl P-D-glucopyranoside, Whole-cell protein analysis (SDSPAGE). The preparation of pullulan, raffinose, ribose, rhamnose, sorbitol, sucrose, cellular protein extracts, SDS-PAGE, densitometric analy- tagatose, trehalose or D-xylose. All of the strains sis, normalization and interpolation of the protein profiles, displayed alanine-phenylalanine-proline arylamidase, and numerical analysis were performed as described by Pot esterase C4, a-glucosidase, leucine arylamidase and et al. (1994) using the Hoefer SE 600 vertical slab gel unit, phosphoamidase activity. None of the strains exhibited Pharmacia-LKB UltroScan XL and the GELCOMPAR 3.0 alkaline phosphatase, arginine dihydrolase, chymo- software package (Applied Maths). The levels of similarity trypsin, a-fucosidase, a-galactosidase, j3-galactosidase, between pairs of traces were expressed by the Pearson j3-galacturonidase, j3-glucosidase, j3-glucuronidase, product moment correlation coefficient converted for con- glycyl-tryptophan arylamidase, a-mannosidase, j3- venience to a percentage value. mannosidase, lipase C 14, trypsin or urease activity. Cell wall murein analysis. Preparation of the cell wall from The strains hydrolysed hippurate, but not aesculin or strain CCUG 28746Tand determination of murein structure gelatin. All were Voges-Proskauer-negative and failed were carried out using methods described by Schleifer & to reduce nitrate. Seven strains were examined by Kandler (1 972) except that TLC on cellulose sheets (Merck) was used instead of paper chromatography. SDS-PAGE analysis of whole-cell proteins which confirmed the high overall phenotypic homogeneity of DNA base composition. DNA was isolated as described by the isolates. The seven strains formed a tight cluster Farrow et al. (1983) and the DNA G + C content (mol %) and were readily separated from all other reference was determined by thermal denaturation as described by Garvie (1 978). Lactobacillus species examined using this technique (Fig. 1). Cell wall analysis of strain CCUG 28746T Determination of 16s rRNA gene sequences and phylo- revealed the presence of murein type L-L~s-D-As~, genetic analyses. A large fragment of the 16s rRNA gene was amplified by PCR using universal primers pA [5’ which is found in many lactobacilli and other lactic AGAGTTTGATCCTGGCTCAG; positions 8-27 acid bacteria (Hammes et al., 1992; Schleifer & (Escherichia coli numbering)] and pH* (5’ AAGGAGGT- Kandler, 1972). The G + C content of DNA of strain GATCCAGCCGCA; positions 1541-1 522). The PCR CCUG 28746T was determined as 34.4 mol %. This products were purified with a Prep-A-Gene kit (Bio-Rad) value is at the lower end of the DNA G+C range of according to the manufacturer’s instructions and were the genus Lactobacillus (approx. range 33-53 mol %), sequenced using a Taq DyeDeoxy Terminator Cycle but nevertheless compatible with the assignment of the Sequencing kit (Applied Biosystems) and a model 373A unknown bacterium to this genus. automatic sequencer (Applied Biosystems). The closest known relatives of the new isolates were determined by To establish the phylogenetic position of the unknown performing sequence database searches and the sequences of bacterium, the 16s rRNA genes of three representative closely related strains were retrieved from GenBank or strains were amplified by PCR and characterized by Ribosomal Database Project (RDP) libraries. Sequences sequence analysis. The almost complete gene sequence were aligned with the PILEUP program (Devereux et al., 1984) (>1400 nucleotides) of strain CCUG 28746T was and the
Load more

Recommended publications
  • A Taxonomic Note on the Genus Lactobacillus
    Taxonomic Description template 1 A taxonomic note on the genus Lactobacillus: 2 Description of 23 novel genera, emended description 3 of the genus Lactobacillus Beijerinck 1901, and union 4 of Lactobacillaceae and Leuconostocaceae 5 Jinshui Zheng1, $, Stijn Wittouck2, $, Elisa Salvetti3, $, Charles M.A.P. Franz4, Hugh M.B. Harris5, Paola 6 Mattarelli6, Paul W. O’Toole5, Bruno Pot7, Peter Vandamme8, Jens Walter9, 10, Koichi Watanabe11, 12, 7 Sander Wuyts2, Giovanna E. Felis3, #*, Michael G. Gänzle9, 13#*, Sarah Lebeer2 # 8 '© [Jinshui Zheng, Stijn Wittouck, Elisa Salvetti, Charles M.A.P. Franz, Hugh M.B. Harris, Paola 9 Mattarelli, Paul W. O’Toole, Bruno Pot, Peter Vandamme, Jens Walter, Koichi Watanabe, Sander 10 Wuyts, Giovanna E. Felis, Michael G. Gänzle, Sarah Lebeer]. 11 The definitive peer reviewed, edited version of this article is published in International Journal of 12 Systematic and Evolutionary Microbiology, https://doi.org/10.1099/ijsem.0.004107 13 1Huazhong Agricultural University, State Key Laboratory of Agricultural Microbiology, Hubei Key 14 Laboratory of Agricultural Bioinformatics, Wuhan, Hubei, P.R. China. 15 2Research Group Environmental Ecology and Applied Microbiology, Department of Bioscience 16 Engineering, University of Antwerp, Antwerp, Belgium 17 3 Dept. of Biotechnology, University of Verona, Verona, Italy 18 4 Max Rubner‐Institut, Department of Microbiology and Biotechnology, Kiel, Germany 19 5 School of Microbiology & APC Microbiome Ireland, University College Cork, Co. Cork, Ireland 20 6 University of Bologna, Dept. of Agricultural and Food Sciences, Bologna, Italy 21 7 Research Group of Industrial Microbiology and Food Biotechnology (IMDO), Vrije Universiteit 22 Brussel, Brussels, Belgium 23 8 Laboratory of Microbiology, Department of Biochemistry and Microbiology, Ghent University, Ghent, 24 Belgium 25 9 Department of Agricultural, Food & Nutritional Science, University of Alberta, Edmonton, Canada 26 10 Department of Biological Sciences, University of Alberta, Edmonton, Canada 27 11 National Taiwan University, Dept.
    [Show full text]
  • Molecular Assessment of Bacterial Vaginosis by Lactobacillus Abundance and Species Diversity Joke A
    Western University Scholarship@Western Microbiology & Immunology Publications Microbiology & Immunology Department 4-2016 Molecular Assessment of Bacterial Vaginosis by Lactobacillus Abundance and Species Diversity Joke A. M. Dols VU University Amsterdam Douwe Molenaar VU University Amsterdam Jannie J. van der Helm Public Health Service of Amsterdam Martien P. M. Caspers Netherlands Organisation for Applied Scientific Research Alie de Kat Angelino-Bart Netherlands Organisation for Applied Scientific Research See next page for additional authors Follow this and additional works at: https://ir.lib.uwo.ca/mnipub Part of the Immunology and Infectious Disease Commons, and the Microbiology Commons Citation of this paper: Dols, Joke A. M.; Molenaar, Douwe; van der Helm, Jannie J.; Caspers, Martien P. M.; de Kat Angelino-Bart, Alie; Schuren, Frank H. J.; Speksnijder, Adrianus G. C. L.; Westerhoff, Hans V.; Richardus, Jan Hendrik; Boon, Mathilde E.; Reid, Gregor; de Vries, Henry J. C.; and Kort, Remco, "Molecular Assessment of Bacterial Vaginosis by Lactobacillus Abundance and Species Diversity" (2016). Microbiology & Immunology Publications. 50. https://ir.lib.uwo.ca/mnipub/50 Authors Joke A. M. Dols, Douwe Molenaar, Jannie J. van der Helm, Martien P. M. Caspers, Alie de Kat Angelino-Bart, Frank H. J. Schuren, Adrianus G. C. L. Speksnijder, Hans V. Westerhoff, Jan Hendrik Richardus, Mathilde E. Boon, Gregor Reid, Henry J. C. de Vries, and Remco Kort This article is available at Scholarship@Western: https://ir.lib.uwo.ca/mnipub/50 Dols et al. BMC Infectious Diseases (2016) 16:180 DOI 10.1186/s12879-016-1513-3 RESEARCH ARTICLE Open Access Molecular assessment of bacterial vaginosis by Lactobacillus abundance and species diversity Joke A.
    [Show full text]
  • Human Microbiota Network: Unveiling Potential Crosstalk Between the Different Microbiota Ecosystems and Their Role in Health and Disease
    nutrients Review Human Microbiota Network: Unveiling Potential Crosstalk between the Different Microbiota Ecosystems and Their Role in Health and Disease Jose E. Martínez †, Augusto Vargas † , Tania Pérez-Sánchez , Ignacio J. Encío , Miriam Cabello-Olmo * and Miguel Barajas * Biochemistry Area, Department of Health Science, Public University of Navarre, 31008 Pamplona, Spain; [email protected] (J.E.M.); [email protected] (A.V.); [email protected] (T.P.-S.); [email protected] (I.J.E.) * Correspondence: [email protected] (M.C.-O.); [email protected] (M.B.) † These authors contributed equally to this work. Abstract: The human body is host to a large number of microorganisms which conform the human microbiota, that is known to play an important role in health and disease. Although most of the microorganisms that coexist with us are located in the gut, microbial cells present in other locations (like skin, respiratory tract, genitourinary tract, and the vaginal zone in women) also play a significant role regulating host health. The fact that there are different kinds of microbiota in different body areas does not mean they are independent. It is plausible that connection exist, and different studies have shown that the microbiota present in different zones of the human body has the capability of communicating through secondary metabolites. In this sense, dysbiosis in one body compartment Citation: Martínez, J.E.; Vargas, A.; may negatively affect distal areas and contribute to the development of diseases. Accordingly, it Pérez-Sánchez, T.; Encío, I.J.; could be hypothesized that the whole set of microbial cells that inhabit the human body form a Cabello-Olmo, M.; Barajas, M.
    [Show full text]
  • The Microbiota Continuum Along the Female Reproductive Tract and Its Relation to Uterine-Related Diseases
    ARTICLE DOI: 10.1038/s41467-017-00901-0 OPEN The microbiota continuum along the female reproductive tract and its relation to uterine-related diseases Chen Chen1,2, Xiaolei Song1,3, Weixia Wei4,5, Huanzi Zhong 1,2,6, Juanjuan Dai4,5, Zhou Lan1, Fei Li1,2,3, Xinlei Yu1,2, Qiang Feng1,7, Zirong Wang1, Hailiang Xie1, Xiaomin Chen1, Chunwei Zeng1, Bo Wen1,2, Liping Zeng4,5, Hui Du4,5, Huiru Tang4,5, Changlu Xu1,8, Yan Xia1,3, Huihua Xia1,2,9, Huanming Yang1,10, Jian Wang1,10, Jun Wang1,11, Lise Madsen 1,6,12, Susanne Brix 13, Karsten Kristiansen1,6, Xun Xu1,2, Junhua Li 1,2,9,14, Ruifang Wu4,5 & Huijue Jia 1,2,9,11 Reports on bacteria detected in maternal fluids during pregnancy are typically associated with adverse consequences, and whether the female reproductive tract harbours distinct microbial communities beyond the vagina has been a matter of debate. Here we systematically sample the microbiota within the female reproductive tract in 110 women of reproductive age, and examine the nature of colonisation by 16S rRNA gene amplicon sequencing and cultivation. We find distinct microbial communities in cervical canal, uterus, fallopian tubes and perito- neal fluid, differing from that of the vagina. The results reflect a microbiota continuum along the female reproductive tract, indicative of a non-sterile environment. We also identify microbial taxa and potential functions that correlate with the menstrual cycle or are over- represented in subjects with adenomyosis or infertility due to endometriosis. The study provides insight into the nature of the vagino-uterine microbiome, and suggests that sur- veying the vaginal or cervical microbiota might be useful for detection of common diseases in the upper reproductive tract.
    [Show full text]
  • Lactobacillus Crispatus Protects Against Bacterial Vaginosis
    Lactobacillus crispatus protects against bacterial vaginosis M.O. Almeida1, F.L.R. do Carmo1, A. Gala-García1, R. Kato1, A.C. Gomide1, R.M.N. Drummond2, M.M. Drumond3, P.M. Agresti1, D. Barh4, B. Brening5, P. Ghosh6, A. Silva7, V. Azevedo1 and 1,7 M.V.C. Viana 1 Departamento de Genética, Ecologia e Evolução, Instituto de Ciências Biológicas, Universidade Federal de Minas Gerais, Belo Horizonte, MG, Brasil 2 Departamento de Microbiologia, Ecologia e Evolução, , Instituto de Ciências Biológicas, Universidade Federal de Minas Gerais, Belo Horizonte, MG, Brasil 3 Departamento de Ciências Biológicas, Centro Federal de Educação Tecnologica de Minas Gerais, Belo Horizonte, MG, Brasil 4 Institute of Integrative Omics and Applied Biotechnology (IIOAB), Nonakuri, Purba Medinipur, West Bengal, India 5 Institute of Veterinary Medicine, University of Göttingen, Göttingen, Germany 6 Department of Computer Science, Virginia Commonwealth University, Richmond, Virginia, USA 7 Departamento de Genética, Instituto de Ciências Biológicas, Universidade Federal do Pará, Belém, PA, Brasil Corresponding author: V. Azevedo E-mail: [email protected] Genet. Mol. Res. 18 (4): gmr18475 Received August 16, 2019 Accepted October 23, 2019 Published November 30, 2019 DOI http://dx.doi.org/10.4238/gmr18475 ABSTRACT. In medicine, the 20th century was marked by one of the most important revolutions in infectious-disease management, the discovery and increasing use of antibiotics. However, their indiscriminate use has led to the emergence of multidrug-resistant (MDR) bacteria. Drug resistance and other factors, such as the production of bacterial biofilms, have resulted in high recurrence rates of bacterial diseases. Bacterial vaginosis (BV) syndrome is the most prevalent vaginal condition in women of reproductive age, Genetics and Molecular Research 18 (4): gmr18475 ©FUNPEC-RP www.funpecrp.com.br M.O.
    [Show full text]
  • Detection of Vaginal Lactobacilli As Probiotic Candidates Alessandra Pino1, Emanuela Bartolo2, Cinzia Caggia1, Antonio Cianci2 & Cinzia L
    www.nature.com/scientificreports OPEN Detection of vaginal lactobacilli as probiotic candidates Alessandra Pino1, Emanuela Bartolo2, Cinzia Caggia1, Antonio Cianci2 & Cinzia L. Randazzo1 The vaginal microbiota of healthy women is dominated by lactobacilli, which exerts important health- Received: 22 October 2018 promoting efects to the host. In the present study, 261 lactobacilli isolated from vagina of healthy Accepted: 8 February 2019 women were screened for their potential probiotic characteristics. Safety features (haemolytic activity, Published: xx xx xxxx antibiotic susceptibility, bile salt hydrolase activity) and functional properties (resistance to low pH and bile salts, lysozyme tolerance, gastrointestinal survival, antagonistic activity against pathogens, hydrophobicity, auto-aggregation, and co-aggregation abilities, hydrogen peroxide production, bioflm formation, exopolysaccharide production, adhesion capacity to both normal human vagina epithelial cells and Caco-2 epithelial cells, and lactic acid production) were in depth evaluated. Seven strains, identifed as Lactobacillus rhamnosus, Lactobacillus helveticus and Lactobacillus salivarius fulflled the criteria described above. Therefore, the vaginal ecosystem represents a suitable source of probiotic candidates that could be used in new functional formulates for both gastrointestinal and vaginal eubiosis. Probiotics are non-pathogenic, live microorganisms which, when administrated in adequate amounts, benef- cially afect the health of the host1. During the last decade, researches in probiotic have progressed considerably and signifcant advances have been made in the selection and characterization of specifc probiotic strains with health benefts2. Te most studied probiotics belong to Lactobacillus and Bifdobacterium genera, which have been frequently associated with health-promoting efects in both humans and animals3,4. Previous studies have showed that probiotics improve immune system responses, stool consistency and vaginal lactobacilli density5,6.
    [Show full text]
  • A Taxonomic Note on the Genus Lactobacillus
    TAXONOMIC DESCRIPTION Zheng et al., Int. J. Syst. Evol. Microbiol. DOI 10.1099/ijsem.0.004107 A taxonomic note on the genus Lactobacillus: Description of 23 novel genera, emended description of the genus Lactobacillus Beijerinck 1901, and union of Lactobacillaceae and Leuconostocaceae Jinshui Zheng1†, Stijn Wittouck2†, Elisa Salvetti3†, Charles M.A.P. Franz4, Hugh M.B. Harris5, Paola Mattarelli6, Paul W. O’Toole5, Bruno Pot7, Peter Vandamme8, Jens Walter9,10, Koichi Watanabe11,12, Sander Wuyts2, Giovanna E. Felis3,*,†, Michael G. Gänzle9,13,*,† and Sarah Lebeer2† Abstract The genus Lactobacillus comprises 261 species (at March 2020) that are extremely diverse at phenotypic, ecological and gen- otypic levels. This study evaluated the taxonomy of Lactobacillaceae and Leuconostocaceae on the basis of whole genome sequences. Parameters that were evaluated included core genome phylogeny, (conserved) pairwise average amino acid identity, clade- specific signature genes, physiological criteria and the ecology of the organisms. Based on this polyphasic approach, we propose reclassification of the genus Lactobacillus into 25 genera including the emended genus Lactobacillus, which includes host- adapted organisms that have been referred to as the Lactobacillus delbrueckii group, Paralactobacillus and 23 novel genera for which the names Holzapfelia, Amylolactobacillus, Bombilactobacillus, Companilactobacillus, Lapidilactobacillus, Agrilactobacil- lus, Schleiferilactobacillus, Loigolactobacilus, Lacticaseibacillus, Latilactobacillus, Dellaglioa,
    [Show full text]
  • At the Crossroads of Vaginal Health and Disease, the Genome Sequence of Lactobacillus Iners AB-1
    At the crossroads of vaginal health and disease, the genome sequence of Lactobacillus iners AB-1 Jean M. Macklaima,b, Gregory B. Gloorb, Kingsley C. Anukama, Sarah Cribbya, and Gregor Reida,c,1 aCanadian Research and Development Centre for Probiotics, The Lawson Health Research Institute, London, ON, Canada N6A 4V2; and Departments of bBiochemistry and cMicrobiology and Immunology and Surgery, The University of Western Ontario, London, ON, Canada N6A 5C1 Edited by Todd R. Klaenhammer, North Carolina State University, Raleigh, NC, and approved October 12, 2010 (received for review February 1, 2010) Lactobacilli have long been regarded as important constituents Results and Discussion of the healthy human vagina. Lactobacillus iners is the most fre- Phylogeny. A phylogenetic tree was constructed from concatenated quently detected bacterial species in the vagina, but little is known ribosomal subunit protein sequences of several Lactobacillus spe- about its characteristics. We report a description of the whole- cies available from the National Center for Biotechnology In- genome sequence of L. iners AB-1 along with comparative analysis formation (NCBI) database with the addition of sequence for of published genomes of closely related strains of lactobacilli. The L. iners AB-1. The relationship between the species is in agreement Lactobacillus genome is the smallest reported to date, with a 1.3- with previous predictions (12) and places L. iners in the group Mbp single chromosome. The genome seems to have undergone known as the acidophilus complex (13) (Fig. 1 and SI Appendix,Fig. one or more rapid evolution events that resulted in large-scale S1). This clade contains two other Lactobacillus species, L.
    [Show full text]
  • Identification and Characterization of Inerolysin, the Cholesterol Dependent Cytolysin Produced By
    Identification and Characterization of Inerolysin, the Cholesterol Dependent Cytolysin produced by Lactobacillus iners Ryan Rampersaud Submitted in partial fulfillment of the requirements for the degree of Doctor of Philosophy under the Executive Committee of the Graduate School of Arts and Sciences COLUMBIA UNIVERSITY 2014 © 2013 Ryan Rampersaud All rights reserved Abstract Identification and Characterization of Inerolysin, the Cholesterol Dependent Cytolysin produced by Lactobacillus iners Ryan Rampersaud Lactobacillus iners, is a gram positive organism recently identified through the use of culture independent techniques. Identified as a major constituent of the vaginal microbiota, epidemiological studies have suggested that this organism may not provide the protective effects ascribed to other vaginal lactobacilli. Our work here has identified and characterized a pore forming toxin, Inerolysin, produced by this organism. This pore forming toxin was present in all strains of L. iners tested and possessed characteristics which firmly categorize it as a member of the Cholesterol Dependent Cytolsin superfamily. Additionally, we identified pH as a regulatory factor for the activity of Inerolysin as well as other CDCs. Inerolysin was shown to had optimal activity at acidic pH, while other toxins such as pneumolysin and arcanolysin had optimal activity at basic pH. We demonstrate that pH induced changes in activity were reversible, suggesting that a reversible conformational change takes place in the protein. Furthermore, our results show that it is the last step in pore formation, the transition from pre-pore to pore, which is impaired. Our attempts to localize this to particular residues were unsuccessful. Finally, we sought to understand what the vaginal environment of a Lactobacillus dominated flora would look like.
    [Show full text]
  • The Human Vaginal Microbial Community
    View metadata, citation and similar papers at core.ac.uk brought to you by CORE provided by Ghent University Academic Bibliography Research in Microbiology 168 (2017) 811e825 www.elsevier.com/locate/resmic The human vaginal microbial community Mario Vaneechoutte Laboratory for Bacteriology Research, Ghent University, MRB2, De Pintelaan 185, 9000 Gent, Belgium Received 14 June 2017; accepted 16 August 2017 Available online 26 August 2017 Abstract Monopolization of the vaginal econiche by a limited number of Lactobacillus species, resulting in low pH of 3.5e4.5, has been shown to protect women against vaginal dysbiosis, sexually transmitted infections and adverse pregnancy outcomes. Still, controversy exists as to which characteristics of lactobacilli are most important with regard to colonization resistance and to providing protection. This review addresses the antimicrobial and anti-inflammatory roles of lactic acid (and low pH) and hydrogen peroxide (and oxidative stress) as means of lactobacilli to dominate the vaginal econiche. © 2017 Institut Pasteur. Published by Elsevier Masson SAS. All rights reserved. Keywords: Vagina; Glycogen; Lactobacilli; Lactic acid; Hydrogen peroxide 1. Definition and dynamics of the normal vaginal against sexually transmitted infections (STIs) and adverse microbial community pregnancy outcome (APO). In other words, the mere absence of these probiotic bacteria from the vaginal econiche is a 1.1. What is normal? health risk factor for women, their partners and their unborn and new-born children. Moreover, it is becoming clear that it It has recently been claimed that almost any type of vaginal is especially lactic acid [4,5], and probably even more, D-lactic microbial community (VMC) can be considered as normal, acid, as produced by only some vaginal lactobacilli [6], but not since even in the absence of lactobacilli there is frequently a any organic acid, that are health-promoting.
    [Show full text]
  • Effect of Oral Consumption of Capsules Containing Lactobacillus Paracasei
    FEMS Microbiology Ecology, 96, 2020, fiaa084 doi: 10.1093/femsec/fiaa084 Advance Access Publication Date: 8 May 2020 Research Article RESEARCH ARTICLE Effect of oral consumption of capsules containing Lactobacillus paracasei LPC-S01 on the vaginal microbiota of healthy adult women: a randomized, placebo-controlled, double-blind crossover study Ranjan Koirala1,†, Giorgio Gargari1,†, Stefania Arioli1, Valentina Taverniti1, Walter Fiore1,2,ElenaGrossi3, Gaia Maria Anelli3, Irene Cetin3 and Simone Guglielmetti1,*,‡ 1Division of Food Microbiology and Bioprocesses, Department of Food, Environmental and Nutritional Sciences, University of Milan, via Luigi Mangiagalli 25, 20133, Milan, Italy, 2Sofar S.p.A., Via Firenze 40, 20060, Trezzano Rosa (MI), Trezzano Rosa, Italy and 3Department of Biomedical and Clinical Sciences, Unit of Obstetrics and Gynecology, ASST Fatebenefratelli Sacco University Hospital, University of Milan, Via Giovanni Battista Grassi 74, 20157, Milan, Italy ∗Corresponding author: Division of Food Microbiology and Bioprocesses, Department of Food, Environmental and Nutritional Sciences (DeFENS), University of Milan, via Luigi Mangiagalli 25, 20133 Milan, Italy. Tel: +39 0250319136; E-mail: [email protected] One sentence summary: This study aims to assess whether a lactobacillus of vaginal origin can benefit the eubosis of the vaginal mucosa of childbearing age woman upon oral intake. †Both authors contributed equally to this work. Editor: Leluo Guan ‡Simone Guglielmetti, http://orcid.org/0000-0002-8673-8190 ABSTRACT Oral consumption of probiotics is practical and can be an effective solution to preserve vaginal eubiosis. Here, we studied the ability of orally administered Lactobacillus paracasei LPC-S01 (DSM 26760) to affect the composition of the vaginal microbiota and colonize the vaginal mucosa in nondiseased adult women.
    [Show full text]
  • A Nearest Centroid Classification Method for Vaginal Microbial Communities Based on Composition Michael T
    France et al. Microbiome (2020) 8:166 https://doi.org/10.1186/s40168-020-00934-6 RESEARCH Open Access VALENCIA: a nearest centroid classification method for vaginal microbial communities based on composition Michael T. France1,2, Bing Ma1,2, Pawel Gajer1,2, Sarah Brown1,3, Michael S. Humphrys1,2, Johanna B. Holm1,2, L. Elaine Waetjen4, Rebecca M. Brotman1,3 and Jacques Ravel1,2* Abstract Background: Taxonomic profiles of vaginal microbial communities can be sorted into a discrete number of categories termed community state types (CSTs). This approach is advantageous because collapsing a hyper-dimensional taxonomic profile into a single categorical variable enables efforts such as data exploration, epidemiological studies, and statistical modeling. Vaginal communities are typically assigned to CSTs based on the results of hierarchical clustering of the pairwise distances between samples. However, this approach is problematic because it complicates between-study comparisons and because the results are entirely dependent on the particular set of samples that were analyzed. We sought to standardize and advance the assignment of samples to CSTs. Results: We developed VALENCIA (VAginaL community state typENearest CentroIdclAssifier), a nearest centroid-based tool which classifies samples based on their similarity to a set of reference centroids. The references were defined using a comprehensive set of 13,160 taxonomic profiles from 1975 women in the USA. This large dataset allowed us to comprehensively identify, define, and characterize vaginal CSTs common to reproductive age women and expand upon the CSTs that had been defined in previous studies. We validated the broad applicability of VALENCIA for the classification of vaginal microbial communities by using it to classify three test datasets which included reproductive age eastern and southern African women, adolescent girls, and a racially/ethnically and geographically diverse sample of postmenopausal women.
    [Show full text]