Construction of a knockout mouse model for

combined methylmalonic aciduria and

homocystinuria, cblC type (Mmachc)

By

Junhui Liu

Department of Human Genetics

McGill University, Montreal, Canada

A thesis submitted to McGill University in partial fulfilment of the requirements of the

degree of Master © Junhui Liu, December 2009

1 TABLE OF CONTENTS

ABSTRACT ...... 5

RÉSUMÉ ...... 6

ACKNOWLEDGEMENTS ...... 7

LIST OF FIGURES ...... 8

LIST OF TABLES ...... 9

ABBREVIATIONS ...... 10

CHAPTER 1. Introduction ...... 12

Chapter 1.1 Cobalamin ...... 12

1.1.1 Vitamin B12 ...... 12

1.1.2 Structure of cobalamin ...... 12

1.1.3 Distribution of cobalamins among life forms ...... 16

1.1.4 Cobalamin uptake and transport in mammals ...... 16

1.1.5 Intracellular cobalamin metabolism ...... 18

1.1.6 Molecular and functional aspects of cobalamin metabolism ...... 20

cblA, cblB and mut ...... 21

cblA: ...... 22

cblB: ...... 23

mut: ...... 23

cblC, cblD and cblF ...... 24

cblC: This will be discussed in details in Chapter 1.3 later...... 24

cblD: ...... 24

2 cblF: ...... 24

cblE, cblG and cblD variant 1 ...... 25

cblE: ...... 26

cblG: ...... 26

Methylenetetrahydrofolate reductase (MTHFR) deficiency ...... 27

1.1.7 Cobalamin and birth defects ...... 28

Chapter 1.2 Knockout mouse models for genes in cobalamin metabolism and

transport pathway ...... 29

1.2.1 Methylenetetrahydrofolate reductase (Mthfr) knockout mouse model ..... 29

1.2.2 Methionine synthase (Mtr) knockout mouse model ...... 30

1.2.3 Methionine synthase reductase (Mtrr) knockout mouse model ...... 30

1.2.4 Mut knockout mouse model ...... 31

1.2.5 Cubn knockout mouse model ...... 31

1.2.6 Amn mouse model ...... 31

Chapter 1.3 MMACHC...... 32

RATIONALE AND OBJECTIVES OF RESEARCH ...... 38

CHAPTER 2. Materials and Methods ...... 39

Chapter 2.1 Generation of knockout mouse model: ...... 39

2.1.1 Gene trap information ...... 39

2.1.2 Evaluation of the gene trap construct ...... 40

2.1.3 Generation of chimeric mice ...... 42

2.1.4 Generation of F1 mice and molecular characterization of the MMACHC

knockout mice ...... 42

3 2.1.5 Embryo Studies ...... 42

Chapter 2.2 Molecular Characterization ...... 43

2.2.1 DNA extraction ...... 43

2.2.2 RNA extraction ...... 43

2.2.3 Sequencing analysis ...... 44

Chapter 2.3 Biochemical analysis ...... 45

2.3.1 Measurement of metabolites in the blood and urine ...... 45

2.3.2 Fibroblast studies ...... 45

2.3.2a Cell culture ...... 45

2.3.2b Cell lines ...... 45

2.3.2c Propionate incorporation studies ...... 46

2.3.2d Methyltetrahydrofolate incorporation studies ...... 47

CHAPTER 3. Results ...... 48

Chapter 3.1 Molecular and biochemical characterization of adult mice ...... 48

Chapter 3.2 Molecular characterization of mouse embryos ...... 55

Chapter 3.3 Embryo morphology ...... 56

Chapter 3.4 MCM and MS function of mouse fibroblasts ...... 60

CHAPTER 4. Discussion ...... 65

SUMMARY AND CONCLUSION ...... 73

CLAIMS OF ORIGINALITY ...... 74

BIBLIOGRAPHY ...... 75

APPENDIX A: PUBLICATIONS AND PRESENTATIONS ...... 85

APPENDIX B: ETHICS AND CERTIFICATES ...... 90

4

ABSTRACT

The MMACHC gene is responsible for cblC, the most common inborn error of cobalamin metabolism in man. We created a knockout mouse model for its ortholog, Mmachc.

Embryonic stem cells from 129 strain mice heterozygous for Mmachc containing a gene trap in intron 1 were injected into blastocysts from c57B6 mice to generate chimeras.

Crossing chimeric males to c57B6 females generated heterozygous F1 mice.

Geonotyping of F2 mice showed 36 wild type, 71 heterozygous and 3 homozygous. The three homozygous mutant F2 mice had a normal phenotype possibly due to alternative splicing causing expression of wild type Mmachc. Genotyping of embryos showed absence of homozygous mutants at e17.5, suggesting they died earlier. We observed phenotypes including open neural folds, amnionless-like, holoprosencephaly and abnormal limbs and face in individual homozygous mutant embryos. This work enables us to further clarify functions of Mmachc and the role of it in birth defects.

5

RÉSUMÉ

Chez l’homme, le gène MMACHC est responsable de la maladie cblC qui est l’erreur innée la plus commune de sentier de métabolique de la cobalamine. Nous avons créé un modèle de souris knockout pour son orthologue--Mmachc. Des cellules souches embryonnaires de type 129 heterozygotes pour un gène piégé dans l’intron 1 de Mmachc ont été injectées dans des blastocystes de type c57B6 afin de produire des chimères. Le croisement de mâles chimériques et de femelles de type c57B6 a produit des mutants hétérozygotes F1. Le génotypage a démontré 36 souris de type sauvage, 71 hétérozygotes et 3 homozygotes. Le génotypage a démontré l'absence d'embryons homozygotes mutants à e17.5, suggérant que les embryons homozygotes mutants sont morts avant e17.5. Nous avons observé des dysmorphologies telles que des plis neuronaux ouverts, un phenotype similaire à ‘amnionless’, de l’holoprosencephaly et des membres et visages anormaux dans les embryons homozygotes mutants. Les trois souris homozygotes mutantes qui ont survécu à la naissance avaient un phenotype normal. Elles exprimaient

Mmachc de type sauvage et mutant, possiblement en raison d’un épissage alternatif.

6 ACKNOWLEDGEMENTS

I would like to start by thanking Dr. David S Rosenblatt for all his wise guidance and

thoughtful help over the entire period I spent in his lab. He is always supportive and his

sense of humor brings us laugh and joy over the past few years. It’s my great honor to

have the chance working with him.

I would like to thank Dr. Loydie Jerome-Majewska for her help on working with mice

and mouse embryos. Her expertise in the field guided me through the tough procedures.

I would like to thank Dr. David Watkins for his generous sharing of experience of

technical issues. His authentic editorial technique helped a lot with all my writings. I

would also like to thank him on helping me with work on propionate incorporation and

methyltetrahydrofolate incorporation.

I would like to thank Dr. Jordan Lerner-Ellis for his initial guiding me through the lab. I

would also like to thank him for his expertise in technical issues. I would particularly like

to thank him for being good friends.

I would like to thank Isabelle Racine-Miousse, Natasscia Anastasio, Lama Yamani, Fei

Li, Peg Illson, Amanda Loewy, Abbygail Gradinger, and Emily Moras who have been

great companions in the lab. They have also helped me in their own areas of laboratory

expertise.

I would like to thank Angela Hosack, Maria Galvez, Jocelyne Lavallée, Laura Benner,

Vanessa Flannery, Morgan Patterson and Yasmin Karim for their help in different aspects of lab functioning. I would also thank Gail Dunbar for teaching me techniques of tissue culture.

I would like to thank my family and friends for their support and encouragement.

7

LIST OF FIGURES

Figure 1: Cobalamin Structure………………………………………………………...14

Figure 2: Cobalamin uptake and transport (Li and Watkins, 2009)………………..18

Figure 3: Intracellular cobalamin metabolism (Li and Watkins, 2009)…………….19

Figure 4: Structure of the gene trap construct pGT0lxr

(http://www.sanger.ac.uk/PostGenomics/genetrap/vectors/)………………………...39

Figure 5: Structure of the Mmachc gene incorporating the pGT01xr gene trap construct. ………………………………………………………………………………..41

Figure 6: PCR genotyping results for 6 F2 mice……………………………………...49

Figure 7 : PCR genotyping results for the 110 F2 mice………………………………50

Figure 8: Expression analysis of F2 mouse tissues by RT-PCR……………………..54

Figure 9 : Mouse embryo dysmorphology………………………………………….....58

Figure 10: Genotyping results for mouse fibroblast lines……………………………61

Figure 11: Expression data for mouse fibroblast cell lines…………………………..62

Figure 12: Propionate incorporation in intact mouse fibroblasts…………………...63

Figure 13: MeTHF incorporation in intact mouse fibroblasts……………………….64

8 LIST OF TABLES

Table 1: Summary of the genes involved in the cobalamin pathway and the corresponding protein and disorders. ……………………………………………….21

Table 2: Primers used in the current study…………………………………………44

Table 3: Results of measurement of homocysteine (HCY) and methylmalonic acid

(MMA) levels in serum of 4 mice…………………………………………………….52

Table 4: Results of measurement of HCY and MMA in urine of 6 mice………….53

Table 5: Genotypes and phenotypes of dissected embryos…………………………56

9 ABBREVIATIONS

AdoCbl: 5’deoxyadenosylcobalamin AMN: Gene name for amnionless ATR: Adenosyltransferase Cbl: Cobalamin cDNA: Complementary DNA CNCbl: Cyanocobalamin CUBN: Gene name for cubilin DNA: Deoxyribonucleic acid HC: Haptocorrin HCY: Homocysteine HPE: Holoprosencephaly IF: Intrinsic factor LMBRD1: cblF gene MCM: Methylmalnyl CoA mutase MeCbl: Methylcobalamin MeTHF: Methyltetrahydrofolate MMA: Methylmalonic acid MMAA: Gene name for methylmalonic aciduria cblA type MMAB: Gene name for methylmalonic aciduria cblB type MMACHC: Gene name for methylmalonic aciduria and homocystinuria cblC type MMADHC: Gene name for methylmalonic aciduria and homocystinuria cblD type MS: Methionine synthase MTRR: Gene name for homocystinuria cblE type MTR: Gene name for homocystinuria cblG type MTHFR: Methylenetetrahydrofolate reductase OHCbl: Hydroxocobalamin RNA: Ribonucleic acid RT-PCR: Reverse transcription-polymerase chain reaction SDS: Sodium dodecyl sulphate

10 TC: Transcobalamin TCblR: Transcobalamin receptor

Key Words: cobalamin, vitamin B12, cblC, MMACHC, mouse model, embryonic lethal

11 CHAPTER 1. Introduction

Chapter 1.1 Cobalamin

1.1.1 Vitamin B12

The discovery and purification of cobalamin was a “major medical triumph of the

th first half of the 20 century” (Stabler, 1999). The crystal structures of different forms of

cobalamin have been determined and extensive work has been performed on cobalamin

and its cofactors. It has been documented that deficiency in absorption, transport and

cellular processing of cobalamin is related to hereditary as well as acquired human

diseases. Multiple genes have been identified which, when mutated, cause inherited

diseases of cobalamin transport or metabolism. These have provided insight into the

biological function of cobalamin. Bacterial studies have addressed the biochemistry of

cobalamin, its dependent enzymes and the genes encoding enzymes involved in bacterial

cobalamin metabolism.

1.1.2 Structure of cobalamin

Cobalamin is an organometallic compound consisting of a central cobalt atom

surrounded by a planar corrin ring (Fig 1). A phosphoribo-5,6-dimethylbenzimidazolyl group extends to the lower axial position of the cobalt atom, covalently bound to the corrin ring. Various groups can be added in the upper axial position to complete the molecule. The central cobalt atom has three oxidation states: cob(III)alamin, cob(II)alamin and cob(I)alamin, respectively the trivalent, divalent and monovalent oxidation states. It has to be reduced to the monovalent state before other chemical moieties can bind to the upper axial position. In mammals, cobalamin is routinely isolated in 3 forms: hydroxocobalamin (OHCbl), methylcobalamin (MeCbl) and

12 adenosylcobalamin (AdoCbl). Cyanocobalamin (CNCbl) is a non-physiologic form generated during cobalamin purification and the pharmacological form that is given under the name of vitamin B12.

13

Figure 1: Cobalamin Structure (http://en.wikipedia.org/wiki/File:Cobalamin.png). R represents the upper axial ligand, which can be cyanoco group (CN), hydroxo group

(OH), 5’-deoxyadenosyl or methyl group.

14

Figure 1: Cobalamin Structure (http://en.wikipedia.org/wiki/File:Cobalamin.png).

15 1.1.3 Distribution of cobalamins among life forms

Only prokaryotes are able to synthesize cobalamin (Herbert 1988). Higher plants do not produce cobalamin nor do they need it. However, animals do require cobalamin in their diets. Humans must take in cobalamin from exogenous sources. It is recommended that adults take in 2.4 µg/day of cobalamin, with the aim of ensuring absorption of 1

µg/day, assuming absorption of about 50% from food (Stabler and Allen, 2004). The

World Health Organization has also recommended a daily intake of 1 µg cobalamin for normal adults; 1.3 and 1.4 µg daily for lactating and pregnant women respectively; and

0.1 µg/day for infants (Watkins et al, 2009.). Cobalamin is found in virtually all animal tissues. The majority of cobalamin in the body is AdoCbl and MeCbl (Linnell 1975).

AdoCbl is found to be the predominant form in most soft tissues. MeCbl is found to be the predominant form in plasma (Lindstrand and Stahlberg 1963). However, there is great variety in cobalamin distributions.

1.1.4 Cobalamin uptake and transport in mammals

Cobalamin from dietary sources enters the stomach where it is released from dietary protein. It binds to haptocorrin (HC) that is present in gastric and salivary fluids in mammals and has high affinity for cobalamin (Allen et al., 1978a; Allen et al., 1978b).

HC is then digested by pancreatic proteases and Cbls are released in the upper duodenum where they can bind to intrinsic factor (IF). Subsequently, the Cbl-IF complex interacts with the ileal intrinsic factor receptor complex cubam which is composed of two proteins: cubilin and amnionless (Fig 2).

Cubilin is a 460 kDa protein on the border of ileal cells, the renal proximal tubule and yolk sac (Moestrup et al., 1998). It is a large peripheral membrane protein that has 8

16 EGF-like and 27 CUB domains. The gene CUBN is located on chromosome 10p12.31

(Kozyraki et al., 1998; Moestrep et al., 1998) and is highly expressed in kidney and yolk

sac (Xu and Fyfe, 2000). Amnionless is a transmembrane protein about 48 kDa. It binds

to the amino terminal of cubilin and facilitates the endocytosis of cubilin by the

enterocyte (Alpers 2005). The corresponding gene amnionless (AMN) was first

discovered by random mutagenesis in extra embryonic visceral endoderm layer. It is

highly expressed in CUBN-expressing tissues including kidney, intestine and mouse visceral yolk sac, and is required for proper formation of amnion and primitive streak in mice. The AMN gene is located on chromosome 14q32.3. (Kalantry et al., 2001). CUBN

and AMN together form a heterodimer--cubam, which is the functional receptor required

for IF-cobalamin complex internalization, renal protein reabsorption, and early mouse

gastrulation. It has been shown in humans that Imerslund-Gräsbeck syndrome (MGA1;

OMIM 261100), characterized by mild proteinuria and megaloblastic anemia due to

decreased ability to uptake cobalamin from intestine, is related to mutations in either

CUBN or AMN (Fyfe et al., 2004).

Cobalamin that has been taken up by enterocytes is then transported across the

basolateral membrane into the portal blood, binding to transcobalamin (TC) (Sennett et

al., 1981).

17

Figure 2: Cobalamin uptake and transport (Li and Watkins, 2009). Cbl: cobalamin,

HC: haptocorrin, IF: intrinsic factor, TC: transcobalamin. Cobalamin interacts with HC in

the stomach. The complex is broken down in the jejunum and cobalamin binds to IF. The

Cbl-IF complex interacts with cubam consisting of cubilin and amnionless in the distal

ileum and is transported into the blood.

1.1.5 Intracellular cobalamin metabolism

As more genes involved in cellular cobalamin pathway are discovered, the

process becomes clearer, however, the details are still poorly understood. The TC-Cbl

complex binds to the TC receptor (TCblR) on plasma membrane and is transported into

the cell by lysosomal mediated endocytosis (Vassiliadis et al., 1991; Quadros et al., 2009).

Subsequent to degradation of TC, cobalamin is released into the cytoplasm from

18 lysosomes in the cob(III)alamin oxidation sate, and must be reduced to its cob(I)alamin

oxidation state before adenosylation or methylation can occur to generate the active

coenzyme forms. AdoCbl binds to methylmalonyl CoA mutase (MCM), which catalyzes

the conversion of L-methylmalonyl CoA to succinyl CoA, in the mitochondria. MeCbl

serves as a methyl donor when methionine synthase (MS) catalyzes the conversion of

homocysteine to methionine in the cytoplasm (Fig 3).

Figure 3: Intracellular cobalamin metabolism (Li and Watkins, 2009). AdoCbl: 5’- deoxyadenosyl cobalamin, LMBRD1: cblF protein MCM: methylmalnyl CoA mutase,

MeCbl: methyl cobalamin, MMAA: cblA protein, MMAB: cblB protein, MMACHC: cblC protein. MMADHC: cblD protein. MS: methionine synthase, MSR: methionine synthase reductase, TCblR: transcobalamin receptor. Cobalamin binds to TC in blood and the complex binds to TCblR before entering the cell through endocytosis. TC degraded in

19 the lysosome and cobalamin is released into the cytoplasm. It finally forms two cofactors:

AdoCbl in the mitochondria and MeCbl in the cytoplasm.

1.1.6 Molecular and functional aspects of cobalamin metabolism

Patients with inborn errors of vitamin B12 (cobalamin; Cbl) metabolism have been divided into seven categories (cblA-cblG) based on complementation analysis (Gravel et al, 1975; Willard et al, 1978; Watkins and Rosenblatt, 1986; Watkins and Rosenblatt,

1988; Coelho et al., 2008). Multiple genes affecting the two different cobalamin metabolite pathways have been identified. Mutations in these genes result in decreased synthesis of AdoCbl, of MeCbl, or of both cobalamin coenzyme forms. The genetic disorders affecting the MCM pathway alone include cblA, cblB, mut and cblD variant 2.

Disorders affecting MS alone include cblE, cblG and cblD variant 1. Disorders affecting both cobalamin-dependent reactions are cblC, classic cblD and cblF.

20 Gene Protein Disease

MMAA MMAA cblA

MMAB Cobalamin Adenosyltransferase cblB

MMACHC MMACHC cblC

MMADHC MMADHC cblD

MTRR Methionine Synthase Reductase cblE

LMBRD1 LMBD1 cblF

MTR Methionine Synthase cblG

CUBN Cubilin Imerslund-Gräsbeck syndrome

AMN AMN Imerslund-Gräsbeck syndrome

MTHFR MTHFR MTHFR deficiency

Table 1: Summary of the genes involved in the cobalamin pathway and the

corresponding protein and disorders.

cblA, cblB and mut

These three autosomal recessive disorders affect either the activity of MCM (mut) or the synthesis of its AdoCbl cofactor (cblA and cblB); synthesis of MeCbl is normal.

This usually results in isolated methylmalonic aciduria (Rosenblatt and Fenton, 2001).

Patients with the mut form of methylmalonic aciduria can be subdivided into mut 0, in which there is no detectable MCM activity in fibroblasts, and mut −, in which high

concentrations of OHCbl can induce some residual activity. Using fibroblast extracts

studies showed that cblA could synthesize AdoCbl from added OHCbl while cblB cells could not. Therapy with supplementation of OHCbl is less effective for cblB patients than

21 for cblA ones (Matsui et al., 1983; Lerner-Ellis et al., 2005; Hörster et al, 2007).

Fibroblast studies with the mut − and cblA groups showed enhanced propionate incorporation after treatment with OHCbl (Merinero et al., 2008). Clinical findings in all patients with methylmalonic aciduria are similar, including lethargy, failure to thrive, recurrent vomiting, respiratory distress, dehydration and muscular hypotonia.

Developmental retardation, hepatomegaly or coma was also observed but less frequently

(Watkins et al., 2009). Nearly all the MCM deficient patients have acidosis (Matsui et al.,

1983; Horster et al., 2007). cblA:

Mutations in the MMAA (MIM 251000) gene lead to the cblA disorder. MMAA is located on chromosome 4q31.1–2 and encodes a protein of 418 amino acids (Dobson et al., 2002). Study of cblA fibroblasts showed reduced synthesis of AdoCbl from exogenous CNCbl with normal levels of MeCbl, and reduced ability to incorporate propionate into cellular macromolecules indicating lower AdoCbl-dependent MCM activity (Watkins et al., 2000).

MeaB, a bacterial ortholog of MMAA, which forms a complex with MCM, is believed to protect MCM from inactivation (Korotkova et al., 2004). Further studies showed that MeaB protected MCM from oxidative interception of its radical intermediates during catalytic cycle (Padovani and Banerjee, 2006). It has been suggested that MeaB controls the transfer of AdoCbl to MCM and also screens for the active cofactor AdoCbl to avoid generation of inactive MCM (Banerjee et al, 2009). However, there is no evidence concerning such a role of MMAA in human.

22 Individuals with the cblA typically have severe disease in infancy or early childhood and sometimes life threatening acidotic crises (Rosenblatt and Fenton, 2001).

About 90% of patients respond well to intake of cobalamin and about 70% will be well at the age of 14 years old (Yang et al., 2004). A case report indicated that oral cobalamin therapy in a woman carrying an affected fetus lowered the maternal excretion of MMA resulting in a baby born with only moderately elevated MMA and developed normally on a restricted protein diet (Ampola, 1975). cblB:

The cblB disorder results from mutations of the MMAB (MIM 251110) gene, localized to chromosome 12q24, which encodes a protein of 250 amino acids. MMAB encodes a cobalamin adenosyltransferase (ATR) that catalyzes adenosylation of cobalamin in the mitochondria (Dobson et al., 2002). It has been shown that human ATR will convert cobalamin to AdoCbl and deliver it to MCM (Padovani et al., 2008). mut:

MCM is encoded by the mut gene on chromosome 6p12-21.2 (Ledley et al., 1988).

Human MCM is a homodimer that is able to bind two molecules of AdoCbl (Kolhouse et al., 1980; Fenton et al., 1982). It is a mitochondrial matrix enzyme, catalyzing the isomerization of methylmalonyl-CoA, generated during the process of catabolism of odd- chain fatty acids, cholesterol, and branched-chain amino acids, to succinyl-CoA which can enter the Krebs cycle (Banerjee, 2003).

23 cblC, cblD and cblF

cblC: This will be discussed in details in Chapter 1.3 later.

cblD:

The cblD disorder (MIM 277410) was first described in 1970 (Goodman et al.,

1970; Willard et al., 1978). Like the cblC disorder, the patients presented with both

methylmalonic aciduria and homocystinuria. Fibroblasts of the original cblD patients

showed the same biochemical phenotype as cblC fibroblasts, with decreased synthesis of

both AdoCbl and MeCbl and decreased function of both MS and MCM. However, the two

disorders were differentiated through complementation analysis (Willard et al., 1978).

The cblD disorder has recently been further categorized into three groups with rather

different clinical and biochemical findings (Suormala et al., 2004). One group presents with

isolated homocystinuria only (cblD variant1). The second group presents with

methylmalonic aciduria only with the phenotype similar to cblA patients (cblD variant2).

The third one presents with both homocystinuria and methylmalonic aciduria.

Recently, the gene affected in cblD disease has been identified as MMADHC on

chromosome 2q23.2. It has been suggested that mutations in the C-terminal region of

MMADHC were associated with isolated homocystinuria, mutations in N-terminal region

were associated with isolated methylmalonic aciduria, and mutations leading to a truncated

product were associated with combined homocystinuria and methylmalonic aciduria.

However, the function of the MMADHC protein is not known yet (Coelho et al., 2008).

cblF:

All the cblF (MIM 277380) patients had hyperhomocysteinemia and methylmalonic

aciduria except for one who had isolated methylmalonic aciduria. Clinical presentation has

24 been variable, with no finding being shared by all the patients that have been studied.

Frequent findings include small weight for gestational age, poor feeding, failure to thrive,

persistent stomatitis and developmental delay (Rosenblatt et al., 1986; Shih et al., 1989;

MacDonald et al., 1992; Waggoner et al., 1998).

Fibroblast studies with cblF patient indicate both the synthesis of cofactors and the function of cobalamin-dependent enzymes are decreased compared with control fibroblasts, which is similar to cblC and cblD fibroblast studies. However, in the cblF fibroblasts, a

large amount of free cobalamin is trapped in lysosomes, preventing its conversion to

cofactors (Rosenblatt et al., 1985). Although there is a concern that excess cobalamin in

lysosomes may impair lysosomal function when OHCbl is used in treatment of the disorder,

OHCbl by intramuscular injection is fairly effective. (Watkins et al., 2009).

Through homozygosity mapping in 12 unrelated cblF individuals and microcell-

mediated chromosome transfer, LMBRD1 on chromosome 6q13 was found to be the gene

underlying the cblF defect of cobalamin metabolism (Rutsch et al., 2009). LMBRD1

encodes a lysosomal membrane protein, LMBD1, with homology to the lipocalin

membrane receptor LIMR (Wang et al., 2005). Since the defect in cblF appears to impair

transport of cobalamin that has been released from transcobalamin, across the lysosomal

membrane into the cytoplasm and since the LMBD1 protein was localized to the lysosomal

membrane, it was suggested that LMBD1 is a lysosomal transmembrane exporter for

cobalamin (Rutsch et al., 2009).

cblE, cblG and cblD variant 1

Based on result of complementation analysis, patients with functional MS deficiency

could be further divided into three different groups: cblE, cblG and cblD variant 1. cblE and

25 cblG patients had similar clinical findings. Common clinical findings include megaloblastic

anemia and neurologic problems such as developmental delay and cerebral atrophy.

Fibroblasts from both groups of patients show decreased synthesis of MeCbl and decreased

activity of MS while AdoCbl synthesis and MCM activity remain normal. cblG patients had

decreased MS activity in cell extracts under all the conditions attempted. cblE cell extracts had normal activity under standard assay conditions, however, when the level of reducing reagent was decreased, MS activity became lower than controls (Watkins and Rosenblatt,

1989). Therapy with intramuscular OHCbl, once or twice per week, has been used to treat these disorders. This can correct the anemia and metabolic errors. However, the neurologic abnormalities are difficult to reverse. Systemic OHCbl treatment of the mother during pregnancy with an affected fetus (cblE) has yielded a favorable result in one case

(Rosenblatt et al., 1985).

cblE:

The gene responsible for the cblE complementation group was identified as

MTRR (MIM 602568), located on chromosome 5p15.2-15.3, which encodes methionine

synthase reductase (Leclerc et al., 1998). Methionine synthase reductase (MSR) is

responsible for maintaining the cob(I)alamin coenzyme attached to MS in the reduced form. It achieves this through catalyzing reductive methylation of cob(II)alamin to form

MeCbl with S-adenosylmethionine as a methyl group donor. cblG:

The cblG disorder is the result of mutations in the MTR (MIM 250940) gene, which codes for MS (Leclerc et al., 1996; Gulati et al., 1996; Wilson et al., 1998). MS has different binding sites for cobalamin, 5-methyltetrahydrofolate, homocysteine and S-

26 adenosylmethionine. It catalyzes the transfer of a methyl group from 5-methyl-THF to homocysteine to form methionine (Taylor 1982). It has been found that the activity of MS in cblG patient cell extracts can be either lower than or similar to that of wild type ones

(Watkins and Rosenblatt, 1989; Hall et al., 1987). Fibroblast extract studies also showed that some of these cblG patients almost have non-detectable MS activity (Sillaots et al., 1992) and they were later identified with null MTR mutations (Wilson et al., 1998). Therefore, there is biochemical heterogeneity among the cblG patients with functional MS deficiency.

There has not been a clear genotype-phenotype correlation. The most common cblG

mutation (c.3518C>T) has not been found in the homozygous state in humans, suggesting

this might be embryonic lethal (Watkins et al., 2002).

Methylenetetrahydrofolate reductase (MTHFR) deficiency

Methylenetetrahydrofolate reductase (MTHFR) deficiency is an autosomal recessive disorder and the most common inborn error of folate metabolism. Deficiency of

MTHFR impairs the synthesis of methyltetrahydrofolate, the methyl donor for methylation of homocysteine to methionine by cobalamin-dependent MS. Patients with

MTHFR disorder have elevated homocysteine concentrations in blood, mild homocystinuria, and decreased concentrations of methionine in plasma. Various clinical presentations have been observed including early death during infancy with severe neurological disorder, patients with adult onset and clinically asymptomatic individuals

(Haworth et al., 1993) Megaloblastic anemia was not observed.

MTHFR deficient patients have been found to have dilatation of cerebral ventricles, internal hydrocephalus and microgyria. Perivascular changes, demyelination, astrocytosis, infiltration and gliosis have been reported (Kanwar et al., 1976). Arterial and cerebral

27 venous thrombosis have been suggested to be causes of death. In some patients with severe

MTHFR deficiency, subacute combined degeneration of the spinal cord has been observed

(Clayton et al., 1986; Beckman et al., 1987)

The human MTHFR gene is located on chromosome 1p36.3, with 11 exons spanning

2.2 kb. The MTHFR protein is about 70 kd (Goyette et al., 1994; Goyette et al., 1998).

MTHFR deficiency is difficult to treat, with a poor prognosis once neurologic involvement is evident. Treatment includes folate, methylTHF, methionine, pyridoxine, cobalamin, carnitine and betaine. Dietary betaine therapy started at neonatal period has been shown to increase the cerebrospinal fluid methionine level, which may compensate for the impaired cerebral methionine cycle (Strauss et al., 2007).

1.1.7 Cobalamin and birth defects

Folate deficiency leads to elevation of homocysteine levels and impairment of S-

adenosylmethionine-dependent transmethylation which may be the cause of a number of

birth defects including cleft lip with or without cleft palate, palate and cardiac outflow

defects, dilated cardiomyopathy and neural tube defects (NTDs) (Kapusta et al., 1999;

Wong et al., 1999; Verkleij-Hagoort et al., 2006; De Bie et al., 2009). Since deficiency of

cobalamin results in similar biochemical effects, it may also increase the risk of birth

defects. Cobalamin has been suggested to be associated with NTDs as early as in 1980

(Schorah et al., 1980; Ray and Blom, 2003). It has also been observed in countries like

India where people have low cobalamin uptake that, the risk of NTD is high (Sharma et

al., 1994).

28 Chapter 1.2 Knockout mouse models for genes in cobalamin metabolism and

transport pathway

Several knockout mouse models have been created for other components of

cobalamin metabolism and transport. These include a methionine synthase (Mtr) knockout model, a methylenetetrahydrofolate reductase (Mthfr) knockout model, a methionine synthase reductase (Mtrr) knockout model, a methylmalonyl CoA mutase

(Mut) knockout model, a cubilin (Cubn) knockout model and an amnionless (Amn)

knockout model.

1.2.1 Methylenetetrahydrofolate reductase (Mthfr) knockout mouse model

Mthfr in embryonic stem (ES) cells was inactivated by targeted gene insertion and then blastocyst injection was performed in order to generate the knockout mouse model.

Mice deficient in Mthfr exhibited hyperhomocysteinemia and reduced methylation capacity (Chen et al., 2001). Mthfr -/- mice were shown to have higher mortality rate on

BALB/c genetic background than on c57B6 genetic background. (Chen et al., 2001;

Schwahn et al., 2004). Betaine supplementation throughout pregnancy until weaning was shown to increase the survival rate as well as improve somatic development (Schwahn et al., 2004). Chen et al. reported that low dietary folate and Mthfr deficiency decreased proliferation and increased apoptosis in neural cells (Chen et al., 2005). Maternal Mthfr deficiency and low dietary folate led to congenital heart defects in offspring (Li et al.,

2005). Embryonic studies indicated that low folate as well as Mthfr deficiency in adult

female mice increased the chance of embryonic developmental delay and placental

abnormalities (Pickell et al., 2009). Further studies showed that maternal folate

29 deficiency affected myocardial proliferation but not apoptosis in hearts of Mthfr +/- embryonic mice (Li and Rozen, 2006).

1.2.2 Methionine synthase (Mtr) knockout mouse model

The Mtr knockout mouse model was created by replacing 3.8 kb of Mtr with a 1.8 kb PGK-neo cassette. Heterozygous mice have almost the same level of plasma homocysteine and methionine as the wild-type mice. Homozygous mutant embryos died soon after implantation and could not be rescued by nutritional supplementation during pregnancy, which demonstrates the importance of the enzyme for early development in mice (Swanson et al., 2001).

1.2.3 Methionine synthase reductase (Mtrr) knockout mouse model

Mice generated by targeted disruption of Mtrr that completely removed its activity resulted in embryonic lethality. Therefore, a gene-trap was inserted between Mtrr exons 9 and 10, resulting in a mouse model with reduced methionine synthase reductase activity in homozygous mutants. The gene trap leads to a hypomorphic expression pattern of Mtrr mRNA, which is tissue dependent. Methionine synthase reducatase activity in livers, kidneys, brains, and especially in hearts was decreased in the homozygous mutant mice (Elmore et al., 2007).

Metabolic measurements showed that the homozygous mutant mice had increased plasma homocysteine and decreased plasma methionine. Growth curves showed that homozygous mutant males had reduced weight gain up until the 10th week of age compared with wild type males. Studies at embryonic day 9.5 (e9.5) showed that Mtrr was expressed throughout the whole embryo, with stronger expression in the optic eminence, forebrain, midbrain, part of hindbrain and the neural tube (Elmore et al., 2007).

30 1.2.4 Mut knockout mouse model

One of the main causes of methylmalonic aciduria in humans is mutations in methylmalonyl-CoA mutase (MCM). A murine model of mut0 methylmalonic aciduria was constructed to assess the efficacy of virus-mediated gene therapy in rescuing the neonatal lethality seen in the homozygous mutant mice. The model was constructed by a targeted deletion of exon 3 of the Mut gene. Homozygous mutant pups died soon after birth. However, adenovirus-mediated hepatic MCM expression could rescue homozygous mutant pups from neonatal mortality. The treated mutants had expression of Mut mRNA in liver. They had reduced levels of MMA compared with the untreated homozygous mutants (Chandler et al., 2008).

1.2.5 Cubn knockout mouse model

Targeted disruption of the Cubn gene in mice resulted in embryonic lethality.

Homozygous mutants had developmental retardation in utero and died between e7.5 and e13.5. Developmental studies showed that cubilin is necessary for embryonic development as well as for the formation of somites, definitive endoderm, visceral endoderm, and for the absorptive function of visceral endoderm (Smith et al., 2006).

1.2.6 Amn mouse model

Analysis of mouse embryos from parents both heterozygous for inactivated Amn via transgene insertion found that the homozygous mutant embryos have no amnion and can not survive through gestation. It has also been observed that homozygous Amn null embryos lack somites or trunk mesoderm (Tomihara-Newberger et al., 1998); whereas homozygous mutations of human AMN only lead to the Imerslund-Gräsbeck syndrome phenotype (Tanner et al., 2003).

31 The discrepancy between the quite different phenotypes needs to be explained. It

has been suggested that the N-terminus of AMN is essential for cobalamin absorption in

humans. N-terminal mutations led to truncated product, translation would start from

alternative start codons downstream resulting in a protein that lack cobalamin uptake

activity. This was supported by mutations identified in AMN in Imerslund-Gräsbeck

patients (Tanner et al., 2003). It is also possible that AMN in humans does not play the

same role as in mice where it is required for primitive streak assembly.

Chapter 1.3 MMACHC

The cblC disorder (MIM 277400) is the most common inborn error of cobalamin

metabolism, with over 500 patients identified. Patients have both homocystinuria and

methylmalonic aciduria as well as hypomethioninemia and cystathioninuria.

Patients usually present in the first year of life with lethargy, poor feeding, failure to

thrive and developmental delay. The majority of patients have megaloblastic anemia with some also having hypersegmented neutrophils, neutropenia and thrombocytopenia.

Neurological dysfunctions include hypotonia, seizures, and developmental delay. Other

patients have later onset disease, sometimes as late as in adulthood, with spasticity,

myelopathy, delirium, dementia, or psychosis (Rosenblatt et al., 1997). Based on the age of

onset, patients can be categorized into two groups: early onset (<4 years old) and late onset

(>4 years old). Although the clinical manifestations of cblC disease are well described, the disease mechanism is still poorly understood.

Fibroblasts from cblC patients are not capable of synthesizing MeCbl and AdoCbl from exogenous CNCbl. Total cobalamin accumulation in those fibroblasts is lower than in control ones. Through measurement of incorporation of labeled 5-

32 [14C]methyltetrahydrofolate and [14C]propionate into cellular macromolecules, it has

been shown that function of MS and MCM are decreased.

Subsequent to localizing the gene responsible for cblC disease to chromosome 1 through linkage analysis (Atkinson et al., 2002), homozygosity mapping and haplotype analyses were performed to narrow down the interval where the gene was localized, and the gene was identified by sequencing of genes in this interval for mutations in cblC

patients. Mutations in the gene MMACHC located on chromosome 1p34.1 are responsible

for the cblC disorder. Northern blot analysis and EST database searches have shown that

MMACHC is ubiquitously expressed in humans. Human MMACHC contains 5 exons with

a coding sequence of 846 nucleotides (Lerner-Ellis et al., 2006). More than 50 mutations

have been identified in over 400 cblC patients (Lerner-Ellis et al., 2006; Lerner-Ellis et al.,

2009). The common c.271dupA and c.331CT (p.R111X) mutations are associated with early onset cblC disease (patients homozygous for these mutations have first symptoms younger than 4 years), while another common mutation c.394CT (p.R132X) is associated with late onset disease (patients homozygous for mutations have first symptom older than 4 years). It has been suggested that differences in mRNA stability or residual function of

the MMACHC protein lead to different phenotypes (Lerner-Ellis et al., 2006). Allelic

imbalance experiments showed that the expression level of MMACHC mRNA in cells

from late onset patients is higher than that in cells from early onset ones (Lerner-Ellis et

al., 2009). Nonetheless, we do not know the exact mechanism leading to the differences.

Different degrees of nonsense mediated RNA decay (NMD) was suggested to be one

possibility. mRNA that carries the c.271dupA or c.331C>T mutation might be degraded

33 through NMD while the mRNA carrying c.394C>T mutation may result in a truncated

product with residual function (Lerner-Ellis et al., 2009).

The C-terminal domain of the MMACHC protein is homologous to the C-

terminal domain of the bacterial TonB protein (Lerner-Ellis et al., 2006). TonB is

involved in transducing energy generated in the process of transporting cobalamin and

iron siderophores across the bacterial outer membrane. Therefore it has been suggested

that the C-terminal domain of MMACHC functions similarly to the TonB C-terminal

domain which has to interact with the bacterial outer membrane receptor before the

transduction process can occur (Bayer and Harjes, 2001). Upon binding to a protein

partner, MMACHC would facilitate conformational changes required for transporting

cobalamin into cytoplasm (Kim et al., 2008). MMACHC residues 198–203 is the only

region of the C-terminal domain that is significantly distinguished from the TonB

structure. In bacteria, the corresponding residues have been shown to bind the Ton box of

TonB-dependent outer-membrane receptors (Warren, 2006) Therefore MMACHC may

bind to a cognate protein partner through a different domain (Lerner-Ellis et al., 2006).

Sequencing showed that there is a cobalamin-binding motif HXXG-X~30-GG

between residues 122-156 of MMACHC. This motif was identified by comparison of the

structures of MS and MCM (Dixon et al., 1996; Evans et al., 2004). The role of the

MMACHC N-terminal domain is not clear yet but it has been suggested it is involved in

releasing cobalamin from the lysosome to the cytoplasm (Lerner-Ellis et al., 2006).

Recently, a lysosomal protein, LMBD1, was found to be involved in the same process

(Rutsch et al., 2009), suggesting the N-terminal of MMACHC may interact with LMBD1 to facilitate exporting of cobalamin to the cytoplasm.

34 Cobalamin in the “base-on” form has a nitrogen of the 5,6-dimethylbenzimidazole

base that co-ordinates with the central cobalt in the lower axial position, while various

groups can co-ordinate with cobalt in the upper axial position. Cobalamin binds to

MMACHC and ATP:cobalamin adenosyltransferase in the base-off conformation with nothing co-ordinating in the lower axial position. When cobalamin binds to MS and

MCM, the lower axial ligand is replaced by a histidine residue of the enzyme (Drennan et

al., 1994; Padmakumar and Banerjee, 1995; Shibata et al., 1999). Kim et al. have shown

that after binding to MMACHC, CNCbl still remains in the base-on state, while AdoCbl

and MeCbl were both in the base-off state indicating that the decyanation is different

from the dealkylation process. Further studies showed that when NADPH and dual

flavoprotein oxidoreductase were added to MMACHC with bound CNCbl, the base-on to

base-off mode conversion could occur while no conversion could be detected in the

absence of MMACHC. This suggests MMACHC catalyzes the reductive decyanation

process (Kim et al., 2008).

Alkylcobalamins are cobalamins with alkyl groups on its upper axial position

including AdoCbl and MeCbl. Experiments in cultured normal bovine aortic endothelial

cells (BAEC) showed that they were able to efficiently dealkylate and convert

alkylcobalamins to predominantly AdoCbl and to some extent MeCbl. However, the ratio

of AdoCbl to MeCbl was dependent on whether OHCbl or CNCbl was used as substrate.

In fibroblast studies, cblC mutant cell lines were much less efficient at converting [57Co]

labeled propylcobalamin (PrCbl) to [57Co]-AdoCbl and [57Co]-MeCbl compared with

wild type fibroblasts. Therefore, MMACHC is involved in removing the alkyl group from

the upper axial position of the alkylcobalamins (Hannibal et al., 2009).

35 It is still hard to treat early-onset cblC patients. Around one-third of patients with onset in the first month of life die (Rosenblatt et al., 1997). It has been shown that for cblC fibroblasts, the increase of MS and MCM activity after supplementation with high concentrations of CNCbl was much lower than after supplementation with OHCbl

(Mellman et al., 1979), which is probably because CNCbl has to go through decyanation catalyzed by MMACHC to convert to its active cofactor forms (MeCbl and AdoCbl). This matches the finding that patients with the cblC disorder respond better clinically to therapy with OHCbl than CNCbl (Anderson and Shapira, 1998). Currently, therapy involves 1 mg OHCbl by intramuscular injection every two weeks, which is expected to provide enough OHCbl substrate for MMACHC to synthesize sufficient AdoCbl and MeCbl to support activity of MCM and MS; and 250 mg/kg oral betaine per day, which helps convert homocysteine to methionine in the absence of cobalamin since betaine- homocysteine S-methyltransferase in liver catalyzes the transfer of a methyl group from betaine to homocysteine (Pajares and Perez-Sala, 2006), in which process betaine compensates for the deficiency of MeCbl. These reduce the MMA and homocysteine levels and elevate the methionine concentration. However, neurologic damage could not be entirely reversed and even with the supplementation, patients who survived usually had developmental delay at different levels. Therapy with other drugs such as AdoCbl, L- carnitine and folic acid has been attempted but is not as effective as OHCbl. It was also found that oral OHCbl is much less effective than injected OHCbl (Bartholomew et al.,

1988). The late-onset patients respond much better to the treatment.

36 A mouse model may allow futher study of MMACHC function during development. If mice present with a phenotype similar to the patients, we may use this model to clarify some aspects of the disease mechanism.

37 RATIONALE AND OBJECTIVES OF RESEARCH

Our objective has been to create a knockout mouse model for cblC disease in

order to compare the phenotype between man and mouse, improve the treatment of the disease and learn more about the role of cobalamin metabolism in birth defects. The primary focus of this thesis is on the creation of the mouse model. In addition, an

objective of this research has been to study the biochemical feature of wild type and

Mmachc knockout mouse cell lines in culture.

38

CHAPTER 2. Materials and Methods

Chapter 2.1 Generation of knockout mouse model:

2.1.1 Gene trap information

The gene trap technique was used by Sanger Institute (United Kingdom) to

generate a mouse ES cell line (AZ0348) from the 129 mice with a null mutation on one

allele of the Mmachc gene. The vector that was used to generate the gene trapped clones

is pGT0lxr (Fig 2), which contains a β-galactosidase gene and a neomycin transferase cassette. Upon incorporation into an intron of a mouse gene, its splice acceptor will compete with the natural one and generate a truncated mRNA product.

Figure 4: Structure of the gene trap construct pGT0lxr

(http://www.sanger.ac.uk/PostGenomics/genetrap/vectors/) Intr1: 1.5 kb of Mouse

En2 intron 1. En2: mouse engrailed gene exon 2. SA: splice acceptor of mouse En2 exon

2. β-geo: fusion of β-galactosidase and neomycin transferase. pA: SV40 polyadenylation

signal. pUC backbone: backbone the pUC plasmids. The gene trap size is 8717bp.

39 The genetrap construct includes a sequence tag that can be used to identify the

location of the genetrap. Analysis showed that the gene trap was inserted in intron 1 of

Mmachc. Multiple primers in intron 1 and in the starting region of pGT0lxr were designed to locate the gene trap. Amplification and sequencing with primers Intr1F and pGT3R indicated that the gene trap was 482 bp downstream of exon 1 (Fig 5).

2.1.2 Evaluation of the gene trap construct

All the primers were designed using Primer 3.0 software (available online: http://frodo.wi.mit.edu/primer3/). cDNA was prepared by RNA extraction from the putative gene trap MMACHC+/- AZ0348 ES cell line using Trizol reagent (Molecular

Research Center, Cincinnati), followed by reverse transcription of mRNA with Moloney

murine leukemia virus (MMLV) reverse transcriptase (USB, Cleveland, Ohio) or

SuperScript reverse transcriptase (Qiagen, Mississauga, Ontario) and poly(dT) 12–18

primer oligonucleotides (GE Healthcare, Baie D’Urfé Quebec). Qiagen Taq or Hot

StarTaq DNA polymerase was used for PCR amplification of mouse genomic DNA and

cDNA. Primers (Ex1F and Ex4R) used to amplify wild type Mmachc cDNA resulted in a

PCR product of 940 bp and primers (Ex1F and SIGR) used to amplify cDNA with the

insertion of gene trap resulted in a product of 284 bp. Size of PCR products was

determined by electrophoresis in 1.1% agarose gels with a 100-bp DNA ladder from

Qiagen.

40

Figure 5: Structure of the Mmachc gene incorporating the pGT01xr gene trap

construct. Arrows represent the primers used for PCR amplification of different products.

The gene trap was inserted in intron 1 and the exact location was determined through

PCR and sequencing with primers Intr1F and pGTR3. RT-PCR using primers Ex1F and

Ex4R amplified a 940 bp product in the absence of the gene trap construct, indicating the

presence of the wild type MMACHC; and RT-PCR using primers Ex1F and SIGR amplified a 284 bp product indicating the presence of the gene trap insertion. Genotyping of genomic DNA was done using primers Ex1F1 and Intr1R, which amplify a 499 bp product which in the presence of the wild type allele, and using primers B-geo1F and B- geo 1R which amplify a 360 bp product when the gene trap insertion is present.

41 2.1.3 Generation of chimeric mice

Blastocyst injection and generation of the chimeric mice was done in Dr. Michel

Tremblay’s transgenic lab at the Biochemistry Department, McGill University. Mmachc

+/- ES cells were injected into host blastocysts from c57B6J females pregnant for 3.5

days. Embryos were then transferred to day 2.5 foster females. After birth, chimeras were

identified on the basis of coat color.

2.1.4 Generation of F1 mice and molecular characterization of the MMACHC

knockout mice

Chimeric mice were crossed with c57B6J mice and DNA was extracted from tail

clips obtained from offspring (F1 generation) 2-3 weeks after birth. Primers (Ex1F1 and

Intr1R) used to amplify the wild type Mmachc allele from genomic DNA resulted in a

PCR product of 499 bp (Fig 5) and those used to amplify the gene trapped allele resulted

in a PCR product of 360 bp (B-geo1F and B-geo 1R). The expected size of the Ex1F1

and Intr1R with the inserted genetrap is about 9kb which normally would not be obtained

through PCR amplification.

2.1.5 Embryo Studies

Heterozygous males and females from either F1 or F2 generation were crossed.

Females were sacrificed and embryos were collected on e9.5, e10.5, e11.5, e12.5, e14.5 and e17.5. Embryos were examined under a Leica stereomicroscope (Leica Microsystems,

Norwell, MA). Pictures were taken using Infinite Capture imaging software (Matrox,

Montreal, Canada). DNA was extracted from yolk sac. The whole embryo was homogenized in Trizol reagent and RNA was isolated. PCR was used to genotype the

42 embryos and RT-PCR was used to confirm their gene expression except for e17.5 embryos.

Chapter 2.2 Molecular Characterization

2.2.1 DNA extraction

DNA was extracted from mouse tails, yolk sacs, livers and cell extracts.

Extraction from mouse tails: Approximately 0.5 cm mouse tail was cut from the mouse and incubated in 250 μl lysis buffer (100 mM Tris pH 8.5, 200 mM NaCl, 5 mM EDTA,

0.5% SDS) with proteinase K (Invitrogen, Canada) at a final concentration 1 mg/ml at

55 °C overnight. One hundred μl 6 M NaCl was added and the solution was gently shaken for 5 minutes. The mixture was then centrifuged at 15000 g (Microfuge ETM,

Beckman Coulter, Inc) for 10 minutes at RT. Supernatant was collected and 250 μl of isopropanol was added. The mixture was then centrifuged at 15000 g for 5 minutes at RT.

The pellet was washed with 70% ethanol, centrifuged and then air-dried. DNA grade water was added to dissolve the DNA.

Extraction of DNA from yolk sacs (~0.05 mg) and livers (~5 mg) was performed using the same technique as mentioned above.

Extraction from cells: Qiagen Blood & Cell Culture DNA Mini Kit was used.

Qiagen protocol for “Isolation of Genomic DNA from Cultured Cells” was used to extract pure DNA.

2.2.2 RNA extraction

RNA was extracted from cell pellets or mouse tissues. The extraction was done by homogenization in the Trizol reagent followed by extraction with chloroform (Fisher,

43 Ottowa), isopropanol (Fisher, Ottawa) precipitation, washing in 70% ethanol. RNA was dissolved in diethylpyrocarbonate (Fisher, Ottawa) treated water.

2.2.3 Sequencing analysis

PCR products were purified with Montage PCR96 filter plates (Millipore, Billerica

MA). Purified PCR products were sequenced at the Genome Quebec Innovation Center in forward and reverse directions on an ABI3700 automated DNA sequencer (Applied

Biosystems). Chromatograms were analyzed using Mutation Surveyor (SoftGenetics,

LLC, USA).

Ex1F CCTTGTGTCCTTTTGGCTTC Ex1F1 CCCTTCCAGGTTGGTTTGTC B-geo 1F CTGGCGTAATAGCGAAGAGG Intr1F GCGGGARCATCAGATTCTTC Intr1R CCAGGCGAGCGTGAGGAATT B-geo 1R GTTGCACCACAGATGAAACG Ex4R CTTAGCTTGAGGCCAACCTG SIGR ATTCAGGCTGCGCAACTGTTGGG PGT3R TCTAGGACAAGAGGGCGAGA

Table 2: Sequences of PCR primers used in the current study

44

Chapter 2.3 Biochemical analysis

2.3.1 Measurement of metabolites in the blood and urine

About 250 ul of blood was extracted from freshly dead mice by cardiac puncture into Microvette Z-gel for capillary blood collection (Sarstedt, Montreal). Half an hour

later, after the blood had clotted, it was centrifuged (Brinkmann centrifuge 5415, Inc,

Canada) at 4°C, 6000 rpm for 6 min. The supernatant serum was retained and stored at –

80°C until delievered to Dr. Stabler at the University of Colorado for analysis of

homocysteine and methylmalonic acid (MMA) level.

A few drops of urine were collected (~50 µl) and stored prior to use at –20 °C.

The urine was also delievered to Dr. Stabler for the same metabolite analysis.

2.3.2 Fibroblast studies

2.3.2a Cell culture

All cell lines were determined to be free of mycoplasma contamination by a

modification of the protocol of Schneider et al (1974). Cells were routinely cultured in

Eagle’s minimum essential medium (MEM) containing Earle’s salts and non-essential

amino acids (Invitrogen Canada, Burlington, Ontario), supplemented with 2.2 g/L sodium

bicarbonate, 0.11 g/L sodium pyruvate, 10 mg/L ferric nitrate, 1.5 g/L glucose, and 10%

fetal bovine serum (Cansera International, Etobicoke, Ontario). Tissue cultures were

2 maintained in 175 cm flasks, incubated at 37 °C in 5% CO2, and fed twice per week.

2.3.2b Cell lines

Human fibroblast line MCH23 and WG3338 were obtained from the Repository for Mutant Human Cell Strains of the Montreal Children’s Hospital

45 (http://www.cellbank.mcgill.ca). MCH23 was used as a wild type control and WG3338, which is homozygous for the c.271dupA mutation, was used as a MMACHC deficient control. The mouse cell lines established were M117 (Mmachc +/-), M127 (Mmachc +/-),

M128 (Mmachc +/+), R15-1 (Mmachc -/-) and R15-4 (Mmachc -/-).

Establishment of mouse fibroblast lines: Adult mice were sacrificed and ~0.5 cm of the tails were collected, placed in MEM, diced to small pieces and incubated at 37°C with 5% CO2 overnight in MEM supplemented with collagenase type II (400 U/ml,

Invitrogen, Canada), 20% heat-inactivated FBS, antibiotics (100 U/ml penicillin and 100

µg/ml streptomycin, Sigma Aldrich, USA) and 0.25 µg/ml fungizone (Fisher, Ottawa).

Medium containing tail pieces was then pipetted multiple times and passed through

sterile nylon netting into sterile centrifuge tubes. Samples were centrifuged for 5 min at

200 g (Beckman Coulter TJ-6) to remove the collagenase solution. Pellets were

resuspended in the incubation buffer: MEM supplemented with 20% heat-inactivated

FBS, antibiotics (100U/ml penicillin and 100 µg/ml streptomycin, and 0.25 µg/ml

fungizone and incubated at 37°C with 5% CO2 until confluent.

2.3.2c Propionate incorporation studies

MCM function in intact fibroblasts was assessed by measuring incorporation of

label from [14C]propionate into trichloroacetic acid-precipitable material. Cultured

fibroblasts plated at a density of 400,000 cells per 35 mm tissue culture dish (triplicates)

were incubated for 18 hours at 37°C in Puck’s F medium supplemented with 15% fetal

bovine serum (FBS, Cansera International) and 100 µmol/L [14C]propionate (GE

Healthcare, Baie D’Urfé Quebec) diluted with unlabelled propionate (Sigma Aldrich,

USA) resulting in a final specific activity of 10 µCi/µmol. After washing with phosphate

46 buffered saline (PBS) 3 times, cellular macromolecules were precipitated by three 15- minute incubations with 5% trichloroacetic acid (TCA) at 4°C. The precipitated material was dissolved in 0.2 M NaOH and radioactivity was determined by liquid scintillation counting. Protein concentration was determined by the Lowry assay (Lowry et al., 1951).

Values for propionate incorporation were expressed in nmols/mg protein/18h (Fig 13).

2.3.2d Methyltetrahydrofolate incorporation studies

MS function was assessed by measuring incorporation of label from

[14C]methylterahydrofolate (MeTHF) into TCA-precipitable material. Confluent fibroblasts, cultured as described above (triplicates) were incubated for 18 hours in methionine- and folate-free MEM supplemented with 10% dialyzed FBS, L- homocysteine (100 μmol/L) and [14C]MeTHF (GE Healthcare, Baie D’Urfé Quebec) with a specific activity of 60 μCi/mmol. Macromolecules were precipitated in 5% TCA as described above and the precipitated material was dissolved in 0.2 M NaOH and radioactivity was determined by liquid scintillation counting. Values for MeTHF were expressed in pmols/mg protein/18h.

47 CHAPTER 3. Results

Chapter 3.1 Molecular and biochemical characterization of adult mice

After injection of the ES cells into blastocysts from a c57B6 female, 4 males born

were found to be more than 90% chimeric by examining coat color and were chosen to

mate with 4 c57B6 females. Eleven litters of F1 generation mice were produced (16M,

25F). Eighteen of the mice were Mmachc +/- and 23 were Mmachc +/+. Intercross of

heterozygous male and female offspring (F1 generation) generated 110 F2 mice, of which genotyping showed that 3 were Mmachc -/-, 71 were Mmachc +/- and 36 were Mmachc

+/+ (Fig 6 and Fig 7). This was significantly different from the predicted Mendelian ratio

(Chi squared equals to 29.109 with 2 degrees of freedom and the two tailed p value is

4.7X10-7). The 3 Mmachc -/-, same as a few +/+ and +/- mice were infertile. However

the numbers are not enough to draw any conclusion. No other phenotypic differences

could be observed between Mmachc -/- mice and heterozygous or wild type mice.

48

Figure 6 : PCR genotyping results for 6 F2 mice. Genomic DNA was isolated from tails of F2 mice and genotype of each mouse was determined by PCR amplification using the primers Ex1F1, Intr1R, B-geo1F and B-geo1R (Fig 5). Primers Ex1F1 and Intr1R amplified a band with size of 499 bp indicating the presence of the wild type Mmachc allele without the gene trap. Primers B-geo1F and B-geo 1R amplified a band with size of

360 bp indicating the presence of the gene trapped allele. Lane 1: 100 bp DNA ladder, lane 2: Mmachc +/+ mouse. lane 3: Mmachc +/- mouse, lane 4-6 Mmachc -/- mice, lane

7: Mmachc+/- ES cell control. Lane 8: water control.

49

Figure 7: PCR genotyping results for 110 F2 mice. Genotype was determined as indicated in Figure 5. Of the F2 mice we obtained, 36 were wild type, 71 were heterozygous and 3 were homozygous. The number of animals homozygous for the gene containing the gene trap construct was significantly less than that predicted by Mendelian inheritance (Chi squared equals to 29.109 with 2 degrees of freedom and the two tailed p value is 4.7X10-7).

50

51

One of the 3 Mmachc -/- mice as well as one wild type and two heterozygous

mice were sacrificed at the ages of 2 months and serum was collected. Urine was

obtained from the other two Mmachc -/- mice as well as two wild type and two

heterozygous mice. Levels of homocysteine and MMA were measured in these blood and

urine samples (Table 3 and table 4). We did not observe any apparent increase in

homocysteine or MMA compared to wild type mice in either serum or urine of

MMACHC -/- mice.

SAMPLE_ID HCY MMA

uM nM

R15-2 (Mmachc +/+) 2.4 347

R14-2 (Mmachc +/-) 4.1 680

R15-3 (Mmachc +/-) 2.5 471

R14-8 (Mmachc -/-) 3.7 513

Table 3: Results of measurement of homocysteine (HCY) and methylmalonic acid

(MMA) levels in serum of 4 F2 mice. Serum samples were extracted from mice from

the F2 generation. No apparent difference was observed in the level of HCY and MMA

among the Mmachc +/+, +/- and -/- mouse.

52

SAMPLE_ID HCY MMA

uM nM

R8-5 (Mmachc +/+) 8.8 35403

R8-7 (Mmachc +/+) 14.2 44328

R8-4 (Mmachc +/-) 13.2 16661

R8-2 (Mmachc +/-) 14.2 14912

R14-8 (Mmachc -/-) 8.3 20333

R15-1 (Mmachc -/-) 7.2 9112

Table 4: Results of measurement of homocysteine and methylmalonic acid in urine

of 6 F2 mice. Each sample was urine obtained from a mouse from the F2 generation. No

apparent difference has been observed in the level of HCY and MMA among the

Mmachc +/+, +/- and -/- mouse.

Liver, kidney and heart RNA was extracted from the sacrificed homozygous

mutant mouse as well as from one heterozygous and one wild type F2 mouse.

Amplification of RNA from the above tissues by RT-PCR followed by agarose gel

electrophoresis showed that there was wild type Mmachc expression in wild type mice,

and there was both wild type Mmachc and gene trapped mRNA expression in

heterozygous mice, both as expected; however, there was expression of wild type

Mmachc mRNA as well as the gene trapped mRNA in the homozygous mutant mice (Fig

8).

53

Figure 8: Expression analysis of Mmachc F2 mouse tissues by RT-PCR. Mmachc +/+ tissue was from mouse R15-2, Mmachc +/- tissue was from R14-9. Mmachc -/- tissue was from R14-8. A) Expression of wild type Mmachc. Primers used were Ex1F and

Ex4R (Fig 5) and the product size was 940 bp. B) Expression of the cDNA containing the gene trap. Primers used were Ex1F and SIGR and the product size was 284 bp. Lanes in

A had the same material in corresponding lanes in B.

54

Chapter 3.2 Molecular characterization of mouse embryos

The low frequency of Mmachc -/- mice suggested that homozygous mice might be

dying prior to birth. We collected mouse embryos produced by intercross of Mmachc +/-

males and females at e9.5 (8 litters), e10.5 (3 litters), e11.5 (1 litters), e13.5 (2 litters),

e14.5 (4 litters) and e17.5 (4 litters) and determined their genotypes by PCR (Table 5). Of the 55 embryos obtained at e9.5, 10 were Mmachc -/- and the ratio of Mmachc +/+:

Mmachc +/-: Mmachc -/- was not significantly different from the predicted Mendelian

ratio (Chi squared equals 1.364 with 2 degrees of freedom, p=0.51) (Table 5). No

Mmachc -/- embryos were observed at e17.5, a result that was significantly different from

the predicted outcome (Chi squared equals 14.15 with 2 degrees of freedom, p=8.5X10-4).

Three Mmachc +/+ and 6 Mmachc +/- embryos were observed at e11.5. Seven Mmachc

+/+ and 13 Mmachc +/- embryos were found at e13.5. Nine Mmachc +/+, 17 Mmachc

+/- and 3 Mmachc -/- embryos were found at e14.5. However, there were insufficient

embryos collected at e10.5, e11.5, e13.5 and e14.5 for statistical analysis.

55

Age of the The number of Numbers of Phenotype Embryos Resorptions embryo embryos embryos with with the (dead genotyped each genotype. phenotype embryos /litter number +/+,+/-, -/- that have been reabsorbed) e9.5 55/9 15,30,10 Open neural folds 1 5

e10.5 32/5 9,17,6 No somites, poorly 1 4 developed trunk e11.5 9/1 3,6,0 2

e13.5 20/3 7,13,0 6

e14.5 29/3 9,17,3 Holoprosencephaly 1 5

Abnormal limbs, 1 face e17.5 40/4 11,29,0 12

Table 5: Genotypes and phenotypes of dissected embryos.

Chapter 3.3 Embryo morphology

When we inspected embryos at e9.5 under microscope, we found one of the 10 homozygous mutant embryos that had open neural folds (Fig 9A). Of 6 homozygous mutant embryos found at e10.5, one had no somites and the trunk was not properly developed (Fig 9E). At e14.5, one of the 3 homozygous mutant embryos had a

56 holoprosencephaly (HPE) phenotype (Fig 9G). The embryo was cyclopic. One other embryo had abnormal limbs and jaw (Fig 9H). All the other Mmachc -/- embryos appeared phenotypically normal.

57

Figure 9: Mouse embryo dysmorphology. Mouse embryos at different stages were examined by microscopy. Yolk sac DNA was extracted to genotype them and RNA was later extracted from the whole embryo to study the expression. A: Mmachc -/- e9.5 embryo with open neural folds. B: Mmachc +/+ e9.5 embryo. C: Mmachc +/+ e10.5 embryo. D: Mmachc -/- e10.5 embryo with normal phenotype. E: Mmachc -/- e10.5 embryo with no somites. F: Mmachc +/+ e14.5 embryo. G: Mmachc -/- e14.5 embryo with holoprosencephaly phenotype. H: Mmachc -/- e14.5 embryo with abnormal limbs and facial dysmorphology. Hf: head fold. Ht: heart. A,B,C,D,E: 4X Magnification. F,G,H

2.0X.

58

Figure 9: Mouse embryo dysmorphology.

59 Chapter 3.4 MCM and MS function of mouse fibroblasts

We collected tails from 2 Mmachc +/+, 2 +/- and 2 -/- mice and used them to establish fibroblast lines. We genotyped the fibroblasts by PCR and the results were the same as the genotyping result using DNA extracted from mouse tails. RT-PCR showed that Mmachc was expressed in the homozygous mutant cell lines (Fig 12).

We indirectly measured the activity of MCM through incorporation of label from

[14C]propionate into cellular macromolecules. Results showed that the MCM activity of

Mmachc -/- fibroblasts (9.0 ± 1.3 nmols/mg protein/18 h for line R15-1 and 9.4 ± 1.3 nmols/mg protein/18h for line R15-4) was not significantly different from that of

Mmachc +/+ fibroblasts (10.3 ± 1.5 nmols/mg protein/18h). This contrasts with the human MMACHC -/- fibroblast line in which propionate incorporation was decreased almost 100-fold compared to the wild type fibroblasts (Fig 13).

We indirectly measured the activity of MS through incorporation of label from

[14C]MeTHF into cellular macromolecules. Results showed that the MS activity of

Mmachc -/- fibroblasts (141.7 ± 30.7 pmols/mg/18h for line R15-1 and 135.9 ± 72.6 pmols/mg protein/18h for line R15-4) was not significantly different from that of

Mmachc +/+ fibroblasts (129.7± 24.2 pmols/mg protein/18h) (Fig 14). This contrasts with the human MMACHC -/- fibroblast line in which MeTHF incorporation was decreased about 100-fold compared to the wild type fibroblasts. For the MMACHC +/+ fibroblasts, the result was 240 ± 11.4 pmols/mg protein/18h while for the MMACHC -/- fibroblasts, the result was 2.7 ± 0.6 pmols/mg protein/18h, which decreased around 100- fold compared to the wild type ones.

60

Figure 10: Genotyping results for mouse fibroblast lines. PCR genotyping results for

DNA extracted from mouse fibroblasts using primers Ex1F1 and Intr1R, B-geo 1F and B- geo 1R.

61

Figure 11: Expression data for mouse fibroblast cell lines.

mRNA was isolated from mouse livers, kidneys and hearts. RT-PCR was performed to indicate the expression of Mmachc and the genetrap construct in each tissue. A) expression data with the gene trap insertion. B) wild type Mmachc expression data obtained using primers Ex1F and Ex4R, Ex1F and SIGR.

62

Figure 12: Propionate incorporation in intact mouse fibroblasts. We measured the

incorporation of label from [14C]propionate into cellular macromolecules (a measure of intact cell MCM activity) in 7 cell lines. MCH23 is a human MMACHC +/+ fibroblast line: 9.4 ± 2.4 nmol/mg protein/18hrs. WG3338 is a human MMACHC -/- fibroblast line:

0.10 ± 0.2 nmol/mg protein/18hrs. M128 is a mouse Mmachc +/+ fibroblast line: 10.3 ±

1.5 nmol/mg protein/18hrs. M117 is a mouse Mmachc +/- fibroblast line: 9.1 ± 1.1 nmol/mg protein/18hrs. M127 is a moue Mmachc +/- fibroblast line: 8.5 ± 1 nmol/mg protein/18hrs. R15-1 is a mouse Mmachc -/- fibroblast line: 9 ± 2.3 nmol/mg protein/18hrs. R15-4 is a mouse Mmachc -/- fibroblast line: 9.4 ± 1.3 nmol/mg protein/18hrs.

63

Figure 13: MeTHF incorporation in intact mouse fibroblasts. We measured the incorporation of label from [14C]MeTHF into cellular macromolecules (a measuer of

intact cell MS function) in 7 cell lines. MCH23 is a human MMACHC +/+ fibroblast line:

240 ± 11.4 pmol/mg protein/18hrs. WG3338 is a human MMACHC -/- fibroblast line: 2.7

± 0.6 pmol/mg protein/18hrs.

64 CHAPTER 4. Discussion

The cblC disorder is the most common inborn error of cobalamin metabolism.

The disease is characterized biochemically by elevated MMA and homocysteine in blood and urine which are respectively due to the decreased MCM and MS function. Decreased activity of MMACHC causes deficiency of the cofactors AdoCbl, which normally binds to MCM and is involved in the conversion of L-methylmalonyl CoA to succinyl CoA, and cofactors MeCbl, which normally serves as the methyl donor for MS during the conversion of homocysteine to methionine. Deficiency of the two cofactors may lead to various clinical findings including megaloblastic anemia, hypersegmented neutrophils, neutropenia, thrombocytopenia as well as neurological findings (Rosenblatt et al., 1997).

MMACHC has been found to be involved in dealkylating MeCbl and AdoCbl, decyanating CNCbl (Kim et al., 2008; Hannibal et al., 2009) and it is possible that

MMACHC may also be involved in more complicated processes such as forming complexes with other proteins in the cobalamin pathway and transporting cobalamin into the cytoplasm. A mouse model of the cblC disease MMACHC will enable us to careful characterize the function of the gene during development and to study the role that cobalamin plays in development of birth defects. If the mouse model is phenotypically similar to the human disease on any strain, it will help us understand the pathophysiology of the cblC disorder better, especially in relation to the neurological complications, and may even lead to improvement in therapies for the disorder.

ES cells from 129 strain mice with the Mmachc gene inactivated by incorporation of a gene trap construct in intron 1 were obtained from Sanger Institute and were tested by RT-PCR and sequencing to confirm the presence of the gene trap and expression of

65 mRNA containing the gene trap. These ES cells were then used for blastocyst injection,

using blastocysts from mated c57B6 female mice. We had successful germline

transmission and obtained 4 male mice with more than 90% chimerism. When we crossed

Mmachc +/- F1 males with Mmachc +/- females, the ratio of homozygous wild type mice: heterozygous mutant mice: homozygous mutant mice was 36:71:3, significantly different from the expected Mendelian ratio 1:2:1 (Fig 7). The decrease in the number of

homozygous mutant mice compared with wild type mice obtained implies that most

homozygous mutants died prior to birth.

We collected embryos at different stages to investigate whether there was

embryonic lethality. At e9.5, there was no significant difference between the observed

ratio and the expected Mendelian ratio of mice with each genotype, which suggests that

embryonic lethality probably had not occurred by this stage. However, at e17.5, while the

number of Mmachc +/+ embryos vs. Mmachc +/- embryos was close to 1:2, we did not

find any Mmachc -/- embryos. The observed ratio was significantly different from the

expected Mendelian ratio. The above findings together with the huge variation found in

adult mice between the expected Mendelian and the observed Mmachc +/+ vs. Mmachc

+/- vs. Mmachc -/- mice ratio strongly suggested that knockout of Mmachc in

homozygous state was embryonic lethal.

Results from some previously created knockout mouse models showed that

inactivating the genes involved in the remethylation of homocysteine to methionine (Mtr

and Mtrr) or the genes involved in the cobalamin transport (Cubn and Amn) seemed to

result in early embryonic lethality (Tomihara-Newberger et al., 1998; Swanson et al.,

2001; Smith et al., 2006; unpublished data of Roy Gravel cited in Elmore et al., 2007).

66 MTHFR is also involved in the conversion of homocysteine to methionine because it is required for the proper synthesis of MeTHF which serves as the methyl donor for this conversion. Although Mthfr -/-mice on different genetic backgrounds had quite different embryonic mortality rate, there was embryonic lethality. (Chen et al., 2001; Schwahn et al., 2004).

Knocking out the Mut gene that codes for MCM seemed to have less severe effect during the embryonic period. Homozygous null mice were born indistinguishable from the wild type littermates. Measurement of MMA levels in blood and urine after birth showed that MMA levels in the homozygous mutant mice were gradually increasing and they could only survive up to 2.5 days (Peters et al., 2003; Chandler and Venditti, 2008).

Therefore, embryonic lethality in our Mmachc -/- mice is likely the result of interference in homocysteine remethylation, not MCM metabolism. This matches the findings in cblC patients whose clinical findings are more related to MS deficiency and rarely show signs of metabolic decompensation.

It has been found in numerous mouse models that the viability of the knockout mice may depend on the genetic background (Schwahn et al., 2004; Nadeau, 2005;

Lemos et al., 2009). Mthfr -/- mice were found to have a much better survival rate on c57B6 background than on BALB/c background (Chen et al., 2001). Therefore, backcrossing the mice to one unique genetic background might result in viable homozygous mutant mice. We will start with c57B6 strain since the knockout of Mthfr which is also involved in the same remethylation process as Mmachc had better survival rate on this genetic background. Meanwhile, supplementation with betaine, which helps converting homocysteine to methionine in the absence of cobalamin could reduce the

67 level of homocysteine during pregnancy. Intramuscular injection of OHCbl, which

provides more cobalamin substrate for the synthesis of AdoCbl and MeCbl, is also

helpful to maintain the activity of MCM and MS, therefore increasing the chance for

Mmachc -/- mice to overcome the embryonic lethality. Severe MTHFR deficiency in

humans could be treated successfully with betaine supplementation (Bönig et al., 2003).

It has also been shown that dietary supplementation with betaine during pregnancy

lowers the mortality rate of Mthfr -/- embryos as well as lowering the plasma

homocysteine level of Mthfr -/- mice that are born (Schwahn et al., 2004).

To date, there is no information on supplementation in animals with a knockout of

the gene encoding MCM. However, prenatal therapy of a cblC patient with OHCbl administration to the mother has been reported. Following the treatment, cobalamin was found to be elevated in umbilical cord blood, suggesting there was adequate transport to the fetus. The MMA level in maternal urine and amniotic fluid, as well as total homocystine level in maternal plasma and amniotic fluid, were reduced. Nevertheless, the baby was born with significantly elevated MMA and homocysteine, which could be alleviated through continued supplementation and diet restriction after birth (Huemer et al., 2005)

The clinical manifestations in cblC disease are complicated and poorly understood.

One relatively common abnormality is minor facial anomalies. Neurological findings such as cerebral atrophy, ventriculomegaly, white matter disease and salt and pepper pigmentary retinopathy have been observed in patients with early onset cblC disorder while ataxia, dementia and psychosis have been reported in late onset patients (Enns et al.,

1999; Cerone et al., 1999; Smith et al., 2006; Tsai et al., 2007).

68 In our model, all of the Mmachc +/+ and Mmachc +/- embryos we examined

were phenotypically normal. However, dysmorphology was observed in some Mmachc -

/- embryos. We found an Mmachc -/- embryo with open neural folds at e9.5 (Fig 9A). It

has been reported that either folate or cobalamin deficiency would increase the risk of

neural tube defects in human (Ray and Blom, 2003; Blom et al., 2006). In pregnant mice,

megalin that has been proposed to be crucial to the proper function of cubam in

transporting cobalamin (Kozyraki and Gofflot, 2007) and inactivation of megalin led to

central nervous system malformations including open neural folds in e9.5 embryos that

resulted in neural tube defects later (Willnow et al., 1996). We found one Mmachc -/-

embryo with no somites and poorly developed trunk similar to the amnionless embryo

that had been observed before (Fig 9A). However, we did not section and stain to confirm

the presence of the amnion since we extracted RNA from the whole embryo. Amnionless

encoded by AMN is a component of cubam, which transports the IF-Cbl complex into the blood. This phenotype has been observed in Amn -/- embryos at e10.5 and is characterized by severly shortened trunk and the absence of somite (Tomihara-

Newberger et al., 1998). We found one holoprosencephalic Mmachc -/- embryo at e14.5

(Fig 9G). This phenotype has been observed in newborn mouse pups from a mother with inactivated megalin (Willnow et al., 1996). Inactivation of cubilin, another component of cubam, in pregnant rats by feeding monoclonal antibodies to them was also shown to induce craniofacial abnormalities that partially resembled HPE and sometimes led to fetal resorptions (Sahali et al., 1988). We found an Mmachc -/- embryo with facial and limb abnormalities at e14.5 (Fig 9H). Facial abnormalities including high forehead, long face, large flappy and low-set ears and flat philtrum have been reported in 7 cblC patients and

69 their morphological characteristics became more evident after 3 years of age (Cerone et al., 1999).

We hypothesized that the phenotypic variability we observed occurred in our

Mmachc -/- embryos because the mice were on a mixed 129/c57B6 background, since many phenotypes as well as penetrance of the phenotypes are strain-dependent (Sanford et al., 2001). Backcrossing mice onto a unique genetic background may result in less variability in the types of birth defects observed in Mmachc -/- embryos.

During our study, we found only three Mmachc -/- mice that had survived to term.

Measurements of plasma and urine levels of HCY and MMA of those mice did not reveal any differences compared to wild type mice. Prvevious studies showed that total HCY in blood of wild type mice varied between genders as well as among strains, with a range from 2.2 to 8.4 µM (Ernest et al., 2005). Our HCY values are close to their experiments.

Systematically study of MMA level in blood and urine has not been completed though it has been found that amniotic MMA level in the wild type mice was 5.3 µM at e19 and plasma MMA level of the wild type mice was too low to be detected result (Chandler et al., 2007)., however, there is a 10-fold difference between the plasma MMA level of our result and theirs. The difference could be due to the age difference, strain difference, diet difference or different water intake control. RT-PCR demonstrated that the wild type

Mmachc gene product was indeed expressed in these three mice in addition to the gene trapped gene product (Fig 8). Genotyping of fibroblasts derived from two of the three -/- mice as well as from a heterozygous and a wild type mouse showed they had the same genotype as the mice from which they were derived. RT-PCR showed that there was expression of the wild type gene product. These fibroblast lines were then used to study

70 the cellular biochemistry of the mice. Propionate incorporation and MeTHF incorporation studies showed that MCM and MS function of the fibroblasts from the two Mmachc -/- mice were not significantly different from those of Mmachc +/+ mice (Fig 13 and Fig

14). We believe that these Mmachc -/- mice had normal phenotype because they had expressed the Mmachc gene product even with the gene trap incorporated in both copies of the Mmachc gene. One of the features of the gene trap technique different from the traditional targeted disruption techniques in creating a knockout mouse model is that alternative splicing may occur when the acceptor splice site of the cryptic exon containing the gene trap is skipped by the RNA splicing machinery, which may allow expression of wild type gene product, and therefore generate hypomorphic alleles which contain reduced level of gene products (McClive et al., 1998). An example of this is the

Mtrr knockout mouse model where Mtrr was found expressed tissue specifically in homozygous mutant mice (Elmore et al., 2007). Since we did not find any defect in cobalamin metabolism in fibroblasts derived from Mmachc -/- mice, we believe the three homozygous mutant mice did not die prior to birth because of alternative splicing which enabled the exons to skip over the gene trap and generate the normal transcript. The expression pattern of Mmachc with and without gene trap incorporation could be explored by a northern blot analysis.

Our results show that we have constructed an Mmachc knockout mouse model.

Although Mmachc -/- embryos appeared to die prior to birth, it may be possible to alter this by changing the genetic background of the mutated gene or by prenatal treatment with betaine and OHCbl. Meanwhile, we are able to perform embryonic studies to learn the role of cobalamin in development of birth defects. Should the mouse model be

71 phenotypically similar to the human disease when expressed on a specific pure strain, it will help us have a better understanding of cblC diseases in human. Further studies on the pathologies associated with the cblC disease and potential therapeutic strategies may eventually allow for new treatment solutions in cblC subjects.

72

SUMMARY AND CONCLUSION

We have successfully constructed an Mmachc knockout mouse model. We have shown that knocking out Mmachc of both alleles led to embryonic lethality based on numbers of mice we obtained through F1 heterozygous crossing and embryonic studies.

We have shown several dysmorphologies in Mmachc -/- embryos that might result from knocking out Mmachc. We also found that there were three homozygous mutant mice that survived to birth with the expression of wild type Mmachc and the function of cobalamin dependent enzymes. Future studies can be planned on rescuing homozygous mutant mice through prenatal treatment and backcrossing the mice to a unique genetic background. Meanwhile, studies on the role of cobalamin plays in birth defect can be continued.

73

CLAIMS OF ORIGINALITY

1. The thesis describes the construction of the first Mmachc knockout mouse model.

2. Mmachc -/- embryos had phenotypes including open neural folds, amnionless-like,

HPE and abnormal limbs and face.

74 BIBLIOGRAPHY

1. Allen RH, Seetharam B, Allen NC, Podell ER, and Alpers DH (1978) Correction of cobalamin malabsorption in pancreatic insufficiency with a cobalamin analogue that binds with high affinity to R protein but not to intrinsic factor. In vivo evidence that a failure to partially degrade R protein is responsible for cobalamin malabsorption in pancreatic insufficiency. J Clin Invest 61 (6):1628- 1634

2. Allen RH, Seetharam B, Podell E, and Alpers DH (1978) Effect of proteolytic enzymes on the binding of cobalamin to R protein and intrinsic factor. In vitro evidence that a failure to partially degrade R protein is responsible for cobalamin malabsorption in pancreatic insufficiency. J Clin Invest 61 (1):47-54

3. Ampola MG, Mahoney MJ, Nakamura E, and Tanaka K (1975) Prenatal therapy of a patient with vitamin-B12-responsive methylmalonic acidemia. N Engl J Med 293 (7):313-317

4. Andersson HC and Shapira E (1998) Biochemical and clinical response to hydroxocobalamin versus cyanocobalamin treatment in patients with methylmalonic acidemia and homocystinuria (cblC). J Pediatr 132 (1):121-124

5. Atkinson, JL, Paterson A, Renaud D, Clark TR, Wilcken B, Bulman D, and Rommens JM. Genetic mapping of cobalamin C deficiency: putative linkage to 1p. Am.J.Hum.Genet . Abstract 2002.

6. Bartholomew DW, Batshaw ML, Allen RH, Roe CR, Rosenblatt D, Valle DL, and Francomano CA (1988) Therapeutic approaches to cobalamin-C methylmalonic acidemia and homocystinuria. J Pediatr 112 (1):32-39

7. Bayer P and Harjes S (2001) TonB--a mediator of iron uptake in bacteria. Trends Biochem Sci 26 (8):472

8. Beckman DR, Hoganson G, Berlow S, and Gilbert EF (1987) Pathological findings in 5,10-methylene tetrahydrofolate reductase deficiency. Birth Defects Orig Artic Ser 23 (1):47-64

9. Blom HJ, Shaw GM, den HM, and Finnell RH (2006) Neural tube defects and folate: case far from closed. Nat Rev Neurosci 7 (9):724-731

10. Bonig H, Daublin G, Schwahn B, and Wendel U (2003) Psychotic symptoms in severe MTHFR deficiency and their successful treatment with betaine. Eur J Pediatr 162 (3):200-201

75 11. Cerone R, Schiaffino MC, Caruso U, Lupino S, and Gatti R (1999) Minor facial anomalies in combined methylmalonic aciduria and homocystinuria due to a defect in cobalamin metabolism. J Inherit Metab Dis 22 (3):247-250

12. Chandler RJ and Venditti CP (2008) Adenovirus-mediated gene delivery rescues a neonatal lethal murine model of mut(0) methylmalonic acidemia. Hum Gene Ther 19 (1):53-60

13. Chen Z, Karaplis AC, Ackerman SL, Pogribny IP, Melnyk S, Lussier-Cacan S, Chen MF, Pai A, John SW, Smith RS, Bottiglieri T, Bagley P, Selhub J, Rudnicki MA, James SJ, and Rozen R (2001) Mice deficient in methylenetetrahydrofolate reductase exhibit hyperhomocysteinemia and decreased methylation capacity, with neuropathology and aortic lipid deposition. Hum Mol Genet 10 (5):433-443

14. Chen Z, Schwahn BC, Wu Q, He X, and Rozen R (2005) Postnatal cerebellar defects in mice deficient in methylenetetrahydrofolate reductase. Int J Dev Neurosci 23 (5):465-474

15. Clayton PT, Smith I, Harding B, Hyland K, Leonard JV, and Leeming RJ (1986) Subacute combined degeneration of the cord, dementia and parkinsonism due to an inborn error of folate metabolism. J Neurol Neurosurg Psychiatry 49 (8):920- 927

16. Coelho D, Suormala T, Stucki M, Lerner-Ellis JP, Rosenblatt DS, Newbold RF, Baumgartner MR, and Fowler B (2008) Gene identification for the cblD defect of vitamin B12 metabolism. N Engl J Med 358 (14):1454-1464

17. De B, I, Nizard SD, and Mitchell GA (2009) Fetal dilated cardiomyopathy: an unsuspected presentation of methylmalonic aciduria and hyperhomocystinuria, cblC type. Prenat Diagn 29 (3):266-270

18. Dixon MM, Huang S, Matthews RG, and Ludwig M (1996) The structure of the C-terminal domain of methionine synthase: presenting S-adenosylmethionine for reductive methylation of B12. Structure 4 (11):1263-1275

19. Dobson CM, Wai T, Leclerc D, Kadir H, Narang M, Lerner-Ellis JP, Hudson TJ, Rosenblatt DS, and Gravel RA (2002) Identification of the gene responsible for the cblB complementation group of vitamin B12-dependent methylmalonic aciduria. Hum Mol Genet 11 (26):3361-3369

20. Drennan CL, Huang S, Drummond JT, Matthews RG, and Lidwig ML (1994) How a protein binds B12: A 3.0 A X-ray structure of B12-binding domains of methionine synthase. Science 266 (5191):1669-1674

21. Elmore CL, Wu X, Leclerc D, Watson ED, Bottiglieri T, Krupenko NI, Krupenko SA, Cross JC, Rozen R, Gravel RA, and Matthews RG (2007) Metabolic derangement of methionine and folate metabolism in mice deficient in methionine synthase reductase. Mol Genet Metab 91 (1):85-97

76 22. Enns GM, Barkovich AJ, Rosenblatt DS, Fredrick DR, Weisiger K, Ohnstad C, and Packman S (1999) Progressive neurological deterioration and MRI changes in cblC methylmalonic acidaemia treated with hydroxocobalamin. J Inherit Metab Dis 22 (5):599-607

23. Evans JC, Huddler DP, Hilgers MT, Romanchuk G, Matthews RG, and Ludwig ML (2004) Structures of the N-terminal modules imply large domain motions during catalysis by methionine synthase. Proc Natl Acad Sci U S A 101 (11):3729-3736

24. Fenton WA, Hack AM, Willard HF, Gertler A, and Rosenberg LE (1982) Purification and properties of methylmalonyl coenzyme A mutase from human liver. Arch Biochem Biophys 214 (2):815-823

25. Goyette P, Sumner JS, Milos R, Duncan AM, Rosenblatt DS, Matthews RG, and Rozen R (1994) Human methylenetetrahydrofolate reductase: isolation of cDNA mapping and mutation identification. Nat Genet 7 (4):551

26. Goyette P, Pai A, Milos R, Frosst P, Tran P, Chen Z, Chan M, and Rozen R (1998) Gene structure of human and mouse methylenetetrahydrofolate reductase (MTHFR). Mamm Genome 9 (8):652-656

27. Gravel RA, Mahoney MJ, Ruddle FH, and Rosenberg LE (1975) Genetic complementation in heterokaryons of human fibroblasts defective in cobalamin metabolism. Proc Natl Acad Sci U S A 72 (8):3181-3185

28. Gulati S, Baker P, Li YN, Fowler B, Kruger W, Brody LC, and Banerjee R (1996) Defects in human methionine synthase in cblG patients. Hum Mol Genet 5 (12):1859-1865

29. Hall CA, Lindenbaum RH, Arenson E, Begley JA, and Chu RC (1989) The nature of the defect in cobalamin G mutation. Clin Invest Med 12 (4):262-269

30. Hannibal L, Kim J, Brasch NE, Wang S, Rosenblatt DS, Banerjee R, and Jacobsen DW (2009) Processing of alkylcobalamins in mammalian cells: A role for the MMACHC (cblC) gene product. Mol Genet Metab 97 (4):260-266

31. Haworth JC, Dilling LA, Surtees RA, Seargeant LE, Lue-Shing H, Cooper BA, and Rosenblatt DS (1993) Symptomatic and asymptomatic methylenetetrahydrofolate reductase deficiency in two adult brothers. Am J Med Genet 45 (5):572-576

32. Herbert V and Colmam N (1988) Folic acid and vitamin B-12. Modern nutrition in health and disease., pp 388-416

33. Horster F, Baumgartner MR, Viardot C, Suormala T, Burgard P, Fowler B, Hoffmann GF, Garbade SF, Kolker S, and Baumgartner ER (2007) Long-term

77 outcome in methylmalonic acidurias is influenced by the underlying defect (mut0, mut-, cblA, cblB). Pediatr Res 62 (2):225-230

34. Huemer M, Simma B, Fowler B, Suormala T, Bodamer OA, and Sass JO (2005) Prenatal and postnatal treatment in cobalamin C defect. J Pediatr 147 (4):469-472

35. Kalantry S, Manning S, Haub O, Tomihara-Newberger C, Lee HG, Fangman J, Disteche CM, Manova K, and Lacy E (2001) The amnionless gene, essential for mouse gastrulation, encodes a visceral-endoderm-specific protein with an extracellular cysteine-rich domain. Nat Genet 27 (4):412-416

36. Kanwar YS, Manaligod JR, and Wong PW (1976) Morphologic studies in a patient with homocystinuria due to 5, 10-methylenetetrahydrofolate reductase deficiency. Pediatr Res 10 (6):598-609

37. Kapusta L, Haagmans ML, Steegers EA, Cuypers MH, Blom HJ, and Eskes TK (1999) Congenital heart defects and maternal derangement of homocysteine metabolism. J Pediatr 135 (6):773-774

38. Kim J, Gherasim C, and Banerjee R (2008) Decyanation of vitamin B12 by a trafficking chaperone. Proc Natl Acad Sci U S A 105 (38):14551-14554

39. Kolhouse JF, Utley C, and Allen RH (1980) Isolation and characterization of methylmalonyl-CoA mutase from human placenta. J Biol Chem 255 (7):2708- 2712

40. Kozyraki R, Kristiansen M, Silahtaroglu A, Hansen C, Jacobsen C, Tommerup N, Verroust PJ, and Moestrup SK (1998) The human intrinsic factor-vitamin B12 receptor, cubilin: molecular characterization and chromosomal mapping of the gene to 10p within the autosomal recessive megaloblastic anemia (MGA1) region. Blood 91 (10):3593-3600

41. Kozyraki R and Gofflot F (2007) Multiligand endocytosis and congenital defects: roles of cubilin, megalin and amnionless. Curr Pharm Des 13 (29):3038-3046

42. L.Philip Sanford, Suhas Kallapur, Ilona Ormsby, and Thomas Doetschman (2001) Gene Knockout Protocols. Methods in Molecular Biology. Humana Press,

43. Leclerc D, Campeau E, Goyette P, Adjalla CE, Christensen B, Ross M, Eydoux P, Rosenblatt DS, Rozen R, and Gravel RA (1996) Human methionine synthase: cDNA cloning and identification of mutations in patients of the cblG complementation group of folate/cobalamin disorders. Hum Mol Genet 5 (12):1867-1874

44. Leclerc D, Wilson A, Dumas R, Gafuik C, Song D, Watkins D, Heng HH, Rommens JM, Scherer SW, Rosenblatt DS, and Gravel RA (1998) Cloning and mapping of a cDNA for methionine synthase reductase, a flavoprotein defective in patients with homocystinuria. Proc Natl Acad Sci U S A 95 (6):3059-3064

78 45. Ledley FD, Lumetta MR, Zoghbi HY, VanTuinen P, Ledbetter SA, and Ledbetter DH (1988) Mapping of human methylmalonyl CoA mutase (MUT) locus on chromosome 6. Am J Hum Genet 42 (6):839-846

46. Lemos MC, Harding B, Reed AA, Jeyabalan J, Walls GV, Bowl MR, Sharpe J, Wedden S, Moss JE, Ross A, Davidson D, and Thakker RV (2009) Genetic background influences embryonic lethality and the occurrence of neural tube defects in Men1 null mice: relevance to genetic modifiers. J Endocrinol 203 (1):133-142

47. Lerner-Ellis JP, Gradinger AB, Watkins D, Tirone JC, Villeneuve A, Dobson CM, Montpetit A, Lepage P, Gravel RA, and Rosenblatt DS (2006) Mutation and biochemical analysis of patients belonging to the cblB complementation class of vitamin B12-dependent methylmalonic aciduria. Mol Genet Metab 87 (3):219- 225

48. Li D, Pickell L, Liu Y, Wu Q, Cohn JS, and Rozen R (2005) Maternal methylenetetrahydrofolate reductase deficiency and low dietary folate lead to adverse reproductive outcomes and congenital heart defects in mice. Am J Clin Nutr 82 (1):188-195

49. Li D and Rozen R (2006) Maternal folate deficiency affects proliferation, but not apoptosis, in embryonic mouse heart. J Nutr 136 (7):1774-1778

50. Li F, Watkins D, and Rosenblatt DS (2009) Vitamin B(12) and birth defects. Mol Genet Metab 98 (1-2):166-172

51. Lindstrand K, Stahlberg KG, Ehrensvard G, and Norden A (1963) Studies on free and serum protein-bound vitamin B12 by the use of Sephadex G 25 and high voltage electrophoresis. Acta Med Scand 173:605-611

52. Linnell RH (1975) The fate of cobalamins in vivo. In: Babior BM (ed) Cobalamin: Biochemistry and pathophysiology. Wiley-Interscience, New York, pp 287-333

53. Matsui SM, Mahoney MJ, and Rosenberg LE (1983) The natural history of the inherited methylmalonic acidemias. N Engl J Med 308 (15):857-861

54. McClive P, Pall G, Newton K, Lee M, Mullins J, and Forrester L (1998) Gene trap integrations expressed in the developing heart: insertion site affects splicing of the PT1-ATG vector. Dev Dyn 212 (2):267-276

55. Mellman I, Willard HF, Youngdahl-Turner P, and Rosenberg LE (1979) Cobalamin coenzyme synthesis in normal and mutant human fibroblasts. Evidence for a processing enzyme activity deficient in cblC cells. J Biol Chem 254 (23):11847-11853

56. Merinero B, Perez B, Perez-Cerda C, Rincon A, Desviat LR, Martinez MA, Sala PR, Garcia MJ, Aldamiz-Echevarria L, Campos J, Cornejo V, Del TM, Mahfoud

79 A, Martinez-Pardo M, Parini R, Pedron C, Pena-Quintana L, Perez M, Pourfarzam M, and Ugarte M (2008) Methylmalonic acidaemia: examination of genotype and biochemical data in 32 patients belonging to mut, cblA or cblB complementation group. J Inherit Metab Dis 31 (1):55-66

57. Moestrup SK, Kozyraki R, Kristiansen M, Kaysen JH, Rasmussen HH, Brault D, Pontillon F, Goda FO, Christensen EI, Hammond TG, and Verroust PJ (1998) The intrinsic factor-vitamin B12 receptor and target of teratogenic antibodies is a megalin-binding peripheral membrane protein with homology to developmental proteins. J Biol Chem 273 (9):5235-5242

58. Nadeau JH (2005) Listening to genetic background noise. N Engl J Med 352 (15):1598-1599

59. Padmakumar R and Banerjee R (1995) Evidence from electron paramagnetic resonance spectroscopy of the participation of radical intermediates in the reaction catalyzed by methylmalonyl-coenzyme A mutase. J Biol Chem 270 (16):9295- 9300

60. Padovani D and Banerjee R (2006) Assembly and protection of the radical enzyme, methylmalonyl-CoA mutase, by its chaperone. Biochemistry 45 (30):9300-9306

61. Pajares MA and Perez-Sala D (2006) Betaine homocysteine S-methyltransferase: just a regulator of homocysteine metabolism? Cell Mol Life Sci 63 (23):2792- 2803

62. Pickell L, Li D, Brown K, Mikael LG, Wang XL, Wu Q, Luo L, Jerome- Majewska L, and Rozen R (2009) Methylenetetrahydrofolate reductase deficiency and low dietary folate increase embryonic delay and placental abnormalities in mice. Birth Defects Res A Clin Mol Teratol 85 (6):531-541

63. Quadros EV, Nakayama Y, and Sequeira JM (2009) The protein and the gene encoding the receptor for the cellular uptake of transcobalamin-bound cobalamin. Blood 113 (1):186-192

64. Ray JG and Blom HJ (2003) Vitamin B12 insufficiency and the risk of fetal neural tube defects. QJM 96 (4):289-295

65. Rosenblatt DS, Hosack A, Matiaszuk NV, Cooper BA, and Laframboise R (1985) Defect in vitamin B12 release from lysosomes: newly described inborn error of vitamin B12 metabolism. Science 228 (4705):1319-1321

66. Rosenblatt DS, Cooper BA, Schmutz SM, Zaleski WA, and Casey RE (1985) Prenatal vitamin B12 therapy of a fetus with methylcobalamin deficiency (cobalamin E disease). Lancet 1 (8438):1127-1129

80 67. Rosenblatt DS, Laframboise R, Pichette J, Langevin P, Cooper BA, and Costa T (1986) New disorder of vitamin B12 metabolism (cobalamin F) presenting as methylmalonic aciduria. Pediatrics 78 (1):51-54

68. Rosenblatt DS, Aspler AL, Shevell MI, Pletcher BA, Fenton WA, and Seashore MR (1997) Clinical heterogeneity and prognosis in combined methylmalonic aciduria and homocystinuria (cblC). J Inherit Metab Dis 20 (4):528-538

69. Rosenblatt DS and Fenton WA (2001) Inherited disorders of folate and cobalamin transport and metabolism. The Metabolic and Molecular Bases of Inherited Disease. McGraw-Hill, New York, pp 3897-3933

70. Rutsch F, Gailus S, Miousse IR, Suormala T, Sagne C, Toliat MR, Nurnberg G, Wittkampf T, Buers I, Sharifi A, Stucki M, Becker C, Baumgartner M, Robenek H, Marquardt T, Hohne W, Gasnier B, Rosenblatt DS, Fowler B, and Nurnberg P (2009) Identification of a putative lysosomal cobalamin exporter altered in the cblF defect of vitamin B12 metabolism. Nat Genet 41 (2):234-239

71. Sahali D, Mulliez N, Chatelet F, Dupuis R, Ronco P, and Verroust P (1988) Characterization of a 280-kD protein restricted to the coated pits of the renal brush border and the epithelial cells of the yolk sac. Teratogenic effect of the specific monoclonal antibodies. J Exp Med 167 (1):213-218

72. Schorah CJ, Smithells RW, and Scott J (1980) Vitamin B12 and anencephaly. Lancet 1 (8173):880

73. Schwahn BC, Laryea MD, Chen Z, Melnyk S, Pogribny I, Garrow T, James SJ, and Rozen R (2004) Betaine rescue of an animal model with methylenetetrahydrofolate reductase deficiency. Biochem J 382 (Pt 3):831-840

74. Shibata N, Masuda J, Tobimatsu T, Toraya T, Suto K, Morimoto Y, and Yasuoka N (1999) A new mode of B12 binding and the direct participation of a potassium ion in enzyme catalysis: X-ray structure of diol dehydratase. Structure 7 (8):997- 1008

75. Shih VE, Axel SM, Tewksbury JC, Watkins D, Cooper BA, and Rosenblatt DS (1989) Defective lysosomal release of vitamin B12 (cb1F): a hereditary cobalamin metabolic disorder associated with sudden death. Am J Med Genet 33 (4):555-563

76. Sillaots SL, Hall CA, Hurteloup V, and Rosenblatt DS (1992) Heterogeneity in cblG: differential retention of cobalamin on methionine synthase. Biochem Med Metab Biol 47 (3):242-249

77. Smith BT, Mussell JC, Fleming PA, Barth JL, Spyropoulos DD, Cooley MA, Drake CJ, and Argraves WS (2006) Targeted disruption of cubilin reveals essential developmental roles in the structure and function of endoderm and in somite formation. BMC Dev Biol 6:30

81 78. Stabler SP (1999) B12 and nutrition. In: R.Banerjee (ed) Chemistry and Biochemistry of B12. John Wiley & Sons, New York, pp 343-365

79. Stabler SP and Allen RH (2004) Vitamin B12 deficiency as a worldwide problem. Annu Rev Nutr 24:299-326

80. Strauss KA, Morton DH, Puffenberger EG, Hendrickson C, Robinson DL, Wagner C, Stabler SP, Allen RH, Chwatko G, Jakubowski H, Niculescu MD, and Mudd SH (2007) Prevention of brain disease from severe 5,10- methylenetetrahydrofolate reductase deficiency. Mol Genet Metab 91 (2):165-175

81. Suormala T, Baumgartner MR, Coelho D, Zavadakova P, Kozich V, Koch HG, Berghauser M, Wraith JE, Burlina A, Sewell A, Herwig J, and Fowler B (2004) The cblD defect causes either isolated or combined deficiency of methylcobalamin and adenosylcobalamin synthesis. J Biol Chem 279 (41):42742- 42749

82. Swanson DA, Liu ML, Baker PJ, Garrett L, Stitzel M, Wu J, Harris M, Banerjee R, Shane B, and Brody LC (2001) Targeted disruption of the methionine synthase gene in mice. Mol Cell Biol 21 (4):1058-1065

83. Tanner SM, Aminoff M, Wright FA, Liyanarachchi S, Kuronen M, Saarinen A, Massika O, Mandel H, Broch H, and de la Chapelle A (2003) Amnionless, essential for mouse gastrulation, is mutated in recessive hereditary megaloblastic anemia. Nat Genet 33 (3):426-429

84. Taylor RT (1982) B12-dependent methionine biosynthesis. In B12. B Babor ed, John Wiley & Sons, New York, pp 307-355

85. Tomihara-Newberger C, Haub O, Lee HG, Soares V, Manova K, and Lacy E (1998) The amn gene product is required in extraembryonic tissues for the generation of middle primitive streak derivatives. Dev Biol 204 (1):34-54

86. Tsai AC, Morel CF, Scharer G, Yang M, Lerner-Ellis JP, Rosenblatt DS, and Thomas JA (2007) Late-onset combined homocystinuria and methylmalonic aciduria (cblC) and neuropsychiatric disturbance. Am J Med Genet A 143A (20):2430-2434

87. Verkleij-Hagoort AC, de Vries JH, Ursem NT, de JR, Hop WC, and Steegers- Theunissen RP (2006) Dietary intake of B-vitamins in mothers born a child with a congenital heart defect. Eur J Nutr 45 (8):478-486

88. Waggoner DJ, Ueda K, Mantia C, and Dowton SB (1998) Methylmalonic aciduria (cblF): case report and response to therapy. Am J Med Genet 79 (5):373-375

89. Wang YH, Chang SC, Huang C, Li YP, Lee CH, and Chang MF (2005) Novel nuclear export signal-interacting protein, NESI, critical for the assembly of hepatitis delta virus. J Virol 79 (13):8113-8120

82 90. Warren MJ (2006) Finding the final pieces of the vitamin B12 biosynthetic jigsaw. Proc Natl Acad Sci U S A 103 (13):4799-4800

91. Warren MJ (2006) Finding the final pieces of the vitamin B12 biosynthetic jigsaw. Proc Natl Acad Sci U S A 103 (13):4799-4800

92. Watkins D, Whitehead M, and Rosenblatt D (2009) Megaloblastic Anemia. In Nathan and Oski's Hematology of infancy and childhood 7th ed Elsevier S. Eidtors: Stuart H Orkin, David G Nathan, David Ginsburg, A. Thomas Look, David E Fisher, Samuel E Lux, Philadelphia, pp 467-520

93. Watkins D and Rosenblatt DS (1986) Failure of lysosomal release of vitamin B12: a new complementation group causing methylmalonic aciduria (cblF). Am J Hum Genet 39 (3):404-408

94. Watkins D and Rosenblatt DS (1986) Failure of lysosomal release of vitamin B12: a new complementation group causing methylmalonic aciduria (cblF). Am J Hum Genet 39 (3):404-408

95. Watkins D and Rosenblatt DS (1988) Genetic heterogeneity among patients with methylcobalamin deficiency. Definition of two complementation groups, cblE and cblG. J Clin Invest 81 (6):1690-1694

96. Watkins D and Rosenblatt DS (1989) Functional methionine synthase deficiency (cblE and cblG): clinical and biochemical heterogeneity. Am J Med Genet 34 (3):427-434

97. Watkins D, Matiaszuk N, and Rosenblatt DS (2000) Complementation studies in the cblA class of inborn error of cobalamin metabolism: evidence for interallelic complementation and for a new complementation class (cblH). J Med Genet 37 (7):510-513

98. Watkins D, Ru M, Hwang HY, Kim CD, Murray A, Philip NS, Kim W, Legakis H, Wai T, Hilton JF, Ge B, Dore C, Hosack A, Wilson A, Gravel RA, Shane B, Hudson TJ, and Rosenblatt DS (2002) Hyperhomocysteinemia due to methionine synthase deficiency, cblG: structure of the MTR gene, genotype diversity, and recognition of a common mutation, P1173L. Am J Hum Genet 71 (1):143-153

99. Willard HF, Mellman IS, and Rosenberg LE (1978) Genetic complementation among inherited deficiencies of methylmalonyl-CoA mutase activity: evidence for a new class of human cobalamin mutant. Am J Hum Genet 30 (1):1-13

100. Willnow TE, Hilpert J, Armstrong SA, Rohlmann A, Hammer RE, Burns DK, and Herz J (1996) Defective forebrain development in mice lacking gp330/megalin. Proc Natl Acad Sci U S A 93 (16):8460-8464

101. Wilson A, Leclerc D, Saberi F, Campeau E, Hwang HY, Shane B, Phillips JA, III, Rosenblatt DS, and Gravel RA (1998) Functionally null mutations in patients with

83 the cblG-variant form of methionine synthase deficiency. Am J Hum Genet 63 (2):409-414

102. Wong WY, Eskes TK, Kuijpers-Jagtman AM, Spauwen PH, Steegers EA, Thomas CM, Hamel BC, Blom HJ, and Steegers-Theunissen RP (1999) Nonsyndromic orofacial clefts: association with maternal hyperhomocysteinemia. Teratology 60 (5):253-257

103. Xu D and Fyfe JC (2000) Cubilin expression and posttranslational modification in the canine gastrointestinal tract. Am J Physiol Gastrointest Liver Physiol 279 (4):G748-G756

84 APPENDIX A: PUBLICATIONS AND PRESENTATIONS

Original Publication

Lerner-Ellis JP, Anastasio N, Liu J, Coelho D, Suormala T, Stucki M, Loewy AD, Gurd

S, Grundberg E, Morel CF, Watkins D, Baumgartner MR, Pastinen T, Rosenblatt DS,

Fowler B. 2009. Spectrum of mutations in MMACHC, allelic expression, and evidence

for genotype-phenotype correlations. Hum Mutat. 30:1072-81.

Abstracts

Lerner-Ellis JP, Liu J, Coelho D, Suormala T, Loewy AD, Watkins D, Gurd S, Morel C,

Pastinen T, Baumgartner M, Rosenblatt DS, Fowler B. The spectrum of mutations in the

MMACHC gene in patients with cblC disease. American Society of Human Genetics

(ASHG) 57th Annual Meeting. October 23-27 2007, San Diego CA. Am J Hum Genet.

Abstract 1553/F

Anastasio N, Lerner-Ellis JP, Pastinen T, Liu J, Coelho D, Suormala T, Stucki M, Loewy

A, Gurd S, Grundberg E, Morel C, Baumgartner MR, Watkins D, Fowler B, Rosenblatt

DS. Allelic expression of the MMACHC gene and genotype-phenotype correlations in

cblC disease. American Society of Human Genetics (ASHG) 58th Annual Meeting,

November 2008, Philadelphia PA. Abstract 1450/W

Liu J, Jerome-Majewska L, Tremblay ML, Rosenblatt DS. Developmental abnormalities

in a mutant mouse model for MMACHC., 1st Annual Canadian Human Genetics

Conference, April 9-12 2008, St-Sauveur QC

85

Presentations (oral and posters)

The spectrum of mutations in the MMACHC gene in patients with cblC disease. Poster presentation (2nd author), American Society of Human Genetics (ASHG) 57th Annual

Meeting. October 23-27 2007, San Diego CA

Developmental abnormalities in a mutant mouse model for MMACHC. Poster

presentation (1st author), 1st Annual Canadian Human Genetics Conference April 9-12

2008, St-Sauveur QC

Developmental abnormalities in a mutant mouse model for MMACHC. Poster presentation (1st author), CAS Developmental Systems Biology Symposium, May 18-20,

2008, Beijing, China

86 American Society of Human Genetics 2007

The spectrum of mutations in the MMACHC gene in patients with cblC disease. J.P.Lerner-Ellis, J. Liu, D. Coelho1, T. Suormala1, A.D. Loewy, D. Watkins, S. Gurd, C. Morel, T. Pastinen, M. Baumgartner4, D.S. Rosenblatt, B. Fowler1, N. Anastasio

Methylmalonic aciduria and homocystinuria, cblC type (OMIM 277400) is the most common inborn error of vitamin B12 (cobalamin, Cbl) metabolism. The gene for cblC was recently identified as MMACHC and sequenced from the genomic DNA of 119 cblC patients, the second largest cohort of cblC patients in the world. Sixteen novel mutations as well as 17 mutations that were observed previously bringing the total number of identified mutations to 58. Haplotype analysis suggests that several mutations have common founders whereas other mutations occurred more than once in human history at CpG sites prone to mutation. A comparison was made between mutations identified in the 102 cblC patients from Basel, and 221 patients diagnosed in Montreal. A similar distribution of pathogenic alleles was observed for the most common mutation c.271dupA (p.R91KfsX14) and was observed primarily on one haplotype, whereas the c.394C>T (p.R132X) mutation, twice as frequent in the Basel cohort, was observed on three different haplotype backgrounds. Genotype-phenotype correlations of common mutations were apparent; individuals with the c.394C>T mutation generally had late onset disease (present after one year of birth) whereas patients with the c.331C>T (p.R111X) and c.271dupA mutations presented in infancy. Quantitative RT-PCR of RNA from cell lines homozygous for the c.394C>T mutation had significantly higher levels of MMACHC transcript than cell lines homozygous for c.271dupA and c.331C>T mutations as compared to controls. Clinically, individuals with the c.394C>T mutation have responded to vitamin B12 therapy with complete reversal of neurological manifestations and so these findings provide insight into disease mechanism.

87 1st Annual Canadian Human Genetics Conference

Developmental Abnormalities in a Mutant Mouse Model for MMACHC. Junhui Liu, Loydie A. Jerome-Majewska, Michel L. Tremblay, David S. Rosenblatt

Combined methylmalonic aciduria and homocystinuria, cblC type (MIM 277400) is the most frequent inborn error of vitamin B12 (cobalamin, Cbl) metabolism. Cultured fibroblasts from cblC patients are unable to convert cobalamin to its two active forms, methylcobalamin and adenosylcobalamin. In man, mutations in the MMACHC gene are responsible for this disorder; we hypothesized that mutations in the mouse Mmachc gene would be a good model for the phenotypes observed in patients. To make a mutant mouse model of Mmachc, a mouse ES cell line with a genetrap insertion in the first intron of Mmachc was obtained from the Sanger Institution. ES cells were injected into blastocysts of strain 129 mice and these were transfered to pseudopregnant mice. Heterozygous offspring of chimeric mice were used for mating to produce homozygous mice for phenotypic analysis. PCR and RT-PCR were used to detect the wild type and genetrap cDNA in embryos and adult mice. Mmachc heterozygous mice had no obvious phenotype and were both viable and fertile. However, Mmachc homozygous mutant embryos on a mixed genetic background had reduced viablity; of the 127 F2 generation mice, only 3 (Expected: 32) were homozygous mutant. Three of 8 homozygous mutant embryos identified by PCR at E10.5 days and E14.5 days had abnormalities of the trunk, limb and head. Our data suggest that Mmachc is required for mammalian embryonic development. We plan to use these mutant embryos to further characterize the developmental requirement for this gene during early mouse development.

88

American Society of Human Genetics 2008

Allelic expression of the MMACHC gene and genotype-phenotype correlations in cblC disease. N. Anastasio, J. P. Lerner-Ellis, T. M. Pastinen, J. Liu, D. Coelho, T. Suormala, M. Stucki, A. Loewy, S. Gurd, E. Grundberg, C. F. Morel, M. R. Baumgartner, D. Watkins, B. Fowler, D. S. Rosenblatt

Combined methylmalonic aciduria and homocystinuria, cblC type, caused by mutations in MMACHC located in chromosome region 1p34.1, results from the inability to convert intracellular vitamin B12 (cobalamin) into its two active coenzyme forms. Methylcobalamin is required by methionine synthase in the conversion of homocysteine to methionine, and adenosylcobalamin is required by methylmalonyl-CoA mutase in the conversion of methylmalonyl CoA to succinyl CoA. Individuals with cblC disease may present early in life or at a much later age. With regard to genotype-phenotype correlation, individuals with the c.394C>T (p.R132X) mutation generally have late onset of disease whereas patients with the c.331C>T (p.R111X) and c.271dupA (p.R91KfsX14) mutations usually present in infancy. Previous quantitative real-time RT-PCR studies showed increased MMACHC mRNA transcript levels in patients homozygous for the late-onset c.394C>T mutation when compared to both controls and patients homozygous for the early onset c.271dupA and c.331C>T mutations. Allele-specific expression analysis was carried out on human cblC fibroblasts with compound heterozygous mutations. Increased transcript levels were consistently observed from the c.394C>T allele when compared to the c.271dupA and c.331C>T alleles. Understanding the mechanisms underlying differential MMACHC transcript levels may provide a clue as to why individuals carrying the c.394C>T mutation generally present later in life.

89

APPENDIX B: ETHICS AND CERTIFICATES

90