OriGene Technologies, Inc. 9620 Medical Center Drive, Ste 200 Rockville, MD 20850, US Phone: +1-888-267-4436 [email protected] EU: [email protected] CN: [email protected] Product datasheet for SC304890
Interferon alpha 6 (IFNA6) (NM_021002) Human Untagged Clone Product data:
Product Type: Expression Plasmids Product Name: Interferon alpha 6 (IFNA6) (NM_021002) Human Untagged Clone Tag: Tag Free Symbol: IFNA6 Synonyms: IFN-alphaK Vector: pCMV6-Entry (PS100001) E. coli Selection: Kanamycin (25 ug/mL) Cell Selection: Neomycin Fully Sequenced ORF: >NCBI ORF sequence for NM_021002, the custom clone sequence may differ by one or more nucleotides
ATGGCTTTGCCTTTTGCTTTACTGATGGCCCTGGTGGTGCTCAGCTGCAAGTCAAGCTGCTCTCTGGACT GTGATCTGCCTCAGACCCACAGCCTGGGTCACAGGAGGACCATGATGCTCCTGGCACAAATGAGGAGAAT CTCTCTTTTCTCCTGTCTGAAGGACAGACATGACTTCAGATTTCCCCAGGAGGAGTTTGATGGCAACCAG TTCCAGAAGGCTGAAGCCATCTCTGTCCTCCATGAGGTGATTCAGCAGACCTTCAACCTCTTCAGCACAA AGGACTCATCTGTTGCTTGGGATGAGAGGCTTCTAGACAAACTCTATACTGAACTTTACCAGCAGCTGAA TGACCTGGAAGCCTGTGTGATGCAGGAGGTGTGGGTGGGAGGGACTCCCCTGATGAATGAGGACTCCATC CTGGCTGTGAGAAAATACTTCCAAAGAATCACTCTCTACCTGACAGAGAAAAAGTACAGCCCTTGTGCCT GGGAGGTTGTCAGAGCAGAAATCATGAGATCCTTCTCTTCATCAAGAAACTTGCAAGAAAGGTTAAGGAG GAAGGAATAA
Restriction Sites: SgfI-MluI ACCN: NM_021002 OTI Disclaimer: Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). OTI Annotation: This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA. RefSeq: NM_021002.2, NP_066282.1
This product is to be used for laboratory only. Not for diagnostic or therapeutic use. View online » ©2021 OriGene Technologies, Inc., 9620 Medical Center Drive, Ste 200, Rockville, MD 20850, US 1 / 2 Interferon alpha 6 (IFNA6) (NM_021002) Human Untagged Clone – SC304890
RefSeq Size: 570 bp
RefSeq ORF: 570 bp Locus ID: 3443 UniProt ID: P05013 Protein Families: Druggable Genome, Secreted Protein Protein Pathways: Antigen processing and presentation, Autoimmune thyroid disease, Cytokine-cytokine receptor interaction, Cytosolic DNA-sensing pathway, Jak-STAT signaling pathway, Natural killer cell mediated cytotoxicity, Regulation of autophagy, RIG-I-like receptor signaling pathway, Toll-like receptor signaling pathway Gene Summary: Produced by macrophages, IFN-alpha have antiviral activities. Interferon stimulates the production of two enzymes: a protein kinase and an oligoadenylate synthetase. [UniProtKB/Swiss-Prot Function]
This product is to be used for laboratory only. Not for diagnostic or therapeutic use. ©2021 OriGene Technologies, Inc., 9620 Medical Center Drive, Ste 200, Rockville, MD 20850, US 2 / 2