Phylogenetic Analyses of subtribe Goodyerinae and Revision of Goodyera section Goodyera (Orchidaceae) from Indonesia, and Fungal Association of Goodyera section Goodyera

Dissertation

Presented in Partial Fulfillment of the Requirements for the Degree Doctor of Philosophy in the Graduate School of The Ohio State University

By

Lina Susanti Juswara, MSc.

Graduate Program in Evolution, Ecology, and Organismal Biology

The Ohio State University

2010

Dissertation Committee:

Paul Fuerst, Advisor

Laura Kubatko

Hans Klompen Copyright by

Lina Susanti Juswara

2010 Abstract

Phylogenetic analyses using morphological and molecular data of the orchid subtribe

Goodyerinae were performed using parsimony, maximum likelihood, and Bayesian methods. Two hypotheses, proposed by Dressler (1993) and Szlachetko (1995), were tested. The results showed that neither hypothesis can be supported, and that there are no morphological characteristics that can define groups within the subtribe Goodyerinae.

Monophyletic groups within the subtribe cannot be defined using molecular information from three genes.

Systematic revision of Goodyera section Goodyera from Indonesia was investigated using phenetic analyses (cluster analysis, non-metric multidimensional scaling), and discriminant function analysis. The results showed that, of eight forms initially recognized, only three independent taxa can be recognized by these analyses. The independent taxa are Goodyera bifida, G. procera, and G. reticulata. Six subspecies are recognized under Goodyera reticulata. They are G. reticulata subsp. colorata, G. reticulata subsp. gibbsiae, G. reticulata subsp. gemmata, G. reticulate subsp. pusilla, and

G. reticulata subsp. reticulata.

ii Fungal associations with members of Goodyera section Goodyera from Indonesia were examined using data from the fungal nuclear ITS region. Indonesian species of Goodyera section Goodyera have a broader range of fungal associates than do other taxa from the subtribe that had been previously studied. Members of Goodyera section Goodyera from

Indonesia are associated not only with fungi of the phylum Basidiomycetes, including

Rhizoctonia-like forms and Russula,, but also with some species from the phylum

Ascomycetes. In contrast, temperate species of the subtribe (Goodyera oblongifolia) showed the stricter association with previously defined fungal taxa (Rhizoctonia groups).

iii Dedication

Dedicated to the students at The Ohio State University

iv Acknowledgments

Thanks to my committee members: Dr. Paul Fuerst, Dr. Laura Kubatko, and Dr. Hans

Klompen for providing scientific assistance during the process of finishing the dissertation. Also, thanks goes to Mr. Lyn Craven from The Australian National

Herbarium for assistance in the taxonomic treatments of Goodyera section Goodyera from Indonesia.

Thanks to the directors or the chiefs of several herbaria Bogor: Herbarium Indonesia (BO);

Australian National Herbarium, Australia (CANB and QRS) Queensland Herbarium, Australia

(BRI), New South Wales Herbarium, Australia (NSW); The British Museum, U.K. (BM), Kew

Herbarium, U.K. (K); National Herbarium Nederland (Leiden Branch), The Netherlands (L);

Museum National d’Histoire Naturelle, France (P); and Bishop Museum (BISH) Hawaii, The

USA for lending herbarium specimens under their care.

Thank you to funding institutes: Indonesian Institute of Sciences: Botany Division;

Evolution, Ecology, and Organismal Biology: Beatley Funding; The Office of

International Affairs: International Travel Funds; Linnean Society of London; The

American Plant Taxonomy; The Ohio State University Graduate School: Alumni Grants

v for Graduate Research and Scholarship; and others that have supported the research and other workshops need to complete the dissertation.

I would like to thank to Jose Diaz, Barbara Shady, Alpana Chaudhuri, and Mesfin Tadesa for providing assistance in molecular techniques and herbarium specimens.

Finally, I would like to thank many people anonymously to support my fieldwork in

Indonesia (Java, Sumatra, Sulawesi, Irian Jaya, and Bali), and in the US (Wisconsin and

Ohio), during the process of preparation of the projects, sending leaf samples, gathering data, and finishing up my dissertation during the process.

vi Vita

1995 ………………………………. B.S. Agriculture, Brawijaya University Indonesia

2000 ………………………………. MSc Science, The Australian National University

2002-Present ……………………. Graduate Teaching Associate, Department of

Evolution, Ecology, and Organismal Biology,

The Ohio State University

Publications:

Juswara, L.S. and Craven, L.A. 2005. The Hibiscus panduriformis complex (Malvaceae)

in Australia. Blumea 50: 389-405.

Craven, L.A., Brown, G.K., and Juswara, L.S. 2005. Collection of Rhododendron

Section Vireya in Sulawesi, Indonesia, for studies into their evolutionary

relationships and biogeography. American Rhododendron Society Journal 59:

194-201.

vii Field of Study

Major Field: Evolution, Ecology, and Organismal Biology

viii Table of Contents

Abstract …………………………………………………………………………..……… ii

Dedication ……………………………………………………………………….……… iv

Acknowledgments ………………………………………………………………………. v

Vita ……………………………………………….……………………………………. vii

List of Tables ………………………………………………………………………… xviii

List of Figures ………………………………………………………………………….xxii

Chapter 1: Introduction ………………………………………………………………….. 1

1.1. Introduction to Goodyerinae ………………………………………………….. 6

1.2. Morphology of Goodyerinae.…………….……………………………………... 9

1.3. Geographic Distribution of Goodyerinae …………………………………..… 14

1.4. Systematic problems of Goodyerinae ……………………………………….. 15

1.5. The genus Goodyera ……………………………………………………….. 17

1.6. The Aims of the Research …………………………………………………… 22

ix Chapter 2: Phylogenetic Analysis of the Subtribe Goodyerinae ………………………. 23

2.1. Introduction ………………………………………………………………………... 23

2.1.1. Taxonomic History of Goodyerinae ……………………………………………. 25

2.1.2. The Association of the subtribe Goodyerinae with other subtribes within tribe

Cranichideae .…………………..…………………………………………….. 29

2.1.3. Aims of the study ……………………………………………………………….. 30

2.2. Methods ……………………………………………………………………………. 31

2.2.1. Testing Phylogenetic Hypotheses: The Problem of Defining the Homology of

Characters .………………..…………………………………………………..... 31

2.2.2. Collection of data ………………………………………………………………... 32

2.2.3. Homology of molecular characters ……………………………………………... 40

2.2.4. Molecular characters used ………………………………………………………. 40

2.2.4.1. Internal Transcribed Spacer (ITS) .………………………………………….. 41

2.2.4.2. trnL-F …………………………………………………………………………………… 43

x 2.2.4.3. rpl16 …………………………………………………………………………….44

2.2.5. Molecular Technique ……………………………………………………………. 47

2.2.5.1. DNA extraction ………………………………………………………………... 47

2.2.5.1.1. CTAB method ……………………………………………………………….. 47

2.2.5.1.2. CTAB extraction for Micro Samples ………………………………………... 48

2.2.5.1.3. Qiagen DNeasy Plant Mini Extraction Kit ………………………………….. 50

2.2.5.2. PCR Amplification and Sequencing …………………………………………... 50

2.2.6. Coding of Potentially Phylogeneticaly Informative Characters ………………… 50

2.2.7. Data Analyses …………………………………………………………………… 52

2.2.7.1. Sequence Alignment…………………………………………………………… 52

2.2.7.2. Analysis Using Parsimony……………………………………………………... 52

2.2.7.3. Maximum Likelihood: Parameters in Maximum Likelihood ………………… 53

2.2.7.3.1. ModelTest ………………………………………………………………….... 54

2.2.7.4. Bayesian Inference of Phylogeny………. …………………………………….. 56

xi 2.2.7.5. Combined Analyses …………………………………………………………….56

2.2.7.6. Statistical Support of Branching Order and Clades …………………………....57

2.2.7.6.1. The Use of Bootstrapping …………………………………………………… 58

2.2.7.6.2. The Use of Jackknifing ……………………………………………………….58

2.3. Results ………………………………………………………………………………59

2.3.1. Use of Molecular Characters to Infer Phylogenetic Relationships in the Subtribe

Goodyerinae ………………………………………………………………… 60

2.3.1.1. Analyses Using Parsimony ……………………………………………………. 60

2.3.1.2. Analyses of ITS, trnL-F, rpl16, and Combined Data Sets Using maximum

likelihood ………………………………………………………………………..71

2.3.1.3. Bayesian Analyses …………………………………………………………….. 83

2.4. Discussion and Conclusion ………………………………………………………... 90

Chapter 3: Fungal Association of Goodyera section Goodyera from Indonesia ……..…93

3.1. Introduction ………………………………………………………………………... 93

xii 3.1.1. Fungal Associations of Goodyera section Goodyera in Indonesia…………….. 100

3.1.2. Hypotheses about Orchid-Fungal Associations ………………………………... 102

3.2. Materials and Methods …………………………………………………………….104

3.2.1. Sampling Strategy ……………………………………………………………… 104

3.2.2. Fungal Cultures and DNA Extraction ………………………………………….. 106

3.2.3. Data Analyses ………………………………………………………………..… 108

3.2.4. Association between Orchids and Fungi ……………………………………….. 111

3.2.5. Statistical Tests for Co-speciation ……………………………………………... 113

3.2.6. Analysis of Fungal Association of Goodyera section Goodyera from Indonesia

…………………………………………………………………………………..114

3.3. Results…………………………………………………………………………….. 114

3.3.1. Anatomical analysis of roots …………………………………………………… 115

3.3.2. DNA Analysis of Fungal Associations with Species within Goodyera section

Goodyera in Indonesia ………………………………………………………... 117

xiii 3.3.3. Results of Parsimony…………………………………………………………… 119

3.4. Discussion ………………………………………………………………………... 122

3.5. Conclusion ……………………………………………………………………….. 124

Chapter 4: Multivariate Analysis of Goodyera section Goodyera from Indonesia ……126

4.1. Introduction ………………………………………………………………………. 126

4.1.1. Goodyera section Goodyera from Indonesia…………………………………… 126

4.1.2. Species Concepts ………………………………………………………………. 129

4.2. Methods…………………………………………………………………………….132

4.2.1. Sampling Strategy………………………………………………………………. 132

4.2.2. Choice of Morphological Characters ……………………………………………137

4.2.3. Defining Morphological Variation within Goodyera section Goodyera ……….. 137

4.2.4. Statistical Examinations in the Choice of Characters of Phenotypic Variation

between Species within Goodyera section Goodyera ………………………...140

4.2.5. Distances and Cluster Analyses ………………………………………………...141

xiv 4.2.6. Ordination (Nonmetric Multidimensional Scaling)…………………………….. 143

4.2.7. Test of Grouping (Discriminant Function Analysis) …………………………... 144

4.3. Results ……………………………………………………………………………..147

4.3.1. Cluster Analyses: UPGMA ……………………………………………………...147

4.3.2. Non-Metric Multidimensional Scaling and Discriminant Function Analysis…...156

4.4. Discussion ………………………………………………………………………... 193

4.5. Taxonomic Conclusion …………………………………………………………... 196

Chapter 5: Taxonomic Treatment of Goodyera section Goodyera from Indonesia …...197

5.1. Introduction ………………………………………………………………………. 197

5.1.1. Identification key to the taxa within Goodyera section Goodyera in Indonesia

…………………………………………………………………………………..197

5.1.2. Account of the taxa of Goodyera section Goodyera in Indonesia ……………... 198

References ……………………………………………………………………….. 139

xv Appendix A: New nuclear ITS sequences and alignment used in phylogenetic analyses

…………..……………………………………………….…………………….255

Appendix B: Forty-eight new trnL-F sequences and alignments used in phylogenetic

analyses ……………………………………………………………………….. 276

Appendix C: Forty-nine new rpl16 sequence and alignments used in phylogenetic

analyses …………………………………………………………………...…315

Appendix D: ITS pairwise sequence divergence between and within genera by the

exclusion or inclusion of the out-groups …………………………………….367

Appendix E: Adam consensus generated from ITS data sets ………………………… 381

Appendix F: Majority rule tree generated from ITS data sets ……………………….. 386

Appendix G: Semi-strict consensus tree generated from ITS data sets ………………. 391

Appendix H: trnL-F pairwise sequence divergence between and within genera with the

exclusion and inclusion of the out-groups …………………………………...396

Appendix I: rpl16 pairwise sequence divergence between and within genera with the

exclusion and inclusion of the out-groups …………………………………... 403

xvi Appendix J:The ITS sequence data for fungi associated with the species from Goodyera

section Goodyera including outgroups (collected both from field and GenBank).

Complete sequences provided ………………… ………………………… 409

Appendix K: Fungal ITS sequence data used in the construction of the fungal trees

associated with the orchids …………………………………………………….416

Appendix L:Original data collected from the herbarium specimens (39 characters, 23

taxa) ……………………………………………………………………………420

Appendix M: Complete data sets of Goodyera section Goodyera used in the phonetic

analyses ……………………………………………………………………….433.

Appendix N: Data sets of Goodyera section Goodyera used in the phonetic analyses after

standardization ……………………………………………………………... 437

Appendix O: Analyses of correlation coefficient of 39 features, 23 taxa (full collected

data set) ……………………………………………………………………...…441

xvii List of Tables

Table 1.1. The characteristics of the six tribes in the subfamily Orchidaceae (adapted

from Pridgeon et al. 2003) …………………………………………………...…4

Table 1.2. The characteristics of the six subtribes in the Tribe Cranichideae (adapted from

Pridgeon et al. 2003) ……………..…………………………………………...…7

Table 2.1. Samples collected from fields and vouchers ………………………………... 34

Table 2.2. PCR Primer sequences used for molecular analyses of samples from the

subtribe Goodyerinae. The location of primers in each …...……………………51

Table 2.3. Evolutionary models incorporated into maximum likelihood Analysis

…………………………………………………………………..……………….55

Table 2.4. Details of the variation in the DNA sequences used in the analysis and

statistics of the tree generated by parsimony analysis………………………....61

Table 3.1. Fungal groups within the form of Rhizoctonia-like according to Andersen

(1990) and Andersen & Stalpers (1994) in Rasmussen (1995, p. 83). ……….…99

Table 3.2. Primers of specific fungi used for sequencing using ABI 3100…………… 109

xviii Table 4.1. Eight groups within Goodyera section Goodyera from Indonesia recognized

priory based on their unique morphological features………….…,,,,,,,………. 134

Table 4.2. Specimens used for the multivariate analyses……………………………...135

Table 4.3. Characters showing morphological variation within Goodyera section

Goodyera from Indonesia……………………………………………………... 138

Table 4.4. Sample scores from the NMDS when using Euclidean distance for the full data

sets of taxa and variables. These values are used for the subsequent Discriminant

Function Analysis (DFA). The values are those determined when the stress value

from NMDS was 5.7%. Sample scores are positions of the data in the axes where data

need to be mapped………………………………………………………………...176

Table 4.5. Sample scores from the NMDS when using Euclidean distance for the full data

sets of taxa and variables. These values are used for the subsequent Discriminant

Function Analysis (DFA). The values are those determined when the stress value

from NMDS was 5.7%. Sample scores are positions of the data in the axes where data

need to be mapped…………………………………………………….………...177

Table 4.6. Sample scores from the NMDS when using the Sorenson distance for the full data

sets of taxa and variables. These values are used for the subsequent Discriminant

function analysis (DFA). The values are those determined when the stress value from

xix NMDS was 10.3%. Sample scores are positions of the data in the axes where data

need to be mapped …………………………………………………….…………..178

Table 4.7. Posterior probability of groups defined a priori using input results from the NMDS

based on separation of taxa by Euclidean distances…………………….…………180

Table 4.8. Posterior probability of groups defined a priori using input results from the NMDS

based on separation of taxa by Sorenson distance…………….…………………...181

Table 4.9. Posterior probability of groups defined a priori using input results from the NMDS

based on separation of taxa by squared root distance……………………………..182

Table 4.10. Sample scores from the NMDS when using Euclidean distance for the data sets

without ‘Procera’. These values are used for the subsequent discriminant function

analysis (DFA). The values are those determined when the stress value from NMDS

was 10.6%. Sample scores are positions of the data in the axes where data need to be

mapped……………………………………………………………………………186

Table 4.11. Sample scores from the NMDS when using Sorenson distance for the data sets

without ‘Procera’. These values are used for the subsequent discriminant function

analysis (DFA). The values are those determined when the stress value from NMDS

was 10.6%. Sample scores are positions of the data in the axes where data need to be

mapped…………………………………………………………………….……..187

xx Table 4.12. Sample scores from the NMDS when using squared root distance for the data sets

without ‘Procera’. These values are used for the subsequent discriminant function

analysis (DFA). The values are those determined when the stress value from NMDS

was6.4%. Sample scores are positions of the data in the axes where data need to be

mapped……………………………………………………………………..……..188

Table 4.13. Posterior Probability of groups determined a priori (NMDS using Euclidean

distance) …………………………………………………………………………...190

Table 4.14. Posterior Probability of groups determined a priori (NMDS using Sorenson

distance) ……………………………………………………………………………191

Table 4.15. Posterior Probability of groups determined a priori (NMDS using the squared

root distance) ……………………………………………………………………...192

xxi List of Figures

Figure 1.1. Distribution of species of subtribe Goodyerinae in the world (adopted from

Pridgeon et al., 2003). ………………………………………..…….…………..16

Figure 2.1. DNA regions used in phylogenetic analyses: A. ITS region, B. trnL-F region,

C.rpl16 region (Adopted from Baldwin, B.G. (1992), Taberlet et al. (1991), and

Tanaka et al. (1986). …………………………………………………………. 46

Figure 2.2. The strict consensus of >5000 trees of the most parsimonious trees, 1405

steps using ITS data sets (OG = out-group taxa; (1) = one stigmata, (2) = two

stigmata sensu Dressler (1993); C = Cherostylidinae (two stigmata),

G=Goodyerinae (one stigmata, column strait), L=Ludissinae (one stigmata,

column twisted) sensu Szlachetko and Rutkowski (2000)). The numbers over the

branch are the bootstrap, and under the branch are jackknife. A. The first half,

B. The second half. ……………………………………………………….…. 66

Figure 2.3. The strict consensus of 1021 trees of the most parsimonious trees, 621 steps

using trnL-F data sets. (OG = out-group taxa; (1) = one stigmata, (2)= two

stigmata sensu Dressler (1993); C = Cherostylidinae (two stigmata), G =

Goodyerinae (one stigmata, column strait), L = Ludissinae (one stigmata, column

xxii twisted) sensu Szlachetko and Rutkowski (2000)). The numbers over the branch

are the bootstrap, and under the branch are jackknife …………………………. 68

Figure 2.4. The strict consensus of 127 trees of the most parsimonious trees, 1171 steps

using rpl16 data sets. (OG = out-group taxa; (1) = one stigmata, (2) = two

stigmata sensu Dressler (1993); C = Cherostylidinae (two stigmata),

G=Goodyerinae (one stigmata, column strait), L=Ludissinae (one stigmata,

column twisted) sensu Szlachetko and Rutkowski (2000)). The numbers over the

branch are the bootstrap, and under the branch are jackknife………………….. 69

Figure 2.5. The strict consensus of three trees of the most parsimonious trees, 1829 steps

using combined data sets (ITS, rpl16, and trnL-F). (OG = out-group taxa; (1) =

one stigmata, (2)= two stigmata sensu Dressler (1993); C = Cherostylidinae (two

stigmata), G=Goodyerinae (one stigmata, column strait), L=Ludissinae (one

stigmata, column twisted) sensu Szlachetko and Rutkowski (2000)). The numbers

over the branch are the bootstrap, and under the branch are jackknife ………..70

Figure 2.6. Rooted ITS maximum likelihood tree, the best model determined by AIC in

the ModelTest. (OG = out-group taxa; (1) = one stigmata, (2) = two stigmata

sensu Dressler (1993); C = Cherostylidinae (two stigmata), G = Goodyerinae (one

xxiii stigmata, column strait), L = Ludissinae (one stigmata, column twisted) sensu

Szlachetko and Rutkowski (2000)). The numbers over the branch are the

bootstrap, and under the branch are jackknife. A. The first half, B. The second

half………………………………………………………….…………………. 76

Figure 2.7. Rooted ITS maximum likelihood tree, the best model determined by

likelihood ratio in the ModelTest. (OG = out-group taxa; (1) = one stigmata, (2) =

two stigmata sensu Dressler (1993); C = Cherostylidinae (two stigmata), G

=Goodyerinae (one stigmata, column strait), L = Ludissinae (one stigmata,

column twisted) sensu Szlachetko and Rutkowski (2000)). The numbers over the

branch are the bootstrap, and under the branch are jackknife. A. The first half, B.

The second half. ………………………………………………..……………… 78

Figure 2.8. Rooted Maximum Likelihood tree using trnL-F data sets. (OG = out-group

taxa; (1) = one stigmata, (2) = two stigmata sensu Dressler (1993); C =

Cherostylidinae (two stigmata), G = Goodyerinae (one stigmata, column strait),

L=Ludissinae (one stigmata, column twisted) sensu Szlachetko and Rutkowski

(2000)). The numbers over the branch are the bootstrap, and under the branch are

jackknife…………………………………………………………...……………..80

xxiv Figure 2. 9. Rooted Maximum Likelihood tree using rpl16 data sets. (OG = out-group

taxa, (1) = one stigmata; (2)= two stigmata sensu Dressler (1993); C =

Cherostylidinae (two stigmata), G=Goodyerinae (one stigmata, column strait),

L=Ludissinae (one stigmata, column twisted) sensu Szlachetko and Rutkowski

(2000)). The numbers over the branch are the bootstrap, and under the branch are

jackknife………………………………………………………………..………..81

Figure 2.10. Rooted Maximum Likelihood tree using combined data sets. The values

above the line indicates the bootstrap values and below line indicates jackknife

value. (OG = out-group taxa; (1) = one stigmata, (2)= two stigmata sensu

Dressler (1993); C = Cherostylidinae (two stigmata), G=Goodyerinae (one

stigmata, column strait), L=Ludissinae (one stigmata, column twisted) sensu

Szlachetko and Rutkowski (2000)). The numbers over the branch are the

bootstrap, and under the branch are jackknife….……………………………... 82

Figure2.11. The rooted Bayesian tree generated using ITS data sets. The numbers

indicate the posterior probability out of 100 clades to appear in the tree generated

by the Bayesian analyses. (OG = out-group taxa; (1) = one stigmata, (2)= two

stigmata sensu Dressler (1993); C = Cherostylidinae (two stigmata),

G=Goodyerinae (one stigmata, column strait), L=Ludissinae (one stigmata,

xxv column twisted) sensu Szlachetko and Rutkowski (2000)). A. The first part, B.

The second part. …………………………………………………..……………. 85

Figure 2.12. The rooted Bayesian tree generated using trnL-F data sets. The numbers

indicate the posterior probability out of 100 clades to appear in the tree generated

by the Bayesian analyses. (OG = out-group taxa; (1) = one stigmata, (2)= two

stigmata sensu Dressler (1993); C = Cherostylidinae (two stigmata),

G=Goodyerinae (one stigmata, column strait), L=Ludissinae (one stigmata,

column twisted) sensu Szlachetko and Rutkowski

(2000))……………………………………….………………………………… 87

Figure 2.13. Rooted Bayesian tree using rpl16 data set. The numbers indicate the

posterior probability out of 100 clade to appear in the tree generated by the

Bayesian analyses. (OG = out-group taxa; (1) = one stigmata, (2)= two stigmata

sensu Dressler (1993); C = Cherostylidinae (two stigmata), G=Goodyerinae (one

stigmata, column strait), L=Ludissinae (one stigmata, column twisted) sensu

Szlachetko and Rutkowski (2000))……………………………………………... 88

Figure 2.14. Rooted Bayesian tree using combined data sets. The numbers indicate the

posterior probability out of 100 clades to appear in the tree generated by the

Bayesian analyses. (OG = out-group taxa; (1) = one stigmata, (2)= two stigmata

xxvi sensu Dressler (1993); C = Cherostylidinae (two stigmata), G=Goodyerinae (one

stigmata, column strait), L=Ludissinae (one stigmata, column twisted) sensu

Szlachetko and Rutkowski (2000))…………………………………………… 89

Figure 3.1. The appearance of concordance between phylogenetic trees of orchids and

phylogenetic trees of fungi for the concepts of (1) specificity in association, (2)

non-specificity of association, and (3) development of new

specialization………………………………………………………….……... 103

Figure 3.2. Anatomy of the orchid roots, with variation in density of pelotons inside

orchid cells in the roots. A. CBF 162 Goodyera oblongifolia, many pelotons

recognized in this slide, B. CBF 162 Goodyera oblongifolia, no pelotons

recognized in this slide………………………………………………………. 116

Figure 3.3. Parsimony analyses of fungi associates of species from the section Goodyera

using ITS. The bootstrap values are above and jackknife values are below the

branches. The connections between the two trees show interaction between the

orchids and their associated fungi……………………………………………. 120

Figure 4.1. Cluster analysis of full data (19 morphological characteristics and 23 taxa) set

using Euclidean distance and UPGMA linkage method………………………. 148

xxvii Figure 4.2. Cluster analysis of full data set (19 morphological characteristics and 23 taxa)

using Euclidean distance and Ward linkage method………………………….. 149

Figure 4.3. Cluster analysis of full data sets (19 morphological characteristics and 23

taxa) using Sorensen distance and UPGMA linkage method…………………..150

Figure 4.4. Cluster analysis of 18 morphological characteristics and 18 taxa (‘Procera’ is

excluded from the analysis) using an analysis with Euclidean distance and

UPGMA linkage method (EU)……………………….………………………153

Figure 4.5. Cluster analysis of 18 morphological characteristics and 18 taxa (‘Procera’ is

excluded from the analysis) using an analysis with Euclidean distance and Ward

linkage method (EW)……….……………………..……………………………154

Figure 4.6. Cluster analysis of 18 morphological characteristics and 18 taxa (‘Procera’ is

excluded from the analysis) using Sorenson distance and UPGMA (SU)……...155

Figure 4.7. NMDS analyses of taxa separated by Euclidean distances. The dataset

consisted of 19 morphological characters and 23 taxa. A. Three dimensional

NMDS analysis of taxa separated by Euclidean distances. The stress value for the

three dimensional analysis is 5.7%; B. Two dimensional representation of the

xxviii NMDS analysis of taxa separated by Euclidean distances when the taxa were

observed from Axis 3. The size of the triangles shows the distance of points from

the axes 1 and 2; C. Two dimensional representation of the NMDS analysis of

taxa separated by Euclidean distances when the taxa were observed from Axis 2.

The size of the triangles shows the distance of points from the axes 1 and 3; D.

Two dimensional representation of the NMDS analysis of taxa separated by

Euclidean distances when the taxa were observed from Axis 1. The size of the

triangles shows the distance of the points from axes 2 and 3. ………….……..159

Figure 4.8. NMDS analyses of taxa separated by squared root distances. The dataset

consisted of 19 morphological characters and 23 taxa. A. Three dimensional

NMDS analysis of taxa separated by squared root distances. The stress value of

the three dimensions is 5.6%; B. Two-dimensional representation of the NMDS

analysis of taxa separated by Squared root distances when the taxa were observed

from Axis 3. The size of the triangles shows the distance of the points from the

axis 1 and 2; C. Two-dimensional representation of the NMDS analysis of taxa

separated by squared root distances when the taxa were observed from Axis 2.

The size of the triangles shows the distances of points from axes 1 and 3; D. Two-

dimensional representation of the NMDS analysis of taxa separated by squared

xxix root distances when the taxa were observed from Axis 1. The size of the triangles

shows the distance of points from axes 2 and 3………………………………...163

Figure 4.9. Two-dimensional representation of the NMDS analysis of taxa separated by

Sorenson distances, the stress value for the two dimensions was 10.3%. The size

of the triangles shows the distance of the points from axes 1 and 2…….……. 167

Figure 4.10. Representation of the relationships between taxa separated by Euclidean

distance for NMDS, when applied to the data set in which samples of ‘Procera’

were excluded. The dataset consisted of 18 morphological characters and 19 taxa.

The size of the triangles shows the distance of the points from the axes 1 and 2.

Stress value was 10.6%...... 169

Figure 4.11. Representation of the relationships between taxa separated by squared root

distance for NMDS, when applied to the data set in which samples of ‘Procera’

were excluded. The dataset consisted of 18 morphological characters and 19 taxa.

The size of the triangles shows the distance of the points from the axes 1 and 2.

Stress value was 10.6%...... 170

Figure 4.12. A. Three dimensional NMDS analysis of taxa separated by Sorenson

distances. The dataset consisted of 18 morphological characters and 19 taxa.

xxx Stress value was 6.4%; B. Two dimensional representation of the NMDS analysis

of taxa separated by Sorenson distances when the taxa were observed from Axis

3. The size of the triangles shows the distance of the points from the axes 1 and

2; C. Two dimensional representation of the NMDS analysis of taxa separated by

Sorenson distances when the taxa were observed from Axis 2. The size of the

triangles shows the distance of the points from the axes 1 and 3; D. Two-

dimensional representation of the NMDS analysis of taxa separated by Sorenson

distances when the taxa were observed from Axis 1. The size of the triangles

shows the distance of the points relative to the axes 2 and 3…………………...171

Figure 5.1. Map: distribution of Goodyera bifida in Indonesia ………………………..201

Figure 5.2. Plate: Goodyera bifida (by Subari, BO) …………………………………...202

Figure 5.3. Photo: Goodyera bifida [Java: West Java: Mt. Gede] ……………………..203

Figure 5.4. Map: Distribution of Goodyera procera in Indonesia ...…………………...206

Figure 5.5. Plate: Goodyera procera (by Subari, BO) ..……………………………….207

Figure 5.6. Photo: Goodyera procera [Java: West Java: Mt. Salak, Curug Nangka] ....208

Figure 5.7. Map: Distribution of Goodyera reticulate subsp. reticulata in Indonesia ...211

xxxi Figure 5.8. Plate: Goodyera reticulata subsp. reticulata (by Subari, BO) …………...212

Figure 5.9. Photo: Goodyera reticulata subsp. reticulata [Java: West Java: Mt. Gede]

...... 213

Figure 5.10. Map: Distribution of Goodyera reticulata subsp. schlectendaliana in

Indonesia...... 217

Figure 5.11. Plate: Goodyera reticulata subsp. schlectendaliana (by Subari, BO) ……218

Figure 5.12. Photo: Goodyera reticulata subsp. schlectendaliana [Sumatra: West

Sumatra: Mt. Singgalang) ...... 219

Figure 5.13. Map: Distribution of Goodyera reticulata subsp. pusilla in Indonesia

…………………………………………………………………………………..222

Figure 5.14. Plate: type specimen Goodyera reticulata subsp. pusilla (L) ……………223

Figure 5.15. Photo: Goodyera reticulata subsp. pusilla (L) [Java: Banten Prov.: Mt.

Karang] ………………………………………………………………………...224

Figure 5.16. Map: Distribution of Goodyera reticulata subsp. gemmata in Indonesia ..227

Figure 5.17. Plate: Goodyera reticulata subsp. gemmata ...... 228

Figure 5.18. Photo: Goodyera reticulata subsp. gemmata [Sumatra: North Sumatra: Mt.

Sinabung] ...... 229

xxxii Figure 5.19. Map: Distribution of Goodyera reticulata subsp. gibbsiae in Indonesia

………………………………………………………………………………….232

Figure 5.20. Plate: Goodyera reticulata subsp. gibbsiae in Indonesia (K. Mediani,

CCAD) ...... 233

Figure 5.21. Map: Distribution of Goodyera reticulata subsp. colorata in Indonesia

…..……………………….……………………………………………………..236

Figure 5.22. Plate: Goodyera reticulata subsp. colorata (by Subari, BO) …………….237

Figure 5.23. (A). Photo: Type of Goodyera reticulata subsp. colorata. (B) Collection des

Orchidées les plus remarquables de l'archipel Indien et du Japon (1858)

……………………………………………………………………………..…..238

xxxiii Chapter 1: Introduction

The family Orchidaceae is the largest family of flowering plants (angiosperms) consisting of 25-30 thousands species (Dressler 1990). The group is characterized by having: (1) a modified and enlarged floral part, the modified medial petal called the labellum or lip, (2) the presence of modified male and female reproductive organs called column

(gynostemium), formed by the fusion of stamen and pistil into one organ, and (3) the presence of compact pollen masses, called pollinia.

Five subfamilies within the Orchidaceae are now recognized by most investigators: the

Apostasioideae, Cypripedioideae, Epidendroideae, Orchidoideae, and Vanillioideae

(Chase et al. 2003). The members of the Apostasioideae are considered to be the most basal clade within the most recent study of Orchidaceae, based on DNA (Chase at al.

2003). Members of the Apostasioideae are recognized as having two or three anthers.

The Apostasioideae forms a sister clade to all other forms of Orchidaceae. Relationships of other subfamilies of the Orchidaceae have only recently been worked out.

Based on the analyses by Chase et al (2003) using the combined DNA sequence data from seven loci, one subfamily, the Vanillioideae, was suggested to have diverged from the lineage leading other more derived subfamilies of the Orchidaceae. Major morphological characteristics of Vanillioideae include single, incumbent anther, and

1 poorly organized pollinia. The anther of the Vanillioideae appears already bent from early development.

A long recognized subfamily in Orchidaceae, Cypripedioideae, has two anthers, and appears to have been the next group that diverged from the ancestor of more advanced forms. The subfamily Epidendroideae is identified as the most derived single anther species group within the orchid family. This placement was supported by Chase et al.

(2003) using seven genes, which identifies the Epidendroideae as the sister clade of the remaining derived subfamily the Orchidoideae. This derived position was also supported in an earlier study by Freudenstein and Rasmussen (1999), based on morphological characteristics. The subfamily Epidendroideae is characterized by having monoandrous anthers, the anther posture developing from an erect position early in development, after which it bends during maturation (Dressler 1981).

Based on five molecular markers (Chase et al. 2003), the final subfamily, the

Orchidoideae, formed a clear group, with members of the problematic Spiranthoideae, previously considered a distinct subfamily, embedded within Orchidoideae (Chase at al.

1994, Kores et al. 1997, Cameron et al., 1999), but with the removal of the tribes

Tropideae and Diceratosteleae from Spiranthoideae and subsequent placement within the subfamily Epidendroideae. A combination of morphological characteristics supported the lumping of the remaining members of the Spiranthoideae as a tribe into Orchidoideae

(Freudenstein and Rasmussen 1999), although there are no strong synapomorphic morphological characteristics to support these groups.

2 Among the five subfamilies, Orchidoideae is the most complex group, as indicated by not having any synapomorphic morphological characteristics that delineate this group. At lower taxonomic levels, groups within this subfamily also show high complexity. The subfamily Orchidoideae consists of Tribes Chloraeeae, Codonorchidaeae and

Cranichideae (Pridgeon et al. 2003). The characteristics of the tribes within the subfamily Orchidoideae are presented in Table 1.1.

3 Table 1.1. The characteristics of the six tribes in the subfamily Orchidaceae (adapted from Pridgeon et al. 2003)

Subtribe Habit Leaves Leavesarrangement Diseae Terrestrial Flattoconvolute Whorlandspiral Diurideae Terrestrial,geophytic Leafyandleafless, Whorl and spiral cylindrical or convoluted Orchideae Terrestrial,rarely Flat and convoluted Spiral epiphytic Chloraeae Terrestrial,sympodial Convoluted,non- Spiral articulated Codonorchideae Terrestrial Convoluted,non- Whorl articulated Cranichideae Terrestrial,litophytic Convoluted Spiral

Subtribe Inflorescence #flowersper Floral orientation inflorescence Diseae Terminal Onetomany Resupinateornon- resupinate Diurideae Terminal Onetomany Resupinateornon- resupinate Orchideae Terminal One Resupinate Chloraeae Terminal One Resupinate Codonorchideae Terminal One Resupinate Cranichideae Terminal Onetomany Resupinaterarelynon- resupinate

Subtribe Floralparts Dorsalsepals Lateralsepals Diseae Mainlyfusedorconnate Connate,tubular, Connate basally galeated Diurideae Free.Slightlyconnate Free,slightlyconnate Freetoslightlyconnate Orchideae Free Free Free Chloraeae Free Free, prominantely Free or connate basally veined Codonorchideae Free Free,thelateralslightly Free longer Cranichideae Fusedtofree Connateorfree,oblong More or less connate elliptic, slightly oblique occasionally Continued

4 Table 1.1. continued

Subtribe Petals Lalbellum Column Diseae Connatebasally, Simple, without spur or As long as or shorter spreading, rarely galaeta with two spurs than the galeate stalked, saccate, labellum marginally fringed Diurideae Freetoslightlyconnate Hingedatthebase Elongate,unitedrarely with stamen and style to almost free Orchideae Free Deflexed,entire,3-5 Basifixed, erect or lobes decumbent, pollinia adnate or separated Chloraeae Free, veined Free, sessile or clawed, Glabrous with or longitudinally entire or three lobes without wings Codonorchideae Free,shorterorlonger Free, long clawed, entire Elongate, thin with strait than dorsal sepals or trilobes wings Cranichideae Connatebasallytofree Freeoradnatetothe Short to elongate ovary, semi rigid or motile, entire, bipartite, tripartite, basally entire, saccate or spurred

Subtribe Ovary Diseae Elongateorbend Diurideae Elongate Orchideae Elongate,glabrous Chloraeae Elongate,glabrous Codonorchideae Short,coneshapeto globrose, glabrous unilocular Cranichideae Twistedoruntwisted

5 1.1 Introduction to the Goodyerinae

The Goodyerinae is a well-defined subtribe within the tribe Cranichideae and the subfamily Orchidoideae (Orchidaceae). There are six subtribes in the tribe Cranichideae, and the six subtribes of the tribe are presented in Table 1.2. It contains approximately

450 species grouped within 35 genera. The term jewel orchids is often used when referring to the members of the Goodyerinae. Species of the Goodyerinae are terrestrial, occasionally lithophytic (growing on the rocks), and rarely epiphytic herbs, characterized by having creeping rhizomes, which occasionally can be thicker than the stem. Stems of these plants are slender, and they usually have fleshy roots. Occasionally, roots are moniliform and hairy. Roots come out from the nodes of the rhizome. Some species have no roots, with roots being replaced by rhizoids. Leaves of Goodyerinae are spiral or rosette, soft, and herbaceous. Many of them have colorful leaves and reticulate or parallel venations. The flowers of these groups are small (ca. 0.5mm) to small-medium size (up to

1.5 cm long), commonly with white to pale green colors. However, some species have yellowish, brownish, and pinkish flowers. The floral parts are very unique, having saccate lips or a spur at the base, and often contain emergent glands. Several studies show that the taxonomy of this group is difficult to analyze due to a combination of the uniformity of the habit, together with the complexity of their floral structures (Salazar et al, 2003, Cameron et al. 1999, and Pridgeon et al. 2003). The members of the

Goodyerinae possess a single, erect, and basitonic monandrous anther (viscidium or rostellum attach with the base of the anther) (Cameron et al. 1999). The morphological details are discussed in the separate section below.

6 Table 1.2. The characteristics of the six subtribes in the Tribe Cranichideae (adapted from Pridgeon et al. 2003)

Tribes Habit Rhizome Leaves Cranichideae Terrestrial,lithophytic Spirallyarranged Terminalrarelylateral, rarely epiphytic, some to many flowers terminal Galleotiellineae Terrestrial,lithophytic, No rhizome, root, Sessile, present at terminal cylindrical, fleshy, flowering time, rigidly sparsely pilose ascending Goodyerinae Terristrial,lithophytic, Creeping terete to Sessile or with a petiole terminal moniliform, short to long Manniellineae Terristrial,lithophytic Condense rhizome roots Rosette, not folding, rarely epiphytic, hairy, fleshy conduplicate, non- monopodial articulate, petiolate Pterostylidinae Perennial,terrestrial, No rhizome, tubers Petiolate subsessile to rarely epiphytic, connected to stolon or sessile, basal or cauline sympodial no tuber Spiranthinae Terristrial,lithophytic, Slender, roots along the Spirally arranged, epiphytic, sympodial slender rhizome solitary or forming a basal rosette

Tribes Inflorescens Flowers Sepals Cranichideae Terminalrarelylateral, Small to medium, non- Subsimilar, more or less some to many flowers resupinate, hairy connate Galleotiellineae Terminal,manyflowers Small,non-resupinate, Connate at the base, cellular papillose lateral sepal decurrent on the ovary for about ¼ of the length Goodyerinae Terminal,manyflowers Smalltomedium,non- Connate at the base, resupinate rarely ono- dorsal often forming resupinate, glabrous hood with a petal, lateral free and fused Manniellineae Terminal,manyflowers Small,resupinate, Free, uniform in all parts spirally arranged, pubescent Terminal, one to many Large relative to the Dorsal sepal and petals flowers other subtribe form galea Terminal,raceme Resupinate,tubular, Free or partially often fleshy connate, decurrent on the ovary and forming a spurred or chin

Continued

7 Table 1.2. continued

Tribes Petals Labellum Column Cranichideae Thin-textured, Saccate, sometimes Short to elongate, strait sometimes adnate with connate at the basal of to bend, anther dorsal the dorsal sepa the column subequal to rostellum Galleotiellineae Erect,partiallyadherent Concave-cymbiform, Short, bend at the tip to the dorsal sepal fleshy, claw, cuneate, unted to connate, blade suborbicular, rarely obovate, apex thinner, apiculate deflected Goodyerinae Freeorfused Fleshy,attachedatthe Short to long, sessile to based, entire, bilobed or stalked tripartite Manniellineae Fusedpartially Freshly,entireor Elongate, geniculate somewhat bipartite near base and abruptly decurved and dilated near apex Pterostylidinae Adherenttothedorsal Free, actively motile, Short to long apical lobe sepals entire or trilobed, basal middle part with or appendage, present or without hairs (trichome) absent, apex trifid to penicillate Spiranthinae Adherenttothedorsal Adherent to the apical A distinct food partially forming hood over the portion of the column, completely adnate column and labellum divided into epichile and obliquely to the ovary hypochile rostellum shapes diverse

Tribes Pollinia Caudicles Viscidium Cranichideae Twotofour Twotofour Terminal Galleotiellineae Four Absent Ventral Goodyerinae Two One Absent Manniellineae Two One Verysmall Pterostylidinae Four None None Spiranthinae Tworarelyfour None Terminalorventral

Tribes Stigma Ovary Cranichideae Entire Hairyorvillose Galleotiellineae Two,raised Nohairsandwithhairs (pubescent) Goodyerinae Oneortwostigma Hairy (pubescent) lobes, free to connate glandular, and without hairs Manniellineae One Hairy(pubescent)and with no hairs Pterostylidinae One Nohairs Spiranthinae Oneortwo Nohairsandwithhairs (lanuginose)

8 Many species of the Goodyerinae occupy the forest floor in shady forests with cool, humid condition, wet, but with good drainage. They are widely distributed in the tropical and subtropical regions of both the Old and New World (Pridgeon et al. 2003).

Species within Goodyerinae are not considered to be economically important. However, some of them, such as some species of Anoectochilus (A. formosanum, A. setaceus, A. calcareous, and A. regalis) and Goodyera (G. kwangtungensis Tso (G. schlectendaliana s.l), G. menziesii Lindl) have been known and used as medicinal herbs in some countries

(Taiwan, Srilangka, China, and Vietnam) and as indoor plants (in Europe and North

America). In Taiwan, two species of Anoectochilus (A. koshunensis Hayata and A. formosanus Hayata) have been investigated for chemical compounds that they contain, because the two have been used as the basic drug for herbal medical treatments for lung and liver diseases, hypertension, and fevers (Kan 1986 in Pridgeon et al. 2003). In addition, Goodyera schlectendaliana Rchb.f. s.l. (G. kwangtungensis Tso) has been also used in traditional Chinese medicine to heal internal injuries and improve circulation (Lin

1978, Lawler 1984).

1.2. Morphology of Goodyerinae

Roots

Two types of roots are recognized in this group, tuber and creeping (Dressler 1993). The majority of the jewel orchids have creeping roots covered by soft hairs. Roots contain root epidermis and exodermis (Pridgeon 1987, Freudenstein and Rasmussen 1999,

Porembski and Barthlott 1988). The epidermis of Goodyerinae is called rhizodermis (the

9 outermost layer of the living roots) (Pridgeon 1987), and the inner part of the epidermis is called exodermis (the sub epidermis layer of cells of the root cortex (Porembski and

Barthloot 1988). Exodermis of Goodyerinae is unthickened, and the exodermis shape is isodiametric. The rhizodermis of the aerial roots are associated with the velamen (the spongy integument or white tissue on the root surface). The number of layers in the velamen varies from 1 to 24. Pridgeon (1987) recognized that Goodyerinae has only a layered velamen, and this is considered to be due to the absence of the thickening cells

(Freudenstein and Rasmussen 1999). Cells inside the roots of this group have spiranthosomes (amyloplasts: starch containing plastids).

Habits: Stems and Leaves

The habit (growth form) of leaves of the members of the Goodyerinae is either attenuate or rosette with creeping roots (Pridgeon 1987, Freudenstein and Rasmussen 1999).

Rosette leaves grow only from the center and then radiate spirally around the center.

Leaves are non-plicate, and they are evergreen (Freudenstein and Rasmussen 1999).

Goodyerinae species do not have an abscission layer at the base of the leaf that separates the blade with the sheath. Therefore, the blade does not fall off from the sheath.

Members of the Goodyerinae have a sympodial growth pattern (Dressler 1993,

Freudenstein and Rasmussen 1999) that allows the plants to rapidly propagate vegetatively, and the stems of the plants are unthickened without swelling nodes.

In general, monocotyledon families have stegmata that occurs longitudinally with conical and spherical shapes. Unlike some groups of Orchidaceae that have siliceous bodies called stegmata, which help to protect leaves in dry conditions, Goodyerinae do not 10 contain any stegmata because the plants are herbaceous (Møller and Rassmussen 1984).

The abaxial epidermal cells of Goodyerinae are found to occur in straight forming rectangular shapes (Stern et al. 1993a, Freudenstein and Rasmussen 1999). In addition, the number of subsidiary cells of Goodyerinae varies from none to four cells (Williams

1979, Freudenstein and Rasmussen 1999).

Floral Parts

The jewel orchids have terminal inflorescences (Dressler 1993). Individually, flowers of this group have no floral abscission (recognized as a peduncle in other flowering plants)

(Freudenstein and Rasmussen 1999). Petals and sepals of this group are persistent because the petals and sepals do not fall off from the summit of the ovary (Freudenstein and Rasmussen 1999). The labellum of the jewel orchids are sac like in shape, in general. However, the sac like labellum is not fused to the column, making it different from the slipper-shape labellum as seen in Cypripedium and Paphilopedillum

(Freudenstein and Rasmussen 1999). Further observation to the center of the flower, stamens and anthers can be found in all orchid groups as a form of column. Only one set of anthers occurs in Goodyerinae and the anther is straight both during the juvenile and adult stages (Rao 1974), with the exception in Goodyera triandra, which has three anthers. The anther is divided into operculum and pollinia. The anther is dehiscent with slits that can release pollen without discarding the operculum (Freudenstein and

Rasmussen 1999). The pollen surface is called the pollen endotheical layer. The layer can have different level of thickness. Freudenstein (1991) recognized four types of endothecial thickening. The type I endothecial layer has a layer that has a widely spaced

11 ring and Us shapes. The type II endothecial layer forms either channels of closely spaced rings or Us shape. The type III is the occurrence of circular-honeycomb layers arrangements of bars, while type IV endothecial layer is characterized by a layer that forms closely spaced scattered bars. Members of the Goodyerinae do not have a specific type of endothecial thickenings. The patterns vary, with types I and II occurring in

Goodyera, and type III and IV being found in Ludisia and Zeuxine. There are three different types of pollinium stalks (Rasmussen 1986). Members of Goodyerinae, represented by Ludisia discolor, have basal caudicles. The type of pollen unit is monad in this group, with reticulate individual pollen surface (Freudenstein and Rasmussen

1999). Pollen of Goodyerinae are grouped into sectiled pollinia in a regular fashion. Due to the presence of exine, the pollen of this group is relatively easy to break into sectile.

The breakable pollen is called acalymmate (Freudenstein and Rasmussen 1999). The number of pollinium in varies in different orchid groups. There may be two, four, and eight pollinium. Dressler (1993) reported that the number of pollinium in Goodyerinae is either two or four. The orientation of the pollinium is also one of the important characters in Orchidaceae. In Goodyerinae, there is a juxtaposed pollinium orientation

(Freudenstein and Rasmussen 1999). The ovary of species of Orchidaceae is divided into

‘chamber(s)’, either one or three. In the ovary of Goodyerinae, separation into three

‘chambers’ cannot be found; instead only one chamber is found in this group.

The complex form of reproductive organs in Orchidaceae is called the column. The stigma forms one part of the column, in which it received pollen for pollination. The shape of the stigma varies in orchids, being either sungken (concave) or protruded

12 (convex). Goodyerinae are recognized as having protruded (convex) stigma by

Freudenstein and Rasmussen (1999). Looking at more detail about the surface of the stigma, the stigman may have five different shape of the cell surface (Dannenbaum et al.

1989): tabular-convex (t-c), convex-hemispheric (c-h), convex (c), finger-shaped (f), and prosenchymatic (pro). A finger-shaped stigma surface is commonly found in

Goodyerinae, as represented by Ludisia discolor. The last floral part in Orchids is the viscidium, a sticky pad which sticks the pollinia to the body of pollinators. In the

Goodyerinae a detachable viscidium occurs (Freudenstein and Rasmussen 1999) that is a viscidium formed from sticky tissue to which the polonium is attached, instead of from type of glue directly attached to the polonium without tissue (diffuse).

Fruit Parts

Occasionally, fruits of Orchidaceae have internal hairs, called endocarpic trichomes, especially in most epiphytic orchids. The majority of terrestrial orchids do not have endocarpic trichomes. Goodyerinae is one group of the terrestrial orchids that do not have endocarpic trichomes. Fruits consist of seeds that can be separated into six different parts. They are seed surface, testa cells, striations, intercellular spaces, wax caps, and covered cell border. The six parts also have variation in shapes. Alternative states for seed surface wall are either seed with or without the lateral compressed wall.

Goodyerinae species do not have the lateral seed compressed wall. In addition, the shape of the cells of the lateral compressed wall of the seed varies. There are three possible different shapes of the cells of the seed surface, (1) isodiametric, (2) a combination between isodiametric and middle elongate, and (3) solely elongate (Freudenstein and

13 Rasmussen 1999). The jewel orchids have elongate seed testa cells. The third characteristic recognized in the seed surface of orchids is whether the individual cell surface is smooth without transverse/reticulate or has longitudinal patterns within the seed intercellular space. The Goodyerinae species have seed intercellular spaces. The cells do not fully attach to each other and have a thin layer covers the space between cells on the seed surface. Finally, Freudenstein and Rasmussen (1999) also recognized that the seeds of jewel orchids do not possess wax caps.

1.3. Geographic distribution of Goodyerinae

With approximately 450 species, the Goodyerinae are widely distributed throughout the globe. However, they occur predominantly in tropical Asia (Figure 1.1.). There are about

63% of species that occur in Asia (including southern part of China, Japan, Taiwan, as far as the pacifics, and Australia), 15% in Africa (Central and Madagascar), and 22% from

America (North and South America). Species of Goodyerinae occur in habitats that are humid, cool with a range temperature about 15o to (24 o) to 28oC maximum during the day. They occur where the forest floor has good drainage with forest litter. Many of the species require that water is available during the entire year (Pridgeon et al. 2003). The stable humid condition in the tropics contributes water from the air to the forests continuously. Mountainous tropical jewel orchids can survive in low temperatures (0-

2oC) at night (personal observation) constantly. In geographical areas with four distinct seasons annually, the jewel orchids experience and survive the cold winter weather

(Pridgeon et al. 2003) every year.

14 1.4. Systematic problems of Goodyerinae

Species of subtribe Goodyerinae have been classified into thirty five genera by Dressler

(1993) using the most comprehensive morphological characters. Dressler (1993) recognized two groups within the subtribe using a single character (stigmatic area(s)).

Szlachetko (1995) and Szlachetko and Rutkowski (2000) refined the classification of

Dressler (1993), and they classified species within the subtribe into three groups. They divided the groups with one stigmatum into two groups based on the orientation of the column. The straight column species with one stigmatum were called Goodyerinae, the species with twisted column were called Ludisiinae, and species with two stigmatic areas are called Cheirostylidinae. Further, Salazar et al. (2003) commented that the subtribe

Goodyerinae is lacking for significant morphological characters. Therefore, testing whether any traits can be identified that separate the two groups defined by Dressler

(1993) and Szlachetko (1995) was a major focus in this research.

15 Figure 1.1. Distribution of Goodyerinae in the world (adopted from Pridgeon et al., 2003)

16 1.5. The genus Goodyera

The genus Goodyera is a wide spread group within Goodyerinae. The distribution of the genus is worldwide in the five continents (Europe, Asia, Africa, Australia, America:

North, Central, and South America). Currently, approximately 55 species are recognized as belonging to the genus (Dressler 1993). Species of Goodyera are characterized by their terrestrial habit, horizontal creeping stems, a rhizome about the same thickness as the stem, rather thick roots, leaves either in rosettes or cauline, a spike arising from the center of the rosette, peduncle and ovary generally hairy and saccate labellum with coarse hairs inside the labellum (Comber 1990, Dockrill 1992). The members of the genus are widely distributed throughout Africa, North and South America, Asia, Europe, and

Australia (Linneaeus 1753, Brown 1813, Blume 1825, Thwaites 1858, Ridley 1886,

Hooker 1894, Schlechter 1906, 1932, Ohwi 1937, Seidenfaden and Smitinand 1959,

Garay and Sweet 1974, Aubreville and Lorey 1977, Cornell 1978, Smith 1905, Dockrill

1992, Seidenfaden and Wood 1992, Cribb and Whistler 1996).

Initially, Robert Brown (1813) described Goodyera and typified it by G. repens (L.)

R.Br. based on Satyrium repens from Europe (1753). Linnaeus described six species under the name Satyrium. All of the species were from Europe. In describing Goodyera,

Robert Brown (1813) separated it from Satyrium based on several unique characters: unconnected petals and resupinate saccate labellum. Only two species are recognized as belonging to the genus in Robert Brown's treatment, i.e. G. repens from Scotland and G. pubescens from North America.

17 The genus was expanded with the addition of other species described from Asia tropical and subtropical regions. Many additional species were described as belonging to the genus Goodyera, and this expanded the concept of the genus. In 1911, in the Flora of

Papua New Guinea, Schlechter treated Goodyera as having two sections. They are section Goodyera (=sect. Eu-Goodyera) and Otosepalum. The significant characteristic described by Schlecther is the orientation of the lateral sepals, which are parallel in the section Goodyera and widely spreading in the section Otosepalum. Schlechter (1911) recognized three species from the section Goodyera and five species from the section

Otosepalum. Several other authors disregard the characteristic of the orientation of the sepal as important (Garay and Sweet 1974, Comber 1990, Wood et al. 1994). More species were included in the section.

There are about 150 names for forms of Goodyera that exist in the Kew Index; however, it is unclear how many species from the section Goodyera exist. An estimate was made that there are approximately 55 species of the genus Goodyera recognized worldwide

(Dressler 1993). A comprehensive study of the genus had not been conducted due to the complexity of the morphological features of the species within the genus, the variety of names that have been applied to the same taxa in different locations, and difficulty in obtaining plant materials for analysis.

Goodyera section Goodyera from Indonesia

Amongst the groups within the genus Goodyera, the taxonomic study of the genus

Goodyera section Goodyera has been one of the most difficult to accomplish. The most

18 variable species in the genus came from the section Goodyera, partly due to minute definitions of the floral and vegetative features used for delimitation of taxa, and the great variation of flower parts within each species. The genus Goodyera has been the subject of controversy among taxonomists, due to differing opinions concerning what traits constitute its key characters. The character that defines the section is the presence of the parallel orientation of the lateral sepals (Schlecter 1911), although many authors disregard this feature as important. This may be due to the difficulty in defining the exact orientation of the lateral sepals, specifically whether that orientation was considered as being parallel or widely spreading (personal observation). The species boundaries for members within the section itself are still confusing. For example: Goodyera schlectendaliana from Mt. Singgalang in Sumatra (Indonesia) was recognized as G. becarii in Schlechter’s treatment. Comber was aware that the differences are almost insignificant; however he still defined the two as different species. G. pusilla and G. reticulata were very similar in their morphology. Comber noticed that G. pusilla is similar to G. reticulata from Java. Although Comber, with his masterpiece of Floras of

Java and Sumatra, has recognized the problems, no effort has been made to revise these taxonomic problems. In addition, the high complexity of the morphological variation and the minute size of the flowers of the species from the section Goodyera make this group difficult to study. Consequently, this group has not received serious attention. New species were described continuously without any comprehensive studies. This may have resulted in considerable taxonomic confusion and error.

19 Evolutionary relationships among species within the section Goodyera studied using molecular methods were conducted initially by Juswara (Masters thesis, The Australian

National University, 2000). About 20 samples were obtained to analyze the evolutionary relationships of the species in the sections of the genus Goodyera, using morphological and mitochondrial ribosomal ITS data. The result indicated that the species within the section formed a monophyletic group, although the support value was not significant.

As a result of these preliminary studies, an extension of the molecular analyses was undertaken with the intention of developing a revision of the classification of relationships of the species within the section Goodyera. These studies were performed using phenetic analyses, and the study was carried out with the complete description, identification keys, and geographical distribution of the species from the section

Goodyera in Indonesia. The results of these analyses will be presented in the following chapters of this thesis.

Fungal Association and co-evolution of Goodyera section Goodyera

Orchidaceae has been known to utilize fungi from nature to initiate seed germination, compensating for the lack of an endosperm in each seed. It has been known that the members of the Orchidaceae have a specific interaction with a particular group of fungi from the Basidiomycetes, the Rhizoctonia group. However, information on this relationship has been gathered from the study of a limited number of subtropical species of orchids. It is unclear whether the symbiotic relationship is very close (specific fungal species with specific plant species) or looser (any of several or may fungi with a specific plant species). 20 The distribution of species of Goodyera section Goodyera in Indonesia is relatively well known, with several publications describing the distribution of the species within the section (Comber 1990 2003, Pridgeon et al. 2003). The phylogeny of the group has been examined and revised by Juswara (Masters thesis, The Australian National University,

2000). The species within the section Goodyera are highly variable. Therefore, knowing the details of the plant-fungal associations is important to our understanding about whether specific interactions occur in the group or whether the orchids can utilize any of a potentially variable set of fungi to facilitate seed germination.

Reasons for studying the jewel orchids:

The extent of habitat within the tropical rain forests has significantly decreased globally in the tropic regions over the last century. Further, there is scientific consensus that the global climate is changing. The changes occurring in the environment affect the presence of living organisms, especially those that are very sensitive to altered surroundings. The jewel orchids represent a group of organisms that occur in specific habitats, and they are known to be sensitive to change in the environment. Once their habitats are destroyed, the species of the jewel orchids will be unable to grow in their historical ranges. The jewel orchids may be affected by an additional factor. Since orchids are known to depend on the presence of specific fungi to initiate seed germination, changes occurring in the habitats of these orchids may affect them indirectly, through effects mediated by the ability of the fungi to adapt to environmental alterations. Therefore, knowledge

21 concerning details of fungal associations with specific jewel orchids is very important in maintaining the sustainability of the species of the jewel orchids.

1.6. The aims of the research

The aims of the research detailed in the following chapters:

1. To test the hypotheses of Dressler (1993) and Szlachetko (1995) concerning whether

the present classification can be supported using molecular data sets, and to

determine whether Pachyplectron is correctly placed within the subtribe

Goodyerinae (Chapter 2).

2. To investigate the diversity of fungi associated with species of Goodyera section

Goodyera from Indonesia (Chapter 3).

3. To delimit the species boundaries of Goodyera section Goodyera from Indonesia

(Chapter 4 and 5).

22 Chapter 2: Phylogenetic Analysis of the Subtribe Goodyerinae

2.1. Introduction

The subtribe Goodyerinae (referred to colloquially as the jewel orchids) offers an amazing opportunity to evaluate evolutionary hypotheses concerning the family

Orchidaceae and determine the utility of various characters used to study the taxonomic classification of the Orchidaceae. Goodyerinae is a large sized subtribe within the

Orchidaceae, including approximately 450 recognized species. The subtribe is predominantly distributed in tropical Asia, with the Malaysian region as the center of diversity (Pridgeon et al. 2003).

This group is considered well circumscribed, distinguished by the presence of sectile pollinia. The general characteristics of the jewel orchids include the facts that: (1) they are herbs ranging up to ca. 50 cm in height; (2) they have fleshy stems and roots that are usually either fasiculate or spread apart along a creeping rhizome; (3) their roots usually contain spiranthosomes (a type of amyloplast); (4) they have leaves that are non- articulate and soft with reticulate veins; and, (5) they have flowers that are tubular with erect anthers and rostellum, and sectile pollinia. However, like other traditional taxonomical treatments of the Orchidaceae, the classification of the subtribe has been based on only a few floral characteristics. According to Pridgeon et al. (2003), the key

23 feature of the subtribe Goodyerinae is the presence of sectile pollinia, with distinct stipes, and the spur (tubular shape) character. If the spur character is present, the labellum is involved in forming the spur.

The presence of the sectile pollinia had been recognized earlier as an important diagnostic trait by Freudenstein and Rasmussen (1999) to separate Goodyerineae from the other groups within the tribe Cranichideae. Salazar et al. 2003 also recognized the subtribe Goodyerinae as a monophyletic group, while also suggesting that the jewel orchids lack significant morphological traits to delimit genera within the subtribe.

However, only a limited number of species was used (2-4 species) in their analyses. The taxonomic problems regarding the evolutionary relationships within the subtribe have yet to be resolved.

Thus, there is general consensus that no clear discrete morphological features separate groups within the subtribe. The delimitation of genera within the subtribe, as is the case of other genera within Orchidaceae, has been based on a few floral morphological features. The strong confidence in the primacy of floral features for classification has led to the placement of the majority of the species within the subtribe into thirty-five

(Dressler 1993) or thirty-four genera (Pridgeon et al. 2003). Dressler (1993) distinguishes two informal groups using floral morphology only, while three based informal groups were recognized by Szlachetko (1995) and Szlachetko and Rutkowski

(2000). Until very recently, DNA sequencing has only been utilized to a very limited degree to infer the phylogeny of groups within the subtribe and its closely related relatives. 24 Studies undertaken over the past two decades based on morphological, anatomical, and molecular data have produced only a small amount of information on the evolutionary relationships within the subtribe Goodyerinae (Dressler 1993, Freudenstein and

Rasmussen 1999, Cameron et al. 1999, Salazar et al. 2003). Salazar et al. (2003) used genetic regions from the chloroplast chromosome (rbcL, matK, trnL-F), together with the nuclear ribosomal RNA spacer region (ITS) to study the tribe Cranichideae, placing emphasis on the subtribe Spiranthinae. They considered that DNA markers were useful in revealing the evolutionary relationships of the group in this study. In addition, the chloroplast DNA marker rpl16 has also been shown to be useful in inferring phylogenetic relationships at the species level (Kelcher and Clark 1997). Salazar et al. (2003) and

Cameron et al. (1999) did not use morphological characters to infer the phylogeny of groups within Orchidaceae. They only compared the phylogenetic results with the existing phylogenetic classification. The goal of the present study was to investigate the evolutionary relationships between taxa of the subtribe Goodyerinae. This will be accomplished by utilizing DNA sequences from plastid and nuclear genes, and then combining this molecular information with morphological data to reach a new understanding of the subtribe.

2.1.1. Taxonomic History of Goodyerinae

The first classification of Orchidaceae was conducted by Swartz (1800) based on a small number of morphological characteristics. The study was continued by Brown (1813),

Lindley (1830-40), Bentham (1863), Pfitzer (1889), Garray and Sweet (1974), and

25 Dressler (1993). Dressler (1993) presented the most comprehensive classification, incorporating phylogenetic concepts into his taxonomic treatment. Dressler (1993) recognized that the described orchid groups are classified based upon only a few morphological characteristics. He attempted a more comprehensive classification of

Orchidaceae using as many morphological characteristics as possible, including characters such as growth habits, and characteristics of roots, stems, leaves, inflorescence, and flowers. However, at lower taxonomic levels (below subtribes), the phylogenetic relationship of the orchids has yet to be resolved.

Initially, the jewel orchids (subtribe Goodyerainae, tribe Cranichideae, Orchidaceae) were delimited as belonging to Div. Pysurideae (illegitimate name) by Lindley (1835).

Due to developments in the study of biological systematics, and the growth of understanding of evolutionary processes, the concepts of evolution have been incorporated in classifying the orchids.

The description of evolutionary relationships within the Goodyerinae has been revised over the past two decades. The Goodyerinae was hypothesized as sharing similarities to the Tropidieae (subfamily Epidendroideae) due to similar morphological features of the rhizomes, which are elongated, and the roots, which are scattered (Pridgeon et al. 2003).

However, the phylogenetic study of Orchidaceae has a long history of using floral morphology as the most important set of characters, and the flowers from the subtribe

Goodyerinae were recognized to be more similar to the tribe Cranichideae (subfamily

Spiranthoideae sensu Dressler) than to the flowers of the Tropidieae (Pridgeon et al.

2003). 26 In 1999, Cameron et al. revised the orchid classification based on molecular data. They recognized Goodyerinae as belonging to subfamily Orchidoideae based upon data from the rbcL gene of the chloroplast.

Pridgeon’s current comprehensive systematic treatment within the Orchidoideae recognized that the tribe Cranichideae can be subdivided into six subtribes (Pridgeon et al. 2003). These are Cranichidinae Lindl., Galeottiellinae Salazar & M.W. Chase,

Goodyerinae Klotzsch, Manniellinae Schltr., Pterostylidinae Pfitzer, and Spiranthinae

Lindl. Of the six subtribes, only one, the subtribe Goodyerinae, represents predominantly forms from the tropics of Asia. This subtribe is poorly studied, despite the fact that some of its members are economically important because of their use as indoor and medicinal plants.

Salazar et al. (2003) carried out phylogenetic studies of the tribe Cranichideae using molecular approaches, but emphasized primarily the subtribe Spiranthineae, and included only a few members of other subtribes as outgroups.The jewel orchids, comprising the subtribe Goodyerinae, have been recognized as a well-defined group by several authors

(Salazar et al. 2003, Cameron et al. 1999) using molecular data from chloroplast and nuclear markers. However, within the subtribe, the evolutionary relationships between taxa remain unresolved. Schlechter (1926), Dressler (1981), and Rasmussen (1982),

Dressler (1993) recognized two informal groups within the subtribe according to the number of stigmatic areas, which can be present either one or two. The genera that have a single stigmatic area include Aspidogyne, Cystorchis, Dicerostylis, Dossinia,

27 Erythroides, Eurycentrum, Evrardia, Gonatostylis, Goodyera, Herpysma, Hylophila,

Kreodanthus, Kuhlhasseltia, Lepidogyne, Ligeophila, Ludisia, Macodes, Moerenhoutia,

Orchipedum, Papuaea, Platylepis, Platythelys, Pristiglottis, Phamphorhynchus, and

Stephanothelys. Genera that have two distinct stigmatic regions comprise Anoectochilus,

Chamaegastrodia, Cheirostylis, Eucosia, Gymnochilus, Hetaeria, Mymerchis,

Tubilabium, Vrydagzynea, and Zeuxine (Dressler 1993).

Szlachetko (1995) and Szlachetko and Rutkowski (2000) proposed an alternative hypothesis of the relationships among taxa of the subtribe, grouping the 35 genera within the subtribe Goodyerinae sensu Dressler (1993) into three subtribes (Goodyerinae,

Ludisiinae, and Cheirostylidinae) on the basis of their column morphology (Szlachetko

1995; Szlachetko and Rutkowski 2000, Pridgeon et al. 2003). The groups were refinement of Dressler’s hypothesis. The members of the subtribe Cheirostylidinae were characterized by having two separate stigmata separated from the first two. The subtribes

Ludisiinae and Goodyerinae both have a single stigma formed from both lateral lobes.

The Ludisiinae and Goodyerinae are distinguished from each other by the occurrence of a twisted asymmetrical column possessed by the former group. The genera within the

Cheirostylidinae are Evrardianthe, Hetaeria, Tubilabium, Vrydagzynea, Anoectochilus,

Cheirostylis, and Myrmechis. Groups with a twisted single stigmatic surface, belonging to the Ludissinae, are Chamaegastrodia, Macodes, Eucosia, Ludisia, Odontochilus, and

Dossinia. Groups that possess a single straight stigmatic single groups belong to

Goodyerinae, and they include the genera Papuaea, Danhatchia, Vieillardorchis,

Goodyera, Platylepis, Halleorchis, Cystopus, Kuhlhasseltia, Lepidogyne, Dicerostylis,

28 Hylophila, Gymnochilus, Moerenhoutia, Gonatostylis, Herpysma, Kreodanthus,

Cystorchis, Orchipedum, Pristiglottis, Eurycentrum, Platythelys, Erythrodes, Ligeophila,

Rhamphorhynchus, Stephanothelys, and Aspidogyne.

2.1.2. The Association of the subtribe Goodyerinae with other subtribes within tribe Cranichideae

There is disagreement among the studies of Goodyerinae and its relatives, concerning the identity of the sister group of the subtribe Goodyerinae. Based upon data from the rbcL chloroplast gene, Salazar et al. (2003) proposed that the Goodyerinae was a sister group to the genus Pachyplectron, and these two groups form a clade that is the sister to

Pterostylis. The resulting phylogeny supported the placement of the Pachyplectron in its own subtribe by Schlechter (1926) based mainly upon non-sectile pollinia. The sister group of a single clade containing Goodyerinae, Pachyplectron, and Pterostylis was then hypothesized to be the “core Spiranthid” (Salazar et al. 2003). Other studies, based on data from several nuclear and chloroplast markers also recognized Pachyplectoninae as the most closely related taxa to subtribe Goodyerinae Salazar et al 2003. The subtribe

Spiranthinae, which was described initially by Dressler (1993), was found to form of several paraphyletic groups (Salazar et al. 2003). The genus Galeottiella was excluded from the subtribe Spiranthinae in the study by Salazar et al. (2003). The remaining groups of the subtribe Spiranthinae, are subsequently designated to constitute the core

Spiranthid.

29 2.1.3. Aims of the study:

The data summarized in this chapter were collected with the aim of testing several hypotheses. The first issue to be examined is the proposed placement of Pachyplectron as the basal member of the subtribe Goodyerinae. Next, the hypotheses of Dressler

(1993) and Szlachetko (1995) concerning the evolutionarily relationships between members of the subtribe Goodyerinae from Indonesia will be studied, including an examination of whether the characters used by Dressler (1993) and Szlachetko (1995) to classify groups legitimately define the groups within the subtribe. To study the hypotheses of Dressler and Szlachetko, we will examine whether there is concordance between morphological characters and molecules. As part of this study, the hypothesis that the number of stigmatic areas is the best criterion to define groups will be tested. It is possible that stigmatic area is not an appropriate criterion because the number of stigmatic areas is affected by additional biological factors, such as pollinators. Finally, preliminary data suggested that the type of reticulation in leaf venation might represents a major character that can be used to define the groups, because its expression is less affected by other biological factors than other characters. This will be tested by examining the concordance of venation with molecular characters.

Several species from the Pachyplectroninae, the core Spiranthoid, and the genus

Pterostylis, and representative species from subtribes within the tribe Cranichideae will be used to root phylogenetic trees of the subtribe Goodyerinae to provide insight into the relationship between taxa in the subtribe Goodyerinae from Indonesia in the analysis.

30 2.2. Methods

2.2.1. Testing Phylogenetic Hypotheses: The Problem of Defining the Homology of Characters

To analyze the phylogenetic relationships among organism, the concept of character homology must be incorporated into our considerations. Three criteria to define homology were recognized by Remane (1952) based upon the similarity of position, structure, and intermediate connection of the features being studied. The similarity of position is defined as the occurrence of one organ/character in a given organism at the same structural position as observed in another organism. A second criterion of homology is similarity of structure. The more similar the structures of a particular organ between organisms, the more likely these structures are to be homologous. This is because it is unlikely that a specialized structure would be formed coincidently in two lineages. The last criterion of homology is intermediate connection. This involves determining that the organs being compared reveal that the occurrence of a series of intermediate evolutionary steps in characters, perhaps from simple to advanced, or a series in developments.

De Pinna (1991) added the concept of reciprocal illumination, to indicate that the homology of a character must occur in congruence with other data. In the situation where the data show incongruence of a character with a phylogeny, this concept allows us to better understand the relationships between characters in terms of putative homology. In

1991 de Pinna proposed three criteria of homology: similarity, conjunction, and congruence. According to de Pinna (1991), similarity is not a test for homology. 31 Similarity is recognized a priori when one compares morphological characters of a given organism with the morphological characters of others (known as primary homology) that are hypothesized as the same. The second criterion is the test of conjunction. If two structures occur in the same organism at the same time, the structures are not homologous. The last criterion is the test of congruence, which examines the agreement or disagreement among morphological characteristics. The test of congruence examines the character changes on the constructed trees. This is also called reciprocal illumination

(known also as secondary homology). If changes in the morphological characteristics occur several times on the tree, the characteristics are homoplasious. Homoplasy is often ambiguous; it may be unknown whether the morphological characters within a specific tree topology evolved independently more than once (de Pinna 1991).

2.2.2. Collection of data

DNA sequences of the subtribe Goodyerinae species and the outgroup species were collected from GenBank for the gene sequences ITS and trnL-F. GenBank accession numbers are presented in the parentheses after the name of the species. The ITS sequences collected includes Maniella gustavi (AJ539517), Maniella cyprippedioides

(AJ539516), Pterichis habenarioides (AJ539509), Cranichis cillilabia (AF391781),

Cranichis cillilabia (AJ539506), Prescottia aff. oligantha (AJ519447), Prescottia plantaginae (AJ539511), Spiranthes spiralis (AF348064), Spiranthes cernua

(AF301444), Gomphichis bototensis (AJ539513), Stenoptera equadorana (AJ539512),

Stenoptera peruviana (AJ348066), Galeottiella sarcoglossa (AJ539518), Pachyplectron 32 arifolium (AJ539522), Pachyplectron arifolium (AF348049), Lepidogyne sceptrum

(AD348037), Platylepis polyadenia (AJ539520), Goodyera pubescens (AJ539539),

Goodyera velutina (AF366898), Goodyera maximowicziana (AF366895), Goodyera macrantha (AF366894), Goodyera schlectendaliana (AF366897), Goodyera repens

(AF366896), Anoectochilus formosanum (AY052780), Zeuxine oblonga (AF348073),

Dossinia mormorata (DMA539521), Ludisia discolor (AJ539483), Chloraea magellanica (AF348003), Chloraea magellanica (AJ539523), Pterostylis daintreana

(AF348055), Pterostylis cucullata (AY134632), Pterostylis banksii (AY134623),

Pterystylis australis (AY134622), Megastylis glandulosus (AF348042), and Megastylis glandulosa (AJ539525). Several trnL-F sequences were obtained from GenBank for species of the subtribe Goodyerinae, including Goodyera viridiflora (GV1409417),

Gonatostylis vieillardii (GV1409416), and Zeuxine vieillardii (AJ409459).

Leaf samples for DNA analysis were obtained from sites in several countries in Asia,

North and South America, and Australia, either by requesting samples from colleagues or by personally making field collections from Indonesia (Java, Sumatra, Sulawesi, and

Irian Jaya). The details of the location of the collections are presented in Table 2.1.

33 Table 2.1. Samples collected from fields and vouchers

Species Name, f: fresh, s: silica Collection Amplified regions

G126 Sarcoglottis (f) Voucher from J.V. Freudenstein ITS, trnL-F G127 Cyclopogon lindleyanus (f) Voucher from J.V. Freudenstein ITS, rpl16 G152 Spiranthes odorata (f) Santa Barbara Orchid Estate ITS, rpl16 (Nursery) G529 Pachyplectron (DNA Voucher from J.V. Freudenstein rpl16, trnL-F extraction) Goodyera oblongifolia (MkAu) North America., M.A. Clements ITS (s) 9862 Goodyera procera (YkwJP) (s) Doi Suthep, Chiang Mai, Queen ITS Sirikit Botanical Garden. Staff 10546. G88 Ligeophila (f) Equador (voucher from J.V. ITS, rpl16, trnL-F Freudenstein) G90 Hylophila montana (s) Yapen Island, Irian Jaya (L.S. ITS, rpl16 Juswara 262) Goodyera viridiflora (MkAu) (f) Australia: Queensland, Mt. ITS Finnegan, Roberts (Org 2561). Goodyera fumata (Thai) (s) Doi Suthep, Chiang Mai, Queen ITS Sirikit Botanical Garden, staff 10665. Goodyera polygonoides (f) Australia: Queensland, Carron ITS Ck,. Kirama St., D.L. Jones M.A. Clements, & A. Mackenzie 15718. G74 Goodyera bifida (s) Sumatra: Jambi, Mt. Tujuh, ITS Kerinci Seblat National Park, 1700m, L.S. Juswara 339. G55 Goodyera bifida (s) Java: Mt. Botol, Mt. Halimun ITS, trnL-F National Park, L.S. Juswara 64. Gooyera foliosa var. foliosa Japan: Honsu, Toyama Pref., ITS (YkwJP) (s) Mt. Oku-iouzen, alt. 895m, Kurashige & Yukawa 400/TBG123268 Continued.

34 Table 2.1., continued

Species Name, f: fresh, s: silica Collection Amplified regions Goodyera velutina (YkwJP) (s) Japan: Nagasaki Pref., ITS Tsushima I., Izuhara, Hikage., Yukawa 98-10/TBG122344. Goodyera hachijoensis (YkwJP) Japan: Kagoshima Pref., ITS (s) Okinawa I., Jonokuchi- Tainokawa, alt. 500m. Yukawa 98-50/TBG122415. G63 Goodyera HOC474 (f) Voucher from J.V. Freudenstein ITS, rpl16, trnL-F Goodyera hispida (red, KRI) (s) Voucher Bogor Botanical ITS Garden, cult. Ex Bogor Botanical Garden. Goodyera hispida (white, KRI) Java: West Java, Mt. Gede, L.S. ITS (s) Juswara 2 and T.Ng. Praptosuwiryo. G98 G. daibucanensis (~similar Voucher from J.V. Freudenstein ITS, rpl16, trnL-F to G. schlectendaliana) (f) Goodyera schlectendaliana China, Wallace s.n. ITS (MkAu) (f) G70 Anoectochilus lanceolata (f) Voucher from J.V. Freudenstein ITS, trnL-F Goodyera schlectendaliana Japan: Honsu, Ibaraki Pref., ITS (YkwJP) (s) Yasato, Dangoishi-tounge., Yukawa s.n./TBGG118165 G 132 Goodyera rotabunensis Voucher from J.V. Freudenstein ITS, rpl16, trnL-F (~similar to G. schlectendaliana) (f) G149 Goodyera tesselata (f) US: Wisconsin, W Star Lake, ITS, trnL-F State House Road, Conty K, about o.5 mile pine forest, L.S. Juswara 399. Goodyera repens (MenInd) (s) Voucher From Mary Mendum ITS (Edinburgh). Collected from India: Himachal Pradesh: mandi, Chogar Dhar. Damp shady banks, on heavy clay with no humus, 2000m, McBeath, R. 1662, 1985. Continued.

35 Table 2.1. continued.

Species Name, f: fresh, s: silica Collection Amplified regions G65 Cystorchis (JColl) (f) Voucher from J.V. Freudenstein ITS, rpl16, trnL-F G76 Cystorchis stenoglossa (s) Indonesia: North ITS Sumatra, Camping ground Sibolangit, L.S. Juswara 310. G99 Anoectochilus Indonesia: North Sumatra, ITS, rpl16 Longicalcaratus (s) Sikulikap water fall, 1200- 1500m, L.S. Juswara 306. G96 Macodes lewii (f) Voucher from J.V. Freudenstein ITS, rpl16, trnL-F G125 Macodes sandriana (f) Voucher from J.V. Freudenstein ITS, rpl16, trnL-F G78 Anoectochilus setaceus (s) Indonesia: Sumatra, Jambi, ITS, rpl16, trnL-F Kerinci Seblat National Park, Mt. Tujun, 1700m, L.S. Juswara 337. G124 Blackepiphyte (f) Voucher J.V. Freudenstein ITS, rpl16, trnL-F G180 Myrmechis gracilis (s) Indonesia: Java, Mt. Gede, ITS, rpl16 1782m. L.S. Juswara 449 G44 Goodyera clavata (KRI) (s) North Sumatra, Aceh Tengah, ITS, rpl16, trnL-F Taman Buru Lingga Isaq, Bintang, 1000m, Samsul Cs 697) G47 Hetaeria cristata (s) Voucher from Cibodas ITS, trnL-F Botanical Garden, Indonesia: Java, Mt. Gede., Hojar s.n. G62 Goodyera vitata (f) Voucher from F.V. ITS, rpl16, trnL-F Freudenstein G153 Cheirostylis Burleigh Park Orchid Nursery ITS , rpl16 Cochinchinenses (f) (Australia), collected from Vietnam G57 Zeuxine viridiflora (s) Indonesia: Java, Mt. Halimun ITS, rpl16, trnL-F National Park, Puraseda, Kampung Padajaya, Gorowek Puraseda, 820m, Kec: Pamijahan, Desa Purwabakti, Kabupaten Bogor., L.S. Juswara 51. G80 Zeuxine gracilis (s) Indonesia: North Sumatra, ITS, rpl16 Sibolangit, L.S. Juswara 300 Continued

36 Table 2.1. continued

Species Name, f: fresh, s: silica Collection Amplified regions G51 Hetaria oblongifolia (s) Voucher from Bogor Botanical ITS, trnL-F Garden., Indonesia., Lugrayasa 814b. Hetaeria oblongifolia (MkAu) Australia: Queensland, Mt. ITS (f) Norkwa, Roberts (Org 2614) G77 Macodes sandriana (s) Indonesia: Irian Jaya Cyclop., ITS Supri s.n. G68 Anoectochilus (f) Voucher from J.V. Freudenstein ITS, rpl16, trnL-F (nursery) G66 Ludisia nigrans (f) Voucher from J.V. Freudenstein ITS, trnL-F (nursery) G207 Pristiglottis (s) Indonesia: North Sumatra, Mt. ITS Sinabung., L.S. Juswara 508 G182 Pristiglottis 37montana (s) Indonesia: Java, West Java, Mt. ITS, rpl16, trnL-F Gede., L.S. Juswara 446. G97 Herpysma rubens (f) Voucher from J.V. Freudenstein ITS, rpl16, trnL-F G210 Herpysma longicaulis Indonesia: North Sumatra ITS (shown G120 in ITS tree) (s) Aceh, Gayo Highland, Mt. Leuser, Bukit Wiyem Beriring. G50 Hetaeria oblongifolia (s) Voucher Bogor Botanical rpl16 Garder, Indonesia., Staff DM 559 G163 Goodyera procera (s) Indonesia: West Java, Mt. rpl16 Salak, Curug Nangka, 2851ft. L.S. Juswara 423. G162 Goodyera pusilla Indonesia: West Java, Banten, rpl16, trnL-F Mt Karang, L.S. Juswara 417 G82 Goodyera pusilla (s) Indonesia: Central Java, Mt. rpl16 Lawu., L.S. Juswara 360 G107 Vrydagzynea (s) Indonesia: Irian Jaya, Yapen rpl16, trnL-F Island, 600m., L.S. Juswara 244. G79 Vrydagzynea (s) Indonesia: Irian Jaya, Yapen rpl16, trnL-F Island, 600m. L.S. Juswara 261 G102 Dossinia mormorata (f) Voucher from J.V. Freudenstein rpl16, trnL-F G71 Ludisia discolor (f) Voucher from J.V. Freudenstein rpl16, trnL-F Continued

37 Table 2.1. continued

Species Name, f: fresh, s: silica Collection Amplified regions G154 Cheirostylis ovate (f) Burleigh Park Orchids rpl16 (Nursery) North Australia G134 Zeuxine oblonga (s) North Australia., AF. 4457 rpl16 G43 Goodyera bifida (s) Indonesia: Sulawesi, Mt. Rante rpl16 Mario. L.S. Juswara, L.A. Craven, and G.Brown 227. G164 Hetaeria cristata (f) Indonesia: West Java, Mt. rpl16 Halimun National Park, Mt, Kendeng, L.S. Juswara 405 G100 Rhomboda100 (f) Indonesia: Irian Jaya, Yapen rpl16 Island., L.S. Juswara 282 G89 Anoectochilus formosanum Voucher from J.V. Freudenstein rpl16, trnL-F (s) G162 Goodyera pusilla (f) Indonesia: West Java, Mt. rpl16 Karang., L.S. Juswara 417. G101 Anoectochilus Indonesia: Sumatra, North rpl16 Longicalcaratus (s) Sumatra, Sikulikap Water Fall, L.S. Juswara 306B G123 Anoectochilus Voucher for J.V. Freudenstein rpl16, trnL-F chapaenensis (f) G67 Anoectochilus brevilabris Voucher from J.V. Freudenstein rpl16, trnL-F (f) G189 Herpysma longicaulis (f) Indonesia: Sumatra, L.S. rpl16 Juswara s.n. G73 Goodyera repens (f) Voucher from J.V. rpl16, trnL-F Freudenstein. North America, Michigan. G45 Goodyera pubescens (f) North America, Ohio., rpl16, trnL-F L.S.Juswara 241 G118 Goodyera oblongifolia (f) North America, Washington rpl16 Pierce Co. C.F.Barret 55 G64 Goodyera rotundifolia (f) Voucher from J.V. Freudenstein rpl16 G103 Goodyera carnea (s) Indonesia: Central Java, Mt. ITS, rpl16, trnL-F Lawu in front of Forestry office, L.S. Juswara 359. G157 Lepidogyne longifolia (f) Indonesia: West Java, Mt. rpl16 Halimun National Park, Cikaniki., L.S. Juswara 413

Continued 38 Table 2.1. continued

Species Name, f: fresh, s: silica Collection Amplified regions G60 Goodyera fumata (s) Voucher from Bogor Botanical rpl16 Garden. Staff s.n. G87 Anoectochilus sikimensis (f) Voucher from J.V. Freudenstein trnL-F G69 Anoectochilus setaceus (f) Voucher from J.V. Freudenstein trnL-F G204 Rhomboda (f) Indonesia: North Sumatra, trnL-F Aceh, Ketambe., L.S. Juswara 493 G214 Zeuxine oblonga (f) Indonesia: Jakarta, Depok, trnL-F Indonesian University., Alex Sumadijaya s.n. G95 Goodyera schlectendaliana Voucher from J.V. Freudenstein rpl16, trnL-F (f) G151 Goodyera dalhousiana (s) Voucher from New York trnL-F Botanical Garden G114 Goodyera oblongifolia (f) North America, Ainsworth trnL-F State Park, Oregon., C.F.Barret 35. G178 Goodyera procera (f) Indonesia: West Java, Mt. trnL-F Halimun National Park, Mt. Endut, L.S.Juswara 457

39 2.2.3. Homology of molecular characters

Fixed position of a nucleotide within a sequence (positional homology, Swofford et al.

1996) is the definition of homology applied in this study. The input sequences must be the same length, having the same number of characters. The number of nucleotides in a gene sequences differs among species. In order to make uniform the number of characters between taxa, sequence alignments were performed. I used CLUSTAL generated in Bioedit to maximize similarity among the sequences and then refined the alignments manually. Variable sites refined manually were aligned by minimizing the number of gaps. Thus, homology of all sites within an alignment cannot be assessed, as many sites within the alignment were highly convergent.

2.2.4. Molecular characters used

Three genomes may be used in molecular systematics to infer phylogenetic study of

Orchidaceae. These represent two organelle genomes, the chloroplast (cp) and mitochondrial (mt) genomes, and the nuclear (nr) genome. Amongst the three, in plants the mitochondrial genome is the most conserved (Wolfe et al. 1987) and rarely used for plant phylogenetic studies. The rate of substitution of the plant mtDNA is slower by about one third relative to that of cpDNA and half that of nrDNA (Wolfe et al. 1987).

The most commonly used markers in plant groups are genes from the chloroplast and nuclear genomes, because they are useful in inferring phylogeny at various levels

(Baldwin 1992, Nickrent and Soltis 1995, Palmer et al. 1988, Taberlet et al. 1991, Wolfe

40 et al. 1987). Chloroplast DNA provides valuable phylogenetic information above the family levels of taxonomic groups (Palmer et al. 1988). However, cpDNA also can render useful evolutionary information at lower levels of classification (Kelchner and

Clark 1997). Two gene regions of the chloroplast genome were sampled for this study, a portion of the sequence for the protein coding gene rpl16, a protein component of the chloroplast large subunit of the ribosome, and the trnL-F, a region including conserved coding sequences for two transfer RNAs.

Nuclear genes are sometimes used, especially for questions of phylogeny at higher levels.

There are many nuclear gene regions to choose from, but only one region has been included in this study, the ITS (Internal Transcribed Spacer) between the genes for the small and large subunits of the nuclear rRNA. This is a gene regions that is the most commonly used region to study phylogeny at the lower level (Baldwin 1992), because of its rapid rate of sequence change. The molecular markers used in this research are presented in Figure 2 A-C, including the location of primers. Detailed information about each region is discussed separately, below.

2.2.4.1. Internal Transcribed Spacer (ITS)

The Internal Transcribed Spacer (ITS) is a part of the nuclear genome that has been known to be useful for inferring phylogeny for many plant species (Baldwin 1992, 1993,

1995, Salazar et al. 2003) especially at lower levels of classification. White et al (1990) recognized that the region consists of two highly diverse non-coding regions (ITS-1 and

ITS-2), separating three coding regions (18S, 5.8S, and 26S nuclear rDNA). The

41 sequence of the Internal Transcribed Spacer can be amplified using primers ITS1 and

ITS4 (see Table 2.2. for more details). Two internal primers (ITS2 and ITS3) can be used in a nested-PCR reaction to amplify the internal region of ITS, if minimal DNA product was obtained after purifying the PCR product of the first reaction. The details of the ITS regions are drawn in Fig. 2.1A. The ITS region exists within the nuclear genome as a multicopy PCR target, encoded as part of the tandemly repeated rRNA repeat region(s). It is also part of a diploid (or greater) genome, unlike the plastid genome.

Therefore, it is possible to observe more than a single base at a particular position in the sequence from an amplification of the DNA from one individual.

A total of eighty-nine sequences were used in the ITS alignments (Appendix A). Fifteen sequences were obtained from amplification of material from field collections, seventeen samples were obtained from botanical gardens from countries in Asia, Australia, and

Europe, and 18 samples were obtained from commercial nurseries in the US. An additional 37 sequences of the ITS were obtained from GENBANK for taxa not directly sampled.

The eighty-nine sequences represent 17 genera within the subtribe Goodyerinae. Of these, 12 genera have one stigmatic area (Cystorchis, Dossinia, Goodyera, Herpysma,

Hylophila, Lepidogyne, Ligeophila, Ludisia, Macodes, Pachyplectron, Platylepis, and

Pristiglottis and five genera have two (Anoectochilus, Cheirostylis, Hetaeria, Myrmechis, and Zeuxine).

42 Sequences were obtained for a number of species that were to be used as outgroups. I obtained 24 sequences of the outgroups from GENBANK, and four other sequences from the other three outgroup genera from commercial nurseries. These represent 27 species grouped into 10 genera. They represented the subtribe(s) within the tribe Cranichideae

(Spiranthineae), Pterostylideae, and Chloraeae (Manniella, Cranichis, Pterichis,

Prescottia, Stenopthera, Gomphichis, Sarchoglottis, Cyclopogon, Spiranthes, and

Galeottiella).

2.2.4.2. trnL-F

The trnL-F region is a region in the chloroplast genome (cpDNA) that has been widely used in plant systematics to infer evolutionary relationships of plants at the various level of classification (Taberlet et al. 1991). The region can encompass a portion of the chloroplast genome between primers placed in the conserved t-RNA-threonine gene

(trnT) and the conserved t-RNA-phenylalanine gene (trnF). The intervening region almost always includes two exons for the t-RNA-leucine gene (trnL). A large part of the amplified segement includes non-coding regions between the genes and an exon between the two parts of the trnL gene. Salazar et al. (2003) and Garcia and Olmstead (2003) employed smaller sections of the region, termed trnL and trnF that excluded the trnT gene and flanking non-coding segment. The length of the region varies from about 500-

1000bp in different taxa (Taberlet et al. 1991). Two primers can be used to amplify this region (Tab c and f). However, for weak amplifications, a nested set of internal primers

(Tab d and e) can be also used to amplify the entire trnL-F region (Figure 2.1B).

43 Sequences from forty-eight species were used in the phylogenetic analyses of trnL-F, including three outgroups (Appendix B). Eighteen sequences were obtained from amplifications of material from field collections, six samples obtained from botanical gardens from some countries in America, Asia, and Europe, and 18 samples from the commercial nurseries in the US and Australia. An additional six sequences of the ITS were obtained from GENBANK for taxa not directly sampled. One of the outgroups were obtained from the commercial nurseries and two others were from GENBANK.

Forty-five of the species can be grouped into 12 genera. Nine of the genera represent groups that have one stigmata, including Pachyplectron, Goodyera, Ligeophyla,

Gonatostylis, Herpysma, Odontochilus (Pristiglottis), Ludisia, Dossinia, and Macodes.

The six genera that have two stigmata are Anoectochilus, Hetaeria, Cystorchis, Zeuxine,

Vrydagzynea, and Rhomboda. The samples were collected mainly from the field in

Indonesia (Java, Sulawesi, Sumatra, and West New Guinea) and in the US (Michigan and

Wisconsin), nurseries, several Botanical Gardens and colleagues in South America, and

Australia.

2.2.4.3. rpl16

The rpl16 gene occurs in a region of the chloroplast genome that includes eight genes coding for ribosomal proteins of the chloroplast. It was originally recognized in the sequence of the tobacco chloroplast genome (Shinozaki et al. 1986; Tanaka et al, 1986).

The size of amplicon representing this region is determined by a combination of the exon designated ORF9 by Tanaka et al (1986) with a short 3-codon ORF (positions 3690- 44 3698) that was found between ORF7 and ORF 8. The result is an amplicon that would be

1020 bases in the tobacco chloroplast genome (Tanaka et al. 1986). The region includes the two introns that occur within the coding region of the rpl16 gene. A diagram of this region is presented in Figure 2.1C.

Sequences for forty-nine species were obtained for the phylogenetic analyses using rpl16

(Appendix C). Twenty-three sequences were obtained from amplifications of material from field collections, eight samples obtained from botanical gardens from some countries in Asia, Australia, and Europe, and 18 samples from commercial nurseries in the US and Australia. Two out-groups used were obtained from commercial nurseries.

The species were separated into out-groups, and in-groups with one stigmatum and two stigmata. The genera within the subtribe Goodyerinae in-groups with one stigmatum are

Pachyplectron, Goodyera, Lepidogyne, Hylophyla, Herpysma, Pristiglottis, Cystorchis,

Dossinia, Ludisia, and Macodes. Genera with two stigmata include Vrydagzynea,

Myrmechis, Zeuxine, Hetaeria, Cheirostylis, Anoectochilus, and Rhomboda. Leaf samples for sequencing the DNA of these species were collected mainly from field samples in Indonesia.

45 Figure 2.1. DNA regions used in phylogenetic analyses A. ITS region, B. trnL-F region, C. rpl16 region (Adopted from Baldwin, B.G. (1992), Taberlet et al. (1991), and Tanaka et al. (1986)).

46 2.2.5. Molecular techniques

2.2.5.1. DNA extraction

Jewel orchid leaf samples were collected from the field (Australia, Indonesia, the United

States), or from botanical gardens (Bogor, Cibodas, Edinburgh, New York, Queen Sirikit, and Tsukuba Botanical Gardens). Leaf materials from field samples were desiccated in silica gel. Specimens were collected for a total of about 60 species, representing 20 genera. Material for genera to be used as out-groups included material from the genera

Spiranthes, Cyclopogon lindleyanus, as well as material from different subtribes of the tribe Cranichideae, to obtain comprehensive representation to infer evolutionary relationships.

Two methods of DNA extraction were used, and these included the use of Hexadecyl

Trimethyl-Ammonium Bromide and Cetyltrimethyl-Amonium Bromide (CTAB) and a commercially available extraction kit: DNeasy Plant Mini kit (Qiagen Inc, Valencia, CA).

2.2.5.1.1. CTAB method

The protocol of Doyle and Doyle (1987) was used in the extraction of DNA from samples, with modification including additional precipitation time. The protocol was used for both fresh and preserved samples (desiccated samples in silica gel or samples soaked in 2X or 4X CTAB solution). The amount of samples used varied depending on the availability of each sample.

47 The standard protocol for DNA extraction used 1 g of leaf tissue. The sample was placed in liquid nitrogen for at least two minutes to allow for complete freezing. The sample was subsequently ground, and then transferred to a 50 ml tube containing 10 ml 2X or 4

X CTAB with 2% (200uL) β-mercaptoethanol. The tube was mixed by inverting the tube several times, and then the tube was placed in a 65oC water bath to incubate the mix.

After incubation, an equal volume of 1:24 chloroform:isoamyl alcohol was added. The tube was inverted gently because the solution is warm and could release gas at this step.

The tube was centrifuged at 5000 rpm in a Kubota 6800 centrifuge (Japan Bioindustry

Assc.) for 10 minutes. The upper clear layer was pipetted and transferred to a new 50 ml tube. A volume equal to 2/3rds of the pipetted amount of cold isopropanol was added to the tube and the tube placed in a freezer to incubate over night.

The tube was spun after precipitation for 10 minutes at 5000 rpm. The supernatant was removed, and 15 ml of DNA wash containing ½ by volume Amonium Acetate

(NH4OAc), and two times of volumes of 100% ethanol was added in the tube. The tube was placed in a centrifuge 5000 rpm for 10 minutes and then supernatant was removed from the tube. The pellet containing DNA remains in the tube. The tube was placed upside down on a bench until there is no smell of ethanol in the tube. The pellet was suspended in 5ml 1X Tris-EDTA pH 8 buffer (TE), and the tube was then placed on the bench until the DNA was dry. The DNA was then completely re-suspended by adding

200uL NACl and 10.5 mL cold ethanol was added (0.04 volume of 5 M NaCl and 2 times of volumes of absolute ethanol). The solution was again placed in the freezer. After

48 precipitation, the tube was spun at 5000 rpm for 5 minutes. The supernatant was removed, and the DNA was dried. The clean DNA was re-suspended in 1 ml TE.

2.2.5.1.2. CTAB extraction for micro-samples

50-200 mg of dried leaf tissue was placed in liquid nitrogen in a 1.5-2 ml eppendorf tube for 1 minute. The tissue was crushed with a plastic rod to a fine powder. Alternatively, the same amount of dried leaf tissue was added to sterile sand and then crushed with a plastic rod if liquid nitrogen is not available. 600 uL 2X CTAB with 0.5% β- mercaptoethanol was added to the tube, and the tube is placed in a 55oC water bath for 30 minutes. An equal volume of 1:24 chloroform:isoamyl alcohol was added to the tube following the incubation. The tube was covered and gently inverted or vortexed several times with care, because the high temperature during incubation can generate gas. The tube was spun at 13000 rpm in a Kubota 6800 centrifuge (Japan Bioindustry Assc.) for 10 minutes. The upper aqueous layer was removed with a 200 ul pipette and transferred to a

1.5-2 ml eppendorf tube. One volume of cold iso-prophanol and 0.1 volume of

Anomium Acetate (NH4OAc) were added to the tube and inverted gently to mix. The amount of iso-prophanol and Amonium Acetate depend on the amount of aqueous layer obtained from the previous process. The sample was placed in a freezer over night to allow the DNA to precipitate. Following the precipitation, the tube was centrifuged at

13000 rpm for 10 minutes to pellet the DNA. The supernatant was discarded. The pellet was washed with 1 ml of 70% ethanol, and the tube was centrifuged for 1 minute. The supernatant was removed and the tube re-centrifuged for 1 minute. The remaining supernatant was discarded following centrifugation without disturbing the pellet. The 49 pellet was dried overnight at room temperature, and then 50-100 ul of TE buffer or water was added to re-suspend the DNA pellet.

2.2.5.1.3. Qiagen DNeasy plant mini extraction kit

Dried or fresh sample materials were used, and the protocol provided with the kit was followed (Qiagen Inc., Valencia, CA). Sample materials were ground in a 1.5-2 ml eppendorf tube using plastic pestels.

2.2.5.2. PCR amplification and sequencing

Three molecular sequences were collected as part of the phylogenetic anaysis of relationships of the subtribe Goodyerinae: the Internal Transcribe Spacer (ITS), trnL-F, and rpl16. Table 3 provides the sequences of primers used for amplification. Internal primers were used for nested PCR when amplification using the external primers did not provide sufficient material to determine a sequence completely.

2.2.6. Coding of potentially phylogenetically informative characters

Molecular characters were treated as multi state discrete characters. Four character states are recognized in the molecular data (A, C, T, and G). Deletions or missing data due to the different length of sequences were coded by giving strip marks (“-“). They were considered as fifth character state.

50 Table 2.2. PCR Primer sequences used for molecular analyses of samples from the subtribe Goodyerineae. The location of primers in each genetic region is shown in Figure 2.1.

------Primer Name Primer Sequence ------ITS region

ITS1(Whiteetal.1990) 5’-TCCGTAGGTGAACCTGCGG ITS2 (White et al. 1990) 5’ - GCT GCG TTC TTC ATC GAT GC ITS3 5’ - GCA TCG ATG AAG AAC GCA GC ITS4 5’ - TCC TCC GCT TAT TGA TAT GC trnL-F region

Tab c (Taberlet et al. 1991) 5’ - CGAAATCGGTAGACGCTACG Tab d (Taberlet et al. 1991) 5’ - GGGGATAGAGGGACTTGAAC Tab e (Taberlet et al. 1991) 5’ - GGTTCAAGTCCCTCTATCCC Tab f (Taberlet et al. 1991) 5’ - ATTTGAACTGGTGACACGAG rpl16 region

F71 5’-GCTATGCTTAGTGTGTGACTCGTTG R1516 5’-CCCTTCATTCTTCCTCTATGTTG

------

51 2.2.7. Data analyses

2.2.7.1. Sequence alignment

The initial sequence alignments of the three genes obtained from species of the jewel orchids were conducted using CLUSTAL (Thompson et al 1994). It is assumed that the sequence of a gene of species 1 is homologous to the gene of species 2. Therefore, the different length of the sequences of different species was rectified in the alignment by insertion and/or deletion of positions. The alignments were examined and refined manually, based on the similarity of the bases between taxa and to minimize sites involved in insertion/deletion (in/del).

Gaps, representing in/dels were added to the alignments during the final manual refinement, with the aim of minimizing the number of base substitutions. Gaps are inserted in positions where the nucleotides would not be present in a particular sequence when compared with others in the alignment.

2.2.7.2. Analysis using parsimony

As an analytical methods, parsimony attempts to explain the evolutionary relationships between organisms by requiring the minimum number of steps on the generated trees

(Camin and Sokal 1965). Branch lengths are not meaningful in a maximum parsimony framework because time is not invoked as part of the hypothesis. Trees were generated in PAUP 4.0 (Swofford 2002) for both the morphological and molecular data sets.

Outgroups were used to root the generated trees. 52 As the number of taxa being examined is greater than 20, an exhaustive search (branch and bound methods) of tree space could not be performed. Instead a heuristic approach using the swapping algorithm for bisection reconnection for branches (TBR) with random addition was used, and ten trees were saved for each run of the algorithm. The maximum number of trees was set as 20000. For the analysis of morphology, the maximum number of trees was set to automatically increase after a preliminary analysis indicated that the number of trees obtained reached the maximum saved trees (20000) generated in PAUP

4.0. When investigating the patterns of changes of morphological traits, an assumption was made to accept the hypothesis of accelerated trait transformation (ACCTRAN), which assigns changes of traits closer to the root of the tree. This minimizes the possibility of accepting parallel evolution of complex traits, as opposed to delayed transformation (DELTRAN), which imposes changes closer to the tips of the tree. It should be noted that there is a question of which assumption is more appropriate

(Agnarrson and Miller 2008).

2.2.7.3. Maximum Likelihood: Parameters in Maximum Likelihood

Phylogenetic analysis using maximum likelihood employs methods that are based on explicit models of evolutionary changes. Phylogenetic relationships of organisms are inferred based on the most likely tree(s) obtained from the given data (Swofford et al.

1996). There are eight widely recognized models of evolutionary change that can be employed in maximum likelihood analysis (Swofford et al. 1996). The different between the models differ in assumptions concerning the ratio of types of substitutions

53 (tranversions: transitions) and in assumptions concerning the frequency of various bases.

The simplest evolutionary model used in Maximum Likelihood analysis is the Jukes-

Cantor model (1969). This model has a single substitution type and equal base frequencies. Alternative models are K2P, K3ST, HKY85, SYM, TrN and GTR, which differ in invoking increasingly complex patterns of substitution. The General Time-

Reversible model (GTR) is the most complex model usually used in the Maximum

Likelihood model. The GTR model uses the largest number of parameters in the analysis, and invokes the fewest assumptions. The comparison of various models is presented in Table 2.3, adapted from Posada and Crandall (1998) and Swofford et al.

(1996).

2.2.7.3.1. ModelTest

In order to choose the most appropriate model for Maximum Likelhood analysis, the model selection procedure (MODELTEST: testing the model of DNA substitution) was employed (Posada and Crandall 1998). To test the goodness of the fits of evolutionary models to the data, two information criteria (hierarchical likelihood-ratio test (hLRT) and

Akaike information criterion (AIC)) were used for the exploratory analysis. The hierarchical likelihood-ratio test (hLRT) has been used widely, but the Akaike information criterion (AIC) is known to be superior relative to the hierarchical likelihood- ratio test (Posada and Crandall 1998). I used both tests, to evaluate the robustness of the data. There are 56 combinations for testing the simpler to the more complicated models.

Both the hLRT and the AIC employ the same combinations of the model for testing the

54 Table 2.3. Evolutionary models incorporated into maximum likelihood analysis

======Model Free parameters Base frequencies (Π) Substitution rates ======

Jukes-Cantor 0 Equal a=b=c=d=e=f F81 3 Unequal a=b=c=d=e=f K80 1 Equal a=c=d=f, b=e HKY 4 Unequal a=c=d=f, b=e TNef 2 Equal a=c=d=f, b, e TN 5 Unequal a=c=d=f, b, e K81 2 Equal a=f, c=d, b=e K81uf 5 Unequal a=f, c=d, b=e TIMef 3 Equal a=f, c=d, b, e. TIM 6 Unequal a=f., c=d, b, e TVMef 4 Equal a, c, d, f, b=e TVM 7 Unequal a, c, d, f, b=e SYM 5 Equal a,c,d,f,b,e GTR 8 Unequal a, c, d, f, b, e ======a:[A-C], b:[A-G], c:[A-T], d:[C-G], e:[C-T], f:[G-T] ======

55 best model. AIC and hLRT evaluated the same models employed in maximum likelihood.

2.2.7.4. Bayesian inference of phylogeny

Bayesian analysis combines the prior probability of a phylogeny with the likelihood of the data given a posterior probability distribution of trees (Huelsenbeck et al. 2001). The posterior probability indicates the confidence that can be placed on a tree as being the true tree that generated the phylogenetic relationships. Bayesian analyses incorporate the likelihood model in the analysis of relationships. The most likely trees supported by the data will be identified to represent the evolution of the given groups.

Huelsenbeck and Rannala (2004) suggested implementing the most complex evolutionary model in the Bayesian method to reduce the chance of concentrating on too few trees.

The most complex evolutionary model used for likelihood analysis is the General Time

Reversal (GTR) model. This model was employed in finding the maximum likelihood tree for Bayesian analysis.

2.2.7.5. Combined analyses

Combined analyses were performed using results from parsimony, maximum likelihood, and Bayesian analysis to generate hypotheses concerning the relationships among taxa, and to map the distribution of characters on the generated trees. The molecular data for all loci were combined, and then the morphological characters were mapped onto the molecular tree. Homogeneity partition analysis was performed in PAUP 4.0 (Swofford

56 2002), and the analysis showed that the p value is equal to one (p=1, not significant).

This showed that data between molecular characters are comparable.

Only 29 taxa were used in the combined analyses due to the fact that these were the only groups for which the complete sequences from the three molecular characters were obtained. Inclusion of missing data was considered, but decided against because of controversy concerning the effects that missing data could have on the outcome of a combined analysis. Combining incomplete data has been debated (Wiens and Reeder

1995, Lemmon et al. 2009). Wiens and Reeder 1995 suggested combining incomplete taxa to permit the analyses of hypotheses of relationships for all the members of a group, to improve the chances of estimating the correct tree, and to justify the principle of total evidence in parsimony analyses. However, results from Lemmon et al. 2009 contradicted

Weins and Reeder’s argument that to introduce incomplete taxa (ambiguous data) can mislead phylogenetic analysis. Lemmon et al. 2009 observed that data can interact among sites that can result in misleading estimates of topology and branch lengths. The combined sequence data sets are presented in Appendix D.

2.2.7.6. Statistical support of branching order and clades

To evaluate the results of the phylogenetic analyses, two different tools are used. They are bootstraping (re-sampling with replacement) and Jackknife.

57 2.2.7.6.1. The use of bootstrapping

The use of statistical bootstrapping was first implemented in systematic studies by

Felsenstein (1995). Bootstrapping involves the re-sampling of data with replacement.

Data are re-sampled randomly to produce a new data set having the same size as the initial data set. The process is repeated many times (e.g. 100, 1000, 10000). Trees are produced from the resampled data sets and results are depicted as a single consensus tree based on majority inclusion of clades. The consensus bootstrap tree can be compared to the most parsimonious and maximum likelihood tree(s), and can be used to investigate whether the monophyletic nature of clades within the most parsimonious and the maximum likelihood tree(s) are well supported.

2.2.7.6.2. The use of Jackknifing

The Jackknife is another tool to investigate the consistency of phylogenetic trees. It was introduced by Lanyon (1985). The Jackknife method utilizes an algorithm that generates a large number of data sets re-sampled from the observed data. Data are sampled without replacement, and not all characters will be included in the new pseudo data sets. Each character has a probability for being included or excluded. Thus, the size of the pseudo data set is different each time it is generated. Each pseudo data sets will be used to identify the most parsimonious tree(s), and a consensus trees is produced from the results of different pseudo data sets based on majority rules. The tree generated is compared with the most parsimonious and maximum likelihood tree(s) obtained directly from the data to see whether the tree is well supported by the data.

58 2.3. Results

Parsimony analysis of the molecular and combined data was performed using PAUP 4.0

(Swofford 2002). Maximum Likelihood analysis of the molecular and combined data was performed using the package Garli (Zwickl 2006), while Bayesian analysis of the molecular and combined data was performed using the package MrBayes version 3.1

(Ronquist et al. 2005). For Likelihood and Bayesian analyses the best-fit model of nucleotide substitution was determined using the program Modeltest (Posada and

Crandall 1998). To summarize the findings of the section below, all methods of analysis

(Parsimony, Maximum Likelihood, and Bayesian) produced phylogenetic trees that showed similar patterns of evolutionary relationships among the taxa within the subtribe

Goodyerinae. The trees generated using the molecular data showed some patterns of monophyletic grouping within the subtribe. Details of each method of analysis will be presented below.

The partition homogeneity test (Farris et al, 1995), was employed to explore whether the data from the three genes can be combined for analysis. The p value was 1.0, indicating that the data are congruent and can be combined because there is no significant difference in patterns among the data sets.

59 2.3.1. Use of molecular characters to infer phylogenetic relationships in the subtribe Goodyerinae

Molecular characters have been used widely in systematic studies, not only at species level but also at the higher levels. Results detailed below show the individual molecular analyses from three genes, ITS, trnL-F and rpl16, and a combined analysis of all molecular data.

Homogeneity partition using 1000 replicates and heuristic search was conducted to justify whether the data have to be combined. The analysis resulted that that the data were comparable and could be combined (p-value is 1.000000). The sums of tree lengths of the combined data were 1932 steps.

2.3.1.1. Analyses using parsimony

Details of the sequences and characteristics of the trees resulting from analysis by parsimony are presented in Table 2.4. The three genes showed slightly different level of homoplasy. The range of homoplasy of ITS, trnL-F, rpl16, and the combined data are around 3 to 4%. The consistency index values (CI) of the data from the three genes and the combined data are between 0.46, ranging to 0.70, and the retention index (RI) ranges from 0.62 to 0.76. Combined data sets were only collected from taxa that had complete sequences. Therefore only 29 taxa used in the analysis.

Parsimony trees using the data for ITS, trnL-F, rpl16, and the combined data were generated using PAUP 4.0*. There are >5000 unrooted trees with a minimum of 1405

60 Table 2.4. Details of the variation in DNA sequences used in the analysis and statistics of the tree generated by parsimony analysis.

Characteristics of the sequences Combined data ITS rpl16 trnL ITS-trnL-F-rpl16

(29 taxa) (89 taxa) (49 taxa) (48 taxa)

======

Number of characters 3292 649 1501 1142

Invariant characters 2331 289 909 797

Uninformative characters 477bp 84bp 301bp 175bp

Parsimony Informative character 484bp 276bp 291bp 170bp

Consistency index 0.69 0.46 0.66 0.70

Retention index 0.62 0.76 0.69 0.73

Maximum parsimony tree length 1829 1405 1171 621

Number of trees 3 >5000 (20k) 1 1021

Pairwise sequence divergence (range in %) 0-106bp (0-3.2) 0-26bp (0-4) 0-65bp (0-4.3) 0-31bp (0-2.7) including outgroups

Pairwise sequence divergence (range in %) 0-25bp (0-3.9) 0-45bp (0-3) 0-18bp (0-1.6) Between genera excluding outgroups

Pairwise sequence divergence (range in %) 0-20bp (0-3.1) 0-35bp (0-2.3) 0-14bp (0-1.2) within genera in the ingroups

Pairwise sequence divergence (range in %) 0-24bp (0-3.7) 1-29bp (0.06-1.9) 8-65bp (0.7-5.7) between genera in outgroups ======

61 steps (the maximum number of trees continued to increase to at least 20,000) generated using 649 nucleotide of ITS data and 89 taxa. The consistency index of this tree is 0.46, and the retention index is 0.76. The pairwise sequence divergence ranges from 0 to up to

4% including the outgroups (Table 2.4). The variation between genera when the outgroups are excluded varies from zero to 25, and the variation within genera from zero to 20 (see Appendix E). This showed that there is no significant difference in the amount of variation seen within and between genera. Four consensus trees (adam, majority rules, semi strict, and strict consensus) were generated, and all consensus trees showed similar pattern. Therefore, only the strict consensus tree is displayed in this chapter (Figure 2.2).

The other three consensus trees are presented in Appendix F, G, and H.

Parsimony analysis for trnF-L results in 1021 most parsimonious trees generated with a minimum of 621 steps for sequences including 1142 nucleotide sites and 48 taxa. The consistency index of the most parsimonious trees is 0.70, with a retention index of 0.72.

The pairwise sequence divergence between samples ranges up to 2.7%, including the outgroups. The pairwise divergence between groups excluding the outgroups is 0-18bp, and within the genera is only 0-14bp (Appendix I). Forty-five species were included in the analysis, consisting of 10 genera (27 species) (Pachyplectron, Goodyera, Ligeophyla,

Gonatostylis, Herpysma, Cystorchis, Pristiglottis, Ludisia, Macodes, and Dossinia) representing groups that have one stigmata, five genera (25 species) (Anoectochilus,

Hetaeria, Zeuxine, Vrydagzynea, and Rhomboda) that have two stigmata, and three species of outgroups. The consensus tree resulting from the parsimony analysis is presented in Figure 2.3.

62 There were 127 most parsimonious trees generated with a minimum of 1171 steps using a dataset including 1501 nucleotide sites and 49 taxa from rpl16 data. There are 10 genera

(28 species) representing groups from one stigmata (Pachyplectron, Goodyera,

Lepidogyne, Hylophyla, Herpysma, Pristiglottis, Cystorchis, Dossinia, Ludisia, and

Macodes), and seven genera (19 species) - representing groups from two stigmata

(Vrydagzynea, Myrmerchis, Zeuxine, Hetaeria, Cheirostylis, Anoectochilus, and

Rhomboda). Two outgroups were incorporated in the analyses to root the tree. The consistency index of the most parsimonious trees is 0.66 and the retention index is 0.69.

The pairwise sequence divergence is up to 4.3% including outgroups, between genera by the exclusion of the outgroups is 0-45, and within genera is 0-35 (Appendix J) This data has the highest value of homoplasy compared to the other two genes. The consensus tree for Rpl16 is presented in Figure 2.4.

There are 3292 characters and 29 taxa in the combined matrix. The 29 taxa consist of nine genera (19 species, 20 samples) of groups that have one stigmata (Pachyplectron,

Goodyera, Ligeophyla, Cystorchis, Herpysma, Pristiglottis, Ludisia, Dossinia, and

Macodes), and three genera (nine species) that have two stigmata (Zeuxine, Hetaeria, and

Anoectochilus). There was no outgroup species for which all three gene sequences had been determined. Thus, no outgroup could be incorporated in the analyses of the combined data sets. This does not affect questions concerning how the two groups from the subtribe Goodyerainae defined by stigmatic number were distributed on the tree. The most parsimonious trees (three trees) generated had 1829 steps.

63 Trees generated by ITS, trnL-F, and rpl16 shows similar patterns of inconsistency.

Within the subtribe Goodyerinae, the distribution of alternative states for the stigmatic area (one versus two) is random across the strict consensus maximum parsimony trees.

Neither of them shows consistency in the number of stigmatic areas. Therefore, the

Dressler hypothesis (1993) failed to define groups within the subtribe Goodyerinae. This was also true of the hypothesis by Szlachetko (1995).

Consensus trees of the tree data sets show that the placement of Pachyplectron at the base of the subtribe Goodyerinae with high bootstrap and Jackknife, 97/99 for trnL-F tree and

100/100 for rpl16 tree (Figure 2.3 and 2.4). The exception is shown in the support for the inclusion of Pachyplectron in ITS tree (Figure 2.2). The existence of Goodyerinae as a monophyletic group to the exclusion of Pachyplectron was supported by 100% Bootstrap and Jackknife values. Based on the bootstrap and jackknife analyses, there is no significant support for the grouping of the Pachyplectron as sister to the subtribe

Goodyerinae s.s. using ITS data. In contrast, there are about 79% of bootstrap replicates and 81% of jackknife replicates that support the monophyletic of Goodyerinae s.s. in the strict consensus tree generated using trnL-F data set.

Further, using molecular data, the distribution of various morphological characters can be mapped. The distribution of venation was analyzed, classifying taxa as to whether the sample shows venation or no venation. The placements of non-reticulated leaf species are random throughout the trees in every parsimonious trees generated from four different data sets (Figs. 2.2., 2.3., 2.4., and 2.5.). Parallelism of those traits occurs commonly in

64 all strict consensus trees. For example, figure 2.3 illustrates the fact that non-reticulated species Goodyera bifida, G. carnea, G. viridiflora, G. procera, and Ligeophyla are clustered together with reticulated species (G. repens, G. pubescens, G. schlectendaliana,

G. G. rotabunensis, G. dalhousiana, G. daibucanensis, G. oblongifolia, G. tesselata,

Goodyera HOC474, G.pusilla, and Anoectochilus lanceolata, ). The leaf venation showed that it evolved independently several times. Therefore, leaf venation cannot be used to define groups within the subtribe Goodyerinae when examined using the combined analysis from all three genes.

In conclusion, the ITS, trnL-F, rpl16, and the combined phylogenetic analysis by parsimony indicates that several proposed morphological characters do not define groups within the subtribe. These include the number of stigmata based on Dressler (1993), the number of stigmata and the orientation of the column (strait or twisted) Szlachetko

(1995) and Szlachetko and Rutkowski (2000), and the pattern of leaf venation. However, the inclusion of Pachyplectron within the subtribe Goodyerinae is supported.

65 A Figure 2.. The strict consensus of >5000 trees of the most parsimonious trees, 1405 steps using ITS data sets. (OG = out-group taxa; (1) = one stigmata, (2)= two stigmata sensu Dressler (1993); C = Cherostylidinae (two stigmata), G=Goodyerinae (one stigmata, column strait), L=Ludissinae (one stigmata, column twisted) sensu Szlachetko and Rutkowski (2000)). The numbers over the branch are the bootstrap, and under the branch are jackknife. A. The first half of taxa, B. The second half.

66 Figure 2.2. continued

B 67 Figure 2.3. The strict consensus of 1021 trees of the most parsimonious trees, 621 steps using trnL-F data sets. (OG = out-group taxa; (1) = one stigmata, (2)= two stigmata sensu Dressler (1993); C = Cherostylidinae (two stigmata), G = Goodyerinae (one stigmata, column strait), L = Ludissinae (one stigmata, column twisted) sensu Szlachetko and Rutkowski (2000)). The numbers over the branch are the bootstrap, and under the branch are jackknife. 68 Figure 2.4. The strict consensus of 127 trees of the most parsimonious trees, 1171 steps using rpl16 data sets. (OG = out-group taxa; (1) = one stigmata, (2) = two stigmata sensu Dressler (1993); C = Cherostylidinae (two stigmata), G=Goodyerinae (one stigmata, column strait), L=Ludissinae (one stigmata, column twisted) sensu Szlachetko and Rutkowski (2000)). The numbers over the branch are the bootstrap, and under the branch are jackknife. 69 Figure 2.5. The strict consensus of three trees of the most parsimonious trees, 1829 steps using combined data sets (ITS, rpl16, and trnL-F). (OG = out-group taxa; (1) = one stigmata, (2)= two stigmata sensu Dressler (1993); C = Cherostylidinae (two stigmata), G=Goodyerinae (one stigmata, column strait), L=Ludissinae (one stigmata, column twisted) sensu Szlachetko and Rutkowski (2000)). The numbers over the branch are the bootstrap, and under the branch are jackknife. 70 2.3.1.2. Analyses of ITS, trnL-F, rpl16, and combined data sets using maximum likelihood

Before proceeding with any analyses, Modeltest 3.7 (Posada 1998) was employed to determine the best model to be used for the maximum likelihood analysis. All models were incorporated in the likelihood analyses generated in GARLI (Zwickl 2006) is discussed individually in each data set.

The use of ModelTest showed that the ITS data shows a best fit to two different substitution models. By likelihood ratio criteria, the data was best explained by the

TrNef+I+G model, while the GTR+I+G is the best-fit model as assessed by Akaike

Information Criterion (AIC). The parameters suggested by likelihood ratio criteria for the

TrNef+I+G model parameters are base frequencies, which are equal; rate matrix substitution model (Nst in PAUP is six with the rate matrix (Rmat) details are R(a) [A-C] is 1.0, R(b) [A-G] is 2.6601, R(c) [A-T] is 1.0, R(d) [C-G] is 1.0, R(e) [C-T] is 3.4355, and R(f) [G-T] is 1.0; among-site rate variation, a gamma distribution with the shape coefficient is 1.4027 and proportion of invariable site (pinvar, I) is 0.2136. Parameters for the GTR+I+G model were base frequency of A is 0.2526, C is 0.2165, G is 0.2958 and T is 0.2352.; the rate matrix is six (Nst in PAUP), consisting of rate matrix details

(Rmat): R(a) [A-C] is 1.0380, R(b) [A-G] is 2.4506, R(c) [A-T] is 1.4181, R(d) [C-G] is

0.7665, R(e) [C-T] is 4.2245, andR(f) [G-T] is 1.0. Among-site rate variation is distributed by following a gamma distribution shape parameter with the value equal to

1.4166, and proportion of invariable sites (pinvar, I) is 0.2129. The trees generated by two different models using ITS data set are presented in Figs. 2.6. and 2.7.

71 Modeltest was used to determine the best substitution model. The analysis showed that the data fit for trnL was best fit with K81uf+G likelihood model parameters, irrespective of the significance criterion applied. The parameters are base frequencies that are frequency A is 0.3572, frequency C is 0.1485, frequency G is 0.1217, and frequency T is

0.3725. Rate matrix substitution model (Nst) is six with the rate matrix details (Rmat in

Garli) are R(a) [A-C] is 1.0, R(b) [A-G] 0.8456, R[c] [A-T] is 2.612, R(d) [C-G] is

0.2612, R(e) [C-T] is 0.8456, and R(f) [G-T] is 1.0; substitution rate follows a gamma distribution with the shape coefficient is 0.8004; and proportion of invariable site (pinvar,

I) is 0.0. The tree generated by this model is presented in Fig 2.8.

Use of Modeltest revealed that nucleotide substitution differentiating the sequences for rpl16 data is fit best using either the K81uf+ G model (as assessed by likelihood ratio) or the TIM+G (as assessed by AIC). The two models differ in base frequencies, Rmat (rate matrix), and distributional shape. K81uf+ G base frequency model parameter are base frequency A is 0.4196, C is 01141, G is 0.1513, and T is 0.3150 , whereas the TIM+G base frequencies model parameters are base frequency A is 0.4287, C is 0.1085, G is

0.1574, and T is 0.3054. Since both models assume that there are six substitution parameters, the values for the substitution rate matrix (Nst is PAUP, and Rmat in Garli) for the K81uf+ G model are R(a) [A-C] is 1.0, R(b) [A-G] is 0.8721, R(c) [A-T] is

0.3256, R(d) [C-G] is 0.3256, R(e) [C-T] is 0.8721, and R(f) [G-T] is 1.0, whereas for the

TIM+G model they are R(a) [A-C] is 1.0, R(b) [A-G] is 0.7499, R(c) [A-T] is 0.3237,

R(d) [C-G] is 0.3237, R(e) [C-T] is 1.0779, and R(f) [G-T] is 1.0. Variable site gamma distribution of (K81uf+ G) is 0.8381 and TIM+G is 0.8276.and among site rate variation 72 refers to the proportion of invariable sites is zero. The tree generated is presented in Fig.

2.9.

I entered the values of base frequencies, and shape as estimated, and Nst (rate matrix) was six as these three parameters were the ones required to change. Both models obtained based on the MODELTEST using rpl16 data set had the same parameter requirements in GARLI as the differences can be predicted by setting the other parameters in the config file as estimated. Therefore, there was only one analysis run in

GARLI (Zwickl 2006). In PAUP all parameters were defined before the analysis, however due to less computer capacity, Garli was used because the program is more efficient and less time consuming to run the analysis. On the other hand, Garli is capable to estimate some parameters. The number of rate matrix has to be defined based on the result from the MODELTEST. Therefore, parameters that differed only based on numbers (e.g. values of the rate matrix) that do not differentiate the number of Nst (e.g.

Rmat=2, 4, or 6) were calculated by Garli.

When the data for the three genes are combined, the pattern of substitution identified by

MODELTEST was consistent irrespective of the criteria for significance applied. The

TIM+I+G model was the best substitution model with parameters defined as: base frequencies are base frequency A is 0.3705,. C is 0.1452, G is 0.1699, and T is 0.3145.

Rate matrix substitution model (Nst in PAUP, and Rmat in Garli) is six, the details are

R(a) [A-C] is 1.0000, R(b) [A-G] is 1.0107, R(c) [A-T] is 0.4299, R(d) [C-G] is 0.4299,

R(e) [C-T] is 1.3606, and R(f) [G-T] is 1.0. Rates were distributed following a gamma distribution with shape parameter (G) is 0.8083; and, the proportion of invariable site 73 (pinvar., I) is 0.1847. There were 29 taxa available for all three genes that could be incorporated in the analyses. In the combined data only nine genera (17 species, 20 samples) remained representing groups with one stigmata (Pachyplectron, Goodyera,

Ligeophyla, Cystorchis, Herpysma, Pristiglottis, Ludisia, Dossinia, and Macodes), and only three genera (nine species, nine samples) (Anoectochilus, Hetaeria, and Zeuxine) were still available representing groups with two stigmata. The tree generated from the combined analysis is presented in Fig. 2.10.

Generated trees showed similar pattern that Pachyplectron is found to diverge at the base of the subtribe with 100% and 99% bootstrap and jackknife values respectively using trnL-F data set. The similar result is also shown in rpl16 that has 99% and 100% bootstrap and jackknife supports respectively. However, the bootstrap support for ITS tree did not show the high value for the inclusion of Pachyplectron in the subtribe

Goodyerinae s.l.

Both models for ITS data were investigated to determine whether they produced slightly different trees. The trees generated by the two models showed strong similarity in the distribution of the taxa (Figures 2.7 and 2.8). Trees generated from trnL-F, rpl16, and the combined data sets showed similar result in the distribution of the taxa (Figure 2.9, 2.10, and 2.11).Also, although there is no outgroup taxa for which all three gene sequences are available incorporated in the combined data, the distribution of taxa showed similar pattern to the results from ITS, trnL-F, and rpl16.

74 The rooted trees showed that the two hypothetical groups within the subtribe

Goodyerinae that are differentiated by the number of the stigmatic area(s) do not form monophyletic groups. Three groups hypothesized by Szlachetko and Rutkowski (2000)

(Cheirostylidina: two stigmata; Ludissinae: one stigmata, twisted column; Goodyerinae: one stigmata, straight column) do not appear as monophyletic groups using either model.

The distribution of the taxa is spread throughout the tree. Alternative states for leaf venation are also spread throughout the trees for the two different models. For example,

Pristiglottis occurs in the same clade as reticulated species such as Anoectochilus,

Ludisia, and Macodes (see the circled group in Fig 2.7A). Thus, all previous hypotheses do not find support from the analysis of ITS sequences, and unique morphological characteristics are not found to define groups within the subtribe Goodyerinea.

75 A Figure 2.6. Rooted ITS maximum likelihood tree, the best model determined by AIC in the ModelTest. (OG = out-group taxa; (1) = one stigmata, (2) = two stigmata sensu Dressler (1993); C = Cherostylidinae (two stigmata), G = Goodyerinae (one stigmata, column strait), L = Ludissinae (one stigmata, column twisted) sensu Szlachetko and Rutkowski (2000)). The numbers over the branch are the bootstrap, and under the branch are jackknife. A. The first half of taxa, B. The second half

76 Figure 2.6. continued

B

77 A

Figure 2.7. Rooted ITS maximum likelihood tree, the best model determined by likelihood ratio in the ModelTest. (OG = out-group taxa; (1) = one stigmata, (2) = two stigmata sensu Dressler (1993); C = Cherostylidinae (two stigmata), G =Goodyerinae (one stigmata, column strait), L = Ludissinae (one stigmata, column twisted) sensu Szlachetko and Rutkowski (2000)). The numbers over the branch are the bootstrap, and under the branch are jackknife. 78 Figure 2.7. continued

B 79 Figure 2.8. Rooted Maximum Likelihood tree using trnL-F data sets. (OG = out- group taxa; (1) = one stigmata, (2) = two stigmata sensu Dressler (1993); C = Cherostylidinae (two stigmata), G = Goodyerinae (one stigmata, column strait), L=Ludissinae (one stigmata, column twisted) sensu Szlachetko and Rutkowski (2000)). The numbers over the branch are the bootstrap, and under the branch are jackknife.

80 Figure 2. 9. Rooted Maximum Likelihood tree using rpl16 data sets. (OG = out- group taxa, (1) = one stigmata; (2)= two stigmata sensu Dressler (1993); C = Cherostylidinae (two stigmata), G=Goodyerinae (one stigmata, column strait), L=Ludissinae (one stigmata, column twisted) sensu Szlachetko and Rutkowski (2000)). The numbers over the branch are the bootstrap, and under the branch are jackknife. 81 Figure 2.10. Rooted Maximum Likelihood tree using combined data sets. The values above the line indicates the bootstrap values and below line indicates jackknife value. (OG = out-group taxa; (1) = one stigmata, (2)= two stigmata sensu Dressler (1993); C = Cherostylidinae (two stigmata), G=Goodyerinae (one stigmata, column strait), L=Ludissinae (one stigmata, column twisted) sensu Szlachetko and Rutkowski (2000)). The numbers over the branch are the bootstrap, and under the branch are jackknife.

82 2.3.1.3. Bayesian Analyses

The same molecular datasets that have been used for analysis by parsimony and analysis by maximum likelihood can be employed in Bayesian analysis. The substitution model that is used for all subsequent Bayesian analysis is the GTR (General Time Reversible), as suggested by Huelsenbeck and Rannala (2004).

For the ITS Bayesian analysis, 89 taxa and 649 nucleotide characters were included. The tree was rooted using Manniella gustavi (AJ539517), as this species always appears at the base of the tree in analyses using parsimony or maximum likelihood. All twenty-seven outgroups used in this analysis are found to diverge at early in the tree (Figure 2.12).

Bayesian trees obtained from the data on trnL-F, rpl16, and combined data set showed the similar patterns to that just described for the ITS region (Figure 2.11., 2.12., 2.13., and 2.14.). Pachyplectron diverges basal to the remaining members of the subtribe

Goodyerinae. The distribution of the stigmatic area is random across the clades within the subtribe. The results suggested that there are no monophyletic groups of taxa having either one or two stigmatic areas, similar to the findings on the trnL-F, rpl16, and combined data sets. The distribution of the stigmata shows no consistent pattern across the trees. Neither of the previous hypotheses (Dressler, 1993 or Szlachetko and

Rutkowski, 2000) are supported by the analyses.

The placement of Pachyplectron is consistent with previous analyses, occurring as a sister clade to other members of the subtribe Goodyerinae s.l. The posterior probability 83 of the subtribe Goodyerinae generated from ITS data, including the two species of

Pachyplectron was 64%, whereas using trnL-F and rpl16 data sets, the posterior probabilities are both 100%.

Patterns of leaf venation are distributed throughout the tree. Changes in leaf venation occurred multiple times. The non-reticulated species of Pristiglottis and Myrmechis gracilis, occur in the same cluster as reticulated species such as Anoectochilus, Ludisia, and Macodes (circle in Fig 2.11A). Thus, again, all three hypotheses proposed about relationships within the subtribe Goodyerinea do not find support, and the Bayesian analysis further strengthens the conclusion that the subtribe does not have any unique morphological characteristics that can define groups within the subtribe.

84 A Figure2.11A. The rooted Bayesian tree generated using ITS data sets. The numbers indicate the posterior probability out of 100 clades to appear in the tree generated by the Bayesian analyses. (OG = out-group taxa; (1) = one stigmata, (2)= two stigmata sensu Dressler (1993); C = Cherostylidinae (two stigmata), G=Goodyerinae (one stigmata, column strait), L=Ludissinae (one stigmata, column twisted) sensu Szlachetko and Rutkowski (2000)). A. The first half of taxa, B. The second half. 85 Figure 2.11. continued

B 86 Figure2.12. The rooted Bayesian tree generated using trnL-F data sets. The numbers indicate the posterior probability out of 100 clades to appear in the tree generated by the Bayesian analyses. (OG = out-group taxa; (1) = one stigmata, (2)= two stigmata sensu Dressler (1993); C = Cherostylidinae (two stigmata), G=Goodyerinae (one stigmata, column strait), L=Ludissinae (one stigmata, column twisted) sensu Szlachetko and Rutkowski (2000)).

87 Figure 2.13. Rooted Bayesian tree using rpl16 data set. The numbers indicate the posterior probability out of 100 clade to appear in the tree generated by the Bayesian analyses. (OG = out-group taxa; (1) = one stigmata, (2)= two stigmata sensu Dressler (1993); C = Cherostylidinae (two stigmata), G=Goodyerinae (one stigmata, column strait), L=Ludissinae (one stigmata, column twisted) sensu Szlachetko and Rutkowski (2000)).

88 Figure 2.14. Rooted Bayesian tree using combined data sets. The numbers indicate the posterior probability out of 100 clades to appear in the tree generated by the Bayesian analyses. (OG = out-group taxa; (1) = one stigmata, (2)= two stigmata sensu Dressler (1993); C = Cherostylidinae (two stigmata), G=Goodyerinae (one stigmata, column strait), L=Ludissinae (one stigmata, column twisted) sensu Szlachetko and Rutkowski (2000)).

89 2.4. Discussion and conclusion

The results from all three methods of analysis, Parsimony, Maximum Likelihood, and

Bayesian analyses, were consistent in the resolution of taxa in the generated trees. The three methods of phylogenetic analysis showed the same patterns of the taxon sequence on the trees indicating the robustness of the data used. All trees generated from the three methods showed that the subtribe Goodyerinae is a monophyletic group. All analyses showed that Pachyplectron forms a basal sister clade to the remaining members of the subtribe Goodyerainea. This result is supported by high bootstrap and jackknife values in the trnL-F and rpl16 data sets, and a high posterior probability from the Bayesian analysis that was also consistent with the previous studies done by Salazar et al. (2003) and Pridgeon et al. (2003). Although, Jackknife and Bootstrap values generated to provide support for the strict consensus trees of Parsimony and Maximum Likelihood and the posterior probability tree of the Bayesian method generated using the data from ITS are low, the placement of Pachyplectron is consistent. Therefore, the hypothesis concerning the placement of Pachyplectron within the subtribe Goodyerinae is supported.

The hypotheses that the subtribe consisted of two groups based on the number of stigmatic areas Dressler (1993) finds no support by any of the analyses. The distribution of the taxa having one or two stigmatic areas shows no consistent clustering in any of the generated trees (Fig 2.1 to 2.14).

The hypothesis of Szachetko and Rutkoqski (2000), recognizing the occurrence of three groups within the subtribe Goodyerinae sensu Dressler (1993) (Cherostylidinae (two

90 stigmata), Goodyerinae (one stigmata, column strait), Ludissinae (one stigmata, column twisted)) also finds no support by any of the analyses using morphological or molecular data (ITS, trnL-F, rpl16, and combined data sets).

The overall patterns from all analyses also gave no support to the use of leaf venation as a defining characteristic of subgroups within the subtribe. Leaf venation appears to have appeared multiple times within the tree. Non-reticulated species are clustered with reticulated species.

Comparison of results from Parsimony, Maximum Likelihood, and Bayesian reconstruction of phylogenetic relationships provide the same results with respect to hypotheses concerning the utility of stigmatic area number or column type or additional morphological characters such as leaf venation. No morphological character provides evidence of monophyletic groups within the subtribe.

Analyses of the morphological characters were unable to find any morphological characteristics that is unique to a particular clade. This is very common in analyses of families within orchids. For instance, the subfamily Orchidoidea does not have any character that can differentiate the group from other subfamilies (Salazar et al. 2003,

Pridgeon et al. 2003, Molina and Cameron 2009).

91 Based on a comprehensive analysis using data for three genes, subgrouping within the subtribe Goodyerinae including Pachyplectron cannot be determined. It is possible that additional molecular data sets from different molecular regions might be able to provide information on the relationships within the subtribe. Meanwhile, until other information is forthcoming, the established classification within the subtribe based on the similarity and differences of morphological characteristics should be retained.

This study suggests that the delimitation of genera within the subtribe is problematic that requires intensive revision to define each genus within the subtribe using molecular data.

Additional samples and DNA sequences from different DNA regions (MatK, nadh, etc.) that have been used to classify species of Orchidaceae in various levels will be needed to represent each genus to obtain convincing result of the monophyletic of the groups.

92 Chapter 3: Fungal Association of Goodyera section Goodyera from Indonesia

3.1. Introduction

Orchids are one of the largest and most widespread groups of flowering plants in the tropics and subtropics. They live in a wide range of habitats and have diverse life strategies. Orchids have an interesting and unique reproductive biology with respect to seed germination. Their capsules can produce as few as 1300 seeds per capsule to four million seeds (Arditti 1992), and under natural conditions the seeds only develop if certain fungi infect the germinating seeds (Arditti 1992). The fungi will live inside the roots of the developing plant for a length of time. Terrestrial orchids rely on mycorrhizas. These relationships continue even after the orchids develop the ability to produce their own foods. Orchids that are always associated with a suitable fungus are called obligatory mycotropics.

Two types of fungal associations are found in terrestrial orchids. These are referred to as mutual and myco-heterotropic (Rasmussen 1995). Mutual interactions begin during seed germination in leafy orchids until the orchids produce their own foods, then the interaction becomes mutual between the two organisms. In contrast, myco-heterotropic interactions occur throughout the lifetime of the orchids without any supply given up by the plant. Some species of orchids, especially parasitic orchids (leafless orchids) obtain nutrients from the fungi (Taylor et al. 2003). However, further investigation shows that 93 there are possible transfers of carbon from other plants to the myco-heterotrophic plants through the presence of the fungi. It was discussed that the fungi actually infect the orchids voluntarily to be ‘digested’ by the orchids to eliminate the infection (Arditti

1992). One of the functions provided by the orchid fungi is to provide a carbon supply for orchids that cannot make their own nutrient. These plants have evolved the capacity to absorb substantial quantities of sugar as well as nutrients from their associated fungi, such that the net flow of carbon is from fungus to plants (Taylor et al. 2003). This specific adaptive interaction might have contributed to the radiation of orchid species, which may lead to the specificity of the orchids to particular species of fungi.

The first observation of a fungal structure (mycorrhiza) anatomically within the roots of orchids was conducted by Reissek (1847) (cited in Hardley 1982). He visualized the mycorrhiza as coils with branched structures of intracellular mycelium form. He recognized the difference in association with fungi between the root structures of the

European terrestrial orchids and the orchids from the subtropics. The cortex of the

European terrestrial orchids was extensively infected by the fungi. In contrast, fungi infect the roots of the tropical orchids in a single peripheral pattern (Hardley 1982). The first person to report changes in the amount of fungus inside orchid roots was Wahrlich

(1886), who noticed that the amount of fungus was reduced in the conditions of cultivation. As explanation, it was suggested that the host digested the fungus in cultivation. However, Magnus (1900) (cited in Hadley 1982) noticed that the fungus remains alive in the orchid cells.

94 Bernard (1903) found that only a suitable fungus could result in germination of orchid seeds. He brought up the concept of a symbiosis between the fungi and the roots of orchids, hypothesizing a relationship that enhanced the absorption of nutrients required for germination, and suggested that the fungi associated with the orchids were parasitic fungi (Hadley, 1982) in Arditti (1992). In this condition, the fungi did not have the ability harm the orchids.

Symbiotic relationships between two different organisms are known as very important aspects of the evolution and adaptation of many organisms. For example, mutual interactions between plants and insect pollinators provide nectar for the insect, and pollination of flowers or seed dispersal for the plant. Similarly, symbiosis between plants and mycorrhizal fungi provide nutritional requirements for both parties. This type of mutually symbiotic relationship occurs in the orchids naturally. The symbiosis allows the growth of different fungi to contribute substantial quantities of sugar and nutrients during the germination, and then continued their lifetime nutritional supplies (Rassmusen 1995) in which that there is a net carbon transfer from fungi to plants in parasitic orchids

(Taylor et al. 2003). It is unclear whether the nutritional relationships during the germination and seedling stages are carried on into the adult stage. However, it is suggested that adult plants maintain some fungal relationships after maturity (Rasmussen

1995). The relationships might be lightly or fungal free. However, it is little known about the durability of the infection of the fungi to the orchid roots (Arditti 1992).

95 Rasmussen (1995) summarized the process of infection of orchids by fungi. The association begins soon after the seeds of the orchids germinate. The fungus infects the cortical cells of the orchid roots via epidermal hairs in the developing protocorms and roots. After penetration, the orchid cells capture the fungi, and the fungi develop hyphae, and maintain the fungus inside the cells. The fungal structures inside orchid cells are called pelotons (coiled fungal structure). The orchid digests the pelotons through enzymatic processes, which may be the main mechanisms for transfer of nutrients from the fungus to the plant. Therefore, orchids are actually “parasitizing” the fungi.

Research showed that fungi associated with the orchids are mainly endophytic (Adritti

1992, Rasmussen 1995, Hadley 1982). Endophytes are living microorganisms occupying plant tissues without causing any harm. The endophyte can act as a latent pathogen, a mutualist, or a saprobe.

Two histological forms of orchid mycorrhiza have been recognized in the cells of the

Orchidaceae, tolypophagy and ptyophagy, and have been recognized to differentiate the morphology of the endophytes (Rasmussen 1995). Ptyophagy is relatively rare and represents a histological type of infected tissue caused by deformation and subsequent lysis of intracellular hyphal tips within the cells, from which contents are subsequently released. Rasmussen (1995) indicates that the contents are presumably released into the interface between the host plasmalemma and the endophyte cell walls. Tolypophagy represents the presence within a cell of a fungus that forms well-formed hyphal coils, the pelotons. These undergo successive cycles of peloton formation, lysis and reinfection,

96 but with continued separation of the host and fungal cytoplasm. Species of Goodyera possessed tolypophagical type of tissues.

Among the best known types of fungi that associate with orchids are Rhizoctonia-like fungi, so named because of similarity in form to the plant pathogen Rhizoctonia both during anamorphic (asexual) and teleomophic (sexual) stages. The fungi that are similar to Rhizoctonia during anamorphic stages include Ceratorhiza, Epulorhiza, and

Moniliopsis. The Rhizoctonia-like sexual stages are seen in several varieties of fungi:

Ceratobasidium, Thanatephrous, Tulasnella, and Sebacina. Genera of fungi that have the form of the genus Rhizoctonia are presented in Table 3.1.

Much research has been done to uncover the fungal associations of some species within the genus Goodyera (G. repens and G. pubescens), mainly involving species from the subtropics (Arditty 1992). Generally, species of Goodyera are found to be associated with Rhizoctonia-like sp (Hadley 1982).

The morphological characteristics of the Rhizoctonia-like fungi are right angle branching, a constriction at the branch point, and a septum in a branch hyphae near its point of origin. The sexual stage is very difficult to encounter, so misidentification often occurs during the vegetative stage (Andersen 1990 in Rasmussen 1995).

Some of these Rhizoctonia-like groups are pathogens of plants. Little information is known about why the fungi voluntarily invade orchid cells. However, it is actually not surprising that fungi invade orchid cells, because invading fungi are primarily

97 endophytes. The fungus may parasitize the orchid seeds as part of their adaptation for survival, in order to obtain nutrition. However, orchid seeds do not produce endosperm for initial growth, so no nutrients are available in the seed for absorption by the embryo for germination. The intervention of the fungus might have given the orchid embryo opportunities to obtain nutrients from its surroundings through sugar flow between fully- grown plants, the fungi, and the orchid seed.

There has been debate concerning the interaction between orchids and their associated fungi. It has centered on whether orchids are specifically associated with particular groups or generally associated with any fungal groups (see Bernard, Burgeff, Curtis, and

Knudson as discussed in Arditti 1992). Studies were initially conducted by Hadley

(1982) in Arditti (1992) to investigate the fungal associations of G. repens that occur during germination. The results showed that the orchid species had various fungal associations for establishing the species through successful symbiosis. In contrast,

Taylor et al. (2003) and Otero et al. (2002) describe that specificity occurs to the relative phylogenetic diversity of fungi and with a particular group of plants.

Bernard and Burgeff, who advocated the theory of orchid-fungus specificity, suggested that specificity might be caused by specific requirements for the Rhizoctonia-like fungi in temperate areas, in contrast to less specific requirements in the tropics (see Arditti 1992).

Species that occur in a particular geographic area might have utilized whatever fungi was available, causing endemic species interactions, specialized only to that geographic

98 Table 3.1. Fungal groups within the form of Rhizoctonia-like organisms according to Andersen (1990) and Andersen & Stalpers (1994) in Rasmussen (1995, p. 83).

Species Anamorph Presumed Teleomorph

1. Ascorhizoctonia Tricharina

2. R. crocorum (type of Rhizoctonia s.str.) Helicobasidium purpureum

3. Epulorhiza Tulasnella + Sebacina

4. Ceratorhiza Ceratobasidium

5. Monilipsis Thanatephorus + Waitea

99 region. In these cases, fungi involved in associations might not be restricted only to groups of the Rhizoctonia-like fungi, as suggested by much of the literature. In addition, orchid plants could switch to alternative fungi to survive under difficult conditions

(McCormick et al. 2006).

In order to investigate plant-fungal specificity, two major approaches have been used in the past. The first approach is to germinate orchid seeds with fungi the orchid species interact, and the second is to identify fungi hosted in the orchid roots.

The identification of fungi using the second approach was initially done by isolating fungi from the adult plant roots (Rasmussen 1995, p. 77-112). This showed that the most frequent groups associated with orchids were from the genus Rhizoctonia, which has proved suitable for the orchid seed germination through an in vitro process (using agar media). Rhizoctonia is classified within Basidiomycetes. The genus is characterized by the presence of “colored septate, relatively wide hyphae; lateral branches arising at an acute angle or at right angles in the distal part of the cell, constricted at the point of origin and with a septum close to the main hyphae; and the formation of monilioid cells and sclerotia” (Rasmussen 1995).

3.1.1. Fungal associations of Goodyera section Goodyera in Indonesia

One of the aims of this research was to identify fungi occurring in species within the section Goodyera from Indonesia. I propose that the fungal associates of the species of this section are more diverse than was initially thought and that they might show diversity

100 extending beyond Rhizoctonia-like fungi. Species from Goodyera section Goodyera including relatives that grow in the tropics experience high competition for light and nutrients because they grow on the forest floor where light and nutrients are not very reliable. It is possible that they use whatever fungal symbionts available in the environment. McCormick et al. (2006) studied Goodyera pubescens in the temperate zone. She proposed that under an extreme environmental condition, the orchid can switch to any fungus individuals in the environment. However she also suggested that the switch has a potential cost, which is the mortality of the orchid.

Little information is available on the types of fungi that are associated with Goodyera, whether these fungi are associated with roots or they contribute to the growth of the orchid. What published information has been reported is limited to studies in the temperate. The research reported here will provide new understandings of fungal associations with the tropical terrestrial green orchids. Further, this research has significant implications for conservation of the jewel orchids. The number and extent of tropical rain forests in Indonesia has decreased enormously due to human development and the dramatic increase of human populations near the forests. Many endemic species of the jewel orchids in Indonesia need to be conserved immediately. Once habitat clearing has occurred, the species will be lost, since they are not found elsewhere. Efforts to grow the species have been conducted. However, when they are collected and cultured in botanical gardens, they are difficult to culture due to a lack of facilities to grow them under natural conditions. It is possible that the fungal requirements of the plants represent one of the limiting factors for the establishment of new plants and populations.

101 The objective of the research in this chapter is to describe the diversity of the fungi associated with Goodyera section Goodyera and to investigate the specificity of the plant-fungus association.

3.1.2. Hypotheses about orchid-fungal associations

The primary hypothesis concerning associations assumes that there is a specific association between species of Goodyera section Goodyera and fungi. Alternative hypotheses can also be stated. Thus,

H0: Species of Goodyera section Goodyera in Indonesia specifically associate

with Rhizoctonia-like fungi (the two groups are congruent).

H1: species of Goodyera section Goodyera in Indonesia associate with any fungi

within the Rhizoctonia-like fungi even with fungi outside the group (the two

phylogenetic trees are incongruent, and the two trees are not specific to the

Rhizoctonia).

H2: The species of Goodyera section Goodyera in Indonesia became specialized

to a specific fungus, but the orchids associate with fungi outside the clade of

Rhizoctonia-like fungal specific, which causes a new form of association

(endemic species) (the two phylogenetic trees are incongruent, but the two trees

are specific to the non-Rhizoctonia-like fungi).

102 Hypothesis of being specific: Hypothesis of being non-specific or became specialized: The

Rhizoctonia- The

like fungi Orchids Rhizoctonia-like

Fungi fungi Orchids

Other fungi

Other fungi

Orchids interact with groups of fungi from Specific clades of orchids interact with the the Rhizoctonia-like fungi (specificity) Rhizoctonia-like fungi and others outside the clade of Rhizoctonia-like fungi (generalists, black color), or specific clades of orchids associate with other fungi outside the clade of Rhizoctonia-like fungi (become specialized, red color).

Figure 3.1. The appearance of concordance between phylogenetic trees of orchids and phylogenetic trees of fungi for the concepts of (1) specificity in association, (2) non-specificity of association, and (3) development of new specialization.

103 3.2. Materials and Methods

3.2.1. Sampling Strategy

There are eight taxa (species and under) from the section Goodyera incorporated in this research. They are G. gibbsiae, G. bifida, G. procera, G. reticulata subsp. colorata, G. reticulata subsp. gemmata, G. reticulata subsp. pusilla, G. reticulata subsp. reticulata, and G. reticulata subsp. schlectendaliana. However, I will still use the traditional names of taxa when they are shown in the tree and in the text to explain the relationship of the orchids and the fungi (G. reticulate subsp. colorata is G. colorata, G. reticulata subsp. gemmata is G. gemmata, G. reticulate subsp. pusilla is G. pusilla, G. reticulate subsp. reticulate is G. reticulata, and G. reticulate subsp. schlectendaliana is G. schlectendaliana).

The areas of exploration in Indonesia were in Bali, Java, Irian Jaya, Sulawesi, and

Sumatra. Samples were collected from Sumatra (Jambi, North, and West Sumatra), Java

(West, Central, and East Java), Sulawesi (South), and Irian Jaya (Cyclop and the Yapen

Island), including species collected from the fields in Indonesia that have been deposited at Bogor Botanical Gardens. Bali was visited, but no specimens were collected in this area. Species of Goodyera section Goodyera are among the rarest orchid species to be collected. They are very inconspicuous plants occurring in shady and wet forests. They occurred in the field as clusters in small areas will be limited numbers. The presence of the species cannot be predicted easily, due to the condition of the forests (which are always humid) and many habitat destructions. An individual plant might decay, but the

104 remaining stems could grow again in an unpredictable period of time depending on the microclimate of the environment in the site. Plants flower throughout the year, as the temperature and humidity are relatively stable (personal observation). Goodyera bifida was collected from West and Central Java; Jambi, North Sumatra, West Sumatra

(Sumatra) and South Sulawesi; G. reticulata from West and Central Java; G. pussila from two places in West Java; G. gemmata from North Sumatra; G. procera from West Java;

G. schlectendaliana from Jambi (Sumatra) and West Sumatra; and G. colorata from

North Sumatra and West Java. Goodyera arfakensis was not collected from the field because the species could not be found in Irian Jaya. A herbarium specimen of Goodyera gemmata was collected from East Kalimantan, Gunung Buntung. Plant specimens from the Borneo area were requested, but no herbarium specimens could be obtained from these areas.

Locations in Java, Sumatra, and Irian Jaya, where the species predominantly grow according to information from herbarium specimens and the literature, were visited.

Initially, sampling transects were planned from the bottom to the top of the sampling areas, with a 100m2 plot for every 100m slope, However, as the distribution of the plants was very restricted and plants were present only in some sites, the sampling strategy could not be performed. Consequently, specimens were collected by following the track.

Every time a population was found, the area was investigated by foot and plants were randomly collected. The number of plants collected varied from 2-5 plants of each species per site. The distribution of the species did not seem to overlap appreciably in the field. Each species was found in a narrow distributional and elevational range. The

105 widest range of distribution was found on Mt Singgalang, where Goodyera reticulata subsp. schlectendaliana, occurred over a ~100m range of elevation high (from 1913m to

2059m asl.). At this site, the track was very narrow, so the left and right sides were mainly deep cliffs with about 90 degree slopes, and the vertical transects were practically safer to collect plants than the horizontal transects. Within this range, 5 populations occurred, with approximately 20m gaps in between populations. The entire whole individual plants were sampled in order to get the root and the leaf materials for DNA extraction.

3.2.2. Fungal cultures and DNA extraction

Of the eight morphs recognized in Indonesia, seven were found and collected. Goodyera bifida is very wide spread in Java and Sumatra, G. procera was found in West Java, G. reticulata subsp. pusilla (G. pusilla) was collected only in West Java, G. reticulata subsp. reticulata (G. reticulate) in West and Central Java, G. reticulata subsp. schlectendaliana

(G. schlectendaliana) was in Sumatra (North and West Sumatra, and Jambi), G. reticulata subsp. gemmata (G. gemmata) was collected in North Sumatra. Collections of

G. reticulata subsp. colorata was restricted to one plant from West Sumatra and one plant from West Java, but no sufficient roots could be obtained from which fungal DNA could be extracted. Finally, Goodyera reticulata subsp. gibbsiae (G. gibbsiae) is not be found in some areas in West New Guinea (Smith 1992-1923). The place where the type specimens were collected could not be visited.

106 To obtain DNA from fungi associated with the orchids of this group, a sufficient amount of fungi was collected by culturing the roots of the orchids, followed by extracting DNA from them or extracting DNA from roots immediately after collection from the fields.

Potato agar media was used to culture the fungi. The potato agar media were prepared by mixing 39 g of potato dextrose agar (PDA) with 1 L of distillated water, which was then autoclaved. This media was allowed to cool, and 1ml of ampicilin stock solution was added for every liter of agar solution. The ampicilin solution was made by adding 2.5 g ampicilin per 10 ml of distilled water. 25 ml agar solution was poured into plastic petridishes and allowed to cool. The media were then ready to be inoculated. All processes were performed in an airflow cabinet.

The roots of orchids were cleaned of any dirt, and the epidermis was removed. The root was sterilized for 10 seconds in a 20% Clorox solution, allowed to dry for a few seconds, and then the clean and sterilized root was embedded in the agar. This technique allowed different endophytes to grow in the plate. Finally, the plate was sealed with parafilm plastic, and the plates were allowed to sit for two or three weeks to permit growth.

Due to the difficulty of getting fungi immediately and the possible contamination that easily occurs in the process described above, I extracted the roots immediately from the fields using standard CTAB protocols to extract the orchid roots (Doyle and Doyle 1987), and the extraction was performed immediately in Indonesia. This process was followed by amplification and sequencing of the fungal DNA, using ITS specific fungal primers.

Individual sequences were performed using ABI 3100 sequencers.

107 I used 1 g roots for the process of extraction. After I obtained DNA pellets during the last process of the DNA extraction, I diluted them in 100 ul of TAE or water. I diluted in a much lower volume than usual (1 ml) because the amount of fungal DNA (the target in this process) is much less than plant DNA.

The primers used to amplify their DNA are ITS1F and ITS4, are presented in Table 3.2.

Additional sequences from the GenBank were collected that relate to Rhizoctonia groups to elucidate where the fungi collected from the field actually fall in the cladograms. To get the identities, the sequences obtained from the root of plants were blasted in

GenBank.

3.2.3. Data analyses

The sequences were aligned using CLUSTAL, then I analyzed the data sets employing parsimonious, Maximum Likelihood, and Bayesian methods in PAUP, Garli, and

MrBayes. Modeltest analyses were performed to get the best model incorporated in maximum likelihood analyses using the data. The generated trees obtained from parsimony and maximum likelihood were statistically tested for robustness using

Bootstraps and Jackknife. MrBayes analysis had an immediate posterior probability showing how many trees support the hypothesis (probability of the hypothesis given the data). Tree supports (Bootstraps and Jackknife values) were calculated for both trees to show the robustness of the trees generated (Felsenstein 1985, Lanyon 1985).

108 Table 3.2. Primers of fungal ITS used for sequencing

Primer specific fungi Primer sequence

ITS1F CTTGGTCATTTAGAGGAAGTAA

ITS4 TCCTCCGCTTATTGATATGC

109 Sequences that were successfully amplified and sequenced were included in phylogenetic analysis using the parsimonious, maximum likelihood, and Bayesian methods. The objective of using the three methods is to see the consistency of the arrangement of the fungi occurring in the tree (cladograms).

Specific association was recognized if a species of orchid had a single fungal partner wherever samples were collected. In addition, the fungal associates can be from closely related or distant groups from the Rhizoctonia like fungi. If the closely related group of orchid interacts with the closely related group of Rhizoctonia like-fungi, then the association is specific. The species of orchids had a generalist association if each species had multiple fungal partners. The association may overlap between species, and can be from any group of fungi. I aligned sequences for both orchids and their fungi separately.

I completed the sequencing analyses of the orchid plants in Chapter 2. The parsimony cladograms of plants using ITS data sets were incorporated to interpret the association between the fungi and the orchids to get the comprehensive relationship of the plants relative to the fungi. The fungus sequences were aligned by Clustal, employed in

Bioedit, and then the alignment was refined. Only 163 bp of sequence was used in the analysis due to difficulty identifying the homology of the sequences. I aligned the sequences based on the similarity of the sequences, minimizing the number gaps.

Parsimony analyses of the data sets were run in PAUP 4.0 (Swofford 2002). The most parsimonious trees using the Wagner algorithm were initially generated. Only one or two

110 trees were saved, and 10 random addition sequences added each time during the searching. This method was used this as a time and memory saver.

3.2.4. Association between orchids and fungi

Reconstruction of the association between orchids and fungi were attempted with several different approaches. The simplest approach to the two unrelated taxa is Brooks parsimony analysis (BPA), as described by Brooks (1981). BPA was designed to maximize co-speciation if multiple parasites occupied multiple hosts, host switching can be inferred from the incongruence. This method recodes parasite cladograms into a data set, which is then mapped onto the host cladogram. Although BPA is the simplest method to analyze the host-parasite relationship, it has limitations in explaining incongruence in the host-parasite relationships. Specificially, no explanations of lineage sorting, duplication, and extinction are present in this method.

The second method to maximize co-speciation is the reconciled tree method (Page and

Charleston 1997). It explains that incongruence between the hosts and parasites is due to extinction. Assume, for instance, that the host cladogram is a species tree, and the parasite cladogram is a gene tree. Gene trees are a tiny part of species trees.

Characteristics that are used to construct species trees are more complicated than those of the gene tree, though species trees are accumulations of the gene trees. Extinction may occur in one of the gene trees; however, if extinctions do not occur in the other gene trees, the summary of all gene trees will show similarity with the species trees. However, the gene tree that becomes extinct might be incongruent with the species tree.

111 Accordingly, this method duplicates the species trees as many times as the number of conflicts. For example, let’s say I have host A, B, C, and D and I have parasite A’, B’,

C’, and D’. The host tree is described is A and the terminal is B, while C is the sister for

A and B; and D is the sister for (A&B) and C. The parasite tree is not congruent with the host tree: (A’&B’) and (C’&D’). The species tree is then duplicated, and the extinction evens are determined by comparing the number of incongruence events. The lowest cost is chosen to explain the relationship of the host and parasite; it is obtained by comparing host and parasites trees obtained randomly and then duplicating the trees according to the number of incongruent events. The disadvantage of using this method is it cannot really explain host switching that might have occurred due to ecological pressures. Also, horizontal transfer cannot be explained using this method. The idea that host and parasite are always co-species ignores other phenomena that can cause conflict in the host and parasite trees.

The third method of association is Jungle (Charleston 1998). This idea is similar to the reconciled tree, which is designed to maximize co-speciation. However, Jungle gives a more comprehensive explanation, because this method tries to incorporate other phenomena that can cause incongruence between host and parasite trees. The chosen interaction is the one that has the lowest cost. The first thing to do is to determine the cost of co-speciation, duplication, lineage sorting, and host switching. The value of co- speciation is less than or equal to 0, while the other parameters’ values should be greater than 0. This concept is very desirable, but, the difficulty with using this method is

112 determining the value of each parameters, called sensitivity analysis, by using several different sets of parameter values (co-speciation, duplication, host switching, and duplication) to get the lowest value of all events occurring in the host-parasite association.

3.2.5. Statistical tests for co-speciation

Co-speciation is indicated by parallel cladograms for two different unrelated taxa . This study helps us to understand the evolutionary history of two unrelated groups of organisms that interact closely.

There are several different statistical tests that can be used to evaluate co-speciation. First is heterogeneity partition test, which was designed to test the significance of indifference

(Farris et al. 1995). This test was based on the number of step differences between two organisms’ trees. Second, co-speciation can be tested using the maximum likelihood approach (Hulsenback et al. 1997). Under this approach, the null hypothesis is a likelihood value that is calculated under constraints assuming that the orchid and fungal phylogenies are identical, and the alternative hypothesis is a likelihood value that is calculated without constraints. To test co-speciation, the likelihood ratio needs to be calculated. If the likelihood ratio is less than one, the alternative hypothesis is favored. In contrast, if the likelihood ratio is equal to or greater than one, the null hypothesis is preferable. The use of the parameters in the substitution model is allowed to be different for the two close but unrelated taxa. The significance of the observed ratio is then measured by comparing the result using simulated data sets with the bootstrap method. If

113 the level of significance is equal or greater than 95%, the significant value is highly supported.

3.2.6. Analysis of fungal association of Goodyera section Goodyera from Indonesia

Phylogenetic relationships of Goodyera section Goodyera from Indonesia was investigated from the general tree obtained from the ITS data sets (Chapter 2), because the data are the most comprehensive and the relationships among species showed similar patterns between the three genes and the combined data sets. The relationships of

Goodyera section Goodyera showed non-monophyletic in the cladograms using the three data sets. To test the fungal-orchid association within the section Goodyera from

Indonesia, I incorporated several species from outgroups and Goodyera oblongifolia collected in the United States to elucidate their specificity. The two clades (fungal and orchid trees) were compared, and their associations are discussed in the results and discussion sections. Their relationships were identified by connected lines between the two cladograms.

3.3. Results

Two aspects of the observations on orchid-fungal associations are presented in this section. The first part presents the root anatomy of some samples to show how the density of pelotons in the roots may vary, which can present problems during DNA extraction. The second part presents the result of the DNA sequencing of the successfully amplified fungal DNA. The evolutionary relationships of the fungi obtained

114 from the orchid roots from this group are presented together with the orchid ITS cladogram to show how congruent the two different organisms are. Although in section

3.2.4. co-evolution of two different unrelated groups of organisms was discussed, co- evolution of fungi and orchids Goodyera from Indonesia was not discussed in the results section.

3.3.1 Anatomical analysis of roots

The staining of root preparations were performed using safranin and alcian blue.

Safranin stains the nucleus strongly with a red color. Results are shown in Figure 3.2.

Pelotons occurring inside a cell were stained with red or blue, depending on what chemical components formed the pelotons. The slides show variation in the amount of pelotons present in the plant roots. When the level of fungi in the root is small, it may be insufficient to provide enough fungal material to extract DNA from the plant materials.

Under this circumstance, it is recommended that fungi be grown by inoculating the whole roots to retain all the variation of the endophytes occurring in the orchid roots. By culturing the orchid roots in an agar media, the amount of endophytes occurring inside roots increases and it was sufficient for DNA extraction.

115 Pelotons

A.

B.

Figure 3.2. Anatomy of the orchid roots, with variation in density of pelotons inside orchid cells in the roots. A. CBF 162 Goodyera oblongifolia: many pelotons can be recognized in this slide, B. CBF 162 Goodyera oblongifolia: no pelotons are recognized in this slide 116 3.3.2. DNA analysis of fungal associations with species within Goodyera section Goodyera in Indonesia

From approximately 15 location of where species of (Java (West Java: Mt. Karang, Mt.

Pulosari, Mt. Gede-Pangrango; Central Java: Mt. Lawu; East Java: Mt. Raung, and

Cangar); Sumatra (North Sumatra: Mt. Sinabung, Villages near Toba district areas;

Jambi: Mt. Kerinci; West Sumatra: Mt. Sago, Mt. Tandikat, Mt. Marapi, and Mt.

Singgalang); and Sulawesi (South Sulawesi: Mt. Rante Mario)). There are about 100 samples, but less than 10 samples successfully provided sufficient fungal material for

DNA extraction and amplification. Only the DNA of endophytes (fungi associated with the orchids) from three species was successfully extracted, amplified, and sequenced from section Goodyera. The three orchid species from which endophytes could be studied are Goodyera reticulata subsp. reticulata (G. reticulate), G. bifida, and G. reticulata subsp. schlectendaliana (G. schlectendaliana).

In addition, successful collection and amplification was obtained for endophytes associated with samples of Hylophila montana collected from Yapen Island (West New

Guinea), and samples from Hetaria sp. and Cystorchis collected from Mt Sinabung

(North Sumatra), and Camping Ground Sibolangit (North Sumatra) respectively. To represent North American species, four samples of Goodyera oblongifolia from the section Goodyera were successfully extracted, amplified, and sequenced collected from

Washington, Oregon, and Michigan. These latter samples provide a comparison for the fungal diversity in the species of Goodyera section Goodyera (see Appendix K).

117 All fungi obtained from the plant samples are members of the Basidiomycetes or

Ascomycetes. Rhizoctonia sp. and species of Russulacea belong to phylum

Basidiomycetes. Pestalotiopsis theae, Annulohypoxylon stygium, Biscogniauxia autropunctata, and Xylaria, a species from the Xylariaceae, belong to the phylum

Ascomycetes. Pestalotiopsis theae is a pathogen of tea species and other plants.

Annulophypoxylon stygium and species of Xylaria are saprophytic species from the family Xylariaceae. These species can be pathogens and are endophytes that commonly occur in the tropical and temperate regions. Biscogniauxia autropunctata is a saprophyte and pathogen, primarily causing stems to decay. This fungus grows outside plant cells, usually on the surface of plant barks.

Three phylogenetic methods (parsimony, maximum likelihood, and Bayesian analyses) were employed in the analysis to generate cladograms of fungi, using sequences of the nuclear ribosomal ITS. Sixteen taxa, including out-group taxa were obtained to represent fungi associated with the species of orchids from the section Goodyerinae.

Approximately 400-800bp of the sequences were amplified (the size was depending on species). The data sequences are presented in Appendix K.

Of the ca. 400-800 nucleotides of sequence obtained for each species, only 163bp was used in the final analysis (because of difficulties of identifying homologous sequence positions in the alignment) and only 16 sequences were ultimately incorporated in the taxonomic analyses. The sequence alignments were very difficult to perform due to high

118 diversity between sequences. The 163bp nucleotide long final sequences were aligned based on the similarity of conserved regions and by minimizing gaps (Appendix L).

3.3.3. Results of parsimony

From 163 nucleotide characters, only 27 characters were taxonomically informative, 121 were constant, and 15 were variable, but uninformative. The ten most parsimonious trees were generated using the fungal ITS data set from 16 taxa. The fungal tree presented does not really reflect the phylogenetic tree of the fungi systematics. The generated trees were based on what sequences collected from the orchid samples. As the number of taxa is less than 20, Branch and Bound was used to search for the most parsimonious trees.

The length of the most parsimonious fungal tree was 59 steps, with a consistency index

(ci) of 0.86, a retention index (ri) of 0.93, and a homoplasy index of 0.14. For comparison with the taxonomic tree of hosts, the ITS tree from fungi is presented as a divided tree, as the host tree is too large to be presented on one page. The maximum parsimony fungal tree is compared to the orchid ITS parsimony tree. The comparison between the two trees is presented in Figure 3.3.A-B.

The fungal tree shows that the Rhizoctonia-like fungi form a paraphyletic group due to the presence of taxa assigned to the Russulaceae in the clade. In addition,

Helicobasidium purpureum is clustered together with Tuberculina persicina, which is not in the Rhizoctonia-like fungal group.

119 A.

Figure 3.3. Parsimony analyses of fungi associates of species from the section Goodyera using ITS. The bootstrap values are above and jackknife values are below the branches. The connections between the two trees show interaction between the orchids and their associated fungi.

120 Figure 3.3. continued

B.

Figure 3.3B. Parsimony analyses of fungi associates of species from the section Goodyera using ITS (first part of tree is in the previous page). The bootstrap values are above and jackknife values are below the branches. The connections between the two trees show interaction between the orchids and their associated fungi. 121 Both Maximum Likelihood and Bayesian trees show similar relationships of the orchid- fungal association. Therefore no trees from the two methods are presented in this section.

3.4. Discussion

The analysis of gene sequences from fungal endophytes associated with orchids did not reveal a specific interaction involving only Rhizoctonia-like fungi. In this study,

Goodyera reticulata subsp. reticulata from Java (Mt Lawu) was found to be associated with Biscogniauxia atropunctata (Family: Xylariaceae, Order: Xylariales, Class:

Sordariomycetes, Phylum: Ascomycota). This fungal species is not a member of the

Rhizoctonia-like fungus group (Phylum: Basidiomycetes). In addition, based on a blast search performed in GenBank to compare fungi collected from the roots of the orchid species and with the data based sequences available, fungal samples obtained from

Goodyera bifida from Sumatra (Gunung Tujuh, Taman National Kerinci Seblat, Jambi) were also found to be associated with Xylaria fungal species with 96% sequence similarity with the other available Xylaria sequences in GenBank. Among the orchids, samples of Hetaeria cristata, one of the outgroups for the analysis of subtribe Goodyera, were also found to be associated with the a form of Xylaria fungal species with 98% sequence similarity. Goodyera reticulata subsp. schlectendaliana was found to be associated with Annulohypoxylon stygium fungal species (Family: Japygoidea, Order:

Xylariales, Class: Ascomycetes, Phylum: Ascomycota). Samples of the fungal obtained from Hylophila montana collected from Yapen Island, Waipon forest, West New Guinea, were associated with Pestalotiopsis theae 98% sequence similarity (Family:

122 Amphisphaeriaceae, Order: Xylariales, Class: Sordariomycetes, Phylum: Ascomycetes).

In short, almost all the samples collected from Indonesia for which fungi were successfully cultured and the ITS sequence amplified, were found to be associated with fungal species from the phylum Ascomycetes. In contrast, Cystrochis stenoglossa collected from Sibolangit Camping Ground in North Sumatra, was found to be associated with Rhizoctonia sp. with 94% sequence similarity. Fungal samples obtained from

Goodyera oblongifolia from North America, collected from Michigan, Oregon, and

Washington, were found to have closest sequence similarity with sequences from

Rhizoctonia in GeneBank (maximum similarity ranges between 88-97%), and with a species of Russulaceae. Both of these fungal taxa belong to Phylum Basidiomycetes, but

Russulaceae is not classified as a species of Rhizoctonia-like fungi.

It should be noted that Russulaceae has been recognized as being endophytic (Dearnaley

2006), and that species of Russulaceae have also been known to be associated with other orchid species, such as Dipodium variegatum (Dearnaley 2006). Therefore, the association of orchids with fungi other than Rhizoctonia-like fungi is not uncommon.

Although Goodyera oblongifolia does not show a strong specificity toward associations with particular species of fungi, there is a general interaction with Basidiomycetes compared to fungal species obtained from orchid species collected from the tropics that have more diverse fungi to associate with.

Research conducted in Thailand by Worapong et al. (2003) showed that Pestalotiopsis theae (a species of Sordiomycetes) occurred in the cambium of the tea plants. This

123 fungus was recognized as a pathogen of Thea sinensis (tea plant) and other plants

(Worapong et al. 2003). Therefore there is a possibility that ectomycorhiza might be capable of switching to become endophytes. In addition, species that exist in tropical rainforests undergo strong competition for light and nutrients. The soil where they grow is clay soil. Also these areas have a high level of rainfall. McCormick et al. (2006) suggested that under difficult conditions it is possible for an orchid species to switch from one endophyte to a different species of fungus. Therefore, it is not too surprising to find that orchid species in Indonesia may associate not only with Rhizoctonia, but also with other available fungi from their environments.

Further research is needed to examine whether Goodyera oblongfolia will allow switching to a different partner to survive.

3.5. Conclusion

The comparative pattern of phylogenetic divergence of host species within the section

Goodyera and of their fungal associates does not show congruence. The species of orchids within the section Goodyera from Indonesia appear to be capable of using any of several available endophytes from the environment. The hypothesis that the orchids exclusively associate with Rhizoctonia-like fungi cannot be supported by these results.

The orchid species from the section Goodyera from Indonesia and its relatives are also capable of showing associations with other groups within the Ascomycetes and

Basidiomycetes. It is possible that host switching to other fungi occurs for survival, or

124 these orchids might be promiscuous to any fungi available in the environment. Further work is needed to distinguish which of these alternatives is correct.

Tropical orchids appear to have a more diverse fungal association than temperate orchids.

The temperate form Goodyera oblongifolia is restricted in association to only

Rhizoctonia-like groups and species of Russulaceae, in contrast to tropical species of

Goodyera that have broader association with Ascomycetes and Basidiomycetes. The association between plant and fungal endophyte in the tropics appeared to be more general than in the temperate regions. The implication of these results is that orchids from the tropics do not have to conserve a specific interaction because, if there is a change in the environment, orchids that interact with many fungi may be able to switch fungi to enhance survival. This contrasts with temperate orchids that have a more specific associations (but not necessarily a one on one association) that must be conserved. If the environment for temperate orchids changes, they would presumably be less able to seek alternative associations which would enhance survival.

125 Chapter 4: Multivariate Analysis of Goodyera section Goodyera from Indonesia

4.1. Introduction

4.1.1 Goodyera section Goodyera from Indonesia

Goodyera section Goodyera is the most complex group in the genus Goodyera. This is due to the high diversity found in their floral and vegetative morphological forms. The section Goodyera has been controversial among taxonomists, because of a lack of consensus concerning the recognition of its key characters (Schlechter 1911, Cribb and

Whistler 1996, Lewis and Cribb 1989, Lewis and Cribb 1991). The key character that defines the section is the presence of parallel or less extended lateral sepals in the section

Goodyera compared to widely spreading lateral sepals in the section Otosepalum

(Schlechter 1911). Many authors did not recognize the division of the genus into two sections, with some authors suggesting that the orientation of the lateral sepals was not important (Cribb and Whistler 1996, Lewis and Cribb 1989, Lewis and Cribb 1991). One factor contributing to this lack of consensus is the fact that there can be difficulty when using herbarium specimens in assessing whether the lateral sepals are parallel or less extended or widely spreading.

The complexity of the morphological appearance combined with the small size of the flowers of the members of the section Goodyera make this group difficult to identify 126 taxonomically. Even though some of the forms have been cultivated as indoor plants (G. schlectendaliana and G. pusilla), the species boundaries of the species within the section are still unclear. Between 1825 to 1908, new species and names were described by authors without adequate studies. For example, Schlechter (1910) in Comber (2003) recognized a new species, G. beccarii, from collections at Mt. Singgalang in western

Sumatra, even though this species closely resembles G. schlectendaliana, a form that was also included in his treatment. Comber (2003) noted that the differences of their floral morphology between these forms are almost insignificant. However, they were still defined as two different species (Comber 2003). As another example, Goodyera gemmata, G. pusilla and G. reticulata are similar to each other in their overall morphological appearances. All three species have reticulate leaf venation, and small size of flowers and plants. Without closer examination, the difference is not noticeable.

Comber (2003) noticed the similarity. However, no one has ever delimited and revised these taxonomic problems. Variation of color, size, and the rigidness of the stem also occur in G. bifida complex. The taxa identified as members of the G. bifida complex from Java and Sulawesi are the same, unlike the form of G. bifida from Sumatra. The

Sumatran form has a more fibrous and stiff stem and smaller leaves. Two color floral variants occur in Sumatra. The differences were observed in the field. Herbarium specimens cannot retain the differences. Small flowers of G. procera can be observed in herbarium specimens that show variation in the number of flowers per spike, the density of the flowers, and the size of the leaves.

127 Approximately 13 names of species within the genus Goodyera were recognized from

Indonesia and used for identification. They include Goodyera becarii, G. bifida, G. colorata, G. gibbsiae, G. foliosa, G. gemmata, G. hispida, G. procera, G. pusilla, G. reticulata, G. schlectendaliana, G. secundiflora, and G. venusta (Gibbs 1917,

Reichenbach 1849, Smith 1909, Smith 1922-1923, Fedde 1910, Linnaeus 1857, Blume

1825, 1858, Schlechter 1911). Several of these names appear to describe similar taxa, and with species names being applied based on floral differences shown either in herbarium specimens or in the field, or at the locations in which observations were made of geographic occurrence or from which specimens were collected. As the morphological features of the section were complex, a consideration of revision of the section seems to be called for as part of this study, in order to provide field guides for identification.

Although the main distribution of the various species from the section Goodyera in

Indonesia has been assumed to include all Indonesian rain forests, they are predominantly distributed in Sumatra and Java, and only a few herbarium specimens have been collected from localities in Indonesia other than Sumatra and Java. No complete taxonomic treatment had been attempted previously. This study attempts a more complete treatment, including species descriptions, identification keys, and geographic distribution of the species within section Goodyera.

128 4.1.2. Species concepts

In its simplest meaning, the term species refers simply to a definition applied to specific biological entities (Nixon and Wheeler 1990). In its biological and evolutionary context, however, the definition of species is far from simple.

Many different species concepts have been proposed (Mayden 1997) and they include concepts concerning species definitions based on the phenotypic, phylogenetic, biological, and ecological species concepts.

One of the earliest of the concepts of species was based on the morphological similarity of individuals. This ultimately formed the basis of the binomial nomenclature system of classification introduced by Carolus Linneus in the first edition of his book Systema

Naturae in 1735. Such phenotypic similarity can, in the age of modern statistical techniques, be incorporated into a concept referred to as the phenetic species concept, identified through the clustering of individuals based on multivariate statistical analysis.

The multivariate species concept ultimately defines a species as a group of organisms that have the same morphology of their organs or of their whole body (Gornall 1997). The concept focuses on the consistency of appearance of the organisms placed together in a species. When individuals belong to the same taxon, they will resemble each others

(Stuessy 1990). In statistical terms, Anderson (1990) utilized this concept by proposing that a species may represent a cluster of individuals in a multidimensional space.

The biological species concept was formulated by numerous investigators during the middle of the 20th Century, and formalized by the 1960’s when it was discussed in Ernst 129 Mayr’s book Animal Species and Evolution (1963). This earliest biological species concept defined a species as “groups of interbreeding natural populations that are reproductively isolated from other such groups”. This concept has also been called the isolation species concept (Paterson 1985; Templeton 1989). Therefore, the ability for populations to interbreed successfully can be used to argue against their recognition at the level of species under this concept. However in plants, unless the progeny find an appropriate niche in which they can survive, and then can act as a bridge to facilitate gene exchange between the parental forms, reproductive isolation still will be maintained, despite occasional hybridization events.

Paterson (1985) came up with the recognition species concept, another view of the biological species concept, in which a species is defined as the most inclusive population of individual biparental organisms, which share a common fertilization system. Paterson

(1985) accepted the basis of Mayr’s biological species concept, but he defined it in the positive sense i.e. fertilization mechanisms. The recognition and isolation species concepts differ in requiring the determination of the functioning of fertilization mechanisms and the identifying the mechanisms of isolation, respectively. Both of these variants of the original definition of the biological species concepts appear to be inappropriate for some cases where gene flow does occur between two well differentiated groups, such as occurs for many plant species. The concepts are also inapplicable to asexual species such as bacteria, or vegetatively reproducing plants (Templeton 1989,

Stuessy 1990).

130 The phylogenetic species concept was defined as the “smallest diagnosable cluster of individual organisms within which there is a parental pattern of ancestry and descendent”

(Cracraft 1983). This concept of a species is related to an organism’s evolutionary history, and to the distribution of characteristics within the organism (Baum 1992).

Species are diagnosable by a unique combination of derived character states, with all individuals within the taxon possessing those characteristic unique features (Nixon 1990).

This shows a clear relationship to the original concepts of morphological species, but depends on the ability of the taxonomist to define descendant characters. Baum (1992) states that the phylogenetic species concept is applicable to a population of organisms that has at least one unique diagnostic character (an autapomorphy). He noted that the diagnostic characteristic can be a fixed feature within one species and absent in other species. Also, the fixed characteristics should be cohesive so that male and female individuals of a species cannot be treated as members of two different species.

The ecological species concept defined a species as a “lineage (or a closely related set of lineages) which occupies an adaptive zone minimally different from that of any other lineage in its range and which evolves independently from all lineages outside its range”

(Van Valen 1976). In a specific environment condition, a group can be identified as being different from the common group of which they initially were members, because adaptation to the environmental condition has resulted in the group evolving into a new entity. Speciation occurs as a result of high adaptation to the environment (Anderson

1990). Thus, a species was formed and remains different because of different selection pressures (Anderson 1990).

131 In this present analysis, entities will be defined using a version of the phenotypic species concept. Other concepts based on the nature of gene flow in natural populations or ecology would be difficult to apply, because of the limited population genetic data available and the limited ecological data that is provided for most herbarium specimens which constitute a major portion of the material being studied.

4.2. Methods

4.2.1. Sampling strategy

Morphological variation of the species of the section Goodyera from Indonesia was studied and examined using specimens borrowed from herbariums and museums in North

America, Asia, Australia, and Europe (Bishop Museum (BISH), British Museum (BM),

Herbarium Bogoriense (BO), Australian National Herbarium (CANB), Kew Botanical

Garden Herbarium (K), Paris Herbarium (P), and Leiden University Herbarium (L)).

Eight taxonomic groups can be recognized a priori, based on their unique morphological features (Table 4.1.).

Samples were chosen arbitrarily to resemble the most complete range of morphological variation of each group. Samples were compared one to another in terms of morphological characters. Morphological variation within the group is divided into characters that can be measure as categorical (discrete) characters or continuous charaacters. I have only one collection of ‘Arfakensis’ and the specimen was used for the multivariate analyses. Eleven sample collections of ‘Bifida’ and ‘Procera’, and four and

132 five of them were used in the multivariate analyses respectively. ‘Reticulata’ has eleven specimens too, and only three used in the multivariate analyses. Fifteen of

‘Schlectendaliana’ collections were examined and four of them were used in multivariate analyses. Seven collections of ‘Pusilla’ were observed and only three were used in the multivariate analyses. Three specimens of ‘Gemmata’ were examined and only one used in the multivariate analyses. Six collections of ‘Colorata’ were observed, but only one was used (Table 4.2.).

The reason for using arbitrary sample selections is because many samples were not completed in terms of their morphological traits, and many collected herbarium specimens were sterile or came from the same place. In addition, some samples stick tidely on the herbarium papers. The method of choosing the samples is not the random technique used in statistics. However, the specimens used represented the range of the variations shown of the available herbarium specimens.

133 Table 4.1. Eight groups within Goodyera section Goodyera from Indonesia recognized a priori based on their unique morphological features.

Groups Distribution Distinct morphological features

‘Arfakensis’ Irian Jaya Leaf venation is spotted, leaves are lanceolate, the peduncle is long, flowers are small (Arfak Mt.)

‘Bifida’ Java, Sumatra, Leaf venation is absent, obliquely rhombic leaf shapes, spike of the flowers is short, the size of Sulawesi the flowers is the largest among all the groups within the section. ‘Colorata’ Java Leaf venation is parallel, leaves are lanceolate, the peduncle is long, flowers are small ‘Gemmata’ North Sumatra Leaf venation are pinkish and white, leaf shape is obliquely rhombic, flowers are small, brownish and pinkish, and labellum is rounded ‘Procera’ Java Leaf venation absent, the plant is the largest among all the species within the group, lanceolate leaf shape, and flowers are the smallest and the number of flowers are numerous. “Pusilla” West Java Leaf venation are brownish and whitish, leaf shape is lanceolate, the color of flowers light brown at the bottom to cream at the top, flowers are bell shape, and the flowers are the smallest among “Reticulata” and “Gemmata” ‘Reticulata’ Java: West and Leaf venations are white and reticulate, leaf shape is lanceolate, and the color of the flowers Central are white, flowers are small, labellum is ovate

‘Schlectendaliana’ Sumatra Leaf venation is spotted, leaves are lanceolate, the peduncle is long, flowers are about the same size as Bifida

134 Table 4.2. Specimens used for the multivariate analyses

No a priori group Island Site Collector

1 ‘Arfakensis’ Irian Jaya Mt. Arfak, Angi Lakes L.S. Gibbs 5571 2 ‘Bifida’ Java West Java; Preanger; H.J. Lam 306 Garoet; Gn. Mandalagiri (BO) Sulawesi Kab. Enrekang; L.S. Juswara, Latimojong Ranges; Mt. L.A. Craven, Rantemario and G.K. Brown, JBC 221 (BO) Sumatra Gn. Kerintji H.A.B. Bunnemeijer 9857 (BO) South Sumatra; Palembang; C.N.A. Voogd Gn. Dempo 390 (BO) 3 ‘Colorata’ Java Cianjur: Gn.. Pangrango V. Schiffner 1767 4 ‘Gemmata’ Borneo East Kalimantan

Sumatra Batang Paluepah Cultured in BO 5 ‘Procera’ Java West Java; North Hill C.A. Backer 14181 (BO) West Java; Gn. Salak C.A. Backer before Pasir Toga 9119 (BO) West Java; Boitenzorg; G. C.G.G.J.. van Halimun Steenis 12424 (L) Central Java; Baturaden; Br. Joss 53 Purwokerto Flores Z van de Rana Mese O. Posthumus 3264 (BO, L) 6 ‘Pusilla’ Java: West Java: Sukabumi: Mt. L. Juswara 35 Halimun (BO)

Continued

135 Table 4.2. continued.

No A priori group Island Site Collector

7 ‘Reticulata’ Java East JavaL Situbondo: Gn. Clason- Laarman 173 Raoeng

West Java: Tjibodas: Gn. A. Gede: Cibereum Kleinhoonte 70 (L) Central Java: Kedoe, Gn. W. van Telemojo Leeuwen Reijnvaan 194 (L) 8 ‘Schlectendaliana’ Sumatra West Sumatra: Gn. H.A.B. Malintang Bunnemeijer 3913 (BO) West Sumatra: Gn. Kerinci Pringo Armadjo 77 (BO) West Sumatra: Padang A. Ernst 841 Panjang (L) North Sumatra: Aceh, Pringo Gajah in Alos landen Atmadjo 77 (BO) North Sumatra: Aceh, C.G.G.J van Gajoladen, Losir massief, Steenis 8435 bivak, Lau Alas

136 4.2.2 – Choice of morphological characters

Information was collected for as many morphological characteristics as possible.

Morphological variation between samples from Goodyera section Goodyera that was considered to be useful for taxonomic identification was identified in characteristics of shape, size, and color of both generative and vegetative parts. Initially, data were collected for 41 morphological characteristics. However, two characters, “habit” and

“trichome in the labellum” were found to be uniform in all specimens examined, and therefore are characteristics of the genus and not useful for further analysis. The list of all characters initially showing morphological variation between specimens of Goodyera section Goodyera from Indonesia is presented in the Table 4.3.

4.2.3. Defining morphological variation within Goodyera section Goodyera

Morphological variations of Goodyera section Goodyera varied in shape, size, and color of generative and vegetative parts. Thirty-nine morphological characteristics of potential taxonomic significance were identified following examination of herbarium specimens, and these were grouped into two data types, continuous and discrete. The morphological variation covered the vegetative and generative morphological characteristics. I collected data of the morphological traits if comprising all morphological characteristics would show the clear separation. The character list of morphological variations of Goodyera section Goodyera from Indonesia is presented in the Table 4.3.

137 Table 4.3. Characters showing morphological variation within Goodyera section Goodyera from Indonesia

Characters:

1. Height (mm) 2. Diameter (mm) * 3. Leaf shape 4. Leaf length (mm) 5. Leaf width (mm) *6. Leaf length/leaf width ratio 7. Root diameter # 8. Root type 9. Leaf venation *10. Number of flowers per spike *11. The length of the spike (from the bottom of the first flower, in mm) 12. Length of the spike/number of flowers per spike 13. Floral size (mm) 14. Floral stalk (mm) *15. Labellum apex length (mm) *16. Labellum apex width (mm) 17. Labellum apex length/width ratio *18. Labellum length (mm) *19. Labellum width (mm) 20. Labellum length/ width ratio *21. Lateral sepal length (mm) *22. Lateral sepal width (mm) 23. Lateral sepal length/width ratio *24. Dorsal sepal length *25. Dorsal sepal width *26. Dorsal sepal length/width ratio *27. Lateral petal length *28. Lateral petal width 29. Lateral petal length/width ratio *30. Shape of the column *31. Column length (mm) *32.Column width (mm) 33. The spur length (mm) measured from the base of the labellum attachment *34. Labellum apex 35. Bract length (mm) 36. Bract width (mm) *37. Bract length width ratio 38. Stalk hair 39. Leaf petiole length

* = excluded from final analysis due to non-independence # = excluded from analysis because of lack of variation after removal of ‘Procera’

138 The morphological data were collected and then coded into numerical data, transformed, and standardized. Details on statistical transformations and standardization are given below. For the phenetic analysis, it was important to use only characters that showed statistical independence, to avoid over-weighting when the data were subjected to multivariate analysis or cluster analyses. Investigations were performed to determine the statistical independence of the morphological characteristics to avoid non-independence of characters when the data were subjected to cluster and multivariate analysis. This resulted in a set of 19 morphological characteristics to be used in the phenetic analyses

(see Table 4.3), and the complete data set is presented in Appendix 13 (original data sets) and appendix 14 (data coded numerically). The description of the analysis for independence resulting in the choice of the nineteen morphological characteristics is discussed in section 4.2.2. of the thesis. Further examination of the data resulted in some analyses being performed using only 18 morphological traits, and the data set is presented in Appendix 16. This occurred because it was noted that the samples represented the taxon ‘Procera’ differed uniquely from other samples for root type. ‘Procera’ was the only taxon that displays a centered root structure (Appendix 13).

To analyze the data, cluster analysis (Sneath and Sokal 1973), and non-metric multidimensional scaling (NMDS) (Kruskal 1964a and b) were employed. As part of the cluster analysis, bootstrapping was performed to evaluate the support of clusters. Finally, discriminant function analyses (DFA) for group analyses (Fisher 1936) based on the results of NMMS was used to further investigate the significance of differences between taxa.

139 4.2.4. Statistical examinations in the choice of characters of phenotypic variation between species within Goodyera section Goodyera

Cluster analysis and ordination were employed to visualize similarity and differences observed in the morphological analyses. Multivariate analyses were performed using the software package PC-ORD (McCune and Grace 2002). For each independent variable, residuals were tested for normality using a chi square test. Data that failed the test of normality were transformed to yield a normal distribution. Two transformation algorithms (log and square root) were used on the 19 independent variables. The variables were transformed by log X (or log X + 1 for variables that have null values) or

√X. The algorithm √X was used because the data are nonnegative, and the log transformation was used because of its generality in producing normally distributed data for most kinds of data following transformation. Other standardization algorithms do not satisfy the data requirements (McCune and Grace 2002). To choose which transformation results in the best-fit to normality, a quantile-quantile line (qq line) was used. Data transformation was performed on all samples because the number of samples was small and does not provide high sensitivity to deviation from normality test. Small sample size will always pass this test. The occurrence of outliers in the data was tested on the complete set of collected data. Outliers were identified as having a value that exceeded two standard deviations from the mean of the character. No outlier value was found for any of the 39 morphological traits.

Standardization of morphological traits was also implemented in the analyses to equally weight characters for multivariate analysis. A standardization method of Milligan and

140 Copper (1988) was employed, standardizing all data to have a range of 0 to 1, so that all variables have the same range. Standardization is essential to eliminate results being dominated by variables that have high values.

In summary, thirty-nine morphological features were initially scored, but only 19 morphological features were used in the final analyses. Choice of final variables was performed based on the values of the correlation coefficient (r) of the 39 characteristics, indicating whether the features were independent to each other. A coefficient correlation exceeding 0.6 was used as an arbitrary cutoff to identify pairs of characters that were highly correlated (Appendix 17). One of the two characters having in a pair having high values of the linear correlation coefficient (r) between the two traits was excluded from further analyses. In addition, on how each trait was correlated, was taken into account when making decisions on whether particular characters should be included in the further analyses.

4.2.5. Distances and Cluster Analyses

The program PC-ORD (McCune and Grace 2002) and R-program (R development for statistical computing 2005) were used for the implementation of multivariate analyses of morphological data in Goodyera section Goodyera. Multivariate distances between data samples were calculated after data were standardized. Several distances were calculated to determine the similarity between data samples and to determine whether patterns existed. These distances included Euclidean distance, Sorenson distance, and squared

Euclidean distance. The distance incorporates the concept of Pythagoras that distance

141 between samples can be represented as the square root of the squared distances of the various independent variables.

The Euclidean distance is the simplest, and one of the most commonly used and effective measures of similarity (McCune and Grace 2002). This was used as the first represention for patterns in the data.

In addition to using different distance methods, two alternative clustering procedures were used to graphically represent the similarity of samples. First, the Unweighted Pair

Groups with Arithmetic Mean (UPGMA) was used to cluster samples. At each step of a

UPGMA analysis, the two clusters having the smallest distance are combined into a higher-level cluster. The distance between any two clusters A and B is taken to be the average of all distances between pairs of objects "x" in A and "y" in B, that is, the mean distance between elements of each cluster. This method has been found to best reflect the similarity matrix as measured by several criteria, including the co-multivariate correlation coefficient of Sokal and Rohlf (1962), the symmetrical hierarchical structure obtained by averaging two distances (McNeill 1979), and by its congruence with classifications derived by traditional methods (Ward 1993). A second clustering method, which was examined, was the Ward linkage method. The linkage function specifying the distance between two clusters is computed as the increase in the "error sum of squares" (ESS) after fusing two clusters into a single cluster. Ward's Method seeks to choose the successive clustering steps so as to minimize the increase in ESS at each step.

142 To test the robustness of any patterns observed in the data, analyses from various combinations of distance and clustering method were conducted results from different combinations were then compared to determine whether the eight putative a priori taxa within Goodyera section Goodyera consistently formed independent clusters (McCune and Grace 2002).

4.2.6. Ordination (Nonmetric Multidimensional Scaling)

Ordination, in the strict sense of multivariate analysis, is a tool for condensing a complex data set consisting of multiple morphological entities forming a taxon into a low number of dimensions (resulting in a summary of the morphological entities). Ordination analyses were performed using non-metric multidimensional scaling because these analyses are known to display the similarity of sample units with minor information loss due to the iterative nature of the technique, which reduces the discrepancy between the input and the output (Kruskal 1964a). NMDS is the optimal method for displaying OTUs in relation to their morphological variation. The method can preserve dissimilarity because it is less affected by skewness of the data, is less affected by sampling error

(Anderson 1971, Chandler and Crisp 1998), and is dependent only on the biological uniqueness of the data (Prentice 1977). Also, NMDS is one of the most powerful ordination methods available to display sample units in a low number of dimensions, because this method has few assumptions about the data. It has great flexibility for displaying the sample units in space (Crips and Chandler 1998).

143 The discrepancy between the experimental data and the configuration in the space is called “stress” (Kruskal 1964a, b). The lowest stress value determines which dimension provides the best resolution for displaying the OTUs in the space. The stress values are categorized into five classes. They are: 0% is perfect, 2.5 % is excellent, 5% is good,

10% is fair, and 20% is poor (Kruskal 1964a).

I used PC-CORD (McCune and Grace 2002) to analyze the set of morphological data.

Three distances (Euclidean, Sorenson, and Square Euclidean distance) were employed in

NMDS. These three are the most commonly used in studies of systematic and community ecology. The results of the analyses (Points x, y, z) were plotted in two or three dimensions.

4.2.7. Test of grouping (Discriminant Function Analysis)

As NMDS can only shows the distribution of the data in low dimensions (two or three) without giving statistic numbers to show a support to the a priori groups, so a further analysis was conducted. Discriminant Function Analysis (DFA) (Fisher 1936) was employed to test the probability of accepting the hypothesis concerning the a priori identification of group membership. The idea of the discriminant function analyses is that two populations/groups or more are discriminated using multiple measurements that are best characterized the populations/groups (Fisher 1936). I run the DFA analyses in

R-program (R development core team 2005).

There were initially 19 morphological characters obtained from 23 OTUs (operational taxonomic units) to display in the ordination. The 23 OTUs were categorized into eight 144 groups as the a priori hypothesis. Initially, five prior groups were tested and plotted using discriminate function analysis and the canonical analysis (ordination). Three groups were excluded from the initial analysis, because they were represented by only one sample unit. This makes it difficult to incorporate these groups into this analysis.

The five groups were evaluated with respect to the probability that they are independent of each other, based on the value of the posterior probability. Essentially, we were testing whether they were significantly different from each other. Groups with single sample units were combined into a single complex group, and then this complex group was included for comparison with the groups formed by the initial analysis, to determine how probable it was the complex group was similar are similar to any of the other five groups.

Initially an analysis using non-metric multidimenesional scaling (NMDS) was performed because the number of morphological characters (independent variables, x(s)) used was similar to the number of sample units (OTUs). It was desirable to incorporate as many morphological characters as possible, and determine whether the OTU groupings could be recognized as independent groups. The general rule for using discriminant function analysis (DFA) is that the sample size should have a ratio of 20 samples for each independent variable. However, the minimum number suggested can be as low as five samples for each independent variable (Hair et al. 2005). Therefore, DFA cannot be performed adequately from a data matrix of 19 morphological characters and 23 sample units. To accomplish a goal for the phenotypic analysis of using as many morphological

145 characters as possible, a two-step analyses was followed: first NMDS, then followed by

DFA.

Cross validation function in DFA used in R program is to calculate how accurate the observed values (a priori groups) relative to the predicted values (the posterior probability). Cross validation function was performed by taking out one of the data each time randomly at a high number of repeats (R development core team 2005). The higher the numbers show the high support to the a-priori groups.

The NMDS analysis was performed to summarize the independent variables into locations in space in two or three dimensions, in order to satisfy the DFA assumption concerning the ratio between the number of independent characters and sample numbers.

The position in space of the points representing the sample units, as determined by

NMDS, was used in the DFA in the further analyses.

Additional analyses were performed with a reduced data set including 18 taxa and 18 morphological characteristics. These analyses excluded ‘root type’ from the list of characters, because all individuals in ‘Procera’ have roots emerging from the center of the plant. Individuals classified a priori as belonging within ‘Procera’ were excluded from the analysis to avoid any bias affecting distances separating other taxa due to the large differences that were found to exist between ‘Procera’ and the other taxa.

146 4.3. Results

4.3.1. Cluster analyses: UPGMA

Two data sets of morphological characters (a full data set and partial data set that excluded taxa identified as ‘Procera’ from the full data set) (appendices 12 and 13) were analyzed by cluster analysis, investigating the effects of applying several different combinations of distances and linkage methods. Using 19 morphological characters and

23 taxa, five groups of taxa can be recognized in the analyses, which used either a combination of Euclidean distance with UPGMA clustering (E-U, Figure 4.1), or

Euclidean distance with Ward clustering (E-W, Figure 4.2). Four groups were seen when the combination of Sorensen distance with UPGMA clustering was used (S-U, Figure

4.3). The five groups recognized by the first two combinations of methods (E-U and E-

W) showed ca. 53% and 30% of the maximum distance respectively. The final combination of methods, (S-U), generating only four distinct groups showed at about

65% of the maximum distance (Figure 4.3).

The five groups recognized by E-U and E-W, were ‘Procera’, ‘Bifida’,

‘Schlectendaliana’, ‘Colorata-Gemmata’, and ‘Arfakensis-Pusilla-Reticulata’. At 65% maximum distance, Sorensen-UPGMA (S-U) did indicate a significant difference between ‘Bifida’ and ‘Schlectendaliana’, in contrast to the other two combinations of methods (E-U and E-W). Therefore, S-U recognized only the clusters of ‘Procera’,

‘Bifida-Schlectendaliana’, ‘Gemmata-Colorata’, and ‘Arfakensis-Pusilla-Reticulata’.

147 Figure 4.1. Cluster analysis of full data (19 morphological characteristics and 23 taxa) set using Euclidean distance and UPGMA linkage method.

148 Figure 4.2. Cluster analysis of full data set (19 morphological characteristics and 23 taxa) using Euclidean distance and Ward linkage method.

149 Figure 4.3. Cluster analysis of full data sets (19 morphological characteristics and 23 taxa) using Sorensen distance and UPGMA linkage method.

150 Further, bootstrapping was performed for the three combinations of distance and clustering method, with 10000 iterations, and for the two alternative data sets (full data sets and data that exclude ‘Procera’) (Figure 4.1. to 4.6.). The combination of Euclidean distance and UPGMA clustering showed that the samples classified as ‘Procera’ form a unique cluster in 98% of the analyses. The two samples ‘Colorate-Gemmata’ formed a unique cluster in 90% of bootstrap replicates. The unique identification of clusters for the other taxa occurred at lower levels. The unique clustering of the four ‘Bifida’ samples compared to the remaining taxa occurred in only 52% of bootstrap replicates in this analysis. The existence of unique clusters of the remaining taxa, ‘Schlectendaliana’,

‘Reticulata’, ‘Pusilla’, and ‘Arfakensis’, is not supported by majority bootstrap values.

The alternative two combinations of distance and clustering method were examined to see whether the results obtained using the Euclidean-UPGMA clustering approach was robust. The combination of Euclidean distance and Ward clustering method (E-W) showed similar patterns to those found by E-U. The clustering of ‘Procera’ uniquely from the rest of the group was supported by 98% bootstrap support. ‘Colorata-Gemmata’ was recognized as being as a unique cluster with 90% bootstrap support. Similarly to the findings with E-U, a unique cluster of the ‘Bifida’ taxa was supported, barely by a 52% bootstrap value. The existence of ‘Schlectendaliana’, ‘Reticulata’, ‘Pusilla’, and

‘Arfakensis’ clusters failed to receive bootstrap support greater than 50%.

Similar results from bootstrapping were obtained for the analysis performed with

Sorenson distance combined with UPGMA clustering (S-U). The ‘Procera’ cluster found

98% bootstrap support, whereas the ‘Colorata-Gemmata’ cluster was supported by an

151 81% bootstrap value. The support for ‘Bifida’ as a coherent group was greater than observed in other methods of analysis, showing the occurrence of the cluster in 70% of bootstrap replicates. In contrast to the other methods of analysis, the ‘Schlectendaliana’ taxa were also found to form a unique cluster, occurring in 66% of bootstrap replicates.

Because ‘Procera’ is shown to be clearly outside of the diversity represented by other taxa of this study, an alternative analysis was performed removing the samples of

‘Procera” from the dataset to be examined using cluster analysis. As previously noted, this also reduced the number of characters by one. By removal of the samples of

‘Procera’, it was hoped that more subtle patterns which are present in the distribution of other taxa, but obscured because of the presence of ‘Procera’ might be observed.

The second analysis, using a combination of Euclidean distance with UPGMA clustering and excluding ‘Procera’, showed that ‘Bifida’ and ‘Schlectendaliana form a single cluster at 75% maximum distance in the analysis (Figure 4.4). The E-U analysis showed the existence of a unique ‘Colorata-Gemmata’ cluster, separate from the remaining groups, supported by an 89% bootstrap value. The existence of a unique grouping of the four samples of ‘Bifida’ is not supported, since the ‘Bifida’ samples do not form a single cluster, having one sample (‘Bifida1’, see Figure 4.4) separated from the remaining

‘Bifida’ taxa by the presence of the cluster of ‘Schlectendaliana’ samples with 52% bootstrap support including ‘Schlectendaliana.’ The cluster in Figure 4.4 showed that the members of ‘Bifida’ were not in a cluster. The other groups that were identified a priori do not show significant support as unique groups in this analysis.

152 Figure 4.4. Cluster analysis of 18 morphological characteristics and 18 taxa (‘Procera’ is excluded from the analysis) using an analysis with Euclidean distance and UPGMA linkage method (EU).

153 Figure 4.5. Cluster analysis of 18 morphological characteristics and 18 taxa (‘Procera’ is excluded from the analysis) using an analysis with Euclidean distance and Ward linkage method (EW).

154 Figure 4.6. Cluster analysis of 18 morphological characteristics and 18 taxa (‘Procera’ is excluded from the analysis) using Sorenson distance and UPGMA (SU).

155 To examine the robustness of the E-U analysis, additional studies using the two alternative distance-linkage approaches were performed. The combination of Euclidean distance with Ward clustering (E-W) showed results similar to that seen using EU. The cluster of ‘Colorata-Gemmata’ was identified as unique, compared to the remaining samples, having 90% bootstrap support. Unlike E-U, the samples of ‘Bifida’ are identified as being part of a single unique cluster supported by a 53% bootstrap value.

Samples of the remaining a priori defined taxa do not appear within unique recognized clusters having majority bootstrap support (Figure 4.5).

A final comparison of the E-U results was performed employing the combination of

Sorenson distance with UPGMA (S-U) (Figure 4.6). In this analysis, the existence of a comprehensive cluster of all samples of ‘Bifida’, is supported by a 70% bootstrap value.

The samples of ‘Schlectendaliana’ also appear as a unique cluster, with a 66% bootstrap value. Samples of ‘Colorata-Gemmata’ continue to exist as a distinct cluster, being distinguished from the rest of the groups by an 80% bootstrap value. The remaining prior recognized groups do not form clusters supported by bootstrap values above 50% (Figure

4.6).

4.6.2. Non-Metric Multidimensional Scaling and Discriminant Function Analysis

Ordination analysis, using the method of Non-Metric Multidimensional Scaling (NMDS) was employed to study the distribution in space of the 23 morphological OTUs. Results of NMDS will then be used in Discriminant Function Analysis (DFA) to determine the significance of morphological differences between clusters of OTUs. In the analysis using NMDS, the robustness of the results was investigated by performing alternative 156 studies employing three different distance measures, to determine whether these transformations resulted in a similar or different pattern(s) of distribution of the OTUs in space. As was done in the studies summarized for the cluster analysis, above, two different data sets (a full data set and a set of data that excluded samples from “Procera” from the analyses) were analyzed.

The best resolution by NMDS incorporating Euclidean (Figure 4.7) using the full data set resulted in the distribution of OTUs over three dimensions. The distribution of OTUs can be seen first as a full three-dimensional NMDS (Figure 4.7A). The distribution of OTUs in space can then be examined by viewing the scatter of points separately from different angles of two dimensions, Axes 1-2, 1-3, and 2-3 (Figures 4.7B, 4.7C and 4.7D, respectively).

Examination of the distribution of taxa in these plots shows that the samples of ‘Procera’ are well separated from other OUT’s along axis 1, while the four samples of ‘Bifida’ show separation along axis 2. ‘Schlectendaliana’ shows separation from other taxa on axis 3, while a group of OTUs included in the taxa ‘Arfakensis’, ‘Reticulata’ and

‘Pusilla’ are found closely associated in axis 3.

NMDS using Euclidean distance showed that the taxa of ‘Procera’ were distinctly different from the rest of the groups. Three of the ‘Bifida’ samples could be differentiated easily from other groups. However, one ‘Bifida’ taxon, ‘Bifida 4’, was consistently placed close to other groups, with the distance separating ‘Bifida 4’ from

‘Bifida’ or from some other groups being relatively the same. This result is also seen in

157 the subsequent NMDS analyses using alternative distances (squared root and Sorenson distances).

NMDS performed on data where OTUs are related to each other using squared distances, using the full data set, also resulted three dimensions as the best resolution (Figure 4.8).

Again, as was found with the analysis using Euclidean distances, the taxa assigned to

‘Procera’ and ‘Bifida’ show the best resolution from other taxa on different axes (axis 1 for ‘Procera; axis 2 for ‘Bifida’). The separation of samples of ‘Schlectendaliana’ from other OTUs does not seem as obvious as was found for relationships using Euclidean distances. For squared root distances, ‘Arfakensis’ appears more separated from

‘Reticulata’ and ‘Pusilla’ than occurred with Euclidean distances.

When the Sorensen distance is used to relate OTUs, the best resolution obtained from

NMDS analysis was found when only a two dimensional representation was determined

(Figure 4.9.). The taxa from ‘Procera’ were well separated from other taxa. Other taxa however, show little statistical separation for this distance measurement, and it does not appear to be as useful as the other two methods of representing distances.

158 A.

Figure 4.7. NMDS analyses of taxa separated by Euclidean distances. The dataset consisted of 19 morphological characters and 23 taxa. A. Three dimensional NMDS analysis of taxa separated by Euclidean distances. The stress value for the three dimensional analysis is 5.7%; B. Two dimensional representation of the NMDS analysis of taxa separated by Euclidean distances when the taxa were observed from Axis 3. The size of the triangles shows the distance of points from the axes 1 and 2; C. Two dimensional representation of the NMDS analysis of taxa separated by Euclidean distances when the taxa were observed from Axis 2. The size of the triangles shows the distance of points from the axes 1 and 3; D. Two dimensional representation of the NMDS analysis of taxa separated by Euclidean distances when the taxa were observed from Axis 1. The size of the triangles shows the distance of the points from axes 2 and 3.

159 Figure 4.7. continued

Figure 4.7B

160 Figure 4.7. continued

Figure 4.7C.

161 Figure 4.7. continued

Figure 4.7D.

.

162 A.

Figure 4.8. NMDS analyses of taxa separated by squared root distances. The dataset consisted of 19 morphological characters and 23 taxa. A. Three dimensional NMDS analysis of taxa separated by squared root distances. The stress value of the three dimensions is 5.6%; B. Two-dimensional representation of the NMDS analysis of taxa separated by Squared root distances when the taxa were observed from Axis 3. The size of the triangles shows the distance of the points from the axis 1 and 2; C. Two-dimensional representation of the NMDS analysis of taxa separated by squared root distances when the taxa were observed from Axis 2. The size of the triangles shows the distances of points from axes 1 and 3; D. Two-dimensional representation of the NMDS analysis of taxa separated by squared root distances when the taxa were observed from Axis 1. The size of the triangles shows the distance of points from axes 2 and 3.

163 Figure 4.8B. .

164 Figure 4.8C. .

165 Figure 4.8D. .

166 Figure 4.9. Two-dimensional representation of the NMDS analysis of taxa separated by Sorenson distances, the stress value for the two dimensions was 10.3%. The size of the triangles shows the distance of the points from axes 1 and 2.

167 The best resolution obtained from NMDS analysis using Sorensen distance was only two dimensions (Figure 4.9.). The taxa from ‘Procera’ were well separated from other taxa.

Other taxa, however show little separation in the dimensions.

As ‘Procera’ might make the separation not very distinct within closely related taxa, the exclusion of ‘Procera’ from the full data set did not improve to the separation of other taxa priori recognized using a few morphological characteristics. It only scattered the taxa further apart from each other. Three distances using data that excluded ‘Procera’ were used in NMDS (Figures 4.10, 4.11, 4.12).

The data set without G. procera using Euclidean and squared root distances resulted in a similar distribution of OTUs. The analysis using the Sorensen distance produced a different distribution of OTUs in the dimensions. The two distances (Euclidean and squared root distance) showed the lowest stress value in two dimensions, while the lowest stress value obtained from the Sorenson distance was in three dimensions. The lowest stress value shows the best resolution of the data on the dimensions (Kruskal 1964a, b).

When the measurements for G. procera are excluded from the analysis, results obtained using Euclidean distance or squared root distance showed similar patterns in the distribution of OTUs that found in the complete analysis. The analysis using the

Sorensen distance produced a different distribution of the OTUs over the three dimensions.

168 Figure 4.10. Representation of the relationships between taxa separated by Euclidean distance for NMDS, when applied to the data set in which samples of ‘Procera’ were excluded. The dataset consisted of 18 morphological characters and 19 taxa. The size of the triangles shows the distance of the points from the axes 1 and 2. Stress value was 10.6%.

169 Figure 4.11. Representation of the relationships between taxa separated by squared root distance for NMDS, when applied to the data set in which samples of ‘Procera’ were excluded. The dataset consisted of 18 morphological characters and 19 taxa. The size of the triangles shows the distance of the points from the axes 1 and 2. Stress value was 10.6%.

170 A

Figure 4.12. A. Three dimensional NMDS analysis of taxa separated by Sorenson distances. The dataset consisted of 18 morphological characters and 19 taxa. Stress value was 6.4%; B. Two dimensional representation of the NMDS analysis of taxa separated by Sorenson distances when the taxa were observed from Axis 3. The size of the triangles shows the distance of the points from the axes 1 and 2; C. Two dimensional representation of the NMDS analysis of taxa separated by Sorenson distances when the taxa were observed from Axis 2. The size of the triangles shows the distance of the points from the axes 1 and 3; D. Two-dimensional representation of the NMDS analysis of taxa separated by Sorenson distances when the taxa were observed from Axis 1. The size of the triangles shows the distance of the points relative to the axes 2 and 3.

171 Figure 4.12B.

172 Figure 4.12C.

173 Figure 4.12D

174 By comparing all three distance measures as studied using NMDS, it was found that

Euclidean distance and squared root distances showed the lowest stress value when data were expressed in two dimensions, while the lowest stress value obtained from the

Sorenson distance occurred when data were examined in three dimensions.

As the resolution of NMDS can be arbitrary based on the a priori groups. The results from the NMDS cannot conclude that the a priori groups are supported. The NMDS output provided sample score to map all OTUs in a two or three-dimensional space using any of three different distances (Tables 4.4, 4.5, and 4.6). These values were then used as the input data sets for a Discriminant Function Analysis (DFA) (Tables 4.7, 4.8, and

4.19), to determine whether the OTUs showed significant clustering, and to identify how much of the variation between taxa could be explained by the morphological variation collapsed into a small number of dimensions. The reason for using the output of the

NMDS as input for Discriminant Function Analysis is to reduce the number of input variables for DFA. Without such collapsing of dimensions, the number of OTUs was greater than the number of independent variables.

175 Table 4.4. Sample scores from the NMDS when using Euclidean distance for the full data sets of taxa and variables. These values are used for the subsequent Discriminant Function Analysis (DFA). The values are those determined when the stress value from NMDS was 5.7%. Sample scores are positions of the data in the axes where data need to be mapped.

======No Name X1 X2 X3 y ======1 Reticulata 0.48509 0.12843 -1.14857 1 2 Reticulata 0.33862 0.15635 -0.56707 1 3 Reticulata 0.07254 0.06273 -0.59479 1 4 Pussila1 0.45258 0.40182 -0.72592 2 5 Pussila2 0.70155 0.13910 -0.53526 2 6 Pussila3 0.53979 0.38015 -0.63042 2 7 Procera1 -1.32878 0.10128 0.27703 3 8 Procera2 -1.55424 0.05850 0.04504 3 9 Procera3 -1.27246 0.17009 -0.07563 3 10 Procera4 -1.14057 0.14391 -0.06463 3 11 Procera5 -1.43533 -0.20399 -0.20399 3 12 Bifida1 0.44045 -0.98726 0.34419 4 13 Bifida2 -0.00780 -0.93189 0.24400 4 14 Bifida3 0.26581 -0.90485 0.01581 4 15 Bifida4 0.20116 -0.46545 0.10696 4 16 Schlectendaliana1 0.36404 -0.03011 0.90994 5 17 Schlectendaliana2 0.59417 0.18349 0.82451 5 18 Schlectendaliana3 0.65735 0.08130 0.41475 5 19 Schlectendaliana4 0.66870 -0.08814 0.47950 5 20 Schlectendaliana5 0.32058 -0.02532 0.55950 5 21 Colorata 0.34862 0.59805 0.23359 0 22 Arfakensis 0.05043 0.10449 -0.31960 0 23 Gemata 0.23769 0.92729 0.21555 0 ======x: axes y: a priori groups ======

176 Table 4.5. Sample scores from the NMDS when using squared root distance for the full data sets of taxa and variables. These values are used for the subsequent discriminant function analysis (DFA). The values are those determined when the stress value from NMDS was 5.6%. Sample scores are positions of the data in the axes where data need to be mapped.

======NoName X1 X2 X3 y ======1 Reticulata 0.4851 0.1284 0.1284 1 2 Reticulata 0.3386 0.1563 -0.5671 1 3 Reticulata 0.0725 0.0627 -0.5948 1 4 Pussila1 0.4526 0.4018 -0.7259 2 5 Pussila2 0.7016 0.1391 -0.5353 2 6 Pussila3 0.5398 0.3802 -0.6304 2 7 Procera1 -1.3288 0.1013 0.2770 3 8 Procera2 -1.5542 0.0585 0.0450 3 9 Procera3 -1.2725 0.1701 -0.0756 3 10 Procera4 -1.1406 0.1439 -0.0646 3 11 Procera5 -1.4353 -0.2040 -0.0085 3 12 Bifida1 0.4405 -0.9873 0.3442 4 13 Bifida2 -0.0078 -0.9319 0.2440 4 14 Bifida3 0.2658 -0.9048 0.0158 4 15 Bifida4 0.2012 -0.4654 0.1070 4 16 schlectendaliana1 0.3640 -0.0301 0.9099 5 17 schlectendaliana2 0.5942 0.1835 0.8245 5 18 schlectendaliana3 0.6574 0.0813 0.0813 5 19 schlectendaliana4 0.6687 -0.0881 0.4795 5 20 schlectendaliana5 0.3206 -0.0253 0.5595 5 21 colorata 0.3486 0.5980 0.2336 0 22 Arfakensis 0.0504 0.1045 -0.3196 0 23 Gemata 0.2377 0.9273 0.2155 0 ======x: axes y: a priori groups ======

177 Table 4.6. Sample scores from the NMDS when using the Sorenson distance for the full data sets of taxa and variables. These values are used for the subsequent Discriminant function analysis (DFA). The values are those determined when the stress value from NMDS was 10.3%. Sample scores are positions of the data in the axes where data need to be mapped.

======NoName X1 X2 y ======1 Reticulata -0.91224 -0.71111 1 2 Reticulata -0.30170 -0.63426 1 3 Reticulata -0.54191 -0.23217 1 4 Pussila1 -0.57958 -0.93731 2 5 Pussila2 -0.60950 -1.17211 2 6 Pussila3 -0.44364 -1.08485 2 7 Procera1 0.27638 1.50091 3 8 Procera2 -0.07617 1.60702 3 9 Procera3 -0.31907 1.51050 3 10 Procera4 -0.30880 1.34129 3 11 Procera5 0.05359 1.55987 3 12 Bifida1 0.24385 0.14093 4 13 Bifida2 0.11953 0.22896 4 14 Bifida3 0.05624 0.18562 4 15 Bifida4 -0.01661 -0.04359 4 16 Schlectendaliana1 0.58685 -0.08114 5 17 Schlectendaliana2 0.93279 -0.32188 5 18 Schlectendaliana3 0.28828 -0.55869 5 19 Schlectendaliana4 0.24042 -0.27591 5 20 Schlectendaliana5 0.37681 -0.07971 5 21 Colorata 0.53195 -0.92708 6 22 Arfakensis -0.44795 -0.29965 6 23 Gemata 0.85049 -0.71566 6 ======x: axes y: a priori groups ======

178 Results of the Discriminant Function Analysis are presented in Tables 4.7-4.9. The DFA results based on input from the results of the NMDS Euclidean distance analysis indicated that the existence of significant clusters of samples representing the groups

‘Procera,’ ‘Bifida,’ and ‘Schlectendaliana’ were well supported based on the cross validation method (Table 4.7). Each individual sample assigned to ‘Procera’ placed within that group with 100% posterior probability (Table 4.7). The individuals in

‘Bifida’ and ‘Schlectendaliana’ had 70-100% posterior probability. However, the boundary between the OTUs defined a priori as belonging to ‘Pusilla’ and ‘Reticulata’ is unclear. This is because one of the taxa, ‘Reticulata-2’, recognized a priori as a member of the group ‘Reticulata’, has about an equal values of posterior probability, and

‘Reticulata-1’ is more like being place in ‘Pusilla’ than in ‘Reticulata’. Similar to the lack of clear definition between ‘Reticulata’ and ‘Pusilla,’ the remaining three taxa,

‘Colorata’, ‘Arfakensis,’ and ‘Gemmata’, do not show clear separation from at least some of the posterior groups being identified. ‘Colorata’ showed a 69% posterior probability of being place in the a prior group identified as ‘Schlectendaliana.’ ‘Arfakensis’ showed a 93% posterior probability of being included with the prior group to which a priori samples of ‘Reticulata’ were assigned. Lastly, ‘Gemmata’ showed 99% posterior probability of being included with the a priori group to which taxa identified as ‘Pusilla’ were assigned. In summary, only the OTUs assigned a priori to ‘Procera’ and ‘Bifida’ could be identified as distinct from other groups included in the analysis.

179 Table 4.7. Posterior probability of groups defined a priori using input results from the NMDS based on separation of taxa by Euclidean distances.

======A Priori groups ------NoApriorGroup 1 2 3 4 5 PP ======1 Reticulata1(1) 2.31e-01 7.69e-01 9.89e-33 1.14e-19 9.14e-23 2 2 Reticulata2(1) 4.03e-01 5.97e-01 2.71e-20 2.14e-11 2.87e-10 2 3 Reticulata3(1) 9.53e-01 4.69e-02 5.56e-17 2.69e-10 9.46e-11 1 4 Pusilla1(2) 4.13e-01 5.87e-01 4.57e-24 4.10e-18 1.21e-12 2 5 Pusilla2(2) 2.00e-01 7.10e-01 1.07e-31 3.31e-11 1.83e-06 2 6 Pusilla3(2) 8.16e-02 9.18e-01 8.33e-26 2.95e-16 4.57e-10 2 7 Procera1(3) 1.57e-20 6.64e-26 1.00e+00 5.47e-27 2.94e-30 3 8 Procera2(3) 2.50e-28 1.50e-36 1.00e+00 1.38e-37 1.08e-43 3 9 Procera3(3) 1.02e-18 7.72e-25 1.00e+00 1.25e-29 1.94e-32 3 10Procera4(3) 2.79e-17 8.67e-24 1.00e+00 2.88e-26 1.98e-30 3 11Procera5(3) 8.92e-22 1.04e-31 1.00e+00 2.31e-27 4.58e-43 3 12Bifida1(4) 9.40e-25 7.44e-24 5.77e-60 9.10e-01 6.02e-08 4 13Bifida2(4) 4.23e-15 4.08e-19 1.13e-25 1.00e+00 8.60e-12 4 14Bifida3(4) 1.01e-12 4.63e-15 3.04e-30 1.00e+00 6.64e-11 4 15Bifida4(4) 1.40e-07 3.08e-10 4.10e-24 9.71e-01 2.85e-02 4 16 Schlectendaliana1 (5) 1.08e-17 3.81e-15 5.65e-32 1.74e-08 1.00e+00 5 17 Schlectendaliana2 (5) 6.90e-18 1.19e-12 1.38e-40 1.06e-14 1.00e+00 5 18 Schlectendaliana3 (5) 1.25e-10 1.46e-07 1.13e-34 7.72e-09 9.99e-01 5 19 Schlectendaliana4 (5) 1.11e-11 8.50e-09 1.95e-37 6.59e-07 9.99e-01 5 20 Schlectendaliana5 (5) 2.37e-10 3.43e-08 7.34e-31 1.54e-06 9.99e-01 5 ======A Priori groups ------NoPriorGroups 1 2 3 4 5 PP ======21Colorata(0) 2.16e-4 3.05e-1 7.21e-23 9.09e-15 6.94e-01 5 22Arfakensis(0) 9.31e-1 6.91e-2 4.29e-14 1.56e-09 5.14e-08 1 23Gemmata(0) 2.36e-4 9.93e-1 6.29e-20 5.28e-21 7.07e-03 2 ======PP: posterior probability ======

180 Table 4.8. Posterior probability of groups defined a priori using input results from the NMDS based on separation of taxa by Sorenson distance.

======A priori groups ------NoPriorGroups 1 2 3 4 5 PP ======1 Reticulata1(1) 6.56e-01 3.44e-01 5.99e-43 5.12e-09 3.92e-09 1 2 Reticulata2(1) 4.78e-01 4.93e-01 7.61e-39 4.85e-04 2.83e-02 2 3 Reticulata3(1) 5.07e-01 4.53e-07 1.35e-32 4.87e-01 6.56e-03 1 4 Pusilla1(2) 7.12e-02 9.29e-01 5.24e-49 1.06e-09 2.05e-06 2 5 Pusilla2(2) 5.74e-04 9.99e-01 1.76e-57 4.75e-14 2.78e-09 2 6 Pusilla3(2) 1.86e-03 9.98e-01 1.85e-52 1.09e-11 3.86e-07 2 7 Procera(3) 3.46e-31 7.49e-50 1.00e+00 1.33e-14 9.24e-27 3 8 Procera2(3) 1.06e-36 1.10e-57 1.00e+00 7.97e-20 4.56e-34 3 9 Procera3(3) 7.73e-33 8.03e-53 1.00e+00 1.62e-18 3.65e-33 3 10Procera4(3) 2.81e-29 1.08e-48 1.00e+00 1.58e-14 2.09e-27 3 11Procera5(3) 4.24e-34 8.70e-54 1.00e+00 1.78e-17 2.40e-30 3 12Bifida1(4) 1.46e-05 2.66e-12 4.16e-17 9.75e-01 2.50e-02 4 13Bifida2(4) 6.31e-06 5.50e-14 6.97e-15 9.98e-01 1.52e-03 4 14Bifida3(4) 3.074e-05 7.87e-13 2.47e-15 9.98e-01 1.71e-03 4 15Bifida4(4) 4.62e-03 2.46e-09 1.84e-21 9.28e-01 6.75e-02 4 16 Schlectendaliana1 (5) 2.20e-06 2.66e-11 5.06e-27 5.49e-02 9.45e-01 5 17 Schlectendaliana2 (5) 1.03e-11 3.34e-11 3.63e-44 1.04e-06 9.99e-01 5 18 Schlectendaliana3 (5) 1.39e-02 3.66e-04 2.89e-46 1.076e-04 9.86e-01 5 19 Schlectendaliana4 (5) 1.91e-03 1.88e-06 4.72e-28 5.07e-02 9.47e-01 5 20 Schlectendaliana5 (5) 1.68e-04 1.52e-09 3.06e-27 3.08e-01 6.91e-01 5 ======A priori groups ------NoPriorGroups 1 2 3 4 5 PP ======21Colorata(0) 4.16e-05 9.92e-02 8.31e-54 1.03e-08 9.01e-1 5 22Arfakensis(0) 9.75e-01 3.52e-05 9.48e-27 2.42e-02 1.09e-3 1 23Gemmata(0) 5.41e-08 5.49e-06 3.81e-50 2.09e-08 9.99e-1 5 ======PP: posterior probability ======

181 Table 4.9. Posterior probability of groups defined a priori using input results from the NMDS based on separation of taxa by squared root distance.

======A priori groups ------NoAPriorGroups 1 2 3 4 5 PP ======1 Reticulata1(1) 9.99e-04 7.09e-03 5.54e-28 7.91e-08 9.92e-01 5 2 Reticulata2(1) 5.49e-01 4.51e-01 9.03e-23 4.56e-10 4.50e-05 1 3 Reticulata3(1) 8.67e-01 1.33e-01 7.38e-17 2.49e-07 4.45e-06 1 4 Pusilla1(2) 1.47e-01 8.53e-01 1.73e-26 2.18e-15 1.25e-06 2 5 Pusilla2(2) 3.67e-01 6.32e-01 2.51e-33 1.61e-10 5.94e-04 2 6 Pusilla3(2) 8.11e-02 9.19e-01 5.71e-28 9.73e-15 7.19e-06 2 7 Procera1(3) 1.89e-21 8.18e-30 1.00e+00 3.26e-27 8.07e-25 3 8 Procera2(3) 2.48e-29 3.00e-39 1.00e+00 6.12e-35 2.22e-35 3 9 Procera3(3) 3.51e-19 8.94e-27 1.00e+00 1.30e-26 1.92e-24 3 10Procera4(3) 7.7e-18 4.18e-26 1.00e+00 1.07e-23 1.04e-22 3 11Procera5(3) 6.05e-23 9.43e-33 1.00e+00 1.02e-23 2.70e-28 3 12Bifida1(4) 1.58e-13 3.69e-18 2.08e-45 1.00e+00 3.33e-09 4 13Bifida2(4) 2.92e-11 1.52e-18 3.73e-23 1.00e+00 1.28e-10 4 14Bifida3(4) 1.10e-09 3.86e-14 9.51e-30 1.00e+00 7.38e-10 4 15Bifida4(4) 4.87e-03 1.71e-08 3.56e-21 9.28e-01 6.74e-02 4 16 Schlectendaliana (5) 5.44e-06 8.62e-11 1.43e-22 1.58e-07 9.99e-01 5 17 Schlectendaliana (5) 7.82e-06 1.26e-07 9.84e-29 1.73e-13 9.99e-01 5 18 Schlectendaliana (5) 8.25e-01 3.89e-02 1.23e-30 1.96e-07 1.36e-01 1 19 Schlectendaliana (5) 1.10e-03 2.29e-05 4.89e-32 2.13e-06 9.99e-01 5 20 Schlectendaliana (5) 3.58e-03 2.85e-06 6.53e-23 1.29e-06 9.96e-01 5 ======A Priori groups ------NoApriorGroups 1 2 3 4 5 PP ======21Colorata(0) 3.09e-1 6.37e-2 9.45e-21 3.99e-16 6.28e-1 5 22Arfakensis(0) 9.93e-1 6.78e-3 1.29e-15 8.10e-09 2.89e-4 1 23Gemmata(0) 4.83e-1 3.36e-1 2.65e-17 1.93e-21 1.81e-1 1 ======PP: posterior probability ======

182 Results of a Discriminant Function Analysis based on the use of square root distance produced results similar to that obtained when Euclidean distance was used (Table 4.8).

OTUs assigned a priori to ‘Procera’ or ‘Bifida’ are identified as being placed in distinct groups, and not mixed with the rest of the sample OTUs with 100% and 92-100% posterior probabilities, respectively. Further, when the square root distance is used, two of the three OTUs assigned a priori to ‘Pusilla’ also were assigned with high probability

(85-92%) to a third distinct group. However, one of the taxa assigned a priori to

‘Pusilla,’ ‘Pusilla-2,’ was found to have only a 63% posterior probability of belonging to the ‘Pusilla’ a priori grouping. ‘Pussila-2’ had a 37% posterior probability of belonging to the posterior group to which ‘Reticulata’ OTUs were assigned. . The other two members of ‘Pusilla’ showed a high posterior probability (91% and 85%) of being included in the same distinct group. As was found with the analysis based on Euclidean distance, the assignment of taxa designated a priori to. The other members of ‘Pusilla’ showed relatively high probability (91% and 85%) to be a distinct group. The boundaries of ‘Reticulata,’ ‘Schlectendaliana,’ ‘Colorata,’ ‘Arfakensis’ and ‘Gemmata’ are not clear.

One species of ‘Reticulata,’ ‘Reticulata-1,’ resembled ‘Schlectendaliana’ more than its own group. Also, members a priori to ‘Schlectendaliana,’ ‘Schlectendaliana-3,’ was more likely to be assigned to the posterior group including most samples of ‘Reticulata’.

The single OTUs from ‘Arfakensis’ and ‘Colorata’ were most likely to be assigned to the posterior group identified with most OTUs of ‘Reticulata’. In summary, when square root distance was used as the basis of DFA, only the OTUs of ‘Procera’ and ‘Bifida’ formed homogenous posterior groups, while other OTUs were included in taxonomically heterogeneous posterior groupings. 183 Lastly, the Discriminant Function Analysis using the NMDS output based on the

Sorenson distance showed strong evidence for the distinction of OTUs assigned a priori to ‘Procera’ and ‘Bifida’ (Table 4.11). The posterior probability of assignment of the two groups was 100% for the five OTUs assigned a priori to ‘Procera’ and 92-99% for the four OTUs assigned a priori to ‘Bifida’. In contrast, assignment of the OTUs assigned a priori to ‘Reticulata’ and ‘Pusilla’ indicated that the boundary between these forms was indistinguishable. The six OTUs showed an approximately 50% posterior probability of being assigned to either of the two posterior groups that could constitute ‘Reticulata’ or

‘Pusilla.’ Four of the five a priori members of ‘Schlectendaliana’ showed high probability (>90%) of being assigned to a single disctinct posterior group (the fifth

‘Schlectendaliana’ OTU was assigned to this same groups with 69% posterior probability). While this suggests that ‘Schlectendaliana’ forms a distinct posterior grouping, this conclusion is diminished because the OTUs assigned a priori to ‘Colorata’ and ‘Gemmata’ wera also assigned with high posterior probability (91% and 99% to the

‘Schlectendaliana’ posterior group. ‘Schlectendaliana’. Therefore, the separation

‘Schlectendaliana,’ ‘Colorata,’ and ‘Gemmata’ was unclear. Finally, the single OTU placed a priori in ‘Arfakensis’ was assigned with high posterior probability (97%) to the a priori group that includes two of the three ‘Reticulata’ OTUs.

In summary, Discriminant Function Analysis based on all 23 sampling OTUs indicated that the OTUs assigned a priori to ‘Procera’ and to ‘Bifida’ could be identified with high probability and separate from each other and from the other putative taxa in the analysis.

184 In contrast, OTUs assigned to any of the other a priori groups were usually intermixed in their a posteriori assignment to possible statistical groups.

A final concern is to investigate whether there is any effect on the separation of some possible taxonomic groups due to inclusion in the analysis of the OTUs assigned a priori to ‘Procera’, a group as being unique based on both analysis of clustering and by

Discriminant Function Analysis. Consequently an analysis was done excluding the

OTUs assigned a priori to ‘Procera’, leaving the remaining groups intact. Tables 4.10.-

4.12. are the NMDS output data used for the input of the DFA by excluding ‘Procera’ from the analyses using the three different distances. The separate DFA analyses based on three different distances showed a no consistent pattern in which OTUs assigned a priori to the groups ‘Reticulata,’ ‘Pusilla,’ ‘Schlectendaliana,’ Colorata,’ ‘Arfakensis,’ and ‘Gemmata’ could be separated into coherent a posteriori groups. DFA based on

NMDS input obtained from Euclidean and square root distances resulted in the similar results. The OTUs assigned a priori to either ‘Bifida’ or ‘Schlectendaliana’ were identified as having a high posterior probability of being assigned into distinct groups representing the a priori classifications. The OTUs assigned a priori to ‘Reticulata,’

‘Pusilla,’ ‘Colorata,’ ‘Arfakensis,’ and Gemmata’ did not form posterior groups that were well defined based on a priori classifications. The OTUs assigned a priori to ‘Colorata’ and ‘Gemmata’ showed a high posterior probability of being grouped with OTUs of

‘Pusilla’ (with posterior probabilities of 78% and >99%, respectively).

185 Table 4.10. Sample scores from the NMDS when using Euclidean distance for the data sets without ‘Procera’. These values are used for the subsequent discriminant function analysis (DFA). The values are those determined when the stress value from NMDS was 10.6%. Sample scores are positions of the data in the axes where data need to be mapped.

======NoName X1 X2 y ======Reticulata1 1.521 -0.3321 1 Reticulata2 0.7524 -0.111 1 Reticulata3 0.6434 -0.2384 1 Pussila1 1.1304 0.4818 2 Pussila2 0.8249 0.7153 2 Pussila3 1.0987 0.5926 2 Bifida1 -0.5433 -0.6203 3 Bifida2 -0.0352 -1.2813 3 Bifida3 -0.4679 -0.7454 3 Bifida4 -0.6421 -0.6537 3 Schlectendaliana1 -0.9802 -0.0107 4 Schlectendaliana2 -0.8986 0.2647 4 Schlectendaliana3 -0.5775 0.1314 4 Schlectendaliana4 -0.8171 -0.2149 4 Schlectendaliana5 -0.9046 -0.188 4 Colorata -0.3215 0.8055 0 Arfakensis 0.5817 0.2761 0 Gemata -0.3646 1.1283 0 ======x: axes y: a priori groups ======

186 Table 4.11. Sample scores from the NMDS when using Sorenson distance for the data sets without ‘Procera’. These values are used for the subsequent discriminant function analysis (DFA). The values are those determined when the stress value from NMDS was 10.6%. Sample scores are positions of the data in the axes where data need to be mapped.

======NoName X1 X2 y ======Reticulata1 1.521 -0.3321 1 Reticulata2 0.7524 -0.111 1 Reticulata3 0.6434 -0.2384 1 Pussila1 1.1304 0.4818 2 Pussila2 0.8249 0.7153 2 Pussila3 1.0987 0.5926 2 Bifida1 -0.5433 -0.6203 3 Bifida2 -0.0352 -1.2813 3 Bifida3 -0.4679 -0.7454 3 Bifida4 -0.6421 -0.6537 3 Schlectendaliana1 -0.9802 -0.0107 4 Schlectendaliana2 -0.8986 0.2647 4 Schlectendaliana3 -0.5775 0.1314 4 Schlectendaliana4 -0.8171 -0.2149 4 Schlectendaliana5 -0.9046 -0.188 4 Colorata -0.3215 0.8055 0 Arfakensis 0.5817 0.2761 0 Gemata -0.3646 1.1283 0 ======x: axes y: a priori groups ======

187 Table 4.12. Sample scores from the NMDS when using squared root distance for the data sets without ‘Procera’. These values are used for the subsequent discriminant function analysis (DFA). The values are those determined when the stress value from NMDS was6.4%. Sample scores are positions of the data in the axes where data need to be mapped.

======No Name X1 X2 X2 y ======Reticulata1 -0.0764 1.3087 0.1413 1 Reticulata2 0.0852 0.4265 0.3125 1 Reticulata3 0.3993 0.4416 0.2393 1 Pussila1 0.3628 0.459 1.2406 2 Pussila2 0 -0.2937 1.441 2 Pussila3 0.0838 0.4776 1.3053 2 Bifida1 0.5001 -0.2517 -0.6668 3 Bifida2 0.6912 -0.174 -0.4346 3 Bifida3 0.453 -0.0662 -0.6871 3 Bifida4 0.3712 0.0722 -0.5247 3 Schlectendaliana1 -0.2359 -0.4027 -0.6343 4 Schlectendaliana2 -0.229 -0.778 -0.6496 4 Schlectendaliana3 -0.2442 -0.4949 -0.1806 4 Schlectendaliana4 -0.133 -0.0635 -0.4251 4 Schlectendaliana5 -0.1438 -0.1617 -0.6384 4 Colorata -1.1998 -0.534 0.03 0 Arfakensis 0.5568 -0.3136 0.579 0 Gemata -1.2411 0.3484 -0.4478 0 ======x: axes y: a priori groups ======

188 Comparison of all three DFA analyses that excluded ‘Procera’ indicated that there is some support for the existence of a distinct a posteriori group made up of the a priori

OTUs of ‘Bifida’. OTUs assigned a prioir to ‘Reticulata’ and ‘Pusilla’ also formed groups with 100% posterior probability. However, the prior sample of ‘Arfakensis’ was also placed into the ‘Reticulata’ a posteriori group with 100% posterior probability. The

OTUs assigned a prioir to ‘Schlectendaliana’ also formed a well supported posterior group, each being assigned to that group with >95% posterior probability. However, the a priori OTUs for ‘Colorata’ and ‘Gemmata’ are also assigned to that same

‘Schlectendaliana’ posterior group with 100% posterior probability. Therefore, only the a priori members of ‘Bifida’ continue to form a significant posterior group that is well supported in the DFA analysis using the NMMDS output based on the Sorenson distance.

Data showing the posterior probability results of the DFA analyses for the three different measures of morphological distance are presented in Table 4.13.-4.15.

189 Table 4.13. Posterior Probability of groups determined a priori (NMDS using Euclidean distance)

======A priori groups ------NoAPriorGroups 1 2 3 4 5 PP ======1 Reticulata1 (1) 2.31e-01 7.69e-01 9.89e-33 1.14e-19 9.14e-23 2 2 Reticulata2 (1) 4.03e-01 5.97e-01 2.71e-20 2.14e-11 2.87e-10 2 3 Reticulata3 (1) 9.53e-01 4.69e-02 5.56e-17 2.69e-10 9.46e-11 1 4 Pusilla1 (2) 4.13e-01 5.87e-01 4.57e-24 4.10e-18 1.21e-12 2 5 Pusilla2 (2) 2.00e-01 7.99e-01 1.07e-31 3.31e-11 1.83e-06 2 6 Pusilla3 (2) 8.16e-02 9.18e-01 8.33e-26 2.95e-16 4.57e-10 2 7 Procera1 (3) 1.57e-20 6.64e-26 1.00e+00 5.47e-27 2.94e-30 3 8 Procera2 (3) 2.50e-28 1.50e-36 1.00e+00 1.38e-37 1.08e-43 3 9 Procera3 (3) 1.02e-18 7.72e-25 1.00e+00 1.25e-29 1.94e-32 3 10 Procera4 (3) 2.78e-17 8.67e-24 1.00e+00 2.88e-26 1.98e-30 3 11 Procera5 (3) 8.92e-22 1.04e-31 1.00e+00 2.31e-27 4.58e-43 3 12 Bifida1 (4) 9.40e-25 7.44e-24 5.77e-60 9.99e-01 6.02e-08 4 13 Bifida2 (4) 4.23e-15 4.08e-19 1.13e-25 1.00e+00 8.60e-12 4 14 Bifida3 (4) 1.01e-12 4.63e-15 3.04e-30 1.00e+00 6.64e-11 4 15 Bifida4 (4) 1.40e-07 3.08e-10 4.99e-24 9.711e-01 2.85e-02 4 16 Schlectendaliana1 (5) 1.08e-17 3.81e-15 5.65e-32 1.74e-08 1.00e+00 5 17 Schlectendaliana2 (5) 6.90e-18 1.19e-12 1.38e-40 1.06e-14 1.00e+00 5 18 Schlectendaliana3 (5) 1.25e-10 1.46e-07 1.13e-34 7.72e-09 9.99e-01 5 19 Schlectendaliana4 (5) 1.11e-11 8.50e-09 1.95e-37 6.59e-07 9.99e-01 5 20 Schlectendaliana5 (5) 2.37e-10 3.43e-08 7.34e-31 1.54e-06 9.99e-01 5 ======A priori groups ------NoAPriorGroups 1 2 3 4 5 PP ======21 Colorata (0) 2.16e-04 3.05e-01 7.21e-23 9.09e-15 6.94e-01 5 22 Arfakensis (0) 9.31e-01 6.91e-02 4.29e-14 1.56e-09 5.14e-08 1 23 Gemmata (0) 2.36e-04 9.93e-01 6.29e-20 5.28e-21 7.07e-03 2 ======PP: posterior probability ======

190 Table 4.14. Posterior Probability of groups determined a priori (NMDS using Sorenson distance)

======A priori groups ------NoAPrioriGroups 1 2 3 4 5 PP ======1 Reticulata1 (1) 6.56e-01 3.44e-01 5.99e-43 5.12e-09 3.92e-09 1 2 Reticulata2 (1) 4.78e-01 4.93e-01 7.61e-39 4.85e-04 2.83e-02 2 3 Reticulata3 (1) 5.07e-01 4.53e-07 1.35e-32 4.87e-01 6.56e-03 1 4 Pusilla1 (2) 7.12e-02 9.29e-01 5.24e-49 1.06e-09 2.05e-06 2 5 Pusilla2 (2) 5.74e-04 9.99e-01 1.76e-57 4.75e-14 2.78e-09 2 6 Pusilla3 (2) 1.86e-03 9.98e-01 1.85e-52 1.09e-11 3.86e-07 2 7 Procera (3) 3.46e-31 7.49e-50 1.00e+00 1.33e-14 9.24e-27 3 8 Procera2 (3) 1.07e-36 1.10e-57 1.00e+00 7.97e-20 4.56e-34 3 9 Procera3 (3) 7.73e-33 8.03e-53 1.00e+00 1.62e-18 3.65e-33 3 10 Procera4 (3) 2.81e-29 1.08e-48 1.00e+00 1.58e-14 2.09e-27 3 11 Procera5 (3) 4.24e-34 8.70e-54 1.00e+00 1.78e-17 2.40e-30 3 12 Bifida1 (4) 1.46e-05 2.66e-12 4.16e-17 9.75e-01 2.50e-02 4 13 Bifida2 (4) 6.31e-06 5.50e-14 6.97e-15 9.98e-01 1.52e-03 4 14 Bifida3 (4) 3.07e-05 7.87e-13 2.47e-15 9.98e-01 1.71e-03 4 15 Bifida4 (4) 4.62e-03 2.46e-09 1.84e-21 9.28e-01 6.75e-02 4 16 Schlectendaliana1 (5) 2.20e-06 2.66e-11 5.06e-27 5.49e-02 9.45e-01 5 17 Schlectendaliana2 (5) 1.03e-11 3.34e-11 3.63e-44 1.04e-06 9.99e-01 5 18 Schlectendaliana3 (5) 1.39e-02 3.66e-04 2.89e-46 1.08e-04 9.86e-01 5 19 Schlectendaliana4 (5) 1.91e-03 1.88e-06 4.72e-28 5.07e-02 9.47e-01 5 20 Schlectendaliana5 (5) 1.68e-04 1.52e-09 3.06e-27 3.08e-01 6.91e-01 5 ======A priori groups ------NoAPriorGroups 1 2 3 4 5 PP ======21 Colorata (0) 4.16e-05 9.92e-02 8.31e-54 1.03e-08 9.01e-01 5 22 Arfakensis (0) 9.75e-01 3.52e-05 9.48e-27 2.42e-02 1.09e-03 1 23 Gemmata (0) 5.41e-08 5.49e-06 3.81e-50 2.09e-08 9.99e-01 5 ======PP: posterior probability ======

191 Table 4.15. Posterior Probability of groups determined a priori (NMDS using the squared root distance)

======A priori groups ------NoAPrioriGroups 1 2 3 4 5 PP ======

1 Reticulata1 (1) 9.99e-04 7.09e-03 5.54e-28 7.91e-08 9.92e-01 5 2 Reticulata2 (1) 5.49e-01 4.51e-01 9.03e-23 4.56e-10 4.50e-05 1 3 Reticulata3 (1) 8.67e-01 1.33e-01 7.38e-17 2.49e-07 4.45e-06 1 4 Pusilla1 (2) 1.47e-01 8.53e-01 1.73e-26 2.18e-15 1.25e-06 2 5 Pusilla2 (2) 3.67e-01 6.32e-01 2.51e-33 1.61e-10 5.94e-04 2 6 Pusilla3 (2) 8.11e-02 9.19e-01 5.71e-28 9.73e-15 7.19e-06 2 7 Procera1 (3) 1.89e-21 8.18e-30 1.00e+00 3.26e-27 8.07e-25 3 8 Procera2 (3) 2.48e-29 3.00e-39 1.00e+00 6.12e-35 2.22e-35 3 9 Procera3 (3) 3.51e-19 8.94e-27 1.00e+00 1.30e-26 1.92e-24 3 10 Procera4 (3) 7.72e-18 4.18e-26 1.00e+00 1.07e-23 1.04e-22 3 11 Procera5 (3) 6.05e-23 9.43e-33 1.00e+00 1.02e-23 2.70e-28 3 12 Bifida1 (4) 1.58e-13 3.69e-18 2.08e-45 1.00e+00 3.33e-09 4 13 Bifida2 (4) 2.92e-11 1.52e-18 3.73e-23 1.00e+00 1.28e-10 4 14 Bifida3 (4) 1.10e-09 3.86e-14 9.51e-30 1.00e+00 7.38e-10 4 15 Bifida4 (4) 4.87e-03 1.71e-08 3.56e-21 9.28e-01 6.74e-02 4 16 Schlectendaliana (5) 5.44e-06 8.62e-11 1.43e-22 1.58e-07 9.99e-01 5 17 Schlectendaliana (5) 7.82e-06 1.26e-07 9.84e-29 1.73e-13 9.99e-01 5 18 Schlectendaliana (5) 8.25e-01 3.89e-02 1.23e-30 1.96e-07 1.36e-01 1 19 Schlectendaliana (5) 1.10e-03 2.29e-05 4.89e-32 2.13e-06 9.99e-01 5 20 Schlectendaliana (5) 3.58e-03 2.85e-06 6.53e-23 1.29e-06 9.96e-01 5 ======A priori groups ------NoAPrioriGroups 1 2 3 4 5 PP ======21 Colorata (0) 3.09e-01 6.37e-02 9.45e-21 3.99e-16 6.28e-01 5 22 Arfakensis (0) 9.93e-01 6.78e-03 1.29e-15 8.10e-09 2.89e-04 1 23 Gemmata (0) 4.83e-01 3.36e-01 2.65e-17 1.93e-21 1.81e-01 1 ======PP: posterior probability ======

192 4.4. Discussion

The cluster analyses resulting from the combination of Euclidean-UPGMA (EU),

Euclidean-Ward (E-W), and Sorenson-UPGMA (S-U) analyses using 19 morphological characteristics revealed that there were five groups arbitrarily recognized at >60% of the maximum distance. These clusters correspond to taxa assigned a priori to the taxonomic groups ‘Procera’, ‘Bifida’, ‘Schlectendaliana’, ‘Gemmata-Colorata’, ‘Reticulata-Pusilla-

Arfakensis’. However, the existence of these clusters as statistically significant units is not well substantiated by examination of the bootstrap support for the various clusters.

The clusters identified with that taxa assigned a priori to ‘Procera’, to the joint group

‘Colorata-Gemmata’, and to ‘Bifida’ were supported by majority bootstrap results (>50%

Bootstrap Value). The significance of clusters for the other a priori groupings (‘Pusilla’,

‘Reticulata’, ‘Gemmata’, ‘Arfakensis’, ‘Schlectendaliana’, and ‘Colorata’) was not supported.

Non-Metric Multidimensional Scaling showed ambiguous separation when compared to the separation of groups observed in cluster analyses, independent of the measure of morphological distance being considered.

As the inclusion of the OTUs from ‘Procera’ might give the obscure the separation between the more closely related taxa, the exclusion of ‘Procera’ was examined.

Excluding the OTUs assigned a priori to ‘Procera’ from the analyses did not improve the resolution of other taxa, which had been recognized a priori based on few morphological

193 characteristics. It did, however, result in greater separation of all remaining taxa from each other, without an increase of the resolution of groups within the remaining data.

There was little difference seen when using different measures of distanced applied in

Discriminate Function Analyses derived from the data summarized by NMDS. The primary results indicated that OTUs assigned a priori to ‘Procera’ and ‘Bifida’ were consistently identified with groups that excluded the remaining OTUs. All analyses using DFA showed inconsistency in the placement of the taxa assigned a priori to

‘Reticulata’-‘Pusilla’-‘Schlectendaliana’-‘Colorata’-‘Arfakensis’-‘Gemmata’. DFA using Euclidean and square root distances showed that one of OTUs assigned a priori to in ‘Reticulata’ was consistently more similar to OTUs assigned to ‘Pusilla’. Also,

‘Colorata’ and ‘Gemmata’ were likely to be assigned to ‘Pusilla’ with high posterior probability. DFA using Sorenson distance showed some differences from those obtained with the other two distance, showing inconsistency in the placement of ‘Colorata’,

‘Arfakensis’, and ‘Gemmata’. ‘Colorata’ and ‘Gemmata’ were more similar to

Schlectendaliana and ‘Arfakensis’ was more similar to ‘Reticulata’. This inconsistency was also seen in the DFA analyses using the full data set of OTUs.

In summary, the taxa identified a priori as ‘Reticulata’, ‘Pusilla’, ‘Schlectendaliana’,

‘Colorata’, ‘Arfakensis’, and ‘Gemmata’ do not show consistent differences that warrant their placement as distinct taxaonomic units. The analysis suggests, rather, that they might be more appropriately treated by being lumped together based on this study.

194 The lumping of these six previously recognized groups occurs because the measurements of morphological traits of the plants are very similar, and do not show evidence of being capable of differentiating the groups. All of the groups have relatively small sized plants, lanceolate leaf shape, and small size of flowers. From the 39 morphological characteristics originally collected, only 19 independent morphological characteristics could be identified for use in multivariete analyses of Goodyera section Goodyera from

Indonesia. The majority of the morphological characters used in the analyses were overlapping in size (the height of the plants, the leaf length, the root type, the leaf venations, the ratio of the length of the spike and the number of flowers, and the leaf petiole length) that differentiate ‘Procera’ and ‘Bifida’ to those six priori recognized groups. Bifida’ and ‘Schlectendaliana’ were the only two a priori groups that have larger floral size and floral stalk, and ‘Bifida’ is the only one that has the bract length and bract width longer and wider compared to the other defined groups initially. In addition, other morphological characters, i.e., the ratio of labellum apex length and width, labellum length and width, lateral sepal length and width, lateral petal length and width, and spur length showed very little difference between groups that might swamp the significant of few morphological characteristics used to classified the prior groups initially. These characters might be significantly important to differentiate groups. Therefore having these data, the eight taxa determined a priori, cannot be concluded because of the insufficient number of discrete characters to separate them.

195 4.5. Taxonomic Conclusion

Based on the multivariate analyses (using Cluster analyses with different distances, together with bootstrap analyses to assay significance of clusters), Non Metric

Multidimensional Scaling (with different distances), and Discriminate Function Analyses, three groups could be recognized from the morphological data. The three groups consist of samples classified a priori as belonging to ‘Procera’, samples classified a priori as belonging to ‘Bifida’, and all remaining samples, which included samples identified a priori as ‘Gemmata’, ‘Colorata’, ‘Reticulata,’ ‘Pusilla,’ ‘Schlectendaliana,’ or

‘Arfakensis’. All the morphs within the last combined group differ from each other by only one or two morphological characteristics, or by their geographical distribution.

I propose that the three groups, i.e., ‘Procera’, ‘Bifida’, and ‘Gemmata-Colorata-

Reticulata-Pusilla-Schlectendaliana-Arfakensis’ be recognized taxonomically at the rank of species and that six subspecies be recognized within the last-named group.

Multivariate analysis was not able to demonstrate non-overlapping separation of the six morphs included in ‘Gemmata-Colorata-Reticulata-Pusilla-Schlectendaliana-Arfakensis’, but there was some degree of morphological coherence within each group. Supported by their geographic distributions, the recognition of the six morphs as subspecies appears warranted. Descriptions of the proposed taxa and an identification key are provided in

Chapter 5.

196 Chapter 5: Taxonomic Treatment of Goodyera section Goodyera from Indonesia

5.1. Introduction

Multivariate analysis based on a set of 19 and 18 morphological characters has been used to delimit taxa within Goodyera section Goodyera from Indonesia. The morphological specimens were shown by multivariate analysis to form three major groups. These groupings are treated below as representing separate species. One of the species has been defined to include six subspecies, based on a priori classifications. The morph names and the corresponding species are given in Table 4.18.

5.1.1. Identification key to the taxa within Goodyera section Goodyera in Indonesia

1a. Leaf venation absent, plants medium to large, ca. 197.5 to 365mm tall ………… 2

2a. Leaf blades obliquely rhombic, roots scattered along the rhizome, flowers

large (excluding the floral stalk) up to 7-8 mm long …………….. G. bifida

2b. Leaf blades lanceolate, roots closely clustered at the nodes, flowers

small (excluding the floral stalk) 1.5-2mm long ……………..… G. procera

1b. Leaf venation present, plants small to medium, ca. 47.67 to 131.25mm long ….. 3

3a. Leaf venation pinkish

Leaf venation parallel, blade lanceolate …. G. reticulata subsp. colorata

Leaf venation reticulate, blade broadly .lanceolate

197 …………………………………………….. G. reticulata subsp. gemmata

3b. Leaf venation white ………………………………………………….…….. 4

4a. Leaf venation spotted …………...…………………………………. 5

5a. Flowers small, excluding the floral stalk 3mm long

……………………………..….. G. reticulata subsp. gibbsiae

5b. Flowers large, excluding the floral stalk, 5-9mm long

………………………... G. reticulata subsp. schlectendaliana

4b. Leaf venation reticulate ………………………………………….… 6

6a. Leaf blades green, flowers entirely white, tepals separated

freely ……………………… G. reticulata subsp. reticulata

6b. Leaves lanceolate with brownish leaves, flowers brownish

brownish flowers, tepals fused

…..………………………………. G. reticulata subsp. pusilla

5.1.2. Account of the taxa of Goodyera section Goodyera in Indonesia

Goodyera R. Br. in W. Aiton et W.T. Aiton, Hortus Kew. (ed. 2) 5: 197 (1813).

Lectotype species: Goodyera repens (L.) R. Br., Satyrium repens L. sp. pl (1753); vide

N.L. Britton et A. Brown, Ill. fl. N U.S. (ed. 2) 1: 569. (1913).

1. Goodyera bifida Blume (Blume), Collection des orchidees les plus remarquables de l’Archipel indien et du Japon. p. 40 (1858). Neottia bifida Blume, Bijdr.: 408 (1825)

Orchioides bifidum (Blume) O. Kuntze, Rev. Gen. Pl. 2: 674 (1891)

Epipactis bifida (Blume) Eat., Proc. Biol. Soc. Washington 21: 63 (1908)

198 Type: Indonesia: Java: Gedeh Java, C.L. Blume s.n. (holo ?; iso L).

Description:

Terrestrial attenuate herb up to 20 cm tall. Rhizome decumbent, rooted at nodes. Scape ascending, leafy in the proximal half, racemose above. Leaves spreading petiolate, blade obliquely rhombic, up to 51 mm long and 23.3 mm wide, acute; petiole up to 20.75 mm.

Inflorescence erect, subdensely many-flowered. Peduncle up to 50 mm long with 2 to 3 sterile bracts at the base of the rachis. Fertile bracts linear-lanceolate, up to 20 mm long and 6.3 mm wide. Flower opening less spreading, brownish. Sepals hairy; dorsal sepal cucullate, narrowly ovate-lanceolate, somewhat oblique, up to 8 mm long and 3 mm wide, acute; lateral sepals ovate-lanceolate, up to 7 mm long and 3.5 mm wide. Petals obliquely rhombic to narrowly spatulate, up to 7 mm long and 2.5 mm wide. Labellum up to 4 mm long and 3 mm wide; mentum cordate, not distinctly long; apex linear, more or less recurved; disc hairy inside. Column cuneate, up to 6 mm long and 1.5 mm wide.

Rostellum present. Anther 1, attached apically. Ovary sessile, up to 9 mm long.

Specimen used in the multivariate analysis (‘Bifida’):

Java; West Java; Preanger; Garoet; G. Mandalagiri, 2 April 1920, H.J. Lam 306 (BO).

Sumatra: Gn. Kerintji, 1 May 1920, H.A.B. Bunnemeijer 9857 (BO); South Sumatra;

Palembang; G. Dempo, 20 May 1929, C.N.A. Voogd 390 (BO). Sulawesi: South

Sumatra: Kab. Enrekang; Latimojong Ranges; Mt. Rantemario; between pos I and II, 6

Jul 2002, L.S Juswara, L.A. Craven, and G.K. Brown, JBC 221 (BO).

199 Specimens examined:

Java: West Java; Sukabumi; Gunung Halimun National Park; Mt. Botol, 19 Apr 2002,

L.S. Juswara 64 (BO); G. Marigih, 21 Mar 1914, C.A. Backer 12387 (BO); East Java; G.

Argopuro North West side, 20 Apr 1914, C.A. Backer 13117 (BO); Banjoemas; G.

Slamet, South West Slope, 21 Apr 1911, C.A. Backer 484 (BO). Sulawesi: Kab.

Enrekang; Latimojong ranges; Mt. Rantemario; Between pos I and II, 6 Jul 2002, L.S.

Juswara, L.A. Craven, & G. K. Brown, JCB 225 (BO). Sumatra: Gn Kerintji, 6 Apr

1920, H.A.B. Bunnemeijer 9153 (BO); Gn. Kerintji, 9 Apr 1920, H.A.B. Bunnemeijer

9288 (BO). Bali Timur; Tabanan; Central part of Bali island; Mt Lesung ca. 6 km WNW of Bedugul; above Bali Botanical Garden, 25 Jul 1994, McDonald & Ismail 4860 (BISH).

Habitat:

Mountainous, shady, wet forests.

Distribution:

Indonesia: Bali, Java, Sulawesi, Sumatra. India: Asam, Sikkim Himalaya. Malaysia:

Perak (Gn. Blumber). China: Hongkong, Kwangtung, Szechuan. Japan: Ryuku;

Okinawa; Prov. Kunigami, Mt. Yae-dake. Specimens from outside Indonesia have been examined.

200 Figure 5.1. Map: Distribution of Goodyera bifida in Indonesia

201 Figure 5.2. Plate: Goodyera bifida (by Subari, BO) 202 Figure 5.3. Photo: Goodyera bifida [Java: West Java: Mt. Gede]

203 2. Goodyera procera (Ker-Gawl.) Hook., Exotic Fl. 1 : t. 39 (1824); Neottia procera

Ker-Gawl, Bot. Reg. 8 : t.639 (1822). Neottia parviflora Bl., Bijdr.: 408 (1825).

Type: Indonesai: Java, C.L. Blume 333 (Holo L)

Description:

Terrestrial attenuate herb to 36.5 cm tall. Rhizome decumbent, rooted at nodes. Scape ascending, leafy in the proximal half, racemose above. Leaves spreading petiolate, blade lanceolate, up to 114.5 mm long and 36.5 mm wide, acute; petiole up to 60 mm.

Inflorescence erect, subdensely many flowered. Peduncle up to 126 mm long with 2 to 3 sterile bracts at the base of the rachis. Fertile bracts linear-lanceolate, up to 5 mm long and 2 mm wide. Flower opening less spreading, pale cream with greenish outer floral parts. Sepals hairy; dorsal sepal cucullate, narrowly ovate-lanceolate, somewhat oblique, up to 2 mm long and 1.25 mm wide, acute; lateral sepals ovate-lanceolate, up to 2 mm long and 1.5 mm wide. Petals obliquely rhombic to narrowly spatulate, up to 2 mm long and 0.75 mm wide. Labellum up to 1 mm long and 1 mm wide; mentum cordate, not distinctly long; apex linear, more or less recurved; disc hairy inside. Column cuneate, up to 1.5 mm long and 1 mm wide. Rostellum present. Anther 1, attached apically. Ovary sessile, up to 4 mm long.

Specimen used in the multivariate analysis (‘Procera’):

Java: West Java; North Hill, 24 June 1914, C.A. Backer 14181 (BO); G. Salak before

Pasir Togor, 11 Sep 1913, C.A. Backer 9119 (BO); Baturaden; Purwokerto, 24 Aug 1969,

Br. Joss 53 (BO); Buitenzorg; G. Halimun; West from Nirmala; North from Tjisaroea; 5-

204 9 April 1941, C.G.G.J. van Steenis 12424 (L). Flores: Z van de Rana Mese, 14 Nov

1932, O Posthumus 3264 (BO, L).

Specimens examined:

Java: West Java: Preanger Region, National mountain Tjadas Malang, Tjidadap, Tjibeber,

19 October 1919, W.F. Winckel 434 β (L); Tjisokan by Tjibeber, 26 December 1917, R. van Leeuwen s.n. (L); North Mt. Salak, above Tjalobak, 25 November 1940, De Voogd s.n. (BO); Bogor, 1913, J.J. Smith 8804 (L); Garut, Gunung Djaja, 27 March 1920, H.J.

Lam 149 (BO). Flores: Endeh, 1 Aug 1933, C.N.A. de Voogd 1673 (L).

Habitat:

This species is quite common in fairly open areas with sandy soil that have access to water, such as on riverbanks.

Distribution:

China: Hainan. Indonesia: Java and Flores. India: Assam, Calcutta, Ceylon, Nepal.

Japan: Ryukyu; Okinawa; Prov. Iriomote Isl. Papua New Guinea; East New Guinea;

Enga Province, Porgera District, near Korombi, Teyenongo. Philippinens: Island of

Luzon: Bontoe Province; Luzon: Sierra Dadre Mountains, NNE of Dingalan; Luzon: Mt.

Pico de Loro, Ilocs Norte Province; Mindanao: Zamboanga del Norte; Mindanao: Mt.

Walcon.

205 Figure 5.4. Map: Distribution of Goodyera procera in Indonesia

206 Figure 5.5. Plate: Goodyera procera (by Subari, BO)

207 Figure 5.6. Photo: Goodyera procera [Java: West Java: Mt. Salak, Curug Nangka]

208 3. Goodyera reticulata Blume. Collection des orchidees les plus remarquables de l’Archipel indien et du Japon. p. 35, t. 96 (1858).

Neottia reticulata Blume, Bijdr. : 408 (1825)

Type: Indonesia: Java (G. Gedeh), C.L. Blume s.n. (holo L).

a. Goodyera reticulata subsp. reticulata (Blume) Juswara comb. et. stat. nov. Neottia reticulata Blume, Bijdr.: 408 (1825). Goodyera reticulata (Blume) Blume, Collection des orchidees les plus remarquables de l’Archipel indien et du Japon. p. 35, t. 96 (1858).

Type: Indonesia: Java; G. Gedeh, C.L. Blume s.n. (holo L)

Description:

Terrestrial attenuate herb to 11,5 cm tall. Rhizome decumbent, rooted at nodes. Scape ascending, leafy in the proximal half, racemose above. Leaves spreading petiolate, blade lanceolate, up to 47 mm long and 20 mm wide, acute; petiole up to 20 mm. Inflorescence erect, subdensely many flowered. Peduncle up to 67 mm long with 2 to 3 sterile bracts at the base of the rachis. Fertile bracts linear-lanceolate, up to 10 mm long and 8 mm wide.

Flower opening less spreading, brownish. Sepals hairy; dorsal sepal cucullate, narrowly ovate-lanceolate, somewhat oblique, up to 3 mm long and 1.5 mm wide, acute; lateral sepals ovate lanceolate, up to 3.5 mm long and 1.3 mm wide. Petals obliquely rhombic to narrowly spatulate, up to 3 mm long and 1 mm wide. Labellum up to 2.5 mm long and

1.5 mm wide; mentum cordate, not distinctly long; apex linear, more or less recurved;

209 disc hairy inside. Column cuneate, up to 2 mm long and 0.75 mm wide. Rostellum present. Anther 1, attached apically. Ovary sessile, up to 6 mm long.

Specimen used in the multivariate analyses (‘Reticulata’):

Java: Situbondo; G. Raoeng via Sumber Wringin; 15 May 1932, Clason-Laarman 173

(L, BO); Gedeh; Tjibeureum, 17 Nov 1932, A. Kleinhoonte 70 (L); Kedoe; G. Telomojo,

27 Sep 1911, W. van Leeuwen Reijnvaan 194 (L).

Specimens examined:

Bali: Mt. Patas (±820m), 22 Nov 1918, Sarip 477 (Exp. R. Maier) (L); Mt. Batur Kase,

11 Oct 1918, Sarip 393 (Exp. R. Maier) (BO, L). Java: Crese in Mt. Gede (plant specimen was cultivated in Hort. Bog. (BO); Mt. Telomojo, 12 May 1899, Koorders

35863β (KDS 35863β) (BO); Preanger Regentich: Tjibodas boven Sindanglaja, 7 Dec

1925, Danser 5770 (L). Sumbawa: Sultanat Dompu, 11 Dec 1909, J. Elbert 4037 (L);

Tjibodas: Mt. Pangrango, 14 Oct 1919, D.T. van Moolen 47 (BO), Tjibodas (Herbarium was cultured in Hort. Bot. Bog), Mei 1911, Nedi s.n. (BO).

Habitat:

Mountainous forest, vulcanic, 1000-1300m alt.

Distribution:

Indonesia: Java and Bali.

210 Figure 5.7. Map: Distribution of Goodyera reticulata subsp. reticulata in Indonesia

211 Figure 5.8. Plate: Goodyera reticulata subsp. reticulata (by Subari, BO)

212 Figure 5.9. Photo: Goodyera reticulata subsp. reticulata [Java: West Java: Mt. Gede]

213 b. G. reticulata subsp. schlectendaliana, (Reichb.f.) Juswara comb. et stat. nov.

Goodyera schlectendaliana Reichb.f. Linnaea 22: 861 (1949). Georchis schlectendaliana (Reichb.f.) Reichb.f. Bonplandia 5: 36 (1854). Orchiodes schlectendaliana (Reichb.f.) O. Kuntze, Rev. Gen. Pl. 2 : 675 (1891).

Type: Japan: Göring (holo?; iso?).

Synonym:

Goodyera beccarii Schltr. Repert. Spec. Nov. Regni Beg. 9: 25 (1910). Type: Indonesia:

West Sumatra: Mt. Singgalang. July 1878. O. Beccari 392 (holo?, iso?).

Goodyera secundiflora Lindl. J. Linn. Soc. 1:182 (1857) non Griff. Type: China: Che-

Kiang, Fortune; Surureem, in Asam, Griffith., J.D.Hooker. 342 & T. Thompson. 328

(Type is not designated) (holo ?, iso ?).

Goodyera meliostele Schltr., Repert. Sp. Nov. Regni Beg. Beih. 4:59&165 (1919). Type:

China: Tschekiang, Hangtschou, 300m. Oct 1913. Limpricht 1113 (holo ?, iso ?).

Description:

Terrestrial attenuate herb to 13.2 cm tall. Rhizome decumbent, rooted at nodes. Scape ascending, leafy in the proximal half, racemose above. Leaves spreading petiolate, blade lanceolate, up to 50 mm long and 22 mm wide, acute; petiole up to 28 mm. Inflorescence erect, subdensely many-flowered. Peduncle up to 85 mm long with 2 to 3 sterile bracts at

214 the base of the rachis. Fertile bracts linear-lanceolate, up to 10.5 mm long and 3 mm wide. Flower opening less spreading, brownish. Sepals hairy; dorsal sepal cucullate, narrowly ovate-lanceolate, somewhat oblique, up to 8 mm long and 4 mm wide, acute; lateral sepals ovate-lanceolate, up to 7 mm long and 3.5 mm wide. Petals obliquely rhombic to narrowly spatulate, up to 8 mm long and 3 mm wide. Labellum up to 4 mm long and 5 mm wide; mentum cordate, not distinctly long; apex linear, more or less recurved; disc hairy inside. Column cuneate, up to 5.5 mm long and 1.5 mm wide.

Rostellum present. Anther 1, attached apically. Ovary sessile, up to 10 mm long.

Specimen used in the multivariate analyses (‘Schlectendaliana’):

Sumatra: West Sumatra; Gn Malintang, 24 Jul 1918, H.A.B. Bunnemeijer 3913 (BO);

West Sumatra; G. Kerinci, 6 May 1929, H.A.B. Bunnemeijer 10111; Aceh; Gajah in Alos landen; 1904, Pringo Atmadjo 77 (BO); Gajolanden ; Losir massief; bivak 2 near 3; Lau

Alas bovenloop, 29 June 1937, C.G.G. J. van Steenis 8435 (L); West Sumatra; Padang

Panjang; 24 May 1906, A Ernst 841 (L).

Specimens examined:

Indonesia: North Sumatra: Atjeh: Gunung Leuser Nature Reserve, Gunung Ketambe and vicinity, 8-15km SW from the mouth of Lau Ketambe, c. 40 km NW of Kutatjane, Aug

17, 1972, W.J.J.O de Wilde and B.E.E. de Wilde-Duyfjes 14342 (L); Atjeh: Gunung

Leuser Nature Reserve, Climbing Gunung Leuser West top, from Penosan via Putjuk

Angasan, ca. 25km SW of Blang Kedjeren, ca. 16-1800m alt., 31 Mar 1975, W.J.J.O de

Wilde and B.E.E. de Wilde-Duyfjes 15932 (L); Atjeh: Gunung Leuser Nature Reserve,

215 Climbing Gunung Leuser West top, from Penosan via Putjuk Angasan, ca. 25km SW of

Blang Kedjeren, ca. 16-1800m alt., camp 4-5, 4 Apr 1975, W.J.J.O de Wilde and B.E.E. de Wilde-Duyfje 16089 (L); Gajoe et Alas Landen, 1904, van Daalen 83 (L); Gajoe et

Alas Landen, 21 Feb 1904, van Daalen s.n. (L); Central Sumatra: Payakumbuh: Mt. Sago near Payakumbuh, alt ca. 1400, 19 Aug 1956, W. Meijer 5292 (L); Mt. Malintang, 26 Jul

1918, H.A.B. Bunnemeijer 3979 (BO, L); Mt. Malintang, 29 Jul 1918, H.A.B.

Bunnemeijer 4037 (BO, L); Mt. Malintang, 1 Aug 1918, H.A.B. Bunnemeijer 4182 (BO);

Mt. Malintang (Gn. Sago), 8 Aug 1918, H.A.B. Bunnemeijer 4360 (L); Mt. Kerintji, 21

Apr 1920, H.A.B. Bunnemeijer 9649 (BO); Mt. Kerintji, 28 Apr 1920, H.A.B.

Bunnemeijer 9733 (BO, L); Mt. Kerintji, 5 May 1920, H.A.B. Bunnemeijer 10076 (BO,

L); W Sumatra: District Pesisir Selatan Kerintji: Mt. Kerintji, Mt. Forest near bivacque

Pondok Patject, 2000 m.s.m., 26 Jul 1956, W. Meijer 6183 (L); Sumatra: Eajoe Loeas, R.

Pringo and Atmodjo 167 (L); Sumatra, Dairi km 115, 11 Mar 1962, Otto-Surbeck 301

(L).

Note:

Unknown whether the type specimen was ever currated; in the original paper, there is no specimen designated.

Habitat:

Mountainous shady and wet forests.

Distribution:

Indonesia: Sumatra. India: Sikkim. China: Hunan Province. Japan: Yokosko, Nagasaki.

216 Figure 5.10. Map: Distribution of Goodyera reticulata subsp. schlectendaliana in Indonesia

217 Figure 5.11. Plate: Goodyera reticulata subsp. schlectendaliana (by Subari, BO)

218 Figure 5.12. Photo: Goodyera reticulata subsp. schlectendaliana [Sumatra: West Sumatra: Mt. Singgalang)

219 c. Goodyera reticulata subsp. pusilla (Blume) Juswara, comb. et stat. nov. Goodyera pusilla Blume., Coll. Orch. Arch. Ind. Jap.: 36 (1859). Orchiodes pusillum (Bl.) O.

Kuntze, Rev. Gen. Pl. : 674 (1891). Epipactis pusilla (Bl.) Eat. Proc. Biol. Soc.

Washington 21: 65 (1908).

Type: Indonesia: Java: Gunung Pangrango, Blume, C.L. s.n. (holo L)

Description:

Terrestrial attenuate herb to 5 cm tall. Rhizome decumbent, rooted at nodes. Scape ascending, leafy in the proximal half, racemose above. Leaves spreading petiolate, blade lanceolate, up to 23.75 mm long and 10.5 mm wide, acute; petiole up to 8 mm.

Inflorescence erect, subdensely many flowered. Peduncle up to 40 mm long with 2 to 3 sterile bracts at the base of the rachis. Fertile bracts linear-lanceolate, up to 10 mm long and 2 mm wide. Flower opening less spreading, brownish. Sepals hairy; dorsal sepal cucullate, narrowly ovate-lanceolate, somewhat oblique, up to 2.5 mm long and 1.5 mm wide, acute; lateral sepals ovate lanceolate, up to 3.5 mm long and 1.5 mm wide. Petals obliquely rhombic to narrowly spatulate, up to 2 mm long and 0.5 mm wide. Labellum up to 2 mm long and 1 mm wide; mentum cordate, not distinctly long; apex linear, more or less recurved; disc hairy inside. Column cuneate, up to 1.5 mm long and 0.5 mm wide.

Rostellum present. Anther 1, attached apically. Ovary sessile, up to 8 mm long.

Specimen used in the multivariate analyses (‘Pusilla’):

220 Java; West Java; Sukabumi; Cikaniki; Gunung Halimun National Park, 1 Feb 2001, L.

Juswara 35 (BO); Sukabumi; Boven Tjibodas; Rawah Gajonggong; G. Gede, 1 April

1950, J.S. van Ootstroom 13455 (L). Sumatra; Atjeh Gajolanden; van Paloh naag

Kongke; 4 March 1937, C.G.G.J. van Steenis 9432 (BO).

Specimens examined:

Java: West Java: Sukabumi: Cikaniki, Halimun National Park, 23 Apr 2002, L. Juswara 119

(BO). Sumatra: South Sumatra: Palembang, Herb. Hort. Bot. Bog. 82 (L). Irian Jaya: Mt.

Cycloop, path Dozai-Dafonsero, top of Mt. Dafonsero (Netherlands New Guinea, distr.

Hollandia), 31 Jul 1961, P. van Royen & H. Sleumer 6359 (L); Mt. Cycloop, path Dozai-

Dafonsero, top of Mt. Dafonsero, N of Dozai (Netherlands New Guinea, distr. Hollandia), 3 Aug

1961, P. van Royen & H. Sleumer 6428 (L).

Note:

Specimens of Goodyera venusta described by Schlechter from PNG are very similar to G. reticulata var. pusilla from Java. Examination of four herbarium specimens from PNG suggested that they cannot be separated (PNG: Enga Province, Porgera District, Paiela Census Division,

Pagupiale valley, 21 Jul 1982. T.M. Reeve 4739 (L, NSW); Enga Province, Porgera District,

Paiela Census Division, near Korombi, Teyonongo, 19 Jul 1982. T.M. Reeve 4687 (L, NSW).

Habitat:

Mountainous, wet, shady forests.

Distribution:

Indonesia: Irian Jaya, Java, and Sumatra. PNG.

221 Figure 5.13. Map: Distribution of Goodyera reticulata subsp. pusilla in Indonesia

222 Figure 5.14. Plate: type specimen Goodyera reticulata subsp. pusilla (L) (from Leiden

Herbarium)

223 Figure 5.15. Photo: Goodyera reticulata subsp. pusilla (L) [Java: Banten Prov.: Mt.

Karang]

224 d. Goodyera reticulata subsp. gemmata (J.J. Sm.) Juswara, comb. et stat. nov.

Goodyera gemmata J.J. Sm. Bull Dep. Agric. Neerl. 22: 10 (1909)

Type: Locality: Unknown. Cult. Hort. Bog. No. 303 (iso L).

Description:

Terrestrial attenuate herb to 6.5 cm tall. Rhizome decumbent, rooted at nodes. Scape ascending, leafy in the proximal half, racemose above. Leaves spreading petiolate, blade lanceolate, up to 57.71 mm long and 20.85 mm wide, acute; petiole up to 20.75 mm.

Inflorescence erect, subdensely many flowered. Peduncle up to 80 mm long with 2 to 3 sterile bracts at the base of the rachis. Fertile bracts linear-lanceolate, up to 4.5 mm long and 1.5 mm wide. Flower opening less spreading, brownish. Sepals hairy; dorsal sepal cucullate, narrowly ovate-lanceolate, somewhat oblique, up to 3 mm long and 1.5 mm wide, acute; lateral sepals ovate-lanceolate, up to 3 mm long and 2 mm wide. Petals obliquely rhombic to narrowly spatulate, up to 3 mm long and 1 mm wide. Labellum up to 1 mm long and 1.3 mm wide; mentum cordate, not distinctly long; apex linear, more or less recurved; disc hairy inside. Column cuneate, up to 2 mm long and 0.5 mm wide.

Rostellum present. Anther 1, attached apically. Ovary sessile, up to 5 mm long.

Specimen used in the multivariate analyses (‘Gemmata’):

Sumatra: North Sumatra; Karo, 15 May 1925, J.A. Lorzing 13640 (BO);

Specimens examined:

225 Borneo: East Kalimantan; Gunung Buntung, 5 Jan 1981, K. Masahiro and H. Wiriadinata

5383 (BO). Sumatra: Batang Paluepah (plant was culture in Hort. Bog.) (L).

Note:

--

Habitat:

Mountainous shady, wet forest.

Distribution:

Indonesia: Kalimantan and Sumatra.

226 Figure 5.16. Map: Distribution of Goodyera reticulata subsp. gemmata in Indonesia

227 Goodyera reticulata subsp. gemmata

Figure 5.17. Plate: Goodyera reticulata subsp. gemmata (from Herbarium Bogoriense)

228 Figure 5.18. Photo: Goodyera reticulata subsp. Gemmata [Sumatra: North Sumatra: Mt. Sinabung]

229 e. Goodyera reticulata subsp. gibbsiae (J.J.Sm) Juswara. comb. et stat. nov.

(‘Arfakensis’)

Goodyera arfakensis J.J. Sm. Nova Guinea 14:349 (1929). Goodyera gibbsiae J.J. Sm.

Bull. Jard. Bot. Buitenzorg, ser. III, Vol. V, Livr. 1 (1922-1923).

Type: Indonesia: North West Irian Jaya: Mt. Arfak, Angi Lakes, terrestrial under edge of forest patch by ♀ lake, 7000’. Fl. Dec. L.S. Gibbs 5571. (Holo BO; iso K). That is what stated in the literature. I will leave the name like that.

Description:

Terrestrial attenuate herb to 12 cm tall. Rhizome decumbent, rooted at nodes. Scape ascending, leafy in the proximal half, racemose above. Leaves spreading petiolate, blade lanceolate, up to 29..75 mm long and 9.75 mm wide, acute; petiole up to 14.3 mm.

Inflorescence erect, subdensely many flowered. Peduncle up to 50 mm long with 2 to 3 sterile bracts at the base of the rachis. Fertile bracts linear-lanceolate, up to 6.25 mm long and 1.25 mm wide. Flower opening parallel, brownish. Sepals hairy; dorsal sepal cucullate, narrowly ovate-lanceolate, somewhat oblique, up to 2.5 mm long and 1 mm wide, acute; lateral sepals ovate-lanceolate, up to 2.5 mm long and 1 mm wide. Petals obliquely rhombic to narrowly spatulate, up to 2.5 mm long and 1 mm wide. Labellum up to 1 mm long and 0.625 mm wide; mentum cordate, not distinctly long; apex linear, more or less recurved; disc hairy inside. Column cuneate, up to 1.5 mm long and 0.5 mm wide. Rostellum present. Anther 1, attached apically. Ovary sessile, up to 5 mm long.

230 Specimen examined for the multivariate analyses (‘Arfakensis’):

Indonesia: North West Irian Jaya: Mt. Arfak, Angi Lakes, terrestrial under edge of forest patch by ♀ lake, 7000’. Fl. Dec. L.S. Gibbs 5571. (BO, K).

Habitat: Mountainous tropical rain forests.

Distribution: Irian Jaya (Arfak Mountain)

231 Figure 5.19. Map: Distribution of Goodyera reticulata subsp. gibbsiae in Indonesia

232 Figure 5.20. Plate: Goodyera reticulata subsp. gibbsiae (by Subari, BO)

233 f. Goodyera reticulata subsp. colorata (Blume) Juswara, comb et. stat. nov.

Neottia colorata Blume, Bijdr. : 409 (1825).

Spiranthes colorata (Blume) Hassk., Cat. Hort. Bog. Alt. : 47 (1844).

Orchiodes coloratum (Blume) O.Kuntze, Rev. Gen. Pl: 674 (1891).

Epipactis colorata (Blume) Eat., Proc. Bio. Soc. Washington 21: 63 (1908).

Type: Indonesia.: Mountain Salak, Tjiapus, Blume s.n. (holo L).

Description:

Terrestrial attenuate herb to 8 cm tall. Rhizome decumbent, rooted at nodes. Scape ascending, leafy in the proximal half, racemose above. Leaves spreading petiolate, blade lanceolate, up to 29.5 mm long and 12 mm wide, acute; petiole up to 15 mm.

Inflorescence erect, subdensely many flowered. Peduncle up to 19 mm long with 2 to 3 sterile bracts at the base of the rachis. Fertile bracts linear-lanceolate, up to 6.5 mm long and 2 mm wide. Flower opening less spreading, brownish. Sepals hairy; dorsal sepal cucullate, narrowly ovate-lanceolate, somewhat oblique, up to 3 mm long and 1.5 mm wide, acute; lateral sepals ovate-lanceolate, up to 3 mm long and 2 mm wide. Petals obliquely rhombic to narrowly spatulate, up to 3 mm long and 1.5 mm wide. Labellum up to 1 mm long and 1 mm wide; mentum cordate, not distinctly long; apex linear, more or less recurved; disc hairy inside. Column cuneate, up to 2 mm long and 1 mm wide.

Rostellum present. Anther 1, attached apically. Ovary sessile, up to 5 mm long.

Specimens used in the multivariate analyses (‘Colorata’):

234 Java: West Java: Cianjur: Mt. Pangrango (updated locality based on the most recent local information), 6 Apr 1894, Schiffner, V. 1767 (L).

Specimens examined:

Java: West Java: Papandayan (L); Sukabumi, Halimun National Park, Cikaniki, 29 Jan

2001, L.S. Juswara 28 (BO); Bogor (Boitenzorg, plant specimen was cultured Herb. Hort.

Bot. Bog. and part of it was collected as this herbarium specimen) (BO); Bogor: Crese in

Tjiapus (plant specimen was cultured in Hort. Bog. and some part of it was collected as this herbarium specimen), (BO); East Java: Loemadjang, E. Connell s.n. (BO).

Habitat:

Mountainous, shady, wet forests.

Distribution:

Indonesia: Java

235 Figure 5.21. Map: Distribution of Goodyera reticulata subsp. colorata in Indonesia

236 Figure 5.22. Plate: Goodyera reticulata subsp. colorata (by Subari, BO)

237 A B

Figure 5.23. (A). Photo: Type of Goodyera reticulata subsp. colorata. (from Leiden

Herbarium) (B) From : Collection des Orchidées les plus remarquables de l'archipel

Indien et du Japon (1858)

238 Literature Cited

Agnarrson, I. and Miller, J.A. 2008. Is ACCTRAN better than DELTRAN? Cladistics

24: 1-7.

Àlvarez-Molina, A. and Cameron, K.M. 2009. Molecular phylogenetics of Prescottiinae

s.l. and their close allies (Orchidaceae, Cranichideae) inferred from plastid and

nuclear ribosomal DNA sequences. American Journal of Botany 96: 1020-1040.

Anderberg, A. and Tehler, A. (1990). Consensus trees, a necessity in taxonomic

practice. Cladistics 6: 399-402.

Anderson, A.J.B. 1971. Ordination methods in ecology. Journal Ecology 59: 713-726.

Arditti, J. 1992. Mycorrhiza. Fundamentals of Orchid Biology. John Wiley & Sons,

Inc., New York.

Aubreville, A. and Lorey, J.F. 1977. Goodyera R.Br. Flore De La Nouvelle Caledonie.

Museum National D’Histoire Naturelle. Paris.

Baldwin, B.G. 1992. Phylogeny utility of the internal transcribed spacers of nuclear

ribosomal DNA in plants: an example from the Compositae. Molecular

Phylogeneics and Evolution 9: 522-559.

______. 1993. Molecular phylogenetic of Calycadenia (Compositae) based on ITS

sequences of nuclear ribosomal DNA: chromosomal and morphological evolution

reexamined. American Journal of Botany 80: 222-238.

239 ______. 1995. The ITS region of nuclear ribosomal DNA: a valuable source of

evidence on Angiosperm phylogeny. Annals of the Missouri Botanical Garden 82:

247-277.

Baum, D. 1992. Phylogenetic species concepts. Trends in Ecology and Evolution 7: 1-

2.

Bentham, R. 1863. Flora Australiensis: a description of the plants of the Australian

Territory. Lovell Reeve & Co., London.

Blume, C.L. 1825. Javaansche Orchideen, Bijdragen tot de Flora van Neder-landsch

India. pp. 407-409.

Blume, C.L. 1858. Goodyera bifida. Collection des orchidees les plus remarquable de

l’Archipel Indien et du Japon. p. 40.

______. 1858. Goodyera colorata. Collection des orchidees les plus remarquable de

l’Archipel Indien et du Japon. p.37.

Brooks, D. R. 1981. "Hennig's parasitological method: a proposed solution." Systematics

Zoology 30: 220-249.

Brown, R. 1813. Goodyera Brown mss. Aiton, L.W (ed), Hortus Kewensis or A

catalogue of The Plants Cultivated in The Royal Botanic Garden at Kew.

Longman, Hurst, Rees, Orme, and Brown, Paternoster Row. London.

Brown, R. 1913. Goodyera Brown mss. An Illustrated Flora of the North United States,

Canada and the British Possessions 2nd. New York, Charles Scribner’s sons.

Cameron, K.M., Chase, M. W., Whitten, M. W., Kores, P. J., Jarrell, D. C., Albert., V.

A., Yukawa, T., Hills, H. G., and Goldman, D. H. 1999. A phylogenetic analysis

240 of Orchidaceae: evidence from rbcL nucleotide sequences. American Journal of

Botany 86:208-224.

Camin, J.H. and Sokal, R.R. 1965. A method for deducing branching sequencing in

phylogeny. Evolution 19:311-326.

Chandler, G.T. and Crisp, M.D. 1998. Morphometric and phylogenetic analysi of the

Daviesia ulicifolia complex (Fabaceaem Mirbelieae). Plant Systematics and

Evolution 209: 93-122.

Chase, M. W., Cameron, K.M., Barrett, R.L., and Freudenstein, J.V. 2003. DNA data

and Orchidaceae systematics: a new phylogenetic classification. Orchid

Conservation. (Dixon, K.W., Kell, S.P., Barrett, R.L., and Cribb, P.J. (eds)).

Natural History Publications, Kota Kinabalu, Sabah.

Comber, J.B. 1990. Orchids of Java. Royal Botanic Gardens, Kew.

Comber, J.B. 2003. Orchids of Sumatra. Natural History Publications, Kota Kinabalu,

Sabah.

Cornell, D.S. 1978. Goodyera R.Br. Native Orchids of North America. Stanford

University Press. Stanford, California. pp. 320-240.

Cracraft, J. 1983. Species concepts and speciation analysis. Current Ornithology. R.F.

Johnson, New York Academi 1: 159-187.

Cribb, P.J. and Whistler, W.A. 1996. Goodyera. Orchids of Samoa. Royal Botanic

Garden, Kew. pp. 27-28.

Dearnaley, J.D.W. 2006. Fungal Endophytes in Australian Myco-hetrotrophic Orchids.

8th International Mycological Congress. Cairns, Australia, August 20-25, 2006.

241 de Pinna, M.C.C. 1991. Concepts and Tests of Homology in the Cladistic Paradigm.

Cladistics 7:367-394.

Dockrill, A.W. 1992. Goodyera R. Br. W. Aition (ed), Australian Indigenous Orchids

1:25-32. Surrey Beatty & Sons. Chipping Norton, NSW.

Doyle, J.J. and Doyle, J.L. 1987. A rapid DNA isolation procedure for small quantities

of fresh leaf tissue. Phytochemistry Bulletin 19: 11-15.

Dressler, R. L. 1981. The Orchids: Natural History and Classification. Cambridge

Massachusetts, Harvard University Press

Dressler, R.L. 1990. The Orchids: Natural History and Classification. Cambaridge

Massachusetts. Harvard University Press.

______. 1993. Phylogeny and Classification of the Orchid Family. Dioscorides

Press, Postland.

Farris, J. 1995. Constructing a significance test for incongruence. Systematic

Biology 44: 570-572.

Fedde, P.F. 1910. Goodyera becarii Schltr., nov. spec. Repertorium specierum

novarum regni vegetabilis. Wildersdorf, Berlin.

Felsenstein, J. 1985. Confidence limits on phylogenies: an approach using the bootstrap.

Evolution 39: 783-791.

Felsenstein, J. 2004. Inferring Phylogeny. Sinauer Associates, Inc. Sunderland,

Massachusetts.

Fisher, R.A. 1936. The use of multiple measurements in taxonomic problems. Annals of

Eugenics 7: 179-188.

242 Freudenstein, J.V. 1991. A systematic study of endothecial thickening in the

Orchidaceae. American Journal of Botany 78: 766-781.

Freudenstein, J.V. and Rasmussen, F.N. 1999. What does morphology tell us about

orchid relationships? A cladistic analysis. American Journal of Botany 21: 225-

248.

Garay, L.A. and Sweet, H.R. 1974. Goodyera R.Br. Orchids of Southern Ryukyu

Islands. Botanical Museum. Harvard University, Cambridge, Massachusetts.

Garcia, V.F. and Olmstead, R.G. 2003. Phylogenetics of Tribe Anthocercideae

(Solanaceae) based on ndhF and trnL/F sequence data. Systematic Botany 28:

609-615.

Gibbs, L.S. 1917. Goodyera (Eugoodyera) arfakensis J.J.S., sp.nov. Dutch N.W. New

Guinea: A contribution to the phytogeography. Archipel Drukkerij, Buitenzorg.

pp.108-109.

Gornall, R.J. 1997. Practical aspects of the species concept in plants. Species the Units

of Biodiversity. Claridge, H.A., Dawah, H.A., and Wilson, M.R. London,

Chapman and Ha.ll. The Systematic Association Special Vol 54: 171-190.

Hadley, G. 1982. Orchid mycorrhiza. Orchid Biology: Review and Perspective, ed. J.

Arditti, 2: 83-118. Ithaca: Cornell University Press.

Hair, J.F., Black, W.C., Babin, B.J., Anderson, R.E., and Tatham, R.L. 2005.

Multivariate Data Analysis. Pearson Prentice Hall, Upper Saddle River, New

Jersey.

Hooker, J.D. 1894. Goodyera R. Br. The Flora of British India. L. Reeve & Co., LTD.

Kent. pp. 111-114.

243 Huelsenbeck, J.P. and Crandall, K.A. 1997. Phylogeny estimation and hypothesis

testing using maximum likelihood. Annual reviews ecology and systematics 28:

437-66.

Huelsenbeck, J.P., Ronquist, F. Nielsen, R., Bollback, J.P. 2001. Bayesian Inference of

Phylogeny and Its Impact on Evolutionary Biology. Science 294: 2310-2314.

Hueselbeck, J.P. and Rannala, B. 2004. Frequenties properties of Bayesian posterior

probabilities of phylogenetic trees under simple and complex substitution models.

Systematic biology 53: 904-913.

Jukes, T.H. and Cantor, C.R. 1969. Evolution of protein molecules. Mammalian Protein

Metabolism. [Ed. Munro, H.N.]. Academic Press, New York. Pp. 21-132.

Juswara, L.S., Clements, M.A., Crisp, M.D., West, J.G., and Jones, D.L. Phylogenetic

analysis of Goodyera section Otosepalum and related taxa using morphology and

molecular ITS data. Master Thesis, The Australian National University,

Canberra, Australia.

Kelchner, S.A. and Wendel, J.F. (1996). Hairpins create minute inversions in non-

coding regions of chloroplast DNA. Current Genetics. 30:259-262.

Kelchner, S.A. and Clark, L.G. 1997. Molecular evolution and phylogenetic utility of

the chloroplast rpl16 intron in Chusquea and the Bambusoideae (Poaceae).

Molecular Phylogenetics and Evolution 8:385-397.

Kelchner, S.A. 2000. The evolution of non-coding chloroplast DNA and its application in

plant systematic. Annals of the Missouri Botanical Garden 87: 482-498.

Knudson, L. 1922. Non-symbiotic germination of orchid seeds. Botanical Gazette 73:

1-25.

244 Kores, P.J., Cameron, K. M., Molvray, M., and Chase, M. W. 1997. The phylogentic

relationships of Orchidoideae and Spiranthoideae (Orchidaceae) as inferred from

rbcL plastid sequences. Lindleyana 12:1-11.

Kristiansen, K.A., Taylor, D.L., Kjøller, R., Rasmussens, H.N., and Rosendahl, S. 2001.

Molecular Ecology 10: 2089-2093.

Kruskal, J.B. 1964a. Multidimensional scaling by optimization goodness of fit a

nonmetric hypothesis. Psychometrika 29:1-27.

Kruskal, J.B. 1964b. Nonmetric multidimensional scaling a numerical method.

Psychometrika 29:115-129.

Lanyon, S.M. 1985. Detecting internal inconsistencies in distance data. Systematic

Zoology 34: 397-403.

Lawler, L.J. 1984. Ethnobotany of the Orchidaceae. In Orchid biology: reviews and

perspectives, III (ed. J. Arditti), pp. 27-149.

Lemmon, A.R., Brown, J.M., Stanger-Hall, K., Lemmon, E.M. 2009. The effect of

Ambiguous data on phylogenetic estimates obtained by maximum likelihood and

Bayesian inference. Systematic Biology 58: 130-145.

Lewis, B. and Cribb, P. 1989. Goodyera R. Brown. In Orchids of Vanuatu. Kew Royal

Botanical Garden. Kew.

______. 1991. Goodyera R. Brown. In Orchids of the Salomon Islands and

Bougenville.

Lin, T.P. 1978. Native orchids of Taiwan 2. Southern Materials Center, Taipei, Taiwan.

Lindley, J. (1830-1840). The genera and species of orchidaceous plants. Ridgways,

London.

245 Linnaeus, C. 1753. Satyrium. Species Plantarum. Bernard Quaritch Ltd., London.

pp. 944-945.

Mayden, R.L. 1997. A hierarchy of species concepts: the denouement in the saga of the

species problem. Species: The Units of Biodiversity. Ed. Claridge, M.F., Dawah,

H.A., Wilson, M.R. Chapman & Hall. London, UK.

Mayr, E. 1963. Animal Species and Evolution. The Belknap Press of Harvard

University Press, Cambridge, Massachusetts. pp. 797.

McCormick, M., Whigham, D.F., Sloan, D., O’Malley, K., and Hodkinson, B. 2006.

Orchid fungus fidelity: a marriage meant to last? Ecology 87: 903-911.

McCune, B., and Grace, J.B. 2002. Analysis of Ecological Communities. MjM

Software Design. Gleneden Beach, Oregon, USA. pp. 300.

McNeil, T. 1979. Structural value: a concept used in the construction of taxonomic

classifications. Taxon 28: 481-504.

Milligan, G.W. and Cooper, M.C. 1988. A study of standardization of variables in

cluster analysis. Journal of classification 5: 181-204.

Mᴓller, J.D. and Rasmussen, H. 1984.Stegmata in Orchidales: character state distribution

and polarity. Botanical Journal of the Linnean Society 89: 53-76.

Nickrent, D.L. and Soltis, D.E. 1995. A comparison of Angiosperm phylogenies from

nuclear 18S rDNA and rbcL sequences. Annals of the Missouri Botanical Garden

82: 208-234.

Nixon, K.C. and Wheeler, Q.D. 1990. An amplication of the phylogenetic species

concept. Cladistics 6: 211-223.

Ohwi, J. 1937. Goodyera yaeyamae. Journal of Japanese Botany 13: 439.

246 Otero, J.T., Ackerman, J.D., and Bayman,P. 2002. Diversity and host specificity of

endophyte Rhizoctonia-like fungi from tropical orchids. American Journal of

Botany 89: 1852-1858.

Page, R.D. M. and Charleston, M.A. 1997. From gene to prganismal phylogeny:

reconciled trees and the gene tree/species tree problem. Molecular Phylogenetic

and Evolution 7: 231-240.

Palmer, J.D. Jansen, R.K., Michaels, H.J., Chase, M.W., and Manhart, J.R. 1988.

Chloroplast DNA variation and plant phylogeny. Annals of the Missouri

Botanical Garden 76: 1180-1206.

Paterson, H.E.H. 1985. The recognition concept of species. Species and Speciation.

E.S. Vrba. South Africa, Transvall Museum. pp: 21-29.

Pfitzer, E. 1889. Orchidaceae. Die Naturlichen Pfanzenfamilien, II. Teil., 6. E,a, K.

Prantl. Abteilung, Leipzig. pp: 52-218.

Porembski, A.M. and Barthlott, W. 1988. Valeman radicum micromophology and

classification of Orchidaceae. Nordic Journal of Botany 8: 117-137.

Posada, D. and Buckley, T.R. 2004. Model selection and model averaging in

phylogenetics: advantages of Akaike information criterion and Bayesian

approaches over likelihood ratio tests. Systematic Biology 53:793-808.

Posada, D. and Crandall, K.A. 1998. MODELTEST: testing the model of DNA

substitution. Bioinformatics Application Note Vol. 14: 817-818.

Prentice, I.C. 1977. Non metric ordination methods in ecology. Journal of Ecology 65:

537-546.

247 Pridgeon, A.M. 1987. The Velamen and exodermis of orchid roots. J. Arditti [Ed.],

Orchid Biology, reviews and perspectives, IV, 139-192. Comstock, Cornell

University Press, Ithaca, NY.

Pridgeon, A.M., Cribb, P.J., Chase, M.W., and Rasmussen, F.N. 2003. Genera

Orchidacearum Vol. 3: Orchidoideae (Part II) Vanilloideae. Oxford University

Press.

Rao, V.S. 1974. The relationships of the Apostasiaceae on the basis of floral anatomy.

Botanical journal of Linnean Society 68: 319-327.

Rasmussen, F.N. 1982. The gynostemium of the neottioid orchids. Opera Botanica, 65: 1-

96.

Rasmussen, F.N. 1986. On the various contrivances by which pollinia are attached to

viscidia. Lindleyana 1: 21-32.

Rasmussen, H.N. 1995. Orchid Mycorrhiza. Terrestrial orchids from seed to

mycotrophic plant. Cambridge University Press. Pp.142-173.

R Development Core Team. 2005. R: A language and environment for statistical

computing, reference index version 2.2.1. R Foundation for Statistical

Computing, Vienna, Austria. ISBN 3-900051-07-0, URL http://www.R-

project.org.

Reichenbach. 1849. Goodyera schlectendaliana. Linnaea 22:861.

Remane, A. 1952. Die Grundlagen des Naturlichen System der Vergleichenden

Anatomie under der Phylogenetic. Geest und Portig K.G., Leipzig.

Ridley, H.N. 1886. Goodyera papuana. Brittenm J. (ed), The Journal of Botany British

and Foreign. West, Newman & Co., London. pp. 355.

248 Ronquist, F., Helsenbeck, J.P., and der Mark, P. 2005. MrBayes 3.1. Manual (draft,

5/26, 2005).

Salazar, G.A., Chase, M.W., Soto-Arenas, M.A., Ingrouille, M. 2003. Phylogenetics of

Cranichideae with Emphasis on Spiranthinae (Orchidaceae, Orchidoideae):

Evidence from plastid and nuclear DNA sequences. American Journal of Botany

90: 777-795.

Schlechter, R. 1906. Goodyera triandra. Bulletin De L’Herbier Boissier 2nd series: 298.

______. 1911. The Orchidaceae of German New Guinea (English translation

1982). The Australian Orchid Foundation, Melbourne. pp. 113-116.

______. 1914. The Orchidaceae of German New Guinea (English translation

1982). The Australian Orchid Foundation, Melbourne. pp. 43-53.

______. 1926. Das System der Orchidaceen. Notizblatt des Botanischen Gartens

und Museums zu Berlin-Dahlem 9: 563-591.

______. 1932. Afrikanische und madagassische Orchideen. Blutenanalysen neuer

Orchideen. Selbstverlag des Herausgebers, Dahlem bei Berlin. pp. 7.

Schuh, R.T. 2000. Biological Systematics: Principles and Applications. Cornell

University Press. Ithaca, New York. pp. 64.

Seidenfaden, G. and Smitinand, T. 1959. Goodyera R.Br. The Orchids of Thailand: A

Preliminary List. The Siam Society. Bangkok. pp. 75-79.

______. and Wood, J.J. 1992. Goodyera. The Orchids of Peninsular Malaysia and

Singapore. Olsen & Olsen, Fredensborg. pp. 58-63.

Shinozaki, K., Ohme, M., Tanaka, T., Wakasugi, N. Hayashida, T., Matsubayashi, N.,

Zaita, J. Chunwongse, J., Obokata, K., Yamaguchi-Shinozaki, C. Ohto, K.,

249 Torazawa, B., Meng, Y., Sugita, M., Deno, H., Kamagoshira, T., Yamada, K.,

Kusuda, J., Takaiwa, F., Kato, A., Tohdoh, N., Shimada, H., Sugiura, M. 1986.

The complete nucleotide sequence of the tobacco chloroplast genome: its

organization and expression. EMBO Journal 5: 2043-2049.

Smith, J.J. 1905. Goodyera rubicunda. Die Orchideen Von Java 6: 121. E.J. Brill,

Leiden.

______. 1909. Goodyera gemmata J.J. Smith. n. sp. Bulletin du Department de

l’Agriculture auz Indes Neerlandaises 22: 10.

______. 1922-23. Goodyera gibbsiae J.J.S. nom. nov. Bulletin du Jardin

Botanique. Van Leeuwen, W.M.D., Von Faber, F.C., Smith, J.J. (eds). Series III,

Vol V. Archipel Drukkerij, Buitenzorg.

Sneath, P.H.A. and Sokal, R.R. 1973. Numerical Taxonomy: Taxonomic structure. W.H.

Freeman. San Fransisco, pp. 187-308.

Sokal, R.R. and Rohlf, F.J. 1962. The comparison of dendrograms by objective

methods. Taxon: 33-40.

Stern, W.L., Aldrich, H.C., McDowell, et al., L.M. Morris, M.W., and Pridgeon, A.M.

1993. Amyloplasts from cortical root cells of Spiranthoideae (Orchidaceae).

Protoplasma 172: 49-55.

Stuessy, T.F. 1990. Plant Taxonomy: The Systematic Evaluation of Comparative Data.

Columbia University Press, New York. pp.514.

Swartz, O. 1800. Genera at Species orchideanum systematice coordinatarum. Kongl.

Svenska Vetenskaps Academiens Handlingar.

250 Swofford, D.L. 2002. Phylogenetic Analysis Using Parsimony Version 4.0. Laboratory

of Molecular Systematics, Smithsonia Institution.

Swofford, Olsen, Waddell and Hillis, D.M. 1996. Phylogenetic Inference. Molecular

Systematics 2nd Ed. (Editors: Hillis, D.M., Moritz, C., Mable, B.K.). Sinauer

Associates, Inc. Publishers. Sunderland, Massachusetts. pp. 407-514.

Szhlachetko, D.L. 1995. Systema Orchidalium. Fragmenta Floristica et Geobotanica

Supplement 3:1-152.

Szlachetko, D.L. and Rutkowski, P. 2000. Subfamily Spiranthoideae Dressl.

Gynostemia Orchidalium I. Acta Botanica Fennica 169: 176-228.

Taberlet, P., Gielly, L. Pautou, G., and Bouvet, J. 1991. Universal primers for

amplification of three non-coding regions of chlroplast DNA. Plant Molecular

Botany 17: 1105-1109.

Tanaka, M. Wakasugi, T., Sugita, M., and Shinozaki, K. 1986. Genes for the eight

ribosomal proteins are clustered on the chloroplast genome of tobacco (Nicotiana

tobacum): Similarity to the S10 and spc operons of Escherichia coli. Proceedings

of the National Academy of Sciences 83: 6030-6034.

Taylor, D.L., Bruns, T.D., Szaro, T.M., and Hodges, S.A. 2003. Divergence in

mycorrhizal specialization within Hexalectris spicata (Orchidaceae), a

nonphotosynthetic desert orchid. American Journal of Botany 90: 1168-1179.

Templeton, A.R. 1989. The meaning of species and speciation: A genetic perspective.

Speciation and its Consequences. D. and E. Otte, J.A. Massachusetts, Sinauer

Associates Inc. Publishers Sunderland: 3-27.

251 Thompson, J.D., Higgins, D.G., and Gibson, T.J. 1994. Clustal W: improving the

sensitivity of progressive multiple sequence alignment through sequence

weighting, position-specific gap penalties and weight matrix choice. Nucleic

Acids Research 22: 4673-4680.

Thwaites, G.H.K. 1858. Goodyera R.Br. Enumeratio Plantarum Zeylaniae: An

Enumeration of Ceylon Plants. Dulau & Co. London. pp. 313-314.

Van Valen, L. 1976. Ecological species, multispecies and oaks. Taxon 25: 233-239.

Ward, J.M. 1993. Systematics of New Zealand Inuleae (Compositae-Asteraceae)-2 A

numerical phenetic study of Raoulia in relation to allied genera. New Zealand

Journal of Botany 31: 29-42.

Weins, J.J. and Reeder, T.W. 1995. Combining data sets with different numbers of taxa

for phylogenetic analysis. Systematic Biology 44: 548-558.

White, T.J., Bruns, T., Lee, S. and Taylor, J. 1990. Amplification and Direct Sequencing

of Fungal Ribosomal RNA Genes for Phylogenetics. PCR Protocols: A Guide to

Methods and Applications. [Eds. Innis, M.A., Gelfand, D.H., Sninsky, J.J.,

White, T.J.] . Academic Press, Inc. San Diego, California. pp 315-322.

William, N.H. and Broome, C.R. 1976. Scanning electron microscope studies of orchid

pollen. American Orchid Society Bulletin 45: 699-707.

Worapong, J.; Inthararaungsorn, S., Strobel, G.A., Hess, W.M. 2003. A new record of

Pestalotiopsis theae, existing as an endophyte on Cinnamomum iners in Thailand.

Mycotaxon 88: 365-372.

252 Wolfe, K.H., Li, W.H., and Shape, P.M. 1987. Rates of nucleotide substitution vary

greatly among plant mitocondrial, chloroplast, and nuclear DNAs. Proceedings of

the National Academy of Sciences of the USA 84: 9054-9058.

Wood, J.J., Cribb, P.J., Thorne, A. and Thomas, S. 1994. Goodyera R. Br. A check-list

of the Orchids of Borneo. Kew Royal Botanical Garden. Kew. pp. 54-55.

Zwickl, D.J. 2006. Genetic algorithm approaches for the phylogenetic analysis of large

biological sequence datasets under the maximum likelihood criterion. PhD.

Dissertation, The University of Texas at Austin.

253 APPENDICES

254 Appendix A. New nuclear ITS sequences and alignment used in phylogenetic analyses

255 60

Goodyera_bifida_G74 TTGGAGCTAC AAA-GAAAA- --GATGGAAG GAAAAA-TAA C-TCGGG-CG CAGTTA-TGT Gbifi_G55 ...... T-.....- --...... -... .-.....-...... -... GviriMkAU ...... G... ..T-.....- --...... -... .-.....-...... -... GfumThai ...... G... ..T-.....- --....A...... -... .-.....-...... -... Gclav_G44 ...... G.C. ..T-.....- --...... -... .-.....-...... -... GpolygoMkAu ...... G... ..T-.....- --...... -... .-.....-...... -... GhachiYkwJpn ...... T-.....- --...... AA.. .-....--...... G-..C GproYkwJpn .C....A... ..T-.....- --...... G...-A.. .-....--.. .G....-... Gcar_G103 ...... AT. ..TT.....- --...... -.TT .T.T...-...... TA..C GschlecYkwJpn .C..G...... T-.....- --...... -... .-.....-...... -...

GdrepMenIndia ...... T-.....- --...... -C.. .-.....-...... -... Gtesse_G149 ...... T-.....- --...... -C.. .-.....-...... -...

2 GoblongMarkAu ...... T-.....- --...... -... .-.....-...... -... 5

6 GdschlecMkAU .C..G...... T-.....- --...... -... .-.....-...... -... Grota_G132 .C..G...... T-.....- --...... -... .-.....-...... -... Anoelance_G70 .C..G...... T-.....- --...... -... .-.....-...... -... Zeuviri_G57 ...A...... T-....T- --...... T. T.....-... .-.....-...... -..C Ligeophila_G88 ...... T... ..T-.....- --...... -.C. .-.....-...... T-... Hyllophylla_G90 ...... T-.....- --...... AA.. .-.....-...... -... GfolvarmaxiYkwJpn ...... T-.....- --...... -... .-.....-...... -...

GvelutYkwJpn ...... T-.C...- --...... -... .-.....-...... -... Go_HOC474_G63 ...... T-.....- --...... -A.. .-....--...... G-..C GhisRedKRI ...... T-.....- --...... -C.. .-C....-...... -... Gdhispwhite ...... T-.....- --...... -C.. .-C....-...... -... Herpysmalongicaulis_210 ...A...... T-.....- --...... -... T-.....-...... -... CysJohncol_G65 ...A...... T-.....- --...... -A.. .-A....-...... -..C Cyssteno_G76 ...A...... T-.....- --C...... -A.. .-A....-.. .TTG..-..C Cheirostylis_G153 ...... T. ..T-..TG.- --...... T. TT....AC.. AA.....-.. .G..C.-... Hetoblo_G51 ...A....G. ..T-.....- --...... T. .G....-A.. .-.....-...... -... HetoblMkAU ...A....G. ..T-.....- --...... T. .G....-A.. .-.....G...... -... 60 Gvitat_G62 .C.A..T... ..T-...C.A --...... --C.. .-.....-...... -... Mymerchis_gracilis_G180 ...A...... T-.....- --...... -C.. .-.....-...... -... GclaKRI ...A...... T-.....- --...... -C.. .-.....-...... -... Anoecgreen_G68 .C.A..T... ..T-.....- --...... -C.. .-.....-...... -... Ludnigr_G66 .C.A..T... ..T-.....- --...... --C.. .-.....-...... -... Pristiglottis_G207 .C.A....G. ..T-.....- --...... -... .-....--...... -... Anoebrev_G67 ...AG..A.. ..T-A....- --...... G...... -C.. .-.....-...... G-..C Anoectochilus_longicalcaratus_G99 ...AG..A.. ..T-A....- --...... G...... -C.. .-.....-...... G-..C Maclewii_G96 ...AG..A.. ..T-A....- --...... G...... -C.. .-.....-...... G-..C Mcdessan_G125 C..AG..AG- G.T-A....- --...... G...... -CG. .-.....-...... G-..C 2

5 Anoesetaceus_G78 ...AG..A.. ..T-A....- --...... G...... -C.. .-.....-...... G-..C 7 Blacepi_G124 ...AG..A-- -.T-A....- --...... -C.. .-.....-...... G-..C Macsand_G77 .C.A...... G.T-.....- --T...... C.-C.. .-.....-.. ...C..-... Hetcris_G47 ...AG...... T-A....- --...... -C.. .-....--...... T-... Sarcog_G126 .CA..A.AT. ..---....- --.G..T... A.....--C. T-CTC..-.. .G.CGC-..C Zeuxinegracilis_G80 ...A...... G.T-...C.A AA...... T. T.....-C.. .-.....-.. ...G..-..C Cyclin_G127 .C..G..AT. -.--.....- --.G...CT. A.....--C. A-.....-.. .G.ACC-..C Spiranthesodorata_G152 .C..G..AT. -.T-A.TG-- --.G....T. C..CCTA.C. A-.T...-.. .C.CGC-C.C Pristiglottis_G182 .C------.....- --...... -... .-....--...... -... Gdaib_G98 CC..G...... T-.....- --...... -... .-...C.-...... -...

Herpyrub_G97 ...A...... T-.....- --...... -... T-.....-...... -... 120

Goodyera_bifida_G74 GCCAAGGA-A GTATGCTG-C ATTAGC-ATC -GATGGC-CA TT--CGTAAA AA-G-CCCGG Gbifi_G55 ...... -...... -...... -... -...... -T. ..--...... -.-..... GviriMkAU ...... -...... G.-...... -... -...... -.. ..--..C... ..A.-..... GfumThai ...... -...... G.-...... -... C...... -.. ..--.AC... ..A.-..... Gclav_G44 ...... -...... G.-...... -... -...... -.. ..--..C... ..A.-..... GpolygoMkAu ...... A.-...... G.-...... -... -...... -.. ..--..C... ..A.-..... GhachiYkwJpn ...... -...... -...... -... -...... -T. ..--..C... ..-.-..... GproYkwJpn ...... -T ...... G.-. ..A...-.A. -..CCA.-T. CC--..CG.T ..A.-..T.A Gcar_G103 ...... TG ...... G.-...... TT... -..C...TT. ..--..C... ..A.-..... GschlecYkwJpn ...... -. T...... -...... -... -...... -T. .C--..C... ..-.-.....

GdrepMenIndia ...... -. T...AT..-...... -... -A.....-AT ..--T.C... ..-.-..... Gtesse_G149 ...... -. T...AT..-...... -... -A.....-T. ..--..C... T.-.-....A

2 GoblongMarkAu ...... -. T....T..-...... -... -...... -T. ..--..C... .TAA-....T 5

8 GdschlecMkAU ...... -. T...... -...... -... -A...A.-T. ..--..C... ..-.-..... Grota_G132 ...... -. T...... -...... -... -...... -T. .C--..C..T ..-.-..... Anoelance_G70 ...... -. T...... -...... -... -...... -T. .C--..C... ..-.-..... Zeuviri_G57 ...... -. TC...... -T ...G..-..T -...... -T. ..--...C.. .--.-.TT.T Ligeophila_G88 ...... -...... AA-G ..C...-... -....A.-A. ..--..C... .TA.-....T Hyllophylla_G90 ...... -...... TG.-...... -... -.....A-G. .ACC..C... ..AAA..... GfolvarmaxiYkwJpn ...... -...... -...... -... -...... -T. ..--...... -.-.....

GvelutYkwJpn ...... -...... -...... -... -...... -T. ..--...... -.-..... Go_HOC474_G63 ...... -...... -...... -... -...... -T. ..--..C... ..-.-..... GhisRedKRI ...... -...... -. .C....-..T -...... TT. ..--..C... ..-.-..... Gdhispwhite ...... -...... -...... -... -...... -T. ..--..C... ..-.-..... Herpysmalongicaulis_210 ...... -...... T..-...... -... -...... -T. ..--..CC.. .--.-..T.. CysJohncol_G65 ...... -. .A...T..-. ...G..-... -...... -.. ..--..CC.. .--.-....A Cyssteno_G76 ...C....-. CA...T.A-. T..G.A-... -C.....-.. ..--..CC.. .--A-....A Cheirostylis_G153 ...... -. A.G.....-. ...G..-... -...... -T. ..--..CCT. .--.-..... Hetoblo_G51 ...... -. ..G.....-. ...G..-... -...... -T. ..--..CC.. .--.-..TAC HetoblMkAU ...... -. ..G.....-. ...G..-... -...... -T. ..--..CC.. .--.-..TAC 120 Gvitat_G62 ...... -...... -. ..AG..-... -...... -T. ..--..GC.. .--.-..T.. Mymerchis_gracilis_G180 ...... -...... T..-. ...G..-... -...... -TC ..--..CT.. .--.-..-.T GclaKRI ...... -...... T..-. ...G..-... -...... -TC ..--..CT.. .--.-..-.T Anoecgreen_G68 ...... -...... -. ..AG..-... -...... -T. ..--..GC.. .--.-..T.. Ludnigr_G66 ...... -...... -. ..AG..-... -...... -T. ..--..GC.. .--.-..T.. Pristiglottis_G207 ...... -...... -. ..AGA.-T.. -...... -T. ..--..CC.. .--.-..T.A Anoebrev_G67 ...... -...... T..-. ...G..-... -....A.-T. ..--..CC.. .--.-..T.T Anoectochilus_longicalcaratus_G99 ...... -...... T..-. ...G..-... -....A.-T. ..--..CC.. .--.-..T.T Maclewii_G96 ...... -...... T..-. ...G..-... -....A.-T. ..--..CC.. .--.-..T.T Mcdessan_G125 ...... -...... T..-. ...GA.-... -....A.-T. ..--..CC.. .--.-..T.T 2

5 Anoesetaceus_G78 ...... -...... T..-. ...G..-... -....A.-T. ..--..CC.. .--.-..T.T 9 Blacepi_G124 ...... T-...... -. ...G..-... -....A.-T. ..--..CC.. .--.-....T Macsand_G77 ...... -...... -. ..AT..-... -..C...-T. ..--..CC.. .--.-..T.. Hetcris_G47 ...... -...... -...... -... -..A...-T. ..--..CC.. .--.-.-.TT Sarcog_G126 C..G....-C TC--.G..T. CCCCC.-..G -.GC.T.-T. .C--..C... .--T-.T.A. Zeuxinegracilis_G80 ...... -. ACG.....-. ...GC.-T.. -.....T-T. ..--..CC.. .--.-..TTT Cyclin_G127 ...... -. .C--.T..T. .C....-..T --GC...-T. .C--..CTG. .--.-....A Spiranthesodorata_G152 ...... -. .C--.T..T. .C....-..T -....A.-T. .C--...GGG .--.-.T..A Pristiglottis_G182 ...... -...... -. ..AG..-... -...... -T. ..--..CC.. .--.-..T.- Gdaib_G98 ...... -. T...... -...... -... -...... -T. ..--..C... ..-.-....C

Herpyrub_G97 ...... -...... -...... -... -...... -T. ..--..CC.. .--.-..T.. 180

Goodyera_bifida_G74 CGGGGTT-AG C-G-GAT-TG CTGTTGTTGC TTTCT---AA GTATTG-TAT GA-CTCTCGG Gbifi_G55 ...... -.. .-.-...-...... ---...... -... ..-...... GviriMkAU T...... -.. .-.-..G-...... A... ..C..---...... -... ..-...... GfumThai T....C.-.. .-.-..G-...... C.A... ..C..---...... -... ..-...... Gclav_G44 T...... -.. .-.-..G-C...... A... ..C..---...... -... ..-...... GpolygoMkAu T...... -.. .-.A..G-...... A... ..C..---...... -... ..-...... GhachiYkwJpn .T.....-.. .-.-..G-...... ---.T ...... G... ..C...... GproYkwJpn ....C..-.. .-.-..G-.. .GT...A... ..C..---...... -... ..-...... Gcar_G103 T...... -.. .C.-..GA...... A... ..CT.CCT...... -... ..-...... GschlecYkwJpn T...... -.. .-.-..G-...... CA.---...... -... ..-......

GdrepMenIndia T...... -.. .-.-..G-.. ..T...... CT.---...... -... ..-...... Gtesse_G149 T...T..-.. .-.-..G-.. ..T...... CT.---...... -... ..-......

2 GoblongMarkAu ...... -.. .-.-..G-.. .C...... CT.---...... -... ..-...... A 6

0 GdschlecMkAU T...... -.. .-.-..G-...... CA.---...... -... ..-...... A Grota_G132 T...... -.. .-.-..G-...... CA.---...... -... ..-...... Anoelance_G70 T...... -.. .-.-..G-...... CA.---...... -... ..-...... Zeuviri_G57 T.T.C..-.. .-.-...-.. ..A...... A.CT.---...... -... ..-...... Ligeophila_G88 TA....--.. .-.-..G-...... A... ..CT.---.. T.....-... ..-...... Hyllophylla_G90 T...... -T. .-.-..G-...... A... ..C.A---...... -... ..-...... GfolvarmaxiYkwJpn ...... -.. .-.-...-...... ---...... -... ..-......

GvelutYkwJpn ...... -.. .-.-...-...... ---...... -... ..-...... Go_HOC474_G63 .T.....-C. .-.-..G-.. ...A...... ---...... -... ..-...... GhisRedKRI .T.....-.. .-.-..G-...... ---...... -... ..-...... Gdhispwhite .T.....-.. .-.-..G-...... ---...... -... ..-...... Herpysmalongicaulis_210 T.T.C..-.. .-.-..G-...... CT.---...... -... ..-...... CysJohncol_G65 A.T.C..-T. .-.-ATG-...... CA...... CT.---GT ...... -..C ..-...... Cyssteno_G76 ..A.C..-T. .-T-ATG-...... CA...... CT.---TG ..G...-..C ..-...... T Cheirostylis_G153 T.T.C..-.. .-.-A..-.. TAA...... CT.------A....-... ..-...... Hetoblo_G51 ..T.CCC-CC .-.-..G-.. ..A.C...... CT.---...... -... ..-...... HetoblMkAU ..T.C..-.. .-.-..G-.. ..A.C...... CT.---...... -... ..-...... 180 Gvitat_G62 T.T.C..-T. .-.-..G-...... CT.---...... -... ..-...... Mymerchis_gracilis_G180 ..A.C..-.. .-.-..G-.. A...... CT.---.. T.....-... ..-...... GclaKRI ..A.C..-.. .-.-..G-.. A...... CT.---.. T.....-... ..-...... Anoecgreen_G68 ..T.C..T-. .-.-..G-...... CT.---...... -... ..-...... Ludnigr_G66 ..T.C..T-. .-.-..G-...... CT.---...... -... ..-...... Pristiglottis_G207 T.T.C..TT. .-.-..G-...... CT.---...... -... ..-...... Anoebrev_G67 ..T.C..-.. .-.-..G-.. T...... C.CT.---...... -... ..-...... Anoectochilus_longicalcaratus_G99 ..T.C..-.. .-.-..G-.. T...... CT.---...... -... ..-...... Maclewii_G96 ..T.C..-.. .-.-..G-.. T...... CT.---...... -... ..-...... Mcdessan_G125 ..T.C..-.. .-.-..G-.. T...... CT.---...... -... ..-...... 2

6 Anoesetaceus_G78 ..T.C..-.. .-.-..G-.. T...... CT.---...... -... ..-...... 1 Blacepi_G124 ..T.C..-.C .C.-..G-.. T.....C... ..CT.--A...... -... ..-...... Macsand_G77 A.T.C..-G. .-.-..G-.. T...... CT.---...... -... ..-...... Hetcris_G47 T.T.C..-G. .-.-..G-.. TC...... CT.---...... -... ..-...... A Sarcog_G126 ...T..G-.. .-.-.TG-.. G..A.A...... CAG---.. T.....-... ..-...... Zeuxinegracilis_G80 T.T.C..-.. .-.-..G-...... A.CT.---...... A-... ..-...... Cyclin_G127 T...C.C-.A .-.-.CG-C. ...CCA...... CTG---G. T..C..-... ..-...... Spiranthesodorata_G152 A...C.C-GT .-.-.TG-C. TC...... CTG---.. T.....-... ..-...C... Pristiglottis_G182 ..T.C..T-. .-.-..G-...... T ..CT.---.. ...A..-... ..-...... Gdaib_G98 ...... -.. .-.-..G-.. .C...... A ..CA.---...... T-..A ..-......

Herpyrub_G97 T.T.C..-.. .-.-..G-C...... CT.---...... -... ..-...... 240

Goodyera_bifida_G74 CAATGGA-TA TCTTGGCTCT TGCATCGATG AAGAGCGCAG CGAAA-TG-C GATAC-GTGG Gbifi_G55 ...... -...... -..-...... -.... GviriMkAU ...... -...... -..-...... -.... GfumThai ...... -...... A...... A...-..-...... -.... Gclav_G44 ...... -...... -..-...... -.... GpolygoMkAu ...... -.. .T...... A...... -..-...... -.... GhachiYkwJpn ...... -...... -..-...... -.... GproYkwJpn ...... -...... -..-...... -.... Gcar_G103 ...... A...... G..-...... C.... GschlecYkwJpn ...... -...... -..-...... -....

GdrepMenIndia ...... -...... -..-...... -.... Gtesse_G149 ...... -...... -..-...... -A...

2 GoblongMarkAu ...... -...... -..-...... -.... 6

2 GdschlecMkAU ...... -...... -..-...... C.... Grota_G132 ...... -...... -..-...... -.... Anoelance_G70 ...... -...... -..-...... -.... Zeuviri_G57 ...... -...... -..-...... -.... Ligeophila_G88 ...... -...... -..-...... -.... Hyllophylla_G90 ...... -...... -..-...... -.... GfolvarmaxiYkwJpn ...A...-.T ...... -..-...... -....

GvelutYkwJpn ...... -...... -..-...... -.... Go_HOC474_G63 ...... -...... -..-...... -.... GhisRedKRI ...... -...... -..-...... -.... Gdhispwhite ...... -...... -..-...... -.... Herpysmalongicaulis_210 ...... -...... -..-...... -.... CysJohncol_G65 ...... -...... T.A...... -..-...... -.... Cyssteno_G76 ...... -...... A...... A...... -..-...... -.... Cheirostylis_G153 ...... -...... -..-...... -.... Hetoblo_G51 ...... -...... -..-...... -.... HetoblMkAU ...... -.. ...G.T..T...... -..-...... -.... 240 Gvitat_G62 ...... -...... -..-...... -.... Mymerchis_gracilis_G180 ...... -...... -..-...... -.... GclaKRI ...... -...... C .....-..C...... -.... Anoecgreen_G68 ...... -...... -..-...... -.... Ludnigr_G66 ...... -...... -..-...... -.... Pristiglottis_G207 ...... -...... -..-...... -.... Anoebrev_G67 ...... -...... -..-...... -.... Anoectochilus_longicalcaratus_G99 ...... -...... -..-...... -.... Maclewii_G96 ...... -...... -..-...... -.... Mcdessan_G125 ...... -...... -..-...... -.... 2

6 Anoesetaceus_G78 ...... -...... -..-...... -.... 3 Blacepi_G124 ...... -...... -..-...... -.... Macsand_G77 ...... -...... -..-...... -.... Hetcris_G47 ...... -...... -..-...... -.... Sarcog_G126 A.G....-...... T...G ..TC...... -..-...... -.... Zeuxinegracilis_G80 ...... -...... A .....-..-. A....-.... Cyclin_G127 ...... -...... -..-...... -.... Spiranthesodorata_G152 ...... -...... -..-...... -.... Pristiglottis_G182 ...... -...... -..-...... -.... Gdaib_G98 ...... -...... G...... T...... C .....-..-...... -....

Herpyrub_G97 ...... -...... -..-...... -.... 300

Goodyera_bifida_G74 -TGTGAATT- GCAGAATCCC GTGAACCATC GAG-TTTTTG AACGCAAGTT GCGCCCGAGG Gbifi_G55 -...... - ...... -...... GviriMkAU -...... - ...... T...... A-...... GfumThai -...... - ...... T...... A-...... Gclav_G44 -...... - ...... T...... A-...... GpolygoMkAu -...... - ...... T...... A-...... GhachiYkwJpn -...... - ...... -...... GproYkwJpn -...... - ...... A-...... Gcar_G103 -...... - ...... T...... AA...... GschlecYkwJpn -...... - ...... -......

GdrepMenIndia -...... - ...... -...... Gtesse_G149 -...... - ...... -......

2 GoblongMarkAu -...... - ...... -...... 6

4 GdschlecMkAU -...... - ...... -...... Grota_G132 -...... - ...... -...... Anoelance_G70 -...... - ...... -...... Zeuviri_G57 -...... - ...... A.A-.A...... Ligeophila_G88 -...... - ...... T...... A-...... Hyllophylla_G90 -...... - ...... T...... A-...... GfolvarmaxiYkwJpn -..G.....- .G.A...... -......

GvelutYkwJpn -...... - ...... -...... Go_HOC474_G63 -...... - ...... -...... GhisRedKRI -...... - ...... -...... Gdhispwhite -...... - ...... -...... Herpysmalongicaulis_210 -...... - ...... -...... T.... CysJohncol_G65 -...... - ...... -.A...... Cyssteno_G76 -...... - ...... C..-.A...... Cheirostylis_G153 -...... - ...... A.A-.A...... Hetoblo_G51 -...... - ...... A.A-.C...... HetoblMkAU -...... - ...... A.A-.C...... 300 Gvitat_G62 -...... - ...... A.A-.A...... Mymerchis_gracilis_G180 -...... - ...... A.A-.C...... T.... GclaKRI G...... - ...... A.A-.C...... TA... Anoecgreen_G68 -...... - ...... A.A-.C...... Ludnigr_G66 -...... - ...... A.A-.C...... Pristiglottis_G207 -...... - ...... A..-.C...... Anoebrev_G67 -...... - ...... A.A-.C...... T..C. Anoectochilus_longicalcaratus_G99 -...... - ...... A.A-.C...... T.... Maclewii_G96 -...... - ...... A.A-.C...... T.... Mcdessan_G125 -...... - ...... A.A-.C...... T.... 2

6 Anoesetaceus_G78 -...... - ...... A.A-.C...... T.... 5 Blacepi_G124 G...... T ...... C...... A.A-.C.... .C.C...... T...T.... Macsand_G77 -...... - ...... A.A-.C...... Hetcris_G47 -...... - ...... A.A-.A...... Sarcog_G126 -..A.....- ...... C....G ...-...... C...... C Zeuxinegracilis_G80 -...... - .A.T...... A.A-.A...... A..... Cyclin_G127 -...... - ...... -...... Spiranthesodorata_G152 -...... - ...... -...... Pristiglottis_G182 -...... - ...... A..-.C...... Gdaib_G98 -...... - ...... G...... -...... C......

Herpyrub_G97 -...... - ...... -...... T.... 360

Goodyera_bifida_G74 -TGTGAATT- GCAGAATCCC GTGAACCATC GAG-TTTTTG AACGCAAGTT GCGCCCGAGG Goodyera_bifida_G74 CCAATTGGCT AAGGGCA-CG TCCGCCTGGG CGTCAAGCAT TACGTCGCTT CATTCGGCAC Gbifi_G55 ...... -...... GviriMkAU ...... -...... A...... GfumThai ...... -...... A...... Gclav_G44 ...... -...... A...... GpolygoMkAu ...... -...... A...... GhachiYkwJpn ...... -...... A...T... GproYkwJpn ...... -...... C...A.. Gcar_G103 ...... -...... GschlecYkwJpn ...... -...... A...

GdrepMenIndia ...... -......

2 Gtesse_G149 ...... -...... T...... 6

6 GoblongMarkAu ...... -...... GdschlecMkAU ...... -...... A... Grota_G132 ...... -...... A... Anoelance_G70 ...... -...... A... Zeuviri_G57 ...... T. G...... -...... A...... C....CA Ligeophila_G88 ...... -...... A...... Hyllophylla_G90 ...... -...... A...... GfolvarmaxiYkwJpn ...... -......

GvelutYkwJpn ...... -...... A... Go_HOC474_G63 ...... -...... A...T... GhisRedKRI ...... -...... A...T.G. Gdhispwhite ...... -...... A...T... Herpysmalongicaulis_210 ...... -...... A...... A... CysJohncol_G65 ...... -...... A...... A... Cyssteno_G76 ...... A....-...... A...... AAA... Cheirostylis_G153 ...... -...... TA...... CCGAA... Hetoblo_G51 ...... -...... A...... T.C...... HetoblMkAU ...... C...... A...... T.C...... 360 Gvitat_G62 ...T...... T...... -...... A...... C..A... Mymerchis_gracilis_G180 ...... -...... A...... A... GclaKRI ...... -...... A...... A... Anoecgreen_G68 ...T...... -...... A...... A... Ludnigr_G66 ...T...... -...... A...... AA... Pristiglottis_G207 ...... -...... A...... A... Anoebrev_G67 ...... -...... A...... A... Anoectochilus_longicalcaratus_G99 ...... -...... A...... A... Maclewii_G96 ...... -...... A...... A... Mcdessan_G125 ...... -...... A...... A... 2

6 Anoesetaceus_G78 ...... -...... A...... A... 7 Blacepi_G124 ...... T...... -...... A...... A... Macsand_G77 ...... -...... A...... Hetcris_G47 ...... -...... A...... A... Sarcog_G126 ...... G...C.C-.T ...... C...... G..TT. Zeuxinegracilis_G80 ...... A. G...... -...... A...... C...... Cyclin_G127 ...... G...... -...... Spiranthesodorata_G152 ...... G...... -...... A...... C.C..G. Pristiglottis_G182 ...... -...... A...... A... Gdaib_G98 ...... C-...... G.....C...... A...

Herpyrub_G97 ...... -...... A...... A... 420

Goodyera_bifida_G74 CAA--TTGCC CAA--TATTG TGTTTGCGGT G-CCG-GTTT GGATGCGGAG AGT-GGCCCT Gbifi_G55 ...--...... --...... -...-...... -...... GviriMkAU ...--....A ...--...... -...... -...-A..C .A...... -...... GfumThai ...--....A ...--...... -...A. .-...-A..C .A...... -...... Gclav_G44 ...--....A ...--...... -...... -...-...C .A...... -...... GpolygoMkAu ...--....A ...--...... -...... -...-A..C .A...... -...... GhachiYkwJpn ...--...... AA...... C.-...... -...-.... .A...... -...... GproYkwJpn ..G--C.... .GC--...C. ....-...... -...-.... .A.C...... -...... Gcar_G103 ...--....T ...--...... C.-...... -...G.... .A...... G...... GschlecYkwJpn ...--..T.. ...--.G...... -...... C...-.... .A...... -......

GdrepMenIndia ...--...... --...... -...... -...-...C .A...... -...... Gtesse_G149 ...--...... --...... -...... -...-...C .A...... -......

2 GoblongMarkAu ...--...... T.--...... C.-...... -...-A... .A...... -...... 6

8 GdschlecMkAU ...--..T.. ...--...... A.. .C...-.... .A...... -...... Grota_G132 ...--..T.. ...--.G...... -...... -...-.... .A...... -...... Anoelance_G70 ...--.AT.. ...--.G.G. ....-...... -...-.... .A...... -...... Zeuviri_G57 .CCTT.A..T TG.--...G. A.C.-TT... .-.T.-.... .A...... -...... Ligeophila_G88 ...--.C...... --...... -.TT.. .-..T-.... .A...... -...... Hyllophylla_G90 ...--..A.. ...--...... -.T... .-...-...C .A...... -...... GfolvarmaxiYkwJpn ...--...... --...... -...-...... -......

GvelutYkwJpn ...--...... --...... -...-...... -...... Go_HOC474_G63 ...--...... AA...... C.-...... -...-.... .A...... -.A.... GhisRedKRI ...--...... --...... -...... -...-.... .A...... -...... Gdhispwhite ...---...... --...... -...... -...-.... .A...... -...... Herpysmalongicaulis_210 ...--...... --...... C.-.T... .-...-.... .A...... -...... CysJohncol_G65 ...--..... A..--....T ..C.-.T... .-T..-.... .A...... -...... Cyssteno_G76 ...--.C... GG.--...... C.-.T... .-T..-.... .A...... -...... Cheirostylis_G153 ...--...... TT--..... A.CC-ATT.. .-...-.C.. .A...... -...... Hetoblo_G51 ...TT...... --...C. G.C.-.T... .-...-.... .A...... -...... HetoblMkAU ...TT...... --...C. G.C.-.T... .-...-.... .A...... -...... 420 Gvitat_G62 ...TT.A... ..T--..... A.C.-.T.CC .-..T-.... .A...... -...... Mymerchis_gracilis_G180 ...--...... --..... C.GC-...... -...-A..C .A...T...... -...... GclaKRI ...--...... --..... C.GC-T.... .-...-A..C .A...T...... G-...... Anoecgreen_G68 .G.--...... --.T... ..CG-.T... .-...-A..C .A...... -...... Ludnigr_G66 .G.--...... --.T... ..CG-.T... .-...-A..C .A...... -...... Pristiglottis_G207 ...--...... --...... A-.T... .-...-A..C .A...... -...... Anoebrev_G67 ...--...... G--...... C.-.T... .-.T.-A.C. .A...... -.....C Anoectochilus_longicalcaratus_G99 ...--...... G--....T ..C.-.T... .-.T.-..C. .A...... -...... Maclewii_G96 ...--...... G--....T ..C.-.T... .-.T.-..C. .A...... -...... Mcdessan_G125 ...--...... G--....T ..C.-.T... .-.T.-..C. .A...... -....G. 2

6 Anoesetaceus_G78 ...--...... G--....T ..C.-.T... .-.T.-..C. .A..C...... -...... 9 Blacepi_G124 ...--...... --...... CC-TT... .-TT.-..C. .A...... -...... Macsand_G77 ...--...... --...... C.-.TT.. .-...-A..C .A...... -...... Hetcris_G47 T..--...... --...... C.-.T... .-..A-.... .A...... -...... Sarcog_G126 .----CCTT. G.C--C.AG. G.GG-ATT.. T-T..-.G.A .A...T.... .T.-...... Zeuxinegracilis_G80 ...TT...... TA..... A.C.-.T.CC .-...-.... .A...T...... G-...... Cyclin_G127 .----ACCT. A..--C.AG. G.GG-ATT.. .-...-.G.A .A...T.... .T.-...... Spiranthesodorata_G152 .----ACCT. GT.--GG.G. G..G-.TT.. .-...-.G.. .A...T.... .A.-...T.. Pristiglottis_G182 ...--...... --..C.. ..CA-.T... .-...-A... .A...... -...... Gdaib_G98 ...--..T.. ...--...... -..... T-...-.... .A...... -......

Herpyrub_G97 ...--...... --...... C.-.T... .-...-.... .A...... -...... 480

Goodyera_bifida_G74 T-CGCGCA-- CACT-TGTGC GAC-GGGTTG AAGAA-CGGT TTGCTTT-CC TC-TGGCA-A Gbifi_G55 .T...... -- ....-...... -...... -...... -.. ..-.....-. GviriMkAU .-...... -- ....-...... -...... -...... -.. ..-....C-. GfumThai .-...... -- ....-...... -...... -...... -.. ..-....C-. Gclav_G44 .-...... -- ....-...... -...... -...... -.. ..-....C-. GpolygoMkAu .-...... -- ....-...... -...... -...... -.. ..-....C-. GhachiYkwJpn .-...... -- ....-...... -...... -..A...... -.. ..-.....-. GproYkwJpn .-...... -- .CGCT...... G.-...... -TC...... -.. ..-C...C-. Gcar_G103 .-...... -- ...CT...... G...... CGAA...... C.. ..-.....-T GschlecYkwJpn .-...... -- ....-...... -...... -T.A...... -.. ..-..A.C-.

GdrepMenIndia .-...... -- ....-...... G.-...... -...... -.. ..-....C-. Gtesse_G149 .-...... -- ....-...... G.-...... -...... -.. ..-....C-.

2 GoblongMarkAu .-...... -- ....-...... -...... -...... -.. ..-....C-. 7

0 GdschlecMkAU .-...... -- ....-...... -...... -T.A...... T.. ..-..A.C-. Grota_G132 .-...... -- ....-...... -...... -T.A...... -.. ..-..A.C-. Anoelance_G70 .-...... -- ....-...... -...... -T.A...... -.. ..-..A.C-. Zeuviri_G57 .-...... -- .G..-...... -...... -G..A ..C....-.. ..-.....-. Ligeophila_G88 .-....GG-- ....-...... -...C...... -.AA...... -.. ..-....C-. Hyllophylla_G90 .-.....G-- ....-...... -...... -..T...... -.. ..-....C-. GfolvarmaxiYkwJpn .-...... -- ....-...... -...... -...... -.. ..-.....-.

GvelutYkwJpn .-...... -- ....-...... -...... -...... -.. ..-.....-. Go_HOC474_G63 .-T.....-- ....-...... -...... -..A...... -.. ..-.....-. GhisRedKRI .-...... -- ....-...... -...... -...... -.. ..-..A..-. Gdhispwhite .-...... -- ....-...... -...... -...... -.. ..-.....-. Herpysmalongicaulis_210 .-..T...-- T.A.-...... T-...... -..A...... -.. ..-....C-. CysJohncol_G65 .-...... -- A...-..C.. ...-...... -.AA. ..T....-.. ..-....T-G Cyssteno_G76 .-...... -- A...-..C.. ...-...... -.AA. ..T....-.. ..-....T-G Cheirostylis_G153 .-..T...-- AT..-...... T-...... -TC.A ..AT...-.. ..-....T-. Hetoblo_G51 .-...... -- A...-...... -...... G-T..A ...... -.. ..-....C-. HetoblMkAU .-...... -- A...-...... -...... G-T..A ...... -.. ..-....C-. 480 Gvitat_G62 .-...... -- ....-...... -...... -T.AA ...... -.. ..-....C-. Mymerchis_gracilis_G180 .-...... -- ....-...... -...... -.A...... -.. ..-.....-. GclaKRI .-...... -- ....T...... -...... -.A...... -.. ..-.....-. Anoecgreen_G68 .-.....G-- T...-...... -...... C-.A...... -.. ..-..C.C-. Ludnigr_G66 .-.....G-- T...-...... -...... -.A...... -.. ..-....C-. Pristiglottis_G207 .-...... -- ....-...... -...... -.A...... -.. ..-....C-. Anoebrev_G67 .-..T...-- ....-...... -...... -.AA...... -.. ..-....C-. Anoectochilus_longicalcaratus_G99 .-..T...-- ....-....T ...-...... -.AA...... -.. ..-....C-. Maclewii_G96 .-..T...-- ....-....T ...-...... -.AA...... -.. ..-....C-. Mcdessan_G125 .-..T...-- ....-...... C.-...... -.AA. ..C....-.. ..G....C-. 2

7 Anoesetaceus_G78 .-..T...-- ....-....T ...-...... -.AA...... -.. ..-.AA.C-. 1 Blacepi_G124 .-..T...-- ....-...... -...... -.A.. ..A....-.. ..-GC..C-. Macsand_G77 .-...... -- ....-...... -...... -.AA...... -.. ..-....C-. Hetcris_G47 .-...... -- ....-...... -...... -.A...... -.. ..-....C-. Sarcog_G126 .-G.TC..GG ..GC-...... G.-...... CC-G..A ..C.C..-.T ..T..C..G. Zeuxinegracilis_G80 .-...... -- .C..-...... -...... -T.AA ...... -.. ..-....C-G Cyclin_G127 .-..T...GG ..TA-...... G.-...... CC-T..A ....C..-.. ..T....CG. Spiranthesodorata_G152 .-..T...GA ..TC-...... G.-...... CG-.A.A .G...C.-.. ..TC...TG. Pristiglottis_G182 .-...... -- .T..-C...... -...... -.A...... -.. ..-....C-. Gdaib_G98 .-...... -- ....-...... -...... C-T.A...... -.. ..-..A.C-.

Herpyrub_G97 .-..T...-- T.A.-...... T-...... -...... -.. ..-....C-. 540

Goodyera_bifida_G74 TGTTTTGATA --AA-GGGGT GGATGTATGC TGC--CATT------TGGC----- Gbifi_G55 ...... --..-...... --....------....----- GviriMkAU ...... --..-...... --....------....----- GfumThai ...... --..-...... --....------....----- Gclav_G44 ...... --..-...... --....------....----- GpolygoMkAu ...... --..-...... --....------....----- GhachiYkwJpn ...... --..-...... --....------....----- GproYkwJpn ...... --..T...... --....------T....----- Gcar_G103 G...... --..G...... --....------....----- GschlecYkwJpn ...... --..-...... --....------T....C----

GdrepMenIndia ...... --..-...... --....------....----- Gtesse_G149 ...... --..-...... --....------....-----

2 GoblongMarkAu ...... --..-...... --....------....----- 7

2 GdschlecMkAU ...... --..-...... --....------T...GC---- Grota_G132 ...... --..-...... --....------....----- Anoelance_G70 ...... --..-...... --....------....----- Zeuviri_G57 ...... --..-...... -...... --....------....----- Ligeophila_G88 ...... --..-...... --....------....----- Hyllophylla_G90 ...... --..-...... --....------....----- GfolvarmaxiYkwJpn ...... --..-...... ---....------....-----

GvelutYkwJpn ...... --..-...... --....------....----- Go_HOC474_G63 ...... --..-...... G ...--....------....----- GhisRedKRI C...... --..-.A...... --....------....----- Gdhispwhite ...... --..-...... --....------....----- Herpysmalongicaulis_210 ...... --..-...... -...... --....------....----- CysJohncol_G65 ...... --..-...... -G...... --....------....----- Cyssteno_G76 ...... --..-...... -...... --....------....----- Cheirostylis_G153 ...... T --..-....G ..-...G...... --..A.------..C.AATTG Hetoblo_G51 ...... --..-...... -...... --....------....----- HetoblMkAU ...... --..-...... -...... --....------....----- 540 Gvitat_G62 ...... --..-...... -...... --....------....----- Mymerchis_gracilis_G180 ...... --..-...... -...... --....------....----- GclaKRI ...... --..-...... -...... --....------....----- Anoecgreen_G68 ...... --..-...... -...... A .C.--....------....----- Ludnigr_G66 ...... --..-...... -...... --....------....----- Pristiglottis_G207 ...... --..-...... -...... --....------....----- Anoebrev_G67 ...... --..-...... -...... A..--....------....----- Anoectochilus_longicalcaratus_G99 ...... --..-...... -...... A..--....------A...----- Maclewii_G96 ...... --..-...... -...... A..--....------A...----- Mcdessan_G125 .A-CA..... --..-...... -....G.. A..--....------A...----- 2

7 Anoesetaceus_G78 GA-GGA..A. --..-...... -..G.G.. ACA--...C------AATA----- 3 Blacepi_G124 GA...GA... TC..-.A..A ..-A.G.-.. A----T..C------A...----- Macsand_G77 ...... --..-...... -..C.... .----..A.------A...----- Hetcris_G47 ...... --..-...... -...... --....------....----- Sarcog_G126 ..A..-.... --..-....G ..TG.G...... CG..G.------....----- Zeuxinegracilis_G80 ...... --..-...... -G.....G ...--....------....----- Cyclin_G127 C.A..-.... --..-...... T..G...... --..G.------....----- Spiranthesodorata_G152 ..CG.-..C. --..-...... T..G...... --.GG.------....----- Pristiglottis_G182 ...... --..-...... -...... --....------....----- Gdaib_G98 ..-GGGCC.. --..-....G .CCG...G.. A.A--..AG------G..G-----

Herpyrub_G97 .....AA... --..-.A..G ..-G.A.--- -..--A.A.A AAGGGGGGGG GGA..AAATA 600

Goodyera_bifida_G74 --CCAC-G-- -C-TATCATC ------TCAAT --AAG-CGGA G-GAGCATA Gbifi_G55 --....-.-- -.-...... ------...T. --GTC-TC.. .-...G... GviriMkAU --....-.-- -.-...... ------...T. --GTC-TC.. .-...G... GfumThai --....-.-- -.-...... ------...T. --GTC-TC.. .-...G... Gclav_G44 --....C.-- -.A...... ------...T. --GTC-TC.. .-...G... GpolygoMkAu --....-.-- -.-...... ------...T. --GTC-TC.. .-...G... GhachiYkwJpn --....-.-- -.-...... ------...T. --GTC-TC.. .-...G.C. GproYkwJpn --....-.-- -.T...... ------T...T. --G-TCTC.. .-...G... Gcar_G103 --....-.-- -.-...... ------...T. --GTCCTC.. .-...G... GschlecYkwJpn --....-.-- -.-...... ------...T. T-GTC-TC.. .-...G...

GdrepMenIndia --....-.-- -.-...... ------A..T. --GCC-TC.. .-...G... Gtesse_G149 --....-.-- -.-...... ------A..T. --GTC-TC.. .-...G...

2 GoblongMarkAu --....-.-- -.-...... ------...T. --GTC-TC.. .-...G... 7

4 GdschlecMkAU --....-.-- -.-...... ------...T. --GTC-TC.. .-...G... Grota_G132 --....-.-- -.-...... ------...T. --GTC-TC.. .-...G... Anoelance_G70 --....-.-- -.-...... ------...T. --GTC-TC.. .-...G... Zeuviri_G57 --....-.-- -.-.G..... ------..GT. --GTC-TA.. .-.CAGG.. Ligeophila_G88 --....-.-- -T-...... ------...T. --G-CCTC.. .-...G... Hyllophylla_G90 --....-.-- -.-...... ------...T. --GTCC-C.. .-...G... GfolvarmaxiYkwJpn --....-.-- -.-...... ------...T. --GTC-TC.. .-...G...

GvelutYkwJpn --....-.-- -.-...... ------...T. --GTC-TC.. .-...G... Go_HOC474_G63 --....-.-- -.-...... A ------...T. --GTC-TC.. .-...G.C. GhisRedKRI --....-.-- -.-...... ------...T. --GTC-TC.. .-...G.C. Gdhispwhite --....-.-- -.-...... ------...T. --GTC-TC.. .-...G.C. Herpysmalongicaulis_210 --....-.-- -.-...... ------...T. --GTC-TT.. .-..TG... CysJohncol_G65 --....-A-- -.-....G.. ------...T. --GTC-TT.. .-...G... Cyssteno_G76 --....-A-- -.-...... ------...T. --GTC-AT.. .-...G... Cheirostylis_G153 GG....-.-- -.-...... ------A..T. --GTC-TC.. .-...AG.. Hetoblo_G51 --....-.-- -.-...... ------...T. --GTC-TC.. .-..CGG.. HetoblMkAU --....-.-- -.-...... ------...T. --GTC-TC.. .-..CGG.. 600 Gvitat_G62 --....-.-- -.-...... ------...T. --GTC-TT.. .-...GG.. Mymerchis_gracilis_G180 --....-A-- -.-...... ------...T. --GTC-TT.. .-...T... GclaKRI --..T.-C-- -.-...... ------...T. --GTC-TT.. .G...T... Anoecgreen_G68 --....-.-- -.-...... A ------...T. --GTC-GA.. .-..AA... Ludnigr_G66 --....-.-- -.-...... ------...T. --GTC-TT.. .-..AA... Pristiglottis_G207 --....-.-- -.-...... ------...T. --GTC-TT.. .-...G... Anoebrev_G67 --....-A-- -.-...... ------...T. --GCC-TT.. .-...G... Anoectochilus_longicalcaratus_G99 --....-A-- -.-...... ------...T. --GCC-TT.. .-...G... Maclewii_G96 --....-A-- -.-...... ------...T. --GCC-TT.. .-...G... Mcdessan_G125 --....-.-- -.GGTC...A ------....G --CC.-...G .-.G..... 2

7 Anoesetaceus_G78 --A.CG-.-- -AGG.G...A ------..... --...-.... .-...... 5 Blacepi_G124 --GGGG-.-- -AGG.G...A ------....G --.G.-.... .-...... Macsand_G77 --GG.G-.------.G...A ------..... --...-.... .-...... Hetcris_G47 --....-.-- -.-...... ------...T. --GTC-TT.. .-...A... Sarcog_G126 --..G.-C-- -T-CG...CA ------...T. --GTCCTT.. .-...GGC. Zeuxinegracilis_G80 --....-.-- -.-...... ------...T. --GCC-TA.. .-...GG.. Cyclin_G127 --..G.-T-- -.-.G....G ------.GT. --GGCCTT.G .-...GGC. Spiranthesodorata_G152 --..G.-A-- -T-.G....G ------...T. --GGCCTT.. .-..TGGCG Pristiglottis_G182 --....-.-- -.-...... ------...T. --GTC-TT.. .-...G... Gdaib_G98 --..GG-.GG G.CA....A. AGGCGGGGGG GCATA..... AAGC.---.. .-......

Herpyrub_G97 AA-T.AG.GG AG-G.G...A ------..... --...-G... .-...... Appendix B.

Forty-two new trnL-F sequences and alignments used in phylogenetic analyses.

276 60 Sarcoglottis_G126 GACTCAA-CG GAA-GCTGTT CTAACGAATG GAATTTACTA CGTTAGATTA GTAGCTAAAA Anoectochilus_brevilabris_G67 ...... -T. ...-.T...... A...... ------Anoetochilus_sikimensis_G87 ...... -T. ...-.T...... A...... ------Anoectochilus_chapaenensis_G123 ...... -T. ...-.T...... A...... ------Dossinia_mormorata_G102 ...... -T. ...-.T...... A...... ------Anoectochilus_etaceus_G69 ...... -T. ...-.T...... A...... ------Macodes_lewii_G96 ...... -T. ...-.T...... A...... ------Anoectochilus_formosanum_G89 ...... -T. ...-.T...... A...... ------Macodes_andriana_G125 ...... -T. ...-.T...... A...... ------Anoectochilus_green_G68 ...... -T. ...-.T...... A......

Ludisiani_grescens_G66 ...... -T. ...-.T...... A...... Blackepiphite_G124 ...... -T. ...-.T...... A...... ------Anoectochilus_etaceus_G78 ...... -T. ...-.T...... A...... Hetaeria_cristata_G47 ...... -T. ...-.T...... A......

2 Rhomboda_ketambe_G204 ...... -T. ...-.T...... A...... A...... 7

7 Vrydagzynea_G107 ...... -T. ...-.T...... A...... Vrydagzynea_G79 ...... -T. ...-.T...... A...... Cystorcchis_johnscoll_G65 ...... -T. ...-...... A.T...... Ludisia_discolor_G71 ...... AT. ...C.T...... A...... Hetaeriao_blongifolia_G51 ...... -T. ...-...... A...A A..A...... T.....

GoodyeraHOC_474_G63 ...... -T. ...-...... A...... A...... Herpys_marubens_G97 ...... -T. ...-...... A...... G...... G.pubescens_G45 ...... TT. ...-...... A...... A..T..... Plactyplectron_G529 ...... -T. ...-...... A...... G...... A...TG..T. Pristiglottis_G182 ...... -T. ...-.T...... A...... Goodyera_repens_G73 ...... -T. ...-...... A...... Goodyera_vitata_G62 ...... -T. ...-...... A...... Zeuxine_oblonga_G214 ...... T-T. ...-C...... A...... A...... C ...... Zeuxine_viridiflora_G57 ...... -T. ...-...... A...... Anoectochilus_lanceolatus_G70 ...... -T. ...-...... A...... A...... 60 Goodyeracfschlectendaliana_G95 ...... -T. ...-...... A...... A...... G.daibucanensis_G98 ...... -T. ...-...... A...... A...... G.rotabunensis_G132 ...... -T. ...-...... A...... A...... G.dalhousiana_G151 ...... -T. ...-...... A...... A...... Goodyera_oblongifolia_G114 ...... -T. ...-...... A...... A...... G.tesselata_G149 ...... -T. ...-...... A...... A...... 2

7 Goodyera_bifida_G55 ...... -T. ...-...... A...... T..... 8 Goodyera_carnea_G103 ...... -T. ...-...... A...... Goodyerapussilla_G162 ...... -T. ...-...... A...... A...... G_procera_G178 ...... -T. ...-...... A......

Ligophylla_G88 ...... -T. ...-...... -...... A.....T.-- -...... G.clavata_G44 ...... -T. ...-...... A...... 120

Sarcoglottis_G126 TCCTTCTTTC ---TATCAAA ------AGA AAAGAAGGAA ATGACAGAAA AGATGACCTT Anoectochilus_brevilabris_G67 ------Anoetochilus_sikimensis_G87 ------Anoectochilus_chapaenensis_G123 ------Dossinia_mormorata_G102 ------Anoectochilus_etaceus_G69 ------Macodes_lewii_G96 ------Anoectochilus_formosanum_G89 ------Macodes_andriana_G125 ------Anoectochilus_green_G68 .A....------...... ------...... TT...... G......

Ludisiani_grescens_G66 .A....------...... ------... C....TT...... G...... Blackepiphite_G124 ------Anoectochilus_etaceus_G78 .A.....A.. AAA...A... ------.T...... TTA...... G...... Hetaeria_cristata_G47 .A.....A.. AAA...A... ------.T...... TTA...... G...... 2

7 Rhomboda_ketambe_G204 .A....------...... ------.T...... TT...... G...... 9 Vrydagzynea_G107 .A....------...A... ------.T...... TT...... G...... Vrydagzynea_G79 .A....------...... ------.T...... TT...... Cystorcchis_johnscoll_G65 .A....------...... ------...... TT...... GA...... Ludisia_discolor_G71 .A....------...... ACCCC------....TT...... G...... Hetaeriao_blongifolia_G51 GA....------...... CCCCC--...... TT...... G......

GoodyeraHOC_474_G63 .A....------...... CCCC------....TT...... G...... Herpys_marubens_G97 .A...A------...... ------.T...... TT...... G...... G.pubescens_G45 .A....------...... G ------.T...... TT...... G...... Plactyplectron_G529 .A....------.....G. ------.T...... TC...... G...... Pristiglottis_G182 .A....------...... ------...... TT...... G...A..... Goodyera_repens_G73 GAA...------.....G. ------.T...... TT...... G...... Goodyera_vitata_G62 .A....------...... ------.T...... TT...... G...... Zeuxine_oblonga_G214 .A....------...... ------.T...... TT...... A... G...... Zeuxine_viridiflora_G57 .A....------...... ------...... TT...... G...... Anoectochilus_lanceolatus_G70 .A....------...... ------.T...... TT...... G...... 120

Goodyeracfschlectendaliana_G95 .A....------...... ------.T...... TT...... G...... G.daibucanensis_G98 .A....------..C.C.. ------.T...... TT...... G...... G.rotabunensis_G132 .A....------...... ------.T...... TT...... G...... G.dalhousiana_G151 .A....------...... ------.T...... TT...... G...... Goodyera_oblongifolia_G114 .A....------...... ------.T...... TT...... G......

2 G.tesselata_G149 .A....------...... ------.T...... TT...... G...... 8

0 Goodyera_bifida_G55 .A....------...... TATCAAA.T...... TT...... G...... Goodyera_carnea_G103 .A...A------...... ------.T...... TT...... G...... A Goodyerapussilla_G162 .A....------...... ------...... TT...... G...... G_procera_G178 GA....------...... ------...... TT...... G......

Ligophylla_G88 .A....------...... ------...... T-...... A....------.A G.clavata_G44 .A....------...... ------.T...... TT...... G...... 180

Sarcoglottis_G126 A------TATACCTAAT ------Anoectochilus_brevilabris_G67 ------...... ------Anoetochilus_sikimensis_G87 ------...... A ------Anoectochilus_chapaenensis_G123 ------...... ------Dossinia_mormorata_G102 ------...... ------Anoectochilus_etaceus_G69 ------...... ------Macodes_lewii_G96 ------...... ------Anoectochilus_formosanum_G89 ------...... ------Macodes_andriana_G125 ------...... ------Anoectochilus_green_G68 .------...... ------

Ludisiani_grescens_G66 .------...... ------Blackepiphite_G124 ------...... ------Anoectochilus_etaceus_G78 .------...... ------Hetaeria_cristata_G47 .------...... ------2

8 Rhomboda_ketambe_G204 .------...... G.. ------1 Vrydagzynea_G107 .------...... G.. ------Vrydagzynea_G79 .------...... G.. ------Cystorcchis_johnscoll_G65 .------.....T.... ------Ludisia_discolor_G71 .------...... ------Hetaeriao_blongifolia_G51 .------.....T.... ------

GoodyeraHOC_474_G63 .------...... ------Herpys_marubens_G97 .------...... ------G.pubescens_G45 .------.G...... ------Plactyplectron_G529 .TATAC---- CT...... ------Pristiglottis_G182 .------...... ------Goodyera_repens_G73 .------...... TATATACCTA ATTATATACC TAATTATATA CCTAATTATA Goodyera_vitata_G62 .------...T...... ------Zeuxine_oblonga_G214 .------...C...... ------Zeuxine_viridiflora_G57 T------...... ------Anoectochilus_lanceolatus_G70 .------...... ------180

Goodyeracfschlectendaliana_G95 .TTTA----- ...... ------G.daibucanensis_G98 .------...... ------G.rotabunensis_G132 .TTTA----- ...... ------G.dalhousiana_G151 .------...... ------Goodyera_oblongifolia_G114 .------...... ------

2 G.tesselata_G149 .------...... ------8

2 Goodyera_bifida_G55 .------...... ------Goodyera_carnea_G103 .TATACGTAA ...... ------Goodyerapussilla_G162 .------...... ------G_procera_G178 .------...... ------

Ligophylla_G88 .------...... ------G.clavata_G44 .TCTTA---- ...... ------240 Sarcoglottis_G126 ------ACATACGT ATACATACTG AC------Anoectochilus_brevilabris_G67 ------..G...... AA ..------G Anoetochilus_sikimensis_G87 ------..G...... T ..------Anoectochilus_chapaenensis_G123 ------..G...... T ..------Dossinia_mormorata_G102 ------..G...... T ..------Anoectochilus_etaceus_G69 ------..G...... T ..------Macodes_lewii_G96 ------..G...... T ..------Anoectochilus_formosanum_G89 ------..G...... T ..------Macodes_andriana_G125 ------..G...... A.....T ..------Anoectochilus_green_G68 ------..G...... T ..ATACTTAC

Ludisiani_grescens_G66 ------..G...... T ..------Blackepiphite_G124 ------..G...... T ..------Anoectochilus_etaceus_G78 ------..G...... T ..------Hetaeria_cristata_G47 ------..G...... T ..------

2 Rhomboda_ketambe_G204 ------..G...... T ..------8

3 Vrydagzynea_G107 ------..G...... T ..------Vrydagzynea_G79 ------..G...... T ..------Cystorcchis_johnscoll_G65 ------..G...... T ..------Ludisia_discolor_G71 ------..G...... T ..------Hetaeriao_blongifolia_G51 ------..G...... T ..------

GoodyeraHOC_474_G63 ------..G..T...... T ..------Herpys_marubens_G97 ------..G...... T ..------G.pubescens_G45 ------.A...T...... T ..------Plactyplectron_G529 ------..G...... ------Pristiglottis_G182 ------..G...... ------Goodyera_repens_G73 TACCTAATTA TATACCTAAT TATATACCTA AT.AG..T...... T ..------Goodyera_vitata_G62 ------..G...... T ..------Zeuxine_oblonga_G214 ------..G...... T ..------Zeuxine_viridiflora_G57 ------...... T ..------Anoectochilus_lanceolatus_G70 ------..G..T...... ---- ..------240

Goodyeracfschlectendaliana_G95 ------..G..T...... ---- ..------G.daibucanensis_G98 ------..G..T...... ---- ..------G.rotabunensis_G132 ------..G..T...... ---- ..------G.dalhousiana_G151 ------..G..T...... ---- ..------Goodyera_oblongifolia_G114 ------..G..T...... ---- ..------

2 G.tesselata_G149 ------..G..T...... ---- ..------8

4 Goodyera_bifida_G55 ------..G..T...... T ..------Goodyera_carnea_G103 ------..G..T...... T ..------Goodyerapussilla_G162 ------..G..T...... T ..------G_procera_G178 ------..G..T...... T ..------

Ligophylla_G88 ------.AG..-...... AT ..------G.clavata_G44 ------..G..T...... T ..------300 Sarcoglottis_G126 ATAGCAAGCG ATTAATCA------CATT TCTTTC------TA---- Anoectochilus_brevilabris_G67 G.....G...... ------...... TT------CTTTT TTTA..---- Anoetochilus_sikimensis_G87 ...... ------...... TT------CTTTT TTTA..---- Anoectochilus_chapaenensis_G123 ...... ------...... TT------CTTTT TTTA..---- Dossinia_mormorata_G102 ...... ------...... TT------CTTTT TTTA..---- Anoectochilus_etaceus_G69 ...... ------...... TT------CTTTT TTTA..---- Macodes_lewii_G96 ...... ------...... ATT------CTTTT TTTA..---- Anoectochilus_formosanum_G89 ...... ------...... TT------CTTTT TTTA..---- Macodes_andriana_G125 ...... ------...... TT------CTTTT TTTA..---- Anoectochilus_green_G68 ...... ------...... TT------ATTTC TTTA..----

Ludisiani_grescens_G66 ...... ------...... TT------ATTTC TTTA..---- Blackepiphite_G124 ...... ------...... TT------CTTTC TTTA..---- Anoectochilus_etaceus_G78 ...... ------...... TT------CTTTC TTTA..---- Hetaeria_cristata_G47 ...... ------...... TT------CTTTC TTTA..----

2 Rhomboda_ketambe_G204 ...... ------...A ...... TT------CTTTC TTTA..---- 8

5 Vrydagzynea_G107 ...... A.------...... TT------CTTTC TTTA..---- Vrydagzynea_G79 ...... ------...... TT------CTTTC TTTA..---- Cystorcchis_johnscoll_G65 ...A...... ------...... TTTA TAATACTATC TTTA..ATAC Ludisia_discolor_G71 ...... ------...... TT------CTTTC TTTA..---- Hetaeriao_blongifolia_G51 ...... ------...... TT------CTTTC TTTA..----

GoodyeraHOC_474_G63 ...... CCA TAACCA...... TT------CTTTC TTTA..---- Herpys_marubens_G97 ...... ------...... TT------CTTTC TTTA.----- G.pubescens_G45 ...... G...... ------...... TT------CTTTC TTTA..---- Plactyplectron_G529 ...... T...... ------...... A------TTTC TTTA..---- Pristiglottis_G182 ...... ------...... TT------CTTTC TTTA..---- Goodyera_repens_G73 ...... T...... ------...... TTT------CTTTC TTTA..---- Goodyera_vitata_G62 ...... A.. .A...... ------...... TT------CTTTC TTTA..---- Zeuxine_oblonga_G214 ....A..A.A .A.....C------.... .T....TT------CTTTC TTTA..---- Zeuxine_viridiflora_G57 ...... A...... ------...... TTT------CTTTC TTTA..---- Anoectochilus_lanceolatus_G70 ...... ------...... -.TT------TAC TTTA..---- 300

Goodyeracfschlectendaliana_G95 ...... ------...... -.TT------TAC TTTA..---- G.daibucanensis_G98 ...... ------...... -.TT------TAC TTTA..---- G.rotabunensis_G132 ...... ------...... -.TT------TAC TTTA..---- G.dalhousiana_G151 ...... ------...... -.TT------TAC TTTA..---- Goodyera_oblongifolia_G114 ...... T ...... ------...... TT------CTTCC TTTA..----

2 G.tesselata_G149 ...... T ...... ------...... TT------CTTCC TTTA..---- 8

6 Goodyera_bifida_G55 ...... ------...... TT------CTTTC TTTA..---- Goodyera_carnea_G103 ...... A.------...... TT------ATTTC TTTA..---- Goodyerapussilla_G162 ...... C------...... TT------CTTTC TTTA..---- G_procera_G178 ...A...... G...------A...... TT------CTTTC TTTA..----

Ligophylla_G88 ...A...... ------...... C...TT------CTTTC TTTA..---- G.clavata_G44 ...... ------...... TT------CTTTC TTTA..---- 360 Sarcoglottis_G126 ------TTA- ----C------TATTAT- --CATAT--- Anoectochilus_brevilabris_G67 ------...- ----.------...... - --.TC..--- Anoetochilus_sikimensis_G87 ------...- ----.------...... - --.TC..--- Anoectochilus_chapaenensis_G123 ------...- ----.------...... - --.TC..--- Dossinia_mormorata_G102 ------...- ----.------...... - --.TC..--- Anoectochilus_etaceus_G69 ------...- ----.------...... - --.TC..--- Macodes_lewii_G96 ------...- ----.------...... - --.TC..--- Anoectochilus_formosanum_G89 ------...- ----.------...... - --ATC..--- Macodes_andriana_G125 ------...- ----.------...... - --ATC..--- Anoectochilus_green_G68 ------...- ----.------...... - --.TC..---

Ludisiani_grescens_G66 ------...- ----.------...... - --.TC..--- Blackepiphite_G124 ------...- ----.------...... - --.TC..--- Anoectochilus_etaceus_G78 ------...- ----.------...... - --.TC..--- Hetaeria_cristata_G47 ------...- ----.------...... - --.TC..--- 2

8 Rhomboda_ketambe_G204 ------...- ----.------...... - --.T...--- 7 Vrydagzynea_G107 ------...- ----.------...... - --.T...--- Vrydagzynea_G79 ------...- ----.------...... - --.T...--- Cystorcchis_johnscoll_G65 TATATA...- ----.------...... - --.T...ATC Ludisia_discolor_G71 ------...- ----.------...... - --.TC..--- Hetaeriao_blongifolia_G51 ------...- ----.------...... - --.T...---

GoodyeraHOC_474_G63 ------...- ----.TATAT ATTA------C...T CC.T...--- Herpys_marubens_G97 ------.....- --.T...--- G.pubescens_G45 ------...- ----.------...... - --TTAC.--- Plactyplectron_G529 ------...- ----.------...... - --.T.C.--- Pristiglottis_G182 ------...- ----.------....C.- --.TC..--- Goodyera_repens_G73 ------...------T------...... - --.T...--- Goodyera_vitata_G62 ------...- ----.TAT-T AT------CGT------..--- Zeuxine_oblonga_G214 ------...- ----.TAT-T AT------CTT------...... - --.T...--- Zeuxine_viridiflora_G57 ------...- ----.TAA-- AT------ATTAC------...... - --AT...--- Anoectochilus_lanceolatus_G70 ------...- ----.TAT-T AT------CTT--ATT TAC.....G- --T....--- 360

Goodyeracfschlectendaliana_G95 ------...- ----.TAT-T AT------CTT--ATT TAC...... - --.T...--- G.daibucanensis_G98 ------...- ----.TAT-T AT------CTT--ATT TAC...... - --.T...--- G.rotabunensis_G132 ------...- ----.TAT-T AT------CTT--ATT TAC...... - --.T...--- G.dalhousiana_G151 ------T TAC...... - --.T...--- Goodyera_oblongifolia_G114 ------...- ----.TAT-T AT------CTT--ATC TAC.....G- --G...----

2 G.tesselata_G149 ------...- ----.TAT-T AT------CTT--ATC TAC.....G- --G...---- 8

8 Goodyera_bifida_G55 ------...- ----.TATAT AT------TAC...... - --.T...--- Goodyera_carnea_G103 ------...A TATT.TTTAT ATTAATATAT AG------TAG...... - --TT...--- Goodyerapussilla_G162 ------...- ----.TAT------...- --.T...--- G_procera_G178 ------...- ----.TAT------...- --.T...---

Ligophylla_G88 ------...- ----ATATAT ATTAG---AT AT------TAG....T.- --TT...--- G.clavata_G44 ------...- ----.TATAT AT------TAC...... - --TT...--- 420 Sarcoglottis_G126 ------CTAC---TA TTAAG------GT------ATG- Anoectochilus_brevilabris_G67 ------....---.. ...G.------A.------...- Anoetochilus_sikimensis_G87 ------....---C. ...G.------A.------...- Anoectochilus_chapaenensis_G123 ------....---.. ...G.------A.------...- Dossinia_mormorata_G102 ------....---.. ...G.------A.------...- Anoectochilus_etaceus_G69 ------....---.. ...G.------A.------...- Macodes_lewii_G96 ------....---.. ...G.------A.------...- Anoectochilus_formosanum_G89 ------....---.. ...G.------A.------...- Macodes_andriana_G125 ------....---.. ...G.------A.------...- Anoectochilus_green_G68 ------....---.. ...G.------A.------...-

Ludisiani_grescens_G66 ------....---.. ...G.------A.------...- Blackepiphite_G124 ------....---.. ...G.------A.------...- Anoectochilus_etaceus_G78 ------....---.. ...G.------A.------...- Hetaeria_cristata_G47 ------....---.. ...G.------A.------...- 2

8 Rhomboda_ketambe_G204 ------....---.. ...G.------A.------...- 9 Vrydagzynea_G107 ------....---.. ...G.------A.------...- Vrydagzynea_G79 ------...T---.. ...G.------A.------...- Cystorcchis_johnscoll_G65 TTAGATCTTA T....---.. ...G.TATTA GTAGGTATTA GGA.------...- Ludisia_discolor_G71 ------....---.. ...G.------A.------...A Hetaeriao_blongifolia_G51 ------....---.. ...G.------

GoodyeraHOC_474_G63 ------....---.. ...G.------A.------...- Herpys_marubens_G97 ------....---.. ...G.------A.------...- G.pubescens_G45 ------A.TA---.. ...G.------A.------...- Plactyplectron_G529 ------T...---.. ...G.------A.------...- Pristiglottis_G182 ------....---.. ...G.------A.------...- Goodyera_repens_G73 ------....---.. ...G.------A.------...- Goodyera_vitata_G62 ------....TAC.. ...G.------A.ATGAGT ATTAGT...- Zeuxine_oblonga_G214 ------....TAC.. ...G.------A.AGGAGT ATTAGT.G.- Zeuxine_viridiflora_G57 ------....---.. ...G.------A.ATGAGT ATTAGT...- Anoectochilus_lanceolatus_G70 ------G A..GT------A.------...- 420

Goodyeracfschlectendaliana_G95 ------T...---.. ...G.------A.------...- G.daibucanensis_G98 ------T...---.. ...G.------A.------...- G.rotabunensis_G132 ------T...---.. ...G.------A.------...- G.dalhousiana_G151 ------T...---.. ...G.------A.------...- Goodyera_oblongifolia_G114 ------A. A..G.------A.------.AA-

2 G.tesselata_G149 ------A. A..G.------A.------.AA- 9

0 Goodyera_bifida_G55 ------....---.. ...G.------A.------...- Goodyera_carnea_G103 ------....---.. ...G.------A.------...- Goodyerapussilla_G162 ------....---.. ...G.------A.------...- G_procera_G178 ------....---.C ...GT------A.------...-

Ligophylla_G88 ------....---.. ...GT------A.------..A- G.clavata_G44 ------....---.. ...G.------A.------...- 480 Sarcoglottis_G126 -----AGTAT TAGTATTAGT ATAGGATAAG TATATATATA GAAACCCTCT AT-TT----- Anoectochilus_brevilabris_G67 -----...... G...... G...... G...... C..----- Anoetochilus_sikimensis_G87 -----...... G...... G...... G...... C..----- Anoectochilus_chapaenensis_G123 -----...... G...... G...... G...... C..----- Dossinia_mormorata_G102 -----...... G...... G...... G...... C..----- Anoectochilus_etaceus_G69 -----...... G...... G...... G...... C..----- Macodes_lewii_G96 -----...... G...... G...... G...... C..----- Anoectochilus_formosanum_G89 -----...... G...... G...... G...... C..----- Macodes_andriana_G125 -----...... G...... G...... G...... C..----- Anoectochilus_green_G68 -----...... G...... G...... G...... C..-----

Ludisiani_grescens_G66 -----...... G...... G...... G...... C..----- Blackepiphite_G124 -----...... G...... G...... G...... C..----- Anoectochilus_etaceus_G78 -----...... G...... A...... G...... G...... C..----- Hetaeria_cristata_G47 -----...... G...... A...... G...... G...... C..----- 2

9 Rhomboda_ketambe_G204 -----...... G...... G...... G...... T..----- 1 Vrydagzynea_G107 -----...... G...... G...... G...... C..----- Vrydagzynea_G79 -----...... G...... G...... G...... C..----- Cystorcchis_johnscoll_G65 -----...... G...... G...... G...... C..----- Ludisia_discolor_G71 GTATT...... G...... G...... G...... C..----- Hetaeriao_blongifolia_G51 ------A...G...... A G...... G...... C..-----

GoodyeraHOC_474_G63 -----....------...... G...... G...... C..AAATT Herpys_marubens_G97 -----...... G...... G...... G...... C..----- G.pubescens_G45 -----....------...... G...... CG...... C..----- Plactyplectron_G529 -----...... G...... G...... --. T...... C.-..----- Pristiglottis_G182 -----...... G...... G...... G...... C..----- Goodyera_repens_G73 -----....------...... G...... G...... C..----- Goodyera_vitata_G62 -----....------...... G...... G...... C..----- Zeuxine_oblonga_G214 -----....------...... G...... G...... C..----- Zeuxine_viridiflora_G57 -----....------...... A A...... G. ....T...... C..----- Anoectochilus_lanceolatus_G70 -----....------...... G...... G...... C..----- 480

Goodyeracfschlectendaliana_G95 -----....------...... G...... G...... C..----- G.daibucanensis_G98 -----....------...... G...... G...... C..----- G.rotabunensis_G132 -----....------...... G...... G...... C..----- G.dalhousiana_G151 -----....------...... G...... G...... C..----- Goodyera_oblongifolia_G114 -----....------...... G...... G...... C..-----

2 G.tesselata_G149 -----....------...... G...... G...... C..----- 9

2 Goodyera_bifida_G55 -----....------...... G...... G...... C..ATATT Goodyera_carnea_G103 -----....------..A...... G...... G...... C..----- Goodyerapussilla_G162 -----....------...... G...... G...... C..AGATT G_procera_G178 -----....------...... G...... G. A...A...... C..-----

Ligophylla_G88 -----....------...A..... G...... G...... C..----- G.clavata_G44 -----....------...... G...... G...... C..----- 540 Sarcoglottis_G126 ------ATC TTCTATT--- -AT------TCTA--- --TATTAATT AGAA------Anoectochilus_brevilabris_G67 ------..A ....TC.TTA T..------....--- --...A...... ------Anoetochilus_sikimensis_G87 ------..A ....TC.TTA T..------....--- --...A...... ------Anoectochilus_chapaenensis_G123 ------..A ....TC.TTA T..------....--- --...A...... ------Dossinia_mormorata_G102 ------..A ....TC.TTA T..------....--- --...A...... ------Anoectochilus_etaceus_G69 ------..A ....TC.TTA T..------....--- --...A.-...... ------Macodes_lewii_G96 ------..A ....TC.TTA T..------....--- --...A...... ------Anoectochilus_formosanum_G89 ------..A ....TC.TTA T..------....--- --...A...... ------Macodes_andriana_G125 ------..A ....TC.TTA T..------....--- --...A...... ------Anoectochilus_green_G68 ------C.A ..T.T..TTA T..------....--- --...... ATTAAT

Ludisiani_grescens_G66 ------..A ....T..TTA T..------....--- --...... ATTAAT Blackepiphite_G124 ------..A ....TC.TTA T..------....--- --...A...... ------Anoectochilus_etaceus_G78 ------..A ....TC.TTA T..------....--- --...A...... ------Hetaeria_cristata_G47 ------..A ....TC.TTA T..------....--- --...A...... ------2

9 Rhomboda_ketambe_G204 ------..A ....TC.TTA T..------....--- --...... ------3 Vrydagzynea_G107 ------..A ....TC.TTA T..------....--- --...... ------Vrydagzynea_G79 ------..A ....TC.TTA T..------....--- --...... ------Cystorcchis_johnscoll_G65 ------..A ....TC.TTA T..------....--- --...... ------Ludisia_discolor_G71 ------C.A ..T.T..TTA A..------....--- --...... ATTAAT Hetaeriao_blongifolia_G51 ------..A ....TC.TTA T..------....--- --...... ------

GoodyeraHOC_474_G63 TTATCTT.AA .....A.TTA A..------....--- --...... ------Herpys_marubens_G97 ------..A ....TC.TTA T..------....--- --...... ------G.pubescens_G45 ------..A .....A.TTA T..------....--- --...... ------Plactyplectron_G529 ------C.A ...... CTA T.GT------....--- --...... ------Pristiglottis_G182 ------C.A ....TC.TTC T..TCTATAT T--....TTG TC...... ------Goodyera_repens_G73 ------..A .....A.TTA T..------....--- --...... ------Goodyera_vitata_G62 ------C.A ..------T..--- --.C...... ------Zeuxine_oblonga_G214 ------..A ..------T..--- --A...... ------Zeuxine_viridiflora_G57 ------..A ....TC.TTA T..------....--- --...... ------Anoectochilus_lanceolatus_G70 ------..A .....A.TTA G..------....--- --...... ------540

Goodyeracfschlectendaliana_G95 ------..A .....A.TTA G..------....--- --...... ------G.daibucanensis_G98 ------..A .....A.TTA G..------....--- --...... ------G.rotabunensis_G132 ------..A .....A.TTA G..------....--- --...... ------G.dalhousiana_G151 ------..A .....A.TTA G..------....--- --...... ------Goodyera_oblongifolia_G114 ------..A ...G.A.TTC T..------....--- --...... ------

2 G.tesselata_G149 ------..A ...G.A.TTC T..------....--- --...... ------9

4 Goodyera_bifida_G55 TTATCTT..A .....A.TTA G..------....--- --...... ------Goodyera_carnea_G103 ------..A .....A.TGA G..------....--- --...... ------Goodyerapussilla_G162 TTATCTT..A .....A.TTA G..------....--- --...... ------G_procera_G178 ------..A .....A.TTA G..------....--- --...G...... ------

Ligophylla_G88 ------..A .....A.TTC T..TCTATAT TAA....--- --...... ------G.clavata_G44 ------..A .....A.TTA T..------....--- --...... ------600 Sarcoglottis_G126 -----TAATA TACTATGAAA AGTTGAAATT CTATCAATTC TAATTGAAGT TGAAAAAAGA Anoectochilus_brevilabris_G67 -----.G..T A...... A..------...... A ...... Anoetochilus_sikimensis_G87 -----.G..T A...... A..------...... Anoectochilus_chapaenensis_G123 -----.G..T A...... A..------...... A ...... Dossinia_mormorata_G102 -----.G..T A...... A..------...... A ...... Anoectochilus_etaceus_G69 -----.G..T A...... A..------...... A ...... Macodes_lewii_G96 -----.G..T A...... A..------...... A ...... Anoectochilus_formosanum_G89 -----.T..T A...... A..------...... A ...... Macodes_andriana_G125 -----.T..T A...... A..------...... A ...... Anoectochilus_green_G68 TAGAA.T... A...... A..------......

Ludisiani_grescens_G66 TAGAA.G... A...... A..------...... Blackepiphite_G124 -----.G..T A...... A..------...... T ...... Anoectochilus_etaceus_G78 -----.G... A...... A..------...... A ...... T. Hetaeria_cristata_G47 -----.G... A...... A..------...... A ...... T. 2

9 Rhomboda_ketambe_G204 -----.G... A...... ------...... A ...... 5 Vrydagzynea_G107 -----.G... A...... ------...... A ...... Vrydagzynea_G79 -----.G.G. A...... ------...... A ...... Cystorcchis_johnscoll_G65 -----.G... A...... ------...... A ...... C...... Ludisia_discolor_G71 TAGAA.T... A...... A..------...... Hetaeriao_blongifolia_G51 -----.G... A...... T..------...... A G......

GoodyeraHOC_474_G63 -----.T... A....G...... ------.TC...... Herpys_marubens_G97 -----.G... A...... ------...... A ...... G.pubescens_G45 -----GG... A...... ------.T....A ...... Plactyplectron_G529 -----.G... A...... ------...... Pristiglottis_G182 -----.G.G. A...... A..------...... Goodyera_repens_G73 -----.G... A.....A...... ------.T....A G...... A. ..------Goodyera_vitata_G62 -----.G... A...... ------...... T...... Zeuxine_oblonga_G214 -----.G... A....G...... ------...... Zeuxine_viridiflora_G57 -----.G... A....G...... ------...... ------Anoectochilus_lanceolatus_G70 -----..... A...... ------.TC...A G...... 600

Goodyeracfschlectendaliana_G95 -----..... A...... ------.TC...A G...... G.daibucanensis_G98 -----..... A...... ------.TC...A G...... G.rotabunensis_G132 -----..... A...... ------.TC...A G...... G.dalhousiana_G151 -----..... A...... ------.TC...A G...... Goodyera_oblongifolia_G114 -----.G... A...... ------.T....A ......

2 G.tesselata_G149 -----.G... A...... ------.T....A ...... 9

6 Goodyera_bifida_G55 -----.T... A...... ------.TC...... Goodyera_carnea_G103 -----.G... A...... TT..------.G....A ...... Goodyerapussilla_G162 -----.T... A....G...... ------.TC...... G_procera_G178 -----.G... A...... ------.T------......

Ligophylla_G88 -----.G... A.....C...... ------.TC...... A...... G.clavata_G44 -----.G... A...... ------.G...... 660 Sarcoglottis_G126 ATCG-AATT- CAAATATTAA GTTATTT-AG TTAT-AAAA------TG ATTCATT--- Anoectochilus_brevilabris_G67 ...A-....- ...... ------.C-.. .G..-C...------.. .G.....--- Anoetochilus_sikimensis_G87 ...A-....- ...... ------.C-.. .G..-C...------.. .G.....--- Anoectochilus_chapaenensis_G123 ...A-....- ...... ------.C-.. .G..-C...------.. .G.....--- Dossinia_mormorata_G102 ...A-....- ...... ------.C-.. .G..-C...------.. .G.....--- Anoectochilus_etaceus_G69 ...A-....- ...... ------.C-.. .G..-C...------.. .G.....--- Macodes_lewii_G96 ...A-....- ...... ------.C-.. .G..-C...------.. .G.....--- Anoectochilus_formosanum_G89 ...A-....- ...... ------.C-.. .G..-C...------.. .G.....--- Macodes_andriana_G125 ...A-....- ...... ------.C-.. .G..-C...------.. .G.....--- Anoectochilus_green_G68 ...A-....- ...... ------.C-.. .G..-C...------.. .G.T...TGA

Ludisiani_grescens_G66 ...A-....- ...... ------.C-.. .G..-C...------.. .G.....--- Blackepiphite_G124 ...A-....- ...... ------.C-.. .G..-C...------.. .G.....--- Anoectochilus_etaceus_G78 ..AC-....- ...... ------.A-.. .G..-C...------.. .G.....--- Hetaeria_cristata_G47 ..AC-....- ...... ------.A-.. .G..-C...------.. .G.....--- 2

9 Rhomboda_ketambe_G204 ..AA-....- .....T.------GA-.A .G..-C...------.. .G.....--- 7 Vrydagzynea_G107 ..AA-....- ...... ------.A-.A .G..-C...------.. .G.....--- Vrydagzynea_G79 ...A-....- ...... ------.A-.. .G..-C...------.. .G.....--- Cystorcchis_johnscoll_G65 ...A-....- ...... ------.C-.. .G..-C...------.. .G.....--- Ludisia_discolor_G71 ...A-....T .T.....------.CCG. GG..CC...------.. .G.T...TGA Hetaeriao_blongifolia_G51 ...A-....- ...... ------.C-.. .G..-C...------.. .G.....---

GoodyeraHOC_474_G63 ....G....- .C.....------.C-.. .G..-C...------G. .G.....--- Herpys_marubens_G97 ...A-....- ...... ------..-.. .G..-C...------.. .G.....--- G.pubescens_G45 ....-....- ...... ------.C-C. .G..-C...------.. .G.....--- Plactyplectron_G529 ....-....- ...... ------.C-.. .G..-G...------...... --- Pristiglottis_G182 ...A-....- ...... ------.C-.. .G..-C...------.A .G.....--- Goodyera_repens_G73 -----....- ...... ------.C-...... -C...------.. .G.....--- Goodyera_vitata_G62 ...A-....- ...... ------.A-.. .G..-C...------.. .G.....--- Zeuxine_oblonga_G214 ...A-....- ...... ------.A-.. .G..-C...------.. .GC....--- Zeuxine_viridiflora_G57 ------..------.C-.. .G..-C...------.. .G.....--- Anoectochilus_lanceolatus_G70 ..T.-....- .G.....------.C-.. .G..-C...------.. .G.....--- 660

Goodyeracfschlectendaliana_G95 ..T.-....- .G.....------.C-.. .G..-C...------.. .G.....--- G.daibucanensis_G98 ..T.-....- .G.....------.C-.. .G..-C...------.. .G.....--- G.rotabunensis_G132 ..T.-....- .G.....------.C-.. .G..-C...------.. .G.....--- G.dalhousiana_G151 ..T.-....- .G.....------.C-.. .G..-C...------.. .G.....--- Goodyera_oblongifolia_G114 ..T.-....- ...... ------.C-.. .G..-C...------.. .G.....---

2 G.tesselata_G149 ..T.-....- ...... ------.C-.. .G..-C...------.. .G.....--- 9

8 Goodyera_bifida_G55 ...A-....- ...... ------.C-.. .G..-C...------.. .G.....--- Goodyera_carnea_G103 ...A-....- ...... ------.C-.. .G..-C...------.. .G.....--- Goodyerapussilla_G162 ....-....- ...... ------.C-.. .G..-C...------.. .G.....--- G_procera_G178 ...A-....- ...... ------.C-.. .G..-C...------.. .A.....---

Ligophylla_G88 ...A-....- ...T...------.C-.. .G..-C...T GAGTCGTT.. .G.....--- G.clavata_G44 ...A-....- ...... ------.C-.. .G..-C...------.. .G.....--- 720 Sarcoglottis_G126 ------CC A-GAGTTT-T CTATATTTTT TGAAGATGAA ------TCGG ACG-AGAATA Anoectochilus_brevilabris_G67 ------TC.. G-C.A...GG A..G...... ------...... -...... Anoetochilus_sikimensis_G87 ------.. .-..A...-G A...... ------...... -...... Anoectochilus_chapaenensis_G123 ------.. .-..A...-G A...... ------...... -...... Dossinia_mormorata_G102 ------.. .-..A...-G A...... ------...... -...... Anoectochilus_etaceus_G69 ------.. .-..A...-G A...... ------...... -...... Macodes_lewii_G96 ------.. .-..A...-G A...... ------...... -...... Anoectochilus_formosanum_G89 ------.. .-..A...-G A...... ------...... -...... Macodes_andriana_G125 ------.. .-..A...-G A...... ------...... -...... Anoectochilus_green_G68 GT-CATTC.. .-...... -G A...... ------...... -......

Ludisiani_grescens_G66 ------.. .-...... -G A...... ------...... -...... Blackepiphite_G124 ------.T .-..A...-. ...G...... ------...... -...... Anoectochilus_etaceus_G78 ------.. .-...... -G A..G...... ------...... -...... Hetaeria_cristata_G47 ------.. .-...... -G A..G...... ------...... -...... 2

9 Rhomboda_ketambe_G204 ------T. .-...... -G A...... ------...... -...... 9 Vrydagzynea_G107 ------T. .-...... -G A..G...... ------...... -...... Vrydagzynea_G79 ------T. .-...... -G A.CG...... ------...... -...... Cystorcchis_johnscoll_G65 ------.. .-...... -G A...... ------...... -...... Ludisia_discolor_G71 GTTCCTTC.A G-.G....-. A...... A..... ------A...... A...... Hetaeriao_blongifolia_G51 ------.. .G..A...-G A...... ------...... -......

GoodyeraHOC_474_G63 ------.. .-...... -G A..G...... ------...... -...... Herpys_marubens_G97 ------.. .-T.....-G A...... ------.T.. ...-...... G.pubescens_G45 ------.. .-...... -G A..G...... A.. ------...... -...... Plactyplectron_G529 ------.. .-...... -G A..G...... AA.. ------...... -...... Pristiglottis_G182 ------.. .-...... -G A...C...... ------...... -...... Goodyera_repens_G73 ------.. .-...... -G A..G...... ------...... -...... Goodyera_vitata_G62 ------.. .-...... -G A.C...... ------...... -...... Zeuxine_oblonga_G214 ------.. .-...... -G A...... T..... ------...... -...... Zeuxine_viridiflora_G57 ------.. .-...... -G A...... ------...... -...... Anoectochilus_lanceolatus_G70 ------.. .-...... -G A..G...... ------...... -...... 720

Goodyeracfschlectendaliana_G95 ------.. .-...... -G A..G...... ------...... -...... G.daibucanensis_G98 ------.. .-...... -G A..G...... -.. ------...... -...... G.rotabunensis_G132 ------.. .-...... -G A..G...... ------...... -...... G.dalhousiana_G151 ------.. .-...... -G A..G...... A.. ------...... -...... Goodyera_oblongifolia_G114 ------.. .-...... -G A..G...... GATGAA...... -......

3 G.tesselata_G149 ------.. .-...... -G A..G...... GATGAA...... -...... 0

0 Goodyera_bifida_G55 ------.. .-...... -G A..G...... ------...... -...... Goodyera_carnea_G103 ------.. .-...... -G A..G...... T...... ------...... -...... Goodyerapussilla_G162 ------.. .-...... -G A..G...... ------...... -...... G_procera_G178 ------.. .-...... -. A..G...... ------...... -......

Ligophylla_G88 ------.. .-...... -G A..G...... ------...... -...... G.clavata_G44 ------.. .-...... -G A...... ------...... -...... 780 Sarcoglottis_G126 AA--GAGAGA GTCC-CCTTT TACATGTCAA TACCGACAAC AATGAAATTT AAAGTAAGAG Anoectochilus_brevilabris_G67 ..--...... -.A...... G...... Anoetochilus_sikimensis_G87 ..--...... -.A...... G...... Anoectochilus_chapaenensis_G123 ..--...... -.A...... G...... Dossinia_mormorata_G102 ..--...... -.A...... G...... Anoectochilus_etaceus_G69 ..--...... -.A...... G...... Macodes_lewii_G96 ..--...... -.A...... G...... Anoectochilus_formosanum_G89 ..--...... -.A...... G...... Macodes_andriana_G125 ..--...... -.A...... G...... Anoectochilus_green_G68 ..--...... -.A...... G .G......

Ludisiani_grescens_G66 ..--...... -.A...... G .GG...... Blackepiphite_G124 ..--...... -.A...... G...... Anoectochilus_etaceus_G78 ..--...... -.A...... G...... Hetaeria_cristata_G47 ..--...... -.A...... G...... 3

0 Rhomboda_ketambe_G204 ..--...... -.A...... G...... 1 Vrydagzynea_G107 ..--...... -.A...... G...... Vrydagzynea_G79 ..--...... -.A...... T...... Cystorcchis_johnscoll_G65 ..--...... -.A...... G...... Ludisia_discolor_G71 ..--...... C.A...... G...... G....G .G...... Hetaeriao_blongifolia_G51 ..AG...... -.A...... C...... G......

GoodyeraHOC_474_G63 ..--...... -...... G...... Herpys_marubens_G97 ..--...... -.A...... G...... G.pubescens_G45 ..--...... -.A...... G...... GG.....G. Plactyplectron_G529 ..--..T...... -.A...... T...... Pristiglottis_G182 ..--...... -.A...... C..-...... G .G...... Goodyera_repens_G73 ..--...... -.A...... G...... Goodyera_vitata_G62 ..--...... -.A...... G...... Zeuxine_oblonga_G214 ..--...... -.A...... G...... Zeuxine_viridiflora_G57 ..--...... -.A...... A...... A...... G...... Anoectochilus_lanceolatus_G70 ..--...... -.A...... C...... G...... 780

Goodyeracfschlectendaliana_G95 ..--...... -.A...... G...... G.daibucanensis_G98 ..--...... -.A...... - ...... - ...... G....-... G.rotabunensis_G132 ..--...... -.A...... G...... G.dalhousiana_G151 ..--...... -.A...... A ...... G...... Goodyera_oblongifolia_G114 ..--...... -.A...... G......

3 G.tesselata_G149 ..--...... -.A...... G...... 0

2 Goodyera_bifida_G55 ..--...... -.A...... G...... Goodyera_carnea_G103 ..--...... -.A...... G...... Goodyerapussilla_G162 ..--...... -...... G...... G_procera_G178 ..--...... -.A...... G......

Ligophylla_G88 ..--...... -.A...... T...... G.clavata_G44 ..--...... -.A...... G...... 840 Sarcoglottis_G126 GAAAATCCGT CGAAT---AA AAAT------Anoectochilus_brevilabris_G67 ...... TG-...... CGTGAG GGTTCAAGTC CCTCTATCCC CAAGAAAAAG Anoetochilus_sikimensis_G87 ...... TG-...... CGTGAG GGTTCAAGTC CCTCTATCCC CAAGAAAAAG Anoectochilus_chapaenensis_G123 ...... -G-...... CG-GAG GGTTCAAGTC CCTCTATCCC CAAGAAAAAG Dossinia_mormorata_G102 ...... TG-...... CGTGAG GGTTCAAGTC CCTCTATCCC CAAGAAAAAG Anoectochilus_etaceus_G69 ...... -G-...... CGTGAG GGTTCAAGTC CCTCTATCCC CAAGAAAAAG Macodes_lewii_G96 ...... TG-...... CGTGAG GGTTCAAGTC CCTCTATCCC CAAGAAAAAG Anoectochilus_formosanum_G89 ...... -G-...... CGTGAG GGTTCAAGTC CCTTTTTCCC CAAGAAAAAG Macodes_andriana_G125 ...... TG-...... CGTGAG GGTTCAAGTC CCTCTATCCC CAAGAAAAAG Anoectochilus_green_G68 ...... TG-...... CGGGAG GGTTCAAGTC CCTCTATCCC CAAGAAAA-G

Ludisiani_grescens_G66 ...... -G-...... CGTGAG GGTTCAAGTC CCTCTATCCC CAAGAAAA-G Blackepiphite_G124 ...... TG-...... CGTGAG GGTTCAAGTC CCTCTATCCC CAAGAAAAAG Anoectochilus_etaceus_G78 ...... TG-...... CGTGAG GGTTCAAGTC CCTCTATCCC CAAGAAAAAG Hetaeria_cristata_G47 ...... TG-...... CGTGAG GGTTCAAGTC CCTCTATCCC CAAGAAAAAG 3

0 Rhomboda_ketambe_G204 ...... TG-...... CGAGAG GGTTCAAGTC CCTCTATCCC CAAGAAAAAG 3 Vrydagzynea_G107 ...... TG-...... CGTGAG GGTTCAAGTC CCTCTATCCC CAAGAAAAAG Vrydagzynea_G79 ...... TG-...... CGTGAG GGTTCAAGTC CCTCTATCCC CAAGAAAAAG Cystorcchis_johnscoll_G65 ...... TG-...... CGAGAG GGTTCAAGTC CCTCTATCCC CACGAAAAAG Ludisia_discolor_G71 ...... TG-G. ....CGTGAG GGTTCAAGTC CCTCTATCCC CAAGAAAA-G Hetaeriao_blongifolia_G51 ...... TGG...... CGGGAG GGTTCAAGTC CCTCTATCCC CAAGAAAAAG

GoodyeraHOC_474_G63 ...... TG-...... CGTGAG GGTTCAAGTC CCTCTATCCC CAAGAAAAAG Herpys_marubens_G97 ...... TG-...... CGTGAG GGTTCAAGTC CCTCTATCCC CAAGAAAAAG G.pubescens_G45 ...... TG-...... CGGGGG GGTTCAAGTC CCTTTTTCCC CAAGAAAAAG Plactyplectron_G529 ...... TG-...... CGTGAG GGTTCAAGTC CCTCTATCCC CAAGAAAAAG Pristiglottis_G182 ...... T....TG-...... CG-GAG GGTTCAAGTC CCTCTATCCC CAAGAAAAAG Goodyera_repens_G73 ...... -G-...... CGTGAG GGTTCAAGTC CCTCTATCCC CAATAAAAAG Goodyera_vitata_G62 ...... TG-...... CGTGAG GGTTCAAGTC CCTCTATCCC CAAGAAAAAG Zeuxine_oblonga_G214 ...... TG-...... CGTGAG GGTTCAAGTC CCTCTATCCC CAAGAAAAAG Zeuxine_viridiflora_G57 ...... TG-.. ..T.CGTGAG GGTTCAAGTC CCTCTATCCC CAAGAAAAAA Anoectochilus_lanceolatus_G70 ...... TG-...... CGGGAG GGTTCAAGTC CCCCTATCCC CAAGAAA-AG 840

Goodyeracfschlectendaliana_G95 ...... TG-...... CGTGAG GGTTCAAGTC CCTCTATCCC CAAGAAAAAG G.daibucanensis_G98 ...... TG-...... CGGGAG GGTTCAAGTC CCTCTATCCC CAAGAAAAAG G.rotabunensis_G132 ...... TG-...... CGTGAG GGTTCAAGTC CCTCTATCCC CAAGAAAAAG G.dalhousiana_G151 ...... TG-...... CGTGAG GGTTCAAGTC CCTCTATCCC CAAGAAAAAG Goodyera_oblongifolia_G114 ...... TG-...... CGTGAG GGTTCAAGTC CCTCTATCCC CAAGAAAAAG

3 G.tesselata_G149 ...... TG-...... CGTGAG GGTTCAAGTC CCTCTATCCC CAAGAAAAAG 0

4 Goodyera_bifida_G55 ...... TG-...... CGTGAG GGTTCAAGTC CCTCTATCCC CAAGAAAAAG Goodyera_carnea_G103 ...... TG-...... CGTGAG GGTTCAAGTC CCTCTATCCC CAATAAAAAG Goodyerapussilla_G162 ...... TG-...... CGTGAG GGTTCAAGTC CCTCTATCCC CAAGAAAAAG G_procera_G178 ...... TG-...... CGTGAG GGTTCAAGTC CCTCTATCCC CAAGAAAAAG

Ligophylla_G88 ...... TG-...... CGTGAG GGTTCAAGTC CCTCTATCCC CAAGAAAAAG G.clavata_G44 ...... TG-...... CGTGAG GGTTCAAGTC CCTCTATCCC CAAGAAAAAG 900 Sarcoglottis_G126 CCCATT-TTA TTCCT--CAC TCTTTCTTTG AA-T-CTCAT CC-----TAT TTTTTT---A Anoectochilus_brevilabris_G67 ...... T.A...... --...... - .C-.-...... -----...... ---. Anoetochilus_sikimensis_G87 ...... T.A...... --...... - .C-.-...... -----...... ---. Anoectochilus_chapaenensis_G123 ...... T.A...... --...... - .C-.-...... -----...... ---. Dossinia_mormorata_G102 ...... T.A...... --...... - .C-.-...... -----...... ---. Anoectochilus_etaceus_G69 ...... T.A- .....--...... - .C-.-...... -----...... ---. Macodes_lewii_G96 ...... T.A...... --...... - .C-.-...... -----...... ---. Anoectochilus_formosanum_G89 .-....T.A- .....--...... - .CG.-...... -----...... ---. Macodes_andriana_G125 ...... T.A...... --...... - .C-.-...... -----...... ---. Anoectochilus_green_G68 ...... T.A...... --..T ...... - .C-.-...... -----...... ---.

Ludisiani_grescens_G66 T.....T.A...... --..T ...... - .C-.-...... -----...... ---. Blackepiphite_G124 ...... T.A...... --...... - .C-.-...... -----...... ---. Anoectochilus_etaceus_G78 ...... T.A...... --...... - .C-.-...... -----...... ---C Hetaeria_cristata_G47 ...... T.A...... --...... - .C-.-...... -----...... ---C 3

0 Rhomboda_ketambe_G204 ...... T.A...... --...... C.....- .C-.-...... AAAGG.CA .C.C..---- 5 Vrydagzynea_G107 ...... T.A...... --...... C.....- .C-.-...... -----.C...... ---. Vrydagzynea_G79 T.....T.A. ...T.--...... - .C-.-...... -----...... ---. Cystorcchis_johnscoll_G65 ...... T.A...... --...... T...- .C-.-...... T-----...... T--. Ludisia_discolor_G71 ...... T.A...... --..T ...... - .C-.-...... -----...... ---. Hetaeriao_blongifolia_G51 ...... TGA...... --...... - .C-.-...... -----.C...... ---.

GoodyeraHOC_474_G63 ...G..T.A. ....C--...... - .C-.-...... -----.C...... T--. Herpys_marubens_G97 ...... T.A...... --...... - .C-.-...... -----...... ---. G.pubescens_G45 ...C..T.A. ....C--.C...... T...- .C-.-.C... T.-----.C...... TTT. Plactyplectron_G529 ...... T.A. C....--...... - .T-C-...... -----.C...... AT--. Pristiglottis_G182 ....-.T.A...... --...... - .C-.-...... -----.C...... ---. Goodyera_repens_G73 ...... TGA. ....C--...... - .C-.-...... -----.C...... T--. Goodyera_vitata_G62 ...... TCA...... --...... - .C-.-...... -----...... ---. Zeuxine_oblonga_G214 ...... TCA...... --...... - .C-.-...... -----A...... ----- Zeuxine_viridiflora_G57 ...... T.A...... --...... - .C-.-...... T-----...... ---. Anoectochilus_lanceolatus_G70 ...... T.A. ....CCC.C...... - .C-.T...... -----...... T--. 900

Goodyeracfschlectendaliana_G95 ...... T.A. ....C--...... - .C-.-..... T.-----...... T--. G.daibucanensis_G98 ...... T.A. ....C--...... - .C-.-...... -----...... T--. G.rotabunensis_G132 ...... T.A. ....C--...... - .C-.-...... -----...... T--. G.dalhousiana_G151 ...... T.A. ....C--...... - .C-.-...... -----...... T--. Goodyera_oblongifolia_G114 ...... T.C. ....C--...... - .C-.-..... T.-----.C...... TT-.

3 G.tesselata_G149 ...... T.C. ....C--...... - .C-.-..... T.-----.C...... TT-. 0

6 Goodyera_bifida_G55 ...T..T.A. ....C--...... - .C-.-....C ..-----.C...... T--. Goodyera_carnea_G103 ...... T.C. ....C--...... - .C-.-...... -----.C...... ---. Goodyerapussilla_G162 ...G..T.A. ....C--...... - .C-.-...... -----.C...... T--. G_procera_G178 T.....TGA. ....C--...... - .C-.-...... -----.C...... ---.

Ligophylla_G88 A.....T.A. ....C--...... - .C-.-..T.. ..-----.C...... ---. G.clavata_G44 ...... T.C. ....C--...... - .C-.-...... -----.C...... ---. 960 Sarcoglottis_G126 TCAGTTGTTC AGTTCAAACA AAATTCAATA TCTTTCTAAT TTCATTCAAA ATGTTCTTTC Anoectochilus_brevilabris_G67 ...... ------Anoetochilus_sikimensis_G87 ...... ------Anoectochilus_chapaenensis_G123 ...... ------Dossinia_mormorata_G102 ...... ------Anoectochilus_etaceus_G69 ...... ------Macodes_lewii_G96 ...... A...... ------Anoectochilus_formosanum_G89 ...... -...... ------Macodes_andriana_G125 ...... ------Anoectochilus_green_G68 ...... C...... A...... ------

Ludisiani_grescens_G66 ...... C...... GA...... ------Blackepiphite_G124 ...... GA...... ------Anoectochilus_etaceus_G78 ...... A...... ------Hetaeria_cristata_G47 ...... A...... ------3

0 Rhomboda_ketambe_G204 ----....C. T..CA..C...... A..A. .GAAGT.------7 Vrydagzynea_G107 ...... T...... GA...... ------Vrydagzynea_G79 ...... T...... GA...... ------Cystorcchis_johnscoll_G65 ...... GA...... ------Ludisia_discolor_G71 ...... C...... A...... ------Hetaeriao_blongifolia_G51 ...... T...... GA...... ------

GoodyeraHOC_474_G63 ...... GA...... ------Herpys_marubens_G97 ...... GA...... ------G.pubescens_G45 ...... A...... ------Plactyplectron_G529 ...... ------Pristiglottis_G182 ...... GA...... ------Goodyera_repens_G73 ...... A...... G------Goodyera_vitata_G62 ...... GA.... .A.....------Zeuxine_oblonga_G214 ------Zeuxine_viridiflora_G57 ...... A...... ------Anoectochilus_lanceolatus_G70 ...... GGA...... G------960

Goodyeracfschlectendaliana_G95 ...... T ...... GA...... G------G.daibucanensis_G98 ...... GA...... G------G.rotabunensis_G132 ...... GA...... G------G.dalhousiana_G151 ...... GA...... G------Goodyera_oblongifolia_G114 ...... ------.G------

3 G.tesselata_G149 ...... ------.G------0

8 Goodyera_bifida_G55 ...... -...... GA...... ------Goodyera_carnea_G103 ...... A. ...GGA...... ------Goodyerapussilla_G162 ...... C.GA...... ------G_procera_G178 ...... GA...... ------

Ligophylla_G88 ...... G.GA...... ------G.clavata_G44 ...... GA...... ------1020 Sarcoglottis_G126 ACATTTCATT CAC------TCTATTCTTT CACAAATGGA --TCCA-AAT AGAAA--TCC Anoectochilus_brevilabris_G67 -A...... ------...G...... A... --...G-...... --... Anoetochilus_sikimensis_G87 -A...... ------...G...... A... --.T.G-...... --... Anoectochilus_chapaenensis_G123 -A...... ------...G...... A... --.T.G-...... --... Dossinia_mormorata_G102 -A...... ------...G...... A... --.T.G-...... --... Anoectochilus_etaceus_G69 -A...... ------...G...... A... --.T.G-...... --... Macodes_lewii_G96 -A...... ------...G...... A... --.T.G-... .T...--... Anoectochilus_formosanum_G89 -A...... ------...G...... A... --.T.G-...... --... Macodes_andriana_G125 -A...... ------...G...... A... --.T.G-...... --... Anoectochilus_green_G68 -A...... ------...G...... --...G-...... --...

Ludisiani_grescens_G66 -A...... ------...G...... --...G-...... --... Blackepiphite_G124 -A...... ------...G...... A... --...G-...... --... Anoectochilus_etaceus_G78 -A...... ------...G...... --...G-...... --... Hetaeria_cristata_G47 -A...... ------...G...... --...G-...... --... 3

0 Rhomboda_ketambe_G204 -TT...... T.------..CC...... --...GG... .A...AAC.. 9 Vrydagzynea_G107 -A...... ------...C...... --...G-...... --... Vrydagzynea_G79 -A...... ------...G...... --...G-...... --... Cystorcchis_johnscoll_G65 -A...... ------...G...... --....-...... --... Ludisia_discolor_G71 -A...... ------C..G...... --...G-...... --... Hetaeriao_blongifolia_G51 -A...... ------...G...... --....-...... --...

GoodyeraHOC_474_G63 -A...... ------...G...... TA...C-...... --... Herpys_marubens_G97 -A...... CATTCAC ...G...... --...G-... .A...--... G.pubescens_G45 -A...... ------...G...... --.A.G-...... --.T. Plactyplectron_G529 -A...... ------...G...... G...... --....-...... --... Pristiglottis_G182 -...... G A..------...G...... --...G-...... --... Goodyera_repens_G73 -A...... ------.T.T..A...... --...G-...... --... Goodyera_vitata_G62 -A...... ------...G...... --....-...... --... Zeuxine_oblonga_G214 ------Zeuxine_viridiflora_G57 -A...... ------..------Anoectochilus_lanceolatus_G70 -A...... ------...G...... --...G-...... --... 1020

Goodyeracfschlectendaliana_G95 -A...... ------...G...... --...G-...... --... G.daibucanensis_G98 -A...... ------...G...... --...G-...... --... G.rotabunensis_G132 -A...... ------...G...... --...G-...... --... G.dalhousiana_G151 -A...... ------...G...... --...G-...... --... Goodyera_oblongifolia_G114 -A...... ------...G...... --...G-...... --...

3 G.tesselata_G149 -A...... ------...G...... --...G-...... --... 1

0 Goodyera_bifida_G55 -A...... ------...G...... --...G-...... --... Goodyera_carnea_G103 -A...... ------...T..A...... --...G-...... --... Goodyerapussilla_G162 -A...... ------...G...... T...... TA.GGC-...... --..G G_procera_G178 -A...... ------...G...... --...G-...... --...

Ligophylla_G88 -A...... ------...G...... --...G-...... --... G.clavata_G44 -A...... ------...G...... A... --...G-...... --... 1080 Sarcoglottis_G126 TC---ATATC CTCTTGAAAT T--CCAATCC AATTTTTTT- --TTTTATTT -TTATAAATA Anoectochilus_brevilabris_G67 ..CTCC.... T....CC... .--...... C..T GT....C... -G....G... Anoetochilus_sikimensis_G87 ..CTCC.... T....CC... .--...... C..T GT....C... -G....G... Anoectochilus_chapaenensis_G123 ..CTCC.... T....CC... .--...... C..T GT....C... -G....G... Dossinia_mormorata_G102 ..CTCC.... T....CC... .--...... C..T GT....C... -G....G... Anoectochilus_etaceus_G69 ..CTCC.... T....CC... .--...... C..T GT....C... -G....G... Macodes_lewii_G96 ..CTCC.... T....CC... .--...... C..T GT....C... -G....G... Anoectochilus_formosanum_G89 ..CTTC.... T....CC... .--...... C..T GT....C... -G....G... Macodes_andriana_G125 ..CTCC.... T....CC... .--...... C..T GT....C... -G....G... Anoectochilus_green_G68 ..---C.... T....CC... .--T...... C..T GT....C... -G....G...

Ludisiani_grescens_G66 ..---C.... T....CC... .--T...... C..T GT....C... -G....G... Blackepiphite_G124 ..---C.... T....CC... .--...... C..T GT....C... -G....G... Anoectochilus_etaceus_G78 ..---C...T T....CC... .--...... C..T GT....C... -G....G... Hetaeria_cristata_G47 ..---C...T T....CC... .--...... C..T GT....C... -G....G... 3

1 Rhomboda_ketambe_G204 ..---C...T T....CC... .TC...... A...C..T GT....C.A. ------1 Vrydagzynea_G107 ..---C.... T....CC... .--...... C..T GT....C... ------Vrydagzynea_G79 ..---C.... T....CC... .--...... C..T GT....C... -G....GG.. Cystorcchis_johnscoll_G65 ..---C.... T....CC... .--.....A...... C..T GT....C... -G....G... Ludisia_discolor_G71 ..---C.... T....CC... .--T...... C..T GT...... -G....G... Hetaeriao_blongifolia_G51 ..---C.... T....CC... .--...... C..T GT....C... -G....G...

GoodyeraHOC_474_G63 ..---G.... T.------.. .--...... C..T GT....C... -G....G... Herpys_marubens_G97 ..---C.... T....CC... .--...... C..T GT....C... -G....G.A. G.pubescens_G45 ..---G.... T.A..CC... .------A...... C..T GT....T... -G....G... Plactyplectron_G529 ..---G.... T....CC... .--...... A..T GT...... -G....G... Pristiglottis_G182 ..---C.... T....CC... .------...... C..T GT....C... -G....G... Goodyera_repens_G73 ..---G...- ----.CC... .------...... ------C... -G....G... Goodyera_vitata_G62 ..---C.... T....CC... .--...... C..T -T....C... -G....G... Zeuxine_oblonga_G214 ------C... -G....G... Zeuxine_viridiflora_G57 ------. -G.------Anoectochilus_lanceolatus_G70 ..---G.... T.A..CC... .------..C..T GT....C... -G....G... 1080

Goodyeracfschlectendaliana_G95 ..---G.... T.A..CC... .------...... C..T GT....C... -G....G... G.daibucanensis_G98 ..---G.... T.A..CC... .------...... C..T GT....C... -G....G... G.rotabunensis_G132 ..---G.... T.A..CC... .------...... C..T GT....C... -G....G... G.dalhousiana_G151 ..---G.... T.A..CC... .------...... C..T GT....C... -G....G... Goodyera_oblongifolia_G114 ..---G...A T.A..CC... .------..C..T -T....C... -G....G...

3 G.tesselata_G149 ..---G...A T.A..CC... .------..C..T -T....C... -G....G... 1

2 Goodyera_bifida_G55 ..---G.... T.A..CC... .--...... C..T ------G....G... Goodyera_carnea_G103 ..---G.... T....CC... .--...... C..T ---...C... -G....G... Goodyerapussilla_G162 .A---G.... T.------.. .--...... C..T GT....C... -G....G... G_procera_G178 .A---G.... T.G..CC... .--...... C..T GT....C... GG....G...

Ligophylla_G88 C.---G.... T....CC... .--...... C..T ------G....G... G.clavata_G44 ..---G.... T....CC... .--...... C..T TT....C... -G....G... 1108 Sarcoglottis_G126 GGAT--ACC- TGCACAAATG AACATATA Anoectochilus_brevilabris_G67 C...--...T ...... Anoetochilus_sikimensis_G87 C...--...- ...... Anoectochilus_chapaenensis_G123 C...--...- ...... Dossinia_mormorata_G102 C...--...- ...... Anoectochilus_etaceus_G69 C...--...- ...... Macodes_lewii_G96 C...--...- ...... Anoectochilus_formosanum_G89 C...--...- ...... Macodes_andriana_G125 C...--...- ...... Anoectochilus_green_G68 C...--...- ......

Ludisiani_grescens_G66 C...--...- ...... Blackepiphite_G124 C...--...- ...... Anoectochilus_etaceus_G78 C...AC...- ...... Hetaeria_cristata_G47 C...AC...- ...... 3

1 Rhomboda_ketambe_G204 ------3 Vrydagzynea_G107 ------Vrydagzynea_G79 C...--...- ...... A..... Cystorcchis_johnscoll_G65 C...--...- ...... Ludisia_discolor_G71 C..G--...- ...... Hetaeriao_blongifolia_G51 C...--...- ......

GoodyeraHOC_474_G63 C...--...- ...... Herpys_marubens_G97 C...--..T- ...... G.pubescens_G45 C...--...- ...... Plactyplectron_G529 C...--...- C...... Pristiglottis_G182 C...--...- ...... G. Goodyera_repens_G73 C...--...- ..A...... Goodyera_vitata_G62 C...--.T.- ...... Zeuxine_oblonga_G214 C...--.T.- ...... Zeuxine_viridiflora_G57 ---.--CTT- .-...... Anoectochilus_lanceolatus_G70 T...--...- ...... 1108

Goodyeracfschlectendaliana_G95 T...--...- ...... G.daibucanensis_G98 T...--...- ...... G.rotabunensis_G132 T...--...- ...... G.dalhousiana_G151 T...--...- ...... Goodyera_oblongifolia_G114 C...--...- ......

3 G.tesselata_G149 C...--...- ...... 1

4 Goodyera_bifida_G55 C...--...- ...... Goodyera_carnea_G103 C...--...- ...... G...... T Goodyerapussilla_G162 C...--...- ...... G_procera_G178 C...--...- ..T......

Ligophylla_G88 C...--...- ...... G...... A... G.clavata_G44 C...--...- ...... Appendix C.

Forty-nine new rpl16 sequences and alignments used in phylogenetic analyses.

315 60 Goodyera_vitata_G62 GTCACT-ATA ------TGA-CTG AATCGA-TCA TA-TAGTTGT AGCAACT--- Goodyera_HOC474_G63 ...... -... ------...-...... -... ..-...... --- Goodyera_pussila_G162 ...... -... ------...-... .C....-... ..-...... C..--- Goodyera_pussila_G86 ...... -... ------...-...... -... ..-...... --- Goodyera_procera_G163 ...... -... ------...-...... -... ..-...... --- Goodyera_bifida_G43 ...... -... ------...-T.. ...T..-... ..-...... --- Goodyera_repens_G73 ...... -... ------...-...... -... ..-...... --- Goodyera_pubescens_G45 ...... -... ------...-..A ...... -... ..-.C...... --- Vrydagzynea_G107 ...... -... ------.T.-...... -... .G-.G..... G...... --- Vrydagzynea_G79 ...... C... ------.TG-...... C-... .G-...... C..---

Cheirostylis_cochinchinensG153 ...... -... ------...-...... T..-... ..-...... --- Cheirostylis_G154 ...... -... ------...-...... T..-... ..-...... --- Hetaeria_oblongifolia_G50 ...... -... ------...-G...... -... ..-...... --- Cystorchis_G65 ...... -... ------...-T...... -... ..-...... A.....---

3 Zeuxine_viridiflora_G57 ...... -... ------...-...... A.-... ..-...... --- 1

6 Ludisia_discolor_G71 ...... -... ------...-...... -... ..-.....A...... --- Anoectochilus_green_G68 ...... -... ------...-...... -... ..-.....A...... --- Dossinia_mormorata_G102 ...... -... ------...-...... -... ..-...... A.....--- Hetaeria_cristata_G164 ...... -... ------...-T.. ...T..-... ..-...... C..--- Rhomboda_G100 ...... -... ------...-T.. ...T..-... ..-...... ---

Anoectochilus_formosanum_G89 ...... -... ------...-...... -... ..G...... --- Macodes_lewii_G96 ...... -... ------...-...... -... ..-...... --- Blackepifit_G124 ...... -... ------...-...... -... ..-...... --- Anoectochilus_chapaenensis_G123 ...... -... ------...-...... -... ..-...... --- Anoectochilus_longicalcaratus_B_G101 ...... -... ------...-...... -... ..-...... --- Anoectochilus_setaceus_G78 ...... -... ------...-...... -... ..-...... --- Anoectochilus_brevilabris_G67 ...C..-... ------...-...... -... ..-...... ACA Anoectochilus_longicalcaratusA_G99 ...... -... ------...-...... -... ..-...... --- Macodesandriana_G125 ...... -... ------...-...... -... ..-...... --- Zeuxine_oblong_G134_a ...... -... ------...-...... T..-... ..-...... G ...... --- 60 Zeuxine_gracilis_G80 ...... -... ------...-...... T..-... ..-...... --- Herpysma_rubens_G97 ...... -... ------...-...... -... ..-...... --- Pristiglottis_G182 ...... -T.C ------...-... .C....-... ..-...... --- Mymerchis_gracilis_G180 ...T..-T.C ------...-... .C....G... ..-...... --- Herpysma_longicaulis_G189 ...... -... ------...-...... -... ..-...... C..--- Goodyera_schlectendaliana_G95 ...... -... ------...-...... A.-... ..-...... --- Goodyera_rotundifolia_G64 ...... -... ------...T...... A.-..G ..-...... --- Goodyera_rotabunensis_G132 ...... -... ------...-...... A.-... ..-...... --- Goodyera_daibucanensis_G98 ...... -... ------...-...... A.-... ..-...... --- 3

1 Goodyera_oblongifolia_G118 ...... -... ------...-...... A.-... ..-...... --- 7

Lepidogyne_longifolia_G157 ...... -... ------...-.C. .C..A.-... ..-...... --- Hyllophyllamontana_G90 ...... -... ------...-...... A.-... ..-...... --- Goodyera_fumata_G60 ...... -... AAAAGTCACT ATA...-...... -... ..-...... --- Goodvera_clavata_G44 ...... -... GAAAGTCACT ATA...-...... -... ..-...... G..--- Goodyera_carnea_G103 ...... -... ------...-...... -... ..-...... A.....--- Ligophylla_G88 ...... -... ------...-...... -... ..-...... --- Cyclopogon_lindleyanus_G127 ..A...-T.. ------...-...... AAT-... ..-.T...... C-- Spiranthes_odorata_G152 ...... -... ------...-..T ...AAT-... ..-...... --- Plactyplectron_G529 ...... -... ------...-... .------.. ..-...... --- 120

Goodyera_vitata_G62 ---AAAATTC TTTTCATAAC AAAGAAATCT GATTATGA-A TTGTAAAACA AAAA---GGG Goodyera_HOC474_G63 ---....GGA ...... A ...... C.C. CC..G...... ---... Goodyera_pussila_G162 ---.....GA ...... A ...... -. ....G...... TG---... Goodyera_pussila_G86 ---...... A ...... A ...... -. ....G...... ---... Goodyera_procera_G163 ---....AGT ...... A ...... T... T...... -T ....G...... G-GG... Goodyera_bifida_G43 ---...... A ...... A....A. ....T.---- -.A.G...... ---... Goodyera_repens_G73 ---.....GA ...... A ...... -. ....G...... ---... Goodyera_pubescens_G45 ---.....GA .....C..GA ...... -. ...GG...A. ....---... Vrydagzynea_G107 ---...... C...... T...... -. ....G..... G...---... Vrydagzynea_G79 ---C.C...A ...... T..C....-. ..T.GC...... ---...

Cheirostylis_cochinchinensG153 ---...T...... G ...A....A...... -. ....G...... ---... Cheirostylis_G154 ---...... G ...A....A...... -. ....G...... G---... Hetaeria_oblongifolia_G50 ---C...... -. ....G...... ---... Cystorchis_G65 ---...... -. ....G...... ---..C 3

1 Zeuxine_viridiflora_G57 ---...... A ...... TC...... -. ....G...A. ....A-G... 8 Ludisia_discolor_G71 ---T...... -. ....G...... ---... Anoectochilus_green_G68 ---T...... -. ....G...... ---... Dossinia_mormorata_G102 ---...... A ....A...... T...... -. ...GG...... ---... Hetaeria_cristata_G164 ---...... A ...... A...... T.---- -...G...... ---G... Rhomboda_G100 ---...... A ...... A...... T.---- -...G...... ---...

Anoectochilus_formosanum_G89 ---...... A ...... T...... -. ....G...... ---... Macodes_lewii_G96 ---...... A ...... -. ....G...... ---... Blackepifit_G124 ---...... A ...... -. ....G...... ---... Anoectochilus_chapaenensis_G123 ---...... A ...... -. ....G...... ---... Anoectochilus_longicalcaratus_B_G101 ---...... A ...... -. ....G...... ---... Anoectochilus_setaceus_G78 ---...... A ...... -. ....G...... ---... Anoectochilus_brevilabris_G67 ACT...... A ...... C-C C...G...... ---... Anoectochilus_longicalcaratusA_G99 ---...... A ...... -. .AAA...... ---... Macodesandriana_G125 ---...... A ...... T...... -. ....G...... ---... Zeuxine_oblong_G134_a ---...... -. ...A...... ---... 120 Zeuxine_gracilis_G80 ---...... -. .CCCCC...... ---... Herpysma_rubens_G97 ---...... -...... ---... Pristiglottis_G182 ---...... T ...... -T ....G...... G---... Mymerchis_gracilis_G180 ---....C.T ...... -. ....G...... G---... Herpysma_longicaulis_G189 ---....C.T ...... -T ....G...... G---... Goodyera_schlectendaliana_G95 ---.....GA ...... A ...... -. ....GCC...... ---... Goodyera_rotundifolia_G64 ---.....GA ...... A ...... -. ....GCCC...... ---... Goodyera_rotabunensis_G132 ---.....GA ...... A ...... -. ....G...... ---... Goodyera_daibucanensis_G98 ---.....GA ...... A ...... -. ....G...... ---...

3 Goodyera_oblongifolia_G118 ---....AGA ...... A ...--...... -. ....G...... ---... 1 9 Lepidogyne_longifolia_G157 ---...T...... A ...... -. ....G...... AAA... Hyllophyllamontana_G90 ---...... A ...... -. ....G...... ---... Goodyera_fumata_G60 ---...... A ...... -. ....G...... ---... Goodvera_clavata_G44 ---...... A ...... CCCC..-. ....G.G...... ---... Goodyera_carnea_G103 ---...... A ...... A ...... -. ....G...... ---... Ligophylla_G88 ---...... A ....A.G..A ...... T...... -. ....G...... ---... Cyclopogon_lindleyanus_G127 ---...-...... A ...A....TG A...C.T.-. ....G...... A---.. Spiranthes_odorata_G152 ---...... A ...... TG ....C.T.-. ....G...... A---.. Plactyplectron_G529 ---C...... A ...... G..-. .CCCCC...... ---G... 180

Goodyera_vitata_G62 GATGTGGAAA AAG--GGAAG GATGATAGAA AGAGAGAA------TAAAGA TATCAATGAT Goodyera_HOC474_G63 ...... AA-...... A....------...... C...... Goodyera_pussila_G162 ...... AA-...G...... A.T..------..GC.. .C...T.... Goodyera_pussila_G86 ...... AA-...... A.T..------...... C...... Goodyera_procera_G163 ...... AA-...... ------...... C...... Goodyera_bifida_G43 ...... AA-...... ------...... Goodyera_repens_G73 ...... AA-...... ------...... C...... Goodyera_pubescens_G45 ...... AA-...G...... ------...... C.T...... Vrydagzynea_G107 ...... AA-...G...... ------...... Vrydagzynea_G79 ...... CAA-...... ------G......

Cheirostylis_cochinchinensG153 ...... AG-...... ------...... Cheirostylis_G154 ...... AG-...... ------...... Hetaeria_oblongifolia_G50 ...... G-...... ------....A...... Cystorchis_G65 ...... AA-...... ------...... 3

2 Zeuxine_viridiflora_G57 ...... --...... ------...... 0 Ludisia_discolor_G71 ...... AA-....A ...... A....------...... Anoectochilus_green_G68 ...... AA-....A ...... A....------...... Dossinia_mormorata_G102 ...... AA-...... ------...... Hetaeria_cristata_G164 ...... AA-...G...... ------...... Rhomboda_G100 ...... AA-...... ------......

Anoectochilus_formosanum_G89 ...... AA-...... ------...... Macodes_lewii_G96 ...... AAA...... ------...... Blackepifit_G124 ...... A... ..AA-...... ------...... Anoectochilus_chapaenensis_G123 ...... A... ..AA-...... ------...... Anoectochilus_longicalcaratus_B_G101 ...... A... ..AA-...... ------...... Anoectochilus_setaceus_G78 ...... A... ..AA-...... ------...... Anoectochilus_brevilabris_G67 ...... AAA...... ------...... Anoectochilus_longicalcaratusA_G99 ...... A... ..AA-...... ------...... Macodesandriana_G125 ...... AA-...... ------...... Zeuxine_oblong_G134_a ...... --...... T.A..------..G...... 180 Zeuxine_gracilis_G80 ...... --...... T....------...... Herpysma_rubens_G97 ...... --...... ------...... Pristiglottis_G182 ...... AA-...... ------...... Mymerchis_gracilis_G180 ...... AA-..GG...... ------...... G.... Herpysma_longicaulis_G189 ...... AA-...... ------...... G.... Goodyera_schlectendaliana_G95 ...... AA-...... ------...... C...... Goodyera_rotundifolia_G64 ...... AA-...... ------...... C...... Goodyera_rotabunensis_G132 ...... AA-...... ------...... C...... Goodyera_daibucanensis_G98 ...... AA-...... ------...... C......

3 Goodyera_oblongifolia_G118 ...... AA-...... T....------...... C...... 2 1 Lepidogyne_longifolia_G157 ...... AA-...... ------...G.. .C...G.... Hyllophyllamontana_G90 ...... AA-...... ------...... C...... Goodyera_fumata_G60 ...... AA-...... ------...... C...... Goodvera_clavata_G44 .G...... AA-...... G....G ...... ------...... C...... Goodyera_carnea_G103 ...... AA-...... ------...... C...... Ligophylla_G88 ...... A... ..AAA...... ------...... C...... Cyclopogon_lindleyanus_G127 ....G...... A--...... T....------...... C...... Spiranthes_odorata_G152 ...... A--....A ...... T....------...... C...... Plactyplectron_G529 ....C...... AT-...... G...... TG AGAA...... C...... 240 Goodyera_vitata_G62 TTAGGATTCC CATATGTATG GTTTATGAAG AATCACTTCA TAAAAAA------GG Goodyera_HOC474_G63 A..T...... T ....TT.C...... A------.. Goodyera_pussila_G162 A..T...... T ....CT.C...... ------.. Goodyera_pussila_G86 A..T...... T .....T.C...... ------.. Goodyera_procera_G163 A..T...... T ....C..C...... AAA AAAAAAAG.. Goodyera_bifida_G43 A..T...... ------.. Goodyera_repens_G73 A..T...... T ...... C.C ...... ------.. Goodyera_pubescens_G45 A..T...... T ...... C...... ------.. Vrydagzynea_G107 A..T...... ------.. Vrydagzynea_G79 A..T...... G...... -...... A------..

Cheirostylis_cochinchinensG153 A...... T...... T ...... ------.. Cheirostylis_G154 A...... T...... T ...... ------.. Hetaeria_oblongifolia_G50 A..T...... GA...... ------.. Cystorchis_G65 A..T...... AGA AAAAAA--..

3 Zeuxine_viridiflora_G57 A..T...... TC ...... ------.. 2

2 Ludisia_discolor_G71 A..T....T...... ------.. Anoectochilus_green_G68 A..T....T...... ------.. Dossinia_mormorata_G102 A..T...... ------.. Hetaeria_cristata_G164 A..T...... A...... ------.. Rhomboda_G100 A..T...... ------..

Anoectochilus_formosanum_G89 A..T...... ------.. Macodes_lewii_G96 A..T...... T...... ------.. Blackepifit_G124 A..T...... ------.. Anoectochilus_chapaenensis_G123 A..T...... ------.. Anoectochilus_longicalcaratus_B_G101 A..T...... ------.. Anoectochilus_setaceus_G78 A..T...... ------.. Anoectochilus_brevilabris_G67 A..T...... ------.. Anoectochilus_longicalcaratusA_G99 A..T...... T..TG------C. Macodesandriana_G125 A..T...... ------.. Zeuxine_oblong_G134_a ...TT...... G...... ------.. 240 Zeuxine_gracilis_G80 ...TT...... G...... ------.. Herpysma_rubens_G97 ...... ------.. Pristiglottis_G182 A.GT...... G.. ...A...... C...... ------.. Mymerchis_gracilis_G180 A.TT...C...... GG. ...C.....A ....C..... A...... ------.. Herpysma_longicaulis_G189 A..T...... C...... ------.. Goodyera_schlectendaliana_G95 A..T...... T ...A...C...... ------.. Goodyera_rotundifolia_G64 A..T...... T ...A...C...... ------.. Goodyera_rotabunensis_G132 A..T...... T ...A...C...... ------.. Goodyera_daibucanensis_G98 A..T...... T ...A...C...... ------..

3 Goodyera_oblongifolia_G118 A..T...... A ...A...C...... ------.. 2 3 Lepidogyne_longifolia_G157 A..T...... T .C..C..C...... GAA AAAG----.. Hyllophyllamontana_G90 A..T...... T ...... C...... GAA AAAA----.. Goodyera_fumata_G60 A..T...... T ...... C...... ------.. Goodvera_clavata_G44 A..T...... T ...... C...... ------.. Goodyera_carnea_G103 A..T...... A...C...... ------.. Ligophylla_G88 A..T...... C...... T ...... C...... ------.. Cyclopogon_lindleyanus_G127 A..T...... C.. G...... ------. Spiranthes_odorata_G152 A..T...... C..C.. G...... ------C Plactyplectron_G529 A..T....T...... C...... ------.. 300 Goodyera_vitata_G62 CAGTGT-GAT -AAAGCATCA ATAAATAAAG ATACAAAATC TACG----AT TACAA----- Goodyera_HOC474_G63 ...... -... A...... G...... C.A----T. ..T..----- Goodyera_pussila_G162 .G....-... -...... G...... ----.. ..T..----- Goodyera_pussila_G86 ...... -... -...... G...... ----.. ..T..----- Goodyera_procera_G163 .G....-... -...C.T... .A...... A ...... T.. .C..----.. .C..G----- Goodyera_bifida_G43 ...... -... -...... G...G...... ----...... ----- Goodyera_repens_G73 ...... -... -...... G...G...... T ....----...... ----- Goodyera_pubescens_G45 ...... -... -...... G...----...... T.----...... ----- Vrydagzynea_G107 ...... -... -...... G...... A ....----...... ----- Vrydagzynea_G79 ...... -... -...... A ....----...... -----

Cheirostylis_cochinchinensG153 ...... -... -...... G...G...... ----...... ----- Cheirostylis_G154 ...... -... -...... G...G...... ----...... ----- Hetaeria_oblongifolia_G50 ...... -... -...... G...... A.----G...... ----- Cystorchis_G65 ...... -... -...... G...... T ...... T ....----...... -----

3 Zeuxine_viridiflora_G57 ..A...-... -...... G...... ----...... ----- 2

4 Ludisia_discolor_G71 ...... -... -...... G...... T.----...... ----- Anoectochilus_green_G68 ...... -... -...... G...... C----.A A....TTTGT Dossinia_mormorata_G102 ...... T... -...... G...... A...... ----...... ----- Hetaeria_cristata_G164 .T....-... -...... G...G...... C...... ----...... ----- Rhomboda_G100 ...... -... -...... G...G...... ----...... -----

Anoectochilus_formosanum_G89 ...... -... -...... G...... ----...... ----- Macodes_lewii_G96 ...... -... -...... G...... A ....----...... ----- Blackepifit_G124 ...... -... -...... G...... ----...... ----- Anoectochilus_chapaenensis_G123 ...... -... -...... G...... ----...... ----- Anoectochilus_longicalcaratus_B_G101 ...... -... -...... G...... ----...... ----- Anoectochilus_setaceus_G78 ...... -... -...... G...... ----...... ----- Anoectochilus_brevilabris_G67 ...... -... -...... ----...... ----- Anoectochilus_longicalcaratusA_G99 ...... -... -...... G...... ----...... ----- Macodesandriana_G125 ...... -... -...... G...... ----...... ----- Zeuxine_oblong_G134_a ...... -... -...... ----...... ----- 300 Zeuxine_gracilis_G80 ...... -... -...... ----...... ----- Herpysma_rubens_G97 ...... -... -...... ----...... ----- Pristiglottis_G182 ...A.A-... -.....C... .G.....TT...... ----...... ----- Mymerchis_gracilis_G180 .G....-... -.....C... .G.....TT...... ----...... ----- Herpysma_longicaulis_G189 .G....-... -.....C... .G...... ----...... ----- Goodyera_schlectendaliana_G95 ...... -... -...... G...... ----...... ----- Goodyera_rotundifolia_G64 ...... -... -...... G...... ----...... ----- Goodyera_rotabunensis_G132 ...... -... -...... G...... ----...... ----- Goodyera_daibucanensis_G98 ...... -... -...... G...... ----...... ----- 3

2 Goodyera_oblongifolia_G118 ...... -... -...... G...... ----...... ----- 5 Lepidogyne_longifolia_G157 ...... -... -.....T... .G...... ----...... ----- Hyllophyllamontana_G90 ..A...-... -...... G...... ----...... ----- Goodyera_fumata_G60 ...... -... -...... G...... A...... ----...... ----- Goodvera_clavata_G44 ...... -... -...... G..G...G. ...A...... ----...... ----- Goodyera_carnea_G103 ...... -... -...... G...... A ....----...... ----- Ligophylla_G88 ...... -... -...... G...... TACG...... ----- Cyclopogon_lindleyanus_G127 ...G.G-... -...... G...A...... A----.. ..------Spiranthes_odorata_G152 ...... -... -.....C.T. .G...G...... T .T.A----.. ..------Plactyplectron_G529 ...... -... -...... G...... A...... ----...... ----- 360 Goodyera_vitata_G62 ---ACGA------TTCAAA TCTAA------Goodyera_HOC474_G63 ---C...------.GA... .AG.----AT AAGAAATTTT ------CA-AATAAAA Goodyera_pussila_G162 ---....------.GA... .AG.----GT AAGAAATATA ------CAAAATAAAA Goodyera_pussila_G86 ---....------.GA... .AG.----AT AAGAAATATA ------CAAAATAAAA Goodyera_procera_G163 ---C...------...... G..----TT AAGAA-T------TAAAA Goodyera_bifida_G43 ---....------...... A...TAAAT AAGAAATATA AAGAAATATA CA-AATAAAA Goodyera_repens_G73 ---..A.------..A... .AG..----T AAGAAATATA ------CA-AATAAAA Goodyera_pubescens_G45 ---..A.------..A... .A...----T AAGAAATATA ------CA-AATAAAA Vrydagzynea_G107 ---....------...... A..----AT AAGAAATATA ------CG-AATAAAA Vrydagzynea_G79 ---....------...... A..----AT AAGAAATATA ------CA-AATAAAA

Cheirostylis_cochinchinensG153 ---....------...... ----AT AAGAAATATA ------CA-AAAAAAA Cheirostylis_G154 ---....------...... ----AT AAGAAATATA ------CA-AAAAAAA Hetaeria_oblongifolia_G50 ---.T..------...... A..----AT AAGAAATAT------AAAAAGA Cystorchis_G65 ---....------...... A..----AT AAGAAATTTA ------CA-AATAAAA 3

2 Zeuxine_viridiflora_G57 ---....------...... A------6 Ludisia_discolor_G71 ---....------..T... .AG..TAAAT AAAAAATA------CA-AATAAAA Anoectochilus_green_G68 TCC...------..T..T .T..TATAAA AAT------CA-AATAAAA Dossinia_mormorata_G102 ---....------..T... .A...TAAAT AAGAAATATA ------CA-AATAAAA Hetaeria_cristata_G164 ---....------...... A...TAAAT AAGAAATATA AGGAAATATC CA-AATAAAA Rhomboda_G100 ---....------...... A...TAAAT AAGAAATATA AAGAAATATA CA-AATAAAA

Anoectochilus_formosanum_G89 ---....------...... A...TAAAT AAGAAATATA ------CC-AATGGAA Macodes_lewii_G96 ---....------...... A...TAAAT AAGAAATATA ------CA-AATGAAA Blackepifit_G124 ---....------...... A...TAAAT AAGAAATATA ------CA-AATGAAA Anoectochilus_chapaenensis_G123 ---....------...... A...TAAAT AAGAAATATA ------CA-AATGAAA Anoectochilus_longicalcaratus_B_G101 ---....------...... A...TAAAT AAGAAATATA ------CA-AATGAAA Anoectochilus_setaceus_G78 ---....------...... A...TAAAT AAGAAATATA ------CA-AATGAAA Anoectochilus_brevilabris_G67 ---....------...... A...TAAAT AAGAAATATA ------CA-AATGAAA Anoectochilus_longicalcaratusA_G99 ---....------...... A...TAAAT AAGAAATATA ------CA-AATGAAA Macodesandriana_G125 ---....------...... A...TAAAT AAGAAATATA ------CA-AATTAAA Zeuxine_oblong_G134_a ---.T..------...... ------360 Zeuxine_gracilis_G80 ---.T..------...... ------Herpysma_rubens_G97 ---....------...... ------Pristiglottis_G182 ---....------...... GG..----T AATATATATT ------CT-TATAAAA Mymerchis_gracilis_G180 ---....------....C. .GG..----T AAGATTTATC ------CT-TATAAAA Herpysma_longicaulis_G189 ---....------...... AG..----T AAGAAATAAC ------CA-AATAAAA Goodyera_schlectendaliana_G95 ---..A.------.GA... .AG..------Goodyera_rotundifolia_G64 ---..A.------.GA... .AG..------Goodyera_rotabunensis_G132 ---..A.------.GA... .AG..------Goodyera_daibucanensis_G98 ---..A.------.GA... .AG..----T AAGAAATATA ------CA-AATAAAA 3

2 Goodyera_oblongifolia_G118 ---..A.------..A... .A...----T AAGAAATATA ------CA-AATAAAA 7 Lepidogyne_longifolia_G157 ---G...------..A... .A...----T AAGAAATCTA ------CA-AATAAAA Hyllophyllamontana_G90 ---....------..A... .A...----T AAGAAATATA ------CA-AATAAAA Goodyera_fumata_G60 ---....------..A... .A...----T AAGAAATATA ------CA-AATAAAA Goodvera_clavata_G44 ---....------..A... .A...----T AAGAAATATA ------CA-AATAAAA Goodyera_carnea_G103 ---.T..------..A...... ----T AAGAAATATA ------CA-AATAAAA Ligophylla_G88 ---....TTA AATT..A... .AG..----T AAGAAATATA ------CA-AA-AAAA Cyclopogon_lindleyanus_G127 ------... .AG.----AT AATCAAT-T------CT-AAAAAAA Spiranthes_odorata_G152 ------... .A..----AT AAAAAAT-T------CT-AAAAAA- Plactyplectron_G529 ---..A.------..A... .AG.----AT AAGAAATATA ------GA-AATAAAA 420 Goodyera_vitata_G62 ------TAGAA ------Goodyera_HOC474_G63 AATAGAAAAT TAA-A.G... GAATTTCCTT T------A AAA---AAAA A-AAAAAAAA Goodyera_pussila_G162 AATAGAAAAT AAA-A..... GAATTTCCTT T------A AAA---AAAA A-AAAAAAAA Goodyera_pussila_G86 AATAGAAAAT AAA-A..... GAAATTCCAT TAGAAAAAAA AAA---AAAA A-AAAAAAAA Goodyera_procera_G163 AATAGAAAAG AAA-A..... GATTTTCCTT T------C AAATAGGGAA AAAAAAAAGA Goodyera_bifida_G43 AAGAGAAAAT AAA-A..... GATATTCAAT T------C AAA---GAAT T-GAAAAAGA Goodyera_repens_G73 AATAGAAAAT AAA-A..... -AAATTCAAT T------C AAA---GAAT T-TTAAAAAA Goodyera_pubescens_G45 AATAGAAAAG AAA-A..... AAAATTCAAT T------C AAA---TAAT T-TAAAAAGA Vrydagzynea_G107 AATAGAAAAG AAA-A..... GATATTCAAT T------C AAA---AAAT T-TAAAAAGA Vrydagzynea_G79 AATAGAAAAA AAA-A------AAAAAGG

Cheirostylis_cochinchinensG153 AAAAAAAAAA GAA-AA------Cheirostylis_G154 AAAAAAAAG- ----A..A.. ------Hetaeria_oblongifolia_G50 AAAAATAAA- ----A..... GAT-TTCCAT T------C AAA---TATT T-AAAAAAAA Cystorchis_G65 AAAAAAAAAA A---A..... ------3

2 Zeuxine_viridiflora_G57 ------8 Ludisia_discolor_G71 AAGATAAAAT AAA-A..... GATATTCAAT T------C AAA---GAAT T-TAAAAAGA Anoectochilus_green_G68 AAGATAAAAT AAA-A..... GATTTTCAAT T------C AAA---GAAT T-GAAAAAGA Dossinia_mormorata_G102 AAGAAAAAAT AAA-A..T.. GATATTTAAT T------C AAA---GAAT T-TAAAAAGA Hetaeria_cristata_G164 AAGAGAAAAT AAA-A..... GATTTTCACT T------C AAA---GAAT T-GAAAAAGA Rhomboda_G100 AAGAGAAAAT AAA-A..... GATATTAAAT T------C AAA---GAAT T-GAAAAAGA

Anoectochilus_formosanum_G89 AAGAGAAAAG AAA-A..... AATATTAAAT T------C AAA---GAAT T-TAAAAAGA Macodes_lewii_G96 AAGAGAAAAG AAA-A..... GATATTAAAT T------C AAA---GAAT T-TAAAAAGA Blackepifit_G124 AAGATAAAAG AAA-A..... GATATTAAAT T------C AAA---GAAT T-TAAAAAGA Anoectochilus_chapaenensis_G123 AAGATAAAAG AAA-A..... GATATTAAAT T------C AAA---GAAT T-TAAAAAGA Anoectochilus_longicalcaratus_B_G101 AAGATAAAAG AAA-A..... GATATTAAAT T------C AAA---GAAT T-TAAAAAGA Anoectochilus_setaceus_G78 AAGATAAAAG AAA-A..... GATATTAAAT T------C AAA---GAAT T-TAAAAAGA Anoectochilus_brevilabris_G67 AAGAGAAAAG AAA-A..... GATATTAAAT T------C AAA---GAAT T-TAAAAAGA Anoectochilus_longicalcaratusA_G99 AAGATAAAAG AAA-A..... GATATTAAAT T------C AAA---GAAT T-TAAAAAGA Macodesandriana_G125 AAGAGAAAAG AAA-A..... GATATTAAAT T------C AAA---GAAT T-TAAAAAGA Zeuxine_oblong_G134_a ------..... ------420 Zeuxine_gracilis_G80 ------..... ------Herpysma_rubens_G97 ------..... ------Pristiglottis_G182 AAGAGAAAAT AAG-A..A.. GATGTCCATT T------C AAA---GAAT TCTAAAAAGA Mymerchis_gracilis_G180 AAGAGAAGAT AGG-A..... GATGTCCAAT T------C AAA---GAAT TCTAAAAAGA Herpysma_longicaulis_G189 AAGAGAAAAT AAA-A..... GATTTCCAAT T------C AAA---GAAT TCTAAAAAGA Goodyera_schlectendaliana_G95 ------AAT AAA-A..... GAAATTCTAT T------C AAA---TAAT T-TAAAAAGA Goodyera_rotundifolia_G64 ------AAT AAA-A..... GAAATTCTAT T------C AAA---TAAT T-TAAAAAGA Goodyera_rotabunensis_G132 ------AAT AAA-A..... GAAATTCTAT T------C AAA---TAAT T-TAAAAAGA Goodyera_daibucanensis_G98 AATAGAAAAT AAA-A..... GAAATTCTAT T------C AAA---TAAT T-TAAAAAGA 3

2 Goodyera_oblongifolia_G118 AATAGAAAAT AAA-A..... GAAATTCTAT T------C AAA---TAAT T-TAAAAAGA 9 Lepidogyne_longifolia_G157 GATAGAAAAT AAA-A..... GAAATTCATT T------C AAA---TAAT T-TAAAAAGA Hyllophyllamontana_G90 AATAGAAAAT AAA-A..... GAAATTCAAT T------C AAA---TAAT T-TAAAAAGA Goodyera_fumata_G60 AATAGAAAAT AAA-A..... GAAATTCAAT T------C AAA---TAAT T-TAAAAAGA Goodvera_clavata_G44 AATAGAAAAT AAA-A..... GAAATTCAAT T------C AAA---TAAT T-TAAAAAGA Goodyera_carnea_G103 AATAGAAAAT AAACA..... TAAATTCTAT T------C AAA---TAAT T-TAAAAAGA Ligophylla_G88 AATAGAAAAT AAA-A..... GAAATTAAAT T------C AAA---GAAT A--AAAAAAA Cyclopogon_lindleyanus_G127 AAAAGAAAAA AAA------CTCATT T------T GAA---TAAA A-AAAAAAAA Spiranthes_odorata_G152 ------AAAAAAAA Plactyplectron_G529 AATAGAAAAT AAA-A------TCAAT T------C AAA---TAAT C-TAAAAAGA 480 Goodyera_vitata_G62 ------Goodyera_HOC474_G63 ATAGA----- ATCTAAT--- --CAA------TATT CAATATATAT AT------Goodyera_pussila_G162 ATAGA----- ATCTAAT--- --CAA------TATT CAATATATAT AT------Goodyera_pussila_G86 AAAAA----- ACCTAAT--- --CCA------ATTT CAAAATTTAT AT------Goodyera_procera_G163 ATAAA----- TCCTAAT--- --AAT------TA------TGG AT------Goodyera_bifida_G43 ATAGA----- ATAGAAT--- --CTA------TA------TAT AT------Goodyera_repens_G73 ATCGA----- ATCTAAT--- --CAA------TATT CA--ATATAG AT------Goodyera_pubescens_G45 ATAGA----- ATCTAAT--- --CAA------TATT CA--ATCTAT AT------Vrydagzynea_G107 ATAAA----- ATCCAAT--- --CAA------TA------TAT AG------Vrydagzynea_G79 --AGA----- ATCTAAC--- --CAA------TA------TAT AT------

Cheirostylis_cochinchinensG153 ------TT------Cheirostylis_G154 ------TT------Hetaeria_oblongifolia_G50 AAAAAAAATG ATTTTAT--- --CCA------TT------Cystorchis_G65 ------TCTAACCC 3

3 Zeuxine_viridiflora_G57 ------0 Ludisia_discolor_G71 ATAGA----- ATCTAAT--- --CAA------TA------TAT AT------Anoectochilus_green_G68 ATAGA----- ATCTAAT--- --CAA------TA------TAT AT------Dossinia_mormorata_G102 ATAGA----- ATCTAAT--- --CAA------TA------TAT AT------Hetaeria_cristata_G164 ATAGA----- ATCTACT--- --CTA------TA------TAT AT------Rhomboda_G100 ATAGA----- ATCTAAT--- --CTA------TA------TAT AT------

Anoectochilus_formosanum_G89 ATAGA----- ATCTAAT--- --AAA------TA------TAT AT------Macodes_lewii_G96 ATAGA----- ATCTAAT--- --AAA------TA------TAT AT------Blackepifit_G124 ATAGA----- ATCTAAT--- --AAA------TA------TAT AT------Anoectochilus_chapaenensis_G123 ATAGA----- ATCTAAT--- --AAA------TA------TAT AT------Anoectochilus_longicalcaratus_B_G101 ATAGA----- ATCTAAT--- --AAA------TA------TAT AT------Anoectochilus_setaceus_G78 ATAGA----- ATCTAAT--- --AAA------TA------TAT AT------Anoectochilus_brevilabris_G67 ATAGA----- ATCTAAT--- --AAA------TA------TAT AT------Anoectochilus_longicalcaratusA_G99 ATAGA----- ATCTAAT--- --AAA------TA------TAT AT------Macodesandriana_G125 ATAGA----- ATCTAAT--- --AAA------TA------TAT AT------Zeuxine_oblong_G134_a ------480 Zeuxine_gracilis_G80 ------Herpysma_rubens_G97 ------Pristiglottis_G182 ATAGA----- ATCTACT--- --CAA------TA------TAT AT------Mymerchis_gracilis_G180 TTAGG----- GTCTATT--- --CAA------TA------TAT AT------Herpysma_longicaulis_G189 ATAGA----- ATCTAAT--- --CAA------TA------TAT AT------Goodyera_schlectendaliana_G95 ATAGA----- ATCTAAT--- --CAA------TATT CA--ATATAT AT------Goodyera_rotundifolia_G64 ATAGA----- ATCTAAT--- --CAA------TATT CA--ATATAT AT------Goodyera_rotabunensis_G132 ATAGA----- ATCTAAT--- --CAA------TATT CA--ATATAT AT------Goodyera_daibucanensis_G98 ATAGA----- ATCTAAT--- --CAA------TATT CA--ATATAT AT------3

3 Goodyera_oblongifolia_G118 ATAGA----- ATCTAAT--- --CAA------TATT CA--ATCTAT AT------1

Lepidogyne_longifolia_G157 ATAGA----- ATCTAAT--- --CAAAATCT AATCAATA------TAT AT------Hyllophyllamontana_G90 ATAGA----- ATCTAAT--- --CAA------TA------TAT AT------Goodyera_fumata_G60 ATAGA----- ATCTAAT--- --CAA------TA------TAT AT------Goodvera_clavata_G44 ATAGA----- ATCTAAT--- --CAA------TA------TAT AT------Goodyera_carnea_G103 ATAGA----- ATCTAAT--- --CAA------TA------TAT AT------Ligophylla_G88 ATCGA----- ATCTAAT--- --CAA------TA------TAT AT------Cyclopogon_lindleyanus_G127 ATAAA----- ATCTA------Spiranthes_odorata_G152 ATAGA----- ATCTAAT--- --CAA------GA------TAG AT------Plactyplectron_G529 ATAGA----- ATAGAATATA ATCCA------TATAAATT -AATATATAT AT------540 Goodyera_vitata_G62 ------A------GAGAG-TCT ATTA--TCTA TCTAA-T-AA Goodyera_HOC474_G63 ------.------AT....-...... --.... .AG..-.-.. Goodyera_pussila_G162 ------.------AT....-...... --.... .AG..-.-.. Goodyera_pussila_G86 ------.------AA.AGT-... T...--...T .GG..-A-.. Goodyera_procera_G163 ------.------AA....-...... --...... GG-.. Goodyera_bifida_G43 ------.------AT...A-...... --...... -.-.. Goodyera_repens_G73 ------.------AT....-...... --...... G-.-.. Goodyera_pubescens_G45 ------.------AT....-...... --...... -.-.. Vrydagzynea_G107 ------.------AT...A-...... --...... -.-.. Vrydagzynea_G79 ------.------AT....-...... --...... -.-..

Cheirostylis_cochinchinensG153 ---TTTTGAA AGTTTT------...A.--. Cheirostylis_G154 ---TTTTGAA ATTTTT------...A--.. Hetaeria_oblongifolia_G50 ------TTTTT------AT....-... -...--.... .T...-.-.. Cystorchis_G65 ATATTTAGAA ATTTTT.------AT..G.-C.. T..T--.T.T .....A--.. 3

3 Zeuxine_viridiflora_G57 ------....-.A. ....--...... -.--. 2 Ludisia_discolor_G71 ------.------AT....-... C...--...... -.-.. Anoectochilus_green_G68 ------.------AT....-... C...--...... -.-.. Dossinia_mormorata_G102 ------.------AT....-...... --...... G.-.-.. Hetaeria_cristata_G164 ------.------AA...A-...... --...... -.-.. Rhomboda_G100 ------.------AT...A-...... --...... -.-..

Anoectochilus_formosanum_G89 ------.------AT....-...... --.A...... -.-.. Macodes_lewii_G96 ------.------AT....-...... --.A...... -.-.. Blackepifit_G124 ------.------AT....-...... --.A.. ...C.-.-.. Anoectochilus_chapaenensis_G123 ------.------AT....-...... --.A.. ...C.-.-.. Anoectochilus_longicalcaratus_B_G101 ------.------AT....-...... --.A...... -.-.. Anoectochilus_setaceus_G78 ------.------AT....-...... --.A...... -.-.. Anoectochilus_brevilabris_G67 ------.ATA AATATATATA AT....-...... --.A...... -.-.. Anoectochilus_longicalcaratusA_G99 ------.------AT....-...... --.A...... -.-.. Macodesandriana_G125 ------.------AT....-...... --.A...... -.-.. Zeuxine_oblong_G134_a ------.------T....-...... --...... -.-.. 540 Zeuxine_gracilis_G80 ------.------T....-...... --...... -.-.. Herpysma_rubens_G97 ------.------.....-...... --...... -.-.. Pristiglottis_G182 ------.------AT....-...... --...... C-.-.C Mymerchis_gracilis_G180 ------.------AT....-...... --...... -.-.. Herpysma_longicaulis_G189 ------.------AT....-...... --...... -.-.. Goodyera_schlectendaliana_G95 ------.------TATA ATG...-...... --.... .T...-.-.. Goodyera_rotundifolia_G64 ------.------TATATA ATG...-...... --.... .T...-.-.. Goodyera_rotabunensis_G132 ------.------TATA ATG...-...... --.... .T...-.-.. Goodyera_daibucanensis_G98 ------.------TATA ATG...-...... --.... .T...-.-.. 3

3 Goodyera_oblongifolia_G118 ------.------ATG...-... C...--.... .T...-.-.. 3 Lepidogyne_longifolia_G157 ------.------AT....-.T. ....--...... -.-.. Hyllophyllamontana_G90 ------.------AT....-...... --...... -.-.. Goodyera_fumata_G60 ------.------AT....-...... --...... -.-.. Goodvera_clavata_G44 ------.------AT....-...... --...... -.-.. Goodyera_carnea_G103 ------.------AT....-...... --...... -.-.. Ligophylla_G88 ------.------AT....-... .C..TC...... -.-.. Cyclopogon_lindleyanus_G127 ------.------A------.. Spiranthes_odorata_G152 ------.------A------.. Plactyplectron_G529 ------.------AT..GAG...... --.... G....-.T.. 600 Goodyera_vitata_G62 GCTATAAAAA GAAGA-TATC AAAG-ATAAA AAAA-GATAT AAATA----- TCTGTAAATA Goodyera_HOC474_G63 ...... -...... -...... -...... ----- ...... Goodyera_pussila_G162 ...... -...... -...... -...... ----- ...... Goodyera_pussila_G86 ....A..... A..A.-.TC. ....-...... -...... T----- ...... Goodyera_procera_G163 ...... -...... -...... A....A .T.------...... Goodyera_bifida_G43 ...... -...T ....-...... -T...... ----- ...... - Goodyera_repens_G73 ...... -...... -...... -...... ----- ...... Goodyera_pubescens_G45 ...... -...... -...... -...... ------Vrydagzynea_G107 ...... -...... -...... -...... ----- ...... Vrydagzynea_G79 ...... -...... A-...... -...... ----- ......

Cheirostylis_cochinchinensG153 ------. .------...... ------Cheirostylis_G154 ------. .------...... ------Hetaeria_oblongifolia_G50 ...-...... --.T.. C...-...... G...T. ....T----- ...... Cystorchis_G65 ...T.....G .....-.T.. C...G...... -...T. ....T----- ..------3

3 Zeuxine_viridiflora_G57 ------..-...... -...... ----- ...... G. 4 Ludisia_discolor_G71 ...... -...... -...... -...... ----- ...T...... Anoectochilus_green_G68 ...... -...... -...... -...... ----- ...T...... Dossinia_mormorata_G102 ...... -...... -...... -...... ----- ...A...... Hetaeria_cristata_G164 ...... A....-...T ....-...... -T...... ----- ...... - Rhomboda_G100 ...... A....-...T ....-...... -...... ----- ...... -

Anoectochilus_formosanum_G89 ...... G...T ....-...... -...... ----- ...... - Macodes_lewii_G96 ...... -...T ....-...... -...... ----- ...... - Blackepifit_G124 ...... -...T ....-...... -...... ----- ...... - Anoectochilus_chapaenensis_G123 ...... -...T ....-...... -...... ----- ...... - Anoectochilus_longicalcaratus_B_G101 ...... -...T ....-...... -...... ----- ...... - Anoectochilus_setaceus_G78 ...... -...T ....-...... -...... ----- ...... - Anoectochilus_brevilabris_G67 ...... -...T ....-...... -T...... ----- ...... - Anoectochilus_longicalcaratusA_G99 ...... -...T ....-....G ....-...... ----- ...... - Macodesandriana_G125 ...... -...T ....-...... -...... ----- ...... - Zeuxine_oblong_G134_a ...... -...... A-...... -....G .....----- ...... 600 Zeuxine_gracilis_G80 ...... -...... A-...... -....G .....----- ...... Herpysma_rubens_G97 ...... -...... -...... -...... ----- ...... Pristiglottis_G182 ...... -...... -...... -..... C...------.C Mymerchis_gracilis_G180 ...... -...... -...... -...... T.------.C Herpysma_longicaulis_G189 ...... -...... -...... -...... T.------.. Goodyera_schlectendaliana_G95 ...... -...... -...... -...... ------.. Goodyera_rotundifolia_G64 ...... -...... -...... -...... ------.. Goodyera_rotabunensis_G132 ...... -...... -...... -...... ------.. Goodyera_daibucanensis_G98 ...... -...... -...... -T...... ------.. 3

3 Goodyera_oblongifolia_G118 ...... -...... -...... -...... ----- G...... 5 Lepidogyne_longifolia_G157 ...... -...... -...... -...... AAATA ....G..... Hyllophyllamontana_G90 ...... -.-...... -...... -....G ....------...... Goodyera_fumata_G60 A...... -...... -...... -...... ----- ...... Goodvera_clavata_G44 A...... -...... -...... -...... ----- ...... Goodyera_carnea_G103 ...... T....-...... -...... -...... ----- ...... Ligophylla_G88 ...... -...... -...... -T...... ------Cyclopogon_lindleyanus_G127 ....G...... A.------.- ..T.------..----.... Spiranthes_odorata_G152 ....C...... ------Plactyplectron_G529 ....A...... -...... -...... -..------660 Goodyera_vitata_G62 TCTAAATACT AGAAAA------TA GATGAATAAT TGAATCGAGC T-TCGAGTTA Goodyera_HOC474_G63 ...... ------...... -...... Goodyera_pussila_G162 ...... ------...... -...... Goodyera_pussila_G86 ...... ------...... -...... Goodyera_procera_G163 ...... ------...... T.... .-...... Goodyera_bifida_G43 ------...... ------.. A...... T.... .-...... Goodyera_repens_G73 ...... A....------...... -...... Goodyera_pubescens_G45 ...... ------...... -...... Vrydagzynea_G107 ...... ------...... -...... Vrydagzynea_G79 ...... ------...... A...... -......

Cheirostylis_cochinchinensG153 ------...... ------...... G...... -...... - Cheirostylis_G154 ------...------.A..A.T. ...CC...... -....-... Hetaeria_oblongifolia_G50 ...... CT....------...... -.T...... Cystorchis_G65 --.....C...... ------...... -...... 3

3 Zeuxine_viridiflora_G57 .T...... ------...... -...... 6 Ludisia_discolor_G71 ...... AAAA AAAAAAAAG. A..----...... -...... Anoectochilus_green_G68 ...... AAAA AAA-----G. A..----...... -...... Dossinia_mormorata_G102 ...... ------G. A...... -...... Hetaeria_cristata_G164 ------...... ------G. A...... T...... T.... .-...... Rhomboda_G100 ------...... ------G. A...... T.... .-......

Anoectochilus_formosanum_G89 ------...... ------.. A...... A.... .T..A..... Macodes_lewii_G96 ------...... ------.. A...... A.... .-...... Blackepifit_G124 ------...... ------.. A...... A.... .-...... Anoectochilus_chapaenensis_G123 ------...... ------.. A...... A.... .-...... Anoectochilus_longicalcaratus_B_G101 ------...... ------.. A...... A.... .-...... Anoectochilus_setaceus_G78 ------...... ------.. A...... A.... .-...... Anoectochilus_brevilabris_G67 ------...... ------.. -...... A.... .-...... Anoectochilus_longicalcaratusA_G99 ------...... ------.. A...... A.... .-...... Macodesandriana_G125 ------...... ------.. A...... A.... .-...... Zeuxine_oblong_G134_a .....CC...... ------...... -...... 660 Zeuxine_gracilis_G80 ...... C...... ------...... -...... Herpysma_rubens_G97 ...... ------...... -...... Pristiglottis_G182 ...... C...... ------...... C.. .-...... Mymerchis_gracilis_G180 ...... T...... ------...... -...... Herpysma_longicaulis_G189 ...... ------...... -...... Goodyera_schlectendaliana_G95 ...... ------...... A.... .-...... Goodyera_rotundifolia_G64 ...... ------...... A.... .-...... Goodyera_rotabunensis_G132 ...... ------...... A.... .-...... Goodyera_daibucanensis_G98 ...... ------...... A.... .-...... 3

3 Goodyera_oblongifolia_G118 ...... ------...... A.... .-...... 7 Lepidogyne_longifolia_G157 ...... ------.. A...... -...... Hyllophyllamontana_G90 ...... ------...... -...... Goodyera_fumata_G60 ...... ------...... -...... Goodvera_clavata_G44 ...... ------...... -...... Goodyera_carnea_G103 ...... ------.. T...... -...... Ligophylla_G88 ------.-...... ------...... -...... Cyclopogon_lindleyanus_G127 ....G...A. .AT...------.. ...T...... T.G.. .-.T...... Spiranthes_odorata_G152 ...... GA. .AG...------...... -...... Plactyplectron_G529 ...... A...... ------.. ..C...... T.... .-...... 720 Goodyera_vitata_G62 AGAAAAACTG -AGGAGATTT -ACT-CGGAA AC-AAAGAAC CTATTTT-GT TGGAAGCTCC Goodyera_HOC474_G63 ...... -...... -...-G...... -...... -...... Goodyera_pussila_G162 ...... -...... -...-...... -...... -...... Goodyera_pussila_G86 ...... -...... -...-...... -...... -...... Goodyera_procera_G163 ...... -...... -...-...... -...... -...... Goodyera_bifida_G43 ...... -...... -...-...... -...... C....-...... Goodyera_repens_G73 ...... -...... -...-...... -...A...... -...... Goodyera_pubescens_G45 ...... -...... -...-...... -...... -...... Vrydagzynea_G107 .T...... -...... -...-...... -...... -...... Vrydagzynea_G79 ...... -...... -...-...... -...... -......

Cheirostylis_cochinchinensG153 ...... -..T.A.... -G..-...... -...-... .CT....-A...... Cheirostylis_G154 .A.....A.. G..T...... -G..-..A.. .A-...-... ..T....-T...... Hetaeria_oblongifolia_G50 ...... -... -...... -...-...... -...... -...... Cystorchis_G65 ...... -...... -...-...... -...... T ...... -...... 3

3 Zeuxine_viridiflora_G57 ...... -...... -...-..A.. ..-...... -...... 8 Ludisia_discolor_G71 ...... -...... -...-...... -...... -...... Anoectochilus_green_G68 ...... -...... -TT.-...... -...... -...... Dossinia_mormorata_G102 ...... -...... -...C..T.. ..-...... -...... Hetaeria_cristata_G164 .A...... -...... -...-...... -...... T....-...... Rhomboda_G100 ...... -...... -...-...... -...... -......

Anoectochilus_formosanum_G89 ...... A -...... -...-...... -...... -.G ...... Macodes_lewii_G96 ...... A -...... -...-...... -...... -...... Blackepifit_G124 ...... A -...... -...-...... -...... -...... Anoectochilus_chapaenensis_G123 ...... A -...... -...-...... -...... -...... Anoectochilus_longicalcaratus_B_G101 ...... A -...... -...-...... -...... -...... Anoectochilus_setaceus_G78 ...... A -...... -...-...... -...... -...... Anoectochilus_brevilabris_G67 ...... A -...G..... -...-...... -...... -...... Anoectochilus_longicalcaratusA_G99 ...... A -...... -...-...... -...... T...... Macodesandriana_G125 ...... A -...... -...-...... -...... -...... Zeuxine_oblong_G134_a ...... -...... T...-..T.. ..C...... -.- ...... 720 Zeuxine_gracilis_G80 ...... -...... -...-..T.. ..-...... -...... Herpysma_rubens_G97 ...... -...... -...-...... -...... -...... Pristiglottis_G182 ...... -..A...... -T..-...... -.....C...... -...... Mymerchis_gracilis_G180 ...... -..A...... -T..-...... -...... -...... Herpysma_longicaulis_G189 ...... -..A...... -...-...... -...... -...... Goodyera_schlectendaliana_G95 ...... -...... -...-...... -...... -A...... Goodyera_rotundifolia_G64 ...... -...... -...-...... -...... -A...... Goodyera_rotabunensis_G132 ...... -...... -...-...... -...... -A...... Goodyera_daibucanensis_G98 ...... -...... -...-...... -...... -A...... 3

3 Goodyera_oblongifolia_G118 ...... -...... -...-...... -...... -...... 9 Lepidogyne_longifolia_G157 ...... -...... -...-...... -...... -...... Hyllophyllamontana_G90 ...... -...... -...-...... -...... -.- ...... Goodyera_fumata_G60 ...... -...... -...-...... -...... -...... Goodvera_clavata_G44 ...... -...... -...-...... -...... -...... Goodyera_carnea_G103 .T...... -...... -...-...... -...... -...... Ligophylla_G88 ...... -...... -...-...... -...... -...... Cyclopogon_lindleyanus_G127 ...... -..A...... -...-...... -...... AG.....-.. ..A...... Spiranthes_odorata_G152 ...... -..A...... -...-..T.. ..-...... AG.....-.. ..A...... Plactyplectron_G529 ...... -...... -..A-...... -...... AG.....-...... 780 Goodyera_vitata_G62 ATTGCAGAGT TCAGGCCTAA ACATTAATGT AGAAGCTAT- AGGAACGATG GAAC-CTGTG Goodyera_HOC474_G63 ...... G ...... - ...... -..... Goodyera_pussila_G162 ...... G ...... - ...... -..... Goodyera_pussila_G86 ...... G ...... - ...... -..... Goodyera_procera_G163 ...... G ...... - ...... -..... Goodyera_bifida_G43 ...... G ...... - ...... -..... Goodyera_repens_G73 ...... G ...... - ...... -..... Goodyera_pubescens_G45 ...... G .....T...- ...... -..... Vrydagzynea_G107 ...... G ...... - ...... -..... Vrydagzynea_G79 ...... G ...... - ...... -.....

Cheirostylis_cochinchinensG153 ...... G ...... - ...... -..... Cheirostylis_G154 ...... G ...... - ...... -..... Hetaeria_oblongifolia_G50 ...... G ...... - ...... -..... Cystorchis_G65 ...... A...... A ...... - ...... -..... 3

4 Zeuxine_viridiflora_G57 ...... G ...... - ...... -..... 0 Ludisia_discolor_G71 ...... G ...... - ...... A...-..... Anoectochilus_green_G68 ...... G ...... - ...... A...-..... Dossinia_mormorata_G102 ...... G ...... - ...... -.G.G. Hetaeria_cristata_G164 T...... C.T...... G ...... - ...... C.-..... Rhomboda_G100 ...... G ...... - ...... -.....

Anoectochilus_formosanum_G89 T....GAG...... G G...... - ...... C..... Macodes_lewii_G96 ...... G ...... - ...... -..... Blackepifit_G124 ...... -...... G ...... - ...... -..... Anoectochilus_chapaenensis_G123 ...... -...... G ...... - ....T...... -..... Anoectochilus_longicalcaratus_B_G101 ...... G ...... - ...... -..... Anoectochilus_setaceus_G78 ...... G ...... - ...... -..... Anoectochilus_brevilabris_G67 C...... C...... G G...... - ...... -.C.G. Anoectochilus_longicalcaratusA_G99 ...... C.....G ...... A ...... -..... Macodesandriana_G125 ...... G ...... - ...... -..... Zeuxine_oblong_G134_a ...... G...-...... G ...... - ...... -..... 780 Zeuxine_gracilis_G80 ...... G...... G ...... - ...... -..... Herpysma_rubens_G97 ...... - ...... -..... Pristiglottis_G182 .C...... G ...... - ...... -..... Mymerchis_gracilis_G180 ...... G ...... - ...... -..... Herpysma_longicaulis_G189 ...... G ...... - ...... -..... Goodyera_schlectendaliana_G95 C...... -...G ...... - ...... -..... Goodyera_rotundifolia_G64 ...... G ...... - ...... -..... Goodyera_rotabunensis_G132 ...... G ...... - ...... -..... Goodyera_daibucanensis_G98 ...... G ...... - ...... -..... 3

4 Goodyera_oblongifolia_G118 ...... AG ...... - ...... -..... 1 Lepidogyne_longifolia_G157 ...... T...... G ...... - ...... -..... Hyllophyllamontana_G90 ..-...... T...... G ...... - ...... -..... Goodyera_fumata_G60 ...... T...... G ...... - ...... -..... Goodvera_clavata_G44 ...... T...... G ...... - ...... -..... Goodyera_carnea_G103 ...... T...... G ...... - ...... -..... Ligophylla_G88 ...... T...... G ...... - ...... -..... Cyclopogon_lindleyanus_G127 ...... A...... AG ...... - ...... -..... Spiranthes_odorata_G152 ...... A...... G...... G ...... - ...... -..... Plactyplectron_G529 ...... G...... G ...... - ...... -..... 840 Goodyera_vitata_G62 ACTACATAGG A-TTTTATTG AAAACGAAGA AATCCTAATG ATTCACT--G GGTAGGATGG Goodyera_HOC474_G63 ...... -...... A...... --...... Goodyera_pussila_G162 ...... -...... A...... --...... Goodyera_pussila_G86 ...... -...... A...... --...... Goodyera_procera_G163 ....T...... -...... --...... Goodyera_bifida_G43 ...... -...... -...... --...... Goodyera_repens_G73 ...... -...... --...... Goodyera_pubescens_G45 ...... -...... --...... Vrydagzynea_G107 ...... -...... --...... Vrydagzynea_G79 ...... -...... T C....A...... A...--......

Cheirostylis_cochinchinensG153 ...... -...... --T ...... Cheirostylis_G154 ...... -...... --T ...... Hetaeria_oblongifolia_G50 ...... -...... --...... Cystorchis_G65 ...... -....C...... --...... 3

4 Zeuxine_viridiflora_G57 ...... -...... --...... 2 Ludisia_discolor_G71 ...... -...... --...... Anoectochilus_green_G68 ...... -...... C.G--...... Dossinia_mormorata_G102 ...... -...... -...... T..TT...... GC. Hetaeria_cristata_G164 .....C.... .-....T...... C..--. ...G..GG.. Rhomboda_G100 ...... -...... --......

Anoectochilus_formosanum_G89 .....C.... .-...... C..--...... Macodes_lewii_G96 ...... -...... --...... Blackepifit_G124 ...... -...... --...... -.. Anoectochilus_chapaenensis_G123 ...... A...... --...... G.. Anoectochilus_longicalcaratus_B_G101 ...... -...... --...... G.. Anoectochilus_setaceus_G78 ...... -...... -...-. ....C..C-. ....C.GA.. Anoectochilus_brevilabris_G67 G..C.C.... G-....T...... C..--...... GG.. Anoectochilus_longicalcaratusA_G99 ...... -...... TC.CT-...... Macodesandriana_G125 ...... -...... --...... Zeuxine_oblong_G134_a ...... -...-...... T.--...... 840 Zeuxine_gracilis_G80 ...... -...... T.--...... Herpysma_rubens_G97 ...... -...... --...... Pristiglottis_G182 ...... A. .-...... T..--...... G.. Mymerchis_gracilis_G180 ...... A. .-...... --...... Herpysma_longicaulis_G189 ...... A. .-...... --...... Goodyera_schlectendaliana_G95 ...... -...-...... -...... TGA T.-....--...... Goodyera_rotundifolia_G64 ...... -...... --...... Goodyera_rotabunensis_G132 ...... -...... --...... Goodyera_daibucanensis_G98 ...... -...... --...... 3

4 Goodyera_oblongifolia_G118 ...... -...... --...... 3 Lepidogyne_longifolia_G157 .A...... -....C...... --...... Hyllophyllamontana_G90 .A...... -....C...... --...... Goodyera_fumata_G60 .A...... -....C...... --...... Goodvera_clavata_G44 .A...... -....C...... --...... Goodyera_carnea_G103 .A..A...... -...... --...... Ligophylla_G88 .A...... -...... --...... G.. Cyclopogon_lindleyanus_G127 ...... T .-....C.A...... --...... Spiranthes_odorata_G152 ...... -.------...... --- ...... A.. Plactyplectron_G529 ...... -....C...... G..--...... 900 Goodyera_vitata_G62 CGGAATGAAC CAAGAAAAAA --TGGATTTC TTCT-GAAAG GTCATGAATT GACTCTACAA Goodyera_HOC474_G63 ...... --...... -...T...... T..C...... Goodyera_pussila_G162 ...... --...... -...T...... C...... Goodyera_pussila_G86 ...... --...... -...T...... C...... Goodyera_procera_G163 ...... --...... -...T...... C...... Goodyera_bifida_G43 ...... - ...A...... --...... T ..T.-...T...... C...T.. Goodyera_repens_G73 ...... --.A...... -A..T...... C...... Goodyera_pubescens_G45 ...... --..T...... -...T...... C...... Vrydagzynea_G107 ...... --...... -...T...... A...... TC...... Vrydagzynea_G79 ...... --...... -A..T...... A...... TC......

Cheirostylis_cochinchinensG153 ...... T.....------...... Cheirostylis_G154 ...... T.....------...... Hetaeria_oblongifolia_G50 ...... --...... -...T...... Cystorchis_G65 ...... A....-- ---...... -...T...... C...... 3

4 Zeuxine_viridiflora_G57 ...... --...... -...T...... T...... 4 Ludisia_discolor_G71 ...... - ...A....-- --...G...... T.-...T...... -. ...C.C.T.. Anoectochilus_green_G68 ...... - ...A....-- --...... T...... T.. T..C.CTT.. Dossinia_mormorata_G102 G....A...- ...A...... ---..G...T ..T.-...... C....A. .G.C.CTT.. Hetaeria_cristata_G164 ...... A...... ---...... T ..T.-...... C...... C.C.C.T.. Rhomboda_G100 ...... - ...A...... --...... -...T...... A..C...T..

Anoectochilus_formosanum_G89 ...... - ...A...... --...... T ..T.-...T...... C...T.. Macodes_lewii_G96 ...... T..- ...A...... --...... T ..T.-...T...... C...T.. Blackepifit_G124 ...... - ...A...... --...... -...T. ...T...... C...T.. Anoectochilus_chapaenensis_G123 ...... - ...A...... --...... -...T. ...T...... C...T.. Anoectochilus_longicalcaratus_B_G101 ...... - ...A...... --...... T ..T.-...T...... C...T.. Anoectochilus_setaceus_G78 G.A.--..-. ..CA...... A-G..-...T ..T.-...... C.C.CCT.. Anoectochilus_brevilabris_G67 G...... - ...A...... A-...... T ..T.-...T. ...C...... C.C...T.. Anoectochilus_longicalcaratusA_G99 ...... - ...A...... --...... T ....-...T...... C...T.. Macodesandriana_G125 ...... - ...A...... A-...... -...T...... C...T.. Zeuxine_oblong_G134_a ...... --...... T ....-...T...... 900 Zeuxine_gracilis_G80 ...... --...... -...T...... Herpysma_rubens_G97 ...... --...... -...... Pristiglottis_G182 G...... C...... --...... T ....-...T...... C.C...... Mymerchis_gracilis_G180 ...... --...... -...T...... C...... Herpysma_longicaulis_G189 ...... --...... -...T...... C...... Goodyera_schlectendaliana_G95 ...... --...... -A..T...... T..... Goodyera_rotundifolia_G64 ...... A...... --...... -A..T...... T..... Goodyera_rotabunensis_G132 ...... --...... -A..T...... T..... Goodyera_daibucanensis_G98 ...... --...... -A..T...... C...... 3

4 Goodyera_oblongifolia_G118 ...... A...... --G...... --..T.T .GTCATG.A. ...C...... 5 Lepidogyne_longifolia_G157 ...... A--...... -...T. ..T...... C...... Hyllophyllamontana_G90 ...... A--...... -...T. ..T...... C...... Goodyera_fumata_G60 ...... A--...... -...T...... C...... Goodvera_clavata_G44 ...... A--...... -...T...... C...... Goodyera_carnea_G103 ...... T...... AA--...... -...T...... C...... Ligophylla_G88 ...... A--...G..T ..-.T...T...... C...... Cyclopogon_lindleyanus_G127 ...... - --...... T ....-...T...... C...... Spiranthes_odorata_G152 ..A...... C...... --...... T ..T.-...T...... T..C...... Plactyplectron_G529 ...... - --...... -...T...... C...... 960 Goodyera_vitata_G62 ATGAAGAATA AAAGAGTAAA TA------TTCGC CCGCGAACCC Goodyera_HOC474_G63 ...... G..G ...... C.. ..------...... Goodyera_pussila_G162 ...... G..G ...... C.. ..------...... Goodyera_pussila_G86 ...... G..G ...... C.. ..------...... Goodyera_procera_G163 ...... G..G ...... C.. ..------...... Goodyera_bifida_G43 ...... G..G ...... C.. ..------...... G...... Goodyera_repens_G73 ...... G..G ...... C.. ..------...... Goodyera_pubescens_G45 ...... G..G ...... C.. ..------...... A Vrydagzynea_G107 ...... G..G ...... C.. ..------...... Vrydagzynea_G79 ...... GG.G ...... C.. ..------......

Cheirostylis_cochinchinensG153 ...... G ...... C.. ..------...... A Cheirostylis_G154 ...... G ...... C.. ..------...... A Hetaeria_oblongifolia_G50 ...... G ...... C.. ..------...... T Cystorchis_G65 ..A...G..G ...... C.. ..------...... 3

4 Zeuxine_viridiflora_G57 ...... G ...... C.. ..AATGAAGA ATGAAAGAGT CAATA...... 6 Ludisia_discolor_G71 .A....GGGG ...... AC.. .T------..T.. ..C...... Anoectochilus_green_G68 .AA...GGGG ...A..ACC. A.------..T.. ..C..G.... Dossinia_mormorata_G102 ...... G..G ...... CC. ..------..T.. ..C...... Hetaeria_cristata_G164 ...... GG.G ....G..CC. ..------...... C...... Rhomboda_G100 ...... G.AG ...... C.. ..------......

Anoectochilus_formosanum_G89 ...... G..G ...... C.. ..------...... C...... Macodes_lewii_G96 ...... G..G ...... C.. ..------...... Blackepifit_G124 ...... G..G ...... C.. ..------...... Anoectochilus_chapaenensis_G123 ...... G..G ...... C.. ..------...... Anoectochilus_longicalcaratus_B_G101 ...... G..G ...... C.. ..------...... Anoectochilus_setaceus_G78 .-....GGGG ...... C.. ..------..T.. ...G...... Anoectochilus_brevilabris_G67 ...... GG.G ...... C.. .T------...C...... Anoectochilus_longicalcaratusA_G99 ...... G..G ...... C.. .T------...... Macodesandriana_G125 ...... G..G ...... C.. ..------...... Zeuxine_oblong_G134_a ...... ------...... 960 Zeuxine_gracilis_G80 ..A...... ------...... Herpysma_rubens_G97 ...... ------...... Pristiglottis_G182 ...... G..G ...... C.. ..------...... Mymerchis_gracilis_G180 ...... G..G ...... C.. ..------...... Herpysma_longicaulis_G189 ...... G..G ...... C.. ..------...... Goodyera_schlectendaliana_G95 ...... G..G ...... C.. ..------...... Goodyera_rotundifolia_G64 ...... G..G ...... C.. ..------...... Goodyera_rotabunensis_G132 ...... G..G ...... C.. ..------...... Goodyera_daibucanensis_G98 ...... G..G ...... C.. ..------...... 3

4 Goodyera_oblongifolia_G118 ...... G..G ...... T.. ..------...... 7 Lepidogyne_longifolia_G157 ...... G..G ...... C.. ..------...... Hyllophyllamontana_G90 ...... G..G ...... C.. ..------...... Goodyera_fumata_G60 ...... G..G ...... C.. ..------...... Goodvera_clavata_G44 ...... G..G ...... C.. ..------...... Goodyera_carnea_G103 ...... G..G ...... C.. ..------...... Ligophylla_G88 ...... G..G ...... C.. ..------...... Cyclopogon_lindleyanus_G127 .....AG...... C.. ..------...... Spiranthes_odorata_G152 ...G.AG.------..T.. ..------..T.. ..C...... Plactyplectron_G529 ...... G..G ...... C.. ..------...... AA 1020 Goodyera_vitata_G62 -CTTCTTTC- --TTTTT------CTT G-AATTTA------A AAATTGCATT Goodyera_HOC474_G63 -T..A....- --.....------... .-...... ------. C.....A... Goodyera_pussila_G162 -T...... - --.....------... .-...... ------. C.....A... Goodyera_pussila_G86 -T...... - --.....------... .-...... ------. C.....A... Goodyera_procera_G163 -T...... - --.....------... .-...... ------. C....T.... Goodyera_bifida_G43 -T...... -- --.....TTT TTTTTT-G-- --...... ------...... T.... Goodyera_repens_G73 -T...... -- --.....------... .-...... ------. C....T.... Goodyera_pubescens_G45 -T..A...TA AA.....TT------... .-...... ------. C....T.... Vrydagzynea_G107 -T...... - --.....------... .-...... ------...... ----- Vrydagzynea_G79 -T...... - --.....------.G. .-...... ------.....T----

Cheirostylis_cochinchinensG153 -T..A....- --.....------... .-...... ------...... T.... Cheirostylis_G154 -T..A....- --.....------... .-...... ------...... T.... Hetaeria_oblongifolia_G50 -T...... A- --.....------... .A...... ------...... T.... Cystorchis_G65 -T...... A- --.....------... T-....G.------...... TT... 3

4 Zeuxine_viridiflora_G57 -T...... - --.....------... .-...... ------. ..-.A----- 8 Ludisia_discolor_G71 CT..T...-- --.....TTT TTTTTT------...... ------. ....CT.... Anoectochilus_green_G68 CT..T...-- --.....TTT TTTTTTTT.. ---.....------. ....CT.... Dossinia_mormorata_G102 CT...... -- --.....TTT TTTTTT-G-- --....G.------...... T.... Hetaeria_cristata_G164 -...... -- --.....TTT TTTTTT-G-- --....G.------...... T.... Rhomboda_G100 -T...... - --.....TTT TT-----G-- --...... ------...... T....

Anoectochilus_formosanum_G89 -T...... -- --.....TTT TTTT------....G.------...... TA.A. Macodes_lewii_G96 -T...... - --.....TTT TTTTT------....G.------. ..T..TA.A. Blackepifit_G124 -T....G.-- --.....TTT T------G.. T-....G.------...... A.A. Anoectochilus_chapaenensis_G123 -T....G.-- --.....TTT T------G.. T-....G.------...... A.A. Anoectochilus_longicalcaratus_B_G101 -T...... - --.....TTT TTT------....G.------...... A.A. Anoectochilus_setaceus_G78 -T..T...-- --.....TTT TTTTT------....G.------. ...A..A.A. Anoectochilus_brevilabris_G67 -T...... -- --.....TTT TTTTTT------....G.------...... A.A. Anoectochilus_longicalcaratusA_G99 -T...... - --.....TTT TTT------....G.------...... A.A. Macodesandriana_G125 -T...... - --.....------G.. TT....G.------. ....ATA.A. Zeuxine_oblong_G134_a -T...... - --.....------... .-....G.------...... 1020 Zeuxine_gracilis_G80 -T...... - --.....------... .-....G.------...... Herpysma_rubens_G97 -...... - --.....------... .-...... ------...... Pristiglottis_G182 -T...... - --.....------... .-...... ------...... T.... Mymerchis_gracilis_G180 -T...... - --.....------... .-...... ------...... T.... Herpysma_longicaulis_G189 -T...... - --.....------... .-...... ------...... T.... Goodyera_schlectendaliana_G95 -T..A....- --.....------... .-...... ------. C....T.... Goodyera_rotundifolia_G64 -T..A....- --.....------... .-...... ------. C....T.... Goodyera_rotabunensis_G132 -T..A....- --.....------... .-...... ------. C....T.... Goodyera_daibucanensis_G98 -T..A....- --.....------... .-....G.------...... T.... 3

4 Goodyera_oblongifolia_G118 -T..A...-- --.....T------... .-....G.------T C....T.... 9 Lepidogyne_longifolia_G157 -T..A....- --.....------... .-...... ------...... T.... Hyllophyllamontana_G90 -T..A....- --...A.TTC TTTTT--... .-....G.------...... T.... Goodyera_fumata_G60 -T..A....- --.....------... .-...... ------. ..T..T.... Goodvera_clavata_G44 -T..A....- --.....------... .-...... ------. ..T..T.... Goodyera_carnea_G103 -T..A....- --.....------... .-...... ------...... T.... Ligophylla_G88 -T..A....- --.....------... .-...... ------...... T.... Cyclopogon_lindleyanus_G127 -T..A...A- --.....------... TC-....C------. C....TT..- Spiranthes_odorata_G152 -T..A...-- --.....TTT TTTTTTT------A. C....TT..- Plactyplectron_G529 -T...... - --.....------... -A...... AG ATAAGAAAA...... A.AA 1080 Goodyera_vitata_G62 TAGATTT-CA TATATTGGAT A-CTTTTGGC ACG------ATTTTCTA------GA Goodyera_HOC474_G63 .T.....-...... A...... ------...... ------.. Goodyera_pussila_G162 .T.....-...... G .A...... ------...... ------.. Goodyera_pussila_G86 .T.....-...... A...... ------...... ------.. Goodyera_procera_G163 ...... -...... A...... ------...... ------.. Goodyera_bifida_G43 ..T....-...... A...... ------.....A..------.. Goodyera_repens_G73 ..T....-T...... A...... A------.....A..------.. Goodyera_pubescens_G45 ..T....-T...... A...... ------.....A..------.. Vrydagzynea_G107 ------Vrydagzynea_G79 ------

Cheirostylis_cochinchinensG153 ...... -...... A...... ------...... ------T. Cheirostylis_G154 ...... -...... A...... ------...... ------T. Hetaeria_oblongifolia_G50 ...... -...... A...... T.TGGCATG .....A..------.. Cystorchis_G65 ..T...A-T...... A...... A------.....A..------.. 3

5 Zeuxine_viridiflora_G57 ------0 Ludisia_discolor_G71 ..T....-...... A...... ------.....A..------.. Anoectochilus_green_G68 ..T....-...... A...... ------.....A..------.. Dossinia_mormorata_G102 ...... -...... A...... ------.....A..------.. Hetaeria_cristata_G164 ..T....-...... A...... ------.....A..------.. Rhomboda_G100 ..T....-...... A...... ------.....A..------..

Anoectochilus_formosanum_G89 ..T....-...... A...... T ...------.....A..------.. Macodes_lewii_G96 .CT....-...... A...... T ...------.....A..------.. Blackepifit_G124 .CT....-...... A...... T ...------....GA..------.. Anoectochilus_chapaenensis_G123 .CT....-...... A...... T ...------....GA..------.. Anoectochilus_longicalcaratus_B_G101 .CT....-...... A...... T ...------.....A..------.. Anoectochilus_setaceus_G78 .CT....-...... A...... T ...------.....A..------.. Anoectochilus_brevilabris_G67 .CT....-...... A...... T ...------.....A..------.. Anoectochilus_longicalcaratusA_G99 .CT....G...... A...... T ...------.....A..------.. Macodesandriana_G125 ..T....-...... A...... T ...------.....A..------.. Zeuxine_oblong_G134_a ...... -...... A...... C. ...------...... ------.. 1080 Zeuxine_gracilis_G80 ...... -...... A...... ------...... ------.. Herpysma_rubens_G97 ...... -...... -...... ------...... ------.. Pristiglottis_G182 ...... -...... A...... C..------.....A..------.. Mymerchis_gracilis_G180 ...... -...... A...... ------.....A..------.. Herpysma_longicaulis_G189 ...... -...... A...... ------.....A..------.. Goodyera_schlectendaliana_G95 ...... -...... A...... ------.....A..------.. Goodyera_rotundifolia_G64 ...... -...... A...... ------.....A..------.. Goodyera_rotabunensis_G132 ...... -...... A...... ------.....A..------.. Goodyera_daibucanensis_G98 ...... -...... A...... ------.....A..------.. 3

5 Goodyera_oblongifolia_G118 ...... -...... G.... .A.G...... G.------..A..A..------.. 1 Lepidogyne_longifolia_G157 ...... -...... A...... ------.....A..------.. Hyllophyllamontana_G90 ...... -...... A...... ------.....A..------.. Goodyera_fumata_G60 ...... -...... A...... ------.....A..------.. Goodvera_clavata_G44 ...... -...... A...... ------.....A..------.. Goodyera_carnea_G103 ...... -...... A...... ------.....A..------.. Ligophylla_G88 ..T....-...... A...... C..ATTTTTT .....A..------.. Cyclopogon_lindleyanus_G127 ---..A.--. A.AT.GT.------Spiranthes_odorata_G152 ---....-T...... A...... T.------.....AC.TT ATTATGCG.G Plactyplectron_G529 .TAG...------1140 Goodyera_vitata_G62 GGTAAAGTAA AATATTTTAG CAAATTTGAT ATTGATA------AAAGA AAGAAGCATC Goodyera_HOC474_G63 ...... G.C...... ------...A...... Goodyera_pussila_G162 ...... G.C...... G...... ------...A...... Goodyera_pussila_G86 ...... G.C...... ------...A...... Goodyera_procera_G163 ...... G.C...... G...... ------...... Goodyera_bifida_G43 ...... C...... ------...... Goodyera_repens_G73 ....G...... G.C....T ...... ------...... A...... Goodyera_pubescens_G45 ...... G.C...... ------...... T... Vrydagzynea_G107 ------Vrydagzynea_G79 ------

Cheirostylis_cochinchinensG153 ...... T ...... ------...... Cheirostylis_G154 ...... T ...... ------...... Hetaeria_oblongifolia_G50 .A...... G...... C...... ------...... Cystorchis_G65 ...... G...... ------...T...... 3

5 Zeuxine_viridiflora_G57 ------2 Ludisia_discolor_G71 ...... G...... ------...... Anoectochilus_green_G68 ...... G...... ------...... Dossinia_mormorata_G102 ...... G...... ------...... Hetaeria_cristata_G164 ...... C...... ------...... Rhomboda_G100 ...... C...... ------......

Anoectochilus_formosanum_G89 ...... ------...A...... Macodes_lewii_G96 ...... ------...... Blackepifit_G124 ...... ------...... Anoectochilus_chapaenensis_G123 ...... ------...... Anoectochilus_longicalcaratus_B_G101 ...... ------...... C.. Anoectochilus_setaceus_G78 ...... ------...... Anoectochilus_brevilabris_G67 ...... ------...... Anoectochilus_longicalcaratusA_G99 ...... G...... ------...... Macodesandriana_G125 ...... C...... ------...... Zeuxine_oblong_G134_a ...... T...... ------...... 1140 Zeuxine_gracilis_G80 ...... T...... ------...... Herpysma_rubens_G97 ...... ------...... Pristiglottis_G182 ...... A...... C...... AAT TGATA...... Mymerchis_gracilis_G180 ...... A...... C...... AAT TGATA...... Herpysma_longicaulis_G189 ...... A...... C...... AAT TGATA...... Goodyera_schlectendaliana_G95 ...... G.C...... ------...... Goodyera_rotundifolia_G64 ...... G.C...... ------...... Goodyera_rotabunensis_G132 ...... G.C...... ------...... Goodyera_daibucanensis_G98 ...... G.C...... ------...... 3

5 Goodyera_oblongifolia_G118 ...... A... ..G.CG...... T...... ------...... 3 Lepidogyne_longifolia_G157 ...... G.C...... ------...... Hyllophyllamontana_G90 ...... G.C....C ...... ------...... Goodyera_fumata_G60 ...... G.C...... ------...... Goodvera_clavata_G44 ...... G.C...... ------...... Goodyera_carnea_G103 ...... G.C...... T...... ------...... Ligophylla_G88 ...... ----...... TT...... ------...... Cyclopogon_lindleyanus_G127 ------Spiranthes_odorata_G152 ...... GC...... T.G.------..A...... T... Plactyplectron_G529 ------1200 Goodyera_vitata_G62 ATATATA--- --AACAAATA TGCCTAGTTA TCTAGTT------Goodyera_HOC474_G63 ...... --- --...... C...... ------Goodyera_pussila_G162 ...... --- --...... C...... ------Goodyera_pussila_G86 ...... --- --...... C...... ------Goodyera_procera_G163 C...... --- --...... C. ..T...... ------Goodyera_bifida_G43 ...... --- --..A...... ------Goodyera_repens_G73 ...... --- --...... C...... ------Goodyera_pubescens_G45 ...... --- --...... C. C...... ------Vrydagzynea_G107 ------Vrydagzynea_G79 ------

Cheirostylis_cochinchinensG153 C...... --- --..A...... T.....------Cheirostylis_G154 C...... --- --..A...... T.....------Hetaeria_oblongifolia_G50 ...... --- --..A...... ------Cystorchis_G65 ...... --- --..A...G...... A..------3

5 Zeuxine_viridiflora_G57 ------4 Ludisia_discolor_G71 ...... --- --..A...... ------Anoectochilus_green_G68 ...... --- --..A...... ------Dossinia_mormorata_G102 ...... --- --..A...... C...... ------Hetaeria_cristata_G164 ...... --- --..A...... ------Rhomboda_G100 ...... --- --..A...... ------

Anoectochilus_formosanum_G89 ...... ------.A...... ------Macodes_lewii_G96 ...... ------.A...... ------Blackepifit_G124 ...... ------.A...... A...... G------Anoectochilus_chapaenensis_G123 ...... ------.A...... A...... G------Anoectochilus_longicalcaratus_B_G101 ...... ------.A...... A...... G------Anoectochilus_setaceus_G78 ...... ------.A...... A...... ------Anoectochilus_brevilabris_G67 ...... ------.A...... GG------Anoectochilus_longicalcaratusA_G99 ...... ------.A...... A...... GG------Macodesandriana_G125 ...... ------.A...... ------Zeuxine_oblong_G134_a ...... --- --...... ------1200 Zeuxine_gracilis_G80 ...... --- --...... ------Herpysma_rubens_G97 ...... --- --...... ------Pristiglottis_G182 ...... --- --...... ------Mymerchis_gracilis_G180 ...... --- --...... ------Herpysma_longicaulis_G189 ...... --- --...... ------Goodyera_schlectendaliana_G95 ...... --- --...... C...... --C TAGTTATCTA GTT------Goodyera_rotundifolia_G64 ...... --- --...... C...... --C TAGTTATCTA GTT------Goodyera_rotabunensis_G132 ...... --- --...... C...... --C TAGTTATCTA GTT------Goodyera_daibucanensis_G98 ...... --- --...... C...... ------3

5 Goodyera_oblongifolia_G118 ...... --- --...... C...... A... C...... ------5 Lepidogyne_longifolia_G157 .....G.--- --...... C...... --C T------Hyllophyllamontana_G90 ...... --- --...... C...... --C T------Goodyera_fumata_G60 ...... --- --...... C...... ------Goodvera_clavata_G44 ...... --- --...C..C...... G------Goodyera_carnea_G103 ...... --- --...... C...... ------Ligophylla_G88 ...A.------..A...A...... ------Cyclopogon_lindleyanus_G127 ------Spiranthes_odorata_G152 ....TC.TAT AT..A...C...... A...... A..ATC TAGTT------CTATAGT Plactyplectron_G529 ------1260 Goodyera_vitata_G62 ------CTAT ATATAGA--- --ACTCCCTA Goodyera_HOC474_G63 ------A...... ------...... Goodyera_pussila_G162 ------A...... ------...... Goodyera_pussila_G86 ------A...... ------...... Goodyera_procera_G163 ------A...... --- --...... Goodyera_bifida_G43 ------A...... T.--- --.....T.. Goodyera_repens_G73 ------A...... T..--- --T...... Goodyera_pubescens_G45 ------A...... TT--- --C...... Vrydagzynea_G107 ------Vrydagzynea_G79 ------C heirostylis_cochinchinensG153 ------...... --- --...T.... Cheirostylis_G154 ------...... --- --...T.... Hetaeria_oblongifolia_G50 ------A...... T.--- --...... Cystorchis_G65 ------AAG. GGT------.TA. 3

5 Zeuxine_viridiflora_G57 ------6 Ludisia_discolor_G71 ------A...... T.TA- --...... Anoectochilus_green_G68 ------A...... T.TA- --...... Dossinia_mormorata_G102 ------A...... ------.G...... Hetaeria_cristata_G164 ------A...... T.--- --.....T.. Rhomboda_G100 ------A...... T.--- --.....T..

Anoectochilus_formosanum_G89 ------A...... T.TA- --...... Macodes_lewii_G96 ------A...... T.TA- --...... Blackepifit_G124 ------A...... T.TA- --...... Anoectochilus_chapaenensis_G123 ------A...... T.TA- --...... Anoectochilus_longicalcaratus_B_G101 ------A...... T.TA- --...... Anoectochilus_setaceus_G78 ------A...... T.TA- --...... Anoectochilus_brevilabris_G67 ------A...... T.TAT A-...... Anoectochilus_longicalcaratusA_G99 ------G...... T.TA- --...... Macodesandriana_G125 ------A...... T.TA- --...... Zeuxine_oblong_G134_a ------...... --- --...... 1260 Zeuxine_gracilis_G80 ------...... --- --...... Herpysma_rubens_G97 ------...... --- --...... Pristiglottis_G182 ------A...... T.--- --...... Mymerchis_gracilis_G180 ------A...... T.--- --...... Herpysma_longicaulis_G189 ------A...... T.--- --...... Goodyera_schlectendaliana_G95 ------A...... T.TGG TA...... Goodyera_rotundifolia_G64 ------A...... T.TA- --.....T.. Goodyera_rotabunensis_G132 ------A...... T.TAT A-...... Goodyera_daibucanensis_G98 ------A...... T.--- --...... 3

5 Goodyera_oblongifolia_G118 ------A...... T.TA- --...... 7 Lepidogyne_longifolia_G157 ------A...... ------...... Hyllophyllamontana_G90 ------A... .G.------G.G..... Goodyera_fumata_G60 ------A...... T.--- --...... Goodvera_clavata_G44 ------GG...... T.--- --...... Goodyera_carnea_G103 ------A..C .....------C...... Ligophylla_G88 ------A...... ------...... Cyclopogon_lindleyanus_G127 ------Spiranthes_odorata_G152 TCTATTATAG AAATAGATTC TATATATAAA TAGAAA------...T.... Plactyplectron_G529 ------1320 Goodyera_vitata_G62 T------TAAA TAGT------Goodyera_HOC474_G63 .------.T...... ------Goodyera_pussila_G162 .------.T...... ------Goodyera_pussila_G86 .------.T...... ------Goodyera_procera_G163 .------.T...... ------Goodyera_bifida_G43 .------.T.. ..A.TTAA-- TAATTTATA- Goodyera_repens_G73 .------.T...... ----AT TAATAATTAA Goodyera_pubescens_G45 .------.T...... ------Vrydagzynea_G107 ------Vrydagzynea_G79 ------

Cheirostylis_cochinchinensG153 .------TATAC TATTTACTAT TGAATA.G...... ------Cheirostylis_G154 .------TATAC TATTTACTAT TGAATA.G...... ------Hetaeria_oblongifolia_G50 .------.T...... ------Cystorchis_G65 .------TATAT ATATATAATT ATATAT.T...... ------3

5 Zeuxine_viridiflora_G57 ------8 Ludisia_discolor_G71 .------.T...... ------Anoectochilus_green_G68 .------.T...... ------Dossinia_mormorata_G102 .------.T...... ------Hetaeria_cristata_G164 .------.T.. ..A.TTAA------Rhomboda_G100 .------.T.. ..A.TTAA------

Anoectochilus_formosanum_G89 .------.T.. ..A.------Macodes_lewii_G96 .------.T.. ..A.------Blackepifit_G124 .------.T.. ..A.------Anoectochilus_chapaenensis_G123 .------.T.. ..A.------Anoectochilus_longicalcaratus_B_G101 .------.T.. ..A.------Anoectochilus_setaceus_G78 .------.T.. ..A.------Anoectochilus_brevilabris_G67 .------.T.. ..A.------Anoectochilus_longicalcaratusA_G99 .------.T.. ..A.------Macodesandriana_G125 .------.T.. ..A.------Zeuxine_oblong_G134_a .------...... A.------1320 Zeuxine_gracilis_G80 .------...... A.------Herpysma_rubens_G97 .------...... ------Pristiglottis_G182 .------.T...... ------Mymerchis_gracilis_G180 .------.T...... ------Herpysma_longicaulis_G189 .------.T...... ------Goodyera_schlectendaliana_G95 .------.G...... ------Goodyera_rotundifolia_G64 .------.G...... ------Goodyera_rotabunensis_G132 .------.G...... ------Goodyera_daibucanensis_G98 .------.G...... ------3

5 Goodyera_oblongifolia_G118 .------.T...... ------TTAA 9 Lepidogyne_longifolia_G157 .------.T...... ------Hyllophyllamontana_G90 .------.T...... ------Goodyera_fumata_G60 .------.T...... ------Goodvera_clavata_G44 C------.T...... ------Goodyera_carnea_G103 .------.T...... ------Ligophylla_G88 .TTAATAATT GAATA------.T...... ------Cyclopogon_lindleyanus_G127 ------Spiranthes_odorata_G152 .------AT.. ...G------Plactyplectron_G529 ------1380 Goodyera_vitata_G62 ----AACAAA TTCAAG------AAAA AAA-TTTCAA A------Goodyera_HOC474_G63 ----...... T------...... -...A.. .----TATAA Goodyera_pussila_G162 ----...... T------...... -...A.. .----TATAA Goodyera_pussila_G86 ----...... T------...... -...A.. .----TATAA Goodyera_procera_G163 ----...... A------...... -...A.. .------Goodyera_bifida_G43 TAGT...... T------...... -...A.. .------Goodyera_repens_G73 TAGT...... ------...... -..GA.. .GAAT----- Goodyera_pubescens_G45 ----...... ------...... --...A.. .TAAT----- Vrydagzynea_G107 ------Vrydagzynea_G79 ------

Cheirostylis_cochinchinensG153 ----...------...... --..AA.. .------Cheirostylis_G154 ----...------...... --..AA.. .------Hetaeria_oblongifolia_G50 ----...... T------...... -...... ------Cystorchis_G65 ----...------...C ...-...T.. .------3

6 Zeuxine_viridiflora_G57 ------0 Ludisia_discolor_G71 ----...... T------...... -...A.. .------Anoectochilus_green_G68 ----...... T------...... -...A.. .------Dossinia_mormorata_G102 ----...... T..T------...... -...A.. .------Hetaeria_cristata_G164 TAGA...... T------...... -...A.. .------Rhomboda_G100 TAGA...... T------...... -...A.. .------

Anoectochilus_formosanum_G89 ----...... T------...... -...A.. .------Macodes_lewii_G96 ----...... T------...... -...A.. .------Blackepifit_G124 ----.G...... T------...... A...A.. .------Anoectochilus_chapaenensis_G123 ----.G...... T------...... A...A.. .------Anoectochilus_longicalcaratus_B_G101 ----...... T------...... A...A.. .------Anoectochilus_setaceus_G78 ----...... T------...... A...A.. .------Anoectochilus_brevilabris_G67 ----...... T------...... -...A.. .------Anoectochilus_longicalcaratusA_G99 ----...... T------...G ...A...A.. .------Macodesandriana_G125 ----...... T------...... -...A.. .------Zeuxine_oblong_G134_a ----...... ------...... -...... ------1380 Zeuxine_gracilis_G80 ----...... ------...... -...... ------Herpysma_rubens_G97 ----...... ------...... -...... ------Pristiglottis_G182 ----...... T------...... -...A.. .------Mymerchis_gracilis_G180 ----...... T------...... -...A.. .------Herpysma_longicaulis_G189 ----...... T------...... -...A.. .------Goodyera_schlectendaliana_G95 ----...... T------...... -...A.. .T------Goodyera_rotundifolia_G64 ----...... T------...... -...A.. .T------Goodyera_rotabunensis_G132 ----...... T------...... -...A.. .T------Goodyera_daibucanensis_G98 ----...... T------...... -...A.. .T------3

6 Goodyera_oblongifolia_G118 TAGT...... T------...... -...A.. -T------1 Lepidogyne_longifolia_G157 ----..A...... ------G...... -...------Hyllophyllamontana_G90 ----..A...... ------...... --...A.. .TATT----- Goodyera_fumata_G60 ----..A...... T------...... -...------Goodvera_clavata_G44 -----.A...... T------...... -...------Goodyera_carnea_G103 ----..A...... ------.... .---...T.. .ATT------Ligophylla_G88 ----..A...... ------...... -..G------Cyclopogon_lindleyanus_G127 ------AAA TGAAAG.... .T.-..GA.. .----TG--- Spiranthes_odorata_G152 ----..A... .GA..TATAA TAGGAAAAAA TGAAAG...... -...... ----TG--- Plactyplectron_G529 ------1440 Goodyera_vitata_G62 ------TCT TT-TGATAGA A-TG------AA--TAC A-TGT---GT Goodyera_HOC474_G63 AAGAAAATC- AGTATAT... ..-...... -..------..A-... .-.A.---.. Goodyera_pussila_G162 AAGAAAATC- AGTATAT... ..-...... -..------..A-... .-.A.---.. Goodyera_pussila_G86 AAGAAAATC- AGTATAT... ..-...... -..------..A-... .-.A.---.. Goodyera_procera_G163 ------TTC AGTATAT... ..-...... -..------..A-... .-.A.---.. Goodyera_bifida_G43 ------... ..-...... -..------..A-... .-...---A. Goodyera_repens_G73 ---AAAAT-A AGTAGAT... ..-...... -..------..A-... .-.A.---.. Goodyera_pubescens_G45 ---AAAAT-A AGTAGAT... ..-.C...... -..------..A-... .-.A.---.. Vrydagzynea_G107 ------. ..-...... -..------..A-A.. .-...---.. Vrydagzynea_G79 ------. .C-.C...A. .C..------..AC... .G...---..

Cheirostylis_cochinchinensG153 ------.A. ..-...... -..------..A-... .-...GGT.. Cheirostylis_G154 ------.A. ..-...... -..------..A-... .-...GGT.. Hetaeria_oblongifolia_G50 ------... ..-...... -..------..A-... .-..C---.. Cystorchis_G65 ------... ..-...... -..------..A-... .-...---.. 3

6 Zeuxine_viridiflora_G57 ------. ..-...... -..------..A-... .-...---.. 2 Ludisia_discolor_G71 ------... ..-...... -..------..A-... .-...---.. Anoectochilus_green_G68 ------... ..-...... -..------..A-... .-...---.. Dossinia_mormorata_G102 ------.A. ..-...... -..------..A-... .-.T.---.. Hetaeria_cristata_G164 ------... ..-...... -..------..A-... .-...---A. Rhomboda_G100 ------... ..-...... -..------..A-... .-...---A.

Anoectochilus_formosanum_G89 ------... ..-...... -..------..A-... .-...---A. Macodes_lewii_G96 ------... ..-...... -..------..A-..A .-...---A. Blackepifit_G124 ------... ..-...... -..------..A-... .-...---A. Anoectochilus_chapaenensis_G123 ------... ..-...... -..------..A-... .-...---A. Anoectochilus_longicalcaratus_B_G101 ------... ..-...... -..------..A-... .-...---A. Anoectochilus_setaceus_G78 ------... ..-...... -..------..A-... .-...---A. Anoectochilus_brevilabris_G67 ------.A. ..-...... -..------..A-... .-...---A. Anoectochilus_longicalcaratusA_G99 ------... ..-...G... .-..------..A-... .-...---A. Macodesandriana_G125 ------... ..-...... -..------..A-... .-...---A. Zeuxine_oblong_G134_a ------... ..-...... -..------..--... .-...---.. 1440 Zeuxine_gracilis_G80 ------... ..-...... -..------..--... .-...---.. Herpysma_rubens_G97 ------... ..-...... -..------..--... .-...---.. Pristiglottis_G182 ------... ..-...... -..------..A-... .-...---.. Mymerchis_gracilis_G180 ------... ..-...... -..------..A-... .-...---.. Herpysma_longicaulis_G189 ------... ..-...... -..------..A-... .-...---.. Goodyera_schlectendaliana_G95 ---AAAAT-G AGTATAT... ..-...... -..------..A-... .-.A.---.. Goodyera_rotundifolia_G64 ---AAAAT-G AGTATAT... ..-...... -..------..A-... .-.A.---.. Goodyera_rotabunensis_G132 ---AAAAT-G AGTATAT... ..-...... -..------..A-... .-.A.---.. Goodyera_daibucanensis_G98 ---AAAAT-G AGTATAT... ..-...... -..------..A-... .-.A.---.. 3

6 Goodyera_oblongifolia_G118 ---AAAAT-A AGTAGAT... ..-...... -..------..A-G.. .-.A.---.. 3 Lepidogyne_longifolia_G157 ---AAAAT-A AGTAGAT... ..-...... -..------..A-... .-.A.---.. Hyllophyllamontana_G90 ---AAAAT-A AGTAGAT... ..-...... -..------..A-... .-.A.---.. Goodyera_fumata_G60 ---AAAAT-A AGTATAT... ..-.T...... -..------..A-... .-.A.---.. Goodvera_clavata_G44 ---AAAAT-A AGTATAC... ..C.T...... -..------..A-... .-.A.---.. Goodyera_carnea_G103 ---AATAT-A AGTATAT... ..-...... -..------..A-... .-.A.---.. Ligophylla_G88 ---AAAAT-A AGTATAT... ..-...... -..GATAGA ATG..A-... .-.A.---.. Cyclopogon_lindleyanus_G127 ------AGTATAT... ..-...... -..------..A-... .-.T.---.. Spiranthes_odorata_G152 ------AGTATAT... ..-...... -..------..A-... .-.T.---.. Plactyplectron_G529 ------CT... ..-.....AC .-..------..A-... .-...---.. 1489 Goodyera_vitata_G62 A-TATGTAAG ATTA-TTGAA TCATTTCATT CGCGAGGAGC TGGAT-GAG Goodyera_HOC474_G63 .-...... -...... A...... -... Goodyera_pussila_G162 .-...... -...... -... Goodyera_pussila_G86 .-...... -...... -... Goodyera_procera_G163 .-...... C-...... -... Goodyera_bifida_G43 .-...... T ...T-...... -... Goodyera_repens_G73 .-.....C...... -...... -... Goodyera_pubescens_G45 .-...... -C...... -... Vrydagzynea_G107 .-...... -...... -... Vrydagzynea_G79 .G...... A ....-...... C...

Cheirostylis_cochinchinensG153 .-...... -...... -... Cheirostylis_G154 .-...... -...... -... Hetaeria_oblongifolia_G50 .-...... -...... -... Cystorchis_G65 .-...... T ....G...... -... 3

6 Zeuxine_viridiflora_G57 .-...... C-...... -... 4 Ludisia_discolor_G71 .-...... T-..... A...... -... Anoectochilus_green_G68 .-...... T-...... -... Dossinia_mormorata_G102 .-...... T-..T...... -... Hetaeria_cristata_G164 .-...... T ...T-...... -... Rhomboda_G100 .-...... T ...T-...... -...

Anoectochilus_formosanum_G89 .-....C...... G-...... T...... -... Macodes_lewii_G96 .-....C..T ...T-...... T...... -... Blackepifit_G124 .-....C...... T-...... T...... -... Anoectochilus_chapaenensis_G123 .-....C...... T-...... T...... -... Anoectochilus_longicalcaratus_B_G101 .-....C...... T-...... T...... -... Anoectochilus_setaceus_G78 .-....C...... T-...... T...... -... Anoectochilus_brevilabris_G67 .-....C...... T-...... T...... -... Anoectochilus_longicalcaratusA_G99 .-....C...... T-G...... T...... -... Macodesandriana_G125 .-....C...... T-...... T.CT...... -... Zeuxine_oblong_G134_a .-...... -...... -... 1489 Zeuxine_gracilis_G80 .-...... -...... -... Herpysma_rubens_G97 .-...... -...... -... Pristiglottis_G182 .-...... -...... -... Mymerchis_gracilis_G180 .-...... -...... -... Herpysma_longicaulis_G189 .-...... -...... T...... -... Goodyera_schlectendaliana_G95 .-...... -...... -...

Goodyera_rotundifolia_G64 .-...... -...... -... Goodyera_rotabunensis_G132 .-...... -...... -... 3

6 Goodyera_daibucanensis_G98 .-...... -...... -... 5 Goodyera_oblongifolia_G118 .-...... T ....-...... T...... -...

Lepidogyne_longifolia_G157 .-...... -...... -... Hyllophyllamontana_G90 .-...... -...... -... Goodyera_fumata_G60 .-...... -...... -... Goodvera_clavata_G44 .-...... -...... -... Goodyera_carnea_G103 .-.....------...... -..A Ligophylla_G88 .-...... C-...... -... Cyclopogon_lindleyanus_G127 .-.....C...... -...... -... Spiranthes_odorata_G152 .-.....C...... -...... -..A Plactyplectron_G529 .-...... -...... -... Appendix D. ITS pairwise sequence divergence between and within genera by the exclusion or inclusion of the out-groups

======1 2 3 4 5 6 7 8 9101112 13 14 15 16 17 18 19 ======1 Manniella gustav - 2 Manniella cyprip 0 - 3 Pterichis habena 3 3 - 4 Cranichis cillil 1 1 0 - 5 Cranichis ciliil 1 1 0 0 - 6 Prescottia aff. 3 1 0 0 0 - 7 Prescottia plant 3 3 2 0 0 0 - 8 Gomphichis botot 7 5 2 0 0 2 2 - 9 Stenoptera ecuad 1 5 2 0 0 0 2 0 - 10 Stenoptera peruv 1 5 2 0 0 0 2 0 0 - 11G126Sarcog 6 5 4 2 2 6 6 7 4 4 - 12CyclinG127 2 1 0 0 0 6 4 3 0 0 0 - 13 SpirspirAF348064 2 5 0 0 0 7 4 3 2 4 0 0 - 14 SpircerAF301444 2 5 0 0 0 7 4 3 2 2 0 0 0 - 15 G152Spiranthesod 2 5 0 0 0 7 4 3 2 2 0 0 0 0 - 16 GALEOTTIELLA SAR 2 2 3 3 3 5 5 1 1 1 6 8 8 7 7 - 17 Pachyplectron ar 5 5 6 4 4 9 8 10 4 4 12 10 11 10 10 1 - 18 Pachyplectronari 5 5 6 4 4 9 8 10 4 4 12 10 11 10 10 1 0 - 19Megastylisgland 2 4 5 3 3 8 7 5 3 3 9 8 6 5 5 0 5 5 - 20Megastylisgland 2 4 5 3 3 8 7 5 3 3 9 8 6 5 5 0 5 5 0 21 Gavilea lutea A 7 9 6 4 4 11 10 8 4 4 10 10 10 9 9 3 2 2 3 22 Gavilea lutea A 7 9 6 4 4 11 10 8 4 4 10 10 10 9 9 3 2 2 3

======Continued

366 Appendix D. continued ======1 2 3 4 5 6 7 8 9101112 13 14 15 16 17 18 19 ======

23Chloraeamagella 6 6 5 3 3 8 6 7 3 3 10 8 7 6 6 2 3 3 3 24Chloraeamagella 6 6 5 3 3 8 6 7 3 3 10 8 7 6 6 2 3 3 3 25Chloraeaviresce 6 6 5 3 3 7 7 7 3 3 9 7 7 6 6 2 1 1 2 26 Pterostylis dain 9 9 10 10 10 15 12 14 10 10 16 20 16 15 15 5 2 2 3 27 Pterostylis cucu 10 10 11 11 11 16 13 15 11 11 15 23 17 16 16 6 3 3 2 28 Pterostylis bank 10 10 11 11 11 16 13 15 11 11 15 23 17 16 16 6 3 3 2 29 AY134622Pterosty 10 10 11 11 11 18 15 15 11 11 17 25 19 18 18 6 3 3 2 30 GproYkwJpn 19 17 18 16 16 23 22 23 18 18 22 22 22 21 21 13 7 7 11 31 GdaibG98 14 12 15 13 13 20 19 18 13 13 23 21 21 20 20 8 6 6 8 32 GcarG103 18 16 21 19 19 26 25 22 19 19 25 23 23 22 22 12 8 8 12 33 LigeophilaG88 14 14 15 13 13 20 19 18 15 15 19 19 19 18 18 10 6 6 10 34 LepisceptAF34803 14 16 17 15 15 22 23 18 17 17 22 24 22 21 21 12 8 8 12 35 G90 Hyllophylla 14 16 17 15 15 19 21 18 17 17 20 20 20 19 19 10 8 8 12 36 PlatypolyAJ53952 16 16 17 15 15 22 21 20 17 17 21 21 21 20 20 10 6 6 10 37 GclavG44 14 14 15 15 15 22 19 18 15 15 19 21 21 20 20 10 6 6 10 38 GviriMkAU 14 14 15 13 13 20 19 18 15 15 19 19 19 18 18 8 6 6 10 39 GfumThai 14 14 15 13 13 20 19 18 15 15 19 21 19 20 18 10 6 6 10 ======Continued

367 Appendix D. continued ======1 2 3 4 5 6 7 8 9101112 13 14 15 16 17 18 19 ======

40 GpolygoMkAu 14 14 15 13 13 20 19 18 15 15 19 19 19 18 18 8 6 6 10 41 GtesseG149 10 10 13 11 11 16 17 14 11 11 16 17 14 13 13 6 4 4 10 42 GdrepMenIndia 10 10 13 11 11 16 17 14 11 11 16 17 14 13 13 6 4 4 10 43 GoblongMarkAu 9 9 12 10 10 15 16 13 10 10 15 15 13 12 12 5 3 3 7 44 GpubAJ539519 13 11 14 12 12 19 18 17 12 12 20 20 18 17 17 7 4 4 8 45 GdschlecMkAU 14 12 15 13 13 20 19 18 13 13 19 21 19 18 18 8 6 6 8 46 AnoelanceG70 15 13 16 14 14 21 20 19 14 14 20 22 20 19 19 9 7 7 9 47 GschlecYkwJpn 15 13 16 14 14 21 20 19 14 14 20 22 20 19 19 9 7 7 9 48 GrotaG132 15 13 16 14 14 21 20 19 14 14 20 22 20 19 19 9 7 7 9 49 GschlecAF366897 15 13 16 14 14 21 20 19 14 14 20 22 20 19 19 9 7 7 9 50 GrepeAF3666896 15 13 16 14 14 21 20 19 14 14 20 22 20 19 19 9 7 7 9 51 Goodyera bifidaI 12 10 13 11 11 18 17 16 11 11 17 17 15 14 14 6 4 4 8 52 GbifiG55 12 10 13 11 11 18 17 16 11 11 17 17 15 14 14 6 4 4 8 53 GfolvarmaxiYkwJp 12 10 13 11 11 18 17 16 11 11 17 17 15 14 14 6 4 4 8 54 GdveluAF366898 12 10 13 11 11 18 17 16 11 11 17 17 15 14 14 6 4 4 8 55 GvelutYkwJpn 12 10 13 11 11 18 17 16 11 11 17 17 15 14 14 6 4 4 8 56 GmaxiAF366895 12 10 13 11 11 18 17 16 11 11 17 17 15 14 14 6 4 4 8 57 GhachiYkwJpn 12 10 15 13 13 21 21 16 13 13 21 21 19 18 18 8 4 4 8 ======Continued

368 Appendix D. continued ======1 2 3 4 5 6 7 8 9101112 13 14 15 16 17 18 19 ======

58 Go HOC474 G63 12 10 15 13 13 22 21 16 13 13 21 21 19 18 18 8 4 4 8 59 GmacrAF366894 14 12 13 11 11 19 19 16 11 11 19 19 17 16 16 8 6 6 8 60 GhisRedKRI 12 10 13 11 11 20 19 16 11 11 19 19 17 16 16 6 4 4 8 61 Gdhispwhite 12 10 13 11 11 20 19 16 11 11 19 19 17 16 16 6 4 4 8 62 CysJohncolG65 11 13 16 14 14 19 20 15 16 16 21 21 19 18 18 11 5 5 9 63 CysstenoG76 11 13 16 14 14 19 20 15 16 16 19 21 19 18 18 11 5 5 9 64 G153 Cheirostyli 17 17 18 16 16 22 22 21 18 18 22 23 24 23 23 11 9 9 13 65 HetobloG51 13 11 12 10 10 17 16 15 12 12 16 18 18 17 17 9 1 1 5 66 HetoblMkAU 13 11 12 10 10 17 16 15 12 12 18 18 18 17 17 9 1 1 5 67 HerpyrubG97 13 11 10 10 10 17 14 13 10 10 14 16 16 15 15 9 3 3 5 68 GvitatG62 15 13 14 12 12 21 18 17 14 14 18 18 21 20 20 9 3 3 7 69 ZeuviriG57 15 13 16 14 14 19 18 17 16 16 20 20 22 21 21 11 3 3 7 70 ZeuobloAF348073 13 11 14 12 12 21 18 15 14 14 20 20 22 21 21 9 3 3 7 71 G80Zeuxinegracil 13 11 14 12 12 21 18 15 14 14 20 20 22 21 21 9 3 3 7 72 Herpysmalongicau 11 11 10 8 8 13 14 11 10 10 13 13 13 12 12 7 3 3 5 73 G180 Mymerchis g 9 10 9 7 7 12 13 10 9 9 14 14 14 13 13 5 2 2 4 74 GclaKRI 9 10 9 7 7 12 13 10 9 9 14 14 14 13 13 5 2 2 4 75 DosmarmDMA539521 15 15 12 10 10 17 16 15 12 12 16 16 16 15 15 11 3 3 7 ======Continued

369 Appendix D. continued ======1 2 3 4 5 6 7 8 9101112 13 14 15 16 17 18 19 ======

76 AnoecgreenG68 13 11 12 10 10 17 16 15 12 12 16 16 16 15 15 7 1 1 5 77 LuddisAJ539483 13 11 12 10 10 17 16 15 12 12 16 16 16 15 15 7 1 1 5 78 LudnigrG66 13 11 12 10 10 17 16 15 12 12 16 16 17 16 16 7 1 1 5 79 Zeuxine strateum 15 13 14 12 12 19 18 17 14 14 18 18 18 17 17 9 3 3 7 80 G182 Pristiglott 16 14 15 13 13 20 19 18 15 15 19 20 20 19 19 10 6 6 9 81 AnoebrevG67 11 11 12 10 10 15 16 11 12 12 15 17 17 16 16 9 5 5 5 82 AnocforAY052780 11 11 12 10 10 15 16 11 12 12 15 17 17 16 16 9 5 5 5 83 G99 Anoectochilu 11 11 12 10 10 15 16 11 12 12 15 17 17 16 16 9 5 5 7 84 MaclewiiG96 11 11 12 10 10 15 16 11 12 12 15 17 17 16 16 9 5 5 7 85 McdessanG125 14 14 15 13 13 18 19 14 15 15 18 20 21 20 20 12 8 8 8 86 AnoesetaceusG78 16 16 17 15 15 20 21 16 17 17 20 22 23 22 22 14 10 10 12 87 BlacepiG124 18 18 19 17 17 23 22 20 19 19 25 25 25 24 24 14 12 12 12 88 MacsandG77 13 11 12 10 10 18 16 15 12 12 16 16 18 17 17 7 1 1 5 89 HetcrisG47 12 12 13 11 11 19 16 16 13 13 17 18 19 18 18 6 6 6 8 ======Continued

370 Appendix D. continued ======20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 ======20 Megastylis gland - 21 Gavilea lutea A 3 - 22 Gavilea lutea A 3 0 - 23 Chloraea magella 3 0 0 - 24 Chloraea magella 3 0 0 0 - 25 Chloraea viresce 2 1 1 0 0 - 26 Pterostylis dain 3 2 2 2 2 1 - 27 Pterostylis cucu 2 3 3 1 1 0 0 - 28 Pterostylis bank 2 3 3 1 1 0 0 0 - 29 AY134622Pterosty 2 3 3 1 1 0 2 0 0 - 30 GproYkwJpn 11 16 16 14 14 13 20 23 23 23 - 31 GdaibG98 8 11 11 9 9 8 15 18 18 18 4 - 32 GcarG103 12 15 15 11 11 12 17 18 18 18 2 3 - 33 LigeophilaG88 10 15 15 13 13 12 15 16 16 16 1 1 0 - 34 LepisceptAF34803 12 13 13 11 11 10 19 18 18 20 1 1 0 0 - 35 G90 Hyllophylla 12 15 15 12 12 12 15 16 16 16 1 1 0 2 0 - 36 PlatypolyAJ53952 10 13 13 11 11 10 15 16 16 16 1 1 0 0 0 0 - 37 GclavG44 10 13 13 11 11 10 17 18 18 18 1 1 0 0 0 0 0 - 38 GviriMkAU 10 13 13 11 11 10 15 16 16 16 1 1 0 0 0 0 0 0 - 39 GfumThai 10 13 13 11 11 10 17 18 18 18 1 1 0 0 2 0 0 0 0 40 GpolygoMkAu 10 13 13 11 11 10 15 16 16 16 1 1 0 0 0 0 0 0 0 41 GtesseG149 10 9 9 7 7 6 11 12 12 12 2 0 3 1 3 3 1 1 1 42 GdrepMenIndia 10 9 9 7 7 6 11 12 12 12 2 0 3 1 3 3 1 1 1 43 GoblongMarkAu 7 8 8 6 6 5 10 11 11 11 4 0 5 3 5 5 3 3 3 44 GpubAJ539519 8 11 11 9 9 8 13 14 14 14 2 0 3 1 1 1 2 1 1 45 GdschlecMkAU 8 11 11 9 9 8 13 18 18 18 4 0 3 1 1 1 1 1 1 ======Continued

371 Appendix D. continued ======20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 ======46 AnoelanceG70 9 12 12 10 10 9 14 19 19 19 5 1 4 2 2 2 2 2 2 47 GschlecYkwJpn 9 12 12 10 10 9 14 19 19 19 5 0 4 2 2 2 2 2 2 48 GrotaG132 9 12 12 10 10 9 14 19 19 19 5 1 4 2 2 2 2 2 2 49 GschlecAF366897 9 12 12 10 10 9 14 19 19 19 5 1 4 2 2 2 2 2 2 50 GrepeAF3666896 9 12 12 10 10 9 14 19 19 19 5 1 4 2 2 2 2 2 2 51 Goodyera bifidaI 8 11 11 9 9 8 13 14 14 14 2 2 3 1 1 1 1 1 1 52 GbifiG55 8 11 11 9 9 8 13 14 14 14 2 0 3 1 1 1 1 1 1 53 GfolvarmaxiYkwJp 8 11 11 9 9 8 13 14 14 14 2 0 3 1 1 1 1 1 1 54 GdveluAF366898 8 11 11 9 9 8 13 14 14 14 2 0 3 1 1 1 1 1 1 55 GvelutYkwJpn 8 11 11 9 9 8 13 14 14 14 2 0 3 1 1 1 1 1 1 56 GmaxiAF366895 8 11 11 9 9 8 13 14 14 14 2 0 3 1 1 1 1 1 1 57 GhachiYkwJpn 8 11 11 8 8 8 15 14 14 16 2 0 5 1 3 1 1 1 1 58 Go HOC474 G63 8 11 11 9 9 8 15 14 14 16 2 0 5 1 3 1 1 1 1 59 GmacrAF366894 8 13 13 10 10 10 15 14 14 16 2 0 3 1 3 1 1 1 1 60 GhisRedKRI 8 11 11 9 9 8 15 14 14 16 2 0 3 1 3 1 1 1 1 61 Gdhispwhite 8 11 11 9 9 8 15 14 14 16 2 0 3 1 3 1 1 1 1 62 CysJohncolG65 9 10 10 8 8 7 14 15 15 15 14 11 17 15 19 17 15 15 15 63 CysstenoG76 9 10 10 8 8 7 14 15 15 15 14 11 17 15 19 17 15 15 15 64 G153 Cheirostyli 13 14 14 11 11 11 18 19 19 19 20 13 19 19 19 19 21 19 19 ======Continued

372 Appendix D. continued ======20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 ======

65 HetobloG51 5 8 8 6 6 5 14 15 15 15 18 9 15 15 17 15 17 15 15 66 HetoblMkAU 5 8 8 6 6 5 14 15 15 15 18 9 15 15 17 15 17 15 15 67 HerpyrubG97 5 10 10 8 8 7 10 11 11 11 11 11 11 11 11 11 11 13 11 68 GvitatG62 7 8 8 6 6 5 12 15 15 15 20 11 15 15 15 15 17 15 15 69 ZeuviriG57 7 8 8 8 8 7 16 15 15 15 18 9 17 15 15 15 17 15 15 70 ZeuobloAF348073 7 8 8 6 6 5 12 13 13 13 18 9 17 15 15 15 17 15 15 71 G80Zeuxinegracil 7 8 8 6 6 5 12 13 13 13 18 9 17 15 15 15 17 15 15 72 Herpysmalongicau 5 8 8 6 6 5 6 7 7 7 10 5 9 9 11 11 9 9 9 73G180Mymerchisg 4 7 7 5 5 4 7 8 8 8 12 6 12 12 14 14 12 12 12 74GclaKRI 4 7 7 5 5 4 7 8 8 812 6 12 12 14 14 12 12 12 75 DosmarmDMA539521 7 12 12 10 10 9 10 13 13 13 18 11 15 15 15 15 15 15 15 76 AnoecgreenG68 5 10 10 8 8 7 10 13 13 13 18 11 15 17 15 17 15 15 15 77 LuddisAJ539483 5 10 10 8 8 7 10 13 13 13 18 11 15 17 15 17 15 15 15 78 LudnigrG66 5 10 10 8 8 7 10 13 13 13 18 11 15 17 15 17 15 15 15 79 Zeuxine strateum 7 10 10 8 8 7 12 15 15 15 18 13 15 15 15 15 15 15 15 80 G182 Pristiglott 9 11 11 9 9 8 13 18 18 18 19 15 16 16 16 16 16 16 16 81 AnoebrevG67 5 8 8 6 6 5 6 9 11 11 12 9 13 11 13 13 11 11 11 82 AnocforAY052780 5 8 8 6 6 5 6 9 9 9 12 9 13 11 13 13 11 11 11 83 G99 Anoectochilu 7 8 8 6 6 5 6 9 9 9 12 9 13 11 13 13 11 11 11 ======Continued

373 Appendix D. continued ======20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 ======84MaclewiiG96 7 8 8 6 6 5 6 9 9 912 9 13 11 13 13 11 11 11 85 McdessanG125 8 11 11 9 9 8 11 13 13 13 15 19 15 13 15 15 13 13 13 86 AnoesetaceusG78 12 13 13 11 11 10 11 14 14 14 17 20 18 16 18 18 16 16 16 87 BlacepiG124 12 17 17 15 15 14 15 19 19 19 19 20 20 19 19 19 19 19 19 88 MacsandG77 5 8 8 6 6 5 10 13 13 13 18 13 15 15 15 15 15 15 15 89 HetcrisG47 8 10 10 9 9 8 13 15 15 15 16 13 17 17 17 17 17 17 17 ======Continued

374 Appendix D. continued ======39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 ======39 GfumThai - 40 GpolygoMkAu 0 - 41 GtesseG149 1 1 - 42 GdrepMenIndia 1 1 0 - 43 GoblongMarkAu 3 3 0 0 - 44 GpubAJ539519 1 1 0 0 0 - 45 GdschlecMkAU 1 1 0 0 0 0 - 46 AnoelanceG70 2 2 1 1 1 1 1 - 47 GschlecYkwJpn 2 2 1 1 1 1 1 0 - 48GrotaG132 2 2 1 1 1 1 1 0 0 - 49 GschlecAF366897 2 2 1 1 1 1 1 0 0 0 - 50 GrepeAF3666896 2 2 1 1 1 1 1 0 0 0 0 - 51GoodyerabifidaI 1 1 0 0 0 0 0 1 1 1 1 1 - 52GbifiG55 1 1 0 0 0 0 0 1 1 1 1 1 0 - 53 GfolvarmaxiYkwJp 1 1 0 0 0 0 0 1 1 1 1 1 0 0 - 54 GdveluAF366898 1 0 0 0 0 0 0 1 1 1 1 1 0 0 0 - 55 GvelutYkwJpn 1 1 0 0 0 0 0 1 1 1 1 1 0 0 0 0 - 56 GmaxiAF366895 1 1 0 0 0 0 0 1 1 1 1 1 0 0 0 0 0 - 57 GhachiYkwJpn 1 1 0 0 0 0 0 1 1 1 1 1 0 0 0 0 0 0 - 58GoHOC474G63 1 1 0 0 0 0 0 1 1 1 1 1 0 0 0 0 0 0 0 59 GmacrAF366894 1 1 0 0 0 0 0 1 1 1 1 1 0 0 0 0 0 0 0 60GhisRedKRI 1 1 0 0 0 0 0 1 1 1 1 1 0 0 0 0 0 0 0 61 Gdhispwhite 1 1 0 0 0 0 0 1 1 1 1 1 0 0 0 0 0 0 0 62 CysJohncolG65 17 15 11 11 10 11 11 12 12 12 12 12 11 11 11 11 11 11 13 63 CysstenoG76 17 15 11 11 10 11 11 12 12 12 12 12 11 11 11 11 11 11 13 64 G153 Cheirostyli 19 19 13 13 10 14 12 14 13 14 14 14 13 13 13 13 13 13 13 ======Continued

375 Appendix D. continued ======39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 ======65 HetobloG51 17 15 7 7 6 10 9 10 10 10 10 10 9 9 9 9 9 9 9 66 HetoblMkAU 17 15 7 7 6 10 9 10 10 10 10 10 9 9 9 9 9 9 9 67 HerpyrubG97 11 11 5 5 4 7 6 8 7 8 8 8 9 7 7 7 7 7 7 68 GvitatG62 15 15 7 7 6 10 11 12 12 12 12 12 9 9 9 9 9 9 9 69 ZeuviriG57 15 15 7 7 6 10 9 10 10 10 10 10 9 9 9 9 9 9 11 70 ZeuobloAF348073 15 15 7 7 6 12 9 10 10 10 10 10 9 9 9 9 9 9 10 71 G80Zeuxinegracil 15 15 7 7 6 12 9 10 10 10 10 10 9 9 9 9 9 9 10 72 Herpysmalongicau 9 9 5 5 4 5 5 6 6 6 6 6 5 5 5 5 5 5 5 73 G180 Mymerchis g 12 12 6 6 5 8 6 7 7 7 7 7 6 6 6 6 6 6 6 74GclaKRI 1212 6 6 5 8 6 7 7 7 7 7 6 6 6 6 6 6 6 75 DosmarmDMA539521 15 15 7 7 6 9 11 12 12 12 12 12 9 9 9 9 9 9 9 76 AnoecgreenG68 15 15 7 7 6 9 11 12 12 12 12 12 9 9 9 9 9 9 9 77 LuddisAJ539483 15 15 7 7 6 9 11 12 12 12 12 12 9 9 9 9 9 9 9 78 LudnigrG66 15 15 7 7 6 9 11 12 12 12 12 12 9 9 9 9 9 9 9 79 Zeuxine strateum 15 15 9 9 8 11 13 14 14 14 14 14 11 11 11 11 11 11 11 80 G182 Pristiglott 16 16 10 10 9 12 15 16 16 16 16 16 12 12 12 12 12 12 12 81 AnoebrevG67 11 11 5 5 4 5 7 8 8 8 8 8 5 5 5 5 5 5 7 82 AnocforAY052780 11 11 5 5 4 5 7 8 8 8 8 8 5 5 5 5 5 5 7 83 G99 Anoectochilu 11 11 5 5 4 5 7 8 8 8 8 8 5 5 5 5 5 5 7 ======Continued

376 Appendix D. continued ======39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 ======84 MaclewiiG96 11 11 5 5 4 5 7 8 8 8 8 8 5 5 5 5 5 5 7 85 McdessanG125 13 13 7 7 6 7 9 10 10 10 10 10 9 7 7 7 7 7 9 86 AnoesetaceusG78 16 16 10 10 9 10 12 13 13 13 13 13 12 10 10 10 10 10 12 87 BlacepiG124 19 18 11 11 10 13 15 16 16 16 16 16 15 13 13 13 13 13 15 88 MacsandG77 15 15 7 7 6 9 11 12 12 12 12 12 11 9 9 9 9 9 9 89 HetcrisG47 17 17 9 9 8 11 13 14 14 14 14 14 11 11 11 11 11 11 11

======Continued

377 Appendix D. continued ======58 59 60 61 62 63 64 65 66 67 68 69 70 71 72 73 74 75 76 ======58 Go HOC474 G63 - 59 GmacrAF366894 0 - 60 GhisRedKRI 0 0 - 61 Gdhispwhite 0 0 0 - 62 CysJohncolG65 13 11 11 11 - 63 CysstenoG76 13 11 11 11 0 - 64 G153 Cheirostyli 13 13 13 13 4 4 - 65 HetobloG51 9 9 9 9 4 4 0 - 66 HetoblMkAU 9 9 9 9 4 4 0 0 - 67 HerpyrubG97 7 9 9 7 2 2 4 2 2 - 68GvitatG62 9 9 9 9 2 2 0 0 0 2 - 69ZeuviriG57 11 9 9 9 4 4 0 0 0 2 0 - 70 ZeuobloAF348073 10 9 9 9 4 4 0 0 0 2 2 0 - 71 G80Zeuxinegracil 10 9 9 9 4 4 0 0 0 2 2 0 0 - 72 Herpysmalongicau 5 7 5 5 2 2 2 0 0 0 0 0 0 0 - 73 G180 Mymerchis g 6 8 6 6 1 1 1 0 0 0 0 0 2 2 0 - 74GclaKRI 6 8 6 6 1 1 1 0 0 0 0 0 2 4 0 0 - 75 DosmarmDMA539521 9 11 9 9 2 2 0 0 0 4 2 0 0 0 2 2 2 - 76 AnoecgreenG68 9 9 9 9 2 2 0 0 0 2 4 0 0 0 0 0 0 0 - 77 LuddisAJ539483 9 9 9 9 2 2 0 0 0 2 4 0 0 0 0 0 0 0 0 78LudnigrG66 9 9 9 9 2 2 0 0 0 2 4 0 0 0 0 0 0 0 0 79Zeuxinestrateum 11 11 11 11 4 4 0 0 0 4 2 0 0 0 2 0 0 0 0 80 G182 Pristiglott 12 12 12 12 4 4 1 0 0 4 2 0 0 0 2 0 0 0 0 81 AnoebrevG67 7 7 5 5 0 0 2 0 0 3 0 2 2 2 2 0 0 2 0 82 AnocforAY052780 7 7 5 5 0 0 2 0 0 3 0 2 2 2 2 0 0 2 0 ======Continued

378 Appendix D. continued ======58 59 60 61 62 63 64 65 66 67 68 69 70 71 72 73 74 75 76 ======

83 G99 Anoectochilu 7 7 5 5 0 0 2 0 0 3 0 2 2 2 2 0 0 2 0 84 MaclewiiG96 7 7 5 5 0 0 2 0 0 3 0 2 2 2 2 0 0 2 0 85 McdessanG125 9 9 7 7 2 2 4 2 2 8 2 4 4 4 4 2 2 4 2 86 AnoesetaceusG78 12 12 10 10 5 5 7 5 5 11 5 7 7 7 7 5 5 7 7 87 BlacepiG124 15 15 15 13 6 6 10 6 6 14 6 8 8 8 6 5 5 8 7 88MacsandG77 9 9 9 9 2 2 0 0 0 5 2 0 0 0 0 0 0 0 1 89HetcrisG47 11 11 11 11 4 4 2 0 0 2 0 1 0 0 0 1 1 0 0 ======Continued

379 Appendix D. continued ======77 78 79 80 81 82 83 84 85 86 87 88 89 ======77 LuddisAJ539483 - 78 LudnigrG66 0 - 79 Zeuxine strateum 0 0 - 80 G182 Pristiglott 0 0 0 - 81 AnoebrevG67 0 0 0 1 - 82 AnocforAY052780 0 0 0 1 0 - 83 G99 Anoectochilu 0 0 0 1 0 0 - 84 MaclewiiG96 0 0 0 1 0 0 0 - 85 McdessanG125 2 2 2 3 2 2 2 2 - 86 AnoesetaceusG78 5 5 5 6 5 5 7 7 0 - 87 BlacepiG124 6 6 6 7 4 4 4 4 4 0 - 88MacsandG77 0 0 0 0 0 0 0 0 4 810 - 89HetcrisG47 0 0 0 1 2 2 2 2 4 710 0 - ======

380 Appendix E. Adam consensus generated from ITS data sets

/------Manniella gustav | +------Manniella cyprip | | /------Pterichishabena | | | /------+ /----Prescottiaaff. | | \---+ | | \----Prescottiaplant | | | | /----Cranichiscillil | +------+ | /---+ \----Cranichisciliil | | | | || /----G126Sarcog | ||/------+ | ||| \----CyclinG127 | | | | | | \---+ /------SpirspirAF348064 | /------+ | | | | | \--+ /----SpircerAF301444 | | | \---+ | | | \----G152Spiranthesod | | | | | | /------Gomphichisbotot | | | | | | \------+ /----Stenopteraecuad | | \---+ || \----Stenopteraperuv | | | | /------GALEOTTIELLA SAR | | | ||| /----Pachyplectronar | | | /------+ | || | \----Pachyplectronari | | | | | | | | /------GproYkwJpn

Continued

381 Appendix E. continued

| | | | | ||| | | /----GcarG103 | | | | | /------+ | || | /---+| \----LigeophilaG88 | | | | | | | | || | | || /----LepisceptAF34803 | | | | | \--+ /------+ | || | | | | \----G90Hyllophylla | | | | | | | | | | | | \---+ /------PlatypolyAJ53952 | | | | | | | | | | | | \---+ /------GclavG44 | | | | | | | | || | | \---+/------GviriMkAU | | | | | | | | || | | \--+ /----GfumThai ||| | /---+ \---+ \---+| | | | \----GpolygoMkAu | | | | | | | | | | /------GoodyerabifidaI | | | | | | || | | | +------GbifiG55 | | | | | | | | | | | /---+------GfolvarmaxiYkwJp | | | | | | | | | | | | | | /------GdveluAF366898 | | | | | | | | || | | | | \--+ /----GvelutYkwJpn || | || | \---+ | | | | \------+ \----GmaxiAF366895 | | | | | || | | | /----GhachiYkwJpn | | | | | /---+ || | | | | \----GoHOC474G63 | | /---+ | | | | | | | | \------+------GmacrAF366894 | | | | | | || | | | | /----GhisRedKRI | | | | | \---+ || | |/---+ \----Gdhispwhite | | | | | | || |||| /----GdaibG98 || |||| /---+ || | || | | \----GdschlecMkAU

Continued 382 Appendix E. continued

| | | | | | | || | || | | /----AnoelanceG70 || |||| /--+| || | || | || +----GschlecYkwJpn | | | | | | | | | || | || | |\---+----GrotaG132 | | | | | | | | | | | | | +------+ +---- GschlecAF366897 \--+ | | | | | | | | || | | \----GrepeAF3666896 | | | | | | | | | | | \------GpubAJ539519 | | | | | | | || | /----GtesseG149 | | | | +------+ | | || | \----GdrepMenIndia | | | | | | | | | \------GoblongMarkAu | | | | | | || /----CysJohncolG65 | | || /------+ | | || | \----CysstenoG76 | | | | | | | | | | /------AnoebrevG67 | | | | /---+ | | | | | | | +------AnocforAY052780 | | | | | | | | | \--+ | \---+ /----G99Anoectochilu | | | | |/------+ | | | | | | \----MaclewiiG96 | | | | | | | | | /------+ \---+ /------McdessanG125 | | | | | | | | | | | | \--+ /----AnoesetaceusG78 | | | | | \---+ | | | | | \----BlacepiG124 | | | | | | /---+ | | | /----G180Mymerchisg | | | | | \------+ ||| | | \----GclaKRI

Continued

383 Appendix E. continued

| | | | | | | | | | /------G153Cheirostyli | | | | | | | | | | | /---+ /------ZeuviriG57 | | | | | | | | | | | | /---+ | \--+ /----ZeuobloAF348073 ||| ||| | \---+ | | | | | | /---+ \----G80Zeuxinegracil | | | | | | | | | | | | | | | | /----HetobloG51 | | | | | | /---+ \------+ | | | | | | | | \----HetoblMkAU | | | | | | | | | | | | | | /--+ \------GvitatG62 | | | | | | | | | | | | | | | \------HetcrisG47 | | | | | | | | | | | | | | /----DosmarmDMA539521 ||| ||\---+ /---+ | | | \---+ | | \----MacsandG77 | | | | | | | | | | | | /----AnoecgreenG68 | | | | | | | | | | | \------+---+---- LuddisAJ539483 | | | | | | | | | | | \----LudnigrG66 \---+ | | | | | | | /----Zeuxinestrateum | | | \---+ | | | \----G182Pristiglott | | | | | | /----HerpyrubG97 | | \------+ | | \----Herpysmalongicau | | || /----GavilealuteaA | | /---+ | | | \----GavilealuteaA | | /--+ | | || /----Chloraeamagella | | | \---+ | | /---+ \----Chloraeamagella

Continued 384 Appendix E. continued

| | | | | | | \------Chloraeaviresce | \------+ | | /------Pterostylisdain | | | | \---+ /------Pterostyliscucu | | | | \--+ /----Pterostylisbank | \---+ | \----AY134622Pterosty | | /----Megastylisgland \------+ \---- Megastylis gland

385 Appendix F. Majority rule tree generated from ITS data sets

/------Manniella gustav(1) | +------Manniella cyprip(2) | | /------Pterichishabena(3) | | | | /---Cranichiscillil(4) | /68+ 100+ | |||\---Cranichisciliil(5) | | \68+ | | |/---Prescottiaaff.(6) | | 100+ | | \---Prescottiaplant(7) | /100+ | || /---G126Sarcog(11) | | | /-100-+ | | || \---CyclinG127(12) | | | | | | 100+ /------SpirspirAF348064(13) | | | | | /------100------+ 100+ /--- SpircerAF301444(14) | | | 100+ || | \---G152Spiranthesod(15) | | | || | /------Gomphichisbotot(8) | | | | | | \---100---+ /---Stenopteraecuad(9) | | 100+ || \---Stenopteraperuv(10) | | | | /------GALEOTTIELLA SAR(16) | | | ||| /---Pachyplectronar(17) | | | /------100------+ ||| | \---Pachyplectronari(18) | | | | | | | | /------GproYkwJpn(30)

Continued

386 Appendix F. continued

| | | | | ||| | | /---GcarG103(32) | | | | | /------100------+ || | | 100+ | \---LigeophilaG88(33) | | | | | | | ||| | ||| /---LepisceptAF34803(34) | | | | | 100+ /----100-----+ ||| | | || \---G90Hyllophylla(35) | | | | | | | | | | | | 100+ /------PlatypolyAJ53952(36) | | | | | | | | | | | | \100+ /------GclavG44(37) | | | | | | | | | | | | 100+ /------GviriMkAU(38) | | | | | | | ||| | | 100+/---GfumThai(39) ||| | 100+ 100+ ||| | || \---GpolygoMkAu(40) 100+ | | | | | | | | | /------GoodyerabifidaI(51) | | | | | | | | | | | +------GbifiG55(52) | | | | | | | | | | | 100+------GfolvarmaxiYkwJp(53) | | | | | | | | | | | | | | /------GdveluAF366898(54) | | | | | | | | | | | | | | 100+ /---GvelutYkwJpn(55) | | | | | | 100+ | | | | \----100-----+ \---GmaxiAF366895(56) | | | | | || | | | /---GhachiYkwJpn(57) | | | | | 100+ || | | | |\---GoHOC474G63(58) | | | /51+ | | | | | | | \-100-+------GmacrAF366894(59) | | | | | | || | || |/---GhisRedKRI(60) || /100+ || 100+ || | | || \---Gdhispwhite(61)

Continued

387 Appendix F. continued

| | | | | | || | | || /---GdaibG98(31) | | | | | | 100+ || | | || |\---GdschlecMkAU(45) | | | | | | | || | | || |/---AnoelanceG70(46) || || /63+| 100+| | | | | | | | | | +---GschlecYkwJpn(47) | | | | | | | | | | | | | | | | | | 100+---GrotaG132(48) | | | | | | | | | | | | | | | \------58------+ +--- GschlecAF366897(49) 100+ | | | | | | | | | || | \---GrepeAF3666896(50) | | | 100+ | | | | | | | | \------GpubAJ539519(44) | | | | | | | | |||| /---GtesseG149(41) | | | | | \------100------+ | | ||| \---GdrepMenIndia(42) | | | | | | | | | \------GoblongMarkAu(43) | | | | | | || /---CysJohncolG65(62) | | | | /------100------+ | | || | \---CysstenoG76(63) | | | | | | | | | | /------AnoebrevG67(81) | | | | | | | | | | | | /---G99Anoectochilu(83) | | | | 100+ /51-+ /-100-+ | | | | | | | | | \---MaclewiiG96(84) | | | | | | | | | | | | | | | | 100+ /------McdessanG125(85) | | | | | | | | | | | | | | 100+ 100+ /---AnoesetaceusG78(86) | ||| 100+ | 100+ | | || || | \---BlacepiG124(87) | | | | | | | | | 100+ | | \------AnocforAY052780(82) | | | | | | | | || /---G180Mymerchisg(73) | | | | \------100------+ |100+ | | \---GclaKRI(74)

Continued 388 Appendix F. continued

| | | | | | | | | | /------G153Cheirostyli(64) | | | | | | | | | | | 100+ /------ZeuviriG57(69) | | | | | | | | | | | | 100+ | 100+ /---ZeuobloAF348073(70) ||| | || | 100+ | | | | | | /100+ \---G80Zeuxinegracil(71) | | | | | | | | ||| | || | | /---HetobloG51(65) | | | | | | 100+ \--100---+ ||| | || || \---HetoblMkAU(66) | | | | | | | | | | | | | | 100+ \------GvitatG62(68) | | | | | | | | | | | | | | | \------HetcrisG47(89) | | | | | | | | | | | | | | /---DosmarmDMA539521(75) ||| | |100+ 100+ | | | \--100---+ | | \---MacsandG77(88) | | | | | | ||| | | |/---AnoecgreenG68(76) | | | | | | | | | | | \------100------100+--- LuddisAJ539483(77) | | | | | | ||| | |\---LudnigrG66(78) | | | | | 100+ | | | /---Zeuxinestrateum(79) | | | 100+ || | \---G182Pristiglott(80) | | | || | /---HerpyrubG97(67) | | \------100------+ || \---Herpysmalongicau(72) | | || /---GavilealuteaA(21) | | 100+ || |\---GavilealuteaA(22) | | 100+ Continued 389 Appendix F. continued

|| ||/---Chloraeamagella(23) | | | 100+ | | 100+ \---Chloraeamagella(24) | | | | | | | \------Chloraeaviresce(25) | \------100------+ | | /------Pterostylisdain(26) | | | | 100+ /------Pterostyliscucu(27) | | | | 100+ /---Pterostylisbank(28) | 100+ | \---AY134622Pterosty(29) | | /---Megastylisgland(19) \------100------+ \--- Megastylis gland(20)

390 Appendix G. Semi-strict consensus generated from ITS data sets

/------Manniella gustav(1) | +------Manniella cyprip(2) | | /------Pterichishabena(3) | | | | /----Cranichiscillil(4) | +---100---+ | | \----Cranichisciliil(5) | | | | /----Prescottiaaff.(6) | /100+---100---+ | | | \----Prescottiaplant(7) | | | | | | /----G126Sarcog(11) | ||/-100--+ | | || \----CyclinG127(12) | | | | | | 100+ /------SpirspirAF348064(13) | /------100------+ | | | | | \100+ /----SpircerAF301444(14) | | | 100+ || | \----G152Spiranthesod(15) | | | || | /------Gomphichisbotot(8) | | | | | | \---100----+ /----Stenopteraecuad(9) | | 100+ || \----Stenopteraperuv(10) | | | | /------GALEOTTIELLA SAR(16) | | | || | /----Pachyplectronar(17) | | | /------100------+ || | | \----Pachyplectronari(18) | | | | | | | | /------GproYkwJpn(30)

Continued

391 Appendix G. continued | | | | | || | | | /----GcarG103(32) | | | | | /------100------+ | | | | 100+ | \----LigeophilaG88(33) | | | | | | | | | | | | | | /----LepisceptAF34803(34) | | | | | \100+ /-----100-----+ || | | | || \----G90Hyllophylla(35) | | | | | | | | | | | | 100+ /------PlatypolyAJ53952(36) | | | | | | | | | | | | \100+ /------GclavG44(37) | | | | | | | | | | | | 100+ /------GviriMkAU(38) | | | | | | | || | | | \100+/----GfumThai(39) ||| | /100+ 100+ 100+ | | | | \----GpolygoMkAu(40) | | | | | | | | | | /------GoodyerabifidaI(51) | | | | | | | | | | | +------GbifiG55(52) | | | | | | | | | | | 100+------GfolvarmaxiYkwJp(53) | | | | | | | | | | | | | | /------GdveluAF366898(54) | | | | | | | | | | | | | | \100+ /----GvelutYkwJpn(55) | | | | | | 100+ | | | | \-----100-----+ \----GmaxiAF366895(56) | | | | | | | | | | /----GhachiYkwJpn(57) | | | | | 100+ | | | | | |\----GoHOC474G63(58) | | 100+ | | | | | | | | \-100--+------GmacrAF366894(59) | | | | | | | | || | |/----GhisRedKRI(60) | | | | | 100+ | | | | 100+ \----Gdhispwhite(61) | | | | | | | | || || /----GdaibG98(31) | | | | | | 100+ | | || || |\----GdschlecMkAU(45)

Continued

392 Appendix G. continued

| | | | | | | | | || || |/----AnoelanceG70(46) | | | | | +------100------+ | | | | | | | | +----GschlecYkwJpn(47) | | | | | | | | | | || || 100+----GrotaG132(48) | | | | | | | | | | | | | +----GschlecAF366897(49) \100+ | | | | | | | | | | \----GrepeAF3666896(50) | | | | | | || || /----GtesseG149(41) | | | | +------100------+ | || || \----GdrepMenIndia(42) | | | | | | | | | +------GoblongMarkAu(43) | | | | | | | | | \------GpubAJ539519(44) | | | | | || | /----CysJohncolG65(62) | | | | /-----100-----+ | || | | \----CysstenoG76(63) | | | | | | | | | | /------AnoebrevG67(81) | | | | 100+ | | | | | | | +------AnocforAY052780(82) | | | | | | | | | \100+ | \100+ /----G99Anoectochilu(83) | | | | |/-100--+ | | | | || \----MaclewiiG96(84) | | | | | | | | | /-100--+ 100+ /------McdessanG125(85) | | | | | | | | | | | | \100+ /----AnoesetaceusG78(86) | | | | | 100+ | | | | | \----BlacepiG124(87) | | | | | | /100+ | | | /----G180Mymerchisg(73) | | | | | \------100------+ || | | | \----GclaKRI(74) | | | | | | | | | | /------G153Cheirostyli(64) | | | | | | | | | | | 100+ /------ZeuviriG57(69) Continued

393 Appendix G. continued

| | | | | | | | | | | | /100+ | \100+ /----ZeuobloAF348073(70) ||| ||| | 100+ | | | | | | /100+ \----G80Zeuxinegracil(71) | | | | | | | | | | | | | | | | /----HetobloG51(65) | | | | | | 100+ \---100---+ | | | | | | | | \----HetoblMkAU(66) | | | | | | | | | | | | | | /100+ \------GvitatG62(68) | | | | | | | | | | | | | | | \------HetcrisG47(89) | | | | | | | | | | | | | | /----DosmarmDMA539521(75) ||| ||100+ 100+ | | | 100+ | | \----MacsandG77(88) | | | | | | | | | | | | /----AnoecgreenG68(76) | | | | | | | | | | | \------100------100+---- LuddisAJ539483(77) | | | | | | || | | |\----LudnigrG66(78) 100+ | | | | | | | /----Zeuxinestrateum(79) | | | 100+ | | | \----G182Pristiglott(80) | | | | | | /----HerpyrubG97(67) | | \------100------+ | | \----Herpysmalongicau(72) | | | | /----GavilealuteaA(21) | | 100+ | | |\----GavilealuteaA(22) | | /100+ | | | | /----Chloraeamagella(23) | | | 100+ | | 100+ \----Chloraeamagella(24) | | | | | | | \------Chloraeaviresce(25) | \------100------+

Continued

394 Appendix G. continued

| | /------Pterostylisdain(26) | | | | 100+ /------Pterostyliscucu(27) | | | | \100+ /----Pterostylisbank(28) | 100+ | \----AY134622Pterosty(29) | | /----Megastylisgland(19) \------100------+ \---- Megastylis gland(20)

395 Appendix H. trnL-F pairwise sequence divergence between genera and within genera by the exclusion or inclusion of the out-groups.

======1 2 3 4 5 6 7 8 9101112 13 14 ======1 G 126 Sarcoglott - 2 AJ544529 Sacoila 1 - 3 AY363055 Spirant 6 7 - 4 G67 Anoectochilu 26 17 15 - 5 G87 Anoetochilus 28 19 16 0 - 6 G123 Anoectochil 28 19 15 0 0 - 7 G102 Dossiniamor 28 19 15 0 0 0 - 8 G69 Anoectochilu 28 19 15 0 0 0 0 - 9 G96 Macodeslewii 28 21 17 0 0 0 0 0 - 10 G89 Anoectochilu 31 20 16 0 0 0 0 0 0 - 11 G125 Macodesandr 28 19 15 0 0 0 0 0 0 0 - 12 G68 Anoectochilu 21 16 12 5 8 8 8 8 10 9 8 - 13 G71 Ludisiadisco 23 18 18 11 11 11 11 11 13 12 11 0 - 14 G66 Ludisianigre 19 16 11 5 7 7 7 7 9 8 7 0 2 - 15 G124 Blackepiphi 25 18 16 0 0 0 0 0 2 1 0 6 9 7 16 G78 Anoectochilu 16 13 7 0 0 0 0 0 2 1 0 3 7 1 17 G47 Hetaeriacris 16 13 7 0 0 0 0 0 2 1 0 3 7 1 18 G204TRNLRhomboda 23 21 20 7 9 9 9 9 11 10 9 6 11 4 19 G107 Vrydagzynea 18 18 18 6 6 6 6 6 8 7 6 2 7 2 20 G79 Vrydagzynea 16 11 9 4 4 4 4 4 6 5 4 0 4 0 21 G65 CystorcchisJ 18 14 8 5 7 7 7 7 9 8 7 4 7 4 ======Continued

396 Appendix H. continued. ======1 2 3 4 5 6 7 8 9101112 13 14 ======22 G51 Hetaeriaoblo 17 15 12 7 9 9 9 9 11 10 9 4 7 4 23 G97 Herpysmarube 14 11 6 3 5 5 5 5 7 6 5 2 6 2 24 G45 G.pubescens 19 12 13 17 15 15 15 15 17 20 15 10 13 10 25 GVI409417 Goodye 16 12 13 14 14 14 14 14 16 15 14 10 14 8 26 G529 Plactyplect 7 4 4 16 16 16 16 16 16 17 16 7 10 5 27 G182 Pristiglott 20 19 14 6 8 8 8 8 10 9 8 0 3 0 28 GVI409416 Gonato 12 10 4 10 10 10 10 10 12 11 10 4 7 4 29 G73 Goodyera rep 14 9 8 12 12 12 12 12 14 13 12 8 12 6 30 G62 Goodyera vit 19 15 11 6 8 8 8 8 10 9 8 6 10 5 31AJ409459Zeuxine 20 15 13 6 8 8 8 8 9 9 8 6 11 4 32 G214Zeuxineoblon 21 16 14 8 10 10 10 10 11 11 10 7 12 5 33 G57 Zeuxinevirid 29 23 16 12 14 14 14 14 16 15 14 11 14 9 34 ZST409458 Zeuxin 22 16 16 12 14 14 14 14 16 15 14 9 13 9 35 G70 Anoectochilu 15 10 8 14 13 13 13 13 15 14 13 10 14 10 36 G95 Goodyeracfsc 14 10 8 14 13 13 13 13 15 14 13 10 14 10 37 G98 G.daibucanen 14 10 8 16 15 15 15 15 17 16 15 10 14 10 38 G132 G.rotabunen 14 10 8 14 13 13 13 13 15 14 13 10 14 10 39 G151 G.dalhousia 14 10 9 14 13 13 13 13 15 14 13 10 14 10 40 G114 Goodyeraobl 14 10 8 11 10 10 10 10 11 11 10 7 11 6 41 G149 G.tesselata 14 10 8 11 10 10 10 10 11 11 10 7 11 6 42 G55 Goodyerabifi 16 14 13 15 15 15 15 15 17 16 15 11 12 11 ======Continued

397 Appendix H. continued ======1 2 3 4 5 6 7 8 9101112 13 14 ======

43 G103 Goodyeracar 16 15 13 12 12 12 12 12 14 13 12 10 12 10 44 G63 GoodyeraHOC 17 15 12 11 11 11 11 11 13 12 11 9 12 10 45 G162TRNLGoodyera 18 16 11 12 12 12 12 12 14 13 12 10 13 10 46 G178Gprocera 16 14 9 13 13 13 13 13 15 14 13 11 14 11 47 G88 Ligophylla T 18 15 11 16 14 14 14 14 16 15 14 11 14 11 48 G44 G.clavata 15 13 8 12 14 14 14 14 16 15 14 9 13 9 ======Continued

398 Appendix H. continued ======15 16 17 18 19 20 21 22 23 24 25 26 27 28 ======15 G124 Blackepiphi - 16 G78 Anoectochilu 0 - 17 G47 Hetaeriacris 0 0 - 18 G204TRNLRhomboda 7 6 6 - 19 G107 Vrydagzynea 8 5 5 0 - 20 G79 Vrydagzynea 6 1 1 0 0 - 21 G65 CystorcchisJ 7 1 1 4 2 0 - 22 G51 Hetaeriaoblo 9 1 1 6 4 0 0 - 23 G97 Herpysmarube 5 1 1 6 4 0 0 0 - 24 G45 G.pubescens 15 10 10 13 11 7 9 10 5 - 25 GVI409417 Goodye 14 10 10 13 11 7 9 10 5 0 - 26 G529 Plactyplect 14 7 7 12 9 4 2 6 2 12 12 - 27 G182 Pristiglott 8 2 2 8 6 3 5 7 3 10 10 7 - 28GVI409416Gonato 12 3 3 6 6 2 2 4 0 4 4 4 7 - 29G73Goodyerarep 12 9 9 11 9 5 3 8 3 0 0 7 8 5 30 G62 Goodyera vit 8 4 4 8 6 5 3 4 3 9 9 8 7 3 31AJ409459Zeuxine 6 3 3 20 3 0 1 1 0 9 9 8 5 1 32 G214Zeuxineoblon 8 4 4 21 4 1 2 2 1 10 10 9 6 2 33 G57 Zeuxinevirid 12 8 8 17 9 5 9 10 7 15 15 8 9 7 34ZST409458Zeuxin 15 5 5 15 7 3 7 9 7 12 12 9 7 4 35 G70 Anoectochilu 14 10 10 12 11 9 9 10 7 6 4 4 10 5 36 G95 Goodyeracfsc 14 10 10 11 11 9 8 10 7 4 4 4 10 5 37 G98 G.daibucanen 16 10 10 11 11 9 8 10 7 3 3 5 10 5 38 G132 G.rotabunen 14 10 10 11 11 9 8 10 7 2 2 4 10 5 ======Continued

399 Appendix H. continued. ======15 16 17 18 19 20 21 22 23 24 25 26 27 28 ======

39 G151 G.dalhousia 14 10 10 11 11 9 8 10 7 4 4 6 10 5 40 G114 Goodyeraobl 10 7 7 17 9 5 4 6 3 5 5 3 10 2 41 G149 G.tesselata 10 7 7 17 9 5 4 6 3 5 5 3 10 2 42 G55 Goodyerabifi 17 12 12 16 15 11 9 11 9 10 10 9 14 9 43 G103 Goodyeracar 14 11 11 13 15 8 6 9 6 5 5 5 11 6 44 G63 GoodyeraHOC 13 9 9 12 12 8 7 10 6 5 5 4 12 7 45 G162TRNLGoodyera 14 9 9 12 12 8 8 11 6 5 5 4 13 8 46 G178Gprocera 15 10 10 13 13 9 11 13 7 6 6 5 14 9 47 G88 Ligophylla T 16 10 10 16 15 10 12 12 8 7 7 5 17 9 48 G44 G.clavata 14 8 8 13 11 7 7 10 7 4 4 1 12 7 ======Continued

400 Appendix H. continued. ======29 30 31 32 33 34 35 36 37 38 39 40 41 42 ======29 G73 Goodyera rep - 30 G62 Goodyera vit 7 - 31 AJ409459 Zeuxine 8 0 - 32 G214Zeuxineoblon 9 0 0 - 33 G57 Zeuxinevirid 11 0 1 1 - 34 ZST409458 Zeuxin 10 1 7 9 0 - 35 G70 Anoectochilu 4 11 10 11 10 9 - 36 G95 Goodyeracfsc 4 10 9 10 10 9 0 - 37 G98 G.daibucanen 4 10 9 10 10 10 0 0 - 38 G132 G.rotabunen 4 10 9 10 10 9 0 0 0 - 39 G151 G.dalhousia 4 11 9 10 12 13 0 0 2 0 - 40 G114 Goodyeraobl 1 8 6 7 6 6 5 2 0 0 0 - 41 G149 G.tesselata 1 8 6 7 6 6 5 2 0 0 0 0 - 42 G55 Goodyerabifi 6 13 10 11 12 11 10 10 10 10 10 6 6 - 43 G103 Goodyeracar 7 10 10 11 9 12 5 3 3 3 4 3 3 7 44 G63 GoodyeraHOC 3 11 11 14 12 16 7 7 7 7 7 3 3 1 45 G162TRNLGoodyera 3 10 14 17 16 18 7 7 7 7 7 3 3 3 46 G178Gprocera 5 11 9 10 13 11 10 8 8 8 8 4 4 3 47 G88 Ligophylla T 6 12 10 11 15 14 10 8 8 8 9 6 6 2 48 G44 G.clavata 3 12 10 11 12 11 4 3 4 3 4 3 3 9 ======Continued

401 Appendix H. continued. ======43 44 45 46 47 48 ======43 G103 Goodyeracar - 44 G63 GoodyeraHOC 5 - 45 G162TRNLGoodyera 5 0 - 46 G178Gprocera 6 2 4 - 47 G88 Ligophylla T 5 1 2 0 - 48 G44 G.clavata 0 5 5 6 5 - ======

402 Appendix I. rpl16 pairwise sequence divergence between genera and within genera by the exclusion or inclusion of the out-groups

======1 2 3 4 5 6 7 8 9101112 13 14 15 16 17 18 19 ======1 G127 Cyclopogon - 2 G152 Spiranthes 8 - 3 G529 Plactyplect 19 18 - 4 G63 Goodyera HOC 52 44 34 - 5 G162 Goodyera pu 53 43 37 0 - 6 G86 Goodyera pus 65 52 39 0 0 - 7 G163 Goodyera pr 57 46 38 0 2 5 - 8 G107 Vrydagzynea 41 42 24 6 10 11 12 - 9 G79 Vrydagzynea 43 47 27 8 9 11 12 0 - 10 G153 Cheirostyli 54 43 33 26 25 39 35 24 28 - 11 G154 Cheirostyli 51 42 32 24 26 38 36 23 26 0 - 12 G50 Hetaeria obl 39 34 18 13 13 25 17 11 11 3 4 - 13 G65 Cystorchis R 37 33 18 29 29 44 35 35 35 21 21 32 - 14 G57 Zeuxine viri 55 54 35 31 32 40 38 22 22 16 15 0 45 - 15 G71 Ludisia disc 45 47 35 16 16 19 16 11 14 29 29 19 35 32 - 16 G68 Anoectochilu 47 49 36 17 17 20 19 14 16 31 31 22 40 35 0 - 17 G102 Dossinia mo 42 42 29 8 8 11 11 8 9 28 28 13 34 28 1 0 - 18 G164 Hetaeria cr 48 46 31 12 14 14 15 13 14 28 31 16 36 33 15 17 15 - 19 G43Goodyera bifi 46 39 28 9 8 11 11 8 9 24 23 13 31 30 4 2 0 0 - 20 G100 Rhomboda 49 41 35 16 15 18 17 15 16 28 28 20 38 37 11 11 5 0 0 21 G89 Anoectochilu 46 43 29 8 8 11 12 8 9 24 23 13 32 32 6 4 4 9 0 22 G96 Macodes lewi 44 39 29 10 10 13 12 8 9 24 23 13 32 32 4 2 2 5 0 23 G124 Blackepifit 50 39 39 13 13 16 15 16 15 25 24 16 36 39 6 6 2 5 0 ======Continued

403 Appendix I. continued ======1 2 3 4 5 6 7 8 9101112 13 14 15 16 17 18 19 ======24 G123 Anoectochil 50 39 39 13 13 16 15 16 15 25 24 16 36 39 6 6 2 5 0 25 G101 Anoectochil 48 40 35 11 11 14 13 13 13 25 24 14 33 36 5 3 3 6 1 26 G78 Anoectochilu 48 46 35 13 13 16 15 13 15 29 28 16 36 36 15 14 15 17 5 27 G67 Anoectochilu 52 45 38 17 15 18 18 17 19 32 31 18 37 40 13 9 13 20 9 28 G99 Anoectochilu 52 41 37 12 12 15 14 15 15 25 24 15 34 39 6 4 2 5 0 29 G125 Macodesandr 46 39 33 11 11 14 15 11 11 25 24 16 36 34 6 6 2 5 0 30 G134 Zeuxine obl 54 42 34 30 32 37 36 26 27 6 6 6 29 14 28 31 27 33 28 31 G80 Zeuxine grac 51 40 35 30 30 37 36 25 28 4 4 6 31 13 28 33 25 30 25 32 G97 Herpysma rub 44 34 28 28 28 35 34 21 20 2 2 2 25 9 26 31 23 27 20 33 G62 Goodyera vit 44 34 28 28 28 35 34 21 20 2 2 2 25 9 26 31 23 27 20 34 G182 Pristiglott 43 38 32 11 15 15 13 6 7 24 26 14 31 31 11 12 7 10 6 35 G180 Mymerchis g 40 36 29 9 15 13 12 5 5 23 26 13 32 33 9 11 1 8 2 36 G189 Herpysma lo 38 32 27 9 11 13 11 3 4 20 21 11 27 26 10 10 1 5 1 37 G73 Goodyera rep 55 48 38 6 6 7 5 10 13 29 28 14 37 38 16 16 9 10 5 38 G45 Goodyera pub 46 43 34 2 4 3 1 10 9 21 20 11 30 32 14 16 9 13 8 39 G95 Goodyera sch 59 52 44 14 14 16 10 12 17 33 32 27 36 38 23 24 16 19 16 40 G64 Goodyera rot 59 51 44 13 13 15 9 12 17 32 31 26 37 38 23 24 15 20 17 41 G132 Goodyera ro 56 49 39 11 11 13 7 9 12 30 29 24 33 35 21 22 13 16 13 42 G98 Goodyera dai 53 48 38 9 9 11 6 9 12 28 27 19 35 33 21 21 15 20 15 43 G118 Goodyera ob 55 45 40 1 1 2 1 11 13 27 26 13 30 34 16 19 16 16 7 ======Continued

404 Appendix I. continued ======1 2 3 4 5 6 7 8 9101112 13 14 15 16 17 18 19 ======44 G157 Lepidogyne 47 44 35 5 8 9 3 9 9 27 24 14 28 32 17 19 11 13 11 45 G90 Hyllophyllam 47 43 35 4 5 10 5 9 9 24 23 15 34 34 15 17 11 14 9 46 G60 Goodyera fum 42 39 32 5 5 8 5 6 7 22 21 12 28 29 15 17 11 12 9 47 G44 Goodvera cla 46 40 36 6 6 9 6 11 14 24 23 14 30 34 17 19 13 14 11 48 G103 Goodyera ca 49 46 34 6 6 9 8 10 11 24 23 18 32 31 18 19 14 14 11 49 G88 Ligophylla 57 50 37 10 10 13 8 11 12 32 31 12 33 37 21 20 17 21 18 ======Continued

405 Appendix I. continued ======20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 ======20 G100 Rhomboda - 21 G89 Anoectochilu 3 - 22 G96 Macodes lewi 3 0 - 23 G124 Blackepifit 7 0 0 - 24 G123 Anoectochil 7 0 0 0 - 25 G101 Anoectochil 4 1 1 1 1 - 26 G78 Anoectochilu 6 3 3 1 1 0 - 27 G67 Anoectochilu 10 9 5 1 1 0 0 - 28 G99 Anoectochilu 5 0 0 0 0 1 0 5 - 29 G125 Macodesandr 7 0 0 4 4 1 3 5 2 - 30 G134 Zeuxine obl 33 33 31 34 34 34 36 38 35 32 - 31 G80 Zeuxine grac 32 29 28 33 33 31 33 35 32 31 0 - 32 G97 Herpysma rub 27 22 21 26 26 24 28 28 25 24 0 0 - 33 G62 Goodyera vit 27 22 21 26 26 24 28 28 25 24 0 0 0 - 34 G182 Pristiglott 11 6 6 7 7 7 12 13 8 7 29 27 25 25 - 35 G180 Mymerchis g 9 2 2 5 5 3 5 7 4 5 30 30 28 28 0 - 36 G189 Herpysma lo 8 1 1 4 4 2 4 6 3 4 23 23 21 21 0 0 - 37 G73 Goodyera rep 14 8 8 11 11 9 11 13 10 11 29 29 27 27 11 9 9 - 38 G45 Goodyera pub 15 8 8 11 11 9 11 13 10 11 23 23 21 21 11 11 7 0 - 39 G95 Goodyera sch 23 16 15 18 18 16 19 18 17 18 33 35 31 31 21 20 18 10 6 40 G64 Goodyera rot 24 16 15 18 18 16 18 20 17 18 32 34 30 30 20 19 17 9 5 41 G132 Goodyera ro 20 14 13 16 16 14 16 18 15 16 30 30 28 28 18 17 15 7 3 42 G98 Goodyera dai 20 15 15 18 18 16 18 22 17 18 30 30 26 26 16 14 14 5 1 43 G118 Goodyera ob 15 10 10 13 13 11 17 15 12 13 27 27 23 23 10 8 8 0 1 44 G157 Lepidogyne 18 11 11 14 14 12 15 16 13 14 28 28 26 26 15 13 11 9 9 45 G90 Hyllophyllam 16 12 11 14 14 12 15 16 13 15 30 30 24 24 11 9 9 7 6 ======Continued

406 Appendix I. continued ======20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 ======46 G60 Goodyera fum 16 9 11 12 12 10 13 14 11 12 24 24 22 22 10 8 8 4 4 47 G44 Goodvera cla 18 11 13 16 16 14 15 18 15 14 26 26 24 24 12 10 10 5 5 48 G103 Goodyera ca 18 11 11 14 14 12 15 16 13 14 31 31 25 25 12 10 10 6 4 49 G88 Ligophylla 20 15 15 17 17 18 21 22 18 15 33 30 26 26 18 12 11 12 6 ======Continued

407 Appendix I. continued ======39 40 41 42 43 44 45 46 47 48 49 ======39 G95 Goodyera sch - 40 G64 Goodyera rot 0 - 41 G132 Goodyera ro 0 2 - 42 G98 Goodyera dai 3 2 0 - 43 G118 Goodyera ob 2 2 0 0 - 44 G157 Lepidogyne 17 16 14 13 12 - 45 G90 Hyllophyllam 14 13 11 13 13 0 - 46 G60 Goodyera fum 12 11 9 9 5 1 0 - 47 G44 Goodvera cla 13 12 10 10 6 2 1 0 - 48 G103 Goodyera ca 15 14 12 12 11 2 0 1 2 - 49 G88 Ligophylla 15 14 12 14 9 3 1 1 2 0 - ======Continued

408 Appendix J. The ITS sequence data for fungi associated with the species from Goodyera section Goodyera including outgroups (collected both from field and GenBank). Complete sequences provided.

No Identity of the fungi Sequence

1. Goodyera oblongifolia CGTACAGGTT TCCGTAGGTG ACCTGCGGAA GGATCATTAT TGAAATGAAT CTAGAGTCGG TTGACGCTGG CCTCCTCCGG GGCAATGTGC WA, Pierce Co., July 2, ACGCCTTCTC TTTTTCATCC ACACACACCT GTGCATTTGT GAGACGGGAG GGTCTGTTTT 2005, ATTATGGACC TTTTCGTCTA TTAAACTACA CAAACTCATT TATTTTGAAC CGAATGTAAA C.F. Barret 55, TGATGTAACA CATCATTTAA AACAAAGTTT CAACAACGGA TCTCTTGGCT CTCGCATCGA TGAAGAACGC AGCGAAATGC GATAAGTAAT Rhizoctonia 92% GTGAATTGCA GAATTCAGTG AATCATCGAA TCTTTGAACG CACCTTGCGC TCCTTGGTAT similarity TCCTTGGAGC ATGCCTGTTT GAGTATCATG AAATTCTCAA AGCAAGCCTT TTGTTAATTC AATTGGTCTT CTTGCTTTGG ACTTGGAGGC TTGCAGATTT CACAGTCTGC TCCTCTTAAA TTCATTAGCT GGATCTCAGT ATATGCTCGG TACCGTCTCG GCGCGATAAA TATCACTCGA TGGAGGACAC TGTAAAGAGG TGGCCGGGAA ATGCCGACGA ACCGCTTCTA ATAGACTATT AAATTAAGAC AATACTCTTA AAGATCTGGA TCTCAAATCA AGGTAGGGACTACCCCGCTG AACTTAAAC 2. Goodyera oblongifolia TCCTGGTCAT TTAGGGGAAG TAAAAGTCGT AACAAGGTTT CCGTAGTGAA CCTGCGGAAG GATCATTGTC GAGACCCTAA AAGGAATGGA King Co., C.F. Barret 62, TTCCTTGGTC ACTAACGTGG AAGCAAAAGT CGTAGCATGG TTTCTGTAGG CGACCTGCGG Russulaceae 93% AAGGATCATT ATCGAATGAG TCAAGCGTCG ATTGTGAGCT GGCCCTCCGG GGCATCGTGC ACGCCTTCTC TTTCATCCAC ACACACCTGT GAACTCGTGA GACGGGAAGC CCATCGGGGC GGCCCGTCTG CCCTTATTAT AAACTCATAT ATTGTAAAAC GAATGTACAC GATGTAAACA CATCTTTAAA CTAAGTTTCA ACAACGGATC TCTTGGCTCT CGCATCGATG AAGAACGCAG CGAAATGCGA TAAGTAATGT GAATTGCAGA ATTCAGTGAA TCATCGAATC TTTGAACGCA CCTTGCGCTC CTTGGTATTC CTCGGAGCAT GCCTGTTTGA GTATCATGAA ATCCTCAAAG CAATACCTTT TGTTCATTCG ATCGGTTTTG TTTTGGACTT GGAGGTCTGC AGATTCACGT CTGCTCCTCT TAAATATATT AGCTGGATCT CGGTGAGCTC GGTTCCACTC GGCGTGATAA GTATCACTCG CTGAGGACAC TGTTAAAAAG GTGGCCGGGA TTGCAGACGA ACCGCTTCTA ATGGTCTATT AGATTAGACA AATCACTCTC ATGATTTGAT CTCAAATCAG GTAGGACTAC

409 CCGCTGAACT TAATCATACA ATTAAGGGGG AGGAAACCCG ATAATGTCGA AAGGTGGTGC CTTTGAAATG CGACCCCGGG ATGGGCGGGA TGACCCGCTG AGTTTAGCAT ATC 3. Goodyera oblongifolia, AGGGGAAGTA AAAGTCGTAA CAAGGTTTCC GTAGGTGAAC CTGCGGAAGG ATCATTATTG AATGAATGTA GAGTCGGTTG TCGCTGGTCC OR, Marion Co., C.F. TTTCGGGGAC ATGTGCACGC CTTCTCTTTC ATCCACACAC ACCTGTGCAC TCGTGAGACG Barret 60, Rhizoctonia GAAGCCCTCG GGCGTCCGTC TGCTCTACAT AAACTCATAT CTATAATTTG AATGTAATTG 97% ATGTAACACA TCTTTAAACT AAGTTTCAAC AACGGATCTC TTGGCTCTCG CATCGATGAA GAACGCAGCG AAATGCGATA AGTAATGTGA ATTGCAGAAT TCAGTGAATC ATCGAATCTT TGAACGCACC TTGCGCTCCT TGGTATTCCT TGGAGCATGC CTGTTTGAGT ATCATGAAAT TATCAAAATA ATTCTTTTGT TCATTCAATT GAATTTTATT TTGGACTTGG AGGTCTGCAG ATTCACGTCT GCTCCTTTTA AATATATTAG CTGGATCTCA GTGAGCTCGG TTCCACTCGG CGTGATAAGT ATCACTCGCT GAGGACACTG TAAAAGGTGG CCGGGATTGC GGATGAACCG CTTCTAATCG TCCATTTACT TGGACAACAA TACTTTATGA TCTGATCTCA AATCAGGTAG GACTACCCGC TGAACTTAAG CATATCAATA AGCGGAGGAA 4. Goodyera oblongifolia, GAAATGAATC TAGAGTCGGT NGTCGNTGGC CTCCTCCNGA GGCAATGTGC ACGCNTTNTC TTTTTCATCC ACACACACCT GTGCANATGT Michigan, .V. GAGACGGGAG GGTCTGTNTT NTTANGGNCC TTTTCGTNTA TTAAACTACA CAAACTCATG Freudenstein 2791, TATYCTGAAC TGTAAGTTGA CGATGTAACA CATCATTTAG GAACAAATGT TTCAACAACC Rhizoctonia 88% GGATACTGTT GGCTCTCGCA TCGATGAAGA ACGCAGCGAA TTGCGATAAG TAATGTGAAT TGCAGAATTC AGTGAATCAT CGAATCTTTG similarity, AACGCGCCTT GCGCTCCTTG GTATTCCTTG GAGCACGCCT GTTTGAGTAT CAAGAAATTC TCAAAGCAAG CCTTTTGTTA ATTCAATTGG TCTTCTTGCT TTGGACTTGG AGGCTTGCAC ATGTCACAGA TCTGCTCCTC TTCAATTCAT TAGCTGGATC TCAGTTATAT GCTCGGTTCC ACTCGGCGTG ATAAGTTATC ACTCGCTGAG GACACTGTAA AAGGTGGGCG GGGAAATGCA GGACGAACCG CTTCTAATAG TCTATTAAAT TACACAATAC TCTAAGATCT GATCTCAAAT CAGGGTAGGA CTACCCGCTG AACTTAAGCA TATCATTAAG CGGGAGGGGG GGGG

410 5. Hylophila Montana, CAAGGTCTCC GTTGGTGACC AGCGTAGGGA TCATTAAAGA GTTTTCTAAA CTCCCCACCC ATGTGAACTT ACCTTTTGTT GCCTCGGCAG Indonesia, West New AGGTTACCTG GTACCTGGAG ACAGGTTACC CTGTAGCAGC TGCCGGTGGA CTACTAAACT Guinea, Yapen Island, CTTGTTATTT TATGTAATCT GAGCGTCTTA TTTTAATAAG TCAAAACTTT CAACAACGGA Waipon Forest, TCTCTTGGTT CTGGCATCGA TGAAGAACGC AGCGAAATGC CATAAGTAAT GTGAATTGCA GAATTCAGTG AATCATCGAA TCTTTGAACG Pestalotiopsis thea 98% CACATTGCGC CCATTAGTAT TCTAGTGGGC ATGCCTGTTC GAGCGTCATT TCAACCCTTA AGCCTAGCTT AGTGTTGGGA ATTTACAGTT ATGTAATTCC TGAAATACAA CGGCGGATCT GTGGTATCCT CTGAGCGTAG TAAATTATTT CTCGCTTTTG TCAGGTGCTG CAGCTCTCAG CCGCTAAACC CCCAATTTTT TGTGGTTGAC CTCGGATCAG GTAGGAATAC CCGCTGAACT TAAGCATATC AGT 6. Orchid: Cystorchis TTCTTGGTCA TTTAGGAGAA GTAAAAGTCG TAACAAGGTT TCCGTAGGTG AACCTGCGGA AGGATCATTA ATGAATTTAA TGTGGAGTTG stenoglosa, Fungi: GTTGTAGCTG GTCCATTGGA TTTTTTAAAT AAATTCCTCT GGGCATGTGC ACACCTCCTC Rhizoctonia sp. 94% TTCCATCCAC ACACACCTGT GCACCTGTGA GGCAGATGTG GGGACTTAAT TGAACCCCTC TGTCTACTTA ATTCACACAA ACCCAATTTA TTATAAAATG AATGTAATTG ATGTAACGCA TCTAATACTA AGTTTCAACA ACGGATCTCT TGGCTCTCGC ATCGATGAAG AACGCAGCGA AATGCGATAA GTAATGTGAA TTGCAGAATT CAGTGAATCA TCGAATCTTT GAACGCACCT TGCGCTCCTT GGTATTCCTT GGAGCATGCC TGTTTGAGTA TCATGAAATC TTCAAAGTCA ATCTTTTGTT AATTCAACTG GTTGTACTTT TGTATTGGAG GTCTTGCAGC TTCACACCTG CTCCTCTTTG TGCATTAGCT GGATCTCAGT GTTATGCTTG GTTCCACTGG GCGTGATAAG TTATCTATCG CTGAGGACAC TGTAAAAGGT GGCCAAGGTA AATGCAGATG AACCGCTTCC AACAGTCCAT TGACTTGGAC AACACTTTTA TGATCTGATC TCAAAT 7. Goodyera bifida, LSJ 339, CATTTTAGAG GAAGTAAAAG TCGTAACAAG GTCTCCGTTG GTGAACCAGC GGAGGGATCA TTAAAGAGTT TTCATAACTC CTAAACCCAT Annulohypoxylon stygium GTGAACTTAC CTTCTGTTGC CTCGGCAGGT CGTGTCTACC CTGTGGTCAC CTACCCTGTA 92% GGTGACTACC TGGTAGTCAC GGGTTTGCCT GCCAGTGGCC CGTCAAAACA CTGTTTATTA CATGTTATTC TGATTTTGCA ACTAAATAAG TTAAAACTTT CAACAACGGA TCTCTTGGTT CTGGCATCGA TGAAGAACGC AGCGAAATGC GATAAGTAAT GTGAATTGCA GAATTCAGTG AATCATCGAA TCTTTGAACG CACATTGCGC CCATTAGTAT TCTAGTGGGC ATGCCTGTTC GAGCGTCATT TCAACCCTTA AGCCCCTGTT GCTTAGTGTT AGGAGCCTAC AGTCCTCTGT

411 AGCTCCCTAA AGTTAGTGGC GGAGTCGGTT TGCACTCTAG ACGTAGTAGC TTCTATCTCG TCTGTAGTTA GGCCGGTCTC TTGCCGTAAA ACCCCCTAAT TTTTAAGGTG ACCTCGGATC AGGTAGGAAT ACCCGCTGAA CTTAAGCATA TCAATTAAAG CGGGAGGAAA A 8. Goodyera velutina, LSJ CAATCAGGTC CCGTTGGTCC AGCGGGAGGG ATCATTAAAG AGTTCTATAA CTCCTTCACC CATGTGAACA TACCTTACGT TGCCTCGGCA 315, Xylaria sp., 96% GGTCGCGCCT ACCCCGTAGC CCCCTAACCC TGTAGGGCCT ACCCGGTAGA CGCGGGTAAG CCTGCCGGCG GCCCAAGAAA CTCTGTTTAG TATTGAATTC TGAACCTATA ACTAAATAAG TTAAAACTTT CAACAACGGA TCTCTTGGTT CTGGCATCGA TGAAGAACGC AGCGAAATGC GATAAGTAAT GTGAATTGCA GAATTCAGTG AATCATCGAA TCTTTGAACG CACATTGCGC CCATTAGTAT TCTAGTGGGC ATGCCTGTTC GAGCGTCATT TCAACCCTTA AGCCTCTGTT GCTTAGTGTT GGGAGCCTAC GGCACCCGTA GCTCCTCAAA GTTAGTGGCG GACTCGGTTC ACACTCTAGA CGTAGTAATT TTATCTCGCC CTTCAGTTGG ACCGGTCCCC GGCCGTAAAA CACCCCAATT TTTAAAGGTG ACCTCGGATC AGGTAGGAA 9. Goodyera reticulata, GAACCAGCGG GAGGATCATT AAAAAAGTTG GTTACAAGCT CCAAACCCAT GTGAACATAC CTACTGTTGC CTCGGCAGGT CGTGCTGCGC Lina Juswara 360, GGCATGATCG CCCCCCCTCG GGTTCAGCTG CTACAGGACT AGCTACCCTG TACCGGCTAC Biscogniauxia CCTGGAGTAG CTACCCTGGA GCAGCTGCTA CTGGACTAGC TACCCCCGTA GCAGCTGCCC atropunctata, 88% TGGAGCATCT ACCCCGTAGC GGGGGGGGGG AGCCCGCCCC GAAGCACTTG AACAGGCCTG CCGGAGGACC CCTAATCTCC ATTTTTACAC CTGTATCTCT GAGGCTATGA TGGAAATAAA TTAAAACTTT CAACAACGGA TCTCTTGGCT CTGGCATCAA TGAAAAACGC AGCGAAATGC GATAAGTAAT GTGAATTGCA GAATTCAGTG AATCATAGAA TCTCTGAACG CACATTGCGC CTAACAGTAT TTTGTTTTGC ATGCCTGTTC GAGCGTCATT TCAACCCTCA AGCCCTATTT GCTTGACGTT GGGAGTTTAC GGAGACGTAA TTCGTTAAAT ATAGTGGCGG AGCCGGGTCG TGCTCTGGGC GTAGTAACCA AACTCTCGCC TCTGTAGCCG GCCCCGGGTC TTGCCGTAAA ACCCC

412 10. G.schlectendalianaG81 ACGCGAAGGG ATCATTACGT GAGTTATCAA AACTCCAACC CTATGTGAAC CTACCTCTGT TTCCTCCGGC GTACCGCGCC AGCGCCTATC CACAGGGCCT CCTTTAGGGG GGGCCCTGCT GGTAAGGTAC CTGAGTGCCG CCTACCCTTC GGGGTACGGC AGCGCGATCA GGGTACCAAC GTAGGCCTGC GCGGCGCCGA GTAGGACCTT CTCGAACTAT AGCACAGTGT GCATCCAGCC CTTTTTTAAG GGCCTGAATC ACCTTATAAC TAAACTAAAG TTTTTTTAAC TAAATACTTT AAAACTTTCA ACAACGGATC TCTTGGTTCT GGCATCGATG AAGAACGCAG CGAAATGCGA TAAGTAATGT GAATTGCAGA ATTCAGTGAA TCATCGAATC TTTGAACGCA CATTGCGCCC ATTAGTATTC TAGTGGGCAT GCCTATTCGA GCGTCATTAC AACCCTTAAG CCCTGTAGCT TAGCGTTGGG AGTCTACGCC CCCCAGGGGC GTAGTTCCTT AAATTCAGTG GCGGAGTTAT AGCACACCCC AAGCGTAGTA GTTTAGCTCG CTTTCAGGGA CTCTGTAGCT GCCTGCCGTA AAAAACCCCT ATACTTATAG AGTTTGACCC GGATTA 11. DQ452131 AAACAAAGGG TAATTTAGGT TGTAGCTGGC Thanatephorus cucumeris TCCATTAATT TGGAGCATGT GCACACCTTG TGCTCTTTTT TAATCCACAC ACACCTGTGA ACCTGTGAGG CAGAGACATG GATGGGAAAA CTTTCATTTA TTTTAAATTA ATGATTGGGA CCCCTACCCA ACCTCTGTCT ACTCAACTCT AATATAAACT CAATTTATTT TAAAACGAAT GTAATGGATG TAACGCATCT AATACTAAGT TTCAACAACG GATCTCTTGG CTCTCGCATC GATGAAGAAC GCAGCGAAAT GCGATAAGTA ATGTGAATTG CAGAATTCAG TGAATCATCG AATCTTTGAA CGCACCTTGC GCTCCTTGGT ATTCCTTGGA GCATGCCTGT TTGAGTATCA TGAAATCTTC AAAGTAAATC TTTTTGTTAA CTCAATTTGG TTTCACTTTG GTATTGGAGG TTCTTGCAGC TTCACATGCT GCTCCTCTTT GTTCATTAGC TGGATCTCGG TGTTATGCTT GGTTCCACTC GGCGTGATAA ATTATCTATC GCTGAGGACA CCCGGTAAAA AAGGTGGCCA AGGTAAATGC AGATGAACCG CTTCTAATAG TCCATTGACT TGGACAATAA AATAATTATT TTATGATCTG ATCTCAAATC AGGTAGGACT ACCCGCTGAA CTTAA 12. AB198715 TGAACGAATG TAGAGTCGGT TGTAGCTGGG Ceratobasidium sp TCTTTTTTTA ATCGAGGCCA TGTGCACGCC TTCTCTTTCA TCCACACACA CCTGTGCACC TGTTTTAGAC GGTCGAAGGA AAAAGGTCTT TTAGGCCGGC TCCTTTTCCC GTCCTATACA TAAAATCTTA TATTATTTAA TCAGAATGTA ATCGATGTAA ACGCATCTAT AAACTAAGTT TCAACAACGG ATCTCTTGGC TCTCGCATCG ATGAAGAACG CAGCGAAATG CGATAAGTAA TGTGAATTGC AGAATTCAGT GAATCATCGA ATCTTTGAAC GCACCTTGCG CTCCTTGGTA TTCCTCGGAG CACGCCTGTT TGAGTATCAT

413 GAAATTCTCA AAGCAAGTCT TTTGTTCTTT CAACTGGCTT TTGTTTTGGA CTTGGAGGTT TTGCAGATTC ACGTCTGCTC CTCTTAAATG CATTAGCTGG ATCTCTATGG AATCGGTTCC ACTCGGCGTG ATAAGTATCA CTCGCTGAGG ACACTCTTGA AAAAGGGTGG CCGGATTCAC GGACGAACCG CTTCCAACCG TCTGTTAGAC ACACTTTATG ATCTGATCTC AAATCAGG 13. AY292455 TTGCGGCTCG ACCTTCACAT CCATTCACCC Helicobasidium TGTGCACCGT AATAATTTAA TTATTATTCT CATCAAACCC TACTAGTCTA CGAATGTAAA purpureum ATCCTTTATA ATTAAAATAA AACTTTTAAC AACGGATCTC TTGGCTCTCG CATCGATGAA GAACGCAGCG AAATGCGATA AGTAATGTGA ATTGCAGAAT TCAGTGAATC ATCGAATCTT TGAACGCACC TTGCGCCTTT TGGTATTCCG AAAGGCACAC CTGTTTGAGC GTCATGAACA CCTCAATCCC CATCTTTTCT TCGGATCGAT GGGTGGCTTG GATGTTGAGC CCTGCTGGTA TGCTATATCA GCTGGCTTTA AACTTATTAG CCGGCTTTGT ACTGGATCGG TTTGACTCGA CGTGATAATA TTATCGTTGA GGATGCATGT CTCATGCAGC CGGAAAGTAT CAAAGCAGCT TCTAGCTTGC CTTTAGCGCA CTTTTACATT TTAGACCTCA GATCAGGTGG GACTACCCGC TGAACTTAAG CATATCAATA AGC 14. AY292452 AGGTGAACCT GCGGAAGGAT CATTATTGAA Tuberculina persicina GCTTAGAGCG CGCTTTATTG CGGCTCGACC CCTTCACATC CATTCACCCC TGTGCACTGT AATTATTTAT TATTTAAACC CTACTGGTTG ATGAATGTAA AAGACCCTTA TAATTGAAAT AAAACTTTCA ACAACGGATC TCTTGGCTCT CGCATCGATG AAGAACGCAG CGAAATGCGA TAAGTAATGT GAATTGCAGA ATTCAGTGAA TCATCGAATC TTTGAACGCA CCTTGCGCCT TTTGGTATTC CGAAAGGCAC ACCTGTTTGA GCGTCATGAA TACCTCAACC TCCCCCGTTG CTATCTTTTG ATGCATGGGG GTGGTTTGGA TGTTGAGCAT TGCTGGCCTG GTTTAAGCAA CCAAAGCCAG CTTGCTTTAA ATGCATCAGC CGGCTCTGTA CTTGATTGGT CCGACTCAAC GTGATAACAT CTTCGTTGAG GATATGCATT ATCATAGATA AATGCAGCCA GAAAGTACAA AGCAGCTTTC TAGCCCCTGC TGTCTTTTTT ACATTTTAGA CCTCAAATCA G 15. EU591763 GGAAGTAAAA GTCGTAACAA GGTTTCCGTA Waitea circinata GGTGAACCTG CGGAAGGATC ATTAATGATT GGTGGCTGTT GCTGACTAGT GTTTCTAGTA TGTGCACGCC ACACCTTCAA TCCCACTTAC ACCTGTGCAC CTTCTGTAAT AGATCTATGT GGATACGGAG ATGTGAAAGT TTGCGCTCTC CTACTCTGTT GAAGCACAGT CTACTACGTT TTTTTTTACA CACACACACA ATAGTCATTG AATGTATTTT TTTTATTCTT ATGATAAAAA CAACTTTCAA CAACGGATCT CTTGGCTCTC GCATCGATGA AGAACGTAGC GAATTACGAT

414 ATGTAATGTG AATTGCAGAA TTCAGTGAAT CATCGAATCT TTGAACGCAC CTTGCGCTCT TTGGTATTCC GAAGAGCATG CCTGTTTGAG TGTCATGAAT CTCTCAAATG CAATAATTTT TATTAATTGT TGTGTTTGGA CTTGGAAGTC TGTCGGCGCA AGTCGACTCT TCTTAAATGT ATTAGCTGGG GTTTATATAG TTGGATCCTT GGTGTGATAA TTATCTACGC CTTGAAGTCC CTGTAGACTC TGCTTCAAAT CGTCTCCTAG AGACAACATT TGAATCATCT GACCTCAAAT CAGGTAGGAC TACCCGCTGA ACTTAAGCAT ATCAATAAGC GGAGGA 16. AY292458 GTAGGTGAAC CTGCGGAAGG ATCATTATCG Tuberculina sbrozzii AAGCATAGAG CGCGCTTTAT TGCGGCTCGA CCTTCACATC CATTCACCCT GTGCACCGTA ATAATTTAAT TATTATTCTC ATCAAACCCT ACTAGTCTAC GAATGTAAAA TCCTTTATAA TTAAAATAAA ACTTTTAACA ACGGATCTCT TGGCTCTCGC ATCGATGAAG AACGCAGCGA AATGCGATAA GTAATGTGAA TTGCAGAATT CAGTGAATCA TCGAATCTTT GAACGCACCT TGCGCCTTTT GGTATTCCGA AAGGCACACC TGTTTGAGCG TCATGAACAC CTCAATCCCC ATCTTTTCTT CGGATCGATG GGTGGCTTGG ATGTTGAGCC CTGCTGGTAT GCTATATCAG CTGGCTTTAA ACTTATTAGC CGGCTTTGTA CTGGATCGGT TTGACTCGAT GTGATAATAT TATCGTTGAG GATGCATGTC TCATGCAGCC GGAAAGTATC AAAGCAGCTT CTAGCTTGCC TTTAGCGCAC TTTTACATTT TAGACCTCAG ATCAGGTGGG ACTACCCGCT GAACTTAAGC ATATCAATAA GCGGAGGA

415 Appendix K.

Fungal ITS sequence data used in the construction of the fungal trees associated with the orchids.

416 60

G_90_Hylophila_montana CAACAACGGA T-CTCTTGGT TCTGGCATCG ATGAAGAACG CAGCGAAATG CCATAAGTAA LSJ339Gbifida ...... -...... G...... LSJ360Greticulata ...... -...... C ...... A .....A...... G...... LSJ315Gvelutina ...... -...... G...... G81G.schlectendaliana ...... -...... G...... AY292458_Tuberculina_sbrozzii T...... -...... C ...C...... G...... AY292455_Helicobasidium_purpureum T...... -...... C ...C...... G......

4 AY292452_Tuberculina_persicina ...... -...... C ...C...... G...... 1

7 AB198715_Ceratobasidium_sp ...... -...... C ...C...... G......

CFB55_Goblongifolia ...... -...... C ...C...... G...... JF2791Goblongifolia ....--.... .A..G....C ...C...... T.. .G...... CFB_60Goblongifolia ...... -...... C ...C...... G...... EU591763_Waitea_circinata ...... -...... C ...C...... T...... T.A .G...T.... CFB62BGoblongifolia ...... -...... C ...C...... G...... G76Cystorchis ...... -...... C ...C...... G...... DQ452131_Thanatephorus_cucumeris ...... -...... C ...C...... G...... 120

G_90_Hylophila_montana TGTGAATTGC AGAATTCAGT GAATCATCGA ATCTTTGAAC GCACATTGCG CCCATTAGTA LSJ339Gbifida ...... LSJ360Greticulata ...... A...... C...... T.AC.... LSJ315Gvelutina ...... G81G.schlectendaliana ...... AY292458_Tuberculina_sbrozzii ...... C...... TT..G... AY292455_Helicobasidium_purpureum ...... C...... TT..G...

4 AY292452_Tuberculina_persicina ...... C...... TT..G... 1

8 AB198715_Ceratobasidium_sp ...... C...... T.C..G...

CFB55_Goblongifolia ...... C...... T.C..G... JF2791Goblongifolia ...... G.C...... T.C..G... CFB_60Goblongifolia ...... C...... T.C..G... EU591763_Waitea_circinata ...... C...... T.T..G... CFB62BGoblongifolia ...... C...... T.C..G... G76Cystorchis ...... C...... T.C..G... DQ452131_Thanatephorus_cucumeris ...... C...... T.C..G... 163

G_90_Hylophila_montana TTCTAGTGGG CATGCCTGTT CGAGCGTCAT TTCAACCCTT AA- LSJ339Gbifida ...... - LSJ360Greticulata ..T.GT.TT...... C ..- LSJ315Gvelutina ...... - G81G.schlectendaliana ...... A...... A...... - AY292458_Tuberculina_sbrozzii ...CGAAA.. ..CA...... T...... GA-.CA...C ..- AY292455_Helicobasidium_purpureum ...CGAAA.. ..CA...... T...... GA-.CA...C ..-

4 AY292452_Tuberculina_persicina ...CGAAA.. ..CA...... T...... GA-.TA...C ..- 1

9 AB198715_Ceratobasidium_sp ...CTCG.A. ..C...... T...TA.... GA-..TT..C ..A

CFB55_Goblongifolia ...CTTG.A...... T...TA.... GA-..TT..C ..A JF2791Goblongifolia ...CTTG.A. ..C...... T...TA...A GA-..TT..C ..A CFB_60Goblongifolia ...CTCG.A...... T...TA.... GA-..T...C ..A EU591763_Waitea_circinata ...CGAA.A...... T...T..... GA-.T.T..C ..A CFB62BGoblongifolia ...CTCG.A...... T...TA.... GA-..T...C ..A G76Cystorchis ...CTTG.A...... T...TA.... GA-..T.T.C ..A DQ452131_Thanatephorus_cucumeris ...CTTG.A...... T...TA.... GA-..T.T.C ..A Appendix L. Original data collected from the herbarium specimens (39 characters, 23 taxa)

Sample C1 C2 C3 “RETICULATA” Clason-Laarman 173, Java 70 1.5 Lanceolate (1) Dr. van Leeuwen-Reijnvan 194 90 1.5 Lanceolate (1) Kleinhoonte A 70 120 3 Lanceolate (1) “ARFAKENSIS” L.S. Gibbs 5571 120 2 Lanceolate (1) “GEMATA” Lorzing 13640 65 1.5 Lanceolata (1) “PUSILLA” CGGJ. Van Steenis 9432 39 1.75 Lanceolata (1) Juswara35 47.67 1 Lanceolata (1) J S van Ooststroom 13455 44 1.5 Lanceolata (1)

“PROCERA” CJJG van Steenis 12424 160 4 Lanceolata (1) O Posthumus 3264 365 3 Lanceolata (1) Br. Bross 53 187.5 3.5 Lanceolata (1) Backer 9119 220 3.5 Lanceolata (1) Backer 14181 210 2 Lanceolata (1) “BIFIDA” Juswara Craven Brown 221 146.67 1.5 Obliquely rhombic (0) H.J. Lam 306 150 2 Obliquely rhombic (0) CNA de Voogd 390 148 2 Obliquely rhombic (0) HAB Bunnemeijer 9857 197.5 2 Obliquely rhombic (0) “SCHLECTENDALIANA” Pringo Atmodjo 77 86.67 1.83 Lanceolata (1) CGGJ van Stennis 8435 90 1 Lanceolata (1) HAB Bunnemeijer 3913 80.67 1 Lanceolata (1) HAB Bunnemeijer 10111 131.25 1.5 Lanceolata (1) A Ernst 841 130 2 Lanceolata (1) “COLORATA” V. Schiffner 1767 80 1.5 Lanceolata (1) Continued

420 Appendix L. continued

Sample C4 C5 C6 “RETICULATA” Clason-Laarman 173, Java 45 18.3 2.46 Dr. van Leeuwen-Reijnvan 194 38.167 19.16 2.27 Kleinhoonte A 70 47.3 20 2.37 “ARFAKENSIS” L.S. Gibbs 5571 29.75 9.75 3.05 “GEMATA” Lorzing 13640 57.71 20.85 2.77 “PUSILLA” CGGJ. Van Steenis 9432 21.5 10.5 2.05 Juswara35 23.75 10 2.38 J S van Ooststroom 13455 18.5 8.75 2.11

“PROCERA” CJJG van Steenis 12424 73.5 30.5 2.41 O Posthumus 3264 114.5 36.5 3.14 Br. Bross 53 84.5 20 4.23 Backer 9119 63 20.2 3.12 Backer 14181 87.8 34.6 2.54 “BIFIDA” Juswara Craven Brown 221 42 22 1.91 H.J. Lam 306 51 21 2.43 CNA de Voogd 390 48 23.3 2.06 HAB Bunnemeijer 9857 40.67 21.83 1.86 “SCHLECTENDALIANA” Pringo Atmodjo 77 46 22 2.09 CGGJ van Stennis 8435 34.3 17 2.02 HAB Bunnemeijer 3913 36.75 16.5 2.23 HAB Bunnemeijer 10111 42 21.8 1.93 A Ernst 841 50 18.3 2.73 “COLORATA” V. Schiffner 1767 29.5 12 2.46 Continued

421 Appendix L. continued

Sample C7 C8 C9 “RETICULATA” Clason-Laarman 173, Java 1 Attenuate (1) Reticulate (0) Dr. van Leeuwen-Reijnvan 194 1 Attenuate (1) Reticulate (0) Kleinhoonte A 70 1 Attenuate (1) Reticulate (0) “ARFAKENSIS” L.S. Gibbs 5571 1.5 Attenuate (1) Spotted (2) “GEMATA” Lorzing 13640 1.5 Attenuate (1) Reticulate (0) “PUSILLA” CGGJ. Van Steenis 9432 0.75 Attenuate (1) Reticulate (0) Juswara35 1 Attenuate (1) Reticulate (0) J S van Ooststroom 13455 1 Attenuate (1) Reticulate (0)

“PROCERA” CJJG van Steenis 12424 3.67 Rosette (0) Non-reticulate (3) O Posthumus 3264 2 Rosette (0) Non-reticulate (3) Br. Bross 53 1.5 Rosette (0) Non-reticulate (3) Backer 9119 2 Rosette (0) Non-reticulate (3) Backer 14181 2 Rosette (0) Non-reticulate (3) “BIFIDA” Juswara Craven Brown 221 1.875 Attenuate (1) Non-reticulate (3) H.J. Lam 306 3 Attenuate (1) Non-reticulate (3) CNA de Voogd 390 2.67 Attenuate (1) Non-reticulate (3) HAB Bunnemeijer 9857 2 Attenuate (1) Non-reticulate (3) “SCHLECTENDALIANA” Pringo Atmodjo 77 3.5 Attenuate (1) Spotted (2) CGGJ van Stennis 8435 2 Attenuate (1) Spotted (2) HAB Bunnemeijer 3913 2 Attenuate (1) Spotted (2) HAB Bunnemeijer 10111 2 Attenuate (1) Spotted (2) A Ernst 841 2.5 Attenuate (1) Spotted (2) “COLORATA” V. Schiffner 1767 1 Attenuate (1) Linear (1) Continued

422 Appendix L. continued

Sample C10 C11 C12 “RETICULATA” Clason-Laarman 173, Java 18 45 2.5 Dr. van Leeuwen-Reijnvan 194 18.5 61.5 3.32 Kleinhoonte A 70 19 67 3.53 “ARFAKENSIS” L.S. Gibbs 5571 23 50 2.17 “GEMATA” Lorzing 13640 45 80 1.78 “PUSILLA” CGGJ. Van Steenis 9432 7 27.5 3.93 Juswara35 10 24 2.4 J S van Ooststroom 13455 11 40 3.63

“PROCERA” CJJG van Steenis 12424 71 80 1.13 O Posthumus 3264 69 98 1.42 Br. Bross 53 70 85 1.21 Backer 9119 79 126 1.59 Backer 14181 58 85 1.47 “BIFIDA” Juswara Craven Brown 221 14 11 3.39 H.J. Lam 306 15.5 47.5 3.06 CNA de Voogd 390 13 47.5 3.85 HAB Bunnemeijer 9857 12.5 50 3 “SCHLECTENDALIANA” Pringo Atmodjo 77 12 85 7.08 CGGJ van Stennis 8435 9 78 8.67 HAB Bunnemeijer 3913 10.5 76.5 7.29 HAB Bunnemeijer 10111 9.5 71.25 7.5 A Ernst 841 8 85 10.625 “COLORATA” V. Schiffner 1767 8 19 2.375 Continued

423 Appendix L. continued

Sample C13 C14 C15 “RETICULATA” Clason-Laarman 173, Java 3 2 1 Dr. van Leeuwen-Reijnvan 194 3.5 6 1 Kleinhoonte A 70 3 6 1 “ARFAKENSIS” L.S. Gibbs 5571 3 5 0.675 “GEMATA” Lorzing 13640 3 5 1 “PUSILLA” CGGJ. Van Steenis 9432 2.5 5 1 Juswara35 2.5 8 0.5 J S van Ooststroom 13455 2 7.5 1

“PROCERA” CJJG van Steenis 12424 1.625 3.5 0.3 O Posthumus 3264 2 4 0.3 Br. Bross 53 1.5 3.5 0.5 Backer 9119 2 3.5 0.5 Backer 14181 1.5 4 0.3 “BIFIDA” Juswara Craven Brown 221 8 9 2 H.J. Lam 306 8 8 2.5 CNA de Voogd 390 7 8 2 HAB Bunnemeijer 9857 8 8 2 “SCHLECTENDALIANA” Pringo Atmodjo 77 9 10 2.5 CGGJ van Stennis 8435 6.5 7 2.5 HAB Bunnemeijer 3913 5 9 1.5 HAB Bunnemeijer 10111 6.5 10 2 A Ernst 841 6 6.5 2.5 “COLORATA” V. Schiffner 1767 3 5 1.5

424 Continued

Appendix L. continued

Sample C16 C17 C18 “RETICULATA” Clason-Laarman 173, Java (R1) 0.5 2 2.5 Dr. van Leeuwen-Reijnvan 194 0.5 2 2 Kleinhoonte A 70 1 2 2 “ARFAKENSIS” L.S. Gibbs 5571 0.5 1.25 1 “GEMATA” Lorzing 13640 0.5 2 1 “PUSILLA” CGGJ. Van Steenis 9432 0.5 2 1.5 Juswara35 0.5 1 1.5 J S van Ooststroom 13455 0.5 2 2

“PROCERA” CJJG van Steenis 12424 0.25 1.2 1 O Posthumus 3264 0.3 1 1.5 Br. Bross 53 0.5 1 0.75 Backer 9119 0.5 1 1 Backer 14181 0.3 1 1 “BIFIDA” Juswara Craven Brown 221 1.5 1.33 3 H.J. Lam 306 2 1.25 3 CNA de Voogd 390 2 1 3 HAB Bunnemeijer 9857 1 2 4 “SCHLECTENDALIANA” Pringo Atmodjo 77 2 1.25 4 CGGJ van Stennis 8435 3 0.83 2.5 HAB Bunnemeijer 3913 1 1.5 3 HAB Bunnemeijer 10111 1 2 3.5 A Ernst 841 2 1.25 2.5 “COLORATA” V. Schiffner 1767 1 1.5 1

425 Continued

Appendix L. continued

C19 C20 C21 Sample “RETICULATA” Clason-Laarman 173, Java 1.5 1.67 2.5 Dr. van Leeuwen-Reijnvan 194 1.5 1.33 3.5 Kleinhoonte A 70 1.5 1.33 3.5 “ARFAKENSIS” L.S. Gibbs 5571 0.625 1.6 2.5 “GEMATA” Lorzing 13640 1.3 0.77 3 “PUSILLA” CGGJ. Van Steenis 9432 0.5 3 2 Juswara35 0.75 2 3.5 J S van Ooststroom 13455 1 2 3

“PROCERA” CJJG van Steenis 12424 1 1 1.75 O Posthumus 3264 1 1.5 2 Br. Bross 53 0.5 1.5 1.75 Backer 9119 0.5 2 1.5 Backer 14181 0.5 2 1.5 “BIFIDA” Juswara Craven Brown 221 3 1 7 H.J. Lam 306 2 1.5 7 CNA de Voogd 390 3 1 6 HAB Bunnemeijer 9857 3 1.33 6 “SCHLECTENDALIANA” Pringo Atmodjo 77 5 0.8 7 CGGJ van Stennis 8435 4 0.625 6 HAB Bunnemeijer 3913 2 1.5 5.5 HAB Bunnemeijer 10111 2 1.75 7 A Ernst 841 2 1.25 6 “COLORATA” V. Schiffner 1767 1 1 3

426 Continued

Appendix L. continued

Sample C22 C23 C24 “RETICULATA” Clason-Laarman 173, Java 0.4 6.25 3 Dr. van Leeuwen-Reijnvan 194 1 3.5 3 Kleinhoonte A 70 1.3 2.69 2.5 “ARFAKENSIS” L.S. Gibbs 5571 1 2.5 2.5 “GEMATA” Lorzing 13640 2 1.5 3 “PUSILLA” CGGJ. Van Steenis 9432 0.75 2.67 2.5 Juswara35 1.5 2.33 2 J S van Ooststroom 13455 1 3 2

“PROCERA” CJJG van Steenis 12424 1 1.75 1.5 O Posthumus 3264 1.5 2 2 Br. Bross 53 1 1.75 1.5 Backer 9119 1 1.5 2 Backer 14181 1 1.5 1.5 “BIFIDA” Juswara Craven Brown 221 3.5 2 7 H.J. Lam 306 2 3.5 8 CNA de Voogd 390 3 2 6.5 HAB Bunnemeijer 9857 3 2 6 “SCHLECTENDALIANA” Pringo Atmodjo 77 3 2.33 8 CGGJ van Stennis 8435 2 3 8 HAB Bunnemeijer 3913 2.5 2.2 5.5 HAB Bunnemeijer 10111 2.5 2.8 6.5 A Ernst 841 3.5 1.71 6 “COLORATA” V. Schiffner 1767 2 1.5 3 Continued

427 Appendix L. continued

Sample C25 C26 C27 “RETICULATA” Clason-Laarman 173, Java 1 3 2.5 Dr. van Leeuwen-Reijnvan 194 1.5 2 3 Kleinhoonte A 70 1.5 1.67 2.5 “ARFAKENSIS” L.S. Gibbs 5571 1 2.5 2.5 “GEMATA” Lorzing 13640 1.5 2 3 “PUSILLA” CGGJ. Van Steenis 9432 1 2.5 1.5 Juswara35 1.5 1.33 1.5 J S van Ooststroom 13455 1.5 1.33 2

“PROCERA” CJJG van Steenis 12424 1 1.5 1.5 O Posthumus 3264 1.25 1.6 2 Br. Bross 53 0.75 2 2 Backer 9119 1 2 2 Backer 14181 0.75 2 1.5 “BIFIDA” Juswara Craven Brown 221 2.5 2.8 7.5 H.J. Lam 306 2 4 8 CNA de Voogd 390 3 2.167 6.5 HAB Bunnemeijer 9857 2 3 6 “SCHLECTENDALIANA” Pringo Atmodjo 77 4 2 8 CGGJ van Stennis 8435 3 2.67 6 HAB Bunnemeijer 3913 2 2.75 5.5 HAB Bunnemeijer 10111 2 3.25 6.5 A Ernst 841 2 3 6 “COLORATA” V. Schiffner 1767 1.5 2 3

428 Continued

Appendix L. continued

Sample C28 C29 C30 “RETICULATA” Clason-Laarman 173, Java 1 2.5 1 Dr. van Leeuwen-Reijnvan 194 0.5 6 1 Kleinhoonte A 70 0.5 5 1 “ARFAKENSIS” L.S. Gibbs 5571 0.5 5 1 “GEMATA” Lorzing 13640 1 3 0 “PUSILLA” CGGJ. Van Steenis 9432 0.3 5 0 Juswara35 0.5 3 1 J S van Ooststroom 13455 0.5 4 1

“PROCERA” CJJG van Steenis 12424 0.5 3 1 O Posthumus 3264 0.75 2.67 1 Br. Bross 53 0.75 2.67 1 Backer 9119 0.5 4 1 Backer 14181 0.5 3 1 “BIFIDA” Juswara Craven Brown 221 2.5 3 0 H.J. Lam 306 1 8 0 CNA de Voogd 390 2.5 2.6 0 HAB Bunnemeijer 9857 3 2 0 “SCHLECTENDALIANA” Pringo Atmodjo 77 3 2.67 0 CGGJ van Stennis 8435 2 3 0 HAB Bunnemeijer 3913 2.5 2.2 0 HAB Bunnemeijer 10111 2.5 2.6 0 A Ernst 841 2.5 2.4 0 “COLORATA” V. Schiffner 1767 1.5 2 1 Continued

429 Appendix L. continued

Sample C31 C32 C33 “RETICULATA” Clason-Laarman 173, Java 1 0.5 1 Dr. van Leeuwen-Reijnvan 194 2 0.75 0.5 Kleinhoonte A 70 1 0.5 0.75 “ARFAKENSIS” L.S. Gibbs 5571 1.5 0.5 0.5 “GEMATA” Lorzing 13640 2 0.5 0 “PUSILLA” CGGJ. Van Steenis 9432 1.5 0.5 0.5 Juswara35 1 0.5 0.5 J S van Ooststroom 13455 1.5 0.5 0.5

“PROCERA” CJJG van Steenis 12424 1.5 1 0 O Posthumus 3264 1.5 0.5 0 Br. Bross 53 1 0.5 0 Backer 9119 1.5 0.5 0 Backer 14181 1.5 0.75 0 “BIFIDA” Juswara Craven Brown 221 4.5 1.5 0 H.J. Lam 306 5 1 0 CNA de Voogd 390 6 1 1 HAB Bunnemeijer 9857 5 1 0.5 “SCHLECTENDALIANA” Pringo Atmodjo 77 5.5 1 0 CGGJ van Stennis 8435 3.5 1 0 HAB Bunnemeijer 3913 4 1.5 0.5 HAB Bunnemeijer 10111 4.5 1 0.5 A Ernst 841 4 1 0.5 “COLORATA” V. Schiffner 1767 2 1 0 Continued

430 Appendix L. continued

Sample C34 C35 C36 “RETICULATA” Clason-Laarman 173, Java Pointy (1) 10 1 Dr. van Leeuwen-Reijnvan 194 Pointy (1) 8 2 Kleinhoonte A 70 Pointy (1) 9 2 “ARFAKENSIS” L.S. Gibbs 5571 Pointy (1) 6.25 1.25 “GEMATA” Lorzing 13640 Pointy(1) 4.5 1.5 “PUSILLA” CGGJ. Van Steenis 9432 Pointy (1) 8 2 Juswara35 Pointy (1) 10 2 J S van Ooststroom 13455 Pointy (1) 7 2

“PROCERA” CJJG van Steenis 12424 Reflected (2) 5 2 O Posthumus 3264 Reflected (2) 4.5 2 Br. Bross 53 Reflected (2) 4.5 1.5 Backer 9119 Reflected (2) 4.5 2 Backer 14181 Reflected (2) 4.5 1.5 “BIFIDA” Juswara Craven Brown 221 Pointy (1) 20 6.3 H.J. Lam 306 Pointy (1) 14.67 3.5 CNA de Voogd 390 Pointy (1) 16 3.5 HAB Bunnemeijer 9857 Pointy (1) 11.75 3 “SCHLECTENDALIANA” Pringo Atmodjo 77 Pointy (1) 8.5 3 CGGJ van Stennis 8435 Pointy (1) 10 2 HAB Bunnemeijer 3913 Pointy (1) 10 2 HAB Bunnemeijer 10111 Pointy (1) 10.5 3 A Ernst 841 Pointy (1) 10 3 “COLORATA” V. Schiffner 1767 Pointy (1) 6.5 2

431 Continued

Appendix L. continued

Sample C37 C38 C39 “RETICULATA” Clason-Laarman 173, Java 10 0 15.25 Dr. van Leeuwen-Reijnvan 194 4 0 16.14 Kleinhoonte A 70 4.5 0 20 “ARFAKENSIS” L.S. Gibbs 5571 5 0 14.3 “GEMATA” Lorzing 13640 3 1 20.75 “PUSILLA” CGGJ. Van Steenis 9432 4 0 12.5 Juswara35 5 0 10.25 J S van Ooststroom 13455 3.5 0 11.5

“PROCERA” CJJG van Steenis 12424 2.5 0 34.67 O Posthumus 3264 2.25 0 60 Br. Bross 53 3 0 50 Backer 9119 2.25 0 37.5 Backer 14181 3 0 57.25 “BIFIDA” Juswara Craven Brown 221 3.17 0 17 H.J. Lam 306 4.19 0 19.6 CNA de Voogd 390 4.57 0 20.75 HAB Bunnemeijer 9857 3.92 0 20.67 “SCHLECTENDALIANA” Pringo Atmodjo 77 2.83 1 22.3 CGGJ van Stennis 8435 5 1 18.75 HAB Bunnemeijer 3913 5 1 15.83 HAB Bunnemeijer 10111 3.5 1 27.75 A Ernst 841 3.3 1 28 “COLORATA” V. Schiffner 1767 3.25 1 15

432 Appendix M. Complete data sets of Goodyera section Goodyera used in the phenetic analyses

Name of OTUs C1 C2 C3 C4 C5 Reticulata 1 0.095092025 0.323656786 0.376141062 0.344144144 0.085616438 Reticulata 2 0.233128834 0.323656786 0.293279082 0.375135135 0.085616438 Reticulata 3 0.156441718 0.876951594 0.402596439 0.405405405 0.085616438 Arfakensis 0.248466258 0.553294809 0.180206004 0.036036036 0.256849315 Gemmata 0.079754601 0.323656786 0.514985223 0.436036036 0.256849315 pusilla 1 0 0.446705191 0.052450391 0.063063063 0 pusilla 2 0.026595092 0 0.089421287 0.045045045 0.085616438 pusilla 3 0.015337423 0.323656786 0 0 0.085616438 procera 1 0.371165644 1.106589617 0.667580568 0.783783784 1 procera 2 1 0.876951594 1 1 0.428082192 procera 3 0.455521472 1 0.764337028 0.405405405 0.256849315 procera 4 0.555214724 1 0.568201011 0.412612613 0.428082192 procera 5 0.524539877 0.553294809 0.792117705 0.931531532 0.428082192 bifida1 0.330276074 0.323656786 0.340596102 0.477477477 0.385273973 bifida2 0.340490798 0.553294809 0.443839674 0.441441441 0.770547945 bifida3 0.334355828 0.553294809 0.410519644 0.524324324 0.657534247 bifida4 0.486196319 0.553294809 0.324432313 0.471351351 0.428082192 schlectendaliana1 0.146226994 0.482386577 0.387724509 0.477477477 0.941780822 schlectendaliana2 0.156441718 0 0.24306659 0.297297297 0.428082192 schlectendaliana3 0.127822086 0 0.275188521 0.279279279 0.428082192 schlectendaliana4 0.28297546 0.323656786 0.340596102 0.47027027 0.428082192 schlectendaliana5 0.279141104 0.553294809 0.432844728 0.344144144 0.599315068 Colorata 0.125766871 0.323656786 0.176617176 0.117117117 0.085616438

C = Character Continued

433 Appendix M. continued

Name of OTUs C6 C7 C8 C9 C10 Reticulata 1 1 0 0.35516606 0.386852838 0 Reticulata 2 1 0 0.48216835 0.472885861 0.5 Reticulata 3 1 0 0.50845658 0.386852838 0.5 Arfakensis 1 0.6666667 0.29287976 0.386852838 0.375 Gemmata 1 0 0.20322871 0.386852838 0.375 pusilla 1 1 0 0.55659776 0.285097164 0.375 pusilla 2 1 0 0.33697333 0.285097164 0.75 pusilla 3 1 0 0.52215196 0.160558385 0.6875 procera 1 0 1 0 0.044672681 0.1875 procera 2 0 1 0.10317662 0.160558385 0.25 procera 3 0 1 0.0333395 0 0.1875 procera 4 0 1 0.15486119 0.160558385 0.1875 procera 5 0 1 0.11714685 0 0.25 bifida1 1 1 0.49126245 0.934264061 0.875 bifida2 1 1 0.44590197 0.934264061 0.75 bifida3 1 1 0.54714878 0.859738699 0.75 bifida4 1 1 0.43641949 0.934264061 0.75 schlectendaliana 1 1 0.6666667 0.81930041 1 1 schlectendaliana 2 1 0.6666667 0.9092077 0.818378356 0.625 schlectendaliana 3 1 0.6666667 0.83185505 0.671950001 0.875 schlectendaliana 4 1 0.6666667 0.84477363 0.818378356 1 schlectendaliana 5 1 0.6666667 1 0.773705676 0.5625 colorata 1 0.3333333 0.33230669 0.386852838 0.375

C = Character Continued

434 Appendix M. continued

Name of OTUs C11 C12 C13 C14 C15 Reticulata 1 1 0.6252833 1 0.083333333 1 Reticulata 2 1 0.4830282 0.4210526 0.666666667 0.5 Reticulata 3 0.20825594 0.4830282 0.2510121 0.5 0.75 Arfakensis 0.46314058 0.599259 0.2105263 0.5 0.5 Gemmata 1 0.1323711 0 0.166666667 0 pusilla 1 1 1 0.245614 0.5 0.5 pusilla 2 0.20825594 0.7415141 0.1754386 0.166666667 0.5 pusilla 3 1 0.7415141 0.3157895 0.333333333 0.5 procera 1 0.41651187 0.2996295 0.0526316 0.166666667 0 procera 2 0.20825594 0.5581154 0.1052632 0.111111111 0 procera 3 0.20825594 0.5581154 0.0526316 0.111111111 0 procera 4 0.20825594 0.7415141 0 0.333333333 0 procera 5 0.20825594 0.7415141 0 0.166666667 0 bifida1 0.53685942 0.2996295 0.1052632 0.166666667 0 bifida2 0.46314058 0.5581154 0.4210526 1 0 bifida3 0.20825594 0.2996295 0.1052632 0.1 1 bifida4 1 0.4830282 0.1052632 0 0.5 schlectendaliana 1 0.46314058 0.1573745 0.1754386 0.111111111 0 schlectendaliana 2 0 0 0.3157895 0.166666667 0 schlectendaliana 3 0.67139652 0.5581154 0.1473684 0.033333333 0.5 schlectendaliana 4 1 0.6563872 0.2736842 0.1 0.5 schlectendaliana 5 0.46314058 0.4418846 0.0451128 0.066666667 0.5 colorata 0.67139652 0.2996295 0 0 0

C = Character Continued

435 Appendix M. continued

Name of OTUs C16 C17 C18 C19 Reticulata 1 0.54080629 0 0 0.22483702 Reticulata 2 0.34414946 0.274317541 0 0.25693649 Reticulata 3 0.44247788 0.274317541 0 0.37828484 Arfakensis 0.17207473 0.078169247 0 0.18843747 Gemmata 0 0.14883972 1 0.39911809 pusilla 1 0.34414946 0.274317541 0 0.11230514 pusilla 2 0.54080629 0.274317541 0 0 pusilla 3 0.24582104 0.274317541 0 0.0651189 procera 1 0.04916421 0.274317541 0 0.68961608 procera 2 0 0.14883972 0 1 procera 3 0 0.274317541 0 0.89682276 procera 4 0 0.14883972 0 0.7340203 procera 5 0 1 0 0.97344894 bifida1 1.52409046 0.576715586 0 0.28631388 bifida2 1 0.576715586 0 0.36685183 bifida3 1.13077679 0.484808408 0 0.39911809 bifida4 0.71288102 0.484808408 0 0.39693157 schlectendaliana 1 0.39331367 0.274317541 1 0.43988679 schlectendaliana 2 0.54080629 0.274317541 1 0.3417615 schlectendaliana 3 0.54080629 0.274317541 1 0.24596085 schlectendaliana 4 0.5899705 0.484808408 1 0.56362234 schlectendaliana 5 0.54080629 0.484808408 1 0.56869774 colorata 0.19665683 0.274317541 1 0.21548239

C = Character

436 Appendix N. Data sets of Goodyera section Goodyera used in the phenetic analyses after standardization

Name of OTUs C1 C2 C3 C4 C5 Reticulata 1 0.095092025 0.323656786 0.376141062 0.344144144 0.085616438 Reticulata 2 0.233128834 0.323656786 0.293279082 0.375135135 0.085616438 Reticulata 3 0.156441718 0.876951594 0.402596439 0.405405405 0.085616438 Arfakensis 0.248466258 0.553294809 0.180206004 0.036036036 0.256849315 Gemmata 0.079754601 0.323656786 0.514985223 0.436036036 0.256849315 pusilla 1 0 0.446705191 0.052450391 0.063063063 0 pusilla 2 0.026595092 0 0.089421287 0.045045045 0.085616438 pusilla 3 0.015337423 0.323656786 0 0 0.085616438 bifida1 0.330276074 0.323656786 0.340596102 0.477477477 0.385273973 bifida2 0.340490798 0.553294809 0.443839674 0.441441441 0.770547945 bifida3 0.334355828 0.553294809 0.410519644 0.524324324 0.657534247 bifida4 0.486196319 0.553294809 0.324432313 0.471351351 0.428082192 schlectendaliana1 0.146226994 0.482386577 0.387724509 0.477477477 0.941780822 schlectendaliana2 0.156441718 0 0.24306659 0.297297297 0.428082192 schlectendaliana3 0.127822086 0 0.275188521 0.279279279 0.428082192 schlectendaliana4 0.28297546 0.323656786 0.340596102 0.47027027 0.428082192 schlectendaliana5 0.279141104 0.553294809 0.432844728 0.344144144 0.599315068 Colorata 0.125766871 0.323656786 0.176617176 0.117117117 0.085616438

C = Character C6 was excluded by the exclusion of 'Procera' Continued

437 Appendix N. continued

Name of OTUs C7 C8 C9 C10 C11 Reticulata 1 0 0.35516606 0.386852838 0 1 Reticulata 2 0 0.48216835 0.472885861 0.5 1 Reticulata 3 0 0.50845658 0.386852838 0.5 0.208256 Arfakensis 0.6666667 0.29287976 0.386852838 0.375 0.463141 Gemmata 0 0.20322871 0.386852838 0.375 1 pusilla 1 0 0.55659776 0.285097164 0.375 1 pusilla 2 0 0.33697333 0.285097164 0.75 0.208256 pusilla 3 0 0.52215196 0.160558385 0.6875 1 bifida1 1 0.49126245 0.934264061 0.875 0.536859 bifida2 1 0.44590197 0.934264061 0.75 0.463141 bifida3 1 0.54714878 0.859738699 0.75 0.208256 bifida4 1 0.43641949 0.934264061 0.75 1 schlectendaliana 1 0.6666667 0.81930041 1 1 0.463141 schlectendaliana 2 0.6666667 0.9092077 0.818378356 0.625 0 schlectendaliana 3 0.6666667 0.83185505 0.671950001 0.875 0.671397 schlectendaliana 4 0.6666667 0.84477363 0.818378356 1 1 schlectendaliana 5 0.6666667 1 0.773705676 0.5625 0.463141 Colorata 0.3333333 0.33230669 0.386852838 0.375 0.671397

C = Character Continued

438 Appendix N. continued

Name of OTUs C12 C13 C14 C15 C16 Reticulata 1 0.62528325 1 0.083333333 1 0.54080629 Reticulata 2 0.48302819 0.4210526 0.666666667 0.5 0.34414946 Reticulata 3 0.48302819 0.2510121 0.5 0.75 0.44247788 Arfakensis 0.59925903 0.2105263 0.5 0.5 0.17207473 Gemmata 0.13237107 0 0.166666667 0 0 pusilla 1 1 0.245614 0.5 0.5 0.34414946 pusilla 2 0.7415141 0.1754386 0.166666667 0.5 0.54080629 pusilla 3 0.7415141 0.3157895 0.333333333 0.5 0.24582104 bifida1 0.29962952 0.1052632 0.166666667 0 1.52409046 bifida2 0.55811543 0.4210526 1 0 1 bifida3 0.29962952 0.1052632 0.1 1 1.13077679 bifida4 0.48302819 0.1052632 0 0.5 0.71288102 schlectendaliana 1 0.15737446 0.1754386 0.111111111 0 0.39331367 schlectendaliana 2 0 0.3157895 0.166666667 0 0.54080629 schlectendaliana 3 0.55811543 0.1473684 0.033333333 0.5 0.54080629 schlectendaliana 4 0.65638721 0.2736842 0.1 0.5 0.5899705 schlectendaliana 5 0.44188457 0.0451128 0.066666667 0.5 0.54080629 colorata 0.29962952 0 0 0 0.19665683

C = Character Continued

439 Appendix N. continued

Name of OTUs C17 C18 C19 Reticulata 1 0 0 0.22483702 Reticulata 2 0.274317541 0 0.25693649 Reticulata 3 0.274317541 0 0.37828484 Arfakensis 0.078169247 0 0.18843747 Gemmata 0.14883972 1 0.39911809 pusilla 1 0.274317541 0 0.11230514 pusilla 2 0.274317541 0 0 pusilla 3 0.274317541 0 0.0651189 bifida1 0.576715586 0 0.28631388 bifida2 0.576715586 0 0.36685183 bifida3 0.484808408 0 0.39911809 bifida4 0.484808408 0 0.39693157 schlectendaliana 1 0.274317541 1 0.43988679 schlectendaliana 2 0.274317541 1 0.3417615 schlectendaliana 3 0.274317541 1 0.24596085 schlectendaliana 4 0.484808408 1 0.56362234 schlectendaliana 5 0.484808408 1 0.56869774 colorata 0.274317541 1 0.21548239

C = Character

440 Appendix O. Analyses of correlation coefficient of 39 features, 23 taxa (full collected data set)

Numbers in red = correlations considered to indicate significant interactions

Characters C1 C2 C1= Height (mm) - 0.616881 C2=Diameter (mm) - C3=Leaf shape C4=Leaf length (mm) C5=Leaf width (mm) C6=Leaf length/Leaf width C7=Root diameter (mm) C8=Root type C9=Leaf venation C10=Number of the flowers per spike C11=The length of the spike (from the bottom of the first flower, mm C12=The length of the spike/number of flowers per spike C13=Floral size (mm) C14=Floral stalk (mm) C15=Labellum apex length (mm) C16=Labellum apex width (mm) C17=Labellum apex length/width C18=Labellum length (mm) C19=Labellum width (mm) C20=Labellum length/width C21=Lateral sepal length (mm) C22=Lateral sepal width (mm) C23=Lateral sepal length/width C24=Dorsal sepal length (mm) C25=Dorsal sepal width (mm) C26=Dorsal sepal length/width C27=Lateral petal length (mm) C28=Lateral petal width C29=Lateral petal length/width C30=Shape of the column Continued 441 Appendix O continued

Characters C1 C2 C30=Shape of the column C31=Column length (mm) C32=Column width (mm) C33=The spur length (mm) measured from the base of the labellum attachment C34=Labellum apex C35=Bract length (mm) C36=Bract width (mm) C37=Bract length/width C38=Stalk hairs C39=Leaf petiole (mm)

Continued

442 Appendix O continued

Characters C3 C4 C5 C6 C1 -0.297344 0.64241 0.768058 0.363872 C2 -1.99E-03 0.474127 0.48001 0.363872 C3 - -9.27E-02 -0.21337 0.383222 C4 - 0.436423 0.162009 C5 - 0.105945 C6 - C7 C8 C9 C10 C11 C12 C13 C14 C15 C16 C17 C18 C19 C20 C21 C22 C23 C24 C25 C26 C27 C28 C29 C30 C31 C32 C33 C34 C35 C36 C37 C38 C39 Continued

443 Appendix O continued

Characters C7 C8 C9 C10 C1 0.589469 -0.64976 -0.78008 0.637994 C2 0.298698 -0.71338 -0.60446 0.459932 C3 -0.347379 -0.24183 0.572263 4.92E-02 C4 0.350682 -0.52217 -0.51328 0.24023 C5 0.6311 -0.55625 -0.63583 0.560892 C6 -2.79E-02 -0.62041 -0.22672 0.542889 C7 - -0.28608 -0.51157 0.400615 C8 - 0.657342 -0.605811 C9 - -0.473795 C10 - C11 C12 C13 C14 C15 C16 C17 C18 C19 C20 C21 C22 C23 C24 C25 C26 C27 C28 C29 C30 C31 C32 C33 C34 C35 C36 C37 C38 C39 Continued

444 Appendix O continued

Characters C11 C12 C13 C14 C1 0.56314 -0.349326 -9.97E-03 -0.183734 C2 0.441544 -0.571258 -0.420155 -0.482246 C3 0.240088 -5.13E-02 -0.598488 -3.99E-01 C4 0.268328 -8.95E-02 -6.95E-02 -0.169179 C5 0.651072 -0.240217 5.06E-02 -0.175526 C6 0.381916 -0.589355 -0.614731 -0.623049 C7 0.560748 0.113851 0.405189 0.241263 C8 -0.54206 0.691903 0.670304 0.585753 C9 -0.27166 0.544887 0.101699 0.184855 C10 0.59373 -0.55006 -0.304895 -0.341752 C11 - -2.69E-02 -8.27E-02 -0.169187 C12 - 0.738861 0.676971 C13 - 0.723903 C14 C15 C16 C17 C18 C19 C20 C21 C22 C23 C24 C25 C26 C27 C28 C29 C30 C31 C32 C33 C34 C35 C36 C37 C38 C39 Continued

445 Appendix O continued

Characters C15 C16 C17 C18 C1 6.52E-02 -8.20E-02 -0.424998 -7.71E-02 C2 -0.311329 -0.364919 -0.321344 -0.414478 C3 -0.393872 -0.46328 -5.38E-03 -0.496223 C4 -1.33E-02 -1.22E-02 -0.495703 8.82E-02 C5 8.39E-02 -6.01E-02 -0.288713 8.20E-02 C6 -0.392036 -0.445901 -0.373235 -0.732808 C7 0.236672 0.339668 -0.378899 0.282676 C8 0.51321 0.598965 0.466102 0.609781 C9 0.127844 0.146415 0.389749 0.129971 C10 -0.300283 -0.308734 -0.390975 -0.337614 C11 -3.96E-02 -5.63E-02 -0.357927 -6.74E-02 C12 0.649446 0.771048 0.159898 0.75781 C13 0.778709 0.876858 0.129978 0.86288 C14 0.537985 0.651295 6.27E-02 0.663774 C15 - 0.722879 0.120418 0.731133 C16 - -0.152667 0.696025 C17 - 0.241934 C18 - C19 C20 C21 C22 C23 C24 C25 C26 C27 C28 C29 C30 C31 C32 C33 C34 C35 C36 C37 C38 C39 Continued

446 Appendix O continued

Characters C19 C20 C21 C22 C1 -6.79E-02 -0.106373 -0.114807 0.18468 C2 -0.276291 0.109166 -0.511368 -0.243532 C3 -0.152606 0.175944 -0.525657 -0.486772 C4 8.82E-02 0.203799 -0.115575 -8.59E-02 C5 0.148351 -0.30142 -2.91E-02 0.188984 C6 -0.435766 0.149338 -0.631602 -0.373813 C7 0.396095 -0.452396 0.338684 0.531856 C8 0.459412 -0.187125 0.717806 0.347141 C9 0.269753 -2.15E-02 0.198409 -8.47E-02 C10 -9.03E-02 -0.276301 -0.286026 -5.98E-02 C11 0.118496 -0.219315 -0.125877 5.48E-02 C12 0.626228 -0.209142 0.787081 0.534578 C13 0.664378 -0.456379 0.952805 0.753359 C14 0.441094 -0.222754 0.828868 0.786958 C15 0.610926 -0.382608 0.757795 0.647191 C16 0.629173 -0.514039 0.866021 0.713214 C17 7.16E-02 0.210365 0.125261 -0.119079 C18 0.688247 -0.197551 0.86724 0.542389 C19 - -0.52845 0.672594 0.462218 C20 - -0.447469 -0.533624 C21 - 0.78908 C22 - C23 C24 C25 C26 C27 C28 C29 C30 C31 C32 C33 C34 C35 C36 C37 C38 C39 Continued

447 Appendix O continued

Characters C23 C24 C25 C26 C1 -0.37218 2.82E-02 -0.121228 -3.02E-02 C2 -0.345329 -0.254911 -0.453854 -0.431712 C3 -1.01E-02 -0.602331 -0.43422 -0.295844 C4 3.07E-02 -5.65E-02 -0.131989 -0.102958 C5 -0.261442 9.13E-02 2.62E-02 -0.163545 C6 -0.316027 -0.478492 -0.636574 -0.118946 C7 -0.315594 0.37913 0.403381 -0.14835 C8 0.468885 0.580041 0.61182 0.485896 C9 0.388403 2.24E-02 0.179849 0.180892 C10 -0.295281 -0.263394 -0.23833 -0.32436 C11 -0.230613 -0.104811 -3.46E-02 -0.106357 C12 0.305474 0.579953 0.743587 0.482671 C13 0.221061 0.86696 0.887253 0.546268 C14 -2.58E-02 0.639172 0.798696 0.292872 C15 0.217671 0.677589 0.765963 0.55151 C16 0.129894 0.667934 0.853142 0.533616 C17 0.341446 0.31235 -1.94E-02 0.187484 C18 0.462656 0.779462 0.799686 0.44539 C19 0.292017 0.481765 0.728527 0.188722 C20 0.180351 -0.20945 -0.603932 0.106578 C21 0.234978 0.822389 0.911955 0.47093 C22 -0.39478 0.691545 0.798415 0.275771 C23 - 0.126328 0.109239 0.271674 C24 0.704488 0.517981 C25 - 0.301386 C26 - C27 C28 C29 C30 C31 C32 C33 C34 C35 C36 C37 C38 C39 Continued

448 Appendix O continued

Characters C27 C28 C29 C30 C1 0.125143 0.160062 -0.124697 0.105773 C2 -0.331646 -0.337393 0.147806 0.378699 C3 -0.572214 -0.437604 -4.91E-02 0.479234 C4 -1.01E-02 2.00E-02 -5.91E-02 0.286452 C5 0.163563 0.231654 -0.210229 -8.65E-02 C6 -0.471092 -0.406986 5.79E-02 0.531438 C7 0.512784 0.509556 -0.203039 -0.408377 C8 0.541284 0.393608 8.93E-02 -0.504608 C9 1.31E-02 -7.20E-03 3.73E-02 -5.43E-02 C10 -0.129378 -4.36E-02 -0.127491 0.458201 C11 8.37E-02 7.68E-02 -1.97E-02 -2.95E-02 C12 0.696613 0.610242 -0.103288 -0.668439 C13 0.958417 0.821603 -0.104259 -0.80834 C14 0.678287 0.544513 3.97E-03 -0.635028 C15 0.783407 0.706764 -0.159274 -0.64629 C16 0.783407 0.751412 -8.71E-02 -0.710315 C17 7.18E-02 5.52E-02 5.51E-03 -0.200495 C18 0.799151 0.696892 -0.111807 -0.658682 C19 0.654726 0.626698 -0.20893 -0.50152 C20 -0.530891 -0.574779 0.309605 0.338561 C21 0.925437 0.803855 -0.12282 -0.754263 C22 0.78923 0.808972 -0.364502 -0.707218 C23 0.127656 -7.58E-02 0.375909 1.54E-02 C24 0.852842 0.735425 -0.101879 -0.71926 C25 0.858683 0.778517 -0.182665 -0.710404 C26 0.546235 0.420157 4.18E-02 -0.473668 C27 - 0.883325 -0.163658 -0.78216 C28 - -0.607004 -0.703141 C29 - 0.153765 C30 - C31 C32 C33 C34 C35 C36 C37 C38 C39 Continued

449 Appendix O continued

Characters C31 C32 C33 C34 C1 0.179835 0.189257 -0.367369 0.649762 C2 -0.290743 -0.290519 -0.24372 0.713375 C3 -0.610373 -0.471909 -5.85E-02 0.241825 C4 5.07E-03 0.196321 -5.69E-02 0.522172 C5 0.223554 0.276123 -0.356444 0.556248 C6 -0.557358 -0.542503 -0.313037 0.620413 C7 0.62558 0.577466 -0.390886 0.286076 C8 0.418067 0.251771 0.521049 -1 C9 -0.120711 -0.15372 0.394911 -0.657342 C10 -0.193824 -9.71E-02 -0.377361 0.605811 C11 7.36E-02 1.62E-02 -0.325995 0.542063 C12 0.637691 0.506733 0.346793 -0.691903 C13 0.895811 0.692709 0.154446 -0.670304 C14 0.723926 0.569042 9.43E-02 -0.585753 C15 0.70762 0.44666 6.87E-02 -0.51321 C16 0.771244 0.611703 7.05E-02 -0.598965 C17 9.30E-02 -1.00E-03 0.338978 -0.466102 C18 0.745077 0.573443 0.384054 -0.609781 C19 0.608436 0.40389 0.237157 -0.459412 C20 -0.450513 -0.472432 0.336061 0.187125 C21 0.844267 0.689674 0.19942 -0.717806 C22 0.832757 0.71437 -0.153511 -0.347141 C23 -6.34E-02 -0.134503 0.516495 -0.468885 C24 0.825958 0.624157 0.224054 -0.580041 C25 0.82778 0.642454 6.55E-02 -0.61182 C26 0.40453 0.124947 0.205915 -0.485896 C27 0.921351 0.744557 2.98E-02 -0.541284 C28 0.837249 0.757108 1.44E-02 -0.393608 C29 -0.200026 -0.331089 2.03E-02 -8.93E-02 C30 -0.838897 -0.599172 -1.58E-02 0.504608 C31 - 0.816996 -3.97E-02 -0.418067 C32 - -0.146267 -0.251771 C33 - -0.521049 C34 - C35 C36 C37 C38 C39 Continued

450 Appendix O continued

Characters C35 C36 C37 C38 C1 -0.177485 0.20792 -0.48417 -0.235499 C2 -0.467605 -6.65E-02 -0.540427 -0.450885 C3 -0.689507 -0.700647 -7.56E-02 0.303488 C4 3.07E-02 0.145669 -0.133694 -0.349297 C5 -0.127433 0.202788 -0.411667 -4.81E-02 C6 -0.687503 -0.527279 -0.280457 -0.171146 C7 0.110578 0.449455 -0.391321 0.21943 C8 0.698411 0.268761 0.604328 0.348608 C9 5.48E-02 -0.317009 0.452023 0.53033 C10 -0.437211 -0.202943 -0.336787 -0.14971 C11 -0.377738 -6.56E-02 -0.422338 0.154797 C12 0.622715 0.426589 0.315068 0.6076 C13 0.81876 0.703305 0.243808 0.413945 C14 0.628616 0.722611 -3.14E-0 0.360387 C15 0.570859 0.56298 8.31E-02 0.432576 C16 0.732252 0.624858 0.222999 0.48422 C17 0.116353 -5.39E-02 0.218837 0.121145 C18 0.8208 0.616588 0.3503 0.231541 C19 0.382755 0.20111 0.26678 0.510059 C20 -0.15888 -0.258942 9.93E-02 -0.510652 C21 0.833897 0.708733 0.257381 0.457304 C22 0.504561 0.776949 -0.260918 0.53372 C23 0.421717 -0.163088 0.75433 -0.185805 C24 0.727949 0.700522 0.126734 0.314331 C25 0.696968 0.697468 8.93E-02 0.501221 C26 0.44919 0.186532 0.372312 0.233149 C27 0.722382 0.691196 0.130517 0.487171 C28 0.572644 0.572399 7.42E-02 0.607506 C29 1.95E-02 -3.28E-02 6.52E-02 -0.452599 C30 -0.595985 -0.613583 -5.58E-02 -0.501688 C31 0.639921 0.759853 -6.10E-02 0.452182 C32 0.5786 0.680197 -4.70E-02 0.433364 C33 0.426533 -0.111664 0.699169 -0.186805 C34 -0.698411 -0.268761 -0.604328 -0.348608 C35 - 0.690157 0.499843 3.30E-02 C36 - -0.281804 8.90E-02 C37 - -6.28E-02 C38 - C39 Continued

451 Appendix O continued

Characters C39 C1 0.82115 C2 0.6804 C3 0.103457 C4 0.533129 C5 0.80533 C6 0.524591 C7 0.511262 C8 -0.843183 C9 -0.632271 C10 0.61434 C11 0.728279 C12 -0.397796 C13 -0.311761 C14 -0.372453 C15 -0.142077 C16 -0.26968 C17 -0.442822 C18 -0.310296 C19 -0.135204 C20 -3.82E-02 C21 -0.373484 C22 3.25E-04 C23 -0.481992 C24 -0.237696 C2 -0.31708 C26 -0.189801 C27 -0.142419 C28 -1.25E-02 C29 -0.215149 C30 0.172608 C31 -6.45E-02 C32 -3.07E-02 C33 -0.489666 C34 0.843183 C35 -0.517511 C36 -5.43E-02 C37 -0.621144 C38 -6.63E-02 C39 -

452