Introduction to Theoretical CS Regular Expressions

Total Page:16

File Type:pdf, Size:1020Kb

Load more

Why Learn Theory? Introduction to Theoretical CS In theory … • Deeper understanding of what is a computer and computing. • Foundation of all modern computers. • Pure science. • Philosophical implications. Fundamental questions: Q. What can a computer do? In practice … Q. What can a computer do with limited resources? • Web search: theory of pattern matching. • Sequential circuits: theory of finite state automata. General approach. • Compilers: theory of context free grammars. • Don't talk about specific machines or problems. • Cryptography: theory of computational complexity. • Consider minimal abstract machines. • Data compression: theory of information. • Consider general classes of problems. Why Learn Theory? In theory … Regular Expressions • Deeper understanding of what is a computer and computing. • Foundation of all modern computers. • Pure science. • Philosophical implications. In practice … • Web search: theory of pattern matching. • Sequential circuits: theory of finite state automata. • Compilers: theory of context free grammars. • Cryptography: theory of computational complexity. • Data compression: theory of information. “ In theory there is no difference between theory and practice. In practice there is.” – Yogi Berra Pattern Matching Pattern Matching Application Pattern matching problem. Is a given string in a specified set of strings? PROSITE. Huge database of protein families and domains. Ex. [genomics] Q. How to describe a protein motif? • Fragile X syndrome is a common cause of mental retardation. • Human genome contains triplet repeats of CGG or AGG, Ex. [signature of the C2H2-type zinc finger domain] bracketed by GCG at the beginning and CTG at the end. 1. C 2. Between 2 and 4 amino acids. Number of repeats is variable, and correlated with syndrome. • 3. C 4. 3 more amino acids. Specified set of strings: “all strings of G, C, T, A having some occurrence 5. One of the following amino acids: LIVMFYWCX. of GCG followed by any number of CGG or AGG triplets, followed by CTG” 6. 8 more amino acids. Q: “Is this string in the set?” 7. H GCGGCGTGTGTGCGAGAGAGTGGGTTTAAAGCTGGCGCGGAGGCGGCTGGCGCGGAGGCTG 8. Between 3 and 5 more amino acids. 9. H A: Yes GCGCGGAGGCGGCTG First step: A. Use a regular expression. Regular expression. A formal notation for specifying a set of strings. CAASCGGPYACGGWAGYHAGWH Pattern Matching Applications Regular Expressions: Basic Operations Test if a string matches some pattern. Regular expression. Notation to specify a set of strings. • Process natural language. • Scan for virus signatures. “in specified set” “not in specified set” • Access information in digital libraries. • Search-and-replace in a word processors. operation regular expression matches does not match Filter text (spam, NetNanny, ads, Carnivore, malware). • concatenation aabaab aabaab every other string • Validate data-entry fields (dates, email, URL, credit card). cumulus succubus Search for markers in human genome using PROSITE patterns. .u.u.u. • wildcard jugulum tumultuous aa aa | baab Parse text files. union baab every other string • Compile a Java program. aa ab ab*a • Crawl and index the Web. closure abbba ababa Read in data stored in TOY input file format. • aaaab a(a|b)aab • Automatically create Java documentation from Javadoc comments. abaab every other string parentheses a aa (ab)*a ababababa abbba Regular Expressions: Examples Generalized Regular Expressions Regular expression. Notation is surprisingly expressive. Regular expressions are a standard programmer's tool. • Built in to Java, Perl, Unix, Python, …. • Additional operations typically added for convenience. – Ex 1: [a-e]+ is shorthand for (a|b|c|d|e)(a|b|c|d|e)*. regular expression matches does not match – Ex 2: \s is shorthand for “any whitespace character” (space, tab, ...). .*spb.* raspberry subspace contains the trigraph spb crispbread subspecies operation regular expression matches does not match a* | (a*ba*ba*ba*)* bbb b aaa bb abcde ade multiple of three b’s a(bc)+de bbbaababbaa baabbbaa one or more abcbcde bcde .*0.... lowercase camelCase 1000234 111111111 character class [A-Za-z][a-z]* fifth to last digit is 0 98701234 403982772 Capitalized 4illegal 08540-1321 111111111 [0-9]{5}-[0-9]{4} gcg(cgg|agg)*ctg gcgctg gcgcgg exactly k 19072-5541 166-54-1111 gcgcggctg cggcggcggctg fragile X syndrome indicator gcgcggaggctg gcgcaggctg negation [^aeiou]{6} rhythm decade Regular Expression Challenge 1 Regular Expression Challenge 2 Q. Consider the RE Q. Give an RE that describes the following set of strings: a*bb(ab|ba)* Which of the following strings match (is in the set it describes)? • characters are A, C, T or G • starts with ATG a. abb • length is a multiple of 3 b. abba • ends with TAG, TAA, or TTG c. aaba d. bbbaab e. cbb f. bbababbab Describing a Pattern REs in Java PROSITE. Huge database of protein families and domains. public class String (Java's String library) Q.Q. How to describe a protein motif? does this string match the given boolean matches(String re) regular expression? Ex. [signature of the C H -type zinc finger domain] replace all occurrences of regular 2 2 String replaceAll(String re, String str) 1. C expression with the replacement string return the index of the first occurrence 2. Between 2 and 4 amino acids. int indexOf(String r, int from) 3. C of the string r after the index from 4. 3 more amino acids. split the string around matches of the String[] split(String re) 5. One of the following amino acids: LIVMFYWCX. given regular expression 6. 8 more amino acids. 7. H 8. Between 3 and 5 more amino acids. 9. H String re = "C.{2,4}C...[LIVMFYWC].{8}H.{3,5}H "; String input = "CAASCGGPYACGGAAGYHAGAH"; boolean test = input.matches(re); A. C.{2,4}C...[LIVMFYWC].{8}H.{3,5}H is the input string in the set described by the RE? CAASCGGPYACGGWAGYHAGWH REs in Java REs in Java Validity checking. Is input in the set described by the re? public class String (Java's String library) does this string match the given public class Validate boolean matches(String re) { regular expression? public static void main(String[] args) { replace all occurrences of regular String replaceAll(String re, String str) String re = args[0]; expression with the replacement string String input = args[1]; return the index of the first occurrence StdOut.println(input.matches(re)); int indexOf(String r, int from) } of the string r after the index from } powerful string library method split the string around matches of the String[] split(String re) given regular expression C2H2 type zinc finger domain % java Validate "C.{2,4}C...[LIVMFYWC].{8}H.{3,5}H" CAASCGGPYACGGAAGYHAGAH RE that matches any sequence of true whitespace characters (at least 1). legal Java identifier % java Validate "[$_A-Za-z][$_A-Za-z0-9]*" ident123 Extra \ distinguishes from the string \s+ true String s = StdIn.readAll(); valid email address (simplified) s = s.replaceAll("\\s+", " "); % java Validate "[a-z]+@([a-z]+\.)+(edu|com)" [email protected] true need quotes to "escape" the shell replace each sequence of at least one whitespace character with a single space REs in Java public class String (Java's String library) DFAs does this string match the given boolean matches(String re) regular expression? replace all occurrences of regular String replaceAll(String re, String str) expression with the replacement string return the index of the first occurrence int indexOf(String r, int from) of the string r after the index from split the string around matches of the String[] split(String re) given regular expression String s = StdIn.readAll(); String[] words = s.split("\\s+"); create an array of the words in StdIn Solving the Pattern Match Problem Deterministic Finite State Automaton (DFA) Regular expressions are a concise way to describe patterns. Simple machine with N states. • How would you implement the method matches() ? • Begin in start state. • Hardware: build a deterministic finite state automaton (DFA). • Read first input symbol. • Software: simulate a DFA. • Move to new state, depending on current state and input symbol. • Repeat until last input symbol read. DFA: simple machine that solves a pattern match problem. • Accept input string if last state is labeled Y. • Different machine for each pattern. • Accepts or rejects string specified on input tape. • Focus on true or false questions for simplicity. a a a b b DFA Y N N b Input b b a a b b a b b DFA and RE Duality DFA Challenge 1 RE. Concise way to describe a set of strings. Q. Consider this DFA: DFA. Machine to recognize whether a given string is in a given set. Duality. • For any DFA, there exists a RE that describes the same set of strings. Which of the following sets of strings does it recognize? • For any RE, there exists a DFA that recognizes the same set. a. Bitstrings with at least one 1 b. Bitstrings with an equal number of occurrences of 01 and 10 a* | (a*ba*ba*ba*)* c. Bitstrings with more 1s than 0s d. Bitstrings with an equal number of occurrences of 0 and 1 e. Bitstrings that end in 1 multiple of 3 b's multiple of 3 b's Practical consequence of duality proof: to match RE • build DFA • simulate DFA on input string. DFA Challenge 2 Implementing a Pattern Matcher Q. Consider this DFA: Problem. Given a RE, create program that tests whether given input is in set of strings described. Step 1. Build the DFA. It is actually better to use an NFA, an equivalent (but Which of the following sets of strings does it recognize? • A compiler! more efficient) representation of a DFA. We ignore • See COS 226 or COS 320. that distinction in this lecture. a. Bitstrings with at least one 1 b. Bitstrings with an equal number of occurrences of 01 and 10 Step 2. Simulate it with given input. c.
Recommended publications
  • Pattern Matching Using Similarity Measures

    Pattern Matching Using Similarity Measures

    Pattern matching using similarity measures Patroonvergelijking met behulp van gelijkenismaten (met een samenvatting in het Nederlands) PROEFSCHRIFT ter verkrijging van de graad van doctor aan de Universiteit Utrecht op gezag van Rector Magnificus, Prof. Dr. H. O. Voorma, ingevolge het besluit van het College voor Promoties in het openbaar te verdedigen op maandag 18 september 2000 des morgens te 10:30 uur door Michiel Hagedoorn geboren op 13 juli 1972, te Renkum promotor: Prof. Dr. M. H. Overmars Faculteit Wiskunde & Informatica co-promotor: Dr. R. C. Veltkamp Faculteit Wiskunde & Informatica ISBN 90-393-2460-3 PHILIPS '$ The&&% research% described in this thesis has been made possible by financial support from Philips Research Laboratories. The work in this thesis has been carried out in the graduate school ASCI. Contents 1 Introduction 1 1.1Patternmatching.......................... 1 1.2Applications............................. 4 1.3Obtaininggeometricpatterns................... 7 1.4 Paradigms in geometric pattern matching . 8 1.5Similaritymeasurebasedpatternmatching........... 11 1.6Overviewofthisthesis....................... 16 2 A theory of similarity measures 21 2.1Pseudometricspaces........................ 22 2.2Pseudometricpatternspaces................... 30 2.3Embeddingpatternsinafunctionspace............. 40 2.4TheHausdorffmetric........................ 46 2.5Thevolumeofsymmetricdifference............... 54 2.6 Reflection visibility based distances . 60 2.7Summary.............................. 71 2.8Experimentalresults.......................
  • Pattern Matching Using Fuzzy Methods David Bell and Lynn Palmer, State of California: Genetic Disease Branch

    Pattern Matching Using Fuzzy Methods David Bell and Lynn Palmer, State of California: Genetic Disease Branch

    Pattern Matching Using Fuzzy Methods David Bell and Lynn Palmer, State of California: Genetic Disease Branch ABSTRACT The formula is : Two major methods of detecting similarities Euclidean Distance and 2 a "fuzzy Hamming distance" presented in a paper entitled "F %%y Dij : ; ( <3/i - yj 4 Hamming Distance: A New Dissimilarity Measure" by Bookstein, Klein, and Raita, will be compared using entropy calculations to Euclidean distance is especially useful for comparing determine their abilities to detect patterns in data and match data matching whole word object elements of 2 vectors. The records. .e find that both means of measuring distance are useful code in Java is: depending on the context. .hile fuzzy Hamming distance outperforms in supervised learning situations such as searches, the Listing 1: Euclidean Distance Euclidean distance measure is more useful in unsupervised pattern matching and clustering of data. /** * EuclideanDistance.java INTRODUCTION * * Pattern matching is becoming more of a necessity given the needs for * Created: Fri Oct 07 08:46:40 2002 such methods for detecting similarities in records, epidemiological * * @author David Bell: DHS-GENETICS patterns, genetics and even in the emerging fields of criminal * @version 1.0 behavioral pattern analysis and disease outbreak analysis due to */ possible terrorist activity. 0nfortunately, traditional methods for /** Abstact Distance class linking or matching records, data fields, etc. rely on exact data * @param None matches rather than looking for close matches or patterns. 1f course * @return Distance Template proximity pattern matches are often necessary when dealing with **/ messy data, data that has inexact values and/or data with missing key abstract class distance{ values.
  • Use Perl Regular Expressions in SAS® Shuguang Zhang, WRDS, Philadelphia, PA

    Use Perl Regular Expressions in SAS® Shuguang Zhang, WRDS, Philadelphia, PA

    NESUG 2007 Programming Beyond the Basics Use Perl Regular Expressions in SAS® Shuguang Zhang, WRDS, Philadelphia, PA ABSTRACT Regular Expression (Regexp) enhance search and replace operations on text. In SAS®, the INDEX, SCAN and SUBSTR functions along with concatenation (||) can be used for simple search and replace operations on static text. These functions lack flexibility and make searching dynamic text difficult, and involve more function calls. Regexp combines most, if not all, of these steps into one expression. This makes code less error prone, easier to maintain, clearer, and can improve performance. This paper will discuss three ways to use Perl Regular Expression in SAS: 1. Use SAS PRX functions; 2. Use Perl Regular Expression with filename statement through a PIPE such as ‘Filename fileref PIPE 'Perl programm'; 3. Use an X command such as ‘X Perl_program’; Three typical uses of regular expressions will also be discussed and example(s) will be presented for each: 1. Test for a pattern of characters within a string; 2. Replace text; 3. Extract a substring. INTRODUCTION Perl is short for “Practical Extraction and Report Language". Larry Wall Created Perl in mid-1980s when he was trying to produce some reports from a Usenet-Nes-like hierarchy of files. Perl tries to fill the gap between low-level programming and high-level programming and it is easy, nearly unlimited, and fast. A regular expression, often called a pattern in Perl, is a template that either matches or does not match a given string. That is, there are an infinite number of possible text strings.
  • Lecture 18: Theory of Computation Regular Expressions and Dfas

    Lecture 18: Theory of Computation Regular Expressions and Dfas

    Introduction to Theoretical CS Lecture 18: Theory of Computation Two fundamental questions. ! What can a computer do? ! What can a computer do with limited resources? General approach. Pentium IV running Linux kernel 2.4.22 ! Don't talk about specific machines or problems. ! Consider minimal abstract machines. ! Consider general classes of problems. COS126: General Computer Science • http://www.cs.Princeton.EDU/~cos126 2 Why Learn Theory In theory . Regular Expressions and DFAs ! Deeper understanding of what is a computer and computing. ! Foundation of all modern computers. ! Pure science. ! Philosophical implications. a* | (a*ba*ba*ba*)* In practice . ! Web search: theory of pattern matching. ! Sequential circuits: theory of finite state automata. a a a ! Compilers: theory of context free grammars. b b ! Cryptography: theory of computational complexity. 0 1 2 ! Data compression: theory of information. b "In theory there is no difference between theory and practice. In practice there is." -Yogi Berra 3 4 Pattern Matching Applications Regular Expressions: Basic Operations Test if a string matches some pattern. Regular expression. Notation to specify a set of strings. ! Process natural language. ! Scan for virus signatures. ! Search for information using Google. Operation Regular Expression Yes No ! Access information in digital libraries. ! Retrieve information from Lexis/Nexis. Concatenation aabaab aabaab every other string ! Search-and-replace in a word processors. cumulus succubus Wildcard .u.u.u. ! Filter text (spam, NetNanny, Carnivore, malware). jugulum tumultuous ! Validate data-entry fields (dates, email, URL, credit card). aa Union aa | baab baab every other string ! Search for markers in human genome using PROSITE patterns. aa ab Closure ab*a abbba ababa Parse text files.
  • CSCI 2041: Pattern Matching Basics

    CSCI 2041: Pattern Matching Basics

    CSCI 2041: Pattern Matching Basics Chris Kauffman Last Updated: Fri Sep 28 08:52:58 CDT 2018 1 Logistics Reading Assignment 2 I OCaml System Manual: Ch I Demo in lecture 1.4 - 1.5 I Post today/tomorrow I Practical OCaml: Ch 4 Next Week Goals I Mon: Review I Code patterns I Wed: Exam 1 I Pattern Matching I Fri: Lecture 2 Consider: Summing Adjacent Elements 1 (* match_basics.ml: basic demo of pattern matching *) 2 3 (* Create a list comprised of the sum of adjacent pairs of 4 elements in list. The last element in an odd-length list is 5 part of the return as is. *) 6 let rec sum_adj_ie list = 7 if list = [] then (* CASE of empty list *) 8 [] (* base case *) 9 else 10 let a = List.hd list in (* DESTRUCTURE list *) 11 let atail = List.tl list in (* bind names *) 12 if atail = [] then (* CASE of 1 elem left *) 13 [a] (* base case *) 14 else (* CASE of 2 or more elems left *) 15 let b = List.hd atail in (* destructure list *) 16 let tail = List.tl atail in (* bind names *) 17 (a+b) :: (sum_adj_ie tail) (* recursive case *) The above function follows a common paradigm: I Select between Cases during a computation I Cases are based on structure of data I Data is Destructured to bind names to parts of it 3 Pattern Matching in Programming Languages I Pattern Matching as a programming language feature checks that data matches a certain structure the executes if so I Can take many forms such as processing lines of input files that match a regular expression I Pattern Matching in OCaml/ML combines I Case analysis: does the data match a certain structure I Destructure Binding: bind names to parts of the data I Pattern Matching gives OCaml/ML a certain "cool" factor I Associated with the match/with syntax as follows match something with | pattern1 -> result1 (* pattern1 gives result1 *) | pattern2 -> (* pattern 2..
  • Perl Regular Expressions Tip Sheet Functions and Call Routines

    Perl Regular Expressions Tip Sheet Functions and Call Routines

    – Perl Regular Expressions Tip Sheet Functions and Call Routines Basic Syntax Advanced Syntax regex-id = prxparse(perl-regex) Character Behavior Character Behavior Compile Perl regular expression perl-regex and /…/ Starting and ending regex delimiters non-meta Match character return regex-id to be used by other PRX functions. | Alternation character () Grouping {}[]()^ Metacharacters, to match these pos = prxmatch(regex-id | perl-regex, source) $.|*+?\ characters, override (escape) with \ Search in source and return position of match or zero Wildcards/Character Class Shorthands \ Override (escape) next metacharacter if no match is found. Character Behavior \n Match capture buffer n Match any one character . (?:…) Non-capturing group new-string = prxchange(regex-id | perl-regex, times, \w Match a word character (alphanumeric old-string) plus "_") Lazy Repetition Factors Search and replace times number of times in old- \W Match a non-word character (match minimum number of times possible) string and return modified string in new-string. \s Match a whitespace character Character Behavior \S Match a non-whitespace character *? Match 0 or more times call prxchange(regex-id, times, old-string, new- \d Match a digit character +? Match 1 or more times string, res-length, trunc-value, num-of-changes) Match a non-digit character ?? Match 0 or 1 time Same as prior example and place length of result in \D {n}? Match exactly n times res-length, if result is too long to fit into new-string, Character Classes Match at least n times trunc-value is set to 1, and the number of changes is {n,}? Character Behavior Match at least n but not more than m placed in num-of-changes.
  • Compiling Pattern Matching to Good Decision Trees

    Compiling Pattern Matching to Good Decision Trees

    Submitted to ML’08 Compiling Pattern Matching to good Decision Trees Luc Maranget INRIA Luc.marangetinria.fr Abstract In this paper we study compilation to decision tree, whose We address the issue of compiling ML pattern matching to efficient primary advantage is never testing a given subterm of the subject decisions trees. Traditionally, compilation to decision trees is op- value more than once (and whose primary drawback is potential timized by (1) implementing decision trees as dags with maximal code size explosion). Our aim is to refine naive compilation to sharing; (2) guiding a simple compiler with heuristics. We first de- decision trees, and to compare the output of such an optimizing sign new heuristics that are inspired by necessity, a notion from compiler with optimized backtracking automata. lazy pattern matching that we rephrase in terms of decision tree se- Compilation to decision can be very sensitive to the testing mantics. Thereby, we simplify previous semantical frameworks and order of subject value subterms. The situation can be explained demonstrate a direct connection between necessity and decision by the example of an human programmer attempting to translate a ML program into a lower-level language without pattern matching. tree runtime efficiency. We complete our study by experiments, 1 showing that optimized compilation to decision trees is competi- Let f be the following function defined on triples of booleans : tive. We also suggest some heuristics precisely. l e t f x y z = match x,y,z with | _,F,T -> 1 Categories and Subject Descriptors D 3. 3 [Programming Lan- | F,T,_ -> 2 guages]: Language Constructs and Features—Patterns | _,_,F -> 3 | _,_,T -> 4 General Terms Design, Performance, Sequentiality.
  • Combinatorial Pattern Matching

    Combinatorial Pattern Matching

    Combinatorial Pattern Matching 1 A Recurring Problem Finding patterns within sequences Variants on this idea Finding repeated motifs amoungst a set of strings What are the most frequent k-mers How many time does a specific k-mer appear Fundamental problem: Pattern Matching Find all positions of a particular substring in given sequence? 2 Pattern Matching Goal: Find all occurrences of a pattern in a text Input: Pattern p = p1, p2, … pn and text t = t1, t2, … tm Output: All positions 1 < i < (m – n + 1) such that the n-letter substring of t starting at i matches p def bruteForcePatternMatching(p, t): locations = [] for i in xrange(0, len(t)-len(p)+1): if t[i:i+len(p)] == p: locations.append(i) return locations print bruteForcePatternMatching("ssi", "imissmissmississippi") [11, 14] 3 Pattern Matching Performance Performance: m - length of the text t n - the length of the pattern p Search Loop - executed O(m) times Comparison - O(n) symbols compared Total cost - O(mn) per pattern In practice, most comparisons terminate early Worst-case: p = "AAAT" t = "AAAAAAAAAAAAAAAAAAAAAAAT" 4 We can do better! If we preprocess our pattern we can search more effciently (O(n)) Example: imissmissmississippi 1. s 2. s 3. s 4. SSi 5. s 6. SSi 7. s 8. SSI - match at 11 9. SSI - match at 14 10. s 11. s 12. s At steps 4 and 6 after finding the mismatch i ≠ m we can skip over all positions tested because we know that the suffix "sm" is not a prefix of our pattern "ssi" Even works for our worst-case example "AAAAT" in "AAAAAAAAAAAAAAT" by recognizing the shared prefixes ("AAA" in "AAAA").
  • Unicode Regular Expressions Technical Reports

    Unicode Regular Expressions Technical Reports

    7/1/2019 UTS #18: Unicode Regular Expressions Technical Reports Working Draft for Proposed Update Unicode® Technical Standard #18 UNICODE REGULAR EXPRESSIONS Version 20 Editors Mark Davis, Andy Heninger Date 2019-07-01 This Version http://www.unicode.org/reports/tr18/tr18-20.html Previous Version http://www.unicode.org/reports/tr18/tr18-19.html Latest Version http://www.unicode.org/reports/tr18/ Latest Proposed http://www.unicode.org/reports/tr18/proposed.html Update Revision 20 Summary This document describes guidelines for how to adapt regular expression engines to use Unicode. Status This is a draft document which may be updated, replaced, or superseded by other documents at any time. Publication does not imply endorsement by the Unicode Consortium. This is not a stable document; it is inappropriate to cite this document as other than a work in progress. A Unicode Technical Standard (UTS) is an independent specification. Conformance to the Unicode Standard does not imply conformance to any UTS. Please submit corrigenda and other comments with the online reporting form [Feedback]. Related information that is useful in understanding this document is found in the References. For the latest version of the Unicode Standard, see [Unicode]. For a list of current Unicode Technical Reports, see [Reports]. For more information about versions of the Unicode Standard, see [Versions]. Contents 0 Introduction 0.1 Notation 0.2 Conformance 1 Basic Unicode Support: Level 1 1.1 Hex Notation 1.1.1 Hex Notation and Normalization 1.2 Properties 1.2.1 General
  • Regular Expressions with a Brief Intro to FSM

    Regular Expressions with a Brief Intro to FSM

    Regular Expressions with a brief intro to FSM 15-123 Systems Skills in C and Unix Case for regular expressions • Many web applications require pattern matching – look for <a href> tag for links – Token search • A regular expression – A pattern that defines a class of strings – Special syntax used to represent the class • Eg; *.c - any pattern that ends with .c Formal Languages • Formal language consists of – An alphabet – Formal grammar • Formal grammar defines – Strings that belong to language • Formal languages with formal semantics generates rules for semantic specifications of programming languages Automaton • An automaton ( or automata in plural) is a machine that can recognize valid strings generated by a formal language . • A finite automata is a mathematical model of a finite state machine (FSM), an abstract model under which all modern computers are built. Automaton • A FSM is a machine that consists of a set of finite states and a transition table. • The FSM can be in any one of the states and can transit from one state to another based on a series of rules given by a transition function. Example What does this machine represents? Describe the kind of strings it will accept. Exercise • Draw a FSM that accepts any string with even number of A’s. Assume the alphabet is {A,B} Build a FSM • Stream: “I love cats and more cats and big cats ” • Pattern: “cat” Regular Expressions Regex versus FSM • A regular expressions and FSM’s are equivalent concepts. • Regular expression is a pattern that can be recognized by a FSM. • Regex is an example of how good theory leads to good programs Regular Expression • regex defines a class of patterns – Patterns that ends with a “*” • Regex utilities in unix – grep , awk , sed • Applications – Pattern matching (DNA) – Web searches Regex Engine • A software that can process a string to find regex matches.
  • Regular Expressions

    Regular Expressions

    CS 172: Computability and Complexity Regular Expressions Sanjit A. Seshia EECS, UC Berkeley Acknowledgments: L.von Ahn, L. Blum, M. Blum The Picture So Far DFA NFA Regular language S. A. Seshia 2 Today’s Lecture DFA NFA Regular Regular language expression S. A. Seshia 3 Regular Expressions • What is a regular expression? S. A. Seshia 4 Regular Expressions • Q. What is a regular expression? • A. It’s a “textual”/ “algebraic” representation of a regular language – A DFA can be viewed as a “pictorial” / “explicit” representation • We will prove that a regular expressions (regexps) indeed represent regular languages S. A. Seshia 5 Regular Expressions: Definition σ is a regular expression representing { σσσ} ( σσσ ∈∈∈ ΣΣΣ ) ε is a regular expression representing { ε} ∅ is a regular expression representing ∅∅∅ If R 1 and R 2 are regular expressions representing L 1 and L 2 then: (R 1R2) represents L 1⋅⋅⋅L2 (R 1 ∪∪∪ R2) represents L 1 ∪∪∪ L2 (R 1)* represents L 1* S. A. Seshia 6 Operator Precedence 1. *** 2. ( often left out; ⋅⋅⋅ a ··· b ab ) 3. ∪∪∪ S. A. Seshia 7 Example of Precedence R1*R 2 ∪∪∪ R3 = ( ())R1* R2 ∪∪∪ R3 S. A. Seshia 8 What’s the regexp? { w | w has exactly a single 1 } 0*10* S. A. Seshia 9 What language does ∅∅∅* represent? {ε} S. A. Seshia 10 What’s the regexp? { w | w has length ≥ 3 and its 3rd symbol is 0 } ΣΣΣ2 0 ΣΣΣ* Σ = (0 ∪∪∪ 1) S. A. Seshia 11 Some Identities Let R, S, T be regular expressions • R ∪∪∪∅∅∅ = ? • R ···∅∅∅ = ? • Prove: R ( S ∪∪∪ T ) = R S ∪∪∪ R T (what’s the proof idea?) S.
  • Context-Free Grammar for the Syntax of Regular Expression Over the ASCII

    Context-Free Grammar for the Syntax of Regular Expression Over the ASCII

    Context-free Grammar for the syntax of regular expression over the ASCII character set assumption : • A regular expression is to be interpreted a Haskell string, then is used to match against a Haskell string. Therefore, each regexp is enclosed inside a pair of double quotes, just like any Haskell string. For clarity, a regexp is highlighted and a “Haskell input string” is quoted for the examples in this document. • Since ASCII character strings will be encoded as in Haskell, therefore special control ASCII characters such as NUL and DEL are handled by Haskell. context-free grammar : BNF notation is used to describe the syntax of regular expressions defined in this document, with the following basic rules: • <nonterminal> ::= choice1 | choice2 | ... • Double quotes are used when necessary to reflect the literal meaning of the content itself. <regexp> ::= <union> | <concat> <union> ::= <regexp> "|" <concat> <concat> ::= <term><concat> | <term> <term> ::= <star> | <element> <star> ::= <element>* <element> ::= <group> | <char> | <emptySet> | <emptyStr> <group> ::= (<regexp>) <char> ::= <alphanum> | <symbol> | <white> <alphanum> ::= A | B | C | ... | Z | a | b | c | ... | z | 0 | 1 | 2 | ... | 9 <symbol> ::= ! | " | # | $ | % | & | ' | + | , | - | . | / | : | ; | < | = | > | ? | @ | [ | ] | ^ | _ | ` | { | } | ~ | <sp> | \<metachar> <sp> ::= " " <metachar> ::= \ | "|" | ( | ) | * | <white> <white> ::= <tab> | <vtab> | <nline> <tab> ::= \t <vtab> ::= \v <nline> ::= \n <emptySet> ::= Ø <emptyStr> ::= "" Explanations : 1. Definition of <metachar> in our definition of regexp: Symbol meaning \ Used to escape a metacharacter, \* means the star char itself | Specifies alternatives, y|n|m means y OR n OR m (...) Used for grouping, giving the group priority * Used to indicate zero or more of a regexp, a* matches the empty string, “a”, “aa”, “aaa” and so on Whi tespace char meaning \n A new line character \t A horizontal tab character \v A vertical tab character 2.