Expression Analysis of CCL27 and CCL28 Mrna in Lesional and Non-Lesional Skin of Dogs with Atopic Dermatitis

FULL PAPER Internal Medicine Expression Analysis of CCL27 and CCL28 mRNA in Lesional and Non-Lesional Skin of Dogs with Atopic Dermatitis

Sadatoshi MAEDA1), Hiromi TSUCHIDA1), Sanae SHIBATA1), Tetsuji KAWAKAMI1), Toshihiro TSUKUI2), Yasunori OHBA1), Tsuneo FUKATA1) and Hitoshi KITAGAWA1)

1)Department of Veterinary Internal Medicine, Faculty of Applied Biological Sciences, Gifu University, Gifu 501–1193 and2)Animal Life Science Laboratory, Nippon Zenyaku Kogyo Co., Ltd., 1–1 Tairanoue Sasagawa, Asaka, Koriyama, Fukushima 963–0196, Japan

(Received 8 August 2007/Accepted 11 September 2007)

ABSTRACT. Chemokines are important regulators of the selective recruitment of inflammatory cells into sites of allergic inflammation. Since canine atopic dermatitis (AD) shares many clinical features of human AD, patterns of chemokine production in dogs may also be similar with those in humans. The aim of this study was to examine mRNA expression of CCL27 and CCL28 in lesional skin of dogs with AD to demonstrate similarity of chemokine production with human counterparts. RNA was extracted from skin biopsy specimens of 12 dogs with AD. The mRNA expression of CC chemokines (CCL4, CCL19, CCL20, CCL21, CCL24, CCL27 and CCL28) was analyzed by quantitative real-time PCR and was compared between lesional and non-lesional skin. Seven types of chemokines examined were constitutively expressed in both lesional and non-lesional skin. It was found that mRNA expression levels of CCL27 and CCL28 among the chemokines were significantly different between lesional and non-lesional skin (P<0.05). Expression level of CCL27 mRNA in lesional skin was significantly lower than that in non-lesional skin. On the other hand, CCL28 mRNA expression in lesional skin was found to be higher than that in non-lesional skin. These results suggest that CCL28 but not CCL27 may play important roles in immunopathogenesis of canine AD, indicating that experimental canine study may provide additional information that can be extrapolated to human AD. KEY WORDS: atopic dermatitis, canine, chemokines, real-time RT-PCR. J. Vet. Med. Sci. 70(1): 51–55, 2008

Chemokine receptors are expressed on various types of It has been shown that cutaneous lymphocyte-associated leukocytes and regulate specific or selective cell trafficking antigen (CLA) was preferentially expressed in skin homing [35]. Specific expression profiles of chemokine receptors T cells [2]. Since CLA is a ligand for E-selectin, which is have been demonstrated in two different subsets of helper T- prominently expressed on inflamed vascular endothelium cells, Th1 and Th2 cells [1]. Regarding specific chemokine [25], interaction of CLA and E-selectin most likely mediates receptors, it has been shown that Th1 cells selectively the selective infiltration of skin homing T cells. Recent express CXCR3 [23] and CCR5 [11] whereas Th2 cells studies demonstrated that CLA+ cells exclusively expressed express CCR3 [24] and CCR4 [5]. Thus, the difference of on CCR10 [3] and CCR10+ cells were predominantly infil- expression patterns of the chemokine receptors between trated in humans with AD [3]. Cytokine profile of CCR10+ Th1 and Th2 cells may cause selective infiltration or migra- cells has not been fully characterized; however, these are tion of the cells into inflammatory sites, depending on the less likely categorized as Th2 cells because only 27% of chemokines produced in allergic lesions. In human AD, it CCR10+ cells co-expressed CCR4 in atopic lesion [30]. To was found that CCR4 expression on CD4+ cells was up-reg- date, cutaneous T cell attracting chemokine (CCL27/ ulated [21] and correlated with disease severity [32]. In CTACK) [4] and mucosae-associated epithelial chemokine lesional skin of human AD, CCR4+ cells were found to be (CCL28/MEC) [33] have been identified for the ligands of markedly infiltrated [18], and thus may be involved in the CCR10. Previous studies indicated that both CCL27 [3] and production of a functional ligand for CCR4, thymus and CCL28 [8] were strongly expressed in atopic lesions in activation regulated chemokine (CCL17/TARC), in the humans. The plasma CCL27 [10] and CCL28 [8] levels lesion. The plasma CCL17 level was increased in human were increased in human AD and correlated with disease AD and correlates with disease severity [9]. In lesional skin severity. These results indicated that interaction of CCR10- of human AD, keratinocytes were the major cell source of CCL27 or CCL28 may be important to regulate chemotaxis CCL17 production [29]. In HaCaT cells, CCL17 production of skin-homing T cells. was up-regulated by stimulation with inflammatory cytok- Canine AD shares a number of clinical features with ines including IL-1β, IFN-γ and TNF-α [31]. These results human AD [16]. House dust mite allergen, which is the suggest that CCR4-CCL17 interaction plays an essential most common environmental allergen in humans, has been role in the immunopathogenesis of AD in humans. identified as the most important allergen in canine AD [17]. It has been speculated that a predisposing genetic factor may *CORRESPONDENCE TO: MAEDA, S., Department of Veterinary Inter- nal Medicine, Faculty of Applied Biological Sciences, Gifu Uni- exist in dogs with AD, since there is a high incidence of the versity, 1–1 Yanagido, Gifu 501–1193, Japan. disease in certain breeds and families [28]. Histopathologi- e-mail: [email protected] cal analysis revealed that CD4+ cells were markedly infil- 52 S. MAEDA ET AL. trated in lesional skin of canine AD [26]. A recent study (Xylocaine®, Fujisawa Pharmaceutical Co., Ltd., Osaka, indicated that IL-4 mRNA was preferentially expressed in Japan). If necessary, dogs were sedated by intramuscular lesional skin of dogs with AD [20]. In lesional skin of injection of medetomidine (Domitor®, Orion Corporation, canine AD, expression of CCL17 [12] and CCR4 mRNA Espoo, Finland) at a dose of 0.04 mg/kg and midazolam [14] was detected in conjunction with the expression of (Dormicum®, Roche, Basel, Switzerland) at a dose of 0.3 inflammatory cytokines including IL-1β, IFN-γ and TNF-α mg/kg. A pair of skin biopsy samples was obtained from [12]. Furthermore, it was also found that the number of sites of both lesional and non-lesional skin in each dog with CCR4+ cells was increased in peripheral CD4+ cells from AD. Gross findings of the lesional skin were generally con- dogs with AD [13]. A recent study also demonstrated that sistent among the dogs and included lichenification and hair keratinocytes were major CCL17-producing cells in lesional loss showing characteristic chronic lesion rather than acute skin of dogs with AD [15]. These studies indicate that the lesion. All skin samples were immediately submerged in immunopathogenesis of canine AD may be similar to that of RNA later (Qiagen Inc., Valencia, CA, U.S.A.) and stored at human AD, suggesting that canine AD can be used as an –20°C until the extraction of total RNA. Following homog- animal model for spontaneous allergy rather than a mice enization of skin samples, total RNA was extracted using a model. commercially available kit (RNeasy Plus Mini Kit, Qiagen In this study, the possible association between allergic Inc., Valencia, CA, U.S.A.) and stored at –80°C until reaction and CCL27 and CCL28 was investigated to further expression analysis. clarify similarities in immunopathogenesis between canine Quantitative Real-Time PCR: Transcription of chemok- and human AD. ine mRNA was quantified by one-step real-time PCR (OneStep RT-PCR Kit, Qiagen Inc., Valencia, CA, U.S.A.) MATERIALS AND METHODS according to manufacturer’s instructions. Template amplifi- cation and detection were performed in an ABI Prism 7000 Dog cases with AD: This study was approved by the Sequence Detection System (Applied Biosystems, Foster Institutional Animal Care and Use Committee at Gifu Uni- City, CA, U.S.A.). Sequences of the primer and probe pairs versity. Twelve dogs referred to the Veterinary Medical (QuantiTect Probe RT-PCR Kit, Qiagen Inc., Valencia, CA, Teaching Hospital of Gifu University were diagnosed with U.S.A.) for canine CCL4, 19, 20, 21, 24, 27, 28 and GAPDH AD according to Willemse’s criteria for clinical diagnosis of are listed in Table 1. A comparative CT method was used canine AD [34]. All of the dogs with AD had compatible for quantification of chemokine mRNA expression as previ- historical and clinical findings of AD including seasonal or ously reported [12]. For each sample, the CT values for the recurrent and chronic pruritus. Dogs with other skin dis- target amplicon (chemokines) and the calibrator (GAPDH) eases causing pruritus such as infestation of parasites and were determined to report the relative transcription of the infection of bacteria or fungi were excluded based on rou- amplicon cDNA against calibrator cDNA, respectively. tine dermatologic examinations and a therapeutic trial of The CT value of the calibrator was subtracted from the CT antibiotics. Food hypersensitivity was excluded based on value of the target chemokine (delta CT) to normalize for the negative result by food elimination test, which was per- differences in the amount of total nucleic acid added to each formed with commercial prescription diets for 8 weeks. In reaction and the efficiency of the reverse transcription. All the present study there were no dogs showing improvement samples were examined in duplicate and the mean value of of clinical signs by the food elimination. All dogs showed delta CT was calculated. The amounts of chemokine positive reaction to Dermatophagoides farinae and D. pter- mRNA were calculated by 2-delta CT, resulting in the evalua- onyssinus based on intradermal skin testing, which are the tion of the samples as n-fold difference relative to that of most common environmental allergens for AD in Japan GAPDH mRNA. [17]. Statistical analysis: Paired t-test was used for statistical Skin biopsies and isolation of total RNA: Skin biopsies analysis of chemokine expression between lesional and non- were carried out using a 6-mm disposable punch (DER- lesional skin. A value of P<0.05 was considered to be sta- MAPUNCH®, Nipro Medical Industries Ltd., Tokyo, Japan) tistically significant. Statistical analysis was performed by under local analgesia with 2% lidocaine hydrochloride using the JMP IN 5.1.2 program (SAS institute inc., Cary,

Table 1. Sequences of primers and probes for quantitative real-time sequence detection system Chemokines Forward (5’–3’) Reverse (5’–3’) Probe (5’–3’) CCL4/Mip1β TCCTTTCTCTCCTTGTGCTA GCTGCTGGTCTCAAAGTAATC TCCTCCTACTGCCTGCT CCL19/Mip3β TGGTGCCAATGATGCTGA CAGTCTACAGCCATCCTTGA CCTTTCACTACCTCCTC CCL20/LARC ATGTGCAGTAGCAAGAAT GTATATCGAAGACAGCAA CAAGTCAGAAGCAGCAA CCL21/SLC GCTGTAAAAAGGACAAGGG GGTCTGTGGCTGTTCAGT GGCAAGAAGGGAAAGG CCL24/eotaxin2 TGGGTCCAGAAGTTGATG TTAGATGGAGGTGCTGTTG CCAGGAGGAAGAAGGTGT CCL27/CTACK TGCATCCACCCTCAGAAT TTCCTTGTCAGCCCCAAA GGGACTCTACCTAACCTG CCL28/MEC AAGGCTTCTGGAGAGAGT AGAGTCTTCTGCGCCTGA TTGTGACTTGGCTGCTG GAPDH CTGGAGAAAGCTGCCAAA TGTTGAAGTCACAGGAGA AGAAGGTAGTGAAGCAG CHEMOKINE EXPRESSION IN CANINE ATOPIC DERMATITIS 53

Table 2. Means and standard errors of 2-delta CT of chemokine mRNA expressed in lesional and non- lesional skin samples of dogs with AD 2-delta CT (Mean ± SEM) P value Chemokines Lesional skin Non-lesional skin (lesional vs non-lesional) CCL4/Mip1β 1.6 ± 0.5 × 10–3 0.9 ± 0.2 × 10–3 0.1961 CCL19/Mip3β 2.9 ± 0.8 × 10–3 2.6 ± 0.7 × 10–3 0.5572 CCL20/LARC 8.1 ± 2.6 × 10–3 14.8 ± 7.0 × 10–3 0.4034 CCL21/SLC 4.3 ± 2.2 × 10–2 2.2 ± 0.7 × 10–2 0.3807 CCL24/eotaxin2 6.0 ± 3.2 × 10–3 7.8 ± 2.9 × 10–3 0.7053 CCL27/CTACK 6.4 ± 2.3 × 10–2 22.9 ± 0.5 × 10–2 0.0266 CCL28/MEC 1.8 ± 0.5 × 10–2 0.4 ± 0.1 × 10–2 0.0242

NC, U.S.A.).

RESULTS

Dogs with AD: Twelve dogs were diagnosed with AD based on the clinical diagnostic criteria proposed by Willemse [34]. The dogs with AD consisted of 4 males (1 neutered) and 8 females whose age ranged from 2 to 11 years old (6.1 ± 4.0 years old). All of the dogs with AD had various degrees of pruritic skin lesions with signs such as erythema, hair loss, papules, and lichenification on the ventral abdomen. Lesional skin samples were originated from ventral abdomen, whereas non-lesional skin samples were obtained from lateral thorax, which gross findings did not show any abnormality. Quantitative Real-Time PCR: Quantitative Real-Time PCR was performed to evaluate mRNA expression of CC chemokines, using total RNA samples from both lesional and non-lesional skin samples. Expression of mRNA for the chemokines examined was observed in all samples. Values of 2-delta CT of the chemokines are summarized in Table 2. Statistical analysis revealed that no difference of the expression levels of CCL4, 19, 20, 21 and 24 between lesional and non-lesional skin samples. Of the 12 cases, eight cases indicated lower expression of CCL27 in lesional compared to non-lesional skin (Fig. 1A), which was statistically significant (P=0.027). On the other hand, expression levels of CCL28 in lesional skin were statistically higher than those in non-lesional skin from most cases except for one case (P=0.024) (Fig. 1B).

DISCUSSION Fig. 1. 2-delta CT of CCL27/CTACK (A) and CCL28/MEC (B) in It was reported that skin-infiltrating lymphocytes express lesional (L) and non-lesional (NL) skin samples of 12 dogs with AD. CCR10 in patients with psoriasis, atopic or contact allergic dermatitis [3]. Effecter function of CCR10+ cells has not been determined based on cytokine production because CCL28 may play an important role on T-cell skin homing. CCR10+ cells showed mixed IL-2/IL-4 expression pattern Further investigation demonstrated that CCR10+ cells did and minor proportion expressed CCR4 [30]. Since its not express CD27 and CCR7, markers of naive cells [27]. ligands, CCL27 and CCL28, were preferentially expressed Thus, CCR10+ cells could be associated with effecter but in inflamed skin [3, 8] and their serum levels were increased not trafficking phenotypes. Initially, CCR10 would be nec- in humans with AD [8, 10], CCR10-CCL27 or CCR10- essary for cutaneous homing of T cells; however, CCR10+ T 54 S. MAEDA ET AL. cells were determined to have no advantage over CCR4+ T 134. cells in T cell homing [27]. A recent study also suggested 2. Clark, R. A., Chong, B., Mirchandani, N., Brinster, N. K., that CCR10 may play more important roles for the migra- Yamanaka, K., Dowgiert, R. K. and Kupper, T. S. 2006. The tion of keratinocyte precursor cells from bone marrow [6]. vast majority of CLA+ T cells are resident in normal skin. J. In the present study, we confirmed lower expression of Immunol. 176: 4431–4439. 3. Homey, B., Alenius, H., Muller, A., Soto, H., Bowman, E. P., CCL27 mRNA compared with non-lesional skin. This Yuan, W., McEvoy, L., Lauerma, A. I., Assmann, T., Bune- result is consistent with a human study reporting lower mann, E., Lehto, M., Wolff, H., Yen, D., Marxhausen, H., To, expression of CCL27 in chronic skin lesion compared with W., Sedgwick, J., Ruzicka, T., Lehmann, P. and Zlotnik, A. normal skin [19]. Taken together with previous results in 2002. CCL27-CCR10 interactions regulate T cell-mediated humans, CCL27 may be less associated with chemoattrac- skin inflammation. Nat. Med. 8: 157–165. tion for T-cells infiltrating chronic lesional skin. 4. Homey, B., Wang, W., Soto, H., Buchanan, M. E., Wiesen- CCL28 is the latest CC chemokine that was identified by born, A., Catron, D., Muller, A., McClanahan, T. K., Dieu- searching the Human Genome Science and GenBank Nosjean, M. C., Orozco, R., Ruzicka, T., Lehmann, P., Old- dbEST databases [33]. Expression of CCL28 has been con- ham, E. and Zlotnik, A. 2000. Cutting edge: the orphan firmed in mucosal epithelial surfaces such as skin and colon chemokine receptor G protein-coupled receptor-2 (GPR-2, CCR10) binds the skin-associated chemokine CCL27 [33]. Like CCL27, CCL28 was initially determined as a (CTACK/ALP/ILC). J. Immunol. 164: 3465–3470. ligand for CCR10, and a later study demonstrated that 5. Imai, T., Nagira, M., Takagi, S., Kakizaki, M., Nishimura, M., CCL28 could also induce chemotaxis of eosinophils Wang, J., Gray, P. W., Matsushima, K. and Yoshie, O. 1999. expressing CCR3 [22]. CCL28 was strongly expressed in Selective recruitment of CCR4-bearing Th2 cells toward anti- epidermal keratinocytes of humans with AD [8], suggesting gen-presenting cells by the CC chemokines thymus and activa- an involvement of CCL28 in the pathogenesis of human tion-regulated chemokine and macrophage-derived chemokine. AD. However, no study was conducted to compare levels of Int. Immunol. 11: 81–88. mRNA expression between lesional and non-lesional skin. 6. Inokuma, D., Abe, R., Fujita, Y., Sasaki, M., Shibaki, A., The present study is the first to analyze expression levels in Nakamura, H., McMillan, J. R., Shimizu, T. and Shimizu, H. skin of the dogs with AD, indicating higher expression of 2006. CTACK/CCL27 accelerates skin regeneration via accumulation of bone marrow-derived keratinocytes. Stem Cells 24: CCL28 mRNA in lesional skin compared to non-lesional 2810–2816. skin. Although little is known about which CCR10 or 7. John, A. E., Thomas, M. S., Berlin, A. A. and Lukacs, N. W. CCR3 can preferentially bind to CCL28, a recent study indi- 2005. Temporal production of CCL28 corresponds to eosino- cated that CCL28 regulated eoshinophil recruitment via phil accumulation and airway hyperreactivity in allergic airway CCR3 in allergic inflammation [7]. In this study, histo- inflammation. Am. J. Pathol. 166: 345–353. pathological examination was carried out in all cases, show- 8. Kagami, S., Kakinuma, T., Saeki, H., Tsunemi, Y., Fujita, H., ing infiltration of eosinophils in lesional skin (data not Sasaki, K., Nakamura, K., Takekoshi, T., Kishimoto, M., Mit- shown); nevertheless, no difference was found on mRNA sui, H., Komine, M., Asahina, A. and Tamaki, K. 2005. expression level of CCL24/eotaxin2, which is one of the Increased serum CCL28 levels in patients with atopic dermati- chemokine recruiting eosinophils. It may be possible that tis, psoriasis vulgaris and bullous pemphigoid. J. Invest. Der- matol. 124: 1088–1090. CCL28 may play an essential role for infiltration of eosino- 9. Kakinuma, T., Nakamura, K., Wakugawa, M., Mitsui, H., phils, not T-cells, in atopic skin lesions. To prove this Tada, Y., Saeki, H., Torii, H., Asahina, A., Onai, N., Matsush- hypothesis, expression analysis of not only other chemok- ima, K. and Tamaki, K. 2001. Thymus and activation-regulated ines for eosinophils such as CCL11/eotaxin, CCL26/ chemokine in atopic dermatitis: Serum thymus and activation- eotaxin3 and CCL5/RANTES, but also CCR3 and CCR10, regulated chemokine level is closely related with disease activ- should be investigated in future prospective studies. ity. J. Allergy Clin. Immunol. 107: 535–541. In conclusion, expression analysis of ligands for CCR10 10. Kakinuma, T., Saeki, H., Tsunemi, Y., Fujita, H., Asano, N., suggests that CCL28 but not CCL27 may play important Mitsui, H., Tada, Y., Wakugawa, M., Watanabe, T., Torii, H., roles in immunopathogenesis of AD, indicating that experi- Komine, M., Asahina, A., Nakamura, K. and Tamaki, K. 2003. mental canine study may provide additional information Increased serum cutaneous T cell-attracting chemokine (CCL27) levels in patients with atopic dermatitis and psoriasis that can be extrapolated to human AD. vulgaris. J. Allergy Clin. Immunol. 111: 592–597. 11. Loetscher, P., Uguccioni, M., Bordoli, L., Baggiolini, M., ACKNOWLEDGMENT. This work was supported by a Moser, B., Chizzolini, C. and Dayer, J. M. 1998. CCR5 is char- Ministry of Education, Science, Sports and Culture Grant- acteristic of Th1 lymphocytes. Nature 391: 344–345. in-Aid for Scientific Research. 12. Maeda, S., Fujiwara, S., Omori, K., Kawano, K., Kurata, K., Masuda, K., Ohno, K. and Tsujimoto, H. 2002. Lesional REFERENCES expression of thymus and activation-regulated chemokine in canine atopic dermatitis. Vet. Immunol. Immunopathol. 88: 79– 1. Bonecchi, R., Bianchi, G., Bordignon, P. P., D’Ambrosio, D., 87. Lang, R., Borsatti, A., Sozzani, S., Allavena, P., Gray, P. A., 13. Maeda, S., Ohmori, K., Yasuda, N., Kurata, K., Sakaguchi, M., Mantovani, A. and Sinigaglia, F. 1998. Differential expression Masuda, K., Ohno, K. and Tsujimoto, H. 2004. Increase of CC of chemokine receptors and chemotactic responsiveness of chemokine receptor 4-positive cells in the peripheral CD4+ type 1 T helper cells (Th1s) and Th2s. J. Exp. Med. 187: 129– cells in dogs with atopic dermatitis or experimentally sensi- CHEMOKINE EXPRESSION IN CANINE ATOPIC DERMATITIS 55

tized to Japanese cedar pollen. Clin. Exp. Allergy. 34: 1467– tive expression of the eotaxin receptor CCR3 by human T 1473. helper 2 cells. Science 277: 2005–2007. 14. Maeda, S., Okayama, T., Omori, K., Masuda, K., Sakaguchi, 25. Santamaria, Babi, L. F., Picker, L. J., Perez, Soler, M. T., Drzi- M., Ohno, K. and Tsujimoto, H. 2002. Expression of CC malla, K., Flohr, P., Blaser, K. and Hauser, C. 1995. Circulat- chemokine receptor 4 (CCR4) mRNA in canine atopic skin ing allergen-reactive T cells from patients with atopic lesion. Vet. Immunol. Immunopathol. 90: 145–154. dermatitis and allergic contact dermatitis express the skin- 15. Maeda, S., Tsukui, T., Saze, K., Masuda, K., Ohno, K., selective homing receptor, the cutaneous lymphocyte-associ- Tsujimoto, H. and Iwabuchi, S. 2005. Production of a mono- ated antigen. J. Exp. Med. 181: 1935–1940. clonal antibody to canine thymus and activation-regulated 26. Sinke, J. D., Thepen, T., Bihari, I. C., Rutten, V. P. and chemokine (TARC) and detection of TARC in lesional skin Willemse, T. 1997. Immunophenotyping of skin-infiltrating T- from dogs with atopic dermatitis. Vet. Immunol. Immuno- cell subsets in dogs with atopic dermatitis. Vet. Immunol. pathol. 103: 83–92. Immunopathol. 57: 13–23. 16. Marsella, R., Olivry, T. 2003. Animal models of atopic derma- 27. Soler, D., Humphreys, T. L., Spinola, S. M. and Campbell, J. J. titis. Clin. Dermatol. 21: 122–133. 2003. CCR4 versus CCR10 in human cutaneous TH lympho- 17. Masuda, K., Sakaguchi, M., Fujiwara, S., Kurata, K., Yamash- cyte trafficking. Blood 101: 1677–1682. ita, K., Odagiri, T., Nakao, Y., Matsuki, N., Ono, K., Watari, 28. Sousa, C. A., Marsella, R. 2001. The ACVD task force on T., Hasegawa, A. and Tsujimoto, H. 2000. Positive reactions to canine atopic dermatitis (II): genetic factors. Vet. Immunol. common allergens in 42 atopic dogs in Japan. Vet. Immunol. Immunopathol. 81: 153–157. Immunopathol. 73: 193–204. 29. Vestergaard, C., Bang, K., Gesser, B., Yoneyama, H., Mat- 18. Nakatani, T., Kaburagi, Y., Shimada, Y., Inaoki, M., Takehara, sushima, K. and Larsen, C. G. 2000. A Th2 chemokine, TARC, K., Mukaida, N. and Sato, S. 2001. CCR4 memory CD4+ T produced by keratinocytes may recruit CLA+CCR4+ lympho- lymphocytes are increased in peripheral blood and lesional skin cytes into lesional atopic dermatitis skin. J. Invest. Dermatol. from patients with atopic dermatitis. J. Allergy Clin. Immunol. 115: 640–646. 107: 353–358. 30. Vestergaard, C., Deleuran, M., Gesser, B. and Gronhoj, Larsen, 19. Nomura, I., Gao, B., Boguniewicz, M., Darst, M. A., Travers, C. 2003. Expression of the T-helper 2-specific chemokine J. B. and Leung, D. Y. 2003. Distinct patterns of gene expres- receptor CCR4 on CCR10-positive lymphocytes in atopic der- sion in the skin lesions of atopic dermatitis and psoriasis: a matitis skin but not in psoriasis skin. Br. J. Dermatol. 149: gene microarray analysis. J. Allergy Clin. Immunol. 112: 1195– 457–463. 1202. 31. Vestergaard, C., Kirstejn, N., Gesser, B., Mortensen, J. T., 20. Nuttall, T. J., Knight, P. A., McAleese, S. M., Lamb, J. R. and Matsushima, K. and Larsen, C. G. 2001. IL-10 augments the Hill, P. B. 2002. Expression of Th1, Th2 and immunosuppres- IFN-gamma and TNF-alpha induced TARC production in sive cytokine gene transcripts in canine atopic dermatitis. Clin. HaCaT cells: a possible mechanism in the inflammatory reac- Exp. Allergy 32: 789–795. tion of atopic dermatitis. J. Dermatol. Sci. 26: 46–54. 21. Okazaki, H., Kakurai, M., Hirata, D., Sato, H., Kamimura, T., 32. Wakugawa, M., Nakamura, K., Kakinuma, T., Onai, N., Mat- Onai, N., Matsushima, K., Nakagawa, H., Kano, S. and sushima, K. and Tamaki, K. 2001. CC chemokine receptor 4 Minota, S. 2002. Characterization of chemokine receptor expression on peripheral blood CD4+ T cells reflects disease expression and cytokine production in circulating CD4+ T cells activity of atopic dermatitis. J. Invest. Dermatol. 117: 188– from patients with atopic dermatitis: up-regulation of C-C 196. chemokine receptor 4 in atopic dermatitis. Clin. Exp. Allergy 33. Wang, W., Soto, H., Oldham, E. R., Buchanan, M. E., Homey, 32: 1236–1242. B., Catron, D., Jenkins, N., Copeland, N. G., Gilbert, D. J., 22. Pan, J., Kunkel, E. J., Gosslar, U., Lazarus, N., Langdon, P., Nguyen, N., Abrams, J., Kershenovich, D., Smith, K., Broadwell, K., Vierra, M. A., Genovese, M. C., Butcher, E. C. McClanahan, T., Vicari, A. P. and Zlotnik, A. 2000. Identifica- and Soler, D. 2000. A novel chemokine ligand for CCR10 and tion of a novel chemokine (CCL28), which binds CCR10 CCR3 expressed by epithelial cells in mucosal tissues. J. (GPR2). J. Biol. Chem. 275: 22313–22323. Immunol. 165: 2943–2949. 34. Willemse, T. 1986. Atopic skin disease: a review and a recon- 23. Sallusto, F., Lenig, D., Mackay, C. R. and Lanzavecchia, A. sideration of diagnostic criteria. J. Small Anim. Pract. 27: 771– 1998. Flexible programs of chemokine receptor expression on 778. human polarized T helper 1 and 2 lymphocytes. J. Exp. Med. 35. Zlotnik, A. and Yoshie, O. 2000. Chemokines: a new classifi- 187: 875–883. cation system and their role in immunity. Immunity 12: 121– 24. Sallusto, F., Mackay, C. R. and Lanzavecchia, A. 1997. Selec- 127.