TNFRSF19 Inhibits Tgfb Signaling Through Interaction with Tgfb

Published OnlineFirst May 7, 2018; DOI: 10.1158/0008-5472.CAN-17-3205

Cancer Molecular Cell Biology Research

TNFRSF19 Inhibits TGFb Signaling through Interaction with TGFb Receptor Type I to Promote Tumorigenesis Chengcheng Deng, Yu-Xin Lin, Xue-Kang Qi, Gui-Ping He, Yuchen Zhang, Hao-Jiong Zhang, Miao Xu, Qi-Sheng Feng, Jin-Xin Bei, Yi-Xin Zeng, and Lin Feng

Abstract

Genetic susceptibility underlies the pathogenesis of cancer. We and others TNFRSF19 (–) normal cell TNFRSF19 (+) cancer cell have previously identified a novel susceptibility gene TNFRSF19,which TGFβ TGFβ encodes an orphan member of the TNF 1 receptor superfamily known to be asso- II II 9 II II II ciated with nasopharyngeal carcinoma II (NPC) and lung cancer risk. Here, we p p-Smad2/3 show that TNFRSF19 is highly expressed p in NPC and is required for cell proliferation and NPC development. However, Smad2/3/4 complex unlike most of the TNF receptors, TNFRSF19 was not involved in NFkB P21 activation or associated with TRAF pro- P21 fi b teins. We identi ed TGF receptor type I PAI-1 PAI-1 (TbRI) as a specific binding partner for TNFRSF19. TNFRSF19 bound the kinase domain of TbRI in the cytoplasm, thereby blocking Smad2/3 association with TbRI and subsequent signal transduction. Ectopic expression of TNFRSF19 in normal epithelial cells conferred resis- Growth inhibition Tumorigenesis tance to the cell-cycle block induced by β b TNFRSF19 is highly expressed in cancer cells and associates with TGF receptor type-I to block TGF , whereas knockout of TNFRSF19 Smad2/3 recruitment and TGFβ signal transduction. in NPC cells unleashed a potent TGFb response characterized by upregulation © 2018 American Association for Cancer Research of Smad2/3 phosphorylation and TGFb target gene transcription. Furthermore, elevated TNFRSF19 expression correlated with reduced TGFb activity and poor prognosis in patients with NPC. Our data reveal that gain of function of TNFRSF19 in NPC represents a mechanism by which tumor cells evade the growth-inhibitory action of TGFb. Significance: TNFRSF19, a susceptibility gene for nasopharyngeal carcinoma and other cancers, functions as a potent inhibitor of the TGFb signaling pathway. Graphical Abstract: http://cancerres.aacrjournals.org/content/canres/78/13/3469/F1.large.jpg. Cancer Res; 78(13); 3469–83. 2018 AACR.

Department of Experimental Research, Sun Yat-sen University Cancer Center, Introduction State Key Laboratory Oncology in South China, Collaborative Innovation Center for Cancer Medicine, Guangzhou, China. Nasopharyngeal carcinoma (NPC) is a malignant tumor that originates in the nasopharynx epithelium. Multiple factors, Note: Supplementary data for this article are available at Cancer Research – Online (http://cancerres.aacrjournals.org/). including genetic susceptibility, Epstein Barr virus (EBV) infection, and environmental factors, contribute to NPC devel- C. Deng, Y.-X. Lin, and X.-K. Qi contributed equally to this article. opment. NPC exhibits a striking geographic and ethnic distri- CorrespondingAuthors: Lin Feng, Sun Yat-senUniversity CancerCenter,651 Dong bution; the incidence of NPC is unusually high in Southeast Feng Road East, Guangzhou 510060, China. Phone: 8620-8734-2626; Fax: 8620- Asia, southern China, and North Africa. In addition, familiar 8734-3171; E-mail: [email protected]; and Yi-Xin Zeng, [email protected] aggregation of NPC and the occurrence of multiple cases of the doi: 10.1158/0008-5472.CAN-17-3205 disease in ﬁrst-degree relatives have been reported in endemic 2018 American Association for Cancer Research. regions, strongly indicating that genetic susceptibility plays a

www.aacrjournals.org 3469

Deng et al.

key role in NPC (1, 2). However, little is known about the CO2. All the NPE and NPC cell lines used in this study were precise genetic changes attributable to the pathogenesis of authenticated using short tandem repeat profiling. All cell lines NPC (3–5). were tested Mycoplasma-free as determined by PCR-based method The fundamental abnormality resulting in the development of (16s rDNA-F: 50-ACTCCTACGGGAGGCAGCAGTA-30, 16s rDNA- cancer is the uncontrolled cell proliferation. Cytokine TGFb is one R: 50-TGCACCATCTGTCACTCTGTTAACCTC-30). Mycoplasma of the few classes of endogenous inhibitors of cell growth. TGFb testing was carried out every 2 or 3 weeks, and the cells were not signals through a complex of membrane-bound type I (TbRI) and cultured for more than 2 months. type II (TbRII) receptors, both of which are serine/threonine Transfection using PEI as well as lentiviral packaging and kinases. TbRII activates TbRI upon formation of the ligand– infection were performed as described previously (22). receptor complex by phosphorylating the cytoplasmic GS domain of TbRI, which turns on the kinase activity of TbRI, followed by the Constructs, reagents, and antibodies phosphorylation of receptor-regulated Smads (R-Smads) includ- cDNA fragments encoding TNFRSF19.1 (referred as TNFRSF19), ing Smad2 and Smad3 at the C-terminal SSXS motif. Phosphor- TNFRSF19.2, mouse Tory, TNFRSF21, LMP1, TGFbRI, TGFbRII, ylated R-Smads then form a trimeric complex with the common Smad2, Smad3, and Smad4 were subcloned into pDONR201 mediator Smad4 (Co-Smad), which is translocated from the (Invitrogen) entry clones and subsequently transferred to gate- cytoplasm to nucleus to cooperate with other transcriptional way-compatible destination vectors. Point mutants (T204D and modulators to initiate the transcriptional regulation of target K232R) and deletion mutants [DGS (delete 175-204 a.a.), Dkinase genes. Several direct target genes of the TGFb pathway include (delete 208-503 a.a.), and DICD (delete 151-503 a.a.)] of TGFbR1 plasminogen activator inhibitor 1 (PAI-1), the CDK inhibitors were generated using site-directed mutagenesis PCR. All constructs p15INK4b and p21Cip1, and TGFb itself. In addition to canonical were verified by sequencing. Smad-dependent TGFb signaling, the TGFb receptor complex also Recombinant human TGFb1 (240-B) was obtained from R&D mediates non-Smad signaling, including activation of the MAPK, Systems; SB-431542 was from Selleckchem. Erk, p38, and JNK kinases (6). Under physiologic conditions, Rabbit anti-TNFRSF19 antisera were raised by immunizing TGFb arrests the cell cycle at G1 phase to inhibit cell proliferation; rabbits with GST-TNFRSF19 (residues 30-140) fusion proteins in contrast, tumor cells often escape the antiproliferative effects of expressed in and purified from Escherichia coli (E. coli). The antisera TGFb by acquiring loss-of-function mutations or deregulating the were affinity-purified using the AminoLink Plus Immobilization expression of various components in the TGFb pathway (7). and Purification Kit (Pierce). Antibodies against P21 (2947), Aberrations in TGFb pathway genes have been reported in NPC PAI-1 (11907), p-Smad2 (3108), Smad2 (5339), p-Smad3 (8–10), and NPC cells often show a loss of TGFb antiproliferative (9520), Smad3 (9523), Smad4 (9515), p-P38 (4511), P38 response (11, 12). However, it remains unclear what genetic (8690), p-IkBa (2859), IkBa (4814), caspase-3 (9662), HA mutations or the aberrant activities of regulatory molecules are (3724), and GST (2624) were obtained from Cell Signaling the cause of resistance to TGFb in NPC. Technology. Antibodies against TGFbRI (sc-398) and TGFbRII Using a genome-wide association study (GWAS), we have (sc-400) were from Santa Cruz Biotechnology. The antibody previously identified TNFRSF19 as a genetic susceptibility gene against GAPDH (60004-1-Ig) was from Proteintech. Mouse in NPC (13). Subsequently, TNFRSF19 has also been reported anti-FLAG (F3165) and rabbit anti-FLAG (F7425) antibodies were to be a lung cancer susceptibility gene in Han Chinese (14), indi- from Sigma-Aldrich. cating that germline mutations in TNFRSF19 confer a predisposition to certain cancers. TNFRSF19 (TNF Receptor Superfamily Microarray assay Member 19), also known as TROY, belongs to the TNF receptor Total RNA was isolated from CNE-1 and HNE-1 cells and their superfamily, which commonly transduces cytokine signals via a TNFRSF19-knockout (KO) counterparts using TRIzol reagent specific adaptor protein bound to the intracellular domain (ICD). (Invitrogen Corp.) according to the manufacturer's instructions. TNFRSF19 is unique because it does not bind to known TNF The concentration and purity of total RNA were determined by ligands and its ICD exhibits no sequence homology to any other spectrophotometry. RNA integrity was confirmed by agarose gel characterized members of the TNF receptor superfamily (15, 16). electrophoresis. Control and TNFRSF19 KO cells were selected for High expression of TNFRSF19 is associated with poor prognosis microarray analysis. Human Genome U133 Plus 2.0 microarrays in various types of cancer (17–21). However, the signal transduced (Affymetrix Corp.) were used to monitor changes in gene expres- by TNFRSF19 and molecular basis of TNFRSF19 in carcinogene- sion. Total RNA was labeled and processed according to the sis have not been explored. In this study, we characterize TNFRSF19 manufacturer's instructions. The microarray analysis was per- as a potent negative regulator of the TGFb receptor–induced formed by CapitalBio Corporation. A gene was considered to signaling response and a key determinant of NPC pathogenesis. be differentially expressed if it was up- or downregulated by at least 2-fold. Online CapitalBio Molecule Annotation System (MAS) version 3.0 (http://bioinfo.capitalbio.com/mas3/) and Materials and Methods Kyoto Encyclopedia of Genes and Genomes (KEGG) databases Cell lines, transfection, and lentiviral infection were used to perform pathway analyses of the differential genes. The immortalized nasopharyngeal epithelial (NPE) cells Microarray data are available publicly at http://www.ncbi.nlm. NPEC2-Bmi1 and NPEC5-TERT were provided by Dr. Mu-Sheng nih.gov/geo (GEO accession numbers: GSE113328). Zeng [Sun Yat-sen University Cancer Center (SYSUCC), Guangzhou, China] and were maintained in keratinocyte/ GSEA assay serum-free medium (Invitrogen). CNE-1 and HNE-1 cells were Microarray data were downloaded from the GEO database provided by Dr. Chao-Nan Qian (SYSUCC) and maintained in (http://www.ncbi.nlm.nih.gov/geo/) using the accession num- DMEM (Invitrogen) with 10% FBS (Invitrogen) at 37C and 5% bers indicated in Fig. 5C. Gene set enrichment analysis (GSEA)

3470 Cancer Res; 78(13) July 1, 2018 Cancer Research

Characterization of TNFRSF19 as a Repressor of TGFb Pathway

was performed using GSEA 2.2.4 (http://www.broadinstitute. expressed in E. Coli BL21 cells. The GST fusion proteins were org/gsea/). purified with Glutathione Sepharose 4B (GE Healthcare), and the MBP fusion proteins were purified with amylose beads (New Luciferase reporter assay England Biolabs) according to the manufacturers' instructions. (CAGA)12-Luc and the control vector pRL-TK (Promega) For the pull-down assay, bait fusion proteins were incubated with Renilla encoding luciferase were cotransfected into HEK293T cells cell lysates or target proteins in NETN buffer for 2 hours at 4C. or NPC cells using PEI. Luciferase activity was measured 24 hours The beads were washed five times with NETN buffer, and the later using the Dual-Luciferase Reporter Assay System (Promega). bound proteins were separated by SDS-PAGE and analyzed by fi fl The re y luciferase activity values were normalized to those of Western blotting or MS. Renilla, and the ratios of firefly/Renilla activities were determined. The experiments were independently performed in triplicate. Patient enrollment and IHC A cohort of 140 patients with NPC (median age, 44.8 years; fl Immuno uorescence analysis range, 15–74 years) who had undergone definitive treatment with Immunostaining was performed as described previously (23). curative intent at our institute from 2003 to 2011 was evaluated. fl Brie y, cells were incubated with primary antibodies against The cases were selected based on the following criteria: patho- – Smad2 and then with Alexa Fluor Plus 488 conjugated goat logically confirmed NPC with available biopsy specimens for antibodies against rabbit (Invitrogen). The cells were counter- tissue microarray construction; no previous malignant disease or stained with DAPI and imaged with a confocal laser-scanning second primary tumors; and no prior history of radiotherapy, microscope (Olympus FV1000). The data were processed with chemotherapy, or surgery. All the selected NPC samples contained Adobe Photoshop 7.0 software. at least 70% carcinoma tissue as determined by the examination Establishment of TNFRSF19 KO NPC cell lines of frozen sections. All patients were treated with standard curative Gene knockout was performed in cells using the CRISPR/Cas9 radiotherapy with or without chemotherapy. Protocols of the as described previously (24). The sequences of guide RNAs study were approved by Ethic Committees of SYSUCC (gRNA) targeting exon 3 of human TNFRSF19 gene were as (YB2013-04). This study was conducted under the provisions of follows: gRNA#1, CAAGAATTCAGGGATCGGTC and gRNA#2, the Declaration of Helsinki, and informed written consents were GTGTTCCCTGCAACCAGTGT. Knockout clones were verified by obtained from all patients before inclusion. The clinical NPC fi fi Western blotting and Sanger sequencing (see the Supplementary samples were xed in 10% formalin and embedded in paraf n, fi Material for detail). and then sections of the embedded specimens were deparaf - nized and rehydrated. The slides were subjected to appropriate Tandem affinity purification and coimmunoprecipitation antigen retrieval protocols, and endogenous peroxidase activity fi fi Tandem af nity puri cation (TAP) and coimmunoprecipitation was blocked with 10% H2O2 for 10 minutes. The slides were then (co-IP) were carried out as described previously (23). Briefly, exposed to anti-TNFRSF19 antibodies at 4C overnight. Immu- HEK293T cells were transfected with plasmids encoding C-termi- nostaining was performed using the Envision System (Dako). A nal SFB-tagged (S-tag, flag epitope tag, and streptavidin-binding semiquantitative scoring criterion was used for the IHC results, peptide tag) TNFRSF19 to establish stable cells via puromycin whereby both the staining intensity and positive areas were (2 mg/mL) selection. The cells were lysed in NETN buffer contain- recorded. The staining index (values 0–12) was obtained by ing50mmol/L b-glycerophosphate, 10mmol/L NaF, and1 mg/mL multiplying the intensity of TNFRSF19-positive stain (negative, each of pepstatin A and aprotinin. The lysates were centrifuged at 0; weak, 1; moderate, 2; or strong, 3) by the proportion of 12,000 rpm to remove debris and then incubated with streptavi- immunopositive cells of interest (<25%, 1; 25%–50%, 2; din-conjugated beads (Amersham) for 1 hour at 4 C. The beads 50%–75%, 3; or 75%, 4). All scores were subdivided into two were washed five times with NETN buffer and followed by elution categories according to a cut-off value of the ROC curve in the with NETN buffer containing 2 mg/mL biotin (Sigma). The elutes study cohort: low expression (7) and high expression (>7). were incubated with S-protein beads (Novagen) for 4 hours. After five washes, the bound proteins were analyzed by SDS-PAGE, and Statistical analysis mass spectrometry (MS) was performed by PTM BioLabs. SPSS software version 16.0 was used to perform all statistical – For co-IP experiments, cells were washed with ice-cold PBS and analyses. Cumulative survival was calculated using Kaplan Meier then lysed in NETN buffer at 4C for 30 minutes. The crude lysates analysis, and comparison between groups was performed using were cleared by centrifugation at 12,000 rpm and 4Cfor30 the log-rank test. Bivariate correlations between study variables fi minutes, and the supernatants were incubated with S-protein beads were determined using Pearson correlation coef cients. Each fi or anti-HA agarose (Sigma) at 4 C for 4 hours to precipitate SFB- experiment was performed at least three times. The signi cance t tagged or HA-tagged proteins, respectively. For endogenous IP, the of variances between groups was determined by the test. All P < cell lysates were incubated with control IgG or a protein-specific statistical tests were two-sided, and 0.05 was considered fi antibody overnight at 4 C, followed by incubation with protein statistically signi cant. The authenticity of this article has been A/G PLUS-Agarose (Santa Cruz Biotechnology) at 4C for 1 hour. validated by uploading the key raw data onto the Research Data The immunocomplexes were washed four times with NETN buffer Deposit public platform (www.researchdata.org.cn), with the and then subjected to SDS-PAGE and Western blotting. approval RDD number as RDDB2018000310. Pull-down assay Soft agar colony formation, tumor spheroid formation, and GST, GST-fused TNFRSF19 extracellular domain (ECD; 30- xenograft studies 170 a.a.) or ICD (192-423 a.a.), GST-fused full-length TNFRSF19 All procedures were performed as described previously without transmembrane domain (30-170 plus 192-423 a.a.), and (24, 25). All the animal experiments were performed with the MBP-fused TGFbRI ECD (34-134 a.a.) or ICD (148-504 a.a.) were approval of Institutional Animal Care and Use Committee of

www.aacrjournals.org Cancer Res; 78(13) July 1, 2018 3471

Deng et al.

A Normal nasopharynx NPC

Score = 0 Score = 1

P = 15 0.0009

Score = 2 Score = 3 10

5 Expression score 0 Normal Tumor

B C

4.0 6.0 NPC 5.0 3.0 3.0 4.0 2.0 2.0 3.0 NPEC2-BMI1NPEC5-TERTNP69 CNE-1HNE-1CNE-2SUNE-15-8F C666 2.0 1.0 1.0 1.0 TNFRSF19 0.0 0.0 0.0 -1.0 1.0 -1.0 median-centered integrity

2 n n n - n = 23 = 81 = 10 = 35 n = 39 n = 39 GAPDH Normal Brain Normal Hepatocellular Normal Pancreatic Log GBM carcinoma adenocarcinoma Sun et al., 2006 Wurmbach et al., 2007 Badea et al., 2006 D EF

100 100 100

50 50 P = 0.032 50 P = 0.191 P < 0.001

Low expression (n = 98) Low expression (n = 98) Low expression (n = 98)

Overall survival (%) n Distant metastasis free High expression (n = 42) survival (%) High expression (n = 42) High expression ( = 42) 0 0 0 050100150 050100150 050100150 Recurrence free survival (%) Time (months) Time (months) Time (months)

Time (months) Time (months)

Figure 1. TNFRSF19 is highly expressed in NPC. A, Left, IHC analysis of TNFRSF19 expression in 8 normal nasopharyngeal and 140 NPC tissues (scale bar, 50 mm), together with an enlarged view of each in the corresponding inset. Right, scatterplots representing the IHC scores are shown on the left. B, Western blot assay of TNFRSF19 expression in three normal NPE cells and 6 NPC cell lines. C, Oncomine box plots of TNFRSF19 expression levels in multiple advanced human cancers. D–F, Kaplan–Meier analysis of TNFRSF19 expression and overall survival (D), distant metastasis-free survival (E), and recurrence-free survival (F) in 140 patients with NPC. G, Kaplan–Meier analysis of overall survival in lung (1,145 patients) and gastric cancer (631 patients) stratiﬁed by TNFRSF19 expression. The P values were calculated using the log-rank test.

3472 Cancer Res; 78(13) July 1, 2018 Cancer Research

Characterization of TNFRSF19 as a Repressor of TGFb Pathway

ABC HNE-1 CNE-1 HNE-1 HNE-1 KO WT WT KO WT KO KO 1# 3 WT 1# 2# 1# 1#2#2# 1# 1#2#2# KO 2# TNFRSF19 2

1 GAPDH 400 OD 450 nm

0 300 01234 D Days 200 WT KO 100 No. of colonies 1# 2# 1# 2# 0 1# 2# WT CNE-1 KO E HNE-1 WT KO 1# 2# 1# 2#

0.8 CNE-1 1.5 HNE-1 CNE-1

0.6 1.0 0.4 HNE-1 0.5 0.2 Soft agar colony 0.0 0.0 CNE-1 HNE-1 2.0 3 formation efficiency (%) 1# 2# 1# 2# 1# 2# 1# 2#

WT KO WT KO 1.5 2 1.0 F 1 0.5

WT KO efficiency (%) 0.0 0 Spheroid formation 1# 2# 1# 2# 1# 2# 1# 2# 1# 2# 1# 2# WT KO WT KO CNE-1 G HNE-1 CNE-1 HNE-1

2..0 CNE-1 HNE-1 2.0

1.5 WT 1.5 WT KO KO

1.0 1.0

0.5 0.5 2nd Spheroid 0.0 0.0 formation efficiency (%) 1# 2# 1# 2# 1# 2# 1# 2# WT KO WT KO H ) ) 3

3 HNE-1 WT CNE-1 WT KO 800 KO 800 600 600 400 400 200 200 0 0

Tumor volume (mm 12 15 18 21 24 27 30 33 36 39 42 45 48

Tumor volume (mm 12 15 18 21 24 27 30 33 36 39 42 45 48 Days after inoculation Days after inoculation

Figure 2. TNFRSF19 is required for NPC tumorigenesis. A, Western blot analysis of TNFRSF19 in WT and knockout (KO) cells. TNFRSF19 KO cells were generated using the CRISPR-Cas9 system with two single-guide RNAs targeting exon 3, and clones 1# and 2# were from sgRNAs 1# and 2#, respectively. B, Proliferation curve of HNE-1 WT or TNFRSF19 KO cells as measured by CCK-8 assay. Error bars, SDs (n ¼ 3). C and D, Knockout of TNFRSF19 reduced the ability to form colonies on conventional plates (C) and soft agar (D). E and F, Primary and secondary tumor sphere formation in ultralow attachment plates of CNE-1 and HNE-1 cells with or without TNFRSF19 KO. Secondary spheroids (F) were obtained from the dissociation of primary spheroids (E) into single cells and reseeded. Error bars, SD (n ¼ 3). Scale bars, 50 mm. G, Wild-type or TNFRSF19 KO cells were subcutaneously injected into the right and left ﬂanks of athymic BALB/c mice, respectively. Images were captured 7 weeks postimplantation. H, Growth curves of the tumors formed by wild-type or TNFRSF19 KO cells. Mean tumor volumes are plotted. Error bars, SD (n ¼ 6).

www.aacrjournals.org Cancer Res; 78(13) July 1, 2018 3473

Deng et al.

A B C HA-TRAF2

SFB- V

Troy kDa T19.1 LMP1 T19.2 Mock T19-SFB 180 V T19.1 T19.2 SFB- LMP1 135 FLAG 100 HA (TRAF2) 75 IP: TNFRSF19-SFB 65 S beads TGFβRI p-IκBα FLAG 45

Input HA (TRAF2) 35 35 Caspase-3 25 HA-TRAF6 25 20 Cleaved caspase-3 No. of Coverage V Troy T19.1 T19.2 15 Input Protein peptides (%) 10 HA (TRAF6) TNFRSF19 10 25.3 GAPDH FLAG TGFβ receptor I 6 16.7 IP: S beads D − ++ TβRI-SFB E F TNFRSF19-SFB − ++ TNFRSF19-HA HNE-1 CNE-1

HA (T19) βRI

IP: G

HA- V

IP: g I IgG TβRI TβRI Smad4 S beads Smad2 FLAG (TβRI) TGF TNFRSF19 Input HA (T19) IgG FLAG (T19)

IgG IP: HA TβRI HA G TβRI-HA ++++— — Input FLAG (T19) TβRII-HA ————++ TNFRSF21-SFB ——— — + + H I TNFRSF19-SFB ——+ + — — GST-T19 GST-T19

GST ICDECD + IP: MBP-TβRI IB: TβRI HA (TβRI) S beads ECD ICD 75 65 IB: GST (T19)

HA (TβRII) 45 180 135 HA (TβRI) 35 CBB 100 75 CBB 65 25 GST Pull-down

Input MBP Pull-down 45 FLAG (T21)

FLAG (T19) GS ICD Kinase GS ICD Kinase FL FL FL SFB- FL J TGFβRI T19-HA — ++++ — ++++ SP TM GS Kinase FL 75

1 26 126 148 175 4 503 FLAG (TβRI) 20 208 65 ECD ICD 1 175 204 503 45 GS 35 1207 Kinase 25 1150 ICD Input HA (TNFRSF19)

IP: HA

3474 Cancer Res; 78(13) July 1, 2018 Cancer Research

Characterization of TNFRSF19 as a Repressor of TGFb Pathway

Sun Yat-sen University (reference no. GZR2016-105), and the ting (Fig. 2A) and Sanger sequencing (Supplementary Fig. S2B). animals were handled in accordance with institutional guide- Knockout of TNFRSF19 resulted in a substantially reduced lines. For xenograft studies, female BALB/c nude mice (5–6 growth rate (Fig. 2B), lower plating efficiency (Fig. 2C) and weeks old) were purchased from Shanghai Laboratory Animal colony-forming capacity on soft agar (Fig. 2D), and reduced Center (Shanghai, China). primary and secondary tumor spheroid formation (Fig. 2E and F), indicating that the transformation ability was greatly in vitro Results impaired by TNFRSF19 loss .Todeterminetheroleof TNFRSF19 in tumorigenesis, we established xenograft tumors High expression of TNFRSF19 in NPC via subcutaneous inoculation of wild-type (WT) and TNFRSF19 As our previous work suggested that TNFRSF19 is associated KO NPC cells into the right and left flanks of nude mice, with NPC risk (13), we first evaluated TNFRSF19 expression in respectively. TNFRSF19 KO cells displayed a significant inhi- NPC patient samples. A specific polyclonal antibody recognizing bition of tumor growth compared with control cells (Fig. 2G TNFRSF19 was raised and used for IHC in NPC biopsies (Sup- and H). Furthermore, knockout of TNFRSF19 resulted in a plementary Fig. S1A) and Western blotting (Supplementary Fig. reduction of tumor-initiating ability, as determined by limiting S1B). We found that TNFRSF19 was highly expressed in patient- dilution transplantation analysis of NPC xenografts (Supple- derived NPC tissues, but it could be barely detected in normal NPE mentary Table S1). The above data indicate that TNFRSF19 is tissues (Fig. 1A). Similarly, TNFRSF19 was expressed in NPC cell required for cell growth and tumorigenesis of NPC. lines but not in the normal NPE cell lines NPEC2-Bmi1, NPEC5- Tert, and NP69 (Fig. 1B). In addition, Oncomine expression TNFRSF19 interacts with TGFb type-I receptor analysis revealed high expression of TNFRSF19 in other human The major signal transducers for the TNFR superfamily are TNF cancers (Fig. 1C), suggesting that the high expression of receptor–associated factors (TRAF), which are linked to NF-kB TNFRSF19 is characteristic of multiple human cancer types. To activation (16). As a member of TNFRs, some studies have shown investigate whether TNFRSF19 expression serves as a novel prog- that TNFRSF19 interacts with TRAF proteins and activates the NF- nostic marker, the correlation of TNFRSF19 expression with NPC kB pathway (19, 21, 26). The human TNFRSF19 gene encodes two prognosis was evaluated. Kaplan–Meier survival curves showed transcripts: TNFRSF19.1 and TNFRSF19.2, which share most of that patients with high TNFRSF19 expression had a significantly exons except the last one (Supplementary Fig. S3A) and are both poorer overall survival and distant metastasis-free survival when expressed in human cells (Supplementary Fig. S3B and S3C). compared with patients with low TNFRSF19 expression, as dem- TNFRSF19.1 has 421 a.a. and lacks the TRAF-binding motif; onstrated by the log-rank test (P < 0.001, Fig. 1D; P ¼ 0.032; Fig. TNFRSF19.2 is shorter (417 a.a.) and has a distinct C-terminus 1E). There was no significant correlation between TNFRSF19 with a potential TRAF-binding consensus sequence (P/S/A/T)X expression and recurrence-free survival (P ¼ 0.191; Fig. 1F). In (Q/E)E, 413SLQE416. Mouse Tnfrsf19, commonly named as Troy, addition, the online database Kaplan–Meier Plotter also revealed only has one transcript and the encoded protein containing a a statistically significant inverse correlation between high different TRAF-binding motif 276TLQE279 (Supplementary Fig. TNFRSF19 expression and overall survival in lung and gastric S3A and S3D). However, transient transfection of these TNFRSF19 cancers (Fig. 1G). These data indicate that TNFRSF19 may play an constructs into HEK293T cells did not lead to IkBa phosphory- oncogenic role. lation or caspase-3 cleavage, while a positive control LMP1, an EBV oncoprotein acting as a constitutively active mimic of TNFR Loss of TNFRSF19 decreases tumorigenicity of NPC CD40 and binding TRAFs (27), potently stimulated IkBa phos- To gain insights into the role of TNFRSF19 in cancer devel- phorylation (Fig. 3A). Consistently, co-IP revealed that TNFRSF19 opment, the TNFRSF19 gene was knocked out in two NPC cell transcript 1 and 2 or the mouse ortholog did not associate with lines, CNE-1 and HNE-1, using the CRISPR-Cas9 genome TRAF2 or TRAF6, whereas binding of TRAF2 to LMP1 was readily editing system. Two independent sgRNAs with efficient cleav- detectable (Fig. 3B). Therefore, it seems that TNFRSF19 does not age activity were selected (Supplementary Fig. S2A), and the share the same set of signal transducers with other TNFRs and may genetic ablation of TNFRSF19 was confirmed by Western blot- have different signaling outputs.

Figure 3. TNFRSF19 interacts with type I TGFb receptor. A, Lysates from HEK293T cells transfected with human TNFRSF19.1, 19.2, mouse Troy, and LMP1 constructs were immunoblotted with the indicated antibodies. LMP1 served as a positive control for NFkB activation. B, Top, SFB-tagged TNFRSF19.1, 19.2, and mouse Troy or LMP1 were transfected into HEK293T cells along with HA-TRAF2. The cell lysates were precipitated with S-protein beads and immunoblotted with the indicated antibodies. LMP1 served as a positive control for TRAF2 binding. Bottom, the interaction of SFB-tagged TNFRSF19.1, 19.2, and mouse Troy with HA-TRAF6. C, HEK293T cells stably expressing SFB-tagged TNFRSF19 were used for TAP. Silver staining of TAP and the number of peptides identiﬁed by MS are shown. D, Co-IP of exogenous TGFbRI (TbRI) and TNFRSF19 (T19). HEK293T cells were transfected with plasmids encoding C-terminal SFB-tagged TGFbRI and C-terminal HA-tagged TNFRSF19. Cell lysates were precipitated with S-protein beads and immunoblotted with the indicated antibodies. E, Interactions between endogenous TNFRSF19 and TbRI in HNE-1 and CNE-1 cells were assessed by immunoprecipitation (IP) with anti-TbRI antibody or control IgG and immunoblotting using anti-TNFRSF19 and TbRI antibodies. Arrow, IgG heavy chain. F, Lysates from HEK293T cells expressing HA-tagged Smad2, Smad4, and TbRI along with SFB-tagged TNFRSF19 were immunoprecipitated with anti-HA agarose and immunoblotted with antibodies as indicated. G, Co-IP of SFB-tagged TNFRSF19 or TNFRSF21 with HA-TbRI or TbRII in transfected HEK293T cells. H, The ICD of TNFRSF19 binds to TbRI. Bacterially expressed GST-ECD and ICD fragments of TNFRSF19 or GST alone were incubated with HNE-1 cell lysates. Proteins bound to glutathione sepharose beads were analyzed by immunoblotting. GST fusion proteins are shown by Coomassie Brilliant Blue (CBB) staining. I, TNFRSF19 directly binds to ICD of TbRI. MBP-tagged ECD or ICD of TbRI fragments were coincubated with GST-tagged TNFRSF19; proteins bound to amylose beads were immunoblotted with anti-GST antibody. J, Left, schematic representation of the TGFbRI domain structure. SP, signal peptide; TM, transmembrane domain. Right, lysates from HEK293T cells expressing SFB-tagged full-length (FL) or deletion mutants of TbRI with or without HA-tagged TNFRSF19 were subjected to immunoprecipitation with anti-HA agarose and immunoblotting with anti-FLAG and anti-HA antibodies.

www.aacrjournals.org Cancer Res; 78(13) July 1, 2018 3475

Deng et al.

To gain insight into the biological pathway transduced by Smad2; in contrast, a constitutive interaction between TNFRSF19 TNFRSF19, we studied the protein interaction network of and TbRI was observed regardless of the presence of TGFb (Fig. TNFRSF19. TAP and MS (TAP-MS) were carried out in HEK293T 4B). In addition, we compared the interaction of TNFRSF19 with cells stably expressing SFB (S-FLAG-SBP) triple-tagged TNFRSF19 either active or inactive forms of TbRI. The T204D mutation in the (transcript variant 1). Interestingly, MS data revealed peptides that GS domain causes ligand- and TbRII-independent activation of corresponded to TbRI (Fig. 3C). TbRI was also identified via TAP in TbRI, whereas the K232R mutation leads to kinase inactivation the NPC cell line HK1 (Supplementary Fig. S3E); besides, the pull- (29). Co-IP experiment suggested that TNFRSF19 bound to all down assay using TNFRSF19 ICD as bait also captured TbRI forms of TbRI, and treatment with SB-431542, a small molecule peptides in HEK293T cell lysates (Supplementary Fig. S3F), but that inhibits the catalytic activity of TbRI, did not affect their no TRAF proteins or death domain-containing proteins were interactions (Fig. 4C). Thus, unlike TbRII and Smad2/3, the found in these MS lists. To verify the interaction of TNFRSF19 binding of TNFRSF19 to TbRI is TGFb independent. with TbRI, reciprocal co-IPs were performed in HEK293T cells and Next, we questioned whether TNFRSF19 affects the interaction showed that TbRI bound to TNFRSF19 in cooverexpression of TbRI with the upstream TbRII and the downstream R-Smads. experiment (Fig. 3D). Furthermore, endogenous TNFRSF19 was Overexpression of TNFRSF19 did not affect TbRI/II heterotetra- coimmunoprecipitated with TbRI in HNE-1 and CNE-1 cells meric receptor complex formation (Fig. 4D); however, the inter- (Fig. 3E). In addition, TNFRSF19 did not bind Smad2 or Smad4 actions of Smad2/3 with TbRI were severely impaired by (Fig. 3F). To further ensure the binding specificity between TNFRSF19 overexpression (Fig. 4E), and both wild-type and the TNFRSF19 and TbRI, another member of the TNF receptor super- constitutively active mutant T204D of TbRI lost their abilities to family, TNFRSF21, which contains the death domain (28), was associate with Smad2 in the presence of exogenous TNFRSF19 used as a control, and the co-IP result suggested that only (Fig. 4F). In agreement with the overexpression data, knockout of TNFRSF19 interacted with TbRI but not TbRII in transiently TNFRSF19 in HNE-1 cells greatly induced endogenous TbRI– transfected HEK293T cells (Fig. 3G). Collectively, these results Smad2 complex formation (Fig. 4G). And as expected, the down- suggest that TNFRSF19 specifically binds TbRI in vivo. stream event of TbRI/R–Smads interaction, oligomerization of Next, we sought to determine the regions responsible for the Smad2 with the Co-Smad, Smad4 was inhibited by TNFRSF19 TNFRSF19–TbRI interaction. To achieve this goal, bacterially overexpression (Fig. 4H), and depletion of TNFRSF19 in HNE-1 expressed ECDs and ICDs of TNFRSF19 and TbRI were used in cells substantially increased Smad2–Smad4 complex (Fig. 4I). In pull-down assays. The GST-fused ICD, but not the ECD of summary, TNFRSF19 competes with R-Smads for binding to the TNFRSF19, was able to pull down TbRI (Fig. 3H). Conversely, kinase domain of TbRI and thereby blocks the recognition and GST-fused TNFRSF19 bound to MBP-fused ICD but not to the activation of R-Smads and the subsequent formation of an active ECD of TbRI (Fig. 3I). These results suggest that TNFRSF19 binds R-Smad/Co-Smad complex. directly to TbRI through the respective cytoplasmic domains. As TNFRSF19 ICD does not harbor any known functional motif, we TNFRSF19 inhibits TGFb signaling further dissected the domains of TbRI ICD mediating the associ- To investigate the biological significance of TNFRSF19 in the ation with TNFRSF19. The cytoplasmic region of TbRI is com- TGFb pathway, we compared the global gene expression profiles posed of a glycine- and serine-rich sequence, termed the GS of control and TNFRSF19 KO cells using microarrays. A total of domain, followed by a kinase domain. A series of deletion 143 differential genes were found between WT and TNFRSF19 KO mutants lacking the GS domain, kinase domain, or the entire HNE-1 cells (Fig. 5A). Strikingly, functional profiling of these ICD of TbRI was generated (Fig. 3J, right), and the co-IP assay differentially expressed genes suggested that the TGFb signaling demonstrated that the GS domain was dispensable for TbRI– pathway was one of the most significantly affected pathways by TNFRSF19 interaction, but deletion of the kinase domain or the the loss of TNFRSF19 (Fig. 5B). Furthermore, after analysis of entire ICD of TbRI abolished the TNFRSF19 association (Fig. 3J, TNFRSF19 expression and TGFb-regulated gene signatures via left). Taken together, these data suggest that TNFRSF19 binds to GSEA in GEO public NPC patient expression datasets (33), we the kinase domain of TbRI in the cytoplasm. found that TNFRSF19 levels were inversely correlated with the gene signatures activated by TGFb (Fig. 5C). TNFRSF19 blocks formation of the TGFbRI–Smad2/3 To validate the participation of TNFRSF19 in the TGFb path- complex way, we used (CAGA)12-Luc, a TGFb-responsive luciferase report- Having established the interaction between TNFRSF19 and er containing a Smad3/4–binding box on the PAI-1 gene pro- TbRI, we next asked how the TbRI complex is regulated by moter (34), to determine whether TNFRSF19 affects TGFb-medi- TNFRSF19. Upon ligand stimulation, TbRI forms a heteromeric ated transcriptional responses. Luciferase assays showed that loss complex with TbRII and is phosphorylated in the GS domain. of TNFRSF19 dramatically increased the activity of the TGFb/ Phosphorylation induces a conformational change of TbRI and its Smad–responsive reporter in TGFb-treated HNE-1 cells (Fig. 5D). subsequent association and phosphorylation of the R-Smads, Consistent with the reporter data, the protein levels of P21 and Smad2, and Smad3 via the kinase domain (29–32) (Fig. 4A). PAI-1, two well-characterized direct transcriptional targets of We first examined whether the TNFRSF19 and TbRI association is TGFb pathway, were robustly upregulated in TNFRSF19 KO cells TGFb-induced. As most TNFRSF19-positive NPC cells lost their than in control cells, the latter responded poorly to TGFb (Fig. 5E). response to TGFb (see below), we chose HaCaT, an immortalized Next, we examined the early mediators of TGFb signaling, for human keratinocyte cell line that is highly responsive to TGFb and example, TGFb-induced phosphorylation of R-Smads. Smad2/3 TNFRSF19-positive, to immunoprecipitate endogenous TbRI phosphorylation was almost undetectable in HNE-1 WT cells before and after TGFb treatment. The TbRI–TbRII complex was even after TGFb stimulation; in contrast, much higher levels of induced after 1 hour of TGFb treatment and declined after 6 hours basal and TGFb-induced Smad2/3 phosphorylation were of treatment, which correlated with the phosphorylation of observed in TNFRSF19 KO cells, while p38 phosphorylation was

3476 Cancer Res; 78(13) July 1, 2018 Cancer Research

Characterization of TNFRSF19 as a Repressor of TGFb Pathway

A B HaCaT C TGF IP: IgG TβRI TβRI-HA WT WT WT T204DK232R TM TGFβ 0 0 1 6 h SB-431542 ———— + p GS TNFRSF19 TNFRSF19-SFB — ++++ KD KD IP:TβRI TβRII IP: HA (TβRI) p Smad2/3 IgG S beads TβRI FLAG (T19) T RII T RI p-Smad2 Input HA (TβRI) p Smad2/3 Input PAI-1

p TNFRSF19 Smad4 F E SFB-Smad2 D TβRI-HA TβRI-HA TβRI-HA: SFB- −Smad2Smad3 WT T204D K232R TβRII-SFB — ++ — — — TNFRSF19 − − + − + TNFRSF19 + + + —— + TNFRSF19 IP: HA (TβRI) HA (TβRI) S beads HA (TβRI)

FLAG FLAG (Smad2) FLAG (TβRII) (Smad2/3) IP: S beads IP: S IP: S beads IP: S HA (TβRI) HA (TβRI) Input HA (TβRI)

TNFRSF19 Input TNFRSF19 TNFRSF19 Input G HNE-1 H WT KO Myc-Smad4 I HNE-1 ——+ + TGFβ SFB-Smad2 — ++ WT KO IP: TβRI TNFRSF19 ——+ ——+ + TGFβ IB: Smad2 IgG IP: Smad2 Myc (Smad4) IB: Smad4 Smad2 eads IgG

TβRI Input S b Smad2 FLAG (Smad2) Input IIP: TNFRSF19 Smad4 TNFRSF19 Input Myc (Smad4)

Figure 4. TNFRSF19 blocks TGFbRI from binding to R-Smads. A, Schematic representation of TbRI activation and signal transduction via receptors. B, Cell lysates from HaCaT cell line treated with TGFb (5 ng/mL) for the indicated times were immunoprecipitated (IP) using anti-TbRI antibody or control IgG, followed by immunoblotting with the indicated antibodies. C, HEK293T cells were cotransfected with plasmids encoding HA-tagged WT, T204D, and K232R mutants of TbRI, along with TNFRSF19-SFB. Following 1 hour of SB-431542 (10 mmol/L) treatment or no treatment, the cell lysates were precipitated with S-protein beads and immunoblotted with the indicated antibodies. Phospho-Smad2 and PAI-1 represent early and late response to TGFb, respectively. D, Co-IP of SFB-tagged TbRII and HA-tagged TbRI in the presence or absence of exogenous TNFRSF19 in transfected HEK293T cells. E, Co-IP of SFB-tagged Smad2 or Smad3 with HA-TbRI in the presence or absence of TNFRSF19 overexpression in transfected HEK293T cells. F, Co-IP of SFB-Smad2 with HA-tagged WT, T204D, or K232R mutant of TbRI with or without cotransfection of TNFRSF19 in transfected HEK293T cells. G, Interaction of endogenous TbRI and Smad2 in WT and TNFRSF19 KO HNE-1 cells with or without TGFb (5 ng/mL) treatment was analyzed by immunoprecipitation with anti-TbRI antibody, followed by immunoblotting with the indicated antibodies. Arrow, IgG heavy chain. H, Co-IP of SFB-Smad2 and Myc-Smad4 with or without TNFRSF19 overexpression in transfected HEK293T cells. I, Endogenous Smad2–Smad4 interaction in WT and TNFRSF19 KO HNE-1 cells with or without TGFb (5 ng/mL) treatment as analyzed by immunoprecipitation with anti-Smad2 antibody, followed by immunoblotting (IB) with anti-Smad4 antibody.

slightly increased (Fig. 5F). These data were in line with the ﬁnding NPC tumor xenografts, as shown in Fig. 2H. The staining results that TNFRSF19 prevented R-Smads from being recruited and revealed that tumors derived from TNFRSF19 KO cells had higher activated by TbRI (Fig. 4). levels of p21 and phosphorylated Smad2 compared with tumors To further examine the role of TNFRSF19 in the TGFb pathway in derived from control cells (Fig. 5G). Consistently, IHC in clinical vivo, we analyzed the levels of P21 and phospho-Smad2 by IHC in specimens demonstrated a negative correlation between TNFRSF19

www.aacrjournals.org Cancer Res; 78(13) July 1, 2018 3477

Deng et al.

A B Significant enriched pathway terms (Top 20) C Log–log scatter plot TGFβ signaling pathway PPAR signaling pathway Adipocytokine signaling pathway PAI-1 JAZAG_TGFB1_SIGNALING_UP Peroxisome P21 Rheumatoid arthritis 0 Bladder cancer Influenza A Cytokine–cytokine receptor interaction

TNFRSF19 KO Caffeine metabolism - 0.3 Hedgehog signaling pathway TNFRSF19 Ovarian steroidogenesis Steroid hormone biosynthesis TNFRSF19 WT Legionellosis Staphylococcus aureus infection T19 high T19 low Glycerolipid metabolism ES = -0.39 Sulfur metabolism NES = -1.56 Complement and coagulation cascades P < 0.01 Fatty acid biosynthesis n Cardiac muscle contraction GSE12452 NPC Specimens ( = 31) Hypertrophic cardiomyopathy (HCM)

0.0 0.25 0.5 D −log(Corrected P−Value) - TGFβ E F WT KO 1# KO 2# 1.0 +TGFβ TGFβ (1 h) - + - + - + WT KO 1# KO 2# 0.8 TGFβ (6 h) - + - + - + p-Smad2 0.6 PAI-1 p-Smad3

0.4 P21 Smad2 0.2 κ α p-I B p-P38

Relative luciferase activity 0.0 WT 1# 2# IκBα P38 KO GAPDH GAPDH

TNFRSF19 TNFRSF19 G NPC Xenograft HNE-1 CNE-1 TNFRSF19 p-Smad2 P21 TNFRSF19 p-Smad2 P21

WT WT

KO KO

H NPC Tissue

TNFRSF19 p-Smad2 P21

Low p-Smad2 Low P21 High p-Smad2 High P21 Patient 1 P < 0.01 P < 0.05

100 100

80 80

60 60

40 40

20 20

Patient 2 % of Specimens % of Specimens 0 0 Low High Low High TNFRSF19 Expression TNFRSF19 Expression

Figure 5. TNFRSF19 suppresses TGFb signaling in NPC. A, Double-log scatter plot comparing the differential expression of mRNAs in control and TNFRSF19 KO HNE-1 cells. Green, downregulated genes; red, upregulated genes. B,KEGG pathway enrichment analysis of differentially expressed genes between WT and TNFRSF19 KO cells. C, GSEA plot showing that TNFRSF19 expression is inversely correlated with TGFb-activated gene signatures in published NPC patient gene expression datasets (GSE12452,

n ¼ 31). ES, enrichment score; NES, normalized enrichment score. D, Luciferase assay of the TGFb reporter (CAGA)12-Luc in WT or TNFRSF19 KO cells treated or not with TGFb (5 ng/mL) for 24 hours. Error bars, SD (n ¼ 3). E, Effects of TNFRSF19 KO on TGFb-induced P21 and PAI-1 expression. WT, TNFRSF19 KO CNE-1, or HNE-1 cells were starved overnight and then treated with TGFb for 6 hours; the induction of target genes was examined by Western blot analysis. F, Effects of TNFRSF19 KO on TGFb-induced phosphorylation of Smad2/3 and P38. Cells with or without TNFRSF19 deletion were starved overnight and then stimulated with TGFb for 1 hour, and the phosphorylated and total proteins were immunoblotted with the indicated antibodies. G, IHC analysis of TNFRSF19 and phosphorylated Smad2 and P21 in xenografts generated from WT and TNFRSF19-KOcellsasshowninFig.2H.Scalebars,100mm. H, Expression levels of p-Smad2 and P21 were inversely associated with TNFRSF19 levels in 40 primary human NPC specimens. Two representative cases are shown. Scale bar, 100 mm. The inset shows a magniﬁed view.

3478 Cancer Res; 78(13) July 1, 2018 Cancer Research

Characterization of TNFRSF19 as a Repressor of TGFb Pathway

and P21 and phospho-Smad2 levels (Fig. 5H). Taken together, normal cells. Overexpression of TNFRSF19 abolished TGFb- these results indicate that TNFRSF19 inhibits TGFb-induced induced (CAGA)12-Luc reporter activation in HEK293T cells R-Smads phosphorylation and transcriptional responses in NPC. (Fig. 6A). When TNFRSF19 was transduced into a normal NPE cell line, NPEC2-Bmi1, which does not express TNFRSF19 (Fig. Overexpression of TNFRSF19 confers resistance to growth- 1B), cell proliferation was accelerated (Fig. 6B), and inhibition of inhibitory effect of TGFb TGFb-induced growth was signiﬁcantly alleviated compared with TGFb acts as a tumor suppressor by inhibiting the growth of the control cells without TNFRSF19 transduction (Fig. 6C). In normal and premalignant cells. We next determined the effects of epithelial cells, TGFb stimulates the transcription of p15INK4b TNFRSF19 gain of function on the antiproliferative role of TGFb in and/or p21Cip1, two cyclin-dependent kinase inhibitors, to arrest

A B C NPEC2-Bmi1 NPEC2-Bmi1 1.5 Vector 293T 1.5 Vector TNFRSF19 0.3 TNFRSF19 1.0 1.0 0.2

0.5 0.5

0.1 OD 450 nm (relative to control) 0.0 Cell viability 0.0 01234 00.10.51 5

Relative luciferase activity 0.0 TGFβ − + + Days TGFβ (ng/mL) TNFRSF19 − − + E Vector TNFRSF19 D Vector TNFRSF19 TGFβ (ng/mL) 0 .1 .5 1 5 0 .1 .5 1 5 0.5 h

TGFβ (ng/mL) 0 .1 .5 1 5 0 .1 .5 1 5 6 h p-Smad2

PAI-1 Smad2

P21 p-P38

TNFRSF19 P38

GAPDH TNFRSF19

GAPDH F Vector TNFRSF19

Smad2 Smad2/DAPI Smad2 Smad2/DAPI

Cyt —— Cyt/Nuc Nuc 100 80 60 40

% of Cells 20 TGFβ TGFβ 0 TGFβ - + - + Vec TNFRSF19

Figure 6.

Overexpression of TNFRSF19 confers resistance to TGFb-mediated growth inhibition in normal NPE cells. A, Effect of TNFRSF19 on the (CAGA)12-Luc transcriptional response induced by TGFb (5 ng/mL) for 24 hours in 293T cells. B, NPEC2-Bmi1 cells were infected with control lentivirus or lentivirus expressing TNFRSF19. The cell proliferation was determined by CCK-8 assay. C, NPEC2-Bmi1 cells with or without TNFRSF19 overexpression were cultured in the absence or presence of TGFb. After 48-hour incubation, the cell viability was determined by CCK-8 assay. D, Control or TNFRSF19-overexpressing NPEC2-Bmi1 cells were treated or not with various concentrations of TGFb for 6 hours; the inductions of P21 and PAI-1 are shown. E, TNFRSF19 overexpression inhibits the phosphorylation of Smad2 induced by 30 minutes of TGFb treatment in NPE cells. F, TNFRSF19 inhibits the nuclear translocation of Smad2 induced by TGFb. Left, immunoﬂuorescence images representing the subcellular localization of Smad2 before and after 30 minutes of stimulation with TGFb in control or TNFRSF19- overexpressing NPE cells. Scale bars, 50 mm. Right, histogram representing the percentage of cells displaying Smad2 distributed in the nuclear, cytoplasmic, or both compartments.

www.aacrjournals.org Cancer Res; 78(13) July 1, 2018 3479

Deng et al.

Normal cells Cancer cells

TGFβ TGFβ

TGFβ TGFβ 1

PP S PP 9 GS G TGFβRII Smad2/3 TGFβRII Smad2/3 Kinase Kinase TGFβRI TGFβRI Χ P p-Smad2/3 P Smad4 Cytoplasm Cytoplasm Smad4

Cofactor Cofactor Nucleus Nucleus P21, PAI-1… P21, PAI-1… PCofactor Χ P

Growth inhibition Tumorigenesis

Figure 7. Working model of TNFRSF19-mediated inhibition of TGFb signaling in cancer.

cell-cycle progression. Consequently, overexpression of TNFRSF19 Discussion substantially reduced the induction of P21 and PAI-1 by TGFb (Fig. NPC is a special type of head and neck cancer. Strong ethnic 6D), while P15 was undetectable due to homozygous deletion of clustering and familiar aggregation of NPC indicates that genetic the p15INK4b locus. The data suggest that TNFRSF19 reduces tran- susceptibility plays a significant role in this disease (1, 35). scriptional activation of TGFb to bypass TGFb-induced growth However, even though numerous mutations/variations have been inhibition. Consistently, TGFb-induced phosphorylation of Smad2 discovered in NPC by multiple whole-genome or exome sequenc- was substantially inhibited by ectopic expression of TNFRSF19 (Fig. ing studies over the years, the exact genetic perturbations resulting 6E). Furthermore, the TGFb-induced cytoplasmic to nuclear trans- in NPC are far from being fully understood (3). location of Smad2 was suppressed by TNFRSF19 in NPE cells (Fig. We have previously identified TNFRSF19 as a susceptibility 6F), Thus, the overexpression data were consistent with the results gene for NPC (13), and another GWAS has reported that obtained from NPC knockout cells. TNFRSF19 is a susceptibility factor in lung cancer (14). TNFRSF19 In addition to its tumor-suppressing activity, TGFb also belongs to the TNFR superfamily. The family members are char- exhibits tumor-promoting effects by assisting cell migration acterized by four conserved cysteine-rich domains in their ECD and cancer metastasis via epithelial-to-mesenchymal transition and a distinct ICD that is responsible for TNFR signaling. In (7). However, loss of TNFRSF19 did not change the level of human, a total of 29 TNFRs have been described to date. In E-cadherin, although N-cadherin levels increased. Besides, general, members of the TNFR superfamily can be divided into the expression of E- and N-cadherin was insensitive to TGFb two groups: survival receptors and death receptors. Survival in HNE-1 cells (Supplementary Fig. S4A). Furthermore, receptors activate the NF-kB pathway by binding to TRAF pro- TNFRSF19-deficient cells exhibited similar migration ability teins. Death receptors mediate signal-induced cell death through compared with control cells (Supplementary Fig. S4B), suggest- their death domains (16). TNFRSF19 is far less characterized in ing that at least in the context of NPC, TNFRSF19 mainly this family. TNFRSF19 does not bind to TNF-related ligands and regulates the growth-inhibitory function of TGFb. remains an orphan receptor to date (15). Its cytoplasmic domain In summary, our results support a model in which TNFRSF19 lacks death domain; in addition, despite the presence of a putative functions as a key repressor of TGFb receptor–induced signaling TRAF-binding motif in the cytoplasmic region of human responses and of TGFb-dependent antiproliferative effects in TNFRSF19.2 and mouse Troy (Supplementary Fig. S3), they were NPC (Fig. 7). unable to bind TRAF2 and TRAF6; accordingly, overexpression or

3480 Cancer Res; 78(13) July 1, 2018 Cancer Research

Characterization of TNFRSF19 as a Repressor of TGFb Pathway

knockout of TNFRSF19 did not affect NF-kB activity (Figs. 3A and the sensitivity of cells to TGFb signals. It is conceivable that B and 5E). Our results are in accordance with previous studies reactivation of TNFRSF19 in normal or premalignant epithelial conducted in other cell lines and mouse models (15, 36). More- cells can protect them against small amounts of autocrine and over, unlike most TNFRs, which are expressed in the immune paracrine TGFb and eventually cause uncontrolled cell growth. system and play roles in innate and adaptive immunity, Although expression of TNFRSF19 in human normal NPE cells TNFRSF19 is not present in lymphoid tissues but is highly is not associated with transformation, such as soft agar growth expressed in skin and hair follicles (15, 37). Collectively, these and the formation of tumors in xenograft mouse models, findings indicate that TNFRSF19 is functionally distinct from TNFRSF19 does exert growth-promoting effects in NPE cells canonical TNFRs. (Fig. 6B). Given that the etiology of NPC is complex and TNFRs utilize adaptor proteins to transduce and amplify recep- involves predisposed genetic and environmental factors, it is tor information to different cell fates. To identify the adaptors for conceivable that multiple factors orchestrate the initiation of TNFRSF19, we performed affinity purification of TNFRSF19. NPC. For example, EBV has been considered as another key Unexpectedly, TGFb type I receptor was captured as a specific player in NPC pathogenesis, and its latent to lytic switch is binding partner for the ICD of TNFRSF19. Domain mapping induced by TGFb (42, 43). Thus, TNFRSF19 may also play roles revealed that TNFRSF19 bound to the kinase domain of TbRI, in the establishment of persistent EBV infection in the early which overlapped with the binding region of R-Smads on TbRI stage of NPC development. Future studies are needed to acquire (Fig. 3J; refs. 30–32). However, unlike TGFbRI/R-Smad complex a better understanding of gene–gene and gene–environment formation, which is induced by TGFb, TNFRSF19 constitutively interactions in the development of NPC. associates with TbRI, thereby blocking the formation of the active In contrast to human TNFRSF19, its mouse ortholog Troy has TbRI/R-Smad complex and the downstream R-Smad/Co-Smad been well studied in mouse models. Using lineage tracing tech- complex (Fig. 4). The constitutive interaction of TNFRSF19 with nology, Troy has been proposed as a stem cell marker for stomach TbRI and the competition of R-Smads for binding to the kinase (44), kidney (45), intestine (20), and brain (46) in mice. Troy also domain inhibit leaky activation of the receptor in the absence of interacts with TGFbRI as its human orthologs (Supplementary Fig. TGFb, thereby eliminating spurious signaling caused by receptor S5A), and therefore, we generated tnfrsf19/troy KO mice using oligomerization-induced R-Smads recruitment in the absence of CRISPR-Cas9 technology (Supplementary Fig. S5B and S5C). The ligand. Indeed, depletion of TNFRSF19 results in active TbRI/R- isolated mouse embryonic fibroblasts (MEF) with a homozygous Smad complex formation and TGFb pathway activation, even in deletion of the tnfrsf19 gene were more sensitive to the antipro- the absence of ligand (Figs. 4G and I and 5). To our knowledge, liferative effects of TGFb than the WT and heterozygous MEFs this is one of the very few examples of a repressor of the TGFb (Supplementary Fig. S5D and S5E) and exhibited enhanced TGFb pathway via direct binding to TGFb receptors, and this finding signaling activity (Supplementary Fig. S5F and S5G). However, may advance our understanding of the functional divergence of the tnfrsf19 / mice were alive at birth and grew into adulthood the TNFR superfamily. without gross abnormalities compared with their littermates, Genetic alterations in the TGFb pathway, such as the biallelic which is consistent with previous reports of tnfrsf19 KO mouse inactivation of TGFBRII, Smad2 and Smad3 mutations, and Smad4 models generated by different gene-editing strategies and in deletion, are often found in human cancers (7, 38). Notably, different mice strains (36, 47). It could be a result of the redun- targeted deletion of Smad4 in the head and neck epithelium of dancy of other TNFR family members such as Edar (36). None- mice is sufficient to drive spontaneous head and neck squamous theless, we showed that human TNFRSF19 is essential for the cell carcinomas (39). Loss of sensitivity to TGFb-induced growth proliferation and tumorigenicity of NPC cells. Future assessment suppression has been found in NPC (11, 12). We identified of chemically induced tumor formation, such as 4NQO TNFRSF19 as a key repressor of the TGFb pathway that is often (4-nitroquinoline 1-oxide)-induced head and neck squamous overexpressed in NPC, and high levels of TNFRSF19 are inversely cell carcinoma is needed in the Troy KO mouse model. One the correlated with TGFb pathway activity in vivo; these evidences other side, given the gain-of-function property of TNFRSF19 in indicate that the inactivation of TGFb signaling in NPC could NPC, a transgenic mouse model would be more valuable to define result from the gain of function of TNFRSF19 rather than muta- the role of TNFRSF19 in NPC development. tions in canonical TGFb components. In addition to TNFRSF19, The cause of aberrant expression of TNFRSF19 in cancers is still other NPC susceptibility loci we have identified in 2010 include elusive. Tumor-specific expression of TNFRSF19 has been MDS1-EVI1 and the CDKN2A-CDKN2B gene cluster (13). Inter- observed in NPC and other cancers (18, 19, 21). However, estingly, CDKN2B (p15INK4b) is a TGFb target gene that partici- whether the genetic variations cause reactivation of TNFRSF19 pates in the mediation of TGFb-induced cell-cycle arrest (40), and remains uncertain. GWAS identified three SNPs within the MDS1-EVI1 is an oncoprotein that suppresses TGFb signaling by TNFRSF19 region, rs1572072, rs9510787, and rs753955, but binding to Smad3 (41). The three NPC susceptibility genes seem none of these SNPs are located in the coding region or near to be involved in the regulation of TGFb signal transduction at the promoter of TNFRSF19 (13, 14). Moreover, using quantitative different levels. In addition, TGFbRII has been shown to be RT-PCR in various cell lines with or without TNFRSF19 expres- downregulated in more than 50% of NPC (10). Various genetic sion, we did not find concordance between the mRNA and protein perturbations leading to the dysfunction of the same biological expression levels (Supplementary Fig. S3C). The reasons for the pathway are common in cancers. Further study of the TGFb poor correlation of mRNA and protein levels include posttran- pathway status in a large cohort of patients with NPC and scriptional and posttranslational modifications, necessitating evaluation of its association with prognosis are warranted. further investigations. The discovery that TNFRSF19 antagonizes TGFb signaling by In conclusion, our results suggest that gain of function of interacting with the type I receptor and preventing its activation in TNFRSF19 in NPC inhibits the tumor-suppressive role of the a ligand-independent manner explains how TNFRSF19 controls TGFb pathway and promotes tumorigenesis. These findings help

www.aacrjournals.org Cancer Res; 78(13) July 1, 2018 3481

Deng et al.

pave the way toward a better understanding of the molecular basis Acknowledgments and therapeutic potential of NPC. We thank Drs. Junjie Chen and Kwok Wai Lo for helpful discussions. This work was supported by the National Key R&D Program of China (nos. Disclosure of Potential Conflicts of Interest 2016YFC0902000 to Y.-X. Zeng and 2017YFA0505600 to L. Feng), Major Project No potential conflicts of interest were disclosed. of Chinese National Programs for Fundamental Research and Development (no. 2013CB910301 to Y.-X. Zeng), the National Natural Science Foundation of China Authors' Contributions (nos. 81672980 to L. Feng and 81372882 to J.-X. Bei), the Key Program of the National Natural Science Foundation of China (no. 81430059 to Y.-X. Zeng), the Conception and design: J.-X. Bei, Y.-X. Zeng, L. Feng Health & Medical Collaborative Innovation Project of Guangzhou City, China Development of methodology: C. Deng, H.-J. Zhang, L. Feng (no. 201803040003 to Y.-X. Zeng), and the Foundation of the Ministry of Science Acquisition of data (provided animals, acquired and managed patients, and Technology of Guangdong Province (no. 2015B050501005 to Y.-X. Zeng). provided facilities, etc.): C. Deng, G.-P. He, H.-J. Zhang, Q.-S. Feng, J.-X. Bei Analysis and interpretation of data (e.g., statistical analysis, biostatistics, computational analysis): C. Deng, Y.-X. Lin, X.-K. Qi, L. Feng The costs of publication of this article were defrayed in part by the payment advertisement Writing, review, and/or revision of the manuscript: C. Deng, Y.-X. Lin, X.-K. of page charges. This article must therefore be hereby marked Qi, J.-X. Bei, L. Feng in accordance with 18 U.S.C. Section 1734 solely to indicate this fact. Administrative, technical, or material support (i.e., reporting or organizing data, constructing databases): G.-P. He, Y. Zhang, M. Xu, Q.-S. Feng Received October 17, 2017; revised March 27, 2018; accepted April 26, 2018; Study supervision: J.-X. Bei, L. Feng published first May 7, 2018.

References 1. Wei WI, Sham JS. Nasopharyngeal carcinoma. Lancet 2005;365: glioblastoma cell invasion via Pyk2-Rac1 signaling. Mol Cancer Res 2010; 2041–54. 8:1558–67. 2. Razak AR, Siu LL, Liu FF, Ito E, O'Sullivan B, Chan K. Nasopharyngeal 19. Loftus JC, Dhruv H, Tuncali S, Kloss J, Yang Z, Schumacher CA, et al. TROY carcinoma: the next challenges. Eur J Cancer 2010;46:1967–78. (TNFRSF19) promotes glioblastoma survival signaling and therapeutic 3. Dai W, Zheng H, Cheung AK, Lung ML. Genetic and epigenetic landscape of resistance. Mol Cancer Res 2013;11:865–74. nasopharyngeal carcinoma. Chin Clin Oncol 2016;5:16. 20. Fafilek B, Krausova M, Vojtechova M, Pospichalova V, Tumova L, Sloncova 4. Bei JX, Zuo XY, Liu WS, Guo YM, Zeng YX. Genetic susceptibility to the E, et al. Troy, a tumor necrosis factor receptor family member, interacts with endemic form of NPC. Chin Clin Oncol 2016;5:15. lgr5 to inhibit wnt signaling in intestinal stem cells. Gastroenterology 5. Hildesheim A, Wang CP. Genetic predisposition factors and nasopharyn- 2013;144:381–91. geal carcinoma risk: a review of epidemiological association studies, 2000– 21. Schon S, Flierman I, Ofner A, Stahringer A, Holdt LM, Kolligs FT, et al. beta- 2011: rosetta stone for NPC: genetics, viral infection, and other environ- catenin regulates NF-kappaB activity via TNFRSF19 in colorectal cancer mental factors. Semin Cancer Biol 2012;22:107–16. cells. Int J Cancer 2014;135:1800–11. 6. Derynck R, Zhang YE. Smad-dependent and Smad-independent pathways 22. Feng L, Chen J. The E3 ligase RNF8 regulates KU80 removal and NHEJ in TGF-beta family signalling. Nature 2003;425:577–84. repair. Nat Struct Mol Biol 2012;19:201–6. 7. Massague J. TGFbeta in Cancer. Cell 2008;134:215–30. 23. Feng L, Huang J, Chen J. MERIT40 facilitates BRCA1 localization and DNA 8. Wei YS, Zhu YH, Du B, Yang ZH, Liang WB, Lv ML, et al. Association of damage repair. Genes Dev 2009;23:719–28. transforming growth factor-beta1 gene polymorphisms with genetic sus- 24. Lian YF, Yuan J, Cui Q, Feng QS, Xu M, Bei JX, et al. Upregulation of ceptibility to nasopharyngeal carcinoma. Clin Chim Acta 2007;380:165–9. KLHDC4 predicts a poor prognosis in human nasopharyngeal carcinoma. 9. Zhang W, Zeng Z, Fan S, Wang J, Yang J, Zhou Y, et al. Evaluation of the PLoS One 2016;11:e0152820. prognostic value of TGF-beta superfamily type I receptor and TGF-beta type 25. Liang Y, Zhong Z, Huang Y, Deng W, Cao J, Tsao G, et al. Stem-like cancer II receptor expression in nasopharyngeal carcinoma using high-throughput cells are inducible by increasing genomic instability in cancer cells. J Biol tissue microarrays. J Mol Histol 2012;43:297–306. Chem 2010;285:4931–40. 10. Lyu X, Fang W, Cai L, Zheng H, Ye Y, Zhang L, et al. TGFbetaR2 is a major 26. Ding Z, Roos A, Kloss J, Dhruv H, Peng S, Pirrotte P, et al. A novel signaling target of miR-93 in nasopharyngeal carcinoma aggressiveness. Mol Cancer complex between TROY and EGFR mediates glioblastoma cell invasion. 2014;13:51. Mol Cancer Res 2018;16:322–32. 11. Xiao J, Xiang Q, Xiao YC, Su ZJ, Huang ZF, Zhang QH, et al. The effect of 27. Kaye KM, Devergne O, Harada JN, Izumi KM, Yalamanchili R, Kieff E, transforming growth factor-beta1 on nasopharyngeal carcinoma cells: et al. Tumor necrosis factor receptor associated factor 2 is a mediator of insensitive to cell growth but functional to TGF-beta/Smad pathway. NF-kappa B activation by latent infection membrane protein 1, the J Exp Clin Cancer Res 2010;29:35. Epstein-Barr virus transforming protein. Proc Nat Acad Sci U S A 12. Lo AK, Dawson CW, Lo KW, Yu Y, Young LS. Upregulation of Id1 by 1996;93:11085–90. Epstein-Barr virus-encoded LMP1 confers resistance to TGFbeta-mediated 28. Pan G, Bauer JH, Haridas V, Wang S, Liu D, Yu G, et al. Identification and growth inhibition. Mol Cancer 2010;9:155. functional characterization of DR6, a novel death domain-containing 13. Bei JX, Li Y, Jia WH, Feng BJ, Zhou G, Chen LZ, et al. A genome-wide TNF receptor. FEBS Lett 1998;431:351–6. association study of nasopharyngeal carcinoma identifies three new sus- 29. Wieser R, Wrana JL, Massague J. GS domain mutations that constitutively ceptibility loci. Nat Genet 2010;42:599–603. activate T beta R-I, the downstream signaling component in the TGF-beta 14. Hu Z, Wu C, Shi Y, Guo H, Zhao X, Yin Z, et al. A genome-wide association receptor complex. EMBO J 1995;14:2199–208. study identifies two new lung cancer susceptibility loci at 13q12.12 and 30. Feng XH, Derynck R. A kinase subdomain of transforming growth factor- 22q12.2 in Han Chinese. Nat Genet 2011;43:792–6. beta (TGF-beta) type I receptor determines the TGF-beta intracellular 15. Hu S, Tamada K, Ni J, Vincenz C, Chen L. Characterization of TNFRSF19, a signaling specificity. EMBO J 1997;16:3912–23. novel member of the tumor necrosis factor receptor superfamily. Genomics 31. Chen YG, Hata A, Lo RS, Wotton D, Shi Y, Pavletich N, et al. Determinants of 1999;62:103–7. specificity in TGF-beta signal transduction. Genes Dev 1998;12:2144–52. 16. Locksley RM, Killeen N, Lenardo MJ. The TNF and TNF receptor super- 32. Huse M, Chen YG, Massague J, Kuriyan J. Crystal structure of the cyto- families: integrating mammalian biology. Cell 2001;104:487–501. plasmic domain of the type I TGF beta receptor in complex with FKBP12. 17. Spanjaard RA, Whren KM, Graves C, Bhawan J. Tumor necrosis factor Cell 1999;96:425–36. receptor superfamily member TROY is a novel melanoma biomarker and 33. Sengupta S, den Boon JA, Chen IH, Newton MA, Dahl DB, Chen M, et al. potential therapeutic target. Int J Cancer 2007;120:1304–10. Genome-wide expression profiling reveals EBV-associated inhibition of 18. Paulino VM, Yang Z, Kloss J, Ennis MJ, Armstrong BA, Loftus JC, et al. TROY MHC class I expression in nasopharyngeal carcinoma. Cancer Res 2006;66: (TNFRSF19) is overexpressed in advanced glial tumors and promotes 7999–8006.

3482 Cancer Res; 78(13) July 1, 2018 Cancer Research

Characterization of TNFRSF19 as a Repressor of TGFb Pathway

34. Dennler S, Itoh S, Vivien D, ten Dijke P, Huet S, Gauthier JM. Direct binding 42. Liang CL, Chen JL, Hsu YP, Ou JT, Chang YS. Epstein-Barr virus BZLF1 of Smad3 and Smad4 to critical TGF beta-inducible elements in the gene is activated by transforming growth factor-beta through coopera- promoter of human plasminogen activator inhibitor-type 1 gene. EMBO tivity of Smads and c-Jun/c-Fos proteins. J Biol Chem 2002;277: J 1998;17:3091–100. 23345–57. 35. Lo KW, Huang DP. Genetic and epigenetic changes in nasopharyngeal 43. Iempridee T, Das S, Xu I, Mertz JE. Transforming growth factor beta- carcinoma. Semin Cancer Biol 2002;12:451–62. induced reactivation of Epstein-Barr virus involves multiple Smad-binding 36. Pispa J, Pummila M, Barker PA, Thesleff I, Mikkola ML. Edar and Troy elements cooperatively activating expression of the latent-lytic switch signalling pathways act redundantly to regulate initiation of hair follicle BZLF1 gene. J Virol 2011;85:7836–48. development. Hum Mol Genet 2008;17:3380–91. 44. Stange DE, Koo BK, Huch M, Sibbel G, Basak O, Lyubimova A, et al. 37. Kojima T, Morikawa Y, Copeland NG, Gilbert DJ, Jenkins NA, Senba E, et al. Differentiated Troy(þ) chief cells act as reserve stem cells to generate all TROY, a newly identiﬁed member of the tumor necrosis factor receptor lineages of the stomach epithelium. Cell 2013;155:357–68. superfamily, exhibits a homology with Edar and is expressed in embryonic 45. Schutgens F, Rookmaaker MB, Blokzijl F, van Boxtel R, Vries R, Cuppen E, skin and hair follicles. J Biol Chem 2000;275:20742–7. et al. Troy/TNFRSF19 marks epithelial progenitor cells during mouse 38. Siegel PM, Massague J. Cytostatic and apoptotic actions of TGF-beta in kidney development that continue to contribute to turnover in adult homeostasis and cancer. Nat Rev Cancer 2003;3:807–21. kidney. Proc Nat Acad Sci U S A 2017;114:E11190–E8. 39. Lu SL, Herrington H, Wang XJ. Mouse models for human head and neck 46. Basak O, Krieger TG, Muraro MJ, Wiebrands K, Stange DE, Frias-Aldeguer J, squamous cell carcinomas. Head Neck 2006;28:945–54. et al. Troyþ brain stem cells cycle through quiescence and regulate their 40. Hannon GJ, Beach D. p15INK4B is a potential effector of TGF-beta-induced number by sensing niche occupancy. Proc Natl Acad Sci U S A 2018;115: cell cycle arrest. Nature 1994;371:257–61. E610–E9. 41. Kurokawa M, Mitani K, Irie K, Matsuyama T, Takahashi T, Chiba S, et al. The 47. Shao Z, Browning JL, Lee X, Scott ML, Shulga-Morskaya S, Allaire N, et al. oncoprotein Evi-1 represses TGF-beta signalling by inhibiting Smad3. TAJ/TROY, an orphan TNF receptor family member, binds Nogo-66 Nature 1998;394:92–6. receptor 1 and regulates axonal regeneration. Neuron 2005;45:353–9.

www.aacrjournals.org Cancer Res; 78(13) July 1, 2018 3483

TNFRSF19 Inhibits TGFβ Signaling through Interaction with TGFβ Receptor Type I to Promote Tumorigenesis

Chengcheng Deng, Yu-Xin Lin, Xue-Kang Qi, et al.

Cancer Res 2018;78:3469-3483. Published OnlineFirst May 7, 2018.

Updated version Access the most recent version of this article at: doi:10.1158/0008-5472.CAN-17-3205

Supplementary Access the most recent supplemental material at: Material http://cancerres.aacrjournals.org/content/suppl/2021/03/16/0008-5472.CAN-17-3205.DC1

Visual A diagrammatic summary of the major findings and biological implications: Overview http://cancerres.aacrjournals.org/content/78/13/3469/F1.large.jpg

Cited articles This article cites 47 articles, 15 of which you can access for free at: http://cancerres.aacrjournals.org/content/78/13/3469.full#ref-list-1

Citing articles This article has been cited by 2 HighWire-hosted articles. Access the articles at: http://cancerres.aacrjournals.org/content/78/13/3469.full#related-urls

E-mail alerts Sign up to receive free email-alerts related to this article or journal.

Reprints and To order reprints of this article or to subscribe to the journal, contact the AACR Publications Department at Subscriptions [email protected].

Permissions To request permission to re-use all or part of this article, use this link http://cancerres.aacrjournals.org/content/78/13/3469. Click on "Request Permissions" which will take you to the Copyright Clearance Center's (CCC) Rightslink site.