The Morphology and Molecular Phylogenies of the Laurencia Complex
Genera with a Description of Species from Eastern Australia
D. Yola Metti
PhD
January 2012
1 2 Originality Statement
‘I hereby declare that this submission is my own work and to the best of my knowledge it contains no materials previously published or written by another person, or substantial proportions of material which have been accepted for the award of any other degree or diploma at UNSW or any other educational institution, except where due acknowledgement is made in the thesis. Any contribution made to the research by others, with whom I have worked at UNSW or elsewhere, is explicitly acknowledged in the thesis. I also declare that the intellectual content of this thesis is the product of my own work, except to the extent that assistance from others in the project’s design and conception or in style, presentation and linguistic expression is acknowledged.’
Yola Metti
January, 2012
Provisional Status Declaration
The results and contents of this PhD thesis are presented in accordance with the regulations of the University of New South Wales. They do not constitute a valid publication and all nomenclatural changes, proposed new genera and proposed new species should be considered provisional.
Yola Metti
January, 2012
3
4 Copyright Statement
‘I hereby grant the University of New South Wales or its agents the right to archive and to make available my thesis or dissertation in whole or part in the University libraries in all forms of media, now or here after known, subject to the provisions of the Copyright Act 1968. I retain all proprietary rights, such as patent rights. I also retain the right to use in future works (such as articles or books) all or part of this thesis or dissertation. I also authorise University Microfilms to use the 350 word abstract of my thesis in Dissertation Abstract International (this is applicable to doctoral theses only). I have either used no substantial portions of copyright material in my thesis or I have obtained permission to use copyright material; where permission has not been granted I have applied/will apply for a partial restriction of the digital copy of my thesis or dissertation.'
Yola Metti
July, 2012
Authenticity Statement
‘I certify that the Library deposit digital copy is a direct equivalent of the final officially approved version of my thesis. No emendation of content has occurred and if there are any minor variations in formatting, they are the result of the conversion to digital format.’
Yola Metti
July, 2012
5
6 ABSTRACT
Generic delineations within the Laurencia complex are examined on a worldwide scale using both morphological characters and molecular analyses (rbcL) including new evidence from
Australian and Asian Pacific material. The results show that the genera Osmundea and Yuzurua are both monophyletic and well supported, that Palisada is not a distinct genus but should be merged with Chondrophycus, and that the genus Laurencia is polyphyletic among three separate clades; Laurencia sensu stricto, Laurencia elata group and Laurencia marilzae group. The results also show an unnamed clade closely related to the Osmundea genus. The unnamed clade, the elata group, and the marilzae group are recognized as new genera with both molecular and morphological evidence; Norfophycus gen. nov. from Norfolk Island and the Philippines;
Coronaphycus gen. nov. from Australia; and Neolaurencia* gen. nov. from the Canary Islands,
Spain, respectively. One new genus is recognized based on morphological evidence alone;
Namia gen. nov. from Korea. In addition, three new combinations are made; Coronaphycus elatus comb. nov., Neolaurencia* marilzae comb. nov., and Namia kangjaewonii comb. nov.
As well as investigating the genera this research investigates the species of the Laurencia complex that occur in NSW. The entire coast of NSW, including Lord Howe and Norfolk
Islands, was visited with the express purpose of collecting taxa belonging to this complex.
Molecular phylogenies using the genes rbcL, rbcL-rbcS spacer, and COX1 were created and combined with traditional morphological investigations to determine species within the
Laurencia complex. Results show seventeen individual species are present in NSW; in the genus Laurencia; L. calliptera, L. queenslandica stat. nov., L. venusta, L. concinna, L. decussata stat. nov., L. elegans stat. nov., and L. dendroidea; in the genus Coronaphycus; Coronaphycus elatus comb. nov., Coronaphycus minorus sp. nov; in the genus Chondrophycus; Chondrophycus cruciatus, and in the
* Neolaurencia is currently being described as the genus Laurenciella by V. Cassano et al. (pers. com. Dec. 8, 2011). The work in this thesis supports their conclusions that this group is to be recognized at a generic level.
7 genus Norfophycus; Norfophycus originalis sp. nov. As well, six taxa may represent previously undescribed species, however further investigations are required to confirm identifications; four Laurencia taxa, one Chondrophycus taxon and one Norfophycus taxon.
8 Acknowledgements
First and foremost I thank my principal supervisor Dr Alan Millar from the Royal Botanic
Gardens Sydney (RBGS) for his support throughout the entire project. Thank you Alan for your faith in me, your encouragement, friendship and for passing on your enthusiasm for all things seaweed. Thank you for the peppermint tea, the ‘so totally awesome’ collecting trips, and always keeping your sense of humour regardless of how stressed I became. Thank you to the whole Millar clan; Roz, Lauren and Scoobs, for taking me in as extended family. Your friendship is truly warming.
I also thank Prof Peter Steinberg, my nominal supervisor from UNSW, for his coaching in scientific presentations and for his calm encouragements.
For financial support I sincerely thank the Royal Botanic Gardens Sydney for office and lab space, for vehicle and boat use, and the day to day support. Thank you to Prof. Peter
Steinberg and the Centre for Marine Biofouling and Bio-innovation (CMBB) who awarded me a year long scholarship, and covered the molecular sequencing costs and most of my travel costs to conferences. Thank you to the Australian Biological Resources Study (ABRS) for a grant that covered field trip costs particularly to Norfolk and Lord Howe Islands.
Thank you to Dr Sandra Lindstrom (UBC), who taught me as an undergrad student, gave me a chance in her lab, and introduced me to Dr Alan Millar. You started me out onto my chosen path of studying seaweed and it is a privilege to now call you friend and colleague.
Thank you to Dr Wilson Freshwater, who put me on my feet with the practical molecular
”how-to’s”. Your patience, teaching and support both in the lab and by email were instrumental in starting me in the right direction.
9 Some samples used for molecular and morphological work were generously donated by various researchers, and I would like to thank each one for supporting this study, including
Dr Showe-Mei Lin, Dr Mutue Fujii, Prof. Hiroshi Kawai, Dr Wilson Freshwater, Dr John
Huisman, Mr James Eu, Dr Wendy Nelson, Dr Nick Yee, Dr Fred Gurgel, Dr Mitsunobu
Kamiya and Ms Danielle Ghosn. The samples have been invaluable.
Thank you to all my colleagues who share my enthusiasm for the Laurencia and who have encouraged me to continue working on them, including Dr Mutue Fujii, Dr Valeria Cassano,
Dr Mariana Olivier, Dr John Huisman, and Dr Showe-Mei Lin.
Thank you to Dr Ki Wan Nam, whose advice has helped me to better understand the morphologies of the Laurencia complex.
Thank you to everyone at the Royal Botanic Gardens who gave advice, help and friendship;
Carolyn Connelly, Katie Thurlby, Dr Paul Rymer, Dr Nick Yee, Dr Richard Jobson, Dr
Adam Marchant, Dr Margaret Heslewood, Dr Hannah McPherson, and Dr Marlien Van Der
Merwe.
Thank you to Louisa Murray at the Royal Botanic Gardens, whose support and friendship is greatly valued, and whose encouragements were so perfectly timed I’m sure they were
Heaven-sent.
Thank you to Dr Peter Wilson for your nomenclatural expertise, thank you to Dr Peter
Weston and Dr Karen Wilson for all your advice on molecular phylogenetics, and thank you to Zonda Erskine for all your help with the many loans I’ve sent and received throughout the years.
Thank you to my in-laws, Mum and Dad, who treated us to home cooked dinners, and spent time with their grandson, often spontaneously, to give me time to complete this project.
10 I thank my family, Mom, Dad, Richard and Jenny, who, although overseas, were behind me every step of the way. They have always encouraged me to ‘go for it’, and are always willing to help in every way possible, especially in planning a celebratory holiday.
Most importantly I thank my wonderful husband Craig (and my beautiful baby Cayleb), who inspired me to follow my dream, who tirelessly covered the home front while I was working on my research, who encouraged me when my spirits were down, and celebrated each success with me. Thank you Craigy for your wide shoulders.
I dedicate this work to our Creator, without Whom there would be quite literally nothing.
11 12 Table of Contents
Originality Statement and Provisional Status Declaration ...... 3 Copyright and Authenticity Statements ...... 5 ABSTRACT ...... 7 Acknowledgements ...... 9 List of Figures ...... 15 List of Tables ...... 19 CHAPTER 1 ...... 21 Introduction to this research ...... 21 Thesis Structure ...... 24 CHAPTER 2 ...... 25 Abstract ...... 25 Introduction ...... 26 Current definitions of Laurencia sensu lato...... 26 The History of the Laurencia complex...... 27 Current definitions of the genera within the Laurencia complex ...... 36 Materials and Methods ...... 41 Results and Observations ...... 51 Laurencia sensu lato ...... 61 Coronaphycus...... 62 Coronaphycus elatus...... 62 Namia ...... 64 Namia kangjaewonia ...... 64 Neolaurencia*...... 65 Neolaurencia* marilzae ...... 65 Norfophycus...... 66 Norfophycus originalis...... 66 Discussion ...... 71 CHAPTER 3 ...... 77 Abstract ...... 77 Introduction ...... 78 Materials and Methods ...... 85 Results and Observations ...... 101
* Neolaurencia is currently being described as the genus Laurenciella by V. Cassano et al. (pers. com. Dec. 8, 2011). The work in this thesis supports their conclusions that this group is to be recognized at a generic level.
13 Laurencia sensu lato ...... 125 Laurencia sensu stricto ...... 127 Laurencia calliptera ...... 129 Laurencia concinna ...... 141 Laurencia decussata...... 159 Laurencia dendroidea ...... 173 Laurencia elegans ...... 189 Laurencia queenslandica...... 205 Laurencia venusta ...... 223 Laurencia sp.1 ...... 235 Laurencia sp.2 ...... 241 Laurencia sp.3 ...... 247 Laurencia sp.4 ...... 253 Chondrophycus ...... 259 Chondrophycus cruciatus ...... 261 Chondrophycus sp...... 273 Norfophycus ...... 279 Norfophycus originalis...... 281 Norfophycus sp...... 297 Coronaphycus ...... 303 Coronaphycus minorus ...... 305 Coronaphycus elatus...... 317 Species recorded from but not confirmed in NSW ...... 323 Laurencia decumbens ...... 323 Laurencia distichophylla ...... 324 Laurencia filiformis ...... 325 Laurencia minuscula...... 326 Laurencia obtusa ...... 327 Laurencia platyclada ...... 328 Laurencia rigida ...... 329 Chondrophycus papillosus ...... 330 Chondrophycus succisus ...... 331 Discussion ...... 333 CHAPTER 4 ...... 341 Introduction ...... 341 References ...... 347
14
List of Figures
Figure 1. A world map indicating recent molecular studies on Laurencia complex taxa ...... 23
Figure 2. The ML phylogram (rbcL) of the Laurencia complex genera ...... 55
Figure 3. The BI phylogram (rbcL) of the Laurencia complex genera ...... 57
Figure 4. The MP phylogram (rbcL) of the Laurencia complex genera ...... 59
Figure 5. Collection locations across NSW ...... 85
Figure 6. The ML phylogram (rbcL) of the Laurencia complex species of NSW ...... 103
Figure 7. The BI phylogram (rbcL) of the Laurencia complex species of NSW ...... 105
Figure 8. The MP phylogram (rbcL) of the Laurencia complex species of NSW ...... 107
Figure 9. The ML phylogram (rbcL and COX1) of the Laurencia complex species of NSW ... 111
Figure 10. The BI phylogram (rbcL and COX1) of the Laurencia complex species of NSW 113
Figure 11. The MP phylogram (rbcL and COX1) of the Laurencia complex species of NSW 115
Figure 12. The ML phylogram (rbcL and spacer) of the Laurencia complex species of NSW 119
Figure 13. The BI phylogram (rbcL and spacer) of the Laurencia complex species of NSW 121
Figure 14. The MP phylogram (rbcL and spacer) of the Laurencia complex species of NSW 123
Figure 15. The distribution of Laurencia calliptera in NSW ...... 129
Figure 16. Habits of Laurencia calliptera from NSW...... 135
Figure 17. Branch details of Laurencia calliptera from NSW...... 137
Figure 18. Microscopic features of Laurencia calliptera from NSW...... 139
Figure 19. The distribution of Laurencia concinna in NSW ...... 141
Figure 20. Habits of Laurencia concinna from NSW...... 151
Figure 21. Branch details of Laurencia concinna from NSW...... 153
Figure 22. Microscopic features of Laurencia concinna from NSW...... 155
Figure 23. Microscopic features of Laurencia concinna from NSW...... 157
Figure 24. The distribution of Laurencia decussata in NSW...... 159
Figure 25. Habits of Laurencia decussata from NSW ...... 167 15 Figure 26. Branch details of Laurencia decussata from NSW...... 169
Figure 27. Microscopic features of Laurencia decussata from NSW...... 171
Figure 28. The distribution of Laurencia dendroidea in NSW ...... 174
Figure 29. Habits of Laurencia dendroidea from NSW...... 181
Figure 30. Habit of Laurencia dendroidea...... 183
Figure 31. Branch details of Laurencia dendroidea from NSW...... 185
Figure 32. Microscopic features of Laurencia dendroidea from NSW...... 187
Figure 33. The distribution of Laurencia elegans in NSW...... 189
Figure 34. Habits of Laurencia elegans from NSW...... 199
Figure 35. Branch details of Laurencia elegans in NSW...... 201
Figure 36. Microscopic features of Laurencia elegans in NSW...... 203
Figure 37. The distribution of Laurencia queenslandica in NSW...... 205
Figure 38. Habits of Laurencia queenslandica from NSW...... 215
Figure 39. Branch details of Laurencia queenslandica from NSW...... 217
Figure 40. Microscopic features of Laurencia queenslandica from NSW...... 219
Figure 41. Microscopic features of Laurencia queenslandica from NSW ...... 221
Figure 42. The distribution of Laurencia venusta in NSW...... 223
Figure 43. Habits of Laurencia venusta from NSW...... 229
Figure 44. Branch details of Laurencia venusta from NSW...... 231
Figure 45. Microscopic features of Laurencia venusta from NSW...... 233
Figure 46. The distribution of Laurencia sp1 in NSW ...... 235
Figure 47. Habits of Laurencia sp1 found in NSW...... 239
Figure 48. The distribution of Laurencia sp2 in NSW ...... 241
Figure 49. Habit of Laurencia sp2 from NSW...... 245
Figure 50. The distribution of Laurencia sp3 in NSW ...... 247
Figure 51. Habit of Laurencia sp3 from NSW...... 251
16 Figure 52. The distribution of Laurencia sp4 in NSW ...... 253
Figure 53. Habit of Laurencia sp4 from NSW...... 257
Figure 54. The distribution of Chondrophycus cruciatus in NSW ...... 262
Figure 55. Habits of Chondrophycus cruciatus...... 267
Figure 56. Branch details of Chondrophycus cruciatus from NSW...... 269
Figure 57. Microscopic details of Chondrophycus cruciatus from NSW...... 271
Figure 58. The distribution of Chondrophycus sp in NSW ...... 273
Figure 59. Habit of Chondrophycus sp from NSW...... 277
Figure 60. The distribution of Norfophycus originalis in NSW ...... 281
Figure 61. Habits of Norfophycus originalis from NSW ...... 289
Figure 62. Branch details of Norfophycus originalis from NSW ...... 291
Figure 63. Microscopic features of Norfophycus originalis from NSW ...... 293
Figure 64. Microscopic features of Norfophycus originalis from NSW ...... 295
Figure 65. The distribution of Norfophycus sp in NSW ...... 297
Figure 66. Habits of Norfophycus sp. from NSW ...... 301
Figure 67. The distribution of Coronaphycus minorus in NSW ...... 305
Figure 68. Habits of Coronaphycus minorus from NSW ...... 311
Figure 69. Branch details of Coronaphycus minorus from NSW...... 313
Figure 70. Microscopic details of Coronaphycus minorus from NSW ...... 315
Figure 71. The distributions of Coronaphycus elatus in NSW ...... 318
Figure 72. Habits of Coronaphycus elatus from NSW ...... 321
17 18 List of Tables
Table 1. Yamada 1931 revision of the genus Laurencia...... 28
Table 2. Saito 1967 revision of the genus Laurencia...... 29
Table 3. Saito and Womersley 1974 revision of the genus Laurencia ...... 31
Table 4. Nam et al 1994 revision of the Laurencia complex...... 32
Table 5. Garbary and Harper 1998 revision of the Laurencia complex ...... 33
Table 6. Nam 1999 revision of the genus Chondrophycus ...... 34
Table 7. Current status of the Laurencia complex...... 36
Table 8. The morphological characters used previous to this study to separate the Laurencia complex genera...... 39
Table 9. A list of species used for generic molecular work in this study ...... 47
Table 10. A list of primers used for generic molecular work in this study...... 49
Table 11. A summary of model parameters used for generic molecular work in this study ...... 49
Table 12. rbcL pairwise distances between and within the Laurencia complex genera ...... 54
Table 13. The key to the genera of the Laurencia complex...... 61
Table 14. The morphological characters used to separate the Laurencia complex genera...... 69
Table 15. A list of Laurencia complex species recorded in NSW previous to this study...... 84
Table 16. A list of species used for specific molecular work in this study ...... 88
Table 17. A list of primers used for specific molecular work in this study ...... 91
Table 18. The details of the PCR program used to amplify the rbcL and spacer gene region. ... 91
Table 19. The details of the PCR program used to amplify the COX1 gene region...... 91
Table 20. The details of the sequencing program used specific molecular work in this study ... 91
Table 21. A summary of model parameters used for specific molecular work in this study...... 98
Table 22. The RuBiSCO spacer final alignment created for this study ...... 99
Table 23. Morphological key to the genera of the Laurencia complex occurring in NSW...... 125
Table 24. Morphological key to the Laurencia species occurring in NSW...... 127
19 Table 25. Morphological key to the Chondrophycus species occurring in NSW...... 259
Table 26. Morphological key to the Norfophycus species occurring in NSW ...... 279
Table 27. Morphological key to the Coronaphycus species occurring in NSW...... 303
Table 28. Species previously recorded in NSW, their records, and their current name...... 337
Table 29. A summary of species within the Laurencia complex present in NSW...... 339
Table 30. A summary of nomenclatural changes...... 340
20 CHAPTER 1
Introduction to this research
Within the Rhodomelaceae, there is a group of species known as the Laurencia complex. The taxa within this complex have a triphasic life cycle with an isomorphic alternation of generations, as is typical of many of the Rhodophyta. They display a polysiphonous construction with extensive cortication and apical growth. The Laurencia complex currently encompasses approximately 170 species. It is a common group of red algae, and members of this complex are found along almost all of the world’s temperate and tropical coastlines.
Australia has one of the largest shares with 65 species, and in the state of New South Wales
(NSW) eighteen have been documented (Millar and Kraft 1993, Millar 1999, Womersley
2003). The Laurencia complex can dominate the intertidal zone and is often abundant in the shallow subtidal region. Within the state of NSW, it is the third most abundant group after
Polysiphonia and Ceramium. In such amounts, the Laurencia complex taxa become important in terms of intertidal biomass and ecology, where they provide food, oxygen and shelter to a vast array of intertidal organisms. Members of the Laurencia complex are also chemically rich and diverse. Laurencia species in particular are distinctive in their biochemistry and their secondary metabolites have potential antifouling and medical applications (W. K. Jung et al
2009, Paradas et al 2010).
A large majority of Laurencia complex species have variable morphologies, and can only be reliably distinguished by subtle differences in internal anatomy and reproductive structures.
Multiple characters distinguish species from each other, but these often describe polyphyletic taxa. This has resulted in the identification of some species from coastlines that are biogeographically disjunct from type localities.
21 Recently taxonomists have employed cladistic analyses using morphological characters to better define taxa and ensure monophyly. Where the Laurencia complex originally contained one genus, Laurencia, the use of molecular analyses resulted in an increase in recognized genera within the complex. Garbary and Harper (1998) examined the genus Laurencia using morphological cladistics and showed that the subgenus Chondrophycus required recognition at the generic rank. Similarly Nam (2006) recognized the subgenus Palisada as distinct.
Recently, the subgenus Yuzurua, from within the genus Chondrophycus, was also raised to generic rank resulting in the five genera that currently constitute the Laurencia complex;
Laurencia, Chondrophycus, Palisada, Yuzurua and Osmundea.
Various Australian studies have included both single species treatments as well as major regional floristics (Nam and Saito 1991, Nam and Choi 2001, Furnari et al 2004, Lucas 1927,
1935, 1947, Cribb 1983, Millar 1990, Millar and Kraft 1993, Womersley 2003, Millar 2004).
Although these treatments have been based on material from Western Australia, South
Australia, Victoria, NSW and Queensland, none have used recent molecular phylogenetic approaches. Of the five genera within the complex, only Laurencia and Chondrophycus are presently known from Australia (Womersley 2003) and neither has been examined at the molecular level.
Most of the molecular work on the Laurencia complex has been on northern hemisphere taxa and Atlantic Ocean representatives. There has been little work carried out in the South
Pacific particularly on the new genera Yuzurua and Palisada, and no molecular work on any
Australian taxa (Figure 1). Australia is a key location for studying marine algae, particularly the Rhodophyta, since it is currently believed that the southwest Pacific region is a large center of biodiversity and endemism for red algae (van den Hoek 1984, Kerswell 2006).
Also, Australia for the most part escaped widespread glaciation events during the last ice
22 ages, allowing for a longer evolutionary history among coastal seaweeds, perhaps even maintaining algal refuga. Because of the long evolutionary history and potentially unique taxa to be found, the results from a molecular, systematic investigation into the Laurencia complex taxa of the Australasian region could have serious impacts on the current world understanding of the Laurencia complex.
Figure 1. A world map indicating recent molecular studies on Laurencia complex taxa (check marks), and highlighting the absence of molecular studies on the Laurencia complex in the Australian region (arrow and question mark). (World map courtesy of Google Maps.)
With biodiversity studies and monitoring now considered crucial to the understanding of possible effects of climate change, ocean acidification and changes in sea levels, detailed molecular phylogenetic research on this major algal component of the intertidal is needed.
In the state of New South Wales (NSW), Australia, the Laurencia complex has not been critically surveyed or monographed. Millar (1990) described and illustrated only 5 species from the northern part of the NSW coast at Coffs Harbour and later supplied a list of 15 species then known to occur in the State (Millar and Kraft 1993). With the increase in the number of genera within the complex and the recognition of many new diagnostic characters it is timely to revise the taxa from NSW using modern molecular techniques. During this 23 project the entire NSW state including Lord Howe and Norfolk Islands has been re-surveyed with new collections. Morphological examinations have been made in order to observe physical features that may be useful in separating taxa. As well, molecular analyses have been employed to confirm species limits, examine the validity of key identifying characters, clarify generic relationships within the complex, and determine possible evolutionary relationships.
In summary, the aims of this research were to:
1. Produce molecular phylogenies of the Laurencia complex genera and species that occur in
NSW.
2. Use the phylogenies to identify and confirm diagnostic morphological characters.
3. Use the molecular phylogenies and morphologically significant features to determine which of the genera and species are present in NSW, including any new taxa.
4. Describe each of these genera and species in detail.
5. Create a dichotomous key for the Laurencia complex genera and species occurring within
NSW.
Thesis Structure
This thesis has been structured into 4 chapters. Chapter 1 briefly introduces the Laurencia complex, the aims of this research, and the breakdown of the thesis structure. In chapter 2 generic delineations within the Laurencia complex are examined using both morphological characters and molecular analyses (rbcL). In chapter 3 the species of the Laurencia complex that occur in NSW are circumscribed using molecular (rbcL, rbcL-rbcS spacer and COX1) and morphological information. Chapter 4 simply describes molecular methodologies followed throughout this study and includes all references.
24 CHAPTER 2
Morphology and Molecular phylogenies of the Laurencia complex genera with the description of four new genera; Norfophycus gen. nov., Namia gen. nov., Neolaurencia* gen. nov., and Coronaphycus gen. nov.
Abstract
In this chapter, generic delineations within the Laurencia complex are examined. Both morphological characters and molecular analyses (rbcL) are used, with new evidence included from Australian and Asian Pacific material. Results suggest that the genera Osmundea and
Yuzurua are both monophyletic and well supported, that Palisada is not a distinct genus but should be merged with Chondrophycus, and that the genus Laurencia is polyphyletic among three separate clades; Laurencia sensu stricto, Laurencia elata group and Laurencia marilzae group.
Results also show an unnamed clade closely related to the Osmundea genus. The unnamed clade, the elata group, and the marilzae group are recognized as new genera with both molecular and morphological evidence; Norfophycus gen. nov. from Norfolk Island and the
Philippines; Coronaphycus gen. nov. from Australia; Neolaurencia* gen. nov. from Canary
Islands, Spain, and one new genus is recognized based on morphological evidence alone;
Namia gen. nov. from Korea. In addition, three new combinations made; Coronaphycus elatus comb. nov., Neolaurencia* marilzae comb. nov., and Namia kangjaewonii comb. nov.
* Neolaurencia is currently being described as the genus Laurenciella by V. Cassano et al. (pers. com. Dec. 8, 2011). The work in this thesis supports their conclusions that this group is to be recognized at a generic level.
25 Introduction
The addition of cladistic analyses in Laurencia taxonomic studies has resulted in an increase in the number of genera within what was traditionally considered the single genus Laurencia
Lamouroux 1813. Osmundea Stackhouse 1809, Chondrophycus (Saito) Garbary and Harper
1998, Palisada (Yamada) Nam 2006 and most recently Yuzurua (Nam) Martin-Lescanne
2010 are currently recognized as genera distinct from Laurencia sensu stricto. For results of a phylogeny to be based on the type method the clade representing a genus must contain a sequence of the generic type from its type location, however, some generitype sequences were not previously available. This study includes for the first time generitype sequences from type locations for the genera Palisada and Chondrophycus allowing for phylogenies to now more accurately represent genera. Additionally, this study attempts to summarize which morphological characters are useful in separating the Laurencia complex genera.
Current definitions of Laurencia sensu lato
Currently the principal defining characters of the Laurencia complex itself are; a distinct apical cell contained within an apical pit, polysiphonous construction seen only at the apex, and an obscuring of the polysiphonous construction by extensive cortication in mature parts (Kylin 1956). Although these three characters define Laurencia sensu lato, on their own they do not adequately separate the complex from two other closely related genera;
Janczewskia and Chondria. The genus Chondria is separated from the Laurencia complex primarily by two morphological traits; the location of spermatangia, and the number of pericentral cells. Chondria develops spermatangial plates, whereas in the Laurencia complex spermatangia develop as filaments or off trichoblasts located within the apical pit (Nam
1999, McIvor et al 2002). Chondria displays five pericentral cells per axial cell, whereas in the Laurencia complex species develop either two or four (Womersley 2003). The genus
26 Janczewskia, which together with the Laurencia complex make up the tribe Laurencieae, is separated from the Laurencia group by its parasitism.
The History of the Laurencia complex
The genus Laurencia sensu stricto was originally erected by Lamouroux (1813) and initially included eight species, most of which were transferred from the algal genus Fucus (Furnari et al 2001). Lamouroux did not designate a type species, however, L. obtusa was designated as the type in 1889 by Schmitz (1889:447). Lamouroux’s key morphological character used to identify the genus Laurencia was the presence of cystocarps at the ends of both branches and branchlets. Soon after the genus Laurencia was established the Pinnatifida genus was proposed (Stackhouse 1816) which was based on the species Pinnatifida vulgaris Stackhouse
1816. It was later placed in synonymy with Laurencia pinnatifida (Hudson) Lamouroux 1813, and the Pinnatifida genus was sunk into the genus Laurencia (Papenfuss 1950, Nam et al
1994). However, Pinnatifida taxa were still recognized as distinct by J. Agardh, but this time as section Pinnatifidae, one of four sections within the Laurencia. The other three sections were Filiformes, Papillosae, and Obtusae (J. G. Agardh 1863, 1879). The divisions were based primarily on branching mode and thallus compression (J. Agardh 1876, Nam and
Choi 2001, Furnari et al 2001). Thallus compression remained a significant character in distinguishing between sections up until modern day molecular cladistic analyses.
The four sections within the Laurencia genus were later regrouped by Yamada (1931) with only one of the original sections surviving, the section Pinnatifidae. The three additional sections were Palisadae, Fosterianae, and Cartilagineae (Table 1). The divisions were based on the following three characters; palisade formation of surface cells, lenticular thickenings and thallus compression. In his detailed study of 66 taxa, Yamada (1931) was one of the first to include reproductive features to further the taxonomy of Laurencia species. He also
27 used microscopic characters, along with the many morphological characters highlighted by
Falkenberg (1901) and Kylin (1923, 1925, and 1928). Morphological characters outlined by
Yamada as significant in addition to those used to separate the sections include; projecting cortical cells, simple or compound stichidial branchlets, the presence or absence of a percurrent axis, and mode of branching. Currently none of these characters is considered helpful in determining a taxon’s genus, however, they are regularly used in determining a species. Interestingly, Yamada assumed L. pinnatifida as the generic type (Yamada 1931) but L. obtusa is still considered to be the type species by the majority of researchers (Saito and Womersley 1974, Garbary and Harper 1998, McIvor et al 2002, Womersley 2003,
Martin-Lescanne et al 2010).
GENUS SUBGENUS SECTION DEFINING CHARACTERS Laurencia Palisadae in transverse sections surface cells are elongated radially and arranged in a palisade formation Fosterianae in transverse sections abundant lenticular thickenings are seen in medullary cell walls. Cartilagineae lenticular thickenings are absent or rare. Pinnatifidae the thallus is clearly compressed
Table 1. This table details the sections within the genus Laurencia after Yamada’s 1931 revision, and includes their defining morphological features.
Yamada’s work is valuable and still important because of his detailed morphological observations and use of type specimens. However, Yamada’s goal was to elucidate species within the genus. He did not specify characters that he felt determined the genus itself. In contrast, Kylin in 1956 determined three distinguishing characters of the genus Laurencia; a single apical cell contained within an apical pit, polysiphonous construction observable only near the apex of a branch or branchlet, and extensive cortication. As genera have been added to the Laurencia complex, these characters have remained valid and are currently used to define a member of the Laurencia complex (Womersley 2003).
Saito (1967) was the first to divide the genus into subgenera; subgenus Laurencia with its
28 designated type Laurencia obtusa, and subgenus Chondrophycus with its designated type
Chondrophycus cartilagineous (basionym: Laurencia cartilaginea). The division was based on two newly introduced morphological characters; the presence of secondary pit connections between epidermal cells as seen in longitudinal section, and the arrangement of tetrasporangia relative to the branchlet axial row. These characters have remained important and are now two of the most common morphological features used to determine genera within the complex. Each subgenus was further divided into sections (Table 2) three of which were retained from Yamada’s 1931 treatment; Fosterianae, Pinnatifidae, and
Palisadae, and two of which were new; Laurencia and Chondrophycus. The sections were distinguished from one another using morphological characters already in use. These were; palisade formation of cortical cells, lenticular thickenings, and thallus compression (Saito
1967).
GENUS SUBGENUS SECTION DEFINING CHARACTERS Laurencia Laurencia secondary pit connections are present, and tetrasporangia are in parallel arrangement. Laurencia subgenus characters plus the thallus is cylindrical, and lenticular thickenings are absent Fosterianae subgenus characters plus the thallus is cylindrical, and lenticular thickenings are present Pinnatifidae subgenus characters plus the thallus is clearly compressed
Laurencia Chondrophycus secondary pit connections are absent, tetrasporangia are in right angle arrangement, and lenticular thickenings are absent Chondrophycus subgenus characters plus in transverse sections surface cells are not elongated radially nor arranged in a palisade formation Palisadae subgenus characters plus in transverse sections surface cells are elongated radially and arranged in a palisade formation Table 2. This table summarizes Saito’s 1967 revision of the genus Laurencia. Two new subgenera were created and five sections recognized.
As technology was improving more and more microscopic features could be observed and compared, resulting in many new morphological features that needed to be taken into consideration within Laurencia taxonomy. Many new rearrangements within the Laurencia were made including attempts at adding subgenera. A ‘spectabilis group’ was considered a potential subgenus based on the following characters; adaxial formation of tetrasporangia,
29 urn-shaped spermatangial receptacles and the lack of secondary pit connections (Saito
1969, McIvor et al 2002). The section Pinnatifidae was also highlighted as a potential subgenus, based on two characters; adaxial formation of tetrasporangia and determinate spermatangial receptacles (Saito 1982, Nam et al 1994). These two potential subgenera,
Spectabilis and Pinnatifidae, were combined to form a third subgenus; Saitoa nom. illeg.
(Furnari and Serio 1993). However the name is not valid since morphological details were not included when this subgenus was being described. Despite the failure of the subgenus
Saitoa nom. illeg. the characters separating it from other Laurencia taxa were to become important in separating the genus Osmundea from the other genera. The genus Laurencia for now still retained only the two subgenera Laurencia and Chondrophycus (Saito and Womersley
1974, Nam et al 1994)
In 1974, the genus Laurencia was slightly reorganized by Saito and Womersley. They simplified the subgenus Laurencia that at this time still contained three sections. The presence or absence of lenticular thickenings was not considered by Saito and Womersley
(1974) to be a reliable defining character. Eliminating this character reduced the number of sections within the subgenus Laurencia to only two; Saito’s original Laurencia, and a new section Planae. The division was based on one morphological character, thallus compression (Saito and Womersley, 1974). Using molecular analyses, these two sections have not been supported within phylogenetic analyses (Garbary and Harper 1998, McIvor et al 2002, Martin-Lescanne et al 2010). However considering how useful and consistent thallus compression is as a morphological character and how frequently it is used in organizing this large genus, there is still some support for these two sections to be perpetuated (Nam and Choi 2001, Womersley 2003). The defining characters for the
Laurencia subgenus, the Chondrophycus subgenus and the Chondrophycus sections were
30 unmodified from Saito’s 1967 definition (Table 3).
GENUS SUBGENUS SECTION DEFINING CHARACTERS Laurencia Laurencia secondary pit connections are present, and tetrasporangia are in parallel arrangement. Laurencia subgenus characters plus the thallus is cylindrical
Planae subgenus characters plus the thallus is clearly compressed
Laurencia Chondrophycus secondary pit connections are absent, and tetrasporangia are in right angle arrangement Chondrophycus subgenus characters plus in transverse sections surface cells are not elongated radially nor arranged in a palisade formation
Palisadae subgenus characters plus in transverse sections surface cells are elongated radially and arranged in a palisade formation Table 3. This table summarizes the reorganization of the Laurencia genus by Saito and Womersley 1974. Within the subgenus Laurencia the previous sections of Fosterianae and Pinnatifidae were removed and the section Planae was introduced based on the removal of ‘lenticular thickenings’ as a significant morphological character.
Osmundea was first proposed as a genus in 1809 by J. Stackhouse four years before the establishment of the genus Laurencia. Osmundea was based on O. expansa, which was later determined to be synonymous with Laurencia osmunda. Due to the popularity of the name, it was decided that Laurencia would be conserved over Osmundea (Papenfuss 1947, Nam et al
1994). However, in 1994 the genus Osmundea Stackhouse (1809) was resurrected with
Osmundea osmunda designated as the type species (Nam et al 1994, Furnari and Serio 1993). It included many taxa from the previously proposed Saitoa subgenus (Nam et al 1994, Furnari and Serio 1993). This resurrection was based on vegetative and male reproductive morphologies, specifically the number of pericentral cells, the origin and branching of spermatangial branches, the shape of apical spermatangial pits, the origin of tetrasporangia, and the alignment of presporangial cover cells (Nam et al 1994). In order to separate the two genera, Laurencia and Osmundea, only two characters were required; the origin of spermatangial branches, and the origin of tetrasporangia (Table 4).
31 Recent cladistic analyses using either morphological or molecular characters have since supported Osmundea as a genus (McIvor et al 2002, Nam et al 2000, Nam 2006, Garbary and
Harper 1998, Gil-Rodriguez et al 2009, Martin-Lescanne 2010). With the current recognition of three other genera within the complex, three morphological characters now define the
Osmundea genus, with spermatangial characters being of particular importance; spermatangial filaments borne from apical and epidermal cells, tetrasporangia borne from epidermal cells, and two pericentral cells per axial cell (Nam et al 1994, Nam 1999, McIvor et al 2002).
GENUS SUBGENUS SECTION DEFINING CHARACTERS Laurencia trichoblast type spermatangial branches, tetraspores develop from pericentral cells Osmundea filament type spermatangial branches, tetraspores develop from epidermal cells Table 4. This table summarizes the generic divisions within the Laurencia complex according to Nam et al 1994, which includes two genera, the Laurencia genus and the resurrected Osmundea genus.
In Saito’s 1967 classification of the Laurencia genus, the subgenus Chondrophycus was proposed for the first time (Saito 1967). It was not until 1998, with the support of cladistic analyses, that Chondrophycus was raised to generic rank (Garbary and Harper 1998). Garbary and
Harper undertook a phylogenetic analysis of the Laurencia complex using 36 morphological characters across 29 Laurencia taxa, including the type specimens. This resulted in three clades; Laurencia subgenus Laurencia, Laurencia subgenus Chondrophycus and the now reinstated
Osmundea genus. Based on this result, they raised Chondrophycus to generic rank (as per Saito
1967 in terms of Latin diagnosis and type designation) but made no mention of sections or subgenera within the genus. Morphological characters highlighted by Garbary and Harper
(1998) as useful in separating the three genera (Laurencia, Chondrophycus, Osmundea) are; the number of pericentral cells, the presence or absence of secondary pit connections among epidermal cells, trichoblast or filament type spermatangial development, and tetrasporangia originating from pericentral cells or epidermal cells (Table 5). The presence of corps en cerise was mentioned as being diagnostic, however they can often only be observed in living material, and therefore this character was believed to be too inconsistent to be reliable. 32 Garbary and Harper (1998) also considered the length of individual spermatangia to be diagnostic. Historically troublesome taxa were placed into one of these three genera based on the number of pericentral cells. Since then the presence of four pericentral cells has consistently been used as a morphological character separating Laurencia from the other genera within the Laurencia complex.
GENUS SUBGENUS SECTION DEFINING CHARACTERS Laurencia 4 pericentral cells, secondary pit connections present, trichoblast type spermatangial branches, tetraspores develop from pericentral cells, presence of corps en cerise Osmundea 2 pericentral cells, filament type spermatangial branches, tetraspores develop from epidermal cells, parallel arrangement of tetrasporangia Chondrophycus 2 pericentral cells, trichoblast type spermatangial branches, tetraspores develop from pericentral cells, secondary pit connections absent Table 5. This table details the three genera within the Laurencia complex after Garbary and Harper (1998). The subgenus Chondrophycus is raised to generic rank.
In 1999 Nam, focusing on the genus Chondrophycus, confirmed the strength of using the number of pericentral cells for separating the two genera Chondrophycus and Laurencia. He also proposed four subgenera within Chondrophycus based on morphological characters including the presence of secondary pit connections, the number of sterile pericentral cells in a tetrasporangial axial segment, and the arrangement of tetrasporangia in comparison to the axial row. Nam’s four subgenera within the newly recognized genus Chondrophycus are;
Chondrophycus (type; C. cartilaginea (Yamada) Garbary and Harper), Kangjaewonia (type: C. kangjaewonii (Nam and Sohn) Garbary and Harper), Palisada (type: C. palisada (Yamada) Nam) and Yuzurua (type: C. poiteaui (Lamouroux) Nam). Of the four subgenera Palisada and
Yuzurua were further divided into two sections each, based on the morphology of epidermal cells (Table 6). Within the subgenus Palisada were Yamada’s section Palisadae (Yamada 1931,
Saito 1967), and Agardh’s section Papillosae (J. G. Agardh 1876) which was amended to contain all taxa not within section Palisadae. The two sections were separated by the palisade formation of epidermal cells as seen in transverse sections (Nam 1999). Within the subgenus
Yuzurua two sections were created; sections Parvipapillatae and Yuzurua. The separation was
33 based on projecting epidermal cells near branchlet apices. Parvipapillatae contained taxa with projecting epidermal cells, and Yuzurua contained taxa without projecting epidermal cells
(Nam 1999) (Table 6).
GENUS SUBGENUS SECTION DEFINING CHARACTERS Laurencia four pericentral cells in vegetative axial segments, trichoblast type spermatangial branches, tetraspores develop from pericentral cells Osmundea two pericentral cells in vegetative axial segments, filament type spermatangial branches, tetraspores develop from epidermal cells Chondrophycus two pericentral cells in vegetative axial segments, trichoblast type spermatangial branches, tetraspores develop from pericentral cells
Chondrophycus no secondary pit connections, two sterile pericentral cells in tetrasporangial axial segments, and right angle arrangement of tetraspores Kangjaewonia no secondary pit connections, two sterile pericentral cells in tetrasporangial axial segments, and parallel arrangement of tetraspores Palisada no secondary pit connections, one sterile pericentral cell in tetrasporangial axial segments, and right angle arrangement of tetraspores
Palisadae subgenus characters plus in transverse sections surface cells are elongated radially and arranged in a palisade formation Papillosae subgenus characters plus in transverse sections surface cells lack a palisade formation Yuzurua secondary pit connections present, one sterile pericentral cell tetrasporangial axial segments, and right angle arrangement of tetraspores Parvipapillatae subgenus characters plus in transverse sections epidermal cells are projecting Yuzurua subgenus characters plus in transverse sections epidermal cells not projecting Table 6. Nam (1999) reorganizes the genus Chondrophycus and includes four subgenera and four sections.
Recent studies recognize a fourth genus within the Laurencia complex, the genus Palisada
(Nam 2007). Nam (2006) performed a cladistic analysis using 49 morphological features from 47 species of the Laurencia complex. His results showed a strongly supported Osmundea clade, a poorly supported Laurencia clade, and two poorly supported Chondrophycus clades
(Nam 2006). With this evidence Nam concluded there were four genera within the Laurencia
34 complex and raised one of the Chondrophycus clades to generic rank. This Chondrophycus clade represented the subgenus Palisadae (Yamada) therefore the new genus was named Palisada
(type species: P. robusta, basionym: Laurencia palisada). However, according to the original definition the only feature characterizing the section Palisadae was the palisade-like formation of epidermal cells as seen in transverse section. Only about half of the taxa within Nam’s new Palisada clade displayed this character. This required a redefinition of both the
Chondrophycus and the Palisada genera and resulted in the removal of the feature ‘palisade-like epidermal cells’ as a defining character for Palisada. Originally this new genus was incorrectly described but was validated in 2007 (Nam 2007) with many new characters needed to separate the two genera. The taxa within the subgenera Yuzurua and Palisada were included in the new genus Palisada, and the taxa from the subgenera Chondrophycus and Kangjaewonii were placed within the genus Chondrophycus. Interestingly, in 2010 the subgenus Yuzurua was itself resurrected and raised to generic rank on the strength of molecular evidence alone
(rbcL) retaining Nam’s original defining characters and type designation Yuzurua poiteaui, basionym Chondrophycus poiteaui (Martin-Lescanne et al 2010) (Table 7).
35
GENUS SUBGENUS SECTION DEFINING CHARACTERS Laurencia trichoblast type spermatangial branches, tetraspores develop from pericentral cells, four pericentral cells Osmundea filament type spermatangial branches, tetraspores develop from epidermal cells Chondrophycus trichoblast type spermatangial branches, tetraspores develop from pericentral cells, two pericentral cells, 1st pericentral cell beside trichoblast, spermatangial branches from two lateral on suprabasal cell of trichoblast, five pericentral cells on procarp-bearing segment, delayed auxiliary cell formation after fertilization, tetrasporangial axis with two sterile pericentral cells. Palisada trichoblast type spermatangial branches, tetraspores develop from pericentral cells, two pericentral cells, 1st pericentral cell underneath trichoblast, spermatangial branches from one lateral on suprabasal cell of trichoblast, four or five pericentral cells on procarp-bearing segment, normal auxiliary cell formation after fertilization, tetrasporangial axis with one sterile and one fertile pericentral cell. Yuzurua secondary pit connections present, one sterile pericentral cell tetrasporangial axial segments, and right angle arrangement of tetraspores
Table 7. The Laurencia, Osmundea, Chondrophycus and Palisada genera are summarized in this table after Nam 2007. Yuzurua is summarized after Martin-Lescanne et al 2010. The subgenus Palisada was raised to generic rank, resulting in four genera within the Laurencia complex, with no subgenera or sections, but a long list of characters separating Palisada from Chondrophycus (Nam 2007). The subgenus Yuzurua was raised to generic rank with no subgenera or sections, no amendments to the other four genera and retaining Yuzurua definitions from Nam 1999 (Martin-Lescanne et al 2010).
Current definitions of the genera within the Laurencia complex
By the turn of the millennium a combination of only a handful of characters were regularly used to separate the three genera, Laurencia, Chondrophycus and Osmundea. (Nam et al 1994,
Garbary and Harper 1998) These morphological characters were reliable and relatively simple to see. They included; the number of pericentral cells, the presence of secondary pit connections, tetrasporangial origin, tetrasporangial arrangement and spermatangial development. With the establishment of the recent Palisada genus, additional characters are now necessary to identify the five genera currently making up the complex (Table 8).
These characters are challenging to reliably locate and identify but are considered diagnostic at a generic level and of major phylogenetic significance (Nam 2007). These
36 additional characters include; the position of the first pericentral cell relative to the trichoblast, the fertility of the second pericentral cell and the number of sterile pericentral cells in the tetrasporangial axial segment, the formation pattern of spermatangial branches on trichoblasts, the number of pericentral cells on procarp-bearing segments, the timing of auxiliary cells after fertilization and the number of sterile and fertile pericentral cells on a tetrasporangial axis. These characters have been used previously in various cladistic analyses but not in defining genera (Garbary and Harper 1998, Nam 1999, McIvor et al
2002).
37 38
MORPHOLOGICAL CHARACTERS segments # pericentral cellson procarpbearing auxiliary cell formation after fertilization cerise en corps p p p segment # pericentral cellson vegetative axial tetrasporangial origin secondary pit connections 1st pericentral cell relative totrichoblast spermatangial development tetraspore arrangement # lateralson suprabasal cell of trichoblast roducing spermatangial branches ericentral cellproducing tetrasporangia ericentral cells on tetrasporangial axis
GENUS REFERENCES Laurencia 4 p yes u t l 1 5 n pt 2 or 3 yes/no Nam 1999, Nam et al 1994, Nam 2006 Osmundea 2 e yes/no s f l N/A 5 or 6 n N/A N/A no Nam 1999, Nam et al 2000, Nam 2006 Chondrophycus 2 p no/yes s t l / r 2 5 d pt 2 or 3 no Nam et al 1994, Garbary and Harper 1998, Nam 2006 Palisada 2 p no u t r 1 4 or 5 n pt 1 no Nam 1999, Nam 2006
Yuzurua 2 p yes ? t r ? 5 ? pt 1 no Nam 1999, Nam 2006, Martine- Lescanne et al 2010 Table 8. The morphological characters used previous to this study to separate the Laurencia complex genera. p=pericentral, e=epidermal, l=parallel, r=right angle, t=trichoblast, f=filament, a=apical epidermal, c=cup, k=pocket, i=single, m=clustered, v=present in every cell, s=side position, u=underneath position, n=normal, d=delayed, pt=particular. ?=indicates no information available.
39 40 Materials and Methods
Sample Collection
All sequences used in the molecular analyses are detailed in Table 9. Collections for molecular and morphological work were made subtidally by SCUBA and intertidally by snorkelling or wading. For each plant collected a sample was dried in silica powder for molecular work, a formalin sample was preserved in 4% formalin in seawater, and a voucher was pressed from unpreserved fresh material on herbarium paper. Each sample was given a unique collection number starting with the initials ‘YM’. These are used throughout the study. They will be databased at the NSW herbarium and become freely available on the Australian Virtual
Herbarium (AVH) website (www.chah.gov.au/avh/). Substrate, time of day, depth or tide height, location, habitat, collector name, date and environmental conditions were recorded for every sample collected. Liquid preserved material was stained with 1% aniline blue and 1% acetic acid solution, sectioned by hand, stained again, then fixed with a 50% karo solution.
Microscopic observations were then made using a Zeiss compound microscope. A BBT Krauss dissector microscope was used to observe surface features of liquid preserved and pressed materials. Photos were taken with a Nikon coolpix4500 digital camera, and microscope adapter lenses were used for slide photos. All slides, vouchers, silica dried material and liquid preserved material are stored at the National Herbarium of New South Wales (NSW).
DNA Extraction, Amplification and Sequencing
Total genomic DNA was extracted from silica dried material using the DNEasy Plant Mini Kit
(Qiagen, Valencia, CA, USA), and immediately purified using the JetQuick PCR Purification Kit
(Genomed Co.). The rbcL gene and the rbcL-rbcS spacer region were amplified together in one independent polymerase chain reaction (PCR) for most samples. Primers used were
41 FrbcL_start_sh and RrbcS_start (Freshwater and Rueness 1994), or YF_1 and YR_rbcS (Metti, this study). Those that were not amplified in one piece were amplified in two pieces using
FrbcL_start_sh and YR_921 (Metti, this study), plus F939 and RrbcS_start (Freshwater and
Rueness 1994) (Table 10). A Corbett Palm thermocycler (Corbett Research, Australia) was used for the PCR amplifications. Program details are; an initial denaturation (3min at 94C), then 5 cycles of denaturation (45sec at 94C), annealing (30sec at 55C), extension (2min at 72C), then 10 cycles of denaturation (45sec at 94C), annealing (30 at 55C to 45C 1C touchdown), extension
(2min at 72C), then 15 cycles of denaturation (45sec at 94C), annealing (30sec at 45C), extension
(2min at 72C), then a final extension for 5minutes at 72C and hold at 4C. The PCR mixture was made to 20uL, with the following concentration of reagents: 11.9uL of dH20, 2uL of 10x reaction buffer (Bioline Ltd.), 1uL of MgCl2 at 25mM (Promega, Madison, USA), 2uL of 4x dNTPs at 2.5mM each, 0.1uL of BioTaq DNA polymerase (Bioline Ltd.), 0.5uL of the forward primer at 20uM, 0.5uL of the reverse primer at 20uM, and 2uL of the genomic DNA.
Amplified products were purified using the JetQuick PCR Purification Kit (Genomed Co.).
4uL of purified PCR product was run on an agarose gel to visualize DNA concentrations.
Primers used for sequencing reactions are outlined in Table 10. The sequencing mixture was made to 20uL, with the following concentration of reagents: 12uL of dH20, 2uL of 5X buffer,
2uL of Big Dye terminator, 2uL of a single 1.6uM primer, 2uL of purified PCR product. The
UNSW Ramaciotti Centre sequencing protocol was followed for the Applied Biosystems 3730
Capillary Sequencer. The program settings were 25cycles of denaturation (10sec at 96C), annealing (5sec at 50C) and extension (4min at 60C), then holding at 4C (UNSW Ramaciotti
Centre program). A Corbett Palm thermocycler (Corbett Research, Australia) was used for the sequencing reactions. The UNSW Ramaciotti Centre ethanol/EDTA precipitation protocol was
42 followed. 5uL of 125mM EDTA and 5uL of ethanol were added to each well and was allowed to incubate at room temperature for 15 minutes to precipitate extension products. Supernatants were then removed and pellets rinsed with 60uL of ethanol. Supernatants were again removed and the pellets dried by vacuum centrifuge and stored at 4C. Precipitated and dried samples were then sent to the UNSW Ramaciotti Centre for sequence electrophoresis.
Alignment and Phylogenetic Analysis
The resulting sequences were aligned visually using Sequencher (Gene Codes Corp., Ann Arbor,
MI, USA). 50 base pairs (bp) were excluded from the 5’ end due to sequences having variable starting points. The final length of the rbcL alignment was 1417 bp. Additional sequences for
Laurencia complex taxa were downloaded from Genbank (Benson et al 2004) (Table 9). All but one Genbank sequence for the rbcL gene included in the alignment were selected on the basis of meeting the following three criteria; A) sequenced from type locality material, B) vouchered, and
C) published. The one taxon not meeting criteria (A) is EF658641. Even though the species name may not be accurate because it was not sampled from type location material, the sequence was included because it was not needed to define the clade but to populate it. Trees were rooted using the outgroup method. Chondria is used as an outgroup since it is closely related to the
Laurencia complex. Also included as outgroups are Polysiphonia species belonging to the family
Rhodomelaceae and Ceramium species in the family Ceramiaceae. Both families belong to the order Ceramiales.
Phylogenetic analyses were run for the rbcL gene using Maximum-Parsimony (MP), Maximum-
Likelihood (ML) and Bayesian Inference (BI) algorithms. Both the MP and ML analyses were performed using the software PAUP for PC (v.4.0 beta10, Swofford 2003). The program
43 MrBayes 3.1 (Huelsenbeck and Ronquist 2001) for PC was used for BI analyses. Both the ML and Bayesian analyses require evolutionary models, which were determined by using the program
Modeltest 3.7 (Posada and Crandall 1998) for PC (Table 11).
Maximum Parsimony Analysis. The Fitch criterion was employed, which does not impose constraints on character transformations (Fitch 1971). The branch-swapping algorithm used was tree-bisection-reconnection (TBR), initial trees were generated with random sequence addition, and 1000 replicates were run. During the tree search the ‘Multrees’ option was in effect but ‘steepest descent’ was not. Branches were collapsed if maximum branch length is zero, creating polytomies. Bootstrap proportion values (Felsenstein 1985) were calculated to determine node support. Bootstrap calculations used 1000 replicates. Pairwise distances between taxa are reported as a percentage and in number of base pairs. Distances need to be considered in light of other evidence but can be useful indicators of closeness of relationships between taxa. In Laurencia complex rbcL analyses, distances of around 10% are high enough to be considered separate genera, distances between 2% and 8% are considered within the one genus, and taxa with distances of less than 2% are generally accepted as being within same species (Diaz-Larrea et al 2007, Cassano et al 2009, Martin-Lescanne et al 2010).
Maximum Likelihood Analysis. The GTR+I+G nucleotide substitution model was used. This is a general-time-reversible (GTR) model of sequence evolution including both invariable sites
(+I) and rate variation among sites (+G). The model parameters were; assumed nucleotide frequencies freqA = 0.3234, freqC = 0.1339, freqG = 0.2039, freqT = 0.3388; substitution rate matrix [A-C] = 1.7510, [A-G] = 6.2864, [A-T] = 2.6154, [C-G] = 1.2721, [C-T] = 20.5244, [G-
T] = 1.0000; Proportion of invariable sites (I) = 0.5591; Gamma distribution shape parameter
= 1.4562 (Table 11). Bootstrap calculations used 1000 replicates.
44 Bayesian Inference Analysis: The evolutionary model was set to GTR (lset nst=6) with gamma distributed rate variation among variable sites (lset rates=invgamma). The invgamma setting was used because the resulting model assumes a proportion of invariable sites (0.5591). The
Bayesian phylogeny was estimated using two runs of four chains each, one cold, three hot, for
1,000,000 generations using the Markov Chain Monte Carlo (mcmc) search algorithm. Each
100th generation was sampled. The analysis resulted in 10,000 trees with a convergence diagnostic value of <0.01. The first 2500 trees were then discarded as the 25% burnin, and a
50% majority rule consensus tree computed from the remaining trees.
45 Species Accessn / Location and collecting data Ref Collectn # Chondrophycus cartilagineous J01 Japan, Fukui, Shikimi, Wakasa, M.Kamiya, J01, 20/08/2006 1
Chondrophycus tronoi (Ganzon-Fortes) K.W. Nam AF489864 Phillipines(?) 2
Chondrophycus translucidus (Fujii & Cordeiro-Marino) Garbary & Harper AF465805 Brazil, Marataizes, Itapemirim, Espirito Santo, M.T.Fujii & S.M.Guimaraes, 17/12/1992, 3
Laurencia brongniartii J.Agardh TFP080186 Panama, Bocas State, Bastimentos, S.Schmitt, D.W.Freshwater, TFP080186, 14/07/2008 1
Laurencia dendroidea J.Agardh GU330222 Brazil, Rio de janeiro, Arraial do Cabo, Prainha, SP399.900, V.Cassano, 2005 4
Laurencia elata JE01 Australia, Western Australia, Rottnest Island, subtidal, James Eu, JE01, 15/11/2008 1
Laurencia intricata Lamouroux AF465809 Mexico, Yucatan, Champoton, Campeche Bay, C.F.Gurgel, LAF#:L45, 14/02/1999 3
Laurencia majuscula (Harvey) A.H.S.Lucas 064 Australia, WA, Freemantle, A.Kurihara, Shimada, 12/11/2003 1
Laurencia majuscula v. elegans (A.H.S.Lucas) Saito & Womersley YM340 Australia, Lord Howe Island, Y.Metti, A.Millar, YM340, 26/10/2005 1
Laurencia marilzae Gil Rodriquez, Senties & M.T.Fujii EF686002 Spain, Canary Islands, Punta del Hidalgo Tenerife, Gil-Rodriquez, TFCPhyc.N#13129, 12/07/2006 5
Laurencia marilzae Gil Rodriquez, Senties & M.T.Fujii EF686003 Spain, Canary Islands, Punta del Hidalgo Tenerife, TFCPhyc.N#13071, Gil-Rodriquez, 6/10/2005 5
Laurencia obtusa (Hudson) J.V.Lamouroux AF281881 Ireland, Co. Donegal, Fanad Head, C.A.Maggs, 6/07/1998 6
Laurencia rigida J.Agardh AY920852 Australia, NSW, Botany Bay, culture number G21, 11/05/2000 7
Laurencia sp. YM194 Australia, NSW, Jervis Bay, Plantation Point, subtidal, Y. Metti & A. Millar, YM194, 15/02/2005 1
Laurencia translucida Fujii & Cordeiro-Marino AY588408 Brazil, Espirito Santo State, Marataizes, M.T.Fujii, LAF 377; SP 356242, 15/04/2001 3
Norfophycus originalis YM296 Australia, Norfolk Island, Collins Head, intertidal, Y.Metti & A.Millar, YM296, 21/03/2005 1
Norfophycus originalis YM300 Australia, Norfolk Island, Collins Head, intertidal, Y.Metti & A.Millar, YM300, 21/03/2005 1
Norfophycus sp. YM279 Australia, Norfolk Island, Kingston Lagoon, subtidal, Y.Metti & A.Millar, YM279, 17/03/2005 1
Osmundea osmunda (S.G.Gmelin) K.W.Nam & Maggs AF281877 Ireland, Co. Donegal, St. John's Point, C.A.Maggs, 12/10/1999 6
Osmundea pinnatifida (Hudson) Stackhouse AF281875 Ireland, Co. Donegal, St. John's Point, C.A.Maggs, 12/10/1999 6
46 Osmundea ramosissima (Oeder) Athanasiadis AF281880 Ireland, Co. Donegal, St. John's Point, C.A.Maggs, 12/10/1999 6
Osmundea spectabilis v. spectabilis (Postels & Ruprecht) K.W.Nam AY172574 Mexico, Baja California, Punta Santo Thomas, M.H.Hommersand, 2/07/1996 8
Osmundea splendens (Hollenberg) K.W. Nam AY172576 Mexico, Baja California, Bahia Colnett, drift, M.H.Hommersand, 2/07/1996 8
Palisada corallopsis (Montagne) K.W. Nam EF061646 Mexico, Yucatan, Cancun, Chaac Mool Beach, J.Diaz Larrea and A.Senties Granados, 2005 9
Palisada perforata (Bory) K.W. Nam EF658641 Mexico, Quintana Roo, Cancun, Isla Mujeres, A. Senties & M.C. Gil-Rodriquez, 2007 10
Palisada robusta K.W.Nam TW20 Taiwan, Orchid Island, Li-Ja Liu and S.M.Lin, TW20, 9/04/2010 1
Yuzurua poiteaui (Harvey) Garbary & Harper EF061649 Mexico, Yucatan, Cancun, Playa del Carmen, J.Diaz-Larrea and A.Senties Granados, 2004 9
Yuzurua poiteaui (Lamouroux) K.W. Nam EF061652 USA, Florida, Long Key, Ocean Side, S. Frederik, 1998 9
Chondria californica (Collins) Kylin AY172578 USA, California, San Diego Co., Beach Club Reef (La Jolla Shores), M.Volovsek, 1/07/1996 8
Ceramium japonicum Okamura FJ943707 South Korea, Eocheongdori, Okdo, Gunsansi, Jeonbuk, C1148 11
Ceramium kondoi Yendo DQ350388 Japan, Itoigawa, Niigata, C1315 12
Polysiphonia pacifica v. disticha Hollenberg AY958162 USA, Oregon, Seal Rock 2, M.S.Kim and E.C.Yang, P194, June 2003 13
Table 9. A list of species used for molecular work in this study, including newly generated sequences from this study, and downloaded Genbank samples. References: 1=this study, 2= GENBANK (http://www.ncbi.nlm.nih.gov), 3= Fujii et al (2006), 4= Cassano et al (in press), 5= Gil Rodriquez et al (2009), 6= Nam et al (2000), 7= Zuccarello and West (2006), 8= McIvor et al (2002), 9= Diaz-Larrea et al (2007), 10= Cassano et al (2009), 11= Yang et al (2009), 12= Yang et al (2008), 13= Kim and Yang (2005)
47 48
Gene Direction Primer Name Sequence (5'-3') Reference rbcL Forward F-749* C AAT GGA AGA TAT GTA TGA AAG AGC modified FrbcL_start_sh* ATG TCT AAC TCT GTA GAA G modified YF_1 TAT GTC TAA ACT CTG TAG AAG AAC G this study F939 TTCCGTGTAATTTGTAAGTGG Freshwater et al 1994 Reverse R-1150 GCA TTT GTC CGC AGT GAA TAC C Freshwater et al 1994 YR_921 CGA GAA TAA GTT GAA TTA CCT GC this study R-749* GCT CTT TCA TAC ATA TCT TCC ATT G modified rbcS Reverse RrbcS_start* GTT CCT TGT GTT AAT CTC AC modified YR_rbcS GGT AAT CTC ACT TAT CTA TAC TCC this study
Table 10. This table details the primers used for both PCR and sequencing reactions in this study. Primers marked with an astricts (*) were modified during this study from original primers outlined in Freshwater et al 1994.
DNA Base Freqs. Rate matrix(A-C, A-G, Data Nucleotides AIC Model Nst Tratio Rates Shape Pinvar Region (A, C, G, T) A-T, C-G, C-T, G-T)
0.3234, 0.1339, 1.7510, 6.2864, 2.6154, rbcL only all sites 1417 GTR+I+G 6 - gamma 1.4562 0.5591 0.2039, 0.3388 1.2721, 20.5244, 1.0000
Table 11. A summary of Modeltest model parameters selected by the AKAIKE Information Criterion (AIC) used in both the maximum likelihood and Bayesian Inference analyses.
49 50 Results and Observations
Molecular results (Figures 2, 3, 4)
The resulting phylogenies include twenty-eight rbcL sequences with seven sequences obtained through this study, and twenty-one downloaded from Genbank, including outgroups (Table 9).
1417 base pairs of the rbcL gene were analyzed which included 410 parsimony informative characters. All three resulting phylogenies (ML, BI, MP) are largely congruent and show the
Laurencia complex to be moderately to strongly supported (ML bootstrap = 68%, BI posterior probability = 1.00, MP bootstrap = 66%). The complex contains seven clades, with each one strongly supported at a generic level when comparing pairwise distances (Figures 2 - 4).
The Osmundea genus forms a monophyletic and fully supported clade (ML bootstrap = 100%,
BI posterior probability = 1.00, MP bootstrap = 100%). In the ML and MP analyses Osmundea grouped as a sister to one unnamed clade, however, this sister relationship is unsupported.
This unnamed clade itself is strongly supported (ML bootstrap = 100%, MP bootstrap = 97%,
BI posterior probability = 1.00) and pairwise distances between it and Osmundea support their separation at a generic level (pairwise distance = 10.49%). It is also separated from every other clade at generic levels (Table 12). This clade is therefore recognized as a genus within the
Laurencia complex and is here named Norfophycus gen. nov. The Norfophycus clade includes two undescribed species from Norfolk Island; Norfophycus originalis sp. nov. and Norfophycus sp., which are described in detail in chapter 3. It also contains one species from the Philippines
Chondrophycus tronoi.
51 The Chondrophycus clade is well supported (ML bootstrap = 97%, BI posterior probability =
1.00, MP bootstrap = 97%) however it is not monophyletic. This clade contains taxa from the
Chondrophycus genus and the Palisada genus, including each generitype from their type locations;
C. cartilagineous and P. robusta. Both types are nesting within the same clade, which indicates that these two genera are congeneric. According to priority of names this clade represents the
Chondrophycus genus. No new combinations are required since all Palisada taxa were originally described as Chondrophycus taxa.
The Yuzurua clade is small but fully supported (ML bootstrap = 100%, BI posterior probability
= 1.00, MP bootstrap = 100%) and is sister to two other clades, the Elata and the Marilzae groups, both which contain Laurencia taxa. These sister relationships are unsupported except between Yuzurua and the Elata group in the BI analysis (BI posterior probability = 1.00).
The Laurencia genus is polyphyletic, with species dispersed among three clades. The legitimate
Laurencia clade is the one containing the topotype species Laurencia obtusa sequenced from its type location. This clade is supported at a generic level and contains four other Laurencia species that were sequenced from type location material (ML bootstrap = 75%, BI posterior probability = 1.00, MP bootstrap = 67%, pairwise distance from closest sister clade = 8.51%).
The two other clades containing Laurencia taxa are the Elata group and the Marilzae group.
They are closely associated with the Yuzurua clade, particularly in the ML and MP results.
However, there is no supported relationship among the three clades except in the BI analysis.
In the BI analysis the Yuzurua genus and Elata group are strongly supported as sister clades (BI posterior probability = 1.00) but are separated by a pairwise distance of 9.47% (Table 12). The
Elata group itself is strongly supported (ML bootstrap = 80%, BI posterior probability = 1.00,
MP bootstrap = 90%). In summary the Elata group is separate from the Yuzurua clade in the 52 ML and MP analyses, it is separate from the Laurencia clade across all three analyses, and it is separated from all other clades at a generic level (Table 12). Therefore, the Elata group is supported as a genus in the Laurencia complex and is here named Coronaphycus gen. nov. The
Coronaphycus clade contains two taxa separated at a species level (pairwise distance of 6.14%);
Laurencia elata and Laurencia sp. from NSW.
The other clade containing Laurencia taxa is the Marilzae group. It is a fully supported clade
(ML bootstrap = 100%, BI posterior probability = 1.00, MP bootstrap = 100%). It is also sister to the Yuzurua clade but this relationship has no support in any analysis. The Marilzae group has a pairwise distance of 10.30% from Yuzurua. The Marilzae group is supported at a generic level within the Laurencia complex and is here named Neolaurencia gen. nov. The
Neolaurencia* clade contains two sequences of the one species, Laurencia marilzae.
With the recent acceptance of Yuzurua as a legitimate genus (Martin-Lescanne 2010) there is support for both the Coronaphycus and Neolaurencia* clades to be accepted at generic rank as well. Both are well supported clades in all three analyses with pairwise distances also supporting their wide separation from the Laurencia sensu stricto clade and each other (Table 12).
Neolaurencia is currently being described as the genus Laurenciella by V. Cassano et al. (pers. com. Dec. 8, 2011). The work in this thesis supports their conclusions that this group is to be recognized at a generic level.
53
Genus Laurencia Chondrophycus Norfophycus Osmundea Coronaphycus Neolaurencia Yuzurua
Laurencia 0.00 - 9.67% 7.03 - 12.45% 9.31 - 13.27% 9.30 - 14.74% 7.81 - 11.10% 8.19 - 10.87% 9.21 - 12.89% (n=98) (0 - 167bps) (57-231bps) (68 - 229bps) (81 - 225bps) (73 - 208bps) (79 - 152bps) (85 - 195bps)
Chondrophycus 0.00 - 8.41% 8.14 - 13.35% 9.49 - 14.68% 8.12 - 11.92% 8.60 - 11.05% 8.87 - 13.15%
(n=35) (0 - 123bps) (59 - 199bps) (46 - 219bps) (69 - 211bps) (70 - 154bps) (65 - 180bps) Norfophycus 0.05 - 7.51% 9.27 - 12.72% 10.42 - 11.19% 10.94 - 11.51% 10.67 - 12.89%
(n=4) (1 - 89bps) (105 - 183bps) (132 - 228bps) (138 - 154bps) (128 - 185bps)
Osmundea 0.00 - 10.09% 10.26 - 13.88% 9.99 - 13.22% 11.21 - 15.15%
(n=18) (0 - 125bps) (120 - 208bps) (114 - 176bps) (126 - 229bps)
Coronaphycus 6.39% 9.00 - 9.13% 9.47 - 11.46%
(n=2) (95bps) (128 - 129bps) (112 - 171bps)
Neolaurencia 0.07 - 0.21% 10.28 - 10.98%
(n=2) (1 - 3bps) (130 - 148bps) Yuzurua 0.33 - 0.86% (n=6) (4 - 13bps)
Table 12. This table shows a comparison of rbcL pairwise distances between and within the Laurencia complex genera, expressed in percent distances (above) and differences in absolute base pairs (in brackets below). These figures are calculated using the ‘savedist’ command in PAUP and include all sequences generated from this study and sequences selected from Genbank according to the criteria outlined on page 92.
54 +
v. disticha +
Figure 2. The Maximum likelihood phylogram for 24 Laurencia complex taxa and four outgroup taxa inferred from rbcL sequence data. The numbers above branches indicate bootstrap values inferred from 1000 ML bootstrap replicates. Values less than 50% are not shown, bold lines and * indicate full support (100%). Taxa with bold names and ^ are generitype sequences from type location material, and taxa with + are species sequences from type location material. Generic conclusions are indicated by solid bars on the far right of the tree.
55 56 +
+
+
+
+
v. disticha +
Figure 3. The Bayesian phylogram for 24 Laurencia complex taxa and four outgroup taxa inferred from rbcL sequence data. The numbers above branches indicate Bayesian inference posterior probabilities. Values less than 0.50 are not shown, bold lines and * indicate full support (1.00). Taxa with bold names and ^ are generitype sequences from type location material, and taxa with + are species sequences from type location material. Generic conclusions are indicated by solid bars on the far right of the tree.
57 58 +
+
+
+
+
v. disticha +
Figure 4. The strict consensus Maximum Parsimony phylogram for 24 Laurencia complex taxa and four outgroup taxa inferred from rbcL sequence data. The numbers above branches indicate bootstrap values inferred from 1000 MP bootstrap replicates. Values less than 50% are not shown, bold lines and * indicate full support (100%). Taxa with bold names and ^ are generitype sequences from type location material, and taxa with + are species sequences from type location material. Pairwise distances and absolute base pair differences between consecutive taxa are shown on a light grey ladder on the immediate right of the tree. Generic conclusions are indicated by solid bars on the far right of the tree.
59 60 Morphological results
Key to the Laurencia sensu lato genera 1 a. Tetrasporangial origin from epidermal cells 2 b. Tetrasporangial origin from pericentral cells 3
2 a. Parallel tetrasporangial arrangement relative to main axial row Osmundea b. Right angle tetrasporangial arrangement relative to main axial row Norfophycus
3 a. Secondary pit connections present between epidermal cells in longitudinal 4 sections b. Secondary pit connections absent between epidermal cells in longitudinal sections 7
4 a. Two pericentral cells per axial row cell Yuzurua b. Four pericentral cells per axial row cell 5
5 a. Corps en cerise present within medullary cells Neolaurencia b. Corps en cerise absent within medullary cells 6
6 a. Compressed thallus AND extensive secondary cortication in supporting branches Coronaphycus present b. Compressed thallus AND extensive secondary cortication in supporting branches Laurencia absent
7 a. Parallel tetrasporangial arrangement relative to main axial row Namia b. Right angle tetrasporangial arrangement relative to main axial row Chondrophycus
Table 13. The key to the genera of the Laurencia complex. The morphological characters used are explained in detail in the following references; Saito 1967, Nam 1999, 2006, Nam and Choi 2001, Garbary and Harper 1998, McIvor et al 2002, Gil-Rodriguez et al 2009.
Laurencia sensu lato
With the characters of the Rhodomelaceae, but with apical cells borne within a distinct apical pit;
Polysiphonous construction that is obscured by extensive cortication except in the apical region;
Trichoblasts borne within the apical pit only from axial cells; Thalli are not parasitic; Spermatangia develop on trichoblasts or filaments; Cystocarps borne on the ends of branches and branchlets.
61 Coronaphycus Metti gen. nov.
DESCRIPTION: Displaying typical Laurencia complex characters; Also compressed thallus; Outer cortical layer single row of epidermal cells; Secondary pit connections present between epidermal cells when viewed in longitudinal section; Four pericentral cells per vegetative axial cell; Extensive secondary cortication by internal rhizoids seen at base of supporting branches, giving branches a terete appearance; Pericentral cell origin of tetrasporangia; Parallel arrangement of tetrasporangia in comparison to axial row; Spermatangial branches borne on trichoblasts; Spermatangial branches terminating in a single sterile cell. Corps en cerise unknown.
ETYMOLOGY: From the Spanish corona meaning crown (King Island type locality) and the Greek phycus meaning seaweed.
GENERITYPE: Coronaphycus elatus (C. Agardh) Metti comb. nov.
Coronaphycus elatus (C. Agardh) Metti comb. nov.
BASIONYM: Chondria pinnatifida var. elata C.Agardh 1822:340
HOMOTYPIC SYNONYMS: Laurencia elata (C.Agardh) Harvey (1847, p.401); Chondria pinnatifida var. elata C. Agardh (1822, p.340); Laurencia pinnatifida var. elata (C. Agardh) Sonder (1846, p.177)
HETEROTYPIC SYNONYMS: Laurencia elata var. luxurians Harvey (1863, p. 26); Laurencia luxurians
(Harvey) J. Agardh (1876, p.658)
TYPE SPECIMEN: Holotype Herb. Agardh LUND LD #37235. Isotype in PC.
TYPE LOCATION: King Island, Bass Strait, Tasmania, Australia.
DISTRIBUTION: Australia (WA, NSW, and Tasmania), New Zealand (Adams 1994), Tanzania (Silva,
Basson and Moe 1996).
62 DESCRIPTION: With characters of the genus but differing from C. minorus by plants being up to
40cm in height, axes evenly compressed, cartilaginous, denuded in lower branches, often branching in triads and at <45-degree angles between ultimate branchlets and supporting branch.
NOTE: further discussion in chapter 3
63 Namia Metti gen. nov.
DESCRIPTION: Displaying typical Laurencia complex characters; Also strongly compressed thallus;
Corps en cerise absent; Outer cortical layer single row of epidermal cells; Secondary pit connections present between epidermal cells when viewed in longitudinal section; Two pericentral cells per vegetative axial cell; Some secondary cortication by internal rhizoids seen at base of supporting branches; Pericentral cell origin of tetrasporangia; Parallel arrangement of tetrasporangia in comparison to axial row; Spermatangial branches borne on trichoblasts; Spermatangial branches terminating in a single sterile cell.
GENERITYPE: Namia kangjaewonia (Nam and Sohn) Metti comb. nov.
Namia kangjaewonia (Nam and Sohn) Metti comb. nov.
BASIONYM: Laurencia kangjaewonii Nam and Sohn (1994, p397-403);
HOMOTYPIC SYNONYMS: Laurencia kangjaewonii Nam and Sohn (1994, p397-403); Chondrophycus kangjaewonii (Nam and Sohn) Garbary and Harper (1998, p195)
TYPE SPECIMEN: Holotype N860109 (Herb Pukyong, National Fisheries University of Pusan,
Korea)
TYPE LOCATION: Yongdeuk near Pohang, Korea
DISTRIBUTION: East and South Korea
DESCRIPTION: As for genus
64 Neolaurencia Metti gen. nov.
DESCRIPTION: Displaying typical Laurencia complex characters; Also terete thallus; one corps en cerise present within every cell, including epidermal, medullary, pericentral, axial and trichoblasts cells;
Outer cortical layer single row of epidermal cells; Secondary pit connections present between epidermal cells when viewed in longitudinal section; Four pericentral cells per vegetative axial cell; No secondary cortication seen at base of supporting branches; Pericentral cell origin of tetrasporangia;
Parallel arrangement of tetrasporangia in comparison to axial row. Spermatangial branches borne on trichoblasts; Spermatangial branches terminating in a single sterile cell.
ETYMOLOGY: From the Latin neo meaning new.
GENERITYPE: Neolaurencia* marilzae (Gil-Rodriguez, Senties, et M.T.Fujii) Metti comb. nov.
Neolaurencia* marilzae (Gil-Rodriguez, Senties, et M.T.Fujii) Metti comb. nov.
BASIONYM: Laurencia marilzae Gil-Rodriguez, Senties, et M.T.Fujii (Gil-Rodriquez et al 2009, p 264-
271)
TYPE SPECIMENS: Holotype Herb. TFC Phyc 13129. Punta del Hidalgo, Northern Tenerife,
Canary Islands, Spain. 12.vii.2006. coll: Gil-Rodriguez, M.C., Senties, A., Fujii, M.T. tetrasporophyte.
TYPE LOCATION: Canary Islands, Spain
DISTRIBUTION: Canary Islands, Spain. The Mexican Caribbean. Brazil.
DESCRIPTION: As for genus
Neolaurencia is currently being described as the genus Laurenciella by V. Cassano et al. (pers. com. Dec. 8, 2011). The work in this thesis supports their conclusions that this group is to be recognized at a generic level.
65 Norfophycus Metti gen. nov.
DESCRIPTION: Displaying typical Laurencia complex characters; Also thallus either terete or compressed; Outer cortical layer consists of two distinct layers of epidermal cells with the surface cells smaller than the second epidermal layer; Secondary pit connections absent between epidermal cells when viewed in longitudinal section; Two pericentral cells per vegetative axial cell; No secondary cortication seen at base of supporting branches; Epidermal cell origin of tetrasporangia; Perpendicular arrangement of tetrasporangia in comparison to axial row. Spermatangia unknown. Corps en cerise unknown.
ETYMOLOGY: Named after historic Norfolk Island where specimens of Norfophycus originalis, the generitype for this genus, were first found. Norfo for the island of its original discovery, phycus is Greek for seaweed.
GENERITYPE: Norfophycus originalis Metti sp. nov.
Norfophycus originalis Metti sp. nov.
TYPE SPECIMENS: Holotype in NSW (YM300) tetrasporic. Isotype in NSW (YM296) cystocarpic.
TYPE LOCALITY: Colins Head, Norfolk Island, South Pacific, Australia
DISTRIBUTION: known only from the type locality
DESCRIPTION: With the characters of the genus and plants up to 5.5cm high but sprawl along substrate to 10.2cm wide. Sturdy but not cartilaginous, wide basal crust holdfast. Branches terete, up to four orders of branching, commonly three. Main branches usually denuded near base, with bulk of branching at top third of main axes, no secondary pit connections between epidermal cells when viewed in longitudinal section. Epidermal cell projection is rarely seen, and only near center of 66 branchlet, not near apical pit. No lenticular thickenings seen. Trichoblasts contained within apical pit, are prostrate, forming a thick layer along the inside of the apical pit. Trichoblasts originate from pericentral cells. Cystocarpic ultimate branchlets are compound. Cystocarps are subconical.
NOTE: further discussion in chapter 3
67 68
MORPHOLOGICAL CHARACTERS tetrasporangial tetrasporangial spermatangial 2cnd pit # pericentral # corps secondary SPECIES origin arrangement development connections cells en cerise cortex REFERENCES Laurencia obtusa ^ p l t yes 4 1 no R1, R2, R3 Neolaurencia marilzae ^ p l t yes 4 v no R4 Coronaphycus elatus^ p l t yes 4 ? yes R5 Chondrophycus cartilagineous ^ p r t no 2 0 no R1, R3, R6 Chondrophycus palisadus p r t no 2 ? no R1, R3, R6 Namia kangjaewonia^ p l t no 2 0 yes R2, R7 Yuzurua poiteaui ^ p r t yes 2 0 no R2, R3 Norfophycus originalis ^ e r ? no 2 ? no R8 Osmundea osmunda ^ e l f no 2 0 no R1, R3, R6, R9 Osmundea spectabilis e l f yes 2 0 no R1, R3, R6, R9
Table 14. The table summarizes the morphological characters determined by this study as useful in separating genera of the Laurencia complex. The species marked with ^ are generitypes and therefore represent their respective genera. p=pericentral, e=epidermal, l=parallel, r=right angle, t=trichoblast type, f=filament type, v=present in every cell. ?=indicates no information available. References R1=Nam et al 1994, R2=Nam 1999, R3=Nam 2006, R4=Gil-Rodriguez et al 2009, R5=Nam and Choi 2001, R6=Garbary and Harper 1998, R7=Nam and Sohn 1994, R8=this study, R9=McIvor et al 2002
69 70 Discussion
The Laurencia complex
Until the present research was undertaken, the Laurencia complex consisted of five genera based on molecular results; Laurencia sensu stricto, Chondrophycus, Osmundea, Palisada and Yuzurua (Martin-
Lescanne et al. 2010). However, missing in all molecular data sets is authentic material of the generitypes of Chondrophycus and Palisada. The present research has included sequences of these two generitypes; C. cartilagineous from Japan and P. robusta from Taiwan, as well as samples from
Western Australia, eastern Australia, Norfolk and Lord Howe Islands and the Caribbean. In the resulting molecular phylogenies (Figures 2, 3, 4) there is evidence for at least seven genera within the Laurencia complex (rbcL pairwise distances >8%), with morphological evidence for an additional one (Table 14).
The Laurencia genus
The Laurencia clade remains well supported even with the addition of the new sequences. The sequence of the generitype from its type location has been available for this genus and so its definition remains unchanged in this study.
The Palisada and Chondrophycus genera
Since the establishment of the Palisada genus (Nam 2007), in molecular phylogenies previous to this study there have been two clades, one representing the Chondrophycus genus, and the other representing Palisada (Martin-Lescanne et al 2010), however, both of these clades were undefined since the generitype sequences were not available. Included in the data set of this present study are the generitype sequences of Chondrophycus cartilagineous and Palisada robusta, from their type locations. In all results these two sequences nest together in the same clade. This shows that the
71 two genera actually represent one genus. According to nomenclatural priority Chondrophycus is the name by which this clade should be known (Garbary and Harper 1998, Nam 2007). This
Chondrophycus clade in previous molecular results was referred to as Palisada (Martin-Lescanne et al 2010). The clade that in previous molecular results was referred to as Chondrophycus on the other hand is now shown to represent a new genus, which is described in this study as
Norfophycus gen. nov.
Norfophycus genus
The Norfophycus genus at the molecular level is strongly supported (ML bootstrap = 100%, BI posterior probability = 1.00, MP bootstrap = 97%) and includes two species from Norfolk
Island (pairwise distance = 7.02%). The clade often results as sister to the Osmundea clade
(pairwise distance = 10.49%) however, morphologically Norfophycus taxa are most similar to
Chondrophycus, with a few outstanding features that separate the two. Norfophycus has a double cortical layer with very small outer epidermal cells and slightly larger inner epidermal cells.
Norfophycus displays the tetrasporangial features of an epidermal cell origin which it shares with
Osmundea, and a right angle arrangement in comparison to the branchlets axial row, which it shares with Chondrophycus. This unusual combination of morphological characters sets it apart from any other genus within the Laurencia complex.
Yuzurua genus
Recently the Yuzurua genus was described based on molecular evidence (Martin-Lescanne et al
2010). The molecular data included sequences of the generitype from its type location. Results in this study confirm Yuzurua as a distinct genus. Also in these results the two new genera
Coronaphycus and Neolaurencia* are as equally supported as distinct genera as Yuzurua is.
72 Neolaurencia* genus
Gil-Rodriguez et al (2009) described the new species Laurencia marilzae from Canary Islands, and in their phylogeny the species was most basal in their represented Laurencia sensu stricto clade.
Results from the present study, which include additional sequences, indicate that L. marilzae does not belong within the Laurencia sensu stricto clade but forms a fully supported clade on its own at a generic level. This clade is described as representing the genus Neolaurencia* gen. nov.
Morphologically Neolaurencia* is very closely related to Laurencia sensu stricto, sharing almost all character states except presence of corps en cerise. These are small vesicles containing secondary metabolites such as bromine, thought to be useful in defence against predation and fouling (de Nys et al 1998, Paradas et al 2010). Traditionally this feature has not been seen as very reliable since corps en cerise are not a permanent characteristic but seem to be developed in response to environmental conditions, and dissipate quickly once the plant is collected (Paradas et al 2010). However in the case of Neolaurencia* marilzae this feature is unusual among the
Laurencia complex taxa in that corps en cerise are present in every cell of the plant, including medullary cells. This does not occur within the Laurencia genus, where corps en cerise are generally seen only in epidermal and trichoblast cells. Usually, the numbers of corps en cerise within the epidermal cells are counted. However, if this feature is reported as present or absent, particularly in epidermal cells only versus within internal cells as well, it becomes much more diagnostic.
* Neolaurencia is currently being described as the genus Laurenciella by V. Cassano et al. (pers. com. Dec. 8, 2011). The work in this thesis supports their conclusions that this group is to be recognized at a generic level.
73 Coronaphycus genus
Two samples identified as Laurencia elata, one from NSW and one from WA, are included in molecular analyses for the first time. These samples do not nest within the Laurencia sensu stricto clade but are strongly supported in their own clade (ML bootstrap = 80%, BI posterior probability = 1.00, MP bootstrap = 90%) at a generic level. The clade contains two species, one from each locality (pairwise distance = 6.14%) and is named Coronaphycus gen. nov. The
Coronaphycus clade groups closest to both Yuzurua and Neolaurencia* but is distant enough to be considered its own genus (pairwise distance = 9.10%). The three groups, Yuzurua, Coronaphycus and Neolaurencia*, consistently emerge together but the phylogenetic relationships between the three have very little support. Morphologically, the Coronaphycus genus is also very similar to the
Laurencia genus, sharing many diagnostic characters such as the presence of secondary pit connections and four pericentral cells. However, the perennial nature of the taxa combined with the extensive secondary cortication at the base of the supporting branches make members of the
Coronaphycus genus stand out from the Laurencia species.
Namia genus
This study has shown that there are seven genera making up the Laurencia complex based on molecular analyses. Accepting this separation of genera allows us to examine the morphological characters that support the phylogeny. The following morphological characters are molecularly supported at the generic level; tetrasporangial origin, tetrasporangial arrangement, secondary pit connections, pericentral cells, corps en cerise, perennial growth and secondary cortication, and tetrasporangial arrangement (Table 13). Based on these morphological characters Nam’s
* Neolaurencia is currently being described as the genus Laurenciella by V. Cassano et al. (pers. com. Dec. 8, 2011). The work in this thesis supports their conclusions that this group is to be recognized at a generic level.
74 subgenus Kangjaewonii (in the genus Chondrophycus, Nam 1999) is also a distinct, eighth genus even though there is a lack of molecular evidence at this stage. It is described as Namia gen. nov.
Osmundea
Currently Osmundea is maintained as a single genus but there is preliminary support in this study for dividing Osmundea into two closely related genera. One clade contains Osmundea osmunda, which is the generitype from the British Isles. Species nesting with this taxon are from Europe or the Mediterranean (Osmundea 1). The other clade contains species from the Pacific, namely
California, USA (Osmundea 2). Molecularly these two clades within the Osmundea genus are consistently separated across all analyses (pairwise distance = 7.90%), however morphologically the differences are not as clear cut. There is some difference in the presence or absence of secondary pit connections, which have been shown to be good characters in separating taxa at a generic level (McIvor et al 2002). In the Osmundea 2 clade all members have secondary pit connections, but in Osmundea 1 there are taxa with and taxa without secondary pit connections.
There are also differences in male reproductive morphology, specifically the type of apical pit in which the spermatangia are contained. Some species within the genus produce cup-shaped apical pits, others produce pocket-shaped pits. However, both clades display pocket-shaped apical pits therefore cannot be separated by this morphological feature either. Osmundea taxa are not present within Australia and rarely reported from the Southern hemisphere (Yoneshigue-
Valentin et al 2003) therefore no types, vouchers, nor fresh material has been examined during this study. It is suggested that future research be done on the Osmundea taxa to clarify generic delineations within this group.
75 76 CHAPTER 3
The Molecular phylogenies and morphology of the Laurencia senso lato species occurring in New South Wales, Australia.
Abstract
Seventeen species of the Laurencia complex were previously recorded as occurring in NSW.
Many of these, and newly recorded taxa, were collected in the field and studied using both molecular data and morphological characters. Species that have been confirmed by this study as occurring in NSW in the genus Laurencia are; L. calliptera, L. venusta, L. concinna, and L. dendroidea, in the genus Coronaphycus; Coronaphycus elatus, Coronaphycus minorus, in the genus
Chondrophycus; Chondrophycus cruciatus, and in the genus Norfophycus; Norfophycus originalis. Three taxa previously referred to as varieties or formas have been recollected throughout this study and are now recognized at the species level; Laurencia elegans stat. nov., Laurencia decussata stat. nov., and Laurencia queenslandica stat. nov. Six taxa have been identified to genus but have not been identified to species. There are four in Laurencia, one in Chondrophycus and one in
Norfophycus. These may prove to be new species. Furthermore, both Laurencia obtusa (Hudson)
Lamouroux and Laurencia brongniartii J. Agardh that were widely reported species from
Australia are now considered not to occur here.
77 Introduction
The Laurencia complex now contains eight genera; Laurencia Lamouroux 1813, Osmundea
Stackhouse 1809, Chondrophycus Garbary and Harper 1998, Yuzurua (Nam) Martin-Lescanne
2010, Norfophycus gen. nov. Metti (this study), Coronaphycus gen. nov. Metti (this study), Namia gen. nov. Metti (this study), and Neolaurencia* gen. nov. Metti (this study). This cosmopolitan complex contains close to 170 currently accepted species ranging from tropical to cold temperate waters. The genus Laurencia is the largest with 132 currently accepted species.
Australia itself has one of the biggest shares with 27 Laurencia sensu stricto species reported
(Womersley 2003, Millar and Kraft 1993, Millar 1999, aussiealgae.org 2010-01-21). Chondrophycus currently has three species reported from Australia (Cribb 1958, Cribb 1983, Millar and Kraft
1993, Womersley 2003), Palisada has six recorded species (A.B. Cribb 1958, Millar and Kraft
1993, Womersley 2003), Osmundea has one reported taxon, originally recorded as Laurencia pedicularioides var. queenslandica (A.B. Cribb 1958, Furnari et al 2004) and of the four newly described genera, Norfophycus and Coronaphycus are known only from Australia, with two species each (Chapter two).
Within the State of New South Wales (NSW) the Laurencia complex frequently dominates the intertidal zones and is often abundant in the shallow subtidal region. It is the third most abundant group after Polysiphonia and Ceramium with twenty-three Laurencia species and varieties being attributed to the coasts of NSW (Harvey 1849, Lucas 1935, Lucas and Perrin 1947, Cribb
1958, Cribb 1983, Nam and Saito 1991, Millar and Kraft 1993, Huisman 2000, Womersley
2003, Millar 2004). Currently five now belong to other Laurencia complex genera, leaving a total of eighteen Laurencia species and varieties previously recorded from NSW (Table 15). Of the
*Neolaurencia is currently being described as the genus Laurenciella by V. Cassano et al. (pers. com. Dec. 8, 2011). The work in this thesis supports their conclusions that this group is to be recognized at a generic level.
78 five that have been placed in other genera, three have been moved to Palisada (P. cruciata, P. flagellifera, P. papillosa), one to Chondrophycus (C. succisus) and one to Chondria (C. infestans) (Millar
1990, Garbary and Harper 1998, Nam 1999, Nam 2007).
One of the first Laurencia complex species to be described from NSW was Laurencia infestans collected and described by A.H.S. Lucas from Manly in 1919 (Lucas 1919) as an epiphyte on
Ecklonia radiata blades. Since then it has been reported from Coffs Harbour where it was growing around the receptacles of Hormosira banksii. Millar (1990) transferred L. infestans to the genus Chondria as Chondria infestans (A.H.S. Lucas) Millar. This move was made after observing that the male plants developed spermatangial plates, which is an identifying morphological feature of the genus Chondria.
One of the most commonly recorded species in NSW is Laurencia majuscula (Harvey) A.H.S.
Lucas. Laurencia majuscula has been recorded as being widespread throughout NSW, including
Lord Howe and Norfolk Islands (Lucas 1935, Lucas and Perrin 1947, Saito and Womersley
1974, Millar and Kraft 1993, Millar 1999). It was originally described by W. H. Harvey from
Rottnest Island, WA, as Laurencia obtusa var. majuscula. Lucas (1935) raised Laurencia obtusa var. majuscula to specific rank as Laurencia majuscula after Yamada’s (1931) raising of another of
Harvey’s Australian varieties L. obtusa var. regia, to L. regia. One of Lucas’ own species described from Lord Howe Island as Laurencia elegans Lucas (1935) was later placed as a variety of L. majuscula by Saito and Womersley (1974), based on a general comparison between habits.
Laurencia majuscula var. elegans is recorded in NSW only from Lord Howe Island (Lucas 1935,
Saito and Womersley 1974, Millar and Kraft 1993). Another species recorded only from Lord
Howe Island is Laurencia venusta Yamada, originally described from Koshiki-jima, Japan (Millar and Kraft 1993).
79 Laurencia filiformis (C. Agardh) Montagne has been previously reported at five locations in NSW;
Woolgoolga, Sydney, Tathra, Jervis Bay and on Norfolk Island (Millar and Kraft 1993, Millar
1999). The type locality of Laurencia filiformis is Kangaroo Island, South Australia. A forma of L. filiformis recorded as occurring in NSW is L. filiformis f. heteroclada (Harvey) Saito and Womersley.
It was originally described from Rottnest Island, WA, as Laurencia heteroclada Harvey, which is reported only from Lord Howe Island (Saito and Womersley 1974, Millar and Kraft 1993,
Womersley 2003). It has recently been reinstated as L. heteroclada Harvey, but no records under this name have yet been published for NSW (Masuda 1997, Wynne et al. 2005). Laurencia heteroclada has one form which was described from Miami, Queensland; L. heteroclada f. decussata
Cribb. This form has been recorded from five locations in NSW; Byron Bay, Yamba,
Woolgoolga, Sydney and Tathra (Cribb 1958).
Laurencia brongniartii J. Agardh is reported as widely occurring throughout NSW, including both
Lord Howe and Norfolk Islands (Saito and Womersley 1974, Millar and Kraft 1993, Millar 1999,
Womersley 2003). The type locality for this species is Martinique, in the West Indies. This raises the question; can the Australian and Caribbean taxa be the same species with such distances from the type locality? Two other species recorded from Australia have been placed in synonymy with L. brongniartii; Laurencia grevilleana Harvey and Laurencia concinna Montagne
(Yamada 1931, A.B.Cribb 1958, Saito and Womersley 1974). Laurencia grevilleana was first described from Western Australia and has not been reported from NSW, however L. concinna originally described from Torres Strait in northeast Australia, has been recorded from Lord
Howe Island (Lucas 1935).
Laurencia elata was first described from King Island, Bass Strait in Southern Australia by
C.Agardh (1822) as Chondria pinnatifida var. elata, but was soon placed into the genus Laurencia by
80 Hooker and Harvey (1847) as a distinct species. It has been recorded in NSW as L. elata from various locations including Split Solitary Islands, Green Cape, Mossy Point and southern NSW
(Saito and Womersley 1974, Millar and Kraft 1993, Womersley 2003). Laurencia luxurians
(Harvey) J. Agardh from WA was placed as a form of L. elata, but is now considered synonymous with L. elata (Saito and Womersley 1974, Womersley 2003).
One species that is rarely reported from NSW is Laurencia distichophylla J. Agardh. It has only been collected in NSW from two locations, Jervis Bay and Twofold Bay, both located in southern NSW (Millar and Kraft 1993, Womersley 2003). The type locality of Laurencia distichophylla is New Zealand.
Another rarely reported species is Laurencia tenera which has a type locality of Hong Kong, China
(Tseng 1943). It has been reported from only two locations within NSW; Coffs Harbour and
Woolgoolga (Cribb 1958, Millar 1990, Millar and Kraft 1993)
The type species for the genus Laurencia is L. obtusa (Hudson) Lamouroux, originally described from England. This species is recorded from NSW, particularly Coffs Harbour, Port Jackson,
Kiama, and Jervis Bay (Cribb 1958, Millar 1990, Millar and Kraft 1993). This is interesting since very few north Atlantic taxa have been reported as occurring on the eastern Australian coast.
Two varieties of L. obtusa have been collected in NSW as well. Laurencia obtusa var. compacta
Cribb is a variety described from Caloundra, Queensland (Cribb 1958). It has been recorded from Byron Bay, Arrawarra, and Jervis Bay (Cribb 1958, Millar 1990, Millar and Kraft 1993).
The other variety present in NSW is L. obtusa var. dendroidea (J.Agardh) Yamada. It has a type locality of Brazil, and in NSW it has only been previously recorded from Norfolk Island (Millar
1999). Recent work has shown L. obtusa var. dendroidea is a distinct species as first described by C.
Agardh (Cassano et al, in press). 81 Laurencia rigida J. Agardh has been widely reported throughout NSW, including Yamba,
Woolgoolga, Twofold Bay, Coffs Harbour, and Arrawarra. It was first collected and described from eastern Australia, probably somewhere in Queensland (Cribb 1958, Millar 1990, Millar and
Kraft 1993).
Laurencia minuscula Schnetter has been collected only from one location on Norfolk Island. Its type locality is Caribbean Columbia (Millar 1999).
Laurencia platyclada Boergesen is a recent and new record for NSW. It was collected at Split
Solitary Island, and has a type location of Karachi and Sind Coast, Pakistan (Millar 2004).
A species rarely occurring in NSW, recorded only from Woolgoolga, is Laurencia pygmaea Weber- van Bosse, which has a type locality of Diego Garcia Atoll in the Indian Ocean (Weber-van
Bosse 1913, Cribb 1958, Millar and Kraft 1993). This taxon is now regarded as a synonym of
Laurencia decumbens Kutzing which was originally described from New Caledonia in the South
Pacific. (Wynne 1995). It has not yet been collected in NSW under its current name.
Laurencia succisa A. B. Cribb has a type location of Ball Bay, Queensland, Australia and in NSW is known only from Lord Howe Island (Millar and Kraft 1993). It has been transferred to the genus Chondrophycus as Chondrophycus succisus (A. B. Cribb) Nam 1999.
Three Laurencia species reported from NSW have recently been moved to the genus Palisada;
Laurencia cruciata Harvey, Laurencia flagellifera J. Agardh and Laurencia papillosa C.Agardh. Laurencia cruciata has a type location of Rottnest Island, WA, and has been transferred twice to two different genera; firstly to Chondrophycus as Chondrophycus cruciatus (Harvey) Nam 1999 and then to the genus Palisada as Palisada cruciata (Harvey) Nam 2007. It has been recorded in NSW from
82 Coffs Harbour, Jervis Bay, and Twofold Bay (Millar and Kraft 1993, Womersley 2003). Laurencia papillosa has had a similar history of transfers, firstly as Chondrophycus papillosus (C.Agardh) Garbary and Harper 1998, and then to Palisada as Palisada papillosa (C. Agardh) Nam 2007. It is now considered synonymous with Palisada perforata (Cassano et al 2009). It has been recorded from
Jervis Bay and Norfolk Island (Millar and Kraft 1993, Millar 1999). Laurencia flagellifera J. Agardh is recorded as an unconfirmed record from Norfolk Island (Millar 1999). It was transferred to
Chondrophycus as Chondrophycus flagelliferus (J. Agardh) Nam 1999 and is now known as Palisada flagellifera (J. Agardh) Nam 2007.
The recent advances in molecular genetics have allowed a much more critical systematic analysis of the complex. For this study, the coast of NSW was surveyed (including Lord Howe and
Norfolk Islands) specifically for members of the Laurencia complex to confirm previous records and to find any previously unrecorded species. Molecular analyses were undertaken to confirm identifications and determine possible evolutionary relationships. Also, past collections of
Laurencia species in NSW were re-evaluated based on current taxonomic understandings and the advances made throughout this study.
83
Species Authority Reference Laurencia brongniartii J. Agardh Millar and Kraft 1993, Womersley 2003, Millar 1999 Laurencia concinna Montagne A.B.Cribb 1958 Laurencia decumbens (as Laurencia pygmaea) Kutzing Millar and Kraft 1993, A.B.Cribb 1958 Laurencia distichophylla J. Agardh Millar and Kraft 1993, Womersley 2003 Laurencia elata (C. Agardh) J.D. Hooker and Harvey Millar and Kraft 1993, Womersley 2003 Laurencia filiformis (C. Agardh) Montagne Womersley 2003, Millar and Kraft 1993, Millar 1999 Laurencia heteroclada f. decussata A.B. Cribb A.B.Cribb 1958 Laurencia filiformis f heteroclada (Harvey) Saito and Womersley Millar and Kraft 1993 Laurencia majuscula (Harvey) A.H.S. Lucas Womersley 2003, Millar and Kraft 1993, Millar 1999 Laurencia majuscula var. elegans (A.H.S. Lucas) Saito and Womersley A.H.S. Lucas 1935, Saito and Womersley 1974 Laurencia minuscula Schnetter Millar 1999 Laurencia obtusa (Hudson) J.V. Lamouroux A.B.Cribb 1958, Millar and Kraft 1993, Millar 1999 Laurencia obtusa var. compacta A.B. Cribb Millar and Kraft 1993, A.B.Cribb 1958 Laurencia obtusa var. dendroidea (J. Agardh) Yamada Millar 1999 Laurencia platyclada Boergesen Millar 2004 Laurencia rigida J. Agardh Millar and Kraft 1993, A.B.Cribb 1958 Laurencia tenera C.K. Tseng Millar and Kraft 1993, A.B.Cribb 1958 Laurencia venusta Yamada Millar and Kraft 1993 Palisada cruciatus (Harvey) K.W. Nam Womersley 2003, Millar and Kraft 1993 Palisada flagelliferus (as Laurencia flagellifera) (J. Agardh) Nam Millar 1999 Palisada papillosus (C. Agardh) Garbary and Harper Millar and Kraft 1993, Millar 1999 Chondrophycus succisus (A.B. Cribb) K.W. Nam Millar and Kraft 1993 Chondria infestans (as Laurencia infestans) (Lucas) A.J.K. Millar A.H.S. Lucas 1919, Millar 1990
Table 15. A list of species within the Laurencia complex recorded as occurring in NSW, Australia, previous to this study.
84 Materials and Methods
Sample Collection
Fieldwork was carried out from April 2004 to June 2008 across twenty-six locations in New
South Wales, including Lord Howe and Norfolk Islands (Figure 5). Sampling locations were selected for maximum coverage of the NSW coastlines, and the variety of habitats found throughout the state. Samples were collected and stored in the same way as outlined in chapter 2 (see sample collection, Chapter two). Sample details are outlined in Table 16.
Herbarium abbreviations follow the online version of the Index Herbariorum (Theirs 2009).
Figure 5. The above diagram details collection site locations for this study along the coast of NSW, including Lord Howe and Norfolk Islands. Inset shows the location of NSW in Australia.
85 Species collection data
Species Accessn / Location and collecting data Ref. Collectn # Ceramium japonicum Okamura FJ943707 South Korea, Eocheongdori, Okdo, Gunsansi, Jeonbuk, C1148 2 Ceramium japonicum Okamura FJ943760 South Korea, Eocheongdori, Okdo, Gunsansi, Jeonbuk, C1148 2 Ceramium kondoi Yendo DQ350388 Japan, Itoigawa, Niigata, C1315 13 Chondria californica (Collins) Kylin AY172578 USA, California, San Diego Co., Beach Club Reef (La Jolla Shores), M. Volovsek, 1/07/1996 3 Chondria succulenta (J.Agardh) Falkenberg YM309 Australia, NSW, Batehaven, Y. Metti, YM309, 30/05/ 2005 1 Chondrophycus cartilagineous (Yamada) Garbary & Harper J01 Japan, Fukui, Shikimi, Wakasa, M.Kamiya, J01, 20//08/2006 1 Chondrophycus sp. YM219 Australia, NSW, Jervis Bay, Y.Metti, A.Millar, N.Yee, YM219, 15/03/2005 1 Chondrophycus sp. YM234 Australia, NSW, Norfolk Island, Y.Metti, A.Millar, YM234, 15/03/2005 1 Chondrophycus sp. YM385 Australia, NSW, Botany Bay, D.Williams, YM385, 17/11/2005 1 Chondrophycus tronoi (Ganzon-Fortes) Nam AF489864 Philippines 4 Kallymenia cribrosa Harvey EU349216 Australia, WA, Tarcoola Beach, M.H. and F. Hommersand, 21 September 1995 5 Laurencia brongniartii J. Agardh JE03 Australia, WA, Rottnest Island, J.Eu, JE03, 15/11/2008 1 Laurencia brongniartii J.Agardh JE02 Australia, WA, Rottnest Island, J. Eu, JE02, 15/11/2008 1 Laurencia brongniartii J.Agardh TFP080186 Panama, Bocas State, Bastimentos, S.Schmitt, D.W.Freshwater, TFP080186, 14/07/2008 1 Laurencia brongniartii J.Agardh YM245 Australia, Norfolk Island, Y.Metti, A.Millar, YM245, 16/03/2005 1 Laurencia brongniartii J.Agardh YM324 Australia, Lord Howe Island, Y.Metti, A.Millar, YM324, 25/10/2005 1 Laurencia calliptera Kutzing YM068 Australia, NSW, Arrawarra Headland, Y.Metti, YM068, 28/07/2004 1 Laurencia calliptera Kutzing YM071 Australia, NSW, Arrawarra Headland, Y.Metti, YM071, 28/07/2004 1 Laurencia calliptera Kutzing YM295 Australia, Norfolk Island, Y.Metti, A.Millar, YM295, 19/03/2005 1 Laurencia catarinensis Cordeiro-Marino & M.T.Fujii AF465808 Brazil, Eusta´quio, Ilhabela, Sao Paulo, M.T. Fujii, SP356241, LAF#: L15, 19/01/2001 6 Laurencia complanata (Suhr) Kutzing AF465813 South Africa, Port Edward, Kwa-Zulu-Natal, A.Millar, LAF#:8.2.01.2.12, L32, 8/02/2011 6 Laurencia dendroidea J. Agardh GU330228 Brazil, Bahia, Lauro de Freitas, Praia Vilas do Atlântico, A.Oliveira, 08/01/2008 7 Laurencia dendroidea J. Agardh GU330222 Brazil, Prainha, Arraial do Cabo, Rio de Janeiro, V.Cassano, SP399.900, 2005 7 Laurencia elata C.Agardh JE01 Australia, Western Australia, Rottnest Island, subtidal, James Eu, JE01, 15/11/2008 1 Laurencia flexuosa Kutzing AF465815 South Africa, Palm Beach, Kwa-Zulu-Natal, S.Fredericq, LAF#:7.2.01.1.19, L44, 7/02/2001 6 Laurencia heteroclada f. decussata A.B.Cribb YM069 Australia, NSW, Arrawarra Headland, Y.Metti, YM069, 28/07/2004 1
86 Laurencia heteroclada f. decussata A.B.Cribb YM049 Australia, NSW, Emerald Beach, Y.Metti, YM049, 25/07/2004 1 Laurencia heteroclada f. decussata A.B.Cribb YM153 Australia, NSW, Sydney, Bare Island, Y.Metti & A.Millar, YM153, 9/02/2005 1 Laurencia heteroclada f. decussata A.B.Cribb YM070 Australia, NSW, Arrawarra Headland, Y.Metti, YM070, 28/07/2004 1 Laurencia heteroclada f. decussata A.B.Cribb YM178 Australia, NSW, Jervis Bay, Y.Metti, A.Millar, N.Yee, YM178, 15/02/2005 1 Laurencia intricata Lamouroux AF465809 Mexico, Yucatan, Champoton, Campeche Bay, C.F.Gurgel, LAF#:L45, 14/02/1999 6 Laurencia majuscula (Harvey) A.H.S.Lucas 064 Australia, WA, Freemantle, A.Kurihara, Shimada, 12/11/2003 1 Laurencia majuscula (Harvey) A.H.S.Lucas YM005 Australia, NSW, Kiama Harbour, Y.Metti, D.Williams, YM005, 3/04/2004 1 Laurencia majuscula (Harvey) A.H.S.Lucas YM288 Australia, Norfolk Island, Y.Metti, A.Millar, YM288, 18/03/2005 1 Laurencia majuscula (Harvey) A.H.S.Lucas YM322 Australia, Lord Howe Island, Y.Metti, A.Millar, YM322, 25/10/2005 1 Laurencia majuscula (Harvey) A.H.S.Lucas YM169 Australia, NSW, Jervis Bay, Plantation Pt, Y.Metti & A.Millar, YM169, 15/02/2005 1 Laurencia majuscula (Harvey) A.H.S.Lucas JH03 Australia, WA, Little Turtle Island, J.Huisman PERTH08052360, JH03, 15/05/2008 1 Laurencia majuscula v. elegans (A.H.S.Lucas) Saito & Womersley YM213 Australia, NSW, Jervis Bay, Y.Metti, A.Millar, N.Yee, YM213, 16/02/2005 1 Laurencia majuscula v. elegans (A.H.S.Lucas) Saito & Womersley YM248 Australia, Norfolk Island, Kingston Lagoon, Y.Metti, A.Millar, YM248, 16/03/2005 1 Laurencia majuscula v. elegans (A.H.S.Lucas) Saito & Womersley YM251 Australia, Norfolk Island, Kingston Lagoon, Y.Metti, A.Millar, YM251, 16/03/2005 1 Laurencia majuscula v. elegans (A.H.S.Lucas) Saito & Womersley JH06 Australia, WA, Whites Beach, Barrow 1, J.Huisman PERTH08052344, JH06, 10/02/2008 1 Laurencia majuscula v. elegans (A.H.S.Lucas) Saito & Womersley YM325 Australia, Lord Howe Island, Y.Metti, A.Millar, YM325, 25/10/2005 1 Laurencia majuscula v. elegans (A.H.S.Lucas) Saito & Womersley YM340 Australia, Lord Howe Island, Y.Metti, A.Millar, YM340, 26/10/2005 1 Laurencia marilzae Gil-Rodriguez,Senties,Diaz-Larrea,Cassano & Fujii EF686003 Spain, Punta del Hidalgo Tenerife, Canary Islands, Gil-Rodriguez, TFCPhyc.N#136071, 06/10/2006 14 Laurencia marilzae Gil-Rodriguez,Senties,Diaz-Larrea,Cassano & Fujii EF686002 Spain, Punta del Hidalgo Tenerife, Canary Islands, Gil-Rodriguez, TFCPhyc.N#13129, 12/07/2006 14 Laurencia natalensis Kylin AF465816 South Africa, Palm Beach, Kwa-Zulu-Natal, S.Fredericq, LAF#:7.2.01.1.20, L49, 7/02/2001 6 Laurencia obtusa (Hudson) J.V.Lamouroux AF281881 Ireland, Co. Donegal, Fanad Head, C.A.Maggs, 6/07/1998 8 Laurencia pacifica Kylin AY588411 USA, California, Central Beach Moss Beach, S.Fredericq, LAFL37, 17/02/1992 6 Laurencia pedicularioides v. queenslandica A.B.Cribb YM185 Australia, NSW, Jervis Bay, Y.Metti, A.Millar, N.Yee, YM185, 15/02/2005 1 Laurencia pedicularioides v. queenslandica A.B.Cribb YM117 Australia, NSW, Bermagui, Y.Metti, YM117, 23/01/ 2005 1 Laurencia sp. YM194 Australia, NSW, Jervis Bay, Plantation Pt, subtidal, Y. Metti, A. Millar, YM194, 15/02/2005 1 Laurencia sp.1 YM399 Australia, NSW, Aragunnu, N.Yee,YM399, 19/01/2007 1 Laurencia sp.2 YM367 Australia, Lord Howe Island, Y.Metti, A.Millar, YM367, 27/10/2005 1 Laurencia sp.3 YM095 Australia, NSW, Gosford, J.Taylor, YM095, 30/10/2004 1 Laurencia sp.3 YM215 Australia, NSW, Jervis Bay, Y.Metti, A.Millar, N.Yee, YM215, 16/02/2005 1 Laurencia sp.3 YM222 Australia, NSW, Jervis Bay, Y.Metti, A.Millar, N.Yee, YM222, 16/02/2005 1
87 Laurencia sp.3 YM260 Australia, Norfolk Island, Y.Metti, A.Millar, YM260, 16/03/2005 1 Laurencia sp.3 YM272 Australia, Norfolk Island, Y.Metti, A.Millar, YM272, 17/03/2005 1 Laurencia sp.3 YM345 Australia, Lord Howe Island, Y.Metti, A.Millar, YM345, 27/10/2005 1 Laurencia sp.3 YM360 Australia, Lord Howe Island, Y.Metti, A.Millar, YM360, 27/10/2005 1 Laurencia sp.4 YM188 Australia, NSW, Jervis Bay, Y.Metti, A.Millar, N.Yee, YM188, 15/02/2005 1 Laurencia sp.4 YM205 Australia, NSW, Jervis Bay, Y.Metti, A.Millar, N.Yee, YM205, 15/02/2005 1 Laurencia sp.4 YM268 Australia, Norfolk Island, Y.Metti, A.Millar, YM268, 17/03/2005 1 Laurencia sp.4 YM349 Australia, Lord Howe Island, Y.Metti, A.Millar, YM349, 27/10/2005 1 Laurencia translucida M.T.Fujii & Cordeiro-Marino AY588408 Brazil, Marataizes,Espirito Santo State, M.T.Fujii, SP356242, LAF#: 377, 15/09/2001 6 Laurencia venusta Yamada YM338 Australia, Lord Howe Island, Y.Metti, A.Millar, YM338, 26/10/2005 1 Laurencia venusta Yamada YM380 Australia, Lord Howe Island, Y.Metti, A.Millar, YM380, 28/10/2005 1 Norfophycus originalis Metti YM296 Australia, Norfolk Island, Collins Head, intertidal, Y.Metti, A.Millar, YM296, 21/03/2005 1 Norfophycus originalis Metti YM300 Australia, Norfolk Island, Collins Head, intertidal, Y.Metti, A.Millar, YM300, 21/03/2005 1 Norfophycus sp. YM279 Australia, Norfolk Island, Kingston Lagoon, subtidal, Y.Metti, A.Millar, YM279, 17/03/2005 1 Osmundea osmunda (S.G.Gmelin) K.W.Nam & Maggs AF281877 Ireland, Co. Donegal, St. John's Point, C.A.Maggs, 12/10/1999 8 Osmundea pinnatifida (Hudson) Stackhouse AF281875 Ireland, Co. Donegal, St. John's Point, C.A.Maggs, 12/10/1999 8 Osmundea sinicola (Setchell & N.L. Gardner) K.W. Nam AY588407 USA, California, Orange Co., Crescent Beach, S.Murray, LAF#:680, 28/05/2002 6 Palisada corallopsis (Montagne) Nam EF061646 Mexico, Yucatan, Cancun, Chaac Mool Beach, J.Diaz Larrea and A.Senties Granados, 2005 9 Palisada robusta K.W. Nam TW20 Taiwan, Orchid Island, Li-Ja Liu & Showe-Mei Lin, TW20, April 2010 1 Palisasda cruciatus (Harvey) Nam YM085 Australia, NSW, Bare Island, Y.Metti, YM085, 16/02/ 2005 1 Polysiphonia pacifica v. disticha Hollenberg AY958162 USA, Oregon, Seal Rock 2, M.S.Kim and E.C.Yang, P194, 06/2003 10 Polysiphonia stricta (Dillwyn) Greville AY958167 United Kingdom: England, Flambourough, P171, 4 Rhodomela confervoides (Hudson) P.C.Silva AF083381 Germany: Kiel Bight 11 Yuzurua poiteaui (Lamouroux) Martin-Lescanne EF061648 Mexico, Ojo de agua, Puerto Morelos, Quintana Roo, J.Diaz-Larrea & A.Senties, 2004 12 Yuzurua poiteaui (Lamouroux) Martin-Lescanne EF061649 Mexico, Yucatan, Cancun, Playa del Carmen, J.Diaz-Larrea & A.Senties, 2004 12 Yuzurua poiteaui (Lamouroux) Martin-Lescanne EF061652 USA, Florida, Long Key, Ovan Side, S. Frederik, 1998 12 Table 16. The details of samples used for molecular work in this study, including donated specimens and selected downloaded Genbank samples used in molecular cladistic analyses. References 1=this study, 2= Yang et al (2009), 3= McIvor et al (2002), 4= GENBANK (http://www.ncbi.nlm.nih.gov), 5= Krayesky et al (2009), 6= Fujii et al (2006), 7= Cassano et al (in press), 8= Nam et al (2000), 9= Senties and Diaz-Larrea (2008), 10= Kim and Yang (2005), 11= de Jong et al (1998), 12= Diaz-Larrea et al (2007), 13= Yang et al (2008), 14=Gil- Rodriguez et al (2009)
88
Morphology
Liquid preserved material was stained with 1% aniline blue and 1% acetic acid solution, sectioned by hand and fixed with a 50% karo solution. Microscopic observations were then made using a Zeiss compound microscope. A BBT Krauss dissector microscope was used to observe surface features of liquid preserved and pressed materials. All photos were taken with a Nikon coolpix4500 digital camera, and microscope adapter lenses were used for slide photos.
All slides, vouchers, silica dried material and liquid preserved material are stored at the
National Herbarium of New South Wales (NSW).
DNA Extraction and Amplification
Total genomic DNA was extracted from silica dried material using the DNEasy Plant Mini Kit
(Qiagen, Valencia, CA, USA), and immediately purified using the JetQuick PCR Purification
Kit (Genomed Co.). The rbcL gene and the rbcL-rbcS spacer region were amplified in one independent polymerase chain reaction (PCR) for most samples. Primers used were
FrbcL_start_sh and RrbcS_start (Freshwater and Rueness 1994), or YF_1 and YR_rbcS (Metti, this study). Those that were not amplified in one piece were amplified in three pieces using a combination of the primers listed in Table 17. The COX1 gene region was also amplified in one piece using the primers GazF1 and GazR1 (Saunders 2005). A Corbett Palm thermocycler
(Corbett Research, Australia) was used for the PCR amplifications. Program details are outlined in Tables 18 and 19.
The PCR mixture was made to 20uL, with the following concentration of reagents: 11.9uL of dH20, 2uL of 10x reaction buffer (Bioline Ltd.), 1uL of MgCl2 at 25mM (Promega, Madison,
89 USA), 2uL of 4x dNTPs at 2.5mM each, 0.1uL of BioTaq DNA polymerase (Bioline Ltd.),
0.5uL of the forward primer at 20uM, 0.5uL of the reverse primer at 20uM, and 2uL of the genomic DNA. Amplified products were purified using the JetQuick PCR Purification Kit
(Genomed Co.). 4uL of purified PCR product was run on a gel to visualize DNA concentrations.
Sequencing
The primers used for all sequencing reactions are detailed in Table 17. The sequencing mixture was made to 20uL, with the following concentration of reagents: 12uL of dH20, 2uL of 5X buffer, 2uL of Big Dye terminator, 2uL of a single 1.6uM primer, 2uL of purified PCR product. The UNSW Ramaciotti Centre sequencing protocol was followed for the Applied
Biosystems 3730 Capillary Sequencer. A Corbett Palm thermocycler (Corbett Research,
Australia) was used for the sequencing reactions and the program is outlined in Table 20.
The UNSW Ramaciotti Centre ethanol/EDTA precipitation protocol was followed. 5uL of
125mM EDTA and 5uL of ethanol were added to each well and was allowed to incubate at room temperature for 15 minutes to precipitate extension products. Supernatants were then removed and pellets rinsed with 60uL of ethanol. Supernatants were again removed and the pellets dried by vacuum centrifuge and stored at 4C. Precipitated and dried samples were then sent to the UNSW Ramaciotti Centre for sequence electrophoresis.
90
Gene Direction Primer Name Sequence (5'-3') Reference rbcL Forward F-492 CGT ATG GAT AAA TTT GGT CG Freshwater et al 1994 F-57 GTA ATT CCA TAT GCT AAA ATG GG Freshwater et al 1994 F-574 GTA GTA TAT GAA GGT CTA AAA GG Freshwater et al 1994 F-749* C AAT GGA AGA TAT GTA TGA AAG AGC Modified from Freshwater et al 1994 FrbcL_start_sh ATG TCT AAC TCT GTA GAA G Modified from Freshwater et al 1994 YF_1 TAT GTC TAA ACT CTG TAG AAG AAC G this study YF_613 CCT TAA AGA TGA TGA AAA TAT TAA TTC this study Reverse R-1150 GCA TTT GTC CGC AGT GAA TAC C Freshwater et al 1994 R-1381 ATC TTT CCA TAG ATC TAA AGC Freshwater et al 1994 R-749* GCT CTT TCA TAC ATA TCT TCC ATT G Modified from Freshwater et al 1994 rbcS Reverse RrbcS_start GTT CCT TGT GTT AAT CTC AC Modified from Freshwater et al 1994 YR_rbcS GGT AAT CTC ACT TAT CTA TAC TCC this study cox1 Forward GazF1 TCA ACA AAT CAT AAA GAT ATT GG Saunders 2005 Reverse GazR1 ACT TCT GGA TGT CCA AAA AAY CA Saunders 2005 Table 17. This table details the primers used for both PCR and sequencing reactions.
Stage Time Temperature Cycles initial denaturation 3min 94C denaturation 45sec 94C annealing 30sec 55C 5cycles extension 2min 72C denaturation 45sec 94C annealing 30sec 55C to 45C 1C touchdown 10cycles extension 2min 72C denaturation 45sec 94C annealing 30sec 45C 15cycles extension 2min 72C final extension 5min 72C hold 4C Table 18. The details of the PCR program used to amplify the rbcL and spacer gene region (this study).
Stage Time Temperature Cycles initial denaturation 1min 94C denaturation 1min 94C annealing 1.5min 50C 5cycles extension 1.5min 72C denaturation 1min 94C annealing 1.5min 50C 35cycles extension 1min 72C final extension 5min 72C hold 4C Table 19. The details of the PCR program used to amplify the COX1 gene region from Saunders et al 2005.
Stage Time Temperature Cycles denaturation 10sec 96C annealing 5sec 50C 25cycles extension 4min 60C hold 4C Table 20. The program followed for sequencing reactions of the rbcL gene (UNSW Ramaciotti Centre protocol).
91 Alignment and Phylogenetic Analysis
The resulting sequences were aligned visually using Sequencher (Gene Codes Corp., Ann
Arbor, MI, USA). For each sample overlapping sequences from both strands were aligned and edited, and the resulting consensus sequence entered into a PAUP nexus file. Final length of the rbcL alignment was 1417 base pairs (bp), the rbcL-rbcS spacer was 153 (bp), and the COX1 gene was 676 (bp).
Additional sequences for Laurencia complex taxa were downloaded from Genbank (Benson et al 2004) and added to the PAUP nexus file. These are listed in Table 16. To be included in the alignment Genbank sequences for the rbcL gene and the rbcL-rbcS spacer were required to meet certain criteria which include: A) sequenced from type locality material, B) vouchered, and C) published. COX1 sequences available on Genbank were limited so those included in the alignment that did not meet the above criteria were limited to outgroup taxa only. Two included sequences do not meet the above criteria however no taxonomic decisions were based on these sequences (Polysiphonia stricta AY958167, and Chondrophycus tronoi AF489864). P. stricta is included as an outgroup, and C. tronoi is included to populate a clade.
Phylogenetic analyses were run for three gene combinations 1) rbcL region only, 2) the rbcL and
COX1 regions combined, and 3) the rbcL and rbcL-rbcS spacer regions combined. For each combination analyses were run using the following algorithms; Maximum-Parsimony (MP),
Maximum-Likelihood (ML) and Bayesian Inference (BI). Both the MP and ML analyses were performed using the software PAUP for PC (v.4.0 beta10, Swofford 2003). The program
MrBayes 3.1 (Huelsenbeck and Ronquist 2001) for PC was used for BI analyses. Both the ML and Bayesian analyses used evolutionary models that were determined by using the program
92 Modeltest 3.7 (Posada and Crandall 1998) for PC. The spacer region was initially aligned using the online program T-COFFEE (Notredame et al 2000), then corrected visually using
Sequencher. Indels were inserted to restore alignments within the nexus file (Table 22).
Trees were rooted using the outgroup method. Chondria is used as an outgroup since it is closely related to the Laurencia complex. Both belong to the family Rhodomelaceae and order
Ceramiales. Also included as outgroups are representatives from: Polysiphonia and Rhodomela belonging to the family Rhodomelaceae and order Ceramiales, Ceramium in the family
Ceramiaceae and order Ceramiales, and Kallymenia in the family Kallymeniaceae and in the order Gigartinales.
Pairwise distances between taxa are indicated on all MP trees as a grey ladder to the immediate right of the trees (Figures 8, 11, 14). The rungs of the ladder point to the pair of taxa being compared, and the pairwise distance is given as a percent difference and an absolute value of base pairs. Table 12 summarizes pairwise distances and absolute base pair differences across the genera within the Laurencia complex (Table 12, Chapter 2).
rbcL gene region
Maximum Likelihood Analysis. The GTR+I+G nucleotide substitution model was used which is a general-time-reversible (GTR) model of sequence evolution including both invariable sites
(+I) and rate variation among sites (+G). The Akaike information criterion (AIC) model parameters were: assumed nucleotide frequencies freqA = 0.3473, freqC = 0.1143, freqG =
0.1739, freqT = 0.3645; substitution rate matrix [A-C] = 1.9291, [A-G] = 7.6346, [A-T] =
2.1319, [C-G] = 2.2665, [C-T] = 23.4123, [G-T] = 1.0000; Proportion of invariable sites (I) =
93 0.5271; Gamma distribution shape parameter = 1.1185 (Table 21). Bootstrap calculations used
1000 replicates (Figure 6).
Bayesian Inference Analysis: The evolutionary model was set to GTR (lset nst=6) with gamma distributed rate variation among variable sites (lset rates=invgamma). The invgamma setting was used because the resulting model assumes a proportion of invariable sites (0.5271). The
Bayesian phylogeny was estimated using two runs of 4 chains each, one cold, three hot, for
5,500,000 generations using the Markov Chain Monte Carlo (mcmc) search algorithm. Each
10th generation was sampled. The first 13,750 trees were discarded as the 25% burnin, and a
50% majority rule consensus tree computed from the remaining trees. Posterior probabilities are reported (Figure 7).
Maximum Parsimony Analysis: The Fitch criterion was employed, which does not impose constraints on character transformations (Fitch 1971). The branch-swapping algorithm used was tree-bisection-reconnection (TBR), initial trees were generated with random sequence addition, and 1000 replicates were run with 10 trees held at each cycle. During the tree search the ‘Multrees’ option was in effect but ‘steepest descent’ was not. Branches were collapsed if maximum branch length is zero creating polytomies. Bootstrap proportion values (Felsenstein
1985) were calculated to determine node support. Bootstrap calculations used 1000 replicates
(Figure 8). Pairwise distances between taxa are reported as a percentage and in number of base pairs (Figure 8). Distances need to be considered in light of other evidence but can be useful indicators of closeness of relationships between taxa. In Laurencia complex phylogenies using rbcL, distances of around 10% are high enough to be considered separate genera, distances between 2% and 8% are considered within the one genus, and taxa with distances of less than
94 2% are generally accepted as being within same species (Diaz-Larrea et al 2007, Cassano et al
2009, Martin-Lescanne et al 2010).
rbcL and COX1 gene regions combined
Maximum Likelihood Analysis. The GTR+I+G nucleotide substitution model was used which is a general-time-reversible (GTR) model of sequence evolution including both invariable sites
(+I) and rate variation among sites (+G). The model parameters were; assumed nucleotide frequencies freqA = 0.3053, freqC = 0.1382, freqG = 0.1906, freqT = 0.3659; substitution rate matrix [A-C] = 1.6984, [A-G] = 15.0285, [A-T] = 3.2052, [C-G] = 1.5858, [C-T] = 25.9328,
[G-T] = 1.0000; Proportion of invariable sites (I) = 0.5601; Gamma distribution shape parameter = 0.8019 (Table 21). Bootstrap calculations used 1000 replicates (Figure 9).
Bayesian Inference Analysis: The evolutionary model was set to GTR (lset nst=6) with gamma distributed rate variation among variable sites (lset rates=invgamma). The invgamma setting was used because the resulting model assumes a proportion of invariable sites (0.5601). The
Bayesian phylogeny was estimated using two runs of 4 chains each, one cold, three hot, for
1,000,000 generations using the Markov Chain Monte Carlo (mcmc) search algorithm. Each
10th generation was sampled. The first 2,500 trees were discarded as the 25% burnin, and a
50% majority rule consensus tree computed from the remaining trees. Posterior probabilities are reported (Figure 10).
Maximum Parsimony Analysis: The Fitch criterion was employed, with TBR branch swapping.
Initial trees were generated with random sequence addition, and 10000 replicates were run with
10 trees held at each cycle. During the tree search the ‘Multrees’ option was in effect but
95 ‘steepest descent’ was not. Branches were collapsed if maximum branch length is zero creating polytomies. Bootstrap proportion values (Felsenstein 1985) were calculated to determine node support. Bootstrap calculations used 1000 replicates (Figure 11). Pairwise distances between taxa are reported as a percentage and in number of base pairs (Figure 11).
For both the ML and BI analyses when using rbcL and COX1 combined, N. originalis was used as the outgroup because the only other taxon available with both rbcL and COX1 sequences is
Ceramium japonicum and it is too distantly related to polarize the ingroup. However, in the MP analysis using rbcL and COX1 combined, N. originalis is part of the ingroup, and Ceramium japonicum is the outgroup.
rbcL and rbcL-rbcS spacer gene regions combined
Maximum Likelihood Analysis. The GTR+I+G nucleotide substitution model was used which is a general-time-reversible (GTR) model of sequence evolution including both invariable sites
(+I) and rate variation among sites (+G). The model parameters were; assumed nucleotide frequencies freqA = 0.3420, freqC = 0.1359, freqG = 0.1858, freqT = 0.3363; substitution rate matrix [A-C] = 2.4877, [A-G] = 10.5106, [A-T] = 2.3341, [C-G] = 1.4863, [C-T] = 23.6301,
[G-T] = 1.0000; Proportion of invariable sites (I) = 0.5666; Gamma distribution shape parameter = 1.4314 (Table 21). Bootstrap calculations used 1000 replicates (Figure 12).
Bayesian Inference Analysis: The evolutionary model was set to GTR (lset nst=6) with gamma distributed rate variation among variable sites (lset rates=invgamma). The invgamma setting was used because the resulting model assumes a proportion of invariable sites (0.5666). The
Bayesian phylogeny was estimated using two runs of 4 chains each, one cold, three hot, for
96 1,000,000 generations using the Markov Chain Monte Carlo (mcmc) search algorithm. Each
10th generation was sampled. The first 2,500 trees were discarded as the 25% burnin, and a
50% majority rule consensus tree computed from the remaining trees. Posterior probabilities are reported (Figure 13).
Maximum Parsimony Analysis: The Fitch criterion was employed, with TBR branch swapping.
Initial trees were generated with random sequence addition, and 1000 replicates were run with
10 trees held at each cycle. During the tree search the ‘Multrees’ option was in effect but
‘steepest descent’ was not. Branches were collapsed if maximum branch length is zero creating polytomies. Bootstrap proportion values (Felsenstein 1985) were calculated to determine node support. Bootstrap calculations used 1000 replicates (Figure 14). Pairwise distances between taxa are reported as a percentage and in number of base pairs (Figure 14).
97
AIC DNA Region Data Nucleotides Base Freqs. Nst Rate matrix Tratio Rates Shape Pinvar Model (A, C, G, T) (A-C, A-G, A-T, C-G, C-T, G-T)
0.3473, 0.1143, 1.9291, 7.6346, 2.1319, 2.2665, rbcL only all sites 1417 GTR+I+G 6 - gamma 1.1185 0.5271 0.1739, 0.3645 23.4123, 1.0000
0.3053, 0.1382, 1.6984, 15.0285, 3.2052, 1.5858, rbcL + COX1 all sites 1417+ 676 GTR+I+G 6 - gamma 0.8019 0.5601 0.1906, 0.3659 25.9328, 1.0000
0.3420, 0.1359, 2.4877, 10.5106, 2.3341, 1.4863, rbcL + Spacer all sites 1417 + 153 GTR+I+G 6 - gamma 1.4314 0.5666 0.1858, 0.3363 23.6301, 1.0000
Table 21. A summary of Modeltest model parameters selected by the AKAIKE Information Criterion (AIC) used in both the maximum likelihood and Bayesian Inference analyses.
98
Table 22. The RuBiSCO spacer final alignment used in this research. Indels were added as gaps to restore sequence alignments.
99 100
Results and Observations
Phylogenetic Analyses of the Laurencia complex species found in NSW rbcL Only
(Figures 6, 7, 8)
The ML and BI analyses include a total of sixty sequences, the MP analysis includes sixty-one sequences, and in all three analyses twenty-one of those sequences are downloaded Genbank samples. 1417bp of the rbcL gene were analyzed, all were unordered and of equal weight, and included 467 parsimony informative characters, and 570 variable sites. All three resulting phylogenies are congruent in that they show the Laurencia complex as monophyletic. It is supported to varying degrees across the three analyses, the strongest support was in the
Bayesian analysis (BI posterior probability = 1.00), followed by the MP (MP bootstrap = 69%), then ML (ML bootstrap = 52%) analyses. The individual genera within the complex are also supported in all three analyses. See chapter 2 for a thorough treatment of each genus.
In both the ML and MP analyses the Laurencia sensu stricto clade is not strongly supported mainly due to the inclusion of Laurencia translucida which is currently the most outlying species within the genus Laurencia. It is the Laurencia species that shares the most traits with the
Chondrophycus genus. It is included in these analyses to encompass the entire scope of the
Laurencia genus. In the BI analysis the Laurencia sensu stricto clade is strongly supported regardless of the inclusion of L. translucida. Laurencia translucida in the ML and BI analyses results as most basal within the genus. In the MP analysis L. complanata is placed as most basal and L. translucida instead groups with the L. brongniartii clade. When looking at pairwise 101 distance comparisons within the genus Laurencia, L. translucida alone is responsible for the large distances seen (8.96%). Without including this taxon the distances within the Laurencia genus would only be 7.33%. It is also responsible for the small intergeneric distances seen between the genus Chondrophycus and the genus Laurencia. However, it is important to keep this taxon in the analyses since it represents the outermost range of the genus Laurencia.
The molecular results for each taxon are covered in detail within each species’ individual discussion below.
102 L. grevilleana
v. pacifica+
Figure 6. The Maximum Likelihood phylogram based on rbcL sequence data showing the phylogenetic relationships among the taxa of the Laurencia complex. The numbers above branches indicate bootstrap values inferred from 1000 ML bootstrap replicates. Values less than 50% are not shown, bold lines and * indicate full support (100%). Taxa with bold names and ^ are generitype sequences from type location material, and taxa with + are species sequences from type location material. Species and generic conclusions are indicated by solid bars on the far right of the tree. Branch lengths indicate amount of sequence change.
103 104 Laurencia brongniartii+
v. pacifica+
Figure 7. The Bayesian Inference phylogram based on rbcL sequence data showing the phylogenetic relationships among the taxa of the Laurencia complex. The numbers above branches indicate Bayesian inference posterior probabilities. Values less than 0.50 are not shown, bold lines and * indicate full support (1.00). Taxa with bold names and ^ are generitype sequences from type location material, and taxa with + are species sequences from type location material. Species and generic conclusions are indicated by solid bars on the far right of the tree. Branch lengths indicate amount of sequence change.
105 106 Laurencia brongniartii+
v. pacifica+
Figure 8. The Maximum Parsimony strict consensus tree based on rbcL sequence data. The tree shows phylogenetic relationships among the taxa of the Laurencia complex. The numbers above branches indicate bootstrap values inferred from 1000 MP bootstrap replicates. Values less than 50% are not shown, bold lines and * indicate full support (100%). Taxa with bold names and ^ are generitype sequences from type location material, and taxa with + are species sequences from type location material. Pairwise distances and absolute base pair differences between consecutive taxa are shown on a light grey ladder on the immediate right of the tree. Species and generic conclusions are indicated by solid bars on the far right of the tree. Five parsimonious trees across 88 islands, tree length=2289, CI=0.3600, HI=0.6400, CI excluding uninformative characters=0.3261, HI excluding uninformative characters=0.6739, RI=0.6433, RC=0.2316.
107 108 rbcL and COX1 Combined
(Figures 9, 10, 11)
Both the ML and BI analyses included thirty-four completed sequences obtained through this study. The MP analysis included thirty-five sequences, which includes one downloaded
Genbank sequence. 2094bp were analyzed, of which 480 characters are parsimony informative. Combining the rbcL and COX1 sequences allows for a clearer separation between closely related taxa such as species. Since the COX1 gene is a coding mitochondrial gene it is easier to align than a non-coding region such as the rbcL-rbcS spacer region. Genes of different origins (ie plastid and mitochondrial) are independent sources of information, with potentially different evolutionary histories. Combining these loci can result in stronger support for the species phylogenies when compared to phylogenies using genes of the same origins (i.e. plastid only). This is true only if the two genes are compatible for combining. In this study, the rbcL and COX1 data sets were found to be congruent therefore were combined for analyses.
Details of gene marker congruence are discussed in chapter 4 (congruence between gene markers, Chapter 4).
With both plastid and mitochondrial genetic information included the rbcL and COX1 results give good evidence for the Laurencia genus (ML bootstrap = 96%, BI posterior probability =
1.00, MP bootstrap = 93%), particularly in comparison with the rbcL only results (Figures 6, 7,
8).
The molecular results for each taxon are covered in detail within each species’ individual discussion below.
109 110
Figure 9. The Maximum Likelihood phylogram based on rbcL and COX1 gene regions combined, showing the phylogenetic relationships within the Laurencia complex. The outgroup is the Norfophycus genus. The numbers above branches indicate bootstrap values inferred from 1000 ML bootstrap replicates. Values less than 50% are not shown, bold lines and * indicate full support (100%). Taxa with bold names and ^ are generitype sequences from type location material, and taxa with + are species sequences from type location material. Species and generic conclusions are indicated by solid bars on the far right of the tree. Branch lengths indicate amount of sequence change.
111 112
Figure 10. The Bayesian Inference phylogram based on rbcL and COX1 gene regions combined showing the phylogenetic relationships within the Laurencia complex. The outgroup is the genus Norfophycus. The numbers above branches indicate Bayesian inference posterior probabilities. Values less than 0.50 are not shown, bold lines and * indicate full support (1.00). Taxa with bold names and ^ are generitype sequences from type location material, and taxa with + are species sequences from type location material. Species and generic conclusions are indicated by solid bars on the far right of the tree. Branch lengths indicate amount of sequence change.
113 114
Figure 11. The Maximum Parsimony strict consensus phylogram based on rbcL and COX1 gene regions combined. The tree shows phylogenetic relationships within the Laurencia complex. The numbers above branches indicate bootstrap values inferred from 1000 MP bootstrap replicates. Values less than 50% are not shown, bold lines and * indicate full support (100%). Taxa with bold names and ^ are generitype sequences from type location material, and taxa with + are species sequences from type location material. Pairwise distances and absolute base pair differences between consecutive taxa are shown on a light grey ladder on the immediate right of the tree. Species and generic conclusions are indicated by solid bars on the far right of the tree. One parsimonious tree across seven islands, tree length=1505, CI=0.5548, HI=0.4452, CI excluding uninformative characters=0.4924, HI excluding uninformative characters=0.5076, RI=0.7311, RC=0.4056.
115 116 rbcL and rbcL-rbcS Spacer Combined
(Figures 12, 13, 14)
The resulting ML and BI phylogenies both included thirty-four sequences, and the MP analysis included forty-four sequences. All analyses included two downloaded Genbank sequences. The combined rbcL and rbcL-rbcS spacer sequence contains 1571bp, of which 385 characters are parsimony informative. The rbcL-rbcS spacer is a non-coding region, therefore mutations are not deleterious and are preserved more often than they are in coding regions. This allows for a clearer separation between closely related taxa, such as species. Pairwise distances in the MP analysis using both the rbcL and rbcL-rbcS spacer combined, tend to be more exaggerated than the distances in the analysis using rbcL only. Pairwise distances between taxa are indicated on the MP tree in Figure 14.
In the resulting phylogenies, the Laurencia genus is well supported (ML bootstrap = 97%, BI posterior probability = 1.00, MP bootstrap = 100%), as are the Yuzurua, Chondrophycus and
Norfophycus genera. However, the Norfophycus clade consistently appears outside of the Laurencia complex in these analyses, indicating perhaps too few outgroups were included.
Unfortunately, there is a lack of rbcL-rbcS spacer region sequences and so no others were available to include.
The molecular results for each taxon are covered in detail within each species’ individual discussion below.
117 118 C. cartilagineous
Figure 12. The Maximum Likelihood phylogram based on rbcL and rbcL-rbcS spacer gene regions combined, showing the phylogenetic relationships within the Laurencia complex. The numbers above branches indicate bootstrap values inferred from 1000 ML bootstrap replicates. Values less than 50% are not shown, bold lines and * indicate full support (100%). Taxa with bold names and ^ are generitype sequences from type location material, and taxa with + are species sequences from type location material. Solid bars on the right of the tree indicate species and generic conclusions. Branch lengths indicate amount of sequence change.
119 120 C. sp. C. cartilagineous
Figure 13. The Bayesian Inference phylogram based on rbcL and rbcL-rbcS spacer gene regions combined showing the phylogenetic relationships within the Laurencia complex. The numbers above branches indicate Bayesian inference posterior probabilities. Values less than 0.50 are not shown, bold lines and * indicate full support (1.00). Taxa with bold names and ^ are generitype sequences from type location material, and taxa with + are species sequences from type location material. Solid bars on the far right of the tree indicate species and generic conclusions. Branch lengths indicate amount of sequence change.
121 122 YM005 Laurencia majuscula
Figure 14. The Maximum Parsimony strict consensus phylogram based on rbcL and rbcL-rbcS gene regions combined. The tree shows phylogenetic relationships within the Laurencia complex. The numbers above branches indicate bootstrap values inferred from 1000 MP bootstrap replicates. Values less than 50% are not shown, bold lines and * indicate full support (100%). Taxa with bold names and ^ are generitype sequences from type location material, and taxa with + are species sequences from type location material. Pairwise distances and absolute base pair differences between consecutive taxa are shown on a light grey ladder on the immediate right of the tree. Species and generic conclusions are indicated by solid bars on the far right of the tree. 144 parsimonious trees across 133 islands, tree length=1080, CI=0.5556, HI=0.4444, CI excluding uninformative characters=0.5052, HI excluding uninformative characters=0.4948, RI=0.8048, RC=0.4471.
123 124 Morphological Observations and Taxonomic Conclusions
Laurencia sensu lato
Key to the Laurencia complex genera that occur in NSW 1 a. Epidermal cell origin of tetrasporangia Norfophycus b. Pericentral cell origin of tetrasporangia 2
2 a. secondary pit connections present between epidermal cells in 3 longitudinal sections b. secondary pit connections absent between epidermal cells in longitudinal Chondrophycus sections
3 a. Compressed thallus AND extensive secondary cortication in supporting Coronaphycus branches present b. Compressed thallus AND extensive secondary cortication in supporting Laurencia branches absent
Table 23. The morphological key to the genera of the Laurencia complex that occur in NSW, Australia.
125 126 Laurencia sensu stricto
Key to the Laurencia sensu stricto species occurring in NSW 1 a. Compressed thallus at some part of plant 2 b. Terete thallus throughout 4
2 a. Lenticular thickenings present 3 b. Lenticular thickenings not present, branching distichous alternate, with Laurencia queenslandica the widest point of axis at apex.
3 a. Discoid holdfast, tetrasporic branchlets often branching into threes, Laurencia calliptera compression relatively even along main axes. b. Basal crust holdfast, palmate branching seen in parts, widest part of Laurencia concinna main axes upper third of branch.
4 a. Percurrent axis present 5 b. Percurrent axis absent Laurencia venusta
5 a. Thallus stiff, sturdy, and cartilaginous Laurencia decussata b. Thallus flaccid and soft 6
6 a. Lower branches longer than branches more apical on all orders of Laurencia dendroidea branching creating pyramidal shape thallus, small ultimate ramuli present on every branching order b. No pattern to branching, with branches evenly spaced along supporting Laurencia elegans branch
Table 24. The morphological key to the Laurencia species occurring in NSW, Australia.
127 128 Laurencia calliptera Kutzing
Laurencia calliptera Kutzing (1865:24), Millar and W.F. Prud'homme van Reine 2005:542.
As Laurencia brongniartii sensu Millar 1990:463 Fig.74A-E. Yamada 1931:241. Saito and
Womersley 1974:839 Fig. 4C, 4D, 20, 21.
(Figures 16, 17, 18)
TYPE LOCALITY: New Caledonia
TYPE SPECIMENS: Holotype: Laurencia calliptera Vieillard #1932, Leiden L 941, 119-53
(barcode L 0194035) (Millar and Prud'homme van Reine 2005: 542).
SPECIMENS EXAMINED: Laurencia calliptera (type) L 0194035. NSW: Arrawarra YM68,
YM71, YM74. Valla Beach YM134-137. Norfolk Island YM295
DNA VOUCHERS: YM68, YM295
DISTRIBUTION: (Figure 15) NSW: Arrawarra, Valla Beach, Norfolk Island (this study). Coffs
Harbour (Millar 1990). AUSTRALIA: NSW (Millar 1990, this study). WORLD: New Caledonia
(Kutzing 1865, Millar and prud’Homme van Reine 2005)
Figure 15. The distribution of Laurencia calliptera in NSW is indicated by grey coastal shading. It includes a portion of the northern coast of NSW and Norfolk Island. The inset shows Australian-wide distributions, which includes some of South Australia. The type location is New Caledonia.
129 HABITAT and SEASONALITY:
In NSW Laurencia calliptera occurs intertidally to 20.8m subtidally. It is epilithic, found with filamentous red algae and corals on rock boulders, rock walls and cliffs. Tetrasporic plants were collected in winter (June to August), carposporic plants were collected in summer (December to
February) and sterile plants were collected in autumn (March to May). Spermatangial plants were not found.
HABIT: (Figures 16, 17)
Plant colours range from bright red to faded, light red. Plant sizes range from 3.3 – 15.0cm in height, and 1.1 – 13.7cm in width. Branches are compressed with wide main axes, particularly at apices (Figure 17). Branching is distichous, alternate to opposite. Many ultimate branchlets are generally long and single, particularly at the base of main branches (Figure 17A). When ultimate branchlets undergo branching they are usually branched in threes (Figure 17B). Ultimate branchlets at apices are close together, but not completely apressed to main supporting branch or each other. Ultimate branchlets are usually compressed unless fertile, then they are terete. Also longer, older single branchlets may be terete as well. Angles between branches are 45-degrees throughout plant. Branching orders range from three to five. Most plants have more than one percurrent axis. The holdfast is discoid. Adherence to paper upon drying is not strong. Some fouling occurs, particularly with encrusting red algae and encrusting bryozoans.
VEGETATIVE STRUCTURES: (Figure 18)
Branches are compressed, particularly main axes, however all branch orders show some degree of compression, even tetrasporic ultimate branchlets, although they can be terete also. Lenticular thickenings are present (Figure 18C, F). They are abundant, large and thick, and present in all
130 phases and even seen in type material. They are particularly well pronounced in old growth material. Secondary pit connections between epidermal cells are present when viewed in longitudinal section (Figure 18H). Four pericentral cells are cut off from each main axial cell.
Apical pits range from wide to narrow, but usually shallow in depth. Epidermal cells are square shaped, and are isodiametric, being the same shape in both longitudinal and transverse section, however near the apical pit in longitudinal section they tend to elongate (Figure 18A, G). No epidermal projection is seen, even near the apical pit. The apical cell averages 7um along the longest axes. Epidermal cells in longitudinal section average 27um diameter, and in transverse section average 25um in diameter.
TETRASPORIC: (Figures 17, 18)
Tetrasporic plants are the largest of those collected, averaging 13cm tall and 9.8cm wide.
Branches are compressed and alternate distichous. Often a very regular pyramidal pattern is seen in overall branching shape, particularly near apices of main branches. Angles between branches are roughly 45-degrees. Angles between ultimate branchlets and their supporting branch are usually less than 45-degrees (Figure 17B). Fertile branchlets are compressed to terete and often arranged in triads at the end of a very small branch (Figure 17F). They tend to be distichous but not strictly. Although they are branched and frequently look compound, they are in fact single because tetraspores are not ‘shared’ among branchlets but contained within only one branchlet
(Figure 17F). Tetraspores develop from fertile pericentral cells, in a parallel arrangement in relation to the main axial row (Figure 18A). An average diameter for tetraspores is 100um.
MALE:
Male plants were not observed.
131 FEMALE: (Figures 17, 18)
Carposporic plants are the smallest observed, averaging 3.8cm tall and 2.7cm wide. Branching is usually up to three branching orders, again alternate distichous and compressed. Cystocarps are born singly on the end of a single branchlet, sometimes with a small protective branchlet (Figure
17E). Branch angles range from 45 to 90-degrees. Cystocarps reach lengths of up to 0.8mm long. The ostiole is slightly protruding. Cystocarps average 98um long and 139um wide, and have a narrowly ovate shape.
MOLECULAR RESULTS: rbcL Only (Figures 6, 7, 8)
In the molecular analyses there are two NSW samples morphologically identified as Laurencia calliptera (see concluding remarks). Sequences from these two samples form a single clade that is well supported and within the genus Laurencia sensu stricto (ML bootstrap = 100%, BI posterior probability = 1.00, MP bootstrap = 100%). The L. calliptera clade is closely associated with L. queenslandica, Laurencia sp1 and Laurencia sp2 and althought the larger clade containing all these taxa has strong support, relationships between the four species clades have weak support (ML bootstrap = 59%, BI posterior probability = 0.87 and MP bootstrap = unsupported). Pairwise distance from the nearest taxon is large enough to justify separation at the species level (pairwise distance = 3.27%).
rbcL and COX1 Combined, and rbcL and rbcL-rbcS Spacer Combined (Figures 9 - 14)
These results support the separation of Laurencia calliptera from other taxa at a species level. The
L. calliptera clade is consistently on its own except for in the MP analysis (rbcL and spacer
132 combined) where it shows as sister to the Laurencia sp1 sequence. This sister relationship however, is unsupported.
Of the four taxa that group together (L. calliptera, L. queenslandica, Laurencia sp1 and Laurencia sp2),
L. calliptera is the only one that has good evidence as a separate taxon, particularily supported by pairwise distances (Figure 8). This clear separation of the L. calliptera clade, along with the close pairwise distances between the other three taxa (L. queenslandica, Laurencia sp1 and Laurencia sp2) could suggest the other three be grouped together as one taxon, however, this would result in a polyphyletic grouping. To maintain monophyly, all four taxa remain separate species and this conclusion is supported by morphological observations as well.
Also present in these analyses are sequences from type location material for the following species; Laurencia brongniartii, Laurencia complanata, and Laurencia grevilleana. All these species display compressed thalli as well. The molecular evidence supports the continued separation of
L. calliptera from these other compressed species.
CONCLUDING REMARKS FOR LAURENCIA CALLIPTERA:
Specimens of Laurencia calliptera from NSW agree well with Vieillard’s type from New Caledonia, particularly when comparing apices of main branches. Of all the flattened species of the
Laurencia genus occurring in NSW, L. calliptera is distinct in having very broad apices that narrow slightly proximally. Records of L. brongniartii from South Australia cited by Saito and Womersley
1974 and Womersley 2003, and from Coffs Harbour, NSW cited by Millar 1990, are Laurencia calliptera.
133 Figure 16. Habits of Laurencia calliptera from NSW. Scale bar = 2cm.
(A) A sterile plant (YM295) collected subtidally at Norfolk Island.
(B) A tetrasporic plant (YM071) collected intertidally in northern NSW (Arrawarra Headland).
(C) The holotype of Laurencia calliptera collected by Vieillard (L 0194035).
(D) A cystocarpic plant (YM135) collected from central NSW (Valla Beach).
134
Figure 16. Habits of Laurencia calliptera from NSW. Scale bar = 2cm.
135 Figure 17. Branch details of Laurencia calliptera from NSW. Scale bar = 1mm.
(A) A sterile branch (YM295).
(B) A tetrasporic branch (YM071).
(C) A pressed carposporic branch (YM135).
(D) The detail of an apex of a sterile branch (YM295).
(E) The detail of a pressed carposporic branch (YM135).
(F) The detail of tetrasporic branchlets (YM071).
136
Figure 17. Branch details of Laurencia calliptera from NSW. Scale bar = 1mm.
137 Figure 18. Microscopic features of Laurencia calliptera from NSW.
(A) Longitudinal section of a tetrasporic ultimate branchlet. Scale bar = 100um.
(B) Longitudinal section through an apical pit, showing the apical cell (white arrow), the axial row
(black bracket) and a basal cell of a trichoblast developing off a central axial cell (black double arrow). Scale bar = 25um.
(C) Transverse section of type material showing large and abundant lenticular thickenings (black arrows). Scale bar = 100um.
(D) Longitudinal section through a cystocarp showing a delicate placenta and carpospores. Scale bar = 100um.
(E) Transverse section through a tetrasporic ultimate branchlet, showing compression of even reproductive branchlets. Scale bar = 100um.
(F) Transverse section through old growth material, showing abundant lenticular thickenings.
Scale bar = 100um.
(G) Transverse section through sterile material showing the squared shape of epidermal cells.
Scale bar = 25um.
(H) Longitudinal section showing the isodiametric nature of the epidermal cells, and the presence of secondary pit connections (black arrows). Scale bar = 25um.
138
Figure 18. Microscopic features of Laurencia calliptera from NSW.
139 140 Laurencia concinna Montagne
Laurencia concinna Montagne 1842, p.6; Lucas 1935:223 pl.ix Fig.1, Cribb 1958
As Laurencia brongniartii sensu Cribb 1983:114 pl.36, Fig.4., Yamada 1931: 240, pl.25 Fig.b., Millar
1999:522.
(Figures 20-23)
TYPE LOCALITY: Toud Island (Warrior Islet), Torres Strait, Australia
TYPE SPECIMEN: Type: Laurencia concinna P. Herbier Museum Paris Cryptogamie MA4037
SPECIMENS EXAMINED: LD Herbarium of J. Agardh Laurencia brongniartii (type) #37257,
#37258. P Herbier Museum Paris Cryptogamie Laurencia concinna (type) MA4037. NSW herb. H.
Deane. W. H. Harvey No.227A Laurencia grevilleana (type) NSW005005. NSW: Norfolk Island
YM226-YM229, YM245, YM246. Lord Howe Island YM324
DNA VOUCHERS: YM245, YM324
DISTRIBUTION: (Figure 19) NSW: Norfolk Island, Lord Howe Island. AUSTRALIA:
Queensland, NSW. WORLD: Not reported outside of Australia
Figure 19. The distribution of Laurencia concinna in NSW includes Lord Howe and Norfolk Islands. Inset shows distributions throughout Australia including the Southern Barrier Reef, as well as Torres Strait (arrow) the type location of L. concinna.
141 HABITAT and SEASONALITY:
All specimens of Laurencia concinna in NSW are subtidal down to depths of 3.5m, and are found on Lord Howe and Norfolk Islands. Substrates that plants were found on include rock and coral walls, rock boulders and coral bomboras surrounded by coarse coral sand. Water conditions that plants were collected in include sheltered lagoons and surge channels. Laurencia concinna in NSW is not epiphytic. Tetrasporic plants were collected in spring (September to November) and autumn (March to May). Sterile plants were collected in autumn only. Neither cystocarpic nor spermatangial plants were found.
HABIT: (Figures 20, 21)
Plants range from red to brown in colour and do not adhere to paper well when dried. Laurencia concinna displays four to five branching orders, and ranges from 5.5 - 9.3cm in height, and 4.5 -
12.4cm in width. The average height and width is 7cm. Plant texture is cartilaginous and tends to break very easily, particularly when freshly collected. The holdfast is a basal crust from which one or sometimes multiple primary percurrent axes arise. If one then often this primary axis branches immediately. Often ‘palmate’ branching seen near apex of larger branches (Figure
20G). The angles between branches and ultimate ramuli are 45 to 90-degrees. The angles between main axis and branches range from >45 to 90-degrees. Most plants collected had some fouling by encrusting coralline red algae. Sterile plants have opposite distichous branching, often with single ultimate ramuli that are spaced widely along the supporting branch. They often show less branching orders than fertile plants and have branches that are shaped somewhat like saw blades (Figure 21B, E). On the other hand tetrasporic plants often have more densely growing ultimate ramuli on one or two more orders of branching (usually 5) and generally form a more pyramidal outline (Figure 21A, C, D, F).
142 VEGETATIVE STRUCTURES: (Figures 22, 23)
Lenticular thickenings are present, are relatively large, and frequent (Figure 23E). Corps en cerise were not looked for in fresh material and were not observed in preserved material. The main branches are often compressed, particularly from midpoint to apex, and show opposite branching in one plane. Often the ultimate branchlets become terete, particularly the fertile ones. Ultimate branchlets show opposite distichous branching and form a pyramidal shape along the supporting branch. Secondary pit connections are seen between epidermal cells in longitudinal section (Figure 23D). In sterile material, epidermal cells do not project near the apical pit, and the outline of branchlets are not undulating (Figure 22B). The apical cell is up to
9.6um in length. The apical pits are shallow and narrow. Both long and short celled trichoblasts emerge from the apical pit and are dichotomously branched. They are not densely packed together (Figure 22A). Each axial cell cuts off four pericentral cells (Figure 23A). In longitudinal sections epidermal cells are varied in shape, ranging from narrowly oblong near the apex to square or slightly elongated longitudinally (transversely oblong) from mid to base of the branchlet. In transverse sections epidermal cells are oblong, slightly radially elongated but are not palisade like. Their sizes average 23um long by 16um wide.
TETRASPORIC: (Figures 22, 23)
Tetrasporic plants are slightly larger than sterile plants, with sizes ranging from 8 - 9.3cm in height and 6.2 - 12.4cm in widths. Unlike in sterile material, in fertile branchlets the outline of the ultimate ramuli is undulating and the apical pit is shallow and wide (Figure 22A, C, E).
Fertile branchlets often show opposite distichous branching but can grow in tight, small clusters that break the distichous pattern, and fertile ramuli then grow in any direction. Branch angles range from 45 to 90-degrees but are mostly 45-degrees. Fertile branchlets show epidermal cells
143 that rarely or only slightly project, even near the apical pit. In this reproductive phase there are usually many long trichoblasts emerging from the apical pit. Fertile ramuli are single, and tetraspores are contained within one branchlet regardless of how many are clustered together.
Fertile ramuli can be single and long near the base of the supporting branch but become shorter towards the branch apex. Tetraspore development is parallel to the axial row, although sometimes this is difficult to see due to short length of fertile branchlets (Figure 22C).
Tetraspores have a pericentral cell origin, with two sterile pericentral cells per tetrasporangial axis
(Figure 23A, B). The average size of mature tetraspores is 112 um in diameter.
MALE:
Spermatangial plants not observed.
FEMALE:
Cystocarpic plants not observed.
MOLECULAR RESULTS: rbcL Only (Figures 6, 7, 8)
There are three critical sequences present in these molecular analyses when looking at Laurencia concinna.; Laurencia brongniartii, Laurencia complanata and Laurencia grevilleana. All three are sequenced from type locality material and as such they can be used as legitimate definitions of that species.
These topotype sequences are critical because, along with L. concinna, L. complanata and L. grevilleana have been placed in synonymy with Laurencia brongniartii, in various combinations.
144 Also included in the analyses are two sequences from NSW material. These are identified by morphological comparisons with type specimens as Laurencia concinna. Laurencia concinna currently is regarded as conspecific with Laurencia brongniartii. The two L. concinna sequences from NSW are the same taxon, as seen by the small sequence divergence (0bp). In the MP analysis L. brongniartii and L. concinna form a moderately supported clade (MP bootstrap = 71%). The pairwise distances between the three sequences indicate a close relationship, if not conspecificity
(Pairwise distance = 1.72%). On the other hand, in both the ML and BI analysis the clade containing the L. concinna and L. brongniartii sequences also includes a fourth sequence; Laurencia complanata. Laurencia complanata is currently regarded as a separate species from L. brongniartii.
This clade has varying degrees of support (ML bootstrap = 64%, BI posterior probability =
1.00). In the MP analysis, L. complanata from South Africa does not group with L. brongniartii from the Caribbean, or with the L. concinna samples from NSW. The pairwise distances between
L. complanata and the others is large enough to justify it being a separate species (L. complanata vs.
L. concinna = 3.95%, L. complanata vs. L. brongniartii = 4.41%). Although it seems that the quick heterogeneous divergence of L. complanata seen in the ML and BI analyses is confounding parsimony, in both cases L. complanata is supported as separate from L. brongniartii. Therefore, to maintain monophyly the three taxa are recognized as separate species; L. brongniartii from the
Caribbean, L. complanata from South Africa and L. concinna from NSW.
Currently regarded as conspecific with L. brongniartii is L. grevilleana from Western Australia.
Laurencia grevilleana is also present in this analysis, however, across all three analyses it is separate from the other three species, L. brongniartii, L. concinna and L. complanata and is therefore supported as a distinct species. Of all four of these species only Laurencia concinna occurs in
NSW.
145
rbcL and COX1 Combined, and rbcL and rbcL-rbcS Spacer Combined (Figures 9 - 14)
In all these analyses the L. brongniartii and L. concinna sequences form a well supported clade with no other taxa included (rbcL and COX1 ML bootstrap = 98%, BI posterior probability = 1.00,
MP bootstrap = 98%) ((rbcL and spacer ML bootstrap = 98%, BI posterior probability = 1.00,
MP bootstrap = 93%)). Unfortunately, neither the COX1 sequence nor the rbcL-rbcS spacer sequence for L. complanata was available, therefore, these analyses could not give more information on its relationships between L. brongniartii and L. concinna. Laurencia grevilleana on the other hand is included and in all analyses was separate from L. concinna and L. brongniartii. These analyses therefore support the separation of Laurencia grevilleana as a distinct species.
CONCLUDING REMARKS FOR LAURENCIA CONCINNA:
What we have in NSW on Lord Howe and Norfolk Islands morphologically matches Laurencia concinna Montagne well, particularly in dimensions of habits, plant sizes and branch widths.
The type location for this species is northern Australia, in Torres Straight. Both the type and the NSW samples show mainly opposite to subopposite branching, with patent branches.
Often there is a palmate shaped triad of branches at the ends of main branches (Figure 20G).
In the molecular analyses of this study the NSW Laurencia concinna samples nest with the topotype of L. brongniartii, however, where the sequence of L. complanata is included in the analyses the three taxa form one clade. Laurencia complanata is a supported and currently recognized species, therefore, the L. concinna and L. brongniartii taxa must be recognized as distinct species to maintain monophyly (see Molecular Results above). In comparing the topotype specimens of Laurencia brongniartii and Laurencia concinna, there are morphological differences supporting their separation
146 including; L. brongniartii is larger and more fully branched than L. concinna, and has one main axis from which all other branches arise whereas Laurencia concinna is smaller, with multiple main axes; the secondary branches in L. brongniartii tend to be shorter near the base and longer near the apex of the main axis whereas in L. concinna no such pattern is observed; and in general the ultimate branchlets in L. concinna are much shorter and wider than in L. brongniartii. Therefore, with both molecular and morphological evidence, Laurencia concinna is here considered a distinct species, and is confirmed in NSW.
Cribb (1958) reports L. concinna from southern Queensland, and includes as synonyms L. calliptera and L. grevilleana. Cribb’s report seems to match L. concinna, which is shown in this research to be separate from L. calliptera, as well as L. grevilleana, therefore his reported distribution is regarded as
L. concinna only. In his 1983 report, Cribb describes L. brongniartii from the Southern Great
Barrier Reef, Queensland. His description and drawings match the type for L. concinna well, therefore this reported distribution is also regarded as L. concinna. Records of L. brongniartii cited by Millar 1999 are Laurencia concinna as well.
Laurencia grevilleana has been considered conspecific with the earlier L. brongniartii by previous researchers based on morphological characters (Saito and Womersley 1974). However, in the molecular analyses the topotype sequence for L. grevilleana does not nest with or near the topotype sequence of L. brongniartii. The two topotypes are also separated by a pairwise distance of 3.65% (rbcL MP). Historically there was morphological support for keeping these two species separate. Yamada (1931) argued that Laurencia grevilleana was a good species, separating it from
L. brongniartii by its soft frond. He also notes that L. brongniartii has few lenticular thickenings whereas L. grevilleana has none. Molecular evidence supports the separation of the two taxa, and
147 it is therefore concluded that L. grevilleana is a good, independent species from L. brongniartii.
According to the results of this study L. grevilleana is not present in NSW.
Traditionally Laurencia brongniartii J. Agardh has been widely recorded from Australia as the common, compressed Laurencia species. Based on molecular results that include L. brongniartii from the Caribbean, it is unlikely that this species occurs in Australia. Laurencia concinna, L. calliptera and L. grevilleana that were considered conspecific with L. brongniartii, are now recognized as separate species.
148 149 Figure 20. Habits of Laurencia concinna from NSW. Scale bar = 2cm.
(A) Habit of a tetrasporic plant (YM324) collected subtidally at Lord Howe Island.
(B) Habit of a tetrasporic plant (YM245) collected subtidally at Norfolk Island.
(C) Habit of a sterile plant (YM292) collected subtidally at Norfolk Island.
(D) Habit of a sterile plant (YM226) collected subtidally at Norfolk Island.
(E) Holotype of Laurencia grevilleana NSW005005 W.H.Harvey No. 227A.
(F) Holotype of Laurencia brongniartii LD#37257 J.Agardh
(G) Holotype of Laurencia concinna PC #MA4037. The arrow indicates palmate branching.
150
Figure 20. Habits of Laurencia concinna from NSW, and holotypes. Scale bar = 2cm.
151 Figure 21. Branch details of Laurencia concinna from NSW. Scale bar=2mm
(A) Apex of a tetrasporic branch showing prolific trichoblasts (white arrows) (YM245).
(B) Apex of a sterile branch (YM292).
(C) The base of a tetrasporic branch, showing longer, single fertile branchlets (white arrows)
(YM245).
(D) Tetraspore detail (white arrows) (YM245).
(E) Sterile branchlets detail (YM292).
(F) Tetrasporic branchlets details (YM245).
152
Figure 21. Branch details of Laurencia concinna from NSW. Scale bar=2mm
153 Figure 22. Microscopic features of Laurencia concinna from NSW. Scale bar = 100um.
(A) Longitudinal section through a tetrasporic ultimate branchlet, showing trichoblasts developing within the apical pit and growing out of the pit. Apical pit is shallow and wide.
(YM245).
(B) Longitudinal section through a sterile branchlet showing a deeper apical pit and less undulating profile than tetrasporic branchlets. (YM292).
(C) Longitudinal section through a tetrasporic ultimate branchlet showing a highly undulating profile. (YM245).
(D) Transverse section through a sterile ultimate branchlet showing oblong epidermal cells.
(YM292).
(E) Transverse section through a tetrasporic ultimate branchlet showing many tetraspores and undulating profile of branchlet. (YM245).
154
Figure 22. Microscopic features of Laurencia concinna from NSW. Scale bar = 100um.
155 Figure 23. Microscopic features of Laurencia concinna from NSW. Scale bar = 25um.
(A) Transverse section through a tetrasporic branchlet showing central axial cell (a), two fertile pericentral cells (pf) and two sterile pericentral cells (ps) (YM245).
(B) Longitudinal section through a tetrasporangial branchlet showing the apical pit, central axial row (ar) and developing tetraspore (t). Tetraspore has a pericentral origin (pf) and two pre- sporangial cover cells (pr) (one out of focus) which are in a horizontal alignment when viewed from the surface (YM245).
(C) Longitudinal section through an ultimate branchlet showing the apical cell (white arrowhead) and elongated cortical cells near apex that do not project (YM292).
(D) Longitudinal section showing epidermal cells and secondary pit connections (black arrows)
(YM292).
(E) Transverse section through a branchlet showing two large lenticular thickenings (black arrows) (YM292).
156
Figure 23. Microscopic features of Laurencia concinna from NSW. Scale bar = 25um.
157 158 Laurencia decussata (A. B. Cribb) Metti stat. nov.
(Figures 25, 26, 27)
BASIONYM: Laurencia heteroclada Harvey forma decussata A.B.Cribb 1958:176-177 pl.11 Fig.1-3; pl. 12 Fig.1-4
TYPE LOCALITY: Miami, Queensland, Australia
TYPE SPECIMENS: Holotype: Fig. 16, BRI No.3.1 11.viii.1948 (Cribb 1958)
SPECIMENS EXAMINED: Laurencia heteroclada f. decussata (type) BRI No.3.1 11.viii.1948
(Cribb 1958). In NSW: Arrawarra Headland YM69, YM70, YM72, YM392, YM393. Jervis Bay
YM171, YM178, YM212.
DNA VOUCHERS: YM70, YM178
DISTRIBUTION: (Figure 24) NSW: Byron Bay, Yamba, Woolgoolga, Sydney, Tathra (Cribb
1958). Kiama, Lennox Heads, Emerald Beach, Woolgoolga, Arrawarra headland, Cronulla,
Bergmagui, Valla Beach, Newcastle, Bare Island, Jervis Bay. AUSTRALIA: Queensland (Cribb
1958), NSW (Cribb 1958, this study). WORLD: Not reported outside of Australia
Figure 24. The distribution of Laurencia decussata in NSW is indicated by grey coastal shading. The inset shows Australian-wide distributions. Other than NSW, it includes only the very southern end of Queensland. Arrow indicates type location.
159 HABITAT AND SEASONALITY:
Laurencia decussata was collected throughout NSW but was not found on either Norfolk or Lord
Howe Islands. It was collected from the lower intertidal to 9m subtidal, always on large rocky substrates such as rock shelves or very large boulders on wave-exposed shores or within turbulent waters. No plants were epiphytic. Plants were collected all year around. Tetrasporic material was collected in the winter (July to August), spring (September to November) and summer (December to February). Carposporic plants were collected in summer, and sterile material was collected in winter. Spermatangial material has not yet been found.
HABIT: (Figures 25, 26)
Most plants are dark red but colours range from light orange-red to dark purple. Plants sizes range from 2 - 7cm tall and 1.8 - 8.3cm wide, with heights commonly around 4.5cm. In general, subtidal plants were larger, averaging 6.4cm in height. Plants when alive are sturdy and do not adhere well to paper when pressed. Fouling by other organisms is common, most samples being covered by some combination of other algae, diatoms, bryozoans, bivalves and isopods (Figure
26F). The holdfast is composed of a densely tangled mass of stolons from which multiple uprights arise, most being percurrent (Figure 26A). Branching orders range from three to five, but commonly plants display four branching orders. Branches are terete and often columnar
(Figure 26B,C). Plants found in NSW are a good match with Cribb’s (1958) original description of the species from Queensland, although the NSW plants are generally slightly smaller (Figure
25).
160
VEGETATIVE STRUCTURES: (Figure 27)
In longitudinal sections, epidermal cells are oblong, averaging 10um wide and 18um long, however, in transverse sections epidermal cells are isodiametric to inversely triangular, averaging
14um in maximum width and length (Figure 27E). Secondary pit connections are seen between epidermal cells in longitudinal section. Epidermal cells are sometimes very slightly projecting at apices, but more often the branchlet shows only an undulating profile (Figure 27G). One corps en cerise is seen in surface cells and in trichoblast cells, none are seen in medullary cells (Figure
27D). Apical pits are shallow in depth and narrow-to-average in width, in relation to the size of the ultimate branchlets (Figure 27A). Moderate amounts of trichoblasts are present within the pit. Long and short celled trichoblasts are seen, both types are dichotomously branched (Figure
27C). In transverse sections, few lenticular thickenings are present (Figure 27H). Vegetative axial cells cut off four pericentral cells each.
TETRASPORIC: (Figures 25, 26, 27)
Tetrasporic plants are the largest compared to other phases, ranging from 2.4 – 7.0cm tall and
3.0 – 8.3cm wide. Tetrasporangial branchlets are often compound, numerous and densely grouped along the supporting branch in the upper portions of percurrent axes (Figure 26E).
Angles between branches and branchlets are extremely tight, with ultimate ramuli pressed against the supporting branches. The sizes of tetrasporangial ultimate ramuli range from 0.5 - 3.0mm long and 300 - 600um in diameter. Tetraspores show parallel development in relation to the central axis, and have a pericentral cell origin (Figure 27A). They reach up to 144um in diameter, and are connected to the supporting cell abaxially. Two sterile pericentral cells are seen on fertile axes. Tetraspore scarring was observed on some branchlets.
161
MALE:
Male plants were not observed.
FEMALE: (Figures 25, 26)
Cystocarpic plants range from 2 – 5.7cm tall and 2.5 – 4.3 cm wide and were collected both intertidally and subtidally to 9m. Up to four branching orders for subtidal specimens were observed. The ultimate branchlets are evenly distributed along secondary and tertiary branches at 45-degree angles or more (Figs. 25D, 26H). Fertile branchlets can be compound but most often they are single and bearing one cystocarp each (Figure 26F). Cystocarps are located at the upper third of branchlets and are widely ovate, almost circular, with ostioles that do not protrude. Cystocarps were seen up to 0.75mm long and 0.60mm in diameter. Carpospores are generally lanceolate, with a maximum observed length of 207um and diameter of 39um.
MOLECULAR RESULTS: rbcL Only (Figures 6, 7, 8)
Two specimens from NSW have been morphologically examined and match the type of L. heteroclada f. decussata. The sequences from the NSW samples form a fully supported clade within all three analyses (ML bootstrap = 100%, BI posterior probability = 1.00, MP bootstrap =
100%). Pairwise distances within this clade are extremely small (up to 0.29%). This is within species limits generally accepted for rbcL, indicating that the sequences of L. heteroclada f. decussata are the same species. In the MP analysis, the closest sequence to the L. heteroclada f. decussata clade is the topotype sequence of L. natalensis from South Africa. This relationship is strongly supported (MP bootstrap = 92%). Pairwise distance between L. heteroclada f. decussata and L.
162 natalensis is only 2.34%, which is only slightly higher than accepted species limits, but much larger than pairwise distances within the L. heteroclada f. decussata clade itself. In the ML and BI analyses however, the clade containing L. heteroclada f. decussata and L. natalensis contains a fourth sequence, the topotype sequence of Laurencia Pacifica. This clade is well supported (ML bootstrap
= 84%, BI posterior probability = 1.00) but pairwise distances between these four taxa indicate species level separations.
rbcL and COX1 Combined (Figures 9, 10, 11)
Using rbcL and COX1 combined gives very strong support for the L. heteroclada f. decussata clade
(ML bootstrap = 100%, BI posterior probabilities = 1.00, MP bootstrap = 100%). Only the BI analysis showed support for a sister clade. This sister clade is the larger clade including L. calliptera, L. composita, L. queenslandica and Laurencia sp1. There is some support for this relationship in the BI results (BI posterior probabilities = 0.89), however the other two analyses
(MP and ML) showed no support.
rbcL and rbcL-rbcS Spacer Combined (Figures 12, 13, 14)
The Laurencia heteroclada f. decussata clade is fully supported in all three analyses (ML bootstrap =
100%, BI posterior probabilities = 1.00, MP bootstrap = 100%). No sister clade relationships are supported except in the BI analysis, where the closest sister clade is the larger clade including
L. calliptera, L. composita, L. queenslandica and Laurencia sp1. There is very weak support for this relationship (BI posterior probabilities = 0.58).
163
CONCLUDING REMARKS FOR LAURENCIA DECUSSATA:
Samples from NSW morphologically match the type of Laurencia heteroclada f. decussata extremely well (Figure 25). Cribb described L. heteroclada f. decussata from Miami, south Queensland (Cribb
1958). He placed his Miami samples together with L. heteroclada, which was originally described by Harvey from Freemantle, Western Australia (1855), because of their similar holdfast, habitats, sizes, textures and clumping of upright axes. However, he described his taxa as a variety because of differences in distributions; L. heteroclada ranges from Redcliffe northwards, and L. heteroclada f. decussata from Miami southwards. He also kept them separate because in young axes the two plants have different branching structures. L. heteroclada f. decussata has ultimate branchlets pressed up to the supporting branch and narrow column-like branching, whereas L. heteroclada does not. In examining the NSW samples of Laurencia heteroclada f. decussata some morphological features were seen that support their separation from Laurencia heteroclada including; the ultimate branchlets that are much longer and stand further out from their supporting branch in L. heteroclada than in L. heteroclada f. decussata; the lower order branches are longer in L. heteroclada than in L. heteroclada f. decussata; the ultimate branchlets are short, usually single and pressed close to their supporting branch in Laurencia heteroclada f. decussata and not in L. heteroclada.
Cribb (1958) suspected that L. heteroclada and L. filiformis have much in common and could be the same, polymorphic species, (along with L. forsteri and L. scoparia). Saito and Womersley (1974) agreed and moved L. heteroclada to be L. filiformis f. heteroclada based on morphological comparisons. In moving L. heteroclada to L. filiformis, Saito and Womersley (Saito and Womersley
1974, Womersley 2003) did not move L. heteroclada f. decussata, and it still stands as a currently accepted form of L. heteroclada. In this study, some critical morphological differences between L.
164 filiformis and L. heteroclada f. decussata were observed. Laurencia filiformis has irregularly radial, lateral branching and long, widespread branchlets that are usually sparse unless reproductive; L. heteroclada f. decussata has usually compact, short branchlets that are pressed close to the supporting branch, particularly along lower order branches. Laurencia heteroclada f. decussata does not agree with the type or with recorded descriptions of L. filiformis and cannot be justified moving to L. filiformis. Recently, Masuda (1997) separated L. heteroclada and L. filiformis because of differences in number of axes arising from the holdfast, holdfast type, lenticular thickenings, and differences in halogenated secondary metabolites. Wynne et al (2005) agreed with Masuda’s conclusions and considered the two species as distinct based on lenticular thickenings and number of axes arising from the holdfast.
In conclusion, Laurencia heteroclada f. decussata has branching development and structures different from both Laurencia heteroclada and Laurencia filiformis. These differences are comparable to the differences between L. heteroclada and L. filiformis that justify their continued separation.
Therefore, L. heteroclada f. decussata is here separated from both at a species level as Laurencia decussata.
165 Figure 25. The habits of Laurencia decussata from NSW. Scale bar = 2cm.
(A) Habit of a sterile plant (YM72) collected intertidally in northern NSW (Arrawarra
Headland).
(B) Habit of cystocarpic thallus (YM212) collected intertidally from southern NSW (Jervis
Bay).
(C) Habit of tetrasporic plant (YM392) collected intertidally in northern NSW (Arrawarra headland)
(D) Habit of cystocarpic thallus (ym171) collected subtidally at 9m in southern NSW (Jervis
Bay)
(E - F) Habit of isotypes of Laurencia heteroclada f. decussata (BRI No.3.1 11.viii.1948 (Cribb
1958))
166
Figure 25. Habits of Laurencia decussata from NSW, and isotypes
167 Figure 26. Branch details of Laurencia decussata from NSW. Scale bar = 1mm
(A) The lower portion of a whole plant detailing the stoloniferous holdfast. (YM69)
(B) The upper portion of a sterile branch showing ultimate branchlets closely pressed to the supporting axis. (YM69)
(C) The general branching pattern of a sterile plant. (YM69)
(D) Detail of tetrasporic ultimate branchlets. (YM393)
(E) The general branching pattern of a tetrasporic plant. (YM393)
(F) Detail of cystocarps. (YM212)
(G) Detail of cystocarpic ultimate branchlets. (YM212)
(H) The general branching pattern of a cystocarpic plant. (YM212)
168
Figure 26. Branch details of Laurencia decussata from NSW.
169 Figure 27. Microscopic features of Laurencia decussata from NSW.
(A) Longitudinal section through a tetrasporic ultimate branchlet, showing parallel arrangement of tetraspores, undulating profile of branchlet and narrow apical pit (YM393). Scale bar =
100um.
(B) Transverse section through a tetrasporic ultimate branchlet showing size of tetraspores compared to diameter of branchlet (YM393). Scale bar = 100um.
(C) Both long and short trichoblasts emerge from apical pit (YM69). Scale bar = 25um.
(D) Surface image showing one to two corps en cerise per epidermal cell (YM69). Scale bar =
15um.
(E) Transverse section through an ultimate branchlet showing cortical cell shapes and medullary cells with thickened cell walls (YM392). Scale bar = 25um.
(F) Longitudinal section showing the apical cell within an apical pit, and the axial row (YM393).
Scale bar = 25um.
(G) Transverse section showing the undulating profile of a branchlet near the apical pit
(YM392). Scale bar = 25um.
(H) Transverse section showing lenticular thickening (YM392). Scale bar = 25um.
170
Figure 27. Microscopic features of Laurencia decussata from NSW.
171 172 Laurencia dendroidea J. Agardh
Laurencia dendroidea J. Agardh 1852: 753
(Figures 29-32)
HOMOTYPIC SYNONYM: Laurencia obtusa var. dendroidea Yamada 1931:224 Millar and
Prud'homme van Reine 2005, Saito 1969: 150
TYPE LOCALITY: Brazil
TYPE SPECIMENS: Laurencia dendroidea J. Agardh LUND No. 36669 (Yamada 1931, although misquoted as #36696)
HETEROTYPIC SYNONYMS: Laurencia obtusa var. majuscula Harvey 1863. Tseng 1943: 200.
Yamada 1931:223, pl.16C. Laurencia majuscula (Harvey) A.H.S. Lucas 1935: 223.: Womersley
2003: 458, Fig.202,205A. Huisman 2000: 171, Cribb 1983: 120, pl.37. Lucas 1935: 223. Lucas and Perrin 1947: 249. Millar and Kraft 1993: 54, Saito and Womersley 1974: 819, Fig.1A,6.
Abbott 1999: 388, Fig.112G-H. Wynne et al 2005: 506, Fig.30,31. Saito 1969: 149.
HETEROTYPE SPECIMENS: Laurencia majuscula TCD (Herb. Harvey, Alg. Aust. Exsiccate.
236a) (Saito et Womersley. 1974). Laurencia majuscula NSW (Herb. Harvey, Alg. Aust. Exsiccate.
236b)
HETEROTYPE LOCALITY: Rottnest Island, Western Australia, Australia
SPECIMENS EXAMINED: Laurencia majuscula (type) Herb. Harvey, Alg. Aust. Exsiccate.
236a, 236b. WA: Rottnest Island JE05. NSW: Jervis Bay YM169, YM182, YM220, YM221.
Kiama YM5. Lord Howe Island YM322, YM329. Norfolk Island YM287, YM288
DNA VOUCHERS: YM5, YM288, YM322
173 DISTRIBUTION: (Figure 28) NSW: Arrawarra headland, Batehaven, Forster, Jervis Bay, Kiama
Harbour, Lord Howe Island, Norfolk Island. AUSTRALIA: Queensland (Cribb 1983), New
South Wales (Millar and Kraft 1993), Lord Howe Island (Lucas 1935, Millar and Kraft 1993),
Norfolk Island, Victoria (Womersley 2003), South Australia (Lucas and Perrin 1947, Womersley
2003), Western Australia (type locality, Saito 1969, Womersley 2003, Huisman 2000), Australia
(Yamada 1931). WORLD: USA-Hawaii (Abbott 1999, Saito 1969), Oman (Wynne et all 2005), tropical Pacific (Saito 1969), Ceylon (Yamada 1931), India (Yamada 1931), Hong Kong (Tseng
1943).
Figure 28. The distribution of Laurencia dendroidea in NSW is indicated by grey coastal shading. The inset shows Australian-wide distributions and it includes the majority of
the east coast, all of the south coast, Tasmania and the southern portion of WA. Arrow indicates type location of Laurencia majuscula. The type location of Laurencia dendroidea is Brazil. The range in WA most likely extends north but no published reports exist yet.
HABITAT and SEASONALITY:
In NSW, Laurencia dendroidea occurs intertidally to 20.8m subtidally, is found on rock platforms, rock substrates, and in intertidal rock pools. It is found in sheltered open coast sites and reef surge channels, and was collected in every season. Cystocarpic and tetrasporic plants were collected in spring (September to November), spermatangial plants collected in winter (June to
August), and all four phases were collected in the summer and fall (December to May).
174 HABIT: (Figure 29)
Plant colours range from dark red to orange-red to bright pink-red, but most are dark red colour with very few plants showing slightly green main axes. Sizes range from 2.8 - 17.8cm high and
2.0 - 21.0cm wide, which is somewhat smaller than the 5 - 30cm height reported in southern
Australian samples (Lucas and Perrin 1947, Womersley 2003). When dried it adheres well to paper, and when alive the plant texture is soft. Generally, the habit outline is pyramidal, particularly in higher branch orders (Figure 29, 31H). Branching orders range from three to five, but most commonly plants show three or four branching orders. All plants seen with five orders of branching were subtidal plants. Branching is radial and generally subternate. Percurrent axes are present. First and second order branching density is moderate. Third and fourth branching orders show generally aligned ternate branching. Ultimate ramuli are often densely branched, forming a pyramidal outline at branch ends. The holdfast is a basal crust from which one to few percurrent axes arise. Holdfasts often have stolons extending to the substrate. The amount of stolons formed varies from none to many. Fouling by other organisms is rare. Laurencia dendroidea has adventitious branchlets, which are ultimate ramuli that are unusually small and grow along every branch order in a seemingly random manner. This feature seems to be diagnostic of the species.
VEGETATIVE STRUCTURES: (Figures 32)
In longitudinal sections, the epidermal cells show secondary pit connections (Figure 32C).
Epidermal cells are slightly projecting at apices. Apical pit dimensions range from shallow-to- average depths and narrow-to-average widths when compared to the size of the ultimate branchlet. In transverse sections, no lenticular thickenings are present. Epidermal cells are
175 isodiametric to pyramidal in shape, ranging in size from 17 - 29um wide and 20 - 27um long.
Vegetative axial cells cut off four pericentral cells each (Figure 32E).
TETRASPORIC: (Figure 31)
Tetrasporic plants are the largest plants collected, ranging from 3.10 - 17.80cm high and 2.10 -
21.00cm wide. Ultimate branchlets measure 0.77 - 1.73mm long and 0.37 - 0.40mm diameter, and are generally longer than in other phases when compared to overall supporting branch length. Tetrasporic ultimate branchlets are simply or compoundly branched, showing profuse branching at branch ends (Figure 31A). They are long rectangular in shape and usually slightly undulated in outline. Tetrasporangial ultimate branchlets and penultimate branches show no tetraspore scarring. Tetraspores show parallel development and a pericentral cell origin.
MALE: (Figure 32)
Male plants range from 4.50 - 12.60cm high and 3.90 - 11.30cm wide. Generally, they are less profusely branched than other phases and show greater distances between ultimate branchlets.
Up to four orders of branching are seen but commonly plants show only three orders of branching. Spermatangial ultimate branchlets are simple or occasionally compoundly branched, and show a distinct widening at apices, resulting in a flattened pyriform shape. Spermatangia develop from fertile trichoblasts within a cup-shaped apical pit, and show an apical nucleus within spermatia. The single terminal vesicle is sterile and ovoid (Figure 32A, B).
FEMALE: (Figure 31)
Cystocarpic plants range from 3.40 - 17.00cm high and 2.30 - 21.00cm wide. Holdfasts for cystocarpic plants tend to exhibit more stoloniferous growth than other phases. The ultimate branchlets are small and tend to be densely grouped at ends of branches. Cystocarps are often abundant. Cystocarps were seen up to 1mm in diameter and are almost spherical with no protruding ostiole (Figure 31D, G).
176 MOLECULAR RESULTS: rbcL Only (Figures 6, 7, 8)
Present in the molecular analyses are sequences of topotype location material for Laurencia dendroidea from Brazil, Laurencia majuscula from Rottnest Island, WA, and Laurencia obtusa from
England, thereby giving a molecular definition for each of these species. Also present in the analyses are three sequences of NSW material. The three NSW sequences, the L. dendroidea sequence and the L. majuscula sequence form a well-supported clade within the genus Laurencia sensu stricto. This L. dendroidea clade has full support in all three analyses (ML bootstrap = 100, BI posterior probability = 1.00, MP bootstrap = 100%). Pairwise distances within the L. dendroidea clade are <1.41% and within accepted species limits. Currently L. dendroidea is known as L. obtusa var. dendroidea, but recent molecular work has shown the two taxa to be separated at the species level (Cassano et al, in press). This study supports these findings. In these results, the L. obtusa sequence does not nest with the L. dendroidea sequence in any analyses. In the MP analysis L. obtusa is within a sister clade to the L. dendroidea clade but this relationship has no support. As well, the pairwise distance between Laurencia obtusa and Laurencia dendroidea support a species level separation (pairwise = 5.72%). These molecular analyses support firstly that L. dendroidea is not a variety of L. obtusa, and secondly that L. dendroidea and L. majuscula are conspecific. With L. dendroidea being the earlier name the clade containing these two sequences is to be known as
Laurencia dendroidea. According to the results in this study L. dendroidea is present in NSW, and L. obtusa is not.
rbcL and COX1 Combined (Figures 9, 10, 11)
Only sequences from NSW material were included in these analyses since COX1 gene sequences are still unavailable for L. dendroidea from Brazil, L. majuscula from WA, and L. obtusa from
177 England. The L. dendroidea clade is well supported (ML bootstrap = 100%, BI posterior probability = 1.00, MP bootstrap = 100%). There are no supported sister clades to the L. dendroidea clade, however the L. brongniartii clade is consistently the closest.
rbcL and rbcL-rbcS Spacer Combined (Figures 12, 13, 14)
Not included in these analyses is the L. dendroidea sequence from Brazil since the spacer sequence is not yet available. In these analyses, the L. dendroidea clade contains the L. majuscula (W.A.) sequence and the L. dendroidea (NSW) sequences. This clade has high support (ML bootstrap =
100%, BI posterior probability = 1.00, MP bootstrap = 100%). The L. brongniartii clade is consistently the closest clade in all three analyses, however, there is no support for this relationship except in the BI analysis, with a moderate posterior probability of 0.62.
CONCLUDING REMARKS FOR LAURENCIA DENDROIDEA:
In the molecular analyses of this study, there are sequences of topotype location material for
Laurencia majuscula, Laurencia obtusa and Laurencia dendroidea. Laurencia dendroidea is currently recognized as L. obtusa var. dendroidea however molecular evidence shows it to be separate from
L. obtusa and is to be raised to specific rank (Cassano et al, in press) (Figures 6, 7, 8). L. majuscula was also placed as a variety of L. obtusa but Lucas recognized it as a species on its own, Laurencia majuscula (Lucas 1935). The molecular results from this study support Lucas’ conclusion that L. majuscula is not a variety of L. obtusa. Laurencia majuscula closely resembles L. dendroidea from
Brazil (J. Agardh 1876, Yamada 1931, Lucas 1935). J. Agardh himself noted that his L. dendroidea was the same as Harvey’s L. obtusa var. majuscula #236, which is one of the syntypes of L. majuscula. The molecular evidence shows these two to be conspecific (Figures 6, 7, 8) with L. dendroidea being the earlier name (J.Agardh 1852). According to both morphological and
178 molecular results L. majuscula and L. dendroidea are conspecific, within the genus Laurencia, and present in NSW.
Laurencia dendroidea is a well described and widely distributed species in NSW that is generally characterized by the presence of percurrent axes, projecting epidermal cells near the apices, lack of lenticular thickenings, and a pyramidal shape. Of particular note is the profuse amount of ultimate branchlets at branch apices that give L. dendroidea an overall full appearance particularly at branch apices. All plants show small, adventitious branchlets, some even reproductive, on all branching orders, particularly percurrent axes or primary branches. This was consistent across all
L. dendroidea plants found. All type material observed have these same adventitious branchlets along all branches. Laurencia dendroidea in NSW shows a wide range of morphologies, most likely due to variable environmental factors. Differences are seen in size, colouring, amount of holdfast stolons and number of percurrent axes. However, the general pyramidal shape, radial subternate branching of penultimate and ultimate branchlets, presence of adventitious small branchlets on all branch orders, and abundant branching at apices are consistent across observed specimens. The lack of lenticular thickenings was also consistent, however the projection of epidermal cells at the apices was not. Overall, samples in NSW match the isotypes well.
Laurencia majuscula var. elegans (AHS Lucas) Saito and Womersley, originally described from Lord
Howe Island as Laurencia elegans was subsequently considered a variety based on south Australian material (Saito and Womersley 1974). In the present study L. majuscula var. elegans was sampled from the type locality and included in the molecular analyses. This sequence is separate and distant from the topotype sequence of L. dendroidea with enough morphological evidence to justify reinstating it to species rank as L. elegans Lucas. Laurencia elegans occurs in NSW (see
Laurencia elegans).
179 Figure 29. Habits of Laurencia dendroidea from NSW. Scale bar = 2cm.
(A) Habit of a cystocarpic plant (YM329) collected subtidally at Lord Howe Island.
(B) Habit of a spermatangial plant (YM169) collected subtidally in southern NSW (Jervis Bay).
(C) Habit of a sterile plant (YM221) collected intertidally in southern NSW (Jervis Bay).
(D) Habit of a tetrasporic plant (YM288) collected subtidally at Norfolk Island.
(E-H) Isotypes of Laurencia majuscula, heterotypic synonym of Laurencia dendroidea Herb. Harvey,
Alg. Aust. Exsiccate 1855
(E) Syntype #236B TCD.
(F) Syntype #236A NSW005217.
(G) Syntype #236A TCD.
(H) Syntype #236B NSW.
180
Figure 29. Habits of Laurencia dendroidea from NSW, and isotypes. Scale bar = 2cm.
181 Figure 30. Habit of Laurencia dendroidea. Scale bar = 2cm.
(A) Laurencia dendroidea plant collected subtidally from Jervis Bay, southern NSW (YM182) showing similar features as L dendroidea holotype. Sterile plant.
(B) Laurencia dendroidea holotype LUND #36669.
182
Figure 30. Habit of Laurencia dendroidea. Scale bar = 2cm.
183 Figure 31. Branch details of Laurencia dendroidea from NSW. Scale bar = 1mm
(A) The general branching structure of a tetrasporic branch (YM329).
(B) The general branching structure of a male branch (YM169).
(C) Tetrasporic branchlets detail (YM329).
(D) Cystocarp detail (YM287).
(E) A sterile branch showing ‘adventitious branchlets’ (white arrows) found on all branch orders.
In reproductive phases these adventitious branchlets can become reproductive (YM182).
(F) Spermatangial branch detail (YM169).
(G) A cystocarpic branch (YM322).
(H) A sterile branch (YM182).
184
Figure 31. Branch details of Laurencia dendroidea from NSW. Scale bar = 1mm.
185 Figure 32. Microscopic features of Laurencia dendroidea from NSW.
(A) Longitudinal section through an ultimate branchlet, showing spermatangial trichoblasts developing within the apical pit (YM169). Scale bar = 100um.
(B) Longitudinal section through a spermatangial apical pit, showing spermatangia with apical nuclei (arrowheads), and a single terminal cell (full arrow) (YM169). Scale bar = 100um.
(C) Longitudinal section through an ultimate branchlet, showing the apical cell (white arrowhead), secondary pit connections (black arrows) and projecting cortical cells near apex
(YM220). Scale bar = 10um.
(D) Longitudinal section through an apical pit, showing the apical cell within the apical pit, the central axial row, and young sterile trichoblasts (YM220). Scale bar = 10um.
(E) Transverse section through an ultimate branchlet showing four pericentral cells (p) per axial cell (a) (YM220). Scale bar = 10um.
186 Figure 32. Microscopic features of Laurencia dendroidea from NSW.
187
188 Laurencia elegans A. H. S. Lucas
Laurencia elegans A. H. S. Lucas 1935: 222.
(Figures 34, 35, 36)
HOMOTYPIC SYNONYM: Laurencia majuscula (Harvey) var. elegans (A.H.S. Lucas) Saito and
Womersley 1974: 821, Womersley 2003: 459.
TYPE LOCALITY: Lord Howe Island, NSW, Australia
TYPE SPECIMENS: Laurencia elegans NSW Herb. Lucas NSW290587
SPECIMENS EXAMINED: Laurencia elegans (type) Herb. Lucas NSW290587, Norfolk Island
YM248, YM298. Lord Howe Island YM334, YM339, YM340, YM325, LHI13_carp,
LHI13_male. Jervis Bay YM213, YM223
DNA VOUCHERS: YM213, YM248, YM325, YM340
DISTRIBUTION: (Figure 33) NSW : Norfolk Island, Lord Howe Island, And Jervis Bay
AUSTRALIA : NSW, As Laurencia majuscula var. elegans: South Australia (Womersley 2003, Saito and Womersley 1974). WORLD: Not reported outside of Australia
Figure 33. The distribution of Laurencia elegans in NSW is indicated by grey coastal shading, and includes Lord Howe Island, Norfolk Island, and only Jervis Bay on the mainland. The inset shows Australian-wide distributions. Arrow indicates type location.
189 HABITAT AND SEASONALITY:
In NSW Laurencia elegans is found most commonly in the shallow subtidal, from 1 - 4m but can be found subtidally to 9m. It grows in rock pools and occasionally intertidally on rock shelves near sandy areas. It is often found floating entangled among seagrasses in very sheltered sandy bays. Laurencia elegans can be epiphytic as well, it is seen in NSW on Sargassum, Colpemenia and
Hormosira, as well as on odd substrates such as rope. Laurencia elegans was collected in spring, summer and autumn (September to May). Tetrasporic and sterile plants were collected in all three seasons, male and cystocarpic plants were collected in the spring only (September to
November).
HABIT: (Figures 34, 35)
Laurencia elegans usually has light or dark green axes, and bright red or dark red ultimate branchlets. Plant sizes range from 2.5 - 17.0cm tall and 3.0 - 23.5cm wide but are most commonly found around 8cm tall and 9cm wide. The holdfast is made up of stolons (Figure
34C) that can get extremely tangled amongst themselves, and collect debris such as large sand particles, small bits of rock, coral and shell fragments, and dead corallines. The stolons secondarily join to lower branches and branch bases in many places. When the plant grows intertidally, or subtidally in moving waters, the main axes stay short and the many stolons grow compact and entangled which results in a turf-like habit, or at least a very tangled and full- branched smaller plant. Often these compact versions will send out one to many long percurrent axes that stand out over the main body of the plant. Subtidally and in very calm waters main axes tend to become percurrent, with less stoloniferous growth. Percurrent axes are usually obscured when they are entangled with higher order branches. Branches from near the base of the main axes grow very long, and can reach the same length as the main axes from
190 which it grows. These tend to tangle into seagrasses in very calm bays, and help anchor floating
L. elegans. Branching occurs in all planes, is generally alternate distichous, including ultimate branchlets. Branches are evenly spaced along entire axes. In sterile material, all branching orders grow at or close to 90-degree angles. In gametophytes, ultimate branchlets can grow out at 90- degrees but bend towards the apex of the supporting branch. More often however, they grow at angles less than 90-degrees. Laurencia elegans is extremely variable in habit, with plants forming low-lying turf matts in the intertidal, to loosely tangled long-branched plants when growing in sheltered waters. Plants adhere well to paper when pressed. Fouling is usually limited to within the stoloniferous holdfast, and sometimes it is difficult to see if other organisms are fouling L. elegans or if it is the other way around.
VEGETATIVE STRUCTURES: (Figure 36)
Trichoblasts are dichotomously branched. In longitudinal sections, secondary pit connections are present and outer epidermal cells show moderate projection along the entire branchlet
(Figure 36A). The apical pits are deep and narrow. Branches are terete, but some ultimate branchlets in transverse sections show very slight compression. In longitudinal section, epidermal cells are rounded, and become elongated towards the apex. In transverse sections, epidermal cells range from 27 – 50um in diameter. Four pericentral cells are cut off the axial cell.
No lenticular thickenings are seen but in older material cell walls become thick and swollen
(Figure 36D). Plants show one corps en cerise per cell.
TETRASPORIC: (Figure 35)
In general, tetrasporic plants are the largest compared to other phases, ranging from 3.9 –
13.2cm tall and 4.9 – 20.0cm wide. Fertile ultimate branchlets are generally compound. Ultimate
191 branchlets form 45-degree angles with their supporting branch (Figure 35G). Tetraspores develop from pericentral cells, in parallel arrangement, and reach sizes of up to 90um in diameter. Tetrasporangia are connected to the supporting cell adaxially. No tetrasporic scarring is seen on ultimate branchlets after the tetraspores are released.
MALE: (Figure 36)
Male plants are the smallest of the phases and range from 4.8 – 5.1cm tall and 6.4 – 7.3cm wide.
The angles between ultimate branchlets and their supporting axes are often between 45 and 90- degrees. The branchlets tend to curve adaxially. Fertile male ultimate branches are usually simple. Spermatangia are formed from fertile trichoblasts within a cup-shaped apical pit.
Spermatangia develop an apical nucleus and measure up to 10um long and 5.9um wide (Figure
36C).
FEMALE: (Figure 35)
All cystocarpic plants found were subtidal and ranged from 4.0 – 8.4cm tall and 5.6 – 10.2cm wide. Cystocarpic ultimate branchlets are compound, with one or two cystocarps forming per branchlet (Figure 35C). Cystocarps measure up to a maximum of 1.2mm in diameter, and
1.3mm from base to tip of ostiole. Ostioles are only slightly protruding. The carpogonia are teardrop shaped and their sizes range from 148 – 200um long and 40 – 68um wide. They are often very numerous within the cystocarp and are joined to a squat placenta.
MOLECULAR RESULTS:
Incluced in these analyses are two sequences from type location material of Laurencia elegans, which is currently recognized as Laurencia majuscula var. elegans. Also included are; one sequence
192 of Laurencia majuscula from type location material, and one of Laurencia dendroidea from type location material. In all analyses Laurencia majuscula var. elegans has no supported relationship with either Laurencia majuscula or Laurencia dendroidea, which are conspecific (see L. dendroidea discussion). This indicates that L. majuscula var. elegans is not supported as a variety of Laurencia majuscula by molecular evidence, and is referred to in this study as Laurencia elegans.
As well as the two sequences of Laurencia elegans from type locality material (Lord Howe Island), there are also two other sequences from NSW plants. All four sequences group together to form the Laurencia elegans clade. This clade is a well-supported, distinct clade within the genus Laurencia and is seen in all phylogenetic results for rbcL, rbcL and spacer combined, and rbcL and COX1 combined.
Within the Laurencia elegans clade two smaller, closely related clades are consistently present. One clade includes samples from the two islands, Norfolk and Lord Howe Islands, and the other clade includes samples from Lord Howe Island and the mainland. Perhaps this split indicates two diverging populations, one on the islands, and one shared between the mainland and Lord
Howe Island. Further analyses with appropriate population methods are required to investigate this hypothesis, however, it is outside of the scope of the present study.
rbcL Only (Figures 6, 7, 8)
All three analyses are congruent in their support of the L. elegans clade (ML bootstrap = 99%, BI posterior probability = 1.00, MP bootstrap = 100%). Pairwise distances within the L. elegans clade in rbcL MP analysis range from 0% - 1.48% (0-21bp) which is within generally accepted species limits for rbcL. Interestingly the 1.48% is between the two clades within the L. elegans
193 group. Within each of the two smaller clades, pairwise distances are from 0% - 0.07%. The L. elegans clade does not consistently appear as sister clade to any one taxon. Interspecific pairwise divergences between L. elegans and its closest neighbouring clades are 6.00% - 6.71% (84 - 95bp).
rbcL and COX1 Combined, and rbcL and rbcL-rbcS Spacer Combined (Figures 9 - 14)
All analyses show L. elegans as a separate clade with strong support (ML bootstrap = 100%, BI posterior probability = 1.00, MP bootstrap = 100%). All results are also congruent in that the L. elegans clade does not nest with the topotype sequence of L. dendroidea, and there is no supported sister clade to L. elegans.
CONCLUDING REMARKS FOR LAURENCIA ELEGANS:
Overall, the plants found on Lord Howe and Norfolk Islands match the original description of
L. elegans by Lucas (1935) very well, particularly in branching patterns, branch diameters and overall size measurements, colour, and habitat. However, NSW specimens differ from Lucas’ description in cystocarp size, which is a minor detail considering cystocarp size will be dependent on what stage of development it was measured. Where Lucas reports 600um diameters, samples from this study have cystocarps up to 1200um diameter, however, many cystocarps smaller than
1200um are seen in the NSW material as well. Lucas’ description included only calm water plants collected on Lord Howe Island. Plants found on the mainland, or in rougher waters tended to be more profusely branched in the lower orders, with percurrent axes much shorter or absent, and overall showed much darker colours than plants found on Lord Howe Islands.
Plants growing in moving water tend to be shorter, with a much more intricate and developed holdfast.
194 Laurencia elegans is not a commonly found species in NSW, and seems generally limited to a narrow latitudinal band in Australia (Figure 33, inset). It was placed as L. majuscula var. elegans by
Saito and Womersley (1974) based on South Australian plants from sheltered localities, with a comment that they show characteristics of L. majuscula but without percurrent axes and with less prominent epidermal cell projection. Laurencia elegans and L. majuscula were collected by Lucas
(1935) from Lord Howe Island, and were considered by him to be separate species. By examining the type specimens and fresh collections of both L. elegans and L. majuscula, which is conspecific with L. dendroidea (see L. dendroidea discussion), morphological differences can be consistently seen, including:
A. Holdfast. Laurencia dendroidea (which is conspecific with L. majuscula) has a discoid holdfast with or without stolons emerging, whereas L. elegans has no discoid holdfast but instead has many stolons entangling with themselves and the substrate (usually seagrass, seaweeds, articulated coralline algae, or rocky substrates), with many reattachment sites along lower order branches.
B. Branching. Laurencia dendroidea branching is more structured when compared to L. elegans branching. Laurencia dendroidea has percurrent axes giving rise to much shorter secondary branches, and often a generally pyramidal shape is seen, particularly in the penultimate and ultimate branchlets. Ultimate branchlets are more densely grouped at the apical end of axes and are not usually evenly spreading along the supporting branch, and importantly, adventitious, tiny ultimate branchlets are present on all branch orders of the plant. Conversely, L. elegans tends to display less structured branching with no overall general pattern. Ultimate branchlets are more or less evenly spread along the supporting branch, and main branches grow in all directions.
Percurrent axes are not always present, but if present are usually obscured by entanglement with
195 long secondary branches. There is also a complete lack of adventitious ultimate ramuli along main axes, which is consistently found in L. dendroidea.
In summary, the L. elegans clade is well supported within all molecular results. Both L. dendroidea and L. elegans were sequenced from type locality material. Both formed well supported, distinctive clades within the Laurencia genus and are well separated from each other. RbcL interspecific pairwise distances are large enough to justify L. elegans as a separate taxon from any other in the phylogeny and intraspecific divergences are small enough to justify the two clades within L. elegans to be one species. Both morphologically and molecularly the separation of L. elegans from L. dendroidea (conspecific with L. majuscula) is justified, therefore Laurencia majuscula var. elegans is recognized at a species rank as Laurencia elegans AHS Lucas.
196 197 Figure 34. Habits of Laurencia elegans from NSW. Scale bar = 2cm.
(A) A cystocarpic plant (LHI13_carp) collected subtidally from Lord Howe Island.
(B) A tetrasporic plant (YM340) collected subtidally from Lord Howe Island.
(C) A spermatangial plant (LHI13_male) collected subtidally from Lord Howe Island.
(D) A sterile plant (YM334) collected subtidally from Lord Howe Island.
(E) The type specimen NSW 290587 from Lord Howe Island.
198
Figure 34. Habits of Laurencia elegans from NSW, including the holotype. Scale bar = 2cm.
199 Figure 35. Branch details of Laurencia elegans from NSW. Scale bar = 1mm.
(A) A sterile branch (YM334).
(B) A male branch (YM298).
(C) Detail of a cystocarpic branchlet (YM339).
(D) Detail of a male branchlet (YM298).
(E) Detail of a tetrasporic branchlet (YM340).
(F) A cystocarpic branch (YM339).
(G) A tetrasporic branch (YM340).
200
Figure 35. Branch details of Laurencia elegans in NSW. Scale bar = 1mm.
201 Figure 36. Microscopic features of Laurencia elegans in NSW. Scale bar = 100um.
(A) A longitudinal section through an ultimate branchlet showing projecting cortical cells (white arrows) and secondary pit connections (black arrows) (YM248).
(B) A transverse section through an ultimate branchlet showing slight compression and no lenticular thickenings (YM223).
(C) A longitudinal section through a fertile male ultimate branchlet showing the apical cell (white arrow), the apical row directly below it, and spermatangia developing within the apical pit
(YM298).
(D) A transverse section through old growth section of a main branch showing enlarged cell walls but no lenticular thickenings (YM339).
(E) A longitudinal section through a fertile tetrasporic ultimate branchlet showing parallel formation of tetraspores (YM340).
202 Figure 36. Microscopic features of Laurencia elegans in NSW. Scale bar = 100um.
203 204 Laurencia queenslandica (Cribb) Metti stat. nov.
(Figures 38-41)
BASIONYM: Laurencia pedicularioides Boergesen var. queenslandica Cribb (Cribb 1958 pg161. Pl.1
Fig.4-5; Pl. 13, Fig.3). NON - Laurencia pedicularioides Boergesen (=Osmundea pedicularioides
(Boergesen) Furnari et al 2004)
TYPE LOCALITY: Redcliffe, Queensland, Australia (Cribb 1958: 161).
TYPE SPECIMENS: Holotype (lost): A.B. Cribb; Redcliffe 16.ix.1955. Lectotype: BRI: AQ
712545 designated by G. Furnari, D. Serio. and M. Cormaci (Furnari et al 2004, pg.455. Fig. 1.)
SPECIMENS EXAMINED: Laurencia pedicularioides var. queenslandica (lectotype) BRI: AQ
712545, NSW: Cronulla YM97, YM102. Gerringong YM90. Jervis Bay YM185, YM186,
YM187. Bermagui YM117, YM118.
DNA VOUCHERS: YM117, YM185
DISTRIBUTION: (Figure 37) NSW: Cronulla, Gerringong, Jervis Bay, And Bermagui.
AUSTRALIA: Queensland; Redcliffe. WORLD: Not reported outside of Australia
Figure 37. The distribution of Laurencia queenslandica in NSW is indicated by grey coastal shading. It includes the entire south coast. The inset shows Australian-wide distributions. Arrow indicates type location of Laurencia queenslandica.
205 HABITAT and SEASONALITY:
In NSW Laurencia queenslandica grows both intertidally and subtidally to 9m. It is both epilithic and epiphytic, found on rock boulders, rock shelves, rock formations near sandy bottoms, and rarely on articulated coralline red algae. It is found in areas with fast currents but sheltered from direct wave exposure. Tetrasporic and cystocarpic plants were collected in spring and summer
(September to February) and spermatangial plants only in summer (December to February).
HABIT: (Figures 38, 39)
Thallus colours range from dark red to pink, often iridescent, and plants adhere well to paper when pressed. Sizes range from 1.9 - 6.7cm high, and 2.2 - 9.4cm wide with an average of 4.5cm in height for intertidal plants, 3.8cm in height for subtidal plants, and 5.0cm in width for both.
These dimensions are generally smaller than Cribb’s original description of the type from southern Queensland (Cribb 1958) (Figure 38). The plant outline is generally pyramidal. Most plants display four orders of branching but range from three to five orders. Main branches, and often the percurrent axes, sometimes display ternate or palmate branching at apices. Branching is distichous, alternate, with the main axes markedly flattened, particularly from midbranch to apices. The apex of a branch is usually the widest point. Carposporic plants usually display thinner main axes than other stages do (Figure 38A, 39A). Secondary main branches are sometimes longer than primary axes. The angles formed between main branches and penultimate branches are <90 to 45-degrees. Sterile ultimate branchlets are often very long, ranging from 1 - 5mm in length, sometimes with very small budding sterile ultimate branchlets at the ends which are usually <1mm and averaging 0.5mm in length. The holdfast is discoid, sometimes spreading to be quite substantially wide. One to many uprights develop from the
206 holdfast, with percurrent axes present. Plants are usually not fouled, or rarely with small amounts of various algae and bryozoans.
VEGETATIVE STRUCTURES: (Figure 40)
The main axes are compressed particularly near the apices and mid branch. Ultimate branchlets are often compressed, or particularly in fertile branchlets can be compressed at the base and become terete near the apex. Branching is mostly distichous, with fertile branches sometimes becoming subdistichous in higher order branches. Plants are not soft. In transverse sections, cortical cells vary in shape from round to transversely oblong to inverse pyramidal, with maximum widths averaging 19um (range 15.6 – 23.4um). Trichoblasts protrude from the apical pit. Secondary pit connections are present between epidermal cells when observed in longitudinal section (Figure 40D). No epidermal cell projection is seen along branchlets, even near the apical pit (Figure 40C). In longitudinal sections, cortical cells are primarily longitudinally oblong but range to inverse pyramidal. Each axial cell cuts off four pericentral cells (Figure 40B).
Lenticular thickenings are absent. Corps en cerise were not looked for in fresh material and none were observed in preserved specimens.
TETRASPORIC: (Figures 39, 41)
The tetrasporic phase is the largest of plant phases but only slightly, averaging 5.3cm height.
Fertile ultimate branchlets are both compound and single, but are mostly compound with ultimate branchlets forming a compressed coroniform-like structure at the apex. Tetrasporic branching is alternate distichous, with some ultimate branchlets subdistichous (Figure 39D). All branches except for ultimate branchlets are compressed, although not severely. The ultimate branchlets near the apex of a plant or on higher order branches are short, averaging 0.6mm in
207 length, particularly the fertile ramuli, however, ultimate branchlets near the base of the plant become distinctly much longer (averaging 3.25mm in length) and more terete, and usually single if fertile. Angles between grouped ultimate branchlets and the supporting branch is less than 45- degrees and angles between the supporting branch and main axes are on average at 45-degrees.
Tetraspores have pericentral cell origins and show parallel development in relation to the main axial row. Tetraspores are large compared to branch diameters, and reach up to 111um in diameter (Figure 41D).
MALE: (Figures 39, 41)
Spermatangial plants are the smallest of the plant phases, averaging 2.0cm in height (Figure 38C).
Fertile ultimate branchlets are single, usually wider at the apex than the base, although not usually distinctly napiform. Fertile ultimate branchlets reach up to 1mm in length and 0.75mm in diameter at the branchlet apex. Angles between the ultimate branchlets and their supporting branch are often less than 45-degrees, with ramuli near the base of the supporting branch pressed close to it (Figure 39F). A mature ultimate branchlet is often slightly compressed at the base and terete at the apex. Branching is distichous alternate, but can become opposite for some ultimate branchlets. Spermatangia develop from fertile trichoblasts within a cup-shaped apical pit, and show an apical nucleus per spermatia (Figure 41B). Spermatia average 4.5um in length.
Single terminal vesicular cells are sterile and narrowly ovate, averaging 9.6um in length (Figure
41B).
FEMALE: (Figures 39, 41)
Cystocarpic plants average 4.7cm in height and 5.5cm in width. Carposporic plants usually display thin main axes, with more single ultimate branchlets compared to other phases. This
208 sometimes gives the plant an appearance similar to Laurencia distichophylla. Ultimate branchlets can be either compound or single. In the higher branch orders, branching structure is not distichous. All branching angles are usually 45-degrees, however some compound ultimate branchlets are pressed close to their supporting branch. Commonly only one cystocarp develops per branchlet, but sometimes two cystocarps are seen. Cystocarps are located at the base of a small compound branchlet, or sometimes on a single branchlet. More mature cystocarps associate with a small protective, curved branchlet (Figure 39C). Cystocarps are wider in diameter than they are tall, and squatly ovate with the widest diameter very close the to point of attachment to the supporting branchlet. Cystocarps average 1.2mm in diameter, and show no protruding ostiole (Figure 41C). Carpospores are small, lanceolate, and average 129um in length and 32um in width. The placenta is thin, delicate looking, and highly branched.
MOLECULAR RESULTS: rbcL Only (Figures 6, 7, 8)
Two sequences from NSW material identified by morphological comparison as Laurencia pedicularioides var. queenslandica are included in all analyses and consistently group together.
Laurencia pedicularioides has recently been placed in the genus Osmundea (Furnari et al 2004). By molecular and morphological evidence, however, the two NSW taxa are not in the genus
Osmundea but instead belong to the genus Laurencia sensu stricto. This gives evidence that L. pedicularioides var. queenslandica is not a variety but can be recognized at the species level as L. queenslandica.
In the molecular results the two NSW sequences together form the Laurencia queenslandica clade, which is strongly supported (ML bootstrap = 99%, BI posterior probability = 1.00, MP
209 bootstrap = 100%). This clade is located within a larger, well-supported clade that also includes
L. calliptera, Laurencia sp1 and Laurencia sp2. The relationships among the taxa within the large clade are not congruent across analyses. Within the ML and BI analyses, the L. queenslandica clade groups together with Laurencia sp1, but with weak support (ML bootstrap = 53%, BI posterior probability = 0.69). In the MP analysis, the Laurencia sp1 sequence groups with L. calliptera, but this relationship has no support (see L. calliptera discussion). The inconsistent placing of the Laurencia sp1 sequence, and the weak support for the relationship between L. queenslandica and Laurencia sp1, suggest they are not conspecific. In the MP results, the Laurencia sp2 sequence is most basal within the clade and comes out on its own. In both the ML and BI analyses, the Laurencia sp2 sequence is distant from L. queenslandica. These results indicate that L. queenslandica and Laurencia sp2 are not conspecific either. Laurencia calliptera has already been shown to be a separate species (see L. calliptera discussion), therefore, L. queenslandica and L. calliptera are also not considered conspecific.
Interestingly, Laurencia queenslandica has pairwise distances that support its amalgamation with both Laurencia sp1 and Laurencia sp2 (L queenslandica vs. Laurencia sp1 pairwise distance = 1.68%,
L. queenslandica vs. Laurencia sp2 pairwise distance = 1.98%) but conspecificity is unsupported in the tree topologies, with L. queenslandica forming its own clade in the MP analysis and Laurencia sp2 sequence coming out separately in all three analyses. The separation of all three taxa is also supported morphologically by basic branching structures, holdfast types, and ratios of ultimate branchlet sizes compared to supporting branches sizes (Figure 38, 47, 49). Therefore, with the combined evidence from the three molecular analyses L. queenslandica, Laurencia sp1, Laurencia sp2 and L. calliptera, are all recognized at species levels to maintain monophyly.
210
rbcL and COX1 Combined (Figures 9, 10, 11)
In these analyses, L. queenslandica sequences from NSW form a well supported clade (ML bootstrap = 100%, BI posterior probability = 1.00, ML bootstrap = 100%). The L. queenslandica clade is within a larger clade that, in these analyses, only includes Laurencia sp1 and Laurencia sp2.
All rbcL and COX1 analyses support this larger clade (ML bootstrap = 78%, BI posterior probability = 0.99, MP bootstrap = 64). Laurencia sp1 is consistently the closest sequence to the
L. queenslandica clade.
rbcL and rbcL-rbcS Spacer Combined (Figures 12, 13, 14)
There is only one sequence of Laurencia queenslandica available for these analyses and in the results it was included in a larger clade with L. calliptera, Laurencia sp1 and Laurencia sp2. This larger clade is well supported (ML bootstrap = 98%, BI posterior probability = 1.00, MP bootstrap =
95%), however, relationships among the taxa within this clade are not congruent across analyses.
Not surprisingly, they reflect results obtained in the rbcL only analyses. In the ML and BI analyses, Laurencia queenslandica is closest to the Laurencia sp1 sequence but with weak support
(ML bootstrap = unsupported, BI posterior probability = 0.84). In the MP analysis, L. queenslandica does not show any supported relationships but comes out on its own. Pairwise distances are exaggerated when using the rbcL and spacer regions combined compared to rbcL only distances, but are still small between L. queenslandica, Laurencia sp1 and Laurencia sp2.
211 In conclusion, based on the conflicting molecular results between all nine analyses and the distinct morphologies of each clade, all four taxa are separated at a species level; Laurencia queenslandica, Laurencia calliptera, Laurencia sp1 and Laurencia sp2.
CONCLUDING REMARKS FOR LAURENCIA QUEENSLANDICA:
Cribb described Laurencia pedicularioides var. queenslandica from Redcliffe, Queensland, Australia, and designated a tetrasporic plant as the holotype (Cribb 1958). The samples collected from
NSW match well with Cribb’s description of the tetrasporic type material, and are therefore identified as L. pedicularioides var. queenslandica, although in general, NSW plants are smaller.
Particularly matching well are the branching descriptions of the main axes, sterile and tetrasporic branchlets.
Because Cribb’s original fertile holotype has since been lost, Furnari et al (2004) lectotypified
Cribb’s L. pedicularioides var. queenslandica with a sterile specimen. Their study of the type of L. pedicularioides Boergesen from India led them to conclude that L. pedicularioides belongs to the genus Osmundea, based on the absence of secondary pit connections, and that tetrasporangia are produced from epidermal cells. This justification is well supported since only Osmundea shows tetrasporangia developing from epidermal cells and in parallel arrangement. Although they had difficulties in rehydrating and sectioning the lectotype of L. pedicularioides var. queenslandica,
Furnari et al (2004) considered it to be conspecific with the Indian L. pedicularioides. This conclusion was based on the absence of secondary pit connections in the lectotype of each taxon and their generally similar habits.
212 However, according to Cribb’s original description the Queensland samples have narrower axes
(<2mm) than the Indian samples (3-4mm) which in general he considered more robust. Also in the Queensland plants the sterile ultimate branchlets are broader at the base than apex, unlike in the Indian L. pedicularioides. Cribb mentions that Boergesen himself believed that the two taxa were specifically distinct, particularly because the Queensland samples were smaller, and showed a pyramidal habit that the Indian L. pedicularioides did not. In this study, the NSW collections show distinct secondary pit connections, and molecular results show them to nest within the
Laurencia clade. These results support placement of L. pedicularioides var. queenslandica as a distinct species within the genus Laurencia and not in the genus Osmundea. Furthermore, as it is not a variety of O. pedicularioides, it is raised to specific rank as Laurencia queenslandica (A.B. Cribb) Metti stat. nov.
213 Figure 38. Habits of Laurencia queenslandica from NSW. Scale bar = 2cm.
(A) Habit of a cystocarpic plant (YM186) collected subtidally from southern NSW (Jervis Bay).
(B) Habit of a tetrasporic plant (YM097) collected intertidally from Sydney, NSW (South
Cronulla).
(C) Habit of a spermatangial plant (YM118) collected intertidally from southern NSW
(Bermagui).
(D) The lectotype of Laurencia pedicularioides var. queenslandica (BRI AQ712545), which is a sterile specimen.
(E-F) A comparison of ‘palmate’ branching (black arrow) between the lectotype and a NSW sample. (E) BRI AQ712545 (lectotype). (F) YM097.
214
Figure 38. Habits of Laurencia queenslandica from NSW, and the lectotype. Scale bar = 2cm.
215 Figure 39. Branch details of Laurencia queenslandica from NSW. Scale bar = 1mm.
(A) A cystocarpic branch (YM090).
(B) A tetrasporic branchlet showing details of compound branchlets with tetraspores (white arrows) (YM102).
(C) Details of cystocarps (YM090).
(D) Tetrasporic branches showing compound fertile branchlets (YM102).
(E) Detail of spermatangial branchlets (YM118).
(F) A spermatangial branch (YM118).
216
Figure 39. Branch details of Laurencia queenslandica from NSW. Scale bar = 1mm.
217 Figure 40. Microscopic features of Laurencia queenslandica from NSW
(A) A transverse section through sterile material showing compression of thallus, medullary layers with no lenticular thickenings and the epidermal cell layer (YM185). Scale bar = 50um.
(B) A transverse section through sterile material near the apex of a branchlet showing four pericentral cells (p) cut off from the main axial cell (a) (YM185). Scale bar = 10um.
(C) A longitudinal section through a branchlet apex showing trichoblasts, shape of apical pit, the apical cell within (white arrow) and the main axial row (YM185). Scale bar = 100um.
(D) A longitudinal section through a branchlet showing secondary pit connections (black arrows) and elongated epidermal cells (YM185). Scale bar = 20um.
218
Figure 40. Microscopic features of Laurencia queenslandica from NSW.
219 Figure 41. Microscopic features of Laurencia queenslandica from NSW showing reproductive features.
(A) Longitudinal section through a male apical pit showing trichoblasts (white arrows) supporting spermatangial filaments (YM118). Scale bar = 10um.
(B) Longitudinal section through a male apical pit showing spermatia detail, a single terminal sterile vesicle (black arrow). Spermatia are showing apical nuclei (YM118). Scale bar = 10um.
(C) A longitudinal section through a cystocarp showing carposporangia and placenta (YM090).
Scale bar = 500um.
(D) A transverse section through a tetrasporic branchlet showing the large size of tetraspore relative to branchlet diameter. A slight compression is seen of the branchlet, which tends towards terete at the apical end (YM187). Scale bar = 100um.
220
Figure 41. Microscopic features of Laurencia queenslandica from NSW showing reproductive features.
221 222 Laurencia venusta Yamada
Laurencia venusta Yamada 1931: 203-204, Fig. H, pl. 6: Fig. a. Saito 1967:14, Pl.V, VI. Fig. 8-14.
Millar and Kraft 1993:55. Yamada 1931:201 Pl. 6, Fig. a, H. Cribb 1958:168 Pl.5, Fig.11. Cribb
1983:126 Pl. 36, Fig. 3. Senties et al 2001, figs. 2-15.
(Figures 43, 44, 45)
TYPE LOCALITY: Japan: Koshiki-jima, Kagoshima Prefecture and Goto-retto, Nagasaki
Prefecture (Silva, Basson and Moe 1996: 521).
TYPE SPECIMENS: Type: Laurencia venusta Ex. Herb. Dr. K. Okamura, SAP 13873 (Yoshida
1998: 1042).
SPECIMENS EXAMINED: Laurencia venusta (type) SAP 13873. NSW: Lord Howe Island
YM337, YM338, YM380
DNA VOUCHERS: YM338, YM380
DISTRIBUTION: (Figure 42) NSW: Lord Howe Island, AUSTRALIA: NSW (Lord Howe
Island), Queensland, WORLD: Mexico, Japan, Australia, Korea, Formosa
Figure 42. The distribution of Laurencia venusta in NSW is indicated by grey coastal shading, and includes only Lord Howe Island. The inset shows Australian-wide distributions that includes only southern Queensland. Type location is Satsuma province, Japan.
223
HABITAT and SEASONALITY:
In NSW, Laurencia venusta is found subtidally from 1 - 3m on rock substrates. Water conditions in which L. venusta is found include quiet bays and sheltered lagoons. The only time of year it was collected was in spring (September to November).
HABIT: (Figures 43, 44)
Plant sizes range from 5.6 – 8.4cm in height and 6.3 – 10.8cm in width. Average sizes are 7cm in height. Colours range from light brown to orange brown to medium brown. Generally, no percurrent axis is visible, instead branching creates a sparse to medium matt of thin, intertwined branches (Figure 43). Branches are terete and generally widely spaced along supporting branches
(Figure 44). Branching occurs in all planes, mostly at 90-degree angles, or at angles at least greater than 45-degrees. Alternate ternate branching occurs in all branching orders but particularly in the higher ones, this creates entanglements between branches, creating a clumping habit (Figure 44C). The entangled habit assists in anchoring the plant. The holdfast is composed of a denser matt of stolons, thinner than the regular branches and usually darker red and highly entangled. Plants adhere to paper when dried. Fouling occurs with epiphytic algae and encrusting red algae.
VEGETATIVE STRUCTURES: (Figure 45)
Both in longitudinal and transverse sections, epidermal cells are well rounded and vary greatly in size. In longitudinal sections, epidermal cell sizes range from 9.8 - 50.7um in diameter, with the average sized cell 22um in diameter. In both longitudinal and transverse sections, epidermal cell projection can be seen along the entire branchlet (Figure 45E). Apical pits are consistent in
224 shape, being of medium depth and width. Trichoblasts are of medium density, extending somewhat beyond the apical pit. Thickened cell walls are seen. Secondary pit connections between epidermal cells are present when viewed in longitudinal section. Four pericentral cells are cut off from the main axial cell.
TETRASPORIC: (Figures 44, 45)
Tetrasporic plants are on average the smallest collected, reaching up to 5.6cm in height. Fertile branchlets are terete and show the typical widely spaced ternate branching of this taxon, causing an entangled habit. Tetraspores are borne on single branchlets (Figure 44D, E). Mature tetraspores are few within a branchlet and range from 65 - 80.8um along the widest diameter
(Figure 45D, F). Tetraspores tend to be smaller than in other Laurencia taxa when they are compared to branchlet diameters. Tetraspores develop from fertile pericentral cells, in a parallel arrangement relative to the main axial row. Trichoblasts tend to be longer and extend farther from the apical pit than in sterile material.
MALE:
Male plants were not observed.
FEMALE: (Figures 44, 45)
The carposporic plants of Laurencia venusta reach up to 8.4cm in height, and are the largest collected of this taxon, which is unusual compared to other Laurencia species found in NSW.
The branching in carposporic plants are the same as in other forms, showing widely spaced alternate ternate branching. Cystocarps are borne singlely (Figure 44A). They are not found on ultimate branchlets, but instead develope in place of one of the ultimate branchlets within the
225 standard ternate pattern of three (Figure 44A). Ostioles do not protrude. The general shape of the cystocarp is widely ovate, and longer than it is wide. Each cystocarp seems to contain many carpospores when compared to other NSW Laurencia species. The average length of a cystocarp is 0.78mm and width is 0.68mm. Carpospores are tear shaped, with or without a long thin tail
(Figure 45C). Average sizes for a carpospore is 38um in width at the widest point, and 108.6um in length, although length varies greatly due to the shape of the thin tail end.
MOLECULAR RESULTS: rbcL Only (Figures 6, 7, 8)
Two sequences of NSW material are included in the molecular analyses that form the Laurencia venusta clade. This is a well-supported clade within the Laurencia genus with high support values across all three analyses (ML bootstrap = 99%, BI posterior probability = 1.00, MP bootstrap =
100%). It has no supported sister clade relationships except in the BI analysis, where it is weakly grouped with a clade including Laurencia sp3 and Laurencia sp4 (BI posterior probability = 0.68).
Pairwise distances between the L. venusta clade and its nearest neighbouring taxon is 3.26%. The separation of the L. venusta clade from any other taxa, combined with a high pairwise distance and clear morphological differences support the recognition of Laurencia venusta as a good species.
rbcL and COX1 Combined, and rbcL and rbcL-rbcS Spacer Combined (Figures 9 - 14)
The rbcL and COX1 combined analyses and the rbcL and spacer combined analyses support the results from the rbcL only analyses. The L. venusta clade in these phylogenies is fully supported as well (ML bootstrap = 100%, BI posterior probability = 1.00, MP bootstrap = 100%) and no supported sister clade relationships are seen.
226
CONCLUDING REMARKS FOR LAURENCIA VENUSTA:
Laurencia venusta is a well defined species morphologically. Features that readily identify L. venusta in NSW are the thin branches showing opposite ternate branching, the single ultimate ramuli in all phases, and the tendency to form tangled mats. Molecular evidence supports L. venusta at a species level and morphological examinations confirm its occurrence in NSW.
227 Figure 43. Habits of Laurencia venusta from NSW. Scale bar = 2cm.
(A) The habit of a carposporic plant (YM338) collected subtidally at Lord Howe Island.
(B) The habit of a tetrasporic plant with many epiphytes (YM380) collected subtidally at Lord
Howe Island.
(C) The Laurencia venusta holotype from Japan (SAP 13873).
228
Figure 43. Habits of Laurencia venusta from NSW, and the lectotype. Scale bar = 2cm.
229 Figure 44. Branch details of Laurencia venusta from NSW. Scale bar = 1mm.
(A) Detail of a carposporic branch (YM338).
(B) Carposporic branch (YM338).
(C) A sterile branch showing the typical alternately ternate branching (YM338).
(D) Detail of a tetrasporic branch showing tetraspores (white arrows) (YM380).
(E) Tetrasporic branch (YM380).
230
Figure 44. Branch details of Laurencia venusta from NSW. Scale bar = 1mm.
231 Figure 45. Microscopic features of Laurencia venusta from NSW.
(A) A longitudinal section of a cystocarp (YM338). Scale bar = 100um.
(B) Longitudinal section through an apical pit, showing the apical cell (white arrow), the axial row
(black bracket) (YM380). Scale bar = 25um.
(C) Details of carpospores within a cystocarp showing teardrop shapes (YM338). Scale bar =
100um.
(D) Longitudinal section through a tetrasporic branchlet showing parallel arrangement of tetraspores (YM380). Scale bar = 100um.
(E) Longitudinal section through a branchlet showing projecting cortical cells (black arrows) near the apical pit (YM338). Scale bar = 25um.
(F) Transverse section through a tetrasporic branchlet showing projecting cortical cells and a small tetraspore (YM380). Scale bar = 100um.
(G) Surface of a branchlet showing rounded shapes and size variation of cortical cells (YM338).
Scale bar = 25um.
232
Figure 45. Microscopic features of Laurencia venusta from NSW. 233 234 Laurencia sp1
(Figure 47)
SPECIMENS EXAMINED: NSW: Aragunnu; YM398, YM399a, YM399b
DNA VOUCHERS: YM399a
DISTRIBUTION: (Figure 46) NSW: Aragunnu
Figure 46. The distribution of Laurencia sp1 in NSW is indicated by grey shading. It was collected in only one location; Aragunnu.
HABITAT and SEASONALITY:
This taxon was found intertidally only. It was located on a north facing intertidal reef, which is exposed at low tide. Collections were made in summer only (December to February).
HABIT: (Figure 47)
Plants are coloured black-red. One of the plants reached 6cm in height, the other 3.3cm in height. All samples have extremely small, numerous and compacted ramuli, unusually small in comparison to the size and thickness of the main branches. The main branches are thick and compressed, with the upper portions the widest. The holdfast is a basal crust with many uprights, some of which become percurrent main branches. Some fouling does occur, with
235 fouling organisms mainly being other red algae. Plants tend not to adhere to paper when pressed dry.
MOLECULAR RESULTS:
Within the molecular results, Laurencia sp1 is associated with L. calliptera and L. queenslandica, however, it does not group consistently with either taxon. In the rbcL only ML and BI analyses, it is sister to L. queenslandica with poor support (ML Bootstrap = 53%, BI posterior probability =
0.69). In the rbcL only MP analysis, it is sister to the L. calliptera clade, however, the relationship has bootstrap support of less than 50% and a pairwise distance of 4.1%. These results suggest it is neither of these two species. In the rbcL and COX1 combined analyses, and in the rbcL and rbcL-rbcS spacer combined analyses, Laurencia sp1 consistently nests closest to L. queenslandica, with a wide variety of support. Although there is only one sequence of Laurencia sp1, but this sequence does not decidedly nest with any one taxon. The conflicting molecular results, and the vast morphological differences suggest Laurencia sp1 is a separate species.
REMARKS:
Morphologically this taxon is unusual in that the ultimate ramuli are extremely thin, small and terete compared to the extreme thickness of the main supporting branches, which are compressed and very wide, particularly from the midpoint above. Unfortunately, with only three samples collected of this species the sampling of this taxon is too small to come to any morphological conclusions of what species this may be. According to both molecular and morphological evidence it belongs to the genus Laurencia, however further investigation is needed before assigning a name to this taxon, which is potentially a new and undescribed species.
236 237 Figure 47. Habits of Laurencia sp1 found in NSW. Scale bar = 2cm.
(A) Habit of plant (YM399a) collected intertidally in southern NSW (Aragunnu).
(B) Habit of plant (YM399b) collected intertidally in southern NSW (Aragunnu).
(C) Habit of plant (YM398) collected intertidally in southern NSW (Aragunnu).
238 A B
C
Figure 47. Habits of Laurencia sp1 found in NSW. Scale bar = 2cm.
239
240 Laurencia sp2
(Figure 49)
SPECIMENS EXAMINED: NSW: Lord Howe Island; YM367, YM368
DNA VOUCHERS: YM367
DISTRIBUTION: (Figure 48) NSW: Lord Howe Island
Figure 48. The distribution of Laurencia sp2 in NSW is indicated by grey shading. It was collected in only one location; Lord Howe Island.
HABITAT and SEASONALITY:
This taxon was found subtidally only, on Lord Howe Island. It was found on coral reef substrates that were surrounded by sandy channels. Collections were made in spring (September to November).
HABIT: (Figure 49)
The two plants collected were both brown, and sizes averaged 5.6cm in height and 7.4cm in width. It adheres to paper but not well, and displays up to four branching orders. The holdfast is made up of long, sparse stolons. Plants are stiff and cartilagineous and both were fouled with encrusting red algae.
241
MOLECULAR RESULTS:
Within the rbcL only molecular results, Laurencia sp2 is sister taxon to the clade containing L. calliptera, L. queenslandica and Laurencia sp1, with strong support in all three analyses (ML bootstrap = 96%, BI posterior probability = 1.00, MP bootstrap = 94%). It does not consistently associate closely with any one of the three taxa within its sister clade. When considering the larger clade which includes Laurencia sp2, L. calliptera, L. queenslandica and
Laurencia sp1 we see that three of the four taxa in this clade (L. calliptera, L. queenslandica and
Laurencia sp1) have been shown to be distinct species, both molecularily and morphologically,.
Therefore, in order to maintain monophyly Laurencia sp2 must be considered a separate species.
In the rbcL and COX1 combined ML, BI and MP analyses, and in the rbcL and rbcL-rbcS spacer combined ML and BI analyses, Laurencia sp2 is sister to the clade containing L. queenslandica and
Laurencia sp1. In the rbcL and spacer MP analysis Laurencia sp2 is sister to the clade containing L. queenslandica, Laurencia sp1 and L. calliptera. All three of these sister taxa have been shown ato be separate species, and Laurencia sp2 is not supported as being any one of them.
REMARKS:
Unfortunately, the sampling of this taxon is too small to come to any morphologically based conclusions of what species this may be. According to both molecular and morphological evidence, it belongs to the genus Laurencia. Further sampling is needed but Laurencia sp2 may be a new and undescribed species.
242 243 Figure 49. Habit of Laurencia sp2 from NSW. Scale bar = 2cm. This plant was collected from
Lord Howe Island (YM367).
244
Figure 49. Habit of Laurencia sp2 from NSW. Scale bar = 2cm.
245 246 Laurencia sp3
(Figure 51)
SPECIMENS EXAMINED: NSW: Norfolk Island YM260, YM272. Lord Howe Island
YM345, YM360, Jervis Bay YM214, YM215, YM222. Batehaven YM310. Gosford YM095
DNA VOUCHERS: YM95, YM215, YM222, YM260, YM272, YM345, YM360
DISTRIBUTION: (Figure 50) NSW: Gosford, Jervis Bay, Batehaven, Norfolk Island, Lord
Howe Island (this study)
Figure 50. The distribution of Laurencia sp3 in NSW is indicated by grey coastal shading, and includes the NSW coast from Gosford to Batehaven, and the two islands, Norfolk and Lord Howe Islands.
HABITAT and SEASONALITY:
This taxon in NSW is found intertidally to 3.5m subtidally. It is commonly found on coral walls, but also found on rock walls, rock platforms and boulders surrounded by sandy substrates.
Water conditions, in which plants were collected, ranged from surgy inlets to shallow, sheltered bays. It is not epiphytic. Plants were collected in all seasons except winter (excluding June to
August).
247
HABIT: (Figure 51)
Plant colours vary greatly, ranging from yellow-brown to purple-green. Plant heights range from
1.4 - 9.4cm but most commonly around 5cm, and widths range from 1.0 - 8.5cm. It adheres well to paper when dried. Plants display up to five orders of branching but commonly four are seen.
Some specimens display percurrent axes and some do not. The holdfast is a basal crust, which can become stoloniferous. Branches form angles of 90-degrees. Sometimes 45-degree angles are seen, mainly at the apex of branches. Plants display subdichotomous branching, alternate distichous to ternate. Short primary branches often support long secondary branches. The ultimate ramuli are generally wide and rectangular. Lenticular thickenings are present, as well as secondary pit connections and projecting epidermal cells. Branching tends to be full and unpatterned. Often this taxon is fouled with other algae, bryozoans and crustaceans.
MOLECULAR RESULTS:
In all molecular analyses, Laurencia sp3 taxa form one well-supported clade. The closest sister clade is one containing only Laurencia sp4. This sister relationship is well supported across analyses, but the distances (pairwise 4.48%) are large enough for Laurencia sp3 to be its own species. This taxon somewhat matches Laurencia galtsoffii M.A.Howe (1934) morphologically, and a comparison to the type of L. galtsoffii from Hawaii is needed before concluding these two taxa are the same. This was not possible within the time limits of this study but is planned for the very near future.
248 249 Figure 51. Habit of Laurencia sp3 from NSW. Scale bar = 2cm.
(A) Habit of plant (YM260) collected subtidally from Norfolk Island.
(B) Habit of plant (YM095) collected intertidally from central NSW (Gosford).
(C) Habit of plant (YM345) collected subtidally from Lord Howe Island.
250
Figure 51. Habit of Laurencia sp3 from NSW. Scale bar = 2cm.
251 252 Laurencia sp4
(Figure 53)
SPECIMENS EXAMINED: NEW COLLECTIONS: NSW: Jervis Bay YM188, YM205, Lord
Howe Island YM349, Norfolk Island YM268. HERBARIUM SPECIMENS: NSWA00948,
NSW V. May Jervis Bay (28/9/1973), 2x(25/11/1973), (11/12/1974), (15/11/1978) NOTE: In the herbarium of NSW, V.May’s 5 specimens are labelled L. obtusa var. compacta A.B.Cribb, however, examination of these pressed vouchers show them to be a good morphological match to Laurencia sp4. Molecular results from this study show no specimens from NSW are Laurencia obtusa, nor do any nest close enough to be considered a variety. It is concluded that L. obtusa var. compacta does not occur in NSW.
DNA VOUCHERS: YM188, YM205, YM268, YM349
DISTRIBUTION: (Figure 52) NSW: Jervis Bay, Lord Howe Island, And Norfolk Island
Figure 52. The distribution of Laurencia sp4 in NSW is indicated by grey coastal shading, and includes Jervis Bay on the NSW coast, and the two islands, Norfolk and Lord Howe Islands.
253 HABITAT and SEASONALITY:
Laurencia sp4 is found subtidally up to 9m, on rock or coral reef surrounded by sand. Collections were made in spring (September to November) and summer (December to February).
HABIT: (Figure 53)
Plant colours range from pale pink to orange to yellow-green. Plant heights range from 1.5 -
6.4cm. All branches are thin and delicate, displaying much branching. There are no percurrent or main axes. Plants are terete throughout. Often plants are epiphytic. Both epidermal cell projection and lenticular thickenings are seen.
MOLECULAR RESULTS:
In all molecular analyses, Laurencia sp4 forms a well-supported clade. The closest sister clade contains only Laurencia sp3. The clades have a paiwise distance of 4.48% between them, which supports a species level separation of these two taxa. Laurencia sp4 shares morphological features with Laurencia tenera C.K.Tseng (1943) which has a type locality of Hong Kong, China, and has been previously recorded in NSW from Coffs Harbour and Woolgoolga (Cribb 1958, Millar
1990, Millar and Kraft 1993). However, Laurencia sp4 differs from L. tenera by the presence of lenticular thickenings, the absence of perennial basal branches and the absence of haptera, which often join adjacent branches together in L. tenera. Laurencia sp4 also shares morphological features with Laurencia calliclada Masuda (1997) that was originally described from Vietnam.
Unfortunately, Laurencia sp4 is not a perfect match with either species and a comparison to the types of both L. calliclada and L. tenera is needed. This was not possible within the time limits of this study but is planned for the very near future. As with the other unidentified taxa from
NSW, this may also be a new and undescribed species.
254 255 Figure 53. The habit of Laurencia sp4 from NSW. Scale bar = 2cm.
(A) Habit of plant (YM268) collected subtidally from Norfolk Island.
(B) Habit of plant (YM349) collected subtidally from Lord Howe Island.
(C) Habit of plant (YM205) collected subtidally from southern NSW (Jervis Bay).
256
Figure 53. Habit of Laurencia sp4 from NSW. Scale bar = 2cm.
257 258 Chondrophycus
Key to the Chondrophycus species occurring in NSW 1 a. Cruciate branching, opposite to subopposite, generally at 90' angles at Chondrophycus cruciatus all nodes, ultimate ramuli of various sizes b. Radial branching with ultimate ramuli short Chondrophycus sp.
Table 25. The morphological key to the Chondrophycus species occurring in NSW.
259 260 Chondrophycus cruciatus (Harvey) K. W. Nam
Chondrophycus cruciatus (Harvey) K.W. Nam 1999:463
(Figures 55, 56, 57)
BASIONYM: Laurencia cruciata Harvey 1855:544
HOMOTYPIC SYNONYMS: Laurencia cruciata Harvey 1855:544, J. Agardh 1876:652, Lucas
1909:39, Yamada 1931: 198, Saito and Womersley 1974:843, Millar 1990:464, Millar and Kraft
1993:54. Chondrophycus cruciatus (Harvey) Nam 1999: 463. Womersley 2003:483, Palisada cruciata
(Harvey) Nam 2007: 54.
TYPE LOCALITY: Rottnest Island, Western Australia
TYPE SPECIMENS: Isotypes; Harvey; on Amphibolis Antarctica Herb Harvey, TCD Trav. Set
209. TCD, Harvey Travelling Set no. 196 (Millar 1990)
SPECIMENS EXAMINED: Laurencia cruciata (type) TCD trav. set 209. NSW: Bare Island,
Sydney, Australia YM85-YM87
DNA VOUCHERS: YM85
DISTRIBUTION: (Figure 54) NSW: Bare Island, Sydney, Twofold Bay, Jervis Bay.
AUSTRALIA: Houtman Abrolhos, W.A. to Kingston, S.A. (Womersley 2003). WORLD: Not reported outside of Australia
261 Figure 54. The distribution of Chondrophycus cruciatus in NSW is indicated by grey coastal shading. It includes Bare Island, Sydney to Twofold Bay. The inset shows Australian-wide distributions. The type location is Rottnest Island, WA, and is indicated by the arrow.
HABITAT and SEASONALITY:
In NSW, Chondrophycus cruciatus is found subtidally to 8.5m on large boulders in calm, sheltered sites, just below the Ecklonia level. Often plants grow on sides of boulders facing away from incoming swell and tides. It was not found to be epiphytic in NSW but has often been reported on Amphibolis species (Womersley 2003). Chondrophycus cruciatus was collected only in winter
(August) throughout this study.
HABIT: (Figures 55, 56)
The thallus colour is consistently dark red-brown. Plant sizes range from 4.0 – 6.2cm high and
6.3 - 8.7cm wide. It adheres to paper when dried but not well. Plants display a generally symmetrical outline, four branching orders, and 45 - 90-degree angles between all branches.
Chondrophycus cruciatus is terete throughout the entire plant and has percurrent axes. Main branches range from 0.7 - 1.1mm wide. Branching is often alternate, sometimes subopposite and rarely opposite (Figure 55). Opposite branching is usually seen only at the fourth branching
262 order. The holdfast is discoid with multiple percurrent axes arising (Figure 56D). There was some fouling by bryozoans, Ceramiales and various small red blades.
VEGETATIVE STRUCTURES: (Figure 57)
A palisade formation of epidermal cells is seen in both transverse and longitudinal sections
(Figure 57E, F). Epidermal cells are columnar and range in heights from 19.6 - 34.3um. No epidermal cells projection is seen and no lenticular thickenings are present (Figure 57A, D, H).
In addition, no corps en cerise were observed. Secondary pit connections are absent in longitudinal section. Each axial cell cuts off two pericentral cells. Apical pits are deep with short trichoblasts. Branching angles are between 45 to 90-degrees, often nearer 90-degrees.
MALE: (Figures 55, 56)
Reproductive branches carry many spermatangial ultimate branchlets, often with angles around
90-degrees. Spermatangial development is of the trichoblast type, in cup-shaped apical pits.
Spermatangial nuclei are apical, and mature spermatangial branches contain one sterile apical vesicle.
FEMALE:
No female plants were observed
TETRASPORIC:
No tetrasporic plants were observed
263 MOLECULAR RESULTS:
Chondrophycus cruciatus is supported as being within the genus Chondrophycus, but stands alone as a separate taxon across all analyses.
rbcL Only (Figures 6, 7, 8)
In the molecular analyses, there are two critical sequences from type location material:
Chondrophycus cartilagineous from Japan, which is the type species for the genus Chondrophycus, and
Palisada robusta from Orchid Island, which is the type species for the genus Palisada. According to all molecular results in this study, these two type species are distinct, yet nest within the same clade, therefore, the two genera Chondrophycus and Palisada are congeneric. The earlier name of
Chondrophycus has priority, therefore, all taxa within this clade belong to the genus Chondrophycus
(see Chapter 2). In addition, present in these analyses is one sequence of Chondrophycus cruciatus from NSW material that was identified by comparison with type specimens. Chondrophycus cruciatus is currently known as Palisada cruciata, however it nests within the Chondrophycus clade, and is therefore recognized in this study as Chondrophycus cruciatus. In both the ML and BI analyses, the C. cruciatus sequence comes out on its own, and in the MP analysis, it forms a weakly supported clade with Chondrophycus sp. (MP bootstrap = 54%). However, pairwise distances support the separation of the C. cruciatus sequence at a species level (C. cruciatus vs. Chondrophycus sp. 2.68%, C. cruciatus vs. P. robusta 3.79%).
rbcL and COX1 Combined, and rbcL and rbcL-rbcS Spacer Combined (Figures 9 - 14)
The results for the rbcL and COX1 combined analyses, and for the rbcL and spacer combined analyses, support the placement of this taxon within the genus Chondrophycus. The large distances
264 seen in all of these analyses between C cruciatus and other taxa within the Chondrophycus clade also support the separation of C. cruciatus at a species level.
CONCLUDING REMARKS FOR CHONDROPHYCUS CRUCIATUS:
In summary, Chondrophycus cruciatus is well supported as a species in NSW. Molecularly, distances in the BI and ML analyses clearly separate it from other Chondrophycus taxa, and MP interspecific pairwise distances are large enough to support C. cruciatus as a separate taxon as well. Overall C. cruciatus from NSW matches well with the type from WA. Morphologically, its cruciate branching structure separates it easily from the one other Chondrophycus species present in NSW,
Chondrophycus sp.
265 Figure 55. Habits of Chondrophycus cruciatus. Scale bar = 2cm.
(A) Habit of spermatangial plant (YM085) collected subtidally in central NSW (Sydney).
(B) Type specimen of Laurencia cruciata (Herb Harvey TCD Trav. Set #209).
(C) Habit of spermatangial plant (YM086) collected subtidally in central NSW (Sydney).
(D) Habit of spermatangial plant (YM087) collected subtidally in central NSW (Sydney).
266
Figure 55. Habits of Chondrophycus cruciatus from NSW and the isotype. Scale bar = 2cm.
267 Figure 56. Branch details of Chondrophycus cruciatus from NSW. Scale bar = 1mm.
(A) Spermatangial branch (YM086).
(B) Detail of a spermatangial branchlet (YM086).
(C) Detail of spermatangial branch (YM086).
(D) Holdfast detail of spermatangial thallus (YM086).
268 Figure 56. Branch details of Chondrophycus cruciatus from NSW. Scale bar = 1mm.
269 Figure 57. Microscopic details of Chondrophycus cruciatus from NSW.
(A) Longitudinal section through a sterile ultimate branchlet showing deep apical pit and no epidermal cell projection (YM086). Scale bar = 100um.
(B) Longitudinal section showing an apical pit detail and axial cell row (bracket) (YM086). Scale bar = 25um.
(C) Detail of spermatangia and sterile vesicular cells (YM086). Scale bar = 25um.
(D) Transverse section through a branchlet showing terete branching shape and no lenticular thickenings (YM086). Scale bar = 100um.
(E) Longitudinal section through an ultimate branchlet showing no secondary pit connections and palisade formation of epidermal cells (YM086). Scale bar = 25um.
(F) Transverse section showing detail of palisade formation of epidermal cells (YM086). Scale bar = 25um.
(G) Male branchlet with spermatangial branches (YM086). Scale bar = 100um.
(H) Transverse section through a branchlet showing lack of lenticular thickenings (YM086). Scale bar = 100um.
270
Figure 57. Microscopic details of Chondrophycus cruciatus from NSW.
271 272 Chondrophycus sp.
(Figure 59)
SPECIMENS EXAMINED: NEW COLLECTIONS: NSW; Norfolk Island YM234, Botany
Bay YM385, Jervis Bay YM219. HERBARIUM SPECIMENS: NSW Lucas Botany Bay
February 1905 #1-7; NSW Lucas Lake Macquarie January 1918 #1 and #2. NOTE: Eleven of
Lucas’ specimens housed in NSW are currently labelled Laurencia obtusa var. mollisima. After morphological examinations these match closely with Chondrophycus sp. and not Laurencia obtusa var. mollisima. Molecular results from this study show no specimens newly collected are Laurencia obtusa, nor do any nest close enough to be considered a variety. Therefore, it is concluded that L. obtusa var. mollisima also does not occur in NSW. Interestingly, there is a note with Lucas’ Botany
Bay specimens by Yuzuru Saito stating that they are of the subgenus Chondrophycus and should be elevated to specific rank.
DNA VOUCHERS: YM219, YM234, YM385
DISTRIBUTION: (Fig, 58) NSW: Arrawarra, Botany Bay, Lake Macquarie, Lord Howe Island,
Norfolk Island, Batehaven
Figure 58. The distribution of Chondrophycus sp in NSW is indicated by grey coastal shading. The inset shows Australian-wide distributions.
273 HABITAT and SEASONALITY:
Chondrophycus sp. is found intertidally in tide pools on rock platforms, often with sand or gravel present. It is also found subtidally down to 21m, on rock or coral reefs surrounded by sand.
Collections were made in every season.
HABIT: (Figure 59)
Plant colours range from dark red to brown to light green. Plant heights range from 2.2 -
13.7cm. The thallus is terete throughout with one or more percurrent axes. The holdfast is small and discoid, sometimes stoloniferous (Figure 59). Branches are sturdy and cartilaginous displaying sparse, ternate branching both alternate and often opposite. No secondary pit connections between epidermal cells are seen in longitudinal sections. The ultimate branchlets are very short in comparison to their supporting branch. Up to four orders of branching are seen but commonly only three are present. Angles between branches are between 45 to 90- degrees. Fouling often occurs by Ceramium, Gelidium, worms, diatoms, brown and green filamentous algae. No corps en cerise observed.
MOLECULAR RESULTS:
All molecular results show Chondrophycus sp. to be a fully supported clade where there is more than one sequence within the genus (ML bootstrap = 100%, BI posterior probability = 1.00,
MP bootstrap = 100%). Large morphological differences support the separation of
Chondrophycus sp. at a species level, as does the rbcL pairwise distance, although weakly (2.68%).
274 REMARKS:
A search of the literature and of several specimens collected by Harvey, who discovered many
Laurencia complex species from Australia, strongly suggest that Harvey’s specimen from Port
Fairy, Victoria, mislabelled as a type specimen of Laurencia rigida (Lund #36695) is the same as
Chondrophycus sp. (see Laurencia rigida). Evidence suggests this is an undescribed species in the genus Chondrophycus, however, due to time constraints it has not been possible to describe it here adequately but will be in future research.
275 Figure 59. Habit of Chondrophycus sp. from NSW. Scale bar = 2cm.
(A) Habit of plant (YM385) collected subtidally from central NSW (Sydney).
(B) Habit of plant (YM219) collected intertidally from southern NSW (Jervis Bay).
(C) Habit of plant (YM234) collected subtidally from Norfolk Island.
276 Figure 59. Habit of Chondrophycus sp. from NSW. Scale bar = 2cm.
277 278 Norfophycus
Key to the Norfophycus species occurring in NSW 1 a. Terete thallus, often decumbent, main axes at the base are often Norfophycus originalis sparsely branched b. Compressed thallus, often less than 3cm in height Norfophycus sp.
Table 26. The morphological key to the Norfophycus species occurring in NSW
279 280 Norfophycus originalis Metti sp. nov.
(Figures 61-64)
Type species of the genus Norfophycus
TYPE LOCALITY: Norfolk Island, NSW, Australia
TYPE SPECIMENS: Lectotype: YM300. Syntype: YM296
SPECIMENS EXAMINED: Norfolk Island YM300, YM300b, YM296
DNA VOUCHERS: YM296, YM300
DISTRIBUTION: (Figure 60) NSW: Norfolk Island. AUSTRALIA: NSW
Figure 60. The distribution of Norfophycus originalis, which currently only includes Norfolk Island (inset).
DIAGNOSIS:
Plants up to 5.5cm high but sprawl along substrate to 10.2cm wide. Sturdy but not cartilaginous when alive, colours range from light to dark brown. Wide basal crust holdfast.
Branches terete, up to four orders of branching, commonly three. Main branches usually denuded near base, with bulk of branching at top third of main axes. Ultimate branchlets from
0.8 to 1.2mm long. Main axes from0.3 to 0.75mm wide. No corps en cerise, no secondary pit connections. Epidermal cell projection is rarely seen, and if present only near center of 281 branchlet not near apical pit. Double cortical layer seen. Outer epidermal cells small, averaging 13um diameter in longitudinal section, subepidermal cells form a second cortical layer averaging 22um diameter. Medullary cells averaging 108um in diameter. No lenticular thickenings were seen. Trichoblasts contained within apical pit, are prostrate, forming a thick layer along the inside of the apical pit. Trichoblasts originate from pericentral cells.
Tetrasporangia are in perpendicular arrangement relative to the axial row, and develop from epidermal cells within and around the apical pit. Cystocarpic ultimate branchlets are compound. Cystocarps are subconical.
HABITAT AND SEASONALITY:
Norfophycus originalis occurs in cliff face intertidal pools on rock shelves, above heavy wave action. Sample collection was undertaken in autumn (March) on Norfolk Island, which is as yet the only location in NSW that N. originalis has been found. Tetrasporic and cystocarpic material was collected at that time.
HABIT: (Figures 61, 62)
Thallus colours range from light tan to dark rust. Plants when alive are sturdy but not strictly cartilaginous. Plant sizes range from 2.6 - 5.5cm high and 1.3 - 10.2cm wide. The habit of N. originalis is generally sprawling along the substrate, forming a vaguely rectangular outline, with few upright axes. The holdfast is a wide basal crust with a number of uprights arising (Figure
62F). All branches are terete, and divide commonly up to three branching orders, with a maximum of four orders seen. Ultimate branchlets range from 0.8 - 1.2mm long. Main axes range from 0.3 - 0.75mm wide and up to 3.3cm long. Norfophycus originalis adheres to paper when dried, although not very well. This species tends to be fouled, particularly with
282 microscopic or very small organisms.
VEGETATIVE STRUCTURES: (Figure 63)
No corps en cerise were observed. In longitudinal sections, secondary pit connections among epidermal cells are absent (Figure 63F). Apical pits are short and narrow, ranging from small circular openings to tightly closed slits. Very rarely is epidermal cell projection seen, and usually only near the center area of a branchlet, not near the apical pit as is commonly seen in the genus Laurencia. The axial row forms a tight 1/3 spiral up to the small and well covered apical cell. Both in longitudinal and transverse sections the outer epidermal cell shapes are the same, being rounded to tear drop shaped, and very small. Each outer epidermal cell contains a strongly staining nucleus, usually located near the pit connection with the mother cell. The subepidermal layer of cells are arranged as a second cortical layer, with each cell producing two, rarely one or three, ultimate epidermal cells. The subepidermal layer cells are much larger in both longitudinal and transverse section than the outer epidermal layer cells, but are still significantly smaller than medullary cells (Figure 63B, C, D). In longitudinal sections, outer epidermal cells average 13um in diameter, subepidermal cells average 22um in diameter, and medullary cells average 108um in diameter. In transverse sections, both the epidermal and subepidermal layers are the same sizes in old growth material as they are in new growth material (Figure 63E, G). The medullary cells are generally larger in old growth compared to new growth branches and they form long oval to rounded square shapes. Medullary cells are large and long, and mostly ‘empty’, particularly in the middle of branchlets. No lenticular thickenings are seen. Each axial cell has two pericentral cells (Figure 63A). The axial row is seen through almost the entire branchlet as large and dark staining cells. Trichoblasts are entirely contained within a narrow apical pit, they are decumbent, low-lying, and form a thick
283 layer along the inside of the apical pit, which obscures the epidermal layer and apical cell.
Trichoblasts originate from pericentral cells. Within the axial segment from which a trichoblast develops, the trichoblast basal cell grows from the opposite side of the two sterile pericentral cells, and underneath, which is unique among the Laurencia complex taxa.
TETRASPORIC: (Figures 62, 64)
Tetrasporic plants reach up to 5.5cm high and 10.20cm wide. Tetrasporangia are in a perpendicular arrangement relative to the axial row, and develop from epidermal cells within and around the apical pit (Figure 62E, 64A). Tetrasporangia are cruciately divided and oval.
They reach sizes of up to 82um along the largest diameter, but are on average 71um long when mature. Tetrasporangia originate within the epidermal cells of the apical pit and as they develop they move to the top of the apical pit region where they are released. Sometimes tetraspores are seen that have not fully developed and are not released but as the branchlet continues to grow these immature tetraspores seem to travel down the branchlet, contained within their pocket (Figure 64A). No tetrasporic scarring is seen on ultimate branchlets after the tetraspores are released.
MALE:
No male plants were observed.
FEMALE: (Figures 62, 64)
Cystocarpic plants are up to 2.7cm tall and 4.6cm wide. Cystocarpic ultimate branchlets are compound. Cystocarps are subconical and measure up to a maximum of 0.6mm in diameter, and 0.6mm from the base to the tip of the ostiole. Cystocarps are embedded within the
284 supporting ultimate branchlet (Figure 62D). The carpospores are long teardrop shaped and their sizes range from 172um X 55um, to 121um X 35um (Figure 64E). They are joined to a well-developed and tall placenta. The pericarp is composed of 5 to 6 cell layers.
MOLECULAR RESULTS:
The molecular analyses contain two sequences of Norfophycus originalis from Norfolk Island. In all analyses (rbcL, rbcL and COX1 combined, and rbcL and spacer combined), the sequences form a fully supported, distinctive clade within the genus Norfophycus with distances from other
Norfophycus taxa large enough to justify species level separation.
rbcL Only (Figures 6, 7, 8)
All three analyses are congruent in their support of the Norfophycus originalis clade (ML bootstrap
= 100%, BI posterior probability = 1.00, MP bootstrap = 100%). Pairwise distance within the
N. originalis clade is 0.07% (1bp) which strongly supports conspecificity.
There are three species within the Norfophycus genus; N. originalis, Norfophycus sp. and C. tronoi. The
N. originalis clade is sister to the clade containing the other two species in all three analyses. N. originalis is the most basal clade in this genus. Pairwise distances between N. originalis and the other taxa are very large and support specific separation (N. originalis vs. Norfophycus sp. 7.51%, N. originalis vs. C. tronoi 5.58%).
rbcL and COX1 Combined (Figures 9, 10, 11)
For both the ML and BI analyses N. originalis was used as the outgroup because the only other taxon available with both rbcL and COX1 sequences is Ceramium japonicum and it is too distantly
285 related to polarize the ingroup. However, in the MP analysis, N. originalis is part of the ingroup and clearly comes out as a separate group from all other taxa, supporting its recognition as a species.
rbcL and rbcL-rbcS Spacer Combined (Figures 12, 13, 14)
All three analyses support N. originalis as a separate clade with strong support (ML bootstrap =
100%, BI posterior probability = 1.00, MP bootstrap = 100%). This clade is also supported as a separate genus by the branchlengths seen in all three analyses and pairwise distances (N. originalis vs. Chondrophycus 8.61% and N. originalis vs. Chondria 12.21%).
286 287 Figure 61. The habits of Norfophycus originalis. Scale bar = 2cm.
(A) Tetrasporic syntype (YM300) collected intertidally at Norfolk Island.
(B) Cystocarpic syntype (YM296) collected intertidally at Norfolk Island.
288 Figure 61. Syntypes of Norfophycus originalis. Scale bar = 2cm.
289 Figure 62. Branch details of Norfophycus originalis from NSW. Scale bar = 1mm.
(A) Carposporic branches (YM300).
(B) Carposporic branches (YM300).
(C) Tetrasporic branch (YM300b).
(D) Detail of cystocarp (circled) almost fully embedded in supporting branchlet (YM300).
(E) Detail of tetrasporic branches (YM300b).
(F) Holdfast detail of cystocarpic thallus (YM300).
290
Figure 62. Branch details of Norfophycus originalis from NSW. Scale bar = 1mm.
291 Figure 63. Microscopic features of Norfophycus originalis.
(A) Transverse section through a branchlet showing apical cells (a1 and a2) along with two pericentral cells each (p1 and p2) (YM300). Scale bar = 25um.
(B) Transverse section through an ultimate branchlet showing terete habit, very small outer cortical cells and no lenticular thickenings (YM300). Scale bar = 100um.
(C) Longitudinal section through a sterile branchlet showing the apical row that is visible throughout branchlet. Also seen is the two epidermal layers, the outer most being very small
(YM300). Scale bar = 100um.
(D) Transverse section through an ultimate branchlet showing detail of epidermal layers
(YM300). Scale bar = 25um.
(E) Transverse section through an old growth main branch showing no lenticular thickenings, and double layer epidermal cells (YM296). Scale bar = 100um.
(F) Longitudinal section through a branchlet showing no secondary pit connections, and very slight projection of outer cortical cells (YM296). Scale bar = 25um.
(G) Transverse section through an old growth branch showing details of epidermal cells
(YM296). Scale bar = 25um.
292
Figure 63. Microscopic features of Norfophycus originalis.
293
Figure 64. Microscopic features of Norfophycus originalis.
(A) Transverse section through a tetrasporic branchlet showing the perpendicular arrangement of tetrasporangia (YM300b). Scale bar = 100um.
(B) Longitudinal section through an apical pit of a tetrasporic ultimate branchlet showing embedded tetrasporangia (circled) and very short trichoblasts (arrows) completely contained within the apical pit (YM300b). Scale bar = 25um.
(C) Longitudinal section through a cystocarp showing the placenta and some carpospores
(YM300). Scale bar = 100um.
(D) Transverse section through a cystocarp showing the general shape and the placenta
(YM300). Scale bar = 100um.
(E) Transverse section showing carpospore detail (YM300). Scale bar = 100um.
294 Figure 64. Microscopic features of Norfophycus originalis.
295 296 Norfophycus sp.
(Figure 66)
SPECIMENS EXAMINED: Norfolk Island YM279, YM263, YM264, YM265
DNA VOUCHERS: YM279
DISTRIBUTION: (Figure 65) Norfolk Island, Australia
Figure 65. The distribution of Norfophycus sp. includes only Norfolk Island.
HABITAT AND SEASONALITY:
Plants were collected on coarse sand, in sheltered lagoons and warm waters (23C). Plants were collected in autumn (March). Norfophycus sp. is not epiphytic.
HABIT: (Figure 66)
Plant colours range from dark red to brown. Plants are small with irregular outlines. Plant heights range from 1 - 2.7cm and plant widths range from 1.6 - 3.2cm. The holdfast is a basal crust with percurrent branches arising, which become recumbent and display one to four branching orders. Branches are compressed, becoming wider towards the apex. Plants adhere well to paper when dried. No corps en cerise or secondary pit connections were observed. A
297 double cortical layer is seen as described for the genus Norfophycus (see Chapter 2). The outer cortical layer shows epidermal cell projection.
MOLECULAR EVIDENCE: rbcL Only (Figures 6, 7, 8)
In the molecular analyses, there is one sequence within the genus Norfophycus that is a new but unnamed species, Norfophycus sp. It forms a weakly supported clade with C. tronoi (ML bootstrap = 65%, BI posterior probability = 0.86, MP bootstrap = 62%). The weak clade support, and large pairwise distances (6.44%) indicate a species level separation between
Norfophycus sp. and C. tronoi.
There are no rbcL-rbcS spacer or COX1 sequences for this taxon as of yet, therefore, it is not included in either the rbcL and rbcL-rbcS spacer combined analyses or the rbcL and COX1 combined analyses.
REMARKS:
According to the molecular results, this taxon is a new and separate species within the genus
Norfophycus, but currently we lack morphological evidence to formally describe and illustrate this species. Only three very small and unreproductive plants have been collected, one of which was used for molecular work, and the other two did not give us enough material for adequate morphological investigation.
298 299 Figure 66. Habits of Norfophycus sp. Scale bar = 2cm.
(A) Sterile plant (YM279) collected subtidally at Norfolk Island.
(B) Sterile plant (YM264) collected subtidally at Norfolk Island.
300 Figure 66. Habits of Norfophycus sp. Scale bar = 2cm.
301
302 Coronaphycus
Key to the Coronaphycus species occurring in NSW 1 a. Plants 2cm tall or less, main axes curved, constriction at branch Coronaphycus minorus bases b. Plants large and robust, branching alternate or subopposite and in Coronaphycus elatus one plane
Table 27. The morphological key to the Coronaphycus species occurring in NSW, Australia.
303 304 Coronaphycus minorus Metti sp. nov.
(Figures 68, 69 70)
TYPE LOCALITY: Plantation Point, Jervis Bay, NSW, Australia
TYPE SPECIMENS: Holotype: in NSW (YM196). Isotypes: in NSW (YM194, YM197)
SPECIMENS EXAMINED: NSW YM194-YM197
DNA VOUCHERS: YM194
DISTRIBUTION: (Figure 67) known only from the type locality.
Figure 67. The distribution of Coronaphycus minorus, which includes southern NSW (Jervis Bay).
DIAGNOSIS:
With typical generic characters (see Chapter 2); also branches markedly curved, constriction at site of perennial old growth giving rise to new branches and constriction at branch bases, subtidal, adheres well to paper, rhizoid holdfast.
305 HABITAT AND SEASONALITY:
Coronaphycus minorus was collected in a wide bay, at depths of 9m, on rocky outcrops surrounded by coarse sand. Tetrasporic, cystocarpic and spermatangial plants were collected in the summer
(February).
HABIT: (Figures 68, 69)
Plants are small, ranging from 1.2 - 2.3cm high and 1.5 - 2.0cm wide, and are various shades of pink. Plants are curved, compressed and generally sprawling along the substrate. When alive they are sturdy but not strictly cartilaginous, and when dried they adhere well to paper. The holdfast is composed of a few thick rhizoids that grow along the substrate, with usually one or very few uprights. Although the plants are compressed, the perennial base is terete and forms a secondary cortex. The secondary cortex is formed by internal rhizoids along the base of supporting branches. New growth branches arise from the apex of old growth branches, with an obvious constriction at the growth site. In general, all branch bases are constricted, not only new growth. Plants are usually sparsely to moderately branched (Figure 68). Branches divide commonly to three branching orders, with a maximum of four orders seen. Main axes are 0.3 -
0.9mm wide and up to 1.3cm long. Ultimate branchlets range from 0.7 - 1.4mm long.
VEGETATIVE STRUCTURES: (Figures 69, 70)
No corps en cerise were observed. In longitudinal sections, secondary pit connections among epidermal cells are present. Epidermal cell projection is very slight. Epidermal cells are round to oval shaped in both transverse and longitudinal sections. No lenticular thickenings were seen but old growth material has thickened cells walls. A thick secondary cortical layer of smaller cells
306 forms on old growth main branches, also with thickened cell walls. Each axial cell has four pericentral cells. Trichoblasts originate from pericentral cells.
TETRASPORIC: (Figure 69)
Tetrasporic plants have branches that are compressed and show constriction at the base.
Reproductive branchlets are born singly along the supporting branch, with the supporting branch being reproductive as well. Branchlets are long in comparison to typical Laurencia tetrasporic branchlets. They reach up to 1.6mm in length. Angles formed between reproductive branchlets and their supporting branches are commonly around 45-degrees, sometimes less
(Figure 69B). Tetrasporangia are in parallel arrangement relative to the axial row, and develop from pericentral cells. Tetrasporangia are cruciately divided and round in shape. They reach sizes up to 146um in diameter when mature.
MALE: (Figure 70)
Spermatangial ultimate branchlets are single, wider at the apex than the base, and are often terete throughout but with compressed supporting branches. Angles between ultimate branchlets and the supporting branch are often less 45-degrees. Spermatangia develop from fertile trichoblasts within a cup-shaped apical pit, and show an apical nucleus per spermatia. Spermatia average
4um in length. Single terminal vesicular cells are sterile and range from rarely narrowly ovate to commonly almost circular (Figure 70B). Sizes reach up to 10um in length.
FEMALE: (Figures 69, 70)
Cystocarpic plants were the largest observed and with the most number of branches. Commonly three to four branching orders are seen. Branches are curved, distichous and compressed. All
307 branch angles are 45-degrees or less. Cystocarps are born singlely along a penultimate supporting branch and reach lengths of up to 1mm long. The ostiole does not protrude and the placenta is squat and delicate.
MOLECULAR RESULTS:
The Coronaphycus clade has good to strong molecular support (ML bootstrap = 80%, BI posterior probability = 0.97, MP bootstrap = 91%) and has a pairwise distance of 9.03% from
Neolaurencia, its closest neighbouring clade, which is high enough to support generic separation.
Within the Coronaphycus clade there are two sequences, one is of Coronaphycus elatus material from WA and the other is a sequence from a NSW specimen representing Coronaphycus minorus.
In the rbcL only analyses, these two sequences are separated by a distance of 6.14%.
REMARKS:
Both molecular and morphological evidence justifies a species level separation between the two. Morphological features of C. minorus include a small, slightly curved thallus, with perennial growth and constrictions at the base of most branches, whereas C. elatus has a much larger, robust thallus, often branches in trichotomies, and lacks basal constrictions.
308 309 Figure 68. Habits of Coronaphycus minorus. Scale bar = 2cm.
(A) Tetrasporic thallus (Isotype YM194) collected subtidally from southern NSW (Jervis Bay).
(B) Cystocarpic thallus (Holotype YM196) collected subtidally from southern NSW (Jervis Bay).
(C) Spermatangial thallus (Isotype YM197) collected subtidally from southern NSW (Jervis Bay).
310 Figure 68. Habits of Coronaphycus minorus. Scale bar = 2cm.
311 Figure 69. Branch details of Coronaphycus minorus. Scale bar = 1mm.
(A) Branching structure showing new growth from old rhizoid (double arrowheads) and tetraspores within single ultimate branchlets (white arrows) (YM194).
(B) Tetrasporic branches showing compression and constriction at base (YM194).
(C) Highlight of tetrasporic branchlet showing parallel arrangement of tetraspores (YM194).
(D) Branching structure of plant (YM196).
(E) Branches showing cystocarps (white arrows) developing along penultimate branches
(YM196).
(F) Close up image of cystocarp (YM196).
(G) Sterile plant showing rhizoid holdfast (YM196).
(H) Image showing constriction at new growth sites (white arrows) and multiple seasons of growth from perennial base (YM196).
(I) Image showing curved and compressed branches, new growth from perennial base and thickened rhizoidal holdfast (YM196).
(J) Close up image of constriction at new growth site (YM196).
312 Figure 69. Branch details of Coronaphycus minorus. Scale bar = 1mm.
313 Figure 70. Microscopic details of Coronaphycus minorus.
(A). Longitudinal section through a spermatangial branchlet showing trichoblast type development (YM197). Scale bar = 100um.
(B) Details of spermatangial branches showing single sterile terminal vesicular cells (black arrows), and apical nuclei (white double arrowheads) (YM197). Scale bar = 25um.
(C) Longitudinal section through a branchlet showing secondary pit connections (YM194). Scale bar = 25um.
(D) Longitudinal section through a cystocarp showing carpospores (YM196). Scale bar =
100um.
(E) Transverse section through perennial old growth main axis showing secondary outer cortex
(white bracket) developing outside of the primary growth (black bracket) (YM194). Scale bar =
100um.
314 Figure 70. Microscopic details of Coronaphycus minorus.
315 316 Coronaphycus elatus (C. Agardh) Metti comb. nov.
(Figure 72)
Coronaphycus elatus is the type species of the genus Coronaphycus.
BASIONYM: Chondria pinnatifida var. elata C.Agardh (1822, p.340)
HOMOTYPIC SYNONYMS: Laurencia elata (C.Agardh) Harvey in Hooker and Harvey
1847:401, J. Agardh 1852:766, Harvey 1847:81, Kutzing 1849:856, Lucas 1909:39, Yamada
1931:241, Lucas and Perrin 1947: 249, Saito and Womersley 1974:837, Millar and Kraft 1993:54,
Huisman 2000:171, Nam and Choi 2001:289, Womersley 2003:475; Chondria pinnatifida var. elata
C. Agardh (1822, p.340); Laurencia pinnatifida var. elata (C. Agardh) Sonder (1846, p.177)
HETEROTYPIC SYNONYMS: Laurencia elata var. luxurians Harvey (1863, p. 26); Yamada
1931:242; Laurencia luxurians (Harvery) J. Agardh (1876, p.658); Lucas 1909:39, Yamada 1931:242
MISAPPLIED NAME: As Laurencia pinnatifida sensu Sonder 1880:30
TYPE LOCALITY: King Island, Bass Strait, Tasmania
TYPE SPECIMENS: Chondria pinnatifida var. elata (holotype): Herb. Agardh, LUND LD
#37235. Isotype in PC
SPECIMENS EXAMINED: Chondria pinnatifida var. elata (type) LD #37235. NSWA010900-
A010904
DNA VOUCHER: WA; JE01
DISTRIBUTIONS: (Figure 71) NSW: Split Solitary Island, Point Stephens, Mossy Point, And
Green Cape. AUSTRALIA: Tasmania, Western Australia, South Australia, Victoria, NSW.
WORLD: New Zealand
317 Figure 71. The distribution of Coronaphycus elatus in NSW includes the entire coast south of Coffs Harbour. The inset shows Australian distributions. The type location is King Island, indicated by black arrow.
DIAGNOSIS:
With typical generic characters (see Chapter 2); also angles between ultimate branchlets and supporting branch less than 45-degrees, plants up to 40cm in height, evenly compressed except at plant base where secondary cortication exists, denuded in lower branches.
REMARKS:
Chondria pinnatifida var. elata was described by C. Agardh based on specimens from King Island,
Bass Strait, Tasmania, and previous to this study was known as Laurencia elata. The specimens examined in this study from WA and southern NSW match the type material, particularly in the extensive secondary cortication that occurs at the base of supporting branches, and the compressed axes throughout, both of which are features typical of the genus Coronaphycus. The
WA material has been sequenced and in the molecular analyses shows it to be in the genus
Coronaphycus, sister to Coronaphycus minorus and not in the genus Laurencia. Therefore, a new combination is here created; Coronaphycus elatus comb. nov.
318 319 Figure 72. Habit of Coronaphycus elatus from Bass Strait (Type specimen LUND # 37235). Scale bar = 2cm.
320 Figure 72. Coronaphycus elatus type specimen LD #37235. Scale bar = 2cm.
321
322 Species recorded from, but not confirmed in NSW
Laurencia decumbens Kutzing
SPECIMENS RECORDED: NSW Cribb 1958 from Woolgoolga (Crib 1958)
REMARKS: The type location for Laurencia decumbens is New Caledonia, which makes its presence in NSW possible since already the two locales share Laurencia taxa. However, the above recorded specimens are missing, and new collections did not include this species, therefore it was not possible to confirm identifications or to determine the occurrence of L. decumbens in NSW.
323 Laurencia distichophylla J. Agardh
SPECIMENS EXAMINED: Jervis Bay NSW 290230 and Twofold Bay NSW 291080 (Millar and Kraft 1993: 54) Norfolk Island, NSW Herb. No.971
REMARKS: Laurencia distichophylla J. Agardh has been recorded in NSW from two southern locations, Jervis Bay and Twofold Bay (Millar and Kraft 1993, Womersley 2003). The Twofold
Bay specimen is identified as Laurencia sp4, and the Jervis Bay specimen represents L. queenslandica. The Norfolk Island specimen that is currently labelled L. distichophylla has no date or other location details recorded. It was originally labelled as Laurencia concinna, however, it also matches very well with Laurencia queenslandica. The type locality of Laurencia distichophylla is New
Zealand. It is here concluded that L. distichophylla has not yet been show to occur in NSW.
324 Laurencia filiformis (C. Agardh) Montagne
SPECIMENS EXAMINED: Jervis Bay (Millar and Kraft 1993), V. May collections
REMARKS: In the collections at NSW, the many Laurencia filiformis specimens represent a vast range of species, none of which appear to match what is currently recognized as L. filiformis, including the Jervis Bay specimens cited by Millar and Kraft (1993). With no new collections of
L. filiformis and no molecular data from its type location, it was not possible in the scope of this research to determine the presence of L. filiformis in NSW. Future work is needed to clarify the large L. filiformis complex taxa and their NSW distributions.
325 Laurencia minuscula Schnetter
SPECIMENS EXAMINED: NSW 402791-402793.
REMARKS: Five specimens exist in the NSW herbarium labelled Laurencia minuscula, all collected from Norfolk Island (Millar 1999). In comparison to photos of the type specimen from Colombia (Senties et al 2010), basic habits match well. However, the Norfolk Island samples are larger and more densely branched, have stoloniferous holdfasts, and do not have lenticular thickenings, whereas L. minuscula has a discoid holdfast, and shows lenticular thickenings. Additionally, L. minuscula has only been reported from tropical to subtropical western Atlantic locations. Based on morphological differences, biogeographical distributions and the lack of molecular data, this record cannot be confirmed.
326 Laurencia obtusa (Hudson) J. V. Lamouroux
SPECIMENS EXAMINED: NSW A005183-A005186, NSW A2861, NSW V. May #839 Port
Hacking, NSW V. May #303 Hawkesbury River, NSW V. May #2455 Tuggerah
REMARKS: Laurencia obtusa does not occur in NSW. In the molecular results, there is a sequence of L. obtusa (AF281881) from Ireland, which is very near to the type locality (England).
No NSW sequences nest with it indicating no L. obtusa has been newly collected from NSW during this study. In addition, the type location of England for L. obtusa makes it unlikely to be present in southeast Australia. Outside of this research the following specimens from the NSW
National Herbarium have been collected as L. obtusa from Botany Bay, NSW; NSW A005183-
A005186, NSW A2861. Each were examined and compared to the type specimen of L. obtusa and found to be morphologically more similar to Laurencia sp3. The L. obtusa type specimen has one percurrent axis, opposite branching at commonly 90-degree angles, whereas Laurencia sp3 has ultimate branchlets much more densely branched and much shorter than L. obtusa branchlets, tends to have multiple uprights and much wider main axes. Three other specimens, V. May
#839 Port Hacking, V. May #303 Hawkesbury River, and V. May #2455 Tuggerah are also labelled as Laurencia obtusa. Morphological examinations indicate these are not L. obtusa but in fact are good matches to Chondrophycus sp., which has less branch orders than L. obtusa, alternate ternate branching, ultimate branchlets that are much shorter than L. obtusa, and secondary branches much shorter in the lower half of the main axes than the upper half. In addition, habitat types differ significantly; L. obtusa has been reported from rocky marine shores, whereas
Chondrophycus sp. seems to prefer calm sites with freshwater inundation, such as coastal lakes or tidal rivers.
327 Laurencia platyclada Boergesen
SPECIMENS EXAMINED: NSW Split Solitary Island NSW289276, NSW289277 (Millar
2004)
REMARKS: The specimens cited by Millar (2004) are a good match with the type of Laurencia platyclada, however, since no new collections of this species were made no molecular data is available to help confirm identifications. The type location for Laurencia platyclada is Pakistan.
328 Laurencia rigida J. Agardh
SPECIMENS EXAMINED: Harvey LUND#36695, Agardh LUND #36694, MELU AM255,
NSW290986 (Cribb 1958, Millar 1990, Millar and Kraft 1993)
REMARKS: In J. Agardh’s LUND collection, two specimens are labelled as “TYPUS”; LUND
#36695, which is a Harvey specimen, and LUND #36694, which is the Agardh specimen.
Yamada (1931) and Millar (1990) state that the correct type of L. rigida is the specimen from northern Australia (LUND #36694) and not the Harvey collected specimen from Port Fairy in
Victoria (LUND #36695). The Harvey specimen may be an extreme variety of authentic
Laurencia rigida, however, preliminary comparisons of the habits of both seem to indicate these two specimens are not the same species. No specimens from NSW match the lectotype of L. rigida, but interestingly, some specimens newly collected in NSW for this study do resemble the
Harvey specimen (LUND #36695). Molecular results show these to be in the genus
Chondrophycus, and are what is described in this research as Chondrophycus sp. Specimens labelled
Laurencia rigida recorded from NSW are in fact Laurencia decussata. Laurencia decussata has robust and decussate branching with ultimate ramuli pressed close to the supporting branch, whereas the type of L. rigida has much longer branches in general except for the ultimate ramuli, which are shorter but less densely branched. Also in L. rigida branches towards the base of the plant are much longer than near the apex, whereas in L. decussata main branches are mostly denuded near the base and are more profusely branched in the top third of the supporting axis. Careful re- examination of both Harvey’s specimen and the lectotype of L. rigida, and closer morphological comparisons with Chondrophycus sp. to both, are needed to confirm the presence and distribution of L. rigida, and to which genus it belongs.
329
Chondrophycus papillosus (C. Agardh) Garbary and Harper
SPECIMENS EXAMINED: NSW A011003, NSW A011004 (loc: Plantation Point, Jervis Bay; coll: Valerie May date: 25/10/1973) (May 1981:342, Millar and Kraft 1993:55)
REMARKS: Specimens from Jervis Bay collected by Valerie May in 1973 are labelled Laurencia papillosa (Forsk.) Grev, which is currently known as Chondrophycus papillosus. Although the fertile ultimate ramuli are densely grouped together, which gives the appearance of Chondrophycus papillosus, the specimens from NSW are not C. papillosus but instead are tetraporic Laurencia decussata. On close inspection they show tetraspores aligned in a parallel fashion in relation to the main axial row and secondary pit connections. It is here concluded that C. papillosus has not yet been show to occur in NSW.
330 Chondrophycus succisus (A. B. Cribb) K. W. Nam
SPECIMENS EXAMINED: MELUK9993 (loc: Lord Howe Island; coll: G. Kraft; date: 1977)
(Millar and Kraft 1993:55)
REMARKS: This poor specimen from Lord Howe Island did not rehydrate well, but no secondary pit connections and no epidermal cell projection were seen. With a type locality of
Ball Bay, near Mackay in Queensland, it is very possible this specimen represents Chondrophycus succisus, but until a wider range of specimens is collected, this record cannot be confirmed.
331 332 Discussion
Many morphological characters are regularly reported for species within the Laurencia complex.
In this study, it was found that microscopic features rarely separate taxa at a species level.
Many of these internal morphological characters are useful instead at separating genera, such as the number of pericentral cells, the presence or absence of secondary pit connections and tetrasporangial origins (see Chapter 2). For the species found in NSW, the only internal, microscopic features that have been found helpful in separating species are the presence or absence of lenticular thickenings, and the projection of epidermal cells. Instead, the most useful characters are those having to do with plant habit, including; holdfast type, presence or absence of a percurrent axis, branching pattern and structure, thallus texture, and thallus compression.
Thallus compression has been a long standing and extremely useful character, and has consistently been used for separating Laurencia complex species since J. Agardh reorganized the group (J. Agardh 1863, J. Agardh 1876, Nam and Choi 2001, Furnari et al 2001). On a molecular level it is shown to be a secondarily derived character as it appears in species contained in various genera (Laurencia, Norfophycus, Coronaphycus and Osmundea). However, thallus compression is useful because it is a consistent feature within a species, and one that is easily observable.
Holdfast type is another morphological feature used to separate species in this study. The primary function of a holdfast is to anchor the plant, therefore it may be somewhat dependent on environmental conditions and seen as an unreliable feature. Usually, plants in the intertidal
333 have more robust holdfasts than their subtidal equivalents, however, the basic holdfast type stays consistent within a species. For instance, a basal crust may be larger or smaller but it is consistently different from a stoloniferous holdfast, making it a useful character for identifications.
A species’ overall habit can be described by the combined characters of; presence or absence of a percurrent axis, branching patterns and structure, and thallus texture. Because all plants display these characters, comparisons across species are possible. Unfortunately, species within the Laurencia complex have a confusing mixture of these and other morphological characters, which have made them traditionally very difficult to separate, often with the result that many varieties and formas are named.
When morphological features alone are not separating taxa at the species level, molecular data can be added to assist. To be helpful in species identifications at least two sequences, from the same gene region, are compared within a complete phylogeny; a sequence from the plant in question, and most importantly, a sequence of type location material of the species the plant is suspected to be. When molecular information is combined with the type method this way, and added to morphological information, species separations often become more clear. When the molecular information of NSW taxa was used in this way, previously recognized varieties and formas have been shown to be supported at the species level instead, including; Laurencia elegans, Laurencia decussata, Laurencia queenslandica and Laurencia dendroidea. A total of seventeen individual Laurencia complex species have been confirmed in NSW. In the genus Laurencia are;
L. calliptera, L. queenslandica, L. venusta, L. concinna, L. decussata, L. elegans, and L. dendroidea, in the genus Coronaphycus; Coronaphycus elatus, Coronaphycus minorus, in the genus Chondrophycus;
334 Chondrophycus cruciatus, and in the genus Norfophycus; Norfophycus originalis (Table 28, 29, 30). The molecular data has also resulted in six unidentified taxa at a species level. These require more material to confirm species identifications, however, each has been confirmed to genus level, and morphologically identified as unique in NSW. These may, in all likelihood, represent new and undescribed species. There are four taxa in Laurencia, one in Chondrophycus and one in
Norfophycus.
335
Species previously recorded in NSW Reference Species in NSW according to this study Laurencia brongniartii Saito and Womersley 1974, Millar 1990, Womersley 2003 Laurencia calliptera Laurencia brongniartii Cribb 1983, Millar 1999 Laurencia concinna Laurencia concinna Lucas 1935, A.B.Cribb 1958 Laurencia concinna Laurencia decumbens (as Laurencia pygmaea) Millar and Kraft 1993, A.B.Cribb 1958 possible, not confirmed Laurencia distichophylla Millar and Kraft 1993, Womersley 2003 Laurencia queenslandica stat. nov. Laurencia elata Millar and Kraft 1993, Womersley 2003 Coronaphycus elatus comb. et stat. nov. Laurencia filiformis Womersley 2003, Millar and Kraft 1993, Millar 1999 possible, not confirmed Laurencia heteroclada f. decussata A.B.Cribb 1958 Laurencia decussata stat. nov. Laurencia filiformis f. heteroclada Millar and Kraft 1993 possible, not confirmed Laurencia majuscula Womersley 2003, Millar and Kraft 1993, Millar 1999 Laurencia dendroidea Laurencia majuscula var. elegans A.H.S. Lucas 1935, Saito and Womersley 1974 Laurencia elegans stat. nov. Laurencia minuscula Millar 1999 possible, not confirmed Laurencia obtusa A.B.Cribb 1958, Millar and Kraft 1993, Millar 1999 not in NSW Laurencia obtusa var. compacta Millar and Kraft 1993, A.B.Cribb 1958 not in NSW Laurencia obtusa var. dendroidea Millar 1999 Laurencia dendroidea Laurencia platyclada Millar 2004 possible, not confirmed Laurencia rigida Millar and Kraft 1993, A.B.Cribb 1958 Laurencia decussata stat. nov. Laurencia tenera Millar and Kraft 1993, A.B.Cribb 1958 possible, not confirmed Laurencia venusta Millar and Kraft 1993 Laurencia venusta Palisada cruciata Womersley 2003, Millar and Kraft 1993 Chondrophycus cruciatus Palisada flagelliferus (as Laurencia flagellifera) Millar 1999 possible, not confirmed Palisada papillosus Millar and Kraft 1993, Millar 1999 Laurencia decussata stat. nov. Chondrophycus succisus Millar and Kraft 1993 possible, not confirmed Chondria infestans (as Laurencia infestans) A.H.S. Lucas 1919, Millar 1990 Chondria infestans not previously recorded in NSW Laurencia queenslandica stat. nov. not previously recorded in NSW Coronaphycus minorus sp. nov.
336 not previously recorded in NSW Norfophycus originalis sp. nov. not previously recorded in NSW Laurencia sp1 possible sp. nov. not previously recorded in NSW Laurencia sp2 possible sp. nov. not previously recorded in NSW Laurencia sp3 possible sp. nov. not previously recorded in NSW Laurencia sp4 possible sp. nov. not previously recorded in NSW Chondrophycus sp possible sp. nov. not previously recorded in NSW Norfophycus sp possible sp. nov.
Table 28. A list of species previously recorded in NSW, along with the references in which the records are published. The column on the far right indicates the current name according to the results of this study.
337 338 Species Authority Status Laurencia calliptera Kutzing confirmed Laurencia queenslandica (A. B. Cribb) Metti comb. et stat. nov Laurencia concinna Montagne confirmed Laurencia decumbens Kutzing possible, not confirmed Laurencia decussata (A. B. Cribb) Metti comb. et stat. nov Laurencia dendroidea J. Agardh confirmed Laurencia elegans A. H. S. Lucas stat. nov Laurencia minuscula Schnetter possible, not confirmed Laurencia tenera C. K. Tseng possible, not confirmed Laurencia venusta Yamada confirmed Chondrophycus cruciatus (Harvey) Garbary and Harper confirmed Chondrophycus succisus (A. B. Cribb) K.W. Nam possible, not confirmed Coronaphycus elatus (C. Agardh) Metti gen. et comb. nov. Coronaphycus minorus Metti sp. nov. Norfophycus originalis Metti gen. et sp. nov. Laurencia sp1 further work required for identification Laurencia sp2 further work required for identification Laurencia sp3 further work required for identification Laurencia sp4 further work required for identification Chondrophycus sp further work required for identification Norfophycus sp further work required for identification
Table 29. A list of species within the Laurencia complex present in NSW, Australia as concluded from molecular and morphological evidence in this study.
339
Previous name Current name Laurencia brongniartii J. Agardh Laurencia brongniartii J. Agardh Laurencia brongniartii J. Agardh Laurencia concinna Montagne Laurencia brongniartii J. Agardh Laurencia grevilleana Harvey Laurencia elata C.Agardh Coronaphycus elatus (C.Agardh) Metti comb. nov. Laurencia heteroclada f. decussata (A.B.Cribb) Laurencia decussata (A.B.Cribb) Metti stat. nov Laurencia majuscula A.H.S.Lucas Laurencia dendroidea J. Agardh Laurencia majuscula v. elegans (A.H.S.Lucas) Saito and Womersley Laurencia elegans A.H.S.Lucas Laurencia pedicularioides v. queenslandica (A.B.Cribb) Laurencia queenslandica (A.B.Cribb) Metti stat. nov. Palisada cruciata (Harvey) K.W.Nam Chondrophycus cruciatus (Harvey) K.W.Nam
Table 30. A summary of nomenclatural changes resulting from this study.
340
CHAPTER 4
Methodologies and References
Introduction
This chapter outlines the methodologies behind the molecular analyses undertaken in chapters two and three, including taxon sampling, gene selections, congruence between gene markers,
Genbank sequence inclusions, the reporting of uncorrected ‘p’ distances and outgroup selections.
Taxon sampling
Multiple samples of each species were sequenced where possible. Samples to be sequenced were selected based on the morphology of plants within each species group. Both the morphologically extreme and the morphologically typical plants were sequenced from each taxon. Multiple sequences per species were acquired to ensure a clear understanding of genetic variation within species, and a stronger confidence in sequence results. For final analyses, exact duplicate sequences were removed for more precise tree search results.
Gene selections
The rbcL coding region
In red algae, the RuBisCO genes are plastid markers found in the chloroplast. The RuBisCO holoenzyme is made up of large (rbcL) and small subunits (rbcS), which are separated by a non- coding spacer region. The RuBisCO genes codes for the enzyme ribulose 1,5-bisphosphate carboxylase-oxygenase (RuBisCO) which is the most abundant protein on Earth and is found in every organism that photosynthesizes (Cooper 2000). The coding rbcL gene region was used
341 for comparison in this study. This gene was selected for a number of reasons; it is universal among plants and so results are possible to compare with other algae and photosynthesizers in general; indels are exteremely rare in most algal lineages; it has established primers for
Rhodophyta; it has been shown to work well for the level of inquiry this study requires i.e. genus and species (McIvor et al 2002, Cassano et al 2009, Martin-Lescanne et al 2010) Because it is a protein coding gene it is highly conserved. It has been show to be variable within the algae (Freshwater et al. 1994, McIvor et al. 2002, Díaz-Larrea et al. 2007, Cassano et al. 2009).
It has become one of the more common genes to sequence and as such, most other Laurencia complex sequences published have been of the rbcL gene. By using the rbcL gene for this study it will be possible to compare results.
The rbcL-rbcS non-coding Spacer Region
The rbcL-rbcS spacer region was also selected for some analyses in this study. It is a non-coding region of variable length depending on the species sequenced. This variability in length means an alignment is simplest to achieve when comparing taxa of the same, or closely related, genera.
Indels (gaps) were necessary to add in the spacer region of the gene for base pair alignment.
This was done first through the online program TCOFFEE (Notredame et al 2000) and further fine-tuned by eye using Sequencher (Gene Codes Corp., Ann Arbor, MI, USA). Indels were positioned to reduce the number of mutational events necessary for their creation. Alignments and length variation in the spacer region limited the outgroups available for use in the analyses, making Chondria succulenta from NSW the only outgroup option for exploring the Laurencia complex species from NSW.
The COX1 coding region
342 The COX1-5’ gene region is a mitochondrial marker coding for cytochrome oxidase subunit I
(cox1). It is currently the global ‘barcoding’ gene of choice, particularly for animals (Hebert et al 2003). COX1 has a high level of interspecific variability, which makes it useful for determining species and populations. It has been shown to be useful in separating the
Rhodophyta at a species level as well (Saunders 2005, Yang et al 2008). It was selected for this study to complement the rbcL molecular data. In using genetic information from both plastid and mitochondrial DNA, the chances of reflecting a true species phylogeny are increased, as opposed to just a phylogeny of a single gene.
Pseudogenes
RbcL is a plastid gene. It is possible for plastid genes to have non-functional copies, or pseudogenes, within the nuclear gene set. When the target plastid gene is amplified, these non- functional copies can also be amplified. Since they are not used for coding they can mutate without deleterious results for the organism, which can result in a different amplified sequence of the same gene in the same sample. By sequencing both forward and reverse complements of each sequence and using species replicates, the risk of including pseudogenes has been greatly reduced. The program Sequencher (Gene Codes Corp., Ann Arbor, MI, USA) was also used to help detect pseudogenes. When the open reading frame for the sequence is lost it may indicate the presence of pseudogenes.
Genbank
Additional sequences for Laurencia complex taxa were downloaded from Genbank (Benson et al
2004) and added to the PAUP nexus file. To be included in the alignment Genbank sequences for the rbcL gene and the rbcL-rbcS spacer were required to meet certain criteria, which include: 343 A) sequenced from type locality material, B) vouchered, and C) published. COX1 sequences available on Genbank were limited so those included in the alignment that did not meet the above criteria were limited to outgroup taxa only.
A ‘blast’ search was conducted to determine if the sequences acquired were within the
Laurencia complex and not from an epiphyte or parasite (Zhang et al 2000). All acquired
Laurencia complex sequences were most similar with other Laurencia complex sequences.
Mutational saturation
Mutational saturations were examined for codon positions 1, 2, 3 and 1+2. This was done by comparing uncorrected ‘P’ distances matrix for each taxon with corrected distances. Saturation is said to occur when the graph of these differences becomes horizontal. Saturation obscures any information that base changes may give, and will have to be excluded from the analyses.
Codon position 3 is most variable with changes being synonymous and having no effect on the coded amino acid. There was no mutational saturation at any of the codons. Corrected distances were obtained from PAUP by entering the correct evolutionary model for the data set.
Evolutionary models were obtained using Modeltest3.7 (Posada and Crandall 1998).
Uncorrected ‘P’ distances
Uncorrected ‘P’ distances were calculated using ‘showdist’ and ‘savedist’ in PAUP for PC (v.4.0 beta10, Swofford 2003). These are a measure of distance or percentage difference between each taxon and every other taxon. They can be used as another guide in deciding how far clades or taxa are from each other and to see if distances are great enough to support specific or generic separation. The ‘savedist’ command was also used to save the absolute base pair differences 344 between sequences. Distances need to be considered in light of other evidence but can be useful indicators of relationships between taxa. In Laurencia phylogenies using rbcL, distances of around 10% are high enough to be considered separate genera, distances between 2% and
8% are considered within the one genus and taxa with distances of less than 2% are generally accepted as being within same species (Martin-Lescanne et al 2010, Diaz-Larrea et al 2007,
Cassano et al 2009).
Congruence between gene markers
All DNA sequence information was aligned within a nexus file. The alignments were partitioned by gene region (rbcL, spacer, COX1) allowing the data to be analyzed all together or in various combination. The codons were non-saturated therefore, the data was not partitioned by codon.
The partitions were tested for congruence using the partition-homogeneity test (PHT) (Farris et al 1995, Cunningham 1997). This is done by measuring the incongruence length difference
(ILD), which is the difference between the number of steps resulting from the individual analysis and the number of steps resulting from the combined analyses (Mickevitch and Farris 1981).
Congruence of phylogenetic signal between two data sets means the resulting phylogenies are similar. If two data sets are congruent then analysis of the combined set of sequences will yield favourable results. If two data sets are not congruent, analyzing them together is not advisable.
PHT was implemented in PAUP, with 100 replicates and the heuristic search option, using the command ‘hompart’. Data sets were found to be congruent in the following combinations of gene markers, and were, therefore, analyzed together to further the precision of resulting phylogenies: rbcL and COX1 combined, and rbcL and spacer combined.
Outgroup Selection
345 Outgroup comparison is a common strategy used to root phylogenetic trees. Using outgroups gives polarity to character states. An outgroup needs to be more distantly related to any of the ingroup than the ingroup is to itself, but close enough that character state saturation doesn’t eliminate any phylogenetic signal. For Laurencia studies Chondria is frequently used as an outgroup since it is closely related to the Laurencia complex. Other outgroup members from outside the family Rhodomelaceae were also selected, as was one member from outside the order
Ceramiales.
346
References
ABBOTT, I. A. (1999). Marine red algae of the Hawaiian Islands. Bishop Museum Press, Honolulu, Hawaii 477 pp.
ADAMS, N. M. (1994) Seaweeds of New Zealand. An Illustrated Guide. Christchurch: Canterbury University Press.
AGARDH, C. A. (1822). Species algarum rite cognitae, cum synonymis, differentiis specificis et descriptionibus succinctis. Volumen primum pars posterior. pp.169-398. Lund: ex officina Berlingiana.
AGARDH, J. G. (1841). In historiam algarum symbolae. Linnaea 15:1-50, 443-457.
AGARDH, J. G. (1852). Species genera et ordines algarum, seu descriptiones succinctae specierum, generum et ordinum, quibus algarum regnum constituitur. Volumen secundum: algas florideas complectens. Part 3, fasc. 1. pp. 701-786. Lund: C.W.K. Gleerup.
AGARDH, J. G. (1863). Species genera et ordines floridearum, seu descriptiones succinctae specierum generum et ordinum, quibus floridearum classis constituitur. Voluminis secundi: pars tertia. Lund: C. W. K. Gleerup
AGARDH, J. G. (1876). Species genera et ordines algarum, seu descriptiones succinctae specierum, generum et ordinum, quibus algarum regnum constituitur, volumen tertium: de florideis curae posteriores. Epicrisis systematis floridearum. Lipseae: Apud T. O. Weigel.
AGARDH, J. G. (1879) Florideernes morphologi. Öfversigt af Kongl. Vetenskaps-Adademiens Förhandlingar, Series 4 15(6): 1-199, pls I-XXXIII.
BENSON, D. A., KARSCH-MIZRACHI, I., LIPMAN, D. J., OSTELL, J., AND WHEELER, D. L. (2004). GenBank: update Nucleic Acids Research, 32 (D23-D26) © 2004 Oxford University Press
CASSANO, V., J. DÍAZ-LARREA, SENTIES, A., OLIVEIRA, M. C., GIL-RODRIGUEZ, C., AND FUJII, M. T. (2009). Evidence for the conspecificity of Palisada papillosa with P. perforata (Ceramiales, Rhodophyta) from The Western and Eastern Atlantic Ocean on The Basis of Morphological and Molecular Analyses. Phycologia 48(2): 86 - 100.
CASSANO, V., METTI, Y., MILLAR, A. J. K., GIL-RODRIGUEZ, C., SENTIES, A., DIAZ-LARREA, J., OLIVEIRA, M., AND FUJII, M. T. (in press). Redefining the taxonomic status of Laurencia dendroidea (Ceramiales, Rhodophyta) from Brazil and the Canary Islands. European Journal of Phycology (in press)
COOPER, G. M. (2000). The Chloroplast Genome. The Cell - A Molecular Approach. Sunderland, Missachusetts, Sinauer Associates, Inc.
347 CRIBB, A. B. (1958). Records of marine Algae from South-Eastern Queensland - III. Laurencia Lamx. Department of Botany 3(19): 159 - 191.
CRIBB, A. B. (1983). Marine algae of the southern great barrier reef. Brisbane, Australian Coral Reef Society.
CUNNINGHAM, C. W. (1997). Is congruence between data partitions a reliable predictor of phylogenetic accuracy? Empirically testing an iterative procedure for choosing among phylogenetic methods. Syst. Biol. 46 (3): 464-478
DE CLERCK, O., BOLTON, J., ANDERSEN, R.J., AND COPPEJANS, E. (2005). Guide to the seaweeds of Kwazulu-Natal. Meise, National Botanic Garden of Belgium, 294 pp. Scripta Botanica Belgica, Vol. 33. dE JONG, Y. D. M., VAN DER WURFF, A. W. G., STAM, W. T., AND OLSEN, J. L. (1998) Studies on Dasyaceae. 3. Towards a phylogeny of the Dasyaceae (Ceramiales, Rhodophyta), based on comparative rbcL gene sequences and morphology. Eur. J. Phycol. 33: 187-201
DE NYS, R., DWORJANYN, S. A., AND STEINBERG, P. D. (1998). A new method for determining surface concentrations of marine natural products on seaweeds. Mar. Ecol. Prog. Ser. 162:79- 87.
DÍAZ-LARREA, J., SENTÍES, A., FUJII, M. T., PEDROCHE, F. F. AND OLIVEIRA, M. C. (2007). Molecular evidence for Chondrophycus poiteaui var. gemmiferus comb. et stat. nov. (Ceramiales, Rhodophyta) from the Mexican Caribbean Sea: implications for the taxonomy of the Laurencia complex. Botanica Marina 50: 250 - 256.
FALKENBERG, P. (1901). Die Rhodomelaceen des Golfes von Neapel und der angrenzenden Meeres- Abschnitte. Fauna und Flora des Golfes von Neapel, Monographie 26. pp. i-xvi, 1-754, 10 figs, 24 pls. Berlin.
FARRIS, J. S., KALLERSJO, M., KLUGE, A. G. AND BULT, C. (1995). Constructing a significance test for incongurence. Syst. Biol. 44(4): 570-572.
FELSENSTEIN, J. (1985). Confidence limits on phylogenies: an approach using the bootstrap. Evolution 39(4): 783-791.
FITCH, W. M. (1971). Toward defining the course of Evolution: minimum change for a specific tree topology. Systematic Biology 20(4): 406-416.
FRESHWATER, D. W., FREDERICQ, S., BUTLER, B. S., HOMMERSAND, M. H. AND CHASE, M. W. (1994). A gene phylogeny of the red algae (Rhodophyta) based on plastid rbcL. Proc. Natl. Acad. Sci. USA 91(July 1994): 7281-7285.
FRESHWATER, D. W., AND RUENESS, J. (1994). Phylogenetic relationships of some European Gelidium (Gelidiales, Rhodophyta) species, based on rbcL nucleotide sequence analysis. Phycologia 33(3): 187-194.
348 FUJII, M. T., GUIMARAES, S. M. P. B., GURGEL, C. F. D. AND FREDERICQ, S. (2006). Characterization and phylogenetic affinities of the red alga Chondrophycus flagelliferus (Rhodomelaceae, Ceramiales) from Brazil on the basis of morphological and molecular evidence. Phycologia 45(4): 432-441.
FURNARI, G., CORMACI, M. AND SERIO, D. (2001). The Laurencia complex (Rhodophyta, Rhodomelaceae) in the Mediterranean Sea: an overview. Cryptogamie, Algol. 22 (4): 331 - 373.
FURNARI, G. AND SERIO, D. (1993). The distinction of Laurencia truncata (Ceramiales, Rhodophyta) in the Mediterranean Sea from Laurencia pinnatifida. Phycologia 32 (5): 367 - 372.
FURNARI, G., SERIO, D. AND CORMACI, M. (2004). Revision of Laurencia pedicularioides (Ceramiales, Rhodophyta). Taxon 53(2): 453 - 460.
GARBARY, D. J. AND HARPER, J. T. (1998). A phylogenetic analysis of the Laurencia complex (Rhodomelaceae) of the red algae. Cryptogamie, Algol. 19 (3): 185-200.
GIL-RODRÍGUEZ, M. C., SENTÍES, A., DÍAZ-LARREA, J., CASSANO, V. AND FUJII, M. T. (2009). Laurencia marilzae sp. nov. (Ceramiales, Rhodophyta) from the Canary Islands, Spain, based on morphological and molecular evidence. Journal of Phycology 45: 264 - 271.
HARVEY, W. H. (1847). Nereis australis, or algae of the southern ocean: being Figures and descriptions of marine plants, collected on the shores of the Cape of Good Hope, the extra-tropical Australian colonies, Tasmania, New Zealand, and the Antarctic regions; deposited in the Herbarium of the Dublin University. Part 1. pp. i-viii, 1-64, pls I-XXV. London: Reeve Brothers.
HARVEY, W. H. (1849). Some account of the marine botany of the colony of western Australia. Transactions of the Royal Irish Academy 22: 525 - 566.
HARVEY, W.H. (1854). Short characters of three new algae from the shores of Ceylon. Hooker's Journal of Botany and Kew Garden Miscellany 6: 143-145, pls V, VI.
HARVEY, W. H. (1855). Some account of the marine botany of the colony of western Australia. Transactions of the Royal Irish Academy 22: 525-566.
HARVEY, W. H. (1863). Phycologia australica: or, a history of Australian seaweeds; comprising coloured Figures and descriptions of the more characteristic marine algae of New South Wales, Victoria, Tasmania, South Australia, and Western Australia, and a synopsis of all known Australian algae. Vol. 5. pp. [i]- x, v-lxxiii (Synoptic catalogue), Plates CCXLI-CCC (with text). London: Lovell Reeve.
HEBERT, P. D. N., RATNASINGHAM, S. AND DEWAARD, J. R. (2003) Barcoding Animal Life: Cytochrome c Oxidase Subunit 1 Divergences among Closely Related Species. Proceedings: Biological Sciences, Vol. 270, Supplement: Biology Letters, pp. S96-S99: The Royal Society
HOOKER, J.D. AND HARVEY, W.H. (1847). Algae tasmanicae: being a catalogue of the species of algae collected on the shores of Tasmania by Ronald Gunn, Esq., Dr. Heannerett, Mrs.
349 Smith, Dr. Lyall and Dr. J.D. Hooker; with characters of the new species. London Journal of Botany 6:397-417.
HOWE, M. A. (1934). Hawaiian algae collected by Dr Paul C. Galtsoff. Journal of the Washington Academy of Sciences 24: 32-42, 5 figs.
HUELSENBECK, J. P. AND RONQUIST, F. (2001). MrBayes: Bayesian inference of phylogenetic trees. Bioinformatics 17:754–755.
HUISMAN, J. M. (2000). Marine Plants of Australia. Nedlands, Western Australia, University of Western Australia Press.
JUNG, W. K., CHOI, I., OH, S., SAE-GWANG PARK, S. G., SEO, S. K., LEE, S. W., LEE, D. S., SOO-JIN HEO, S. J., YOU-JIN JEON, Y. J., JE, J. Y., AHN, C. B., KIM, J. S., OH, K. S., YOUNG- MOG KIM, Y. M., MOON, C. AND CHOI, I. W. (2009). Anti-asthmatic effect of marine red alga (Laurencia undulata) polyphenolic extracts in a murine model of asthma. Food and Chemical Toxicology 47: 293–297
KERSWELL, A. P. (2006). Global biodiversity patterns of benthic marine algae. Ecology 87 (10): 2479-2488.
KIM, M. S. AND YANG, E. C. (2005). Taxonomic Note of Polysiphonia pacifica (Ceramiales, Rhodophyta) Complex with focus on Pacific Isolates. Algae 20(1): 15-23
KRAYESKY, D. M., NORRIS, J. N., GABRIELSON, P. W., GABRIELA, D. AND FREDERICQ, S., (2009). A new order of red algae based on the Peyssonneliaceae, with an evaluation of the ordinal classification of the Florideophyceae (Rhodophyta). Proc. Biol. Soc. Wash. 122: 364– 391.
KUTZING, F. T. (1849). Species Algarum. 922 pp.; A.. Asher and Co., Amsterdam. Reprint 1969.
KUTZING, F. T. (1865) Tabulae Phycologicae vol. XV, 100 pls. Nordhausen. 36 pp.
KYLIN, H. (1923). Studien über die Entwicklungsgeschichte der Florideen. Bihang til Kongliga Svenska Vetenskaps-Akademiens Handlingar 63(11): 1-139.
KYLIN, H. (1925). The marine red algae in the vicinity of of the Biological Station at Friday Harbor, Wash. Lunds Universitets Årsskrift, Ny Följd, Andra Afdelningen 21(9): 1-87, 47 figs.
KYLIN, H. (1928). Entwicklungsgeschichtliche Florideenstudien. Lunds Univ. Arsskr. N.F. Avd. 2 84(4): 1-127.
KYLIN, H. (1956). Die Gattungen der Rhodophyceen. Lund: Gleerups.
LAMOUROUX, J. V. F. (1813). Essai sur les genres de la famille des thalassiophytes non articulées. Annales du Muséum d'Histoire Naturelle, Paris 20: 21-47, 115-139, 267-293, pls 7-13.
350 LUCAS, A. H. S. (1909). Revised list of the Fucoideae and Florideae of Australia. Proceedings of the Linnean Society of New South Wales 34: 9-60.
LUCAS, A. H. S. (1919). Notes on Australian marine algae, ii. Descriptions of four new species. Proceedings of the Linnean Society of New South Wales 44(1).
LUCAS, A. H. S. (1927). Notes on Australian marine algae. The proceedings of the Linnean Society of New Wales 1ii(part 4).
LUCAS, A. H. S. (1935). The marine algae of Lord Howe Island. The proceedings of the Linnean Society of New Wales 1x (parts 3-4).
LUCAS, A. H. S. AND PERRIN, F. (1947). The seaweeds of South Australia Part II. The red seaweeds. pp. 107-458, 202 figs. Adelaide: Government Printer.
MARTIN-LESCANNE, J., ROUSSEAU, F., DE REVIERS, B., PAYRI, C., COULOUX, A., CRUAUD, C. AND LE GALL, L. (2010): Phylogenetic analyses of the Laurencia complex (Rhodomelaceae, Ceramiales) support recognition of five genera: Chondrophycus, Laurencia, Osmundea, Palisada and Yuzurua stat. nov. European Journal of Phycology 45(1): 51-61
MASUDA, M. (1997). A new species of Laurencia, L. omaezakiana (Ceramiales, Rhodophyta) from Japan. Phycological Research 45(3): 123 - 131.
MCIVOR, L., MAGGS, C. A., GUIRY, M. D. AND HOMMERSAND, M. H. (2002). Phylogenetic Analysis of the Geographically Disjunct Genus Osmundea Stackhouse (Rhodomelaceae, Rhodophyta). Constancea 83.
MICKEVICH, M. F., FARRIS J. S. (1981). The implications of congruence in Menidia. Systematic Zoology 30: 351-370.
MILLAR, A. J. K. (1990). Marine Red Algae of the Coffs Harbour Region, Northern New South Wales. Australian Systematic Botany 3: 293 - 593.
MILLAR, A. J. K. (1999). Marine Benthic Algae of Norfolk Island, South Pacific. Australian Systematic Botany 12: 479 - 547.
MILLAR, A. J. K. (2004). New records of marine benthic algae from New South Wales, Eastern Australia. Phycological Research 52(2): 117 - 128.
MILLAR, A. J. K. AND G. T. KRAFT (1993). Catalogue of Marine and Freshwater Red Algae (Rhodophyta) of New South Wales, including Lord Howe Island, South-western Pacific. Aust. Syst. Bot. 6: 1-90
MILLAR, A. J. K. AND PRUD'HOMME VAN REINE, W. F. (2005). Marine benthic macroalgae collected by Vieillard from New caledonia and described as new species by Kutzing. Phycologia 44 (5): 536-549.
351 MONTAGNE, C. (1842). Prodromus generum specierumque phycearum novarum, in itinere ad polum antarcticum. ab illustri Dumont d'Urville peracto collectarum, notis diagnosticis tantum huc evulgatarum, descriptionibus verò fusioribus nec no iconibus analyticis jam jamque illustrandarum. pp. 1-16. Paris: apud Gide.
NAM, K. W. (1999). Morphology of Chondrophycus undulata and C. parvipapillata and its implicatons for the taxonomy of the Laurencia (Ceramiales, Rhodophyta) complex. European Journal of Phycology 34: 455 - 468.
NAM, K. W. (2006). Phylogenetic re-evaluation of the Laurencia complex (Rhodophyta) with a description of L. succulenta sp. nov. from Korea. Journal of Applied Phycology 18: 679 - 697.
NAM, K. W. (2007). Validation of the Generic name Palisada (Rhodomelaceae, Rhodophyta). Algae 22(2): 53 - 55.
NAM, K. W. AND CHOI, H. G. (2000). A Detailed Morphological Study of the Type Species of Osmundea (Rhodomelaceae, Rhodophyta). Botanica Marina 43(2000): 291-297.
NAM, K. W. AND CHOI, H. G. (2001). Morphology of Laurencia clavata and L. elata (Ceramiales, Rhodophyta) in relation to generic circumscription in the Laurencia complex. European Journal of Phycology 36(2001): 285-294.
NAM, K. W., MAGGS, C. A. AND GARBARY, D. J. (1994). Resurrection of the genus Osmundea with an emendation of the generic delineation of Laurencia (Ceramiales, Rhodophyta). Phycologia 33(5): 384 - 395.
NAM, K. W., MAGGS, C. A., MCIVOR, L. AND STANHOPE, M. J. (2000). Taxonomy and phylogeny of Osmundea (Rhodomelaceae, Rhodophyta) in Atlantic Europe. Journal of Phycology 36: 759 - 772.
NAM, K. W. AND SAITO, Y. (1991). Laurencia similis (Ceramiales, Rhodophyta), a New Species from Queensland, Australia. Br. phycol. J. 26(December 1): 375-382.
NAM, K. W. AND SAITO, Y. (1995). Vegetative and reproductive anatomy of some Laurencia (Ceramiales, Rhodophyta) species with a description of L. maris-rubri sp. nov. from the Red Sea. Phycologia 34(2): 157-165.
NAM, K. W. AND SOHN, C. H. (1994). Laurencia kangjaewonii sp. nov. (Ceramiales, Rhodophyta) from Korea. Phycologia 33 (6): 397-403
NOTREDAME, C., HIGGINS, D. G. AND HERINGA, J. (2000). T-Coffee: A novel method for fast and accurate multiple sequence alignment. J. Mol. Biol. 302: 205-217
PAPENFUSS, G. F. (1943). Notes on South African marine Algae, II. The Journal of South African Botany 9:79-92.
352 PAPENFUSS, G. F. (1947). Generic names of algae proposed for conservation. I. Madroño 9: 8- 17.
PAPENFUSS, G. F. (1950). Review of the genera of algae described by Stackhouse. Hydrobiologia 2(3): 181 - 300.
PARADAS, W. C., SALGADO, L. T., SUDATTI, D. B., CRAPEZ, M. A., FUJII, M. T., COUTINHO, R., PEREIRA, R. C. AND AMADO FILHO, G. M. (2010). Induction of halogenated vesicle transport in cells of the red seaweed Laurencia obtusa. Biofouling 26(3): 277-286
POSADA, D. AND CRANDALL, K. A. (1998). MODELTEST: testing the model of DNA substitution. Bioinformatics 14(9): 817-818.
ROCHA-JORGE, R., CASSANO, V., OLIVEIRA, M. C. AND FUJII, M. T. (2010). The occurrence of Laurencia marilzae (Ceramiales, Rhodophyta) in Brazil based on morphological and molecular data. Bot. Mar 53(2): 143-152
RONQUIST, F., HUELSENBECK, J. P. AND VAN DE MARK, P. (2005). MrBayes 3.1 Manual. http://mrbayes.sourceforge.net/manual.php
SAITO, Y. (1967). Studies on Japanese species of Laurencia, with special reference to their comparative morphology. Faculty of Fisheries, Hokkaido University.
SAITO, Y. (1969). The Algal Genus Laurencia from the Hawaiian Islands, the Philippine Islands and Adjacent Areas. Pacific Science XXIII(No 2 April): 148-160.
SAITO, Y. (1982). Morphology and infrageneric position of three British species of Laurencia (Ceramiales, Rhodophyta). Phycologia 21(3): 299-306.
SAITO, Y. AND WOMERSLEY, H. B. S. (1974). The Southern Australian Species of Laurencia (Ceramiales: Rhodophyta). The Australian Journal of Botany 22: 815-74.
SAUNDERS, G. (2005). Applying DNA barcoding to red macroalgae: a preliminary appraisal holds promise for future applications. Philosophical transactions of the Royal Society B 360: 1879 - 1888.
SCHMITZ, F. (1889). Systematische Übersicht der bisher bekannten Gattungen der Florideen. Flora oder Allgemeine botanische Zeitung 72: 435-456, pl. XXI.
SENTIES, G. A., ARECES, A., DIAZ-LARREA, J. AND FUJII, M.T. (2010). First records of Laurencia caduciracmulosa and L. minuscula (Ceramiales, Rhodophyta) from the Cuban archipelago. Botanica Marina 53(5): 433-438
SENTIES, G. A. AND DIAZ-LARREA, J. (2008). Proposals for Palisada poiteaui var. gemmifera comb. nov. and Palisada corallopsis comb. nov. (Rhodomelaceae, Rhodophyta). Botanica Marina 51: 69 - 70.
353 SENTIES, A., DIAZ-LARREA, J., CASSANO, V., GIL-RODRIGUEZ, M. C. AND FUJII, M. T. (2011). Laurencia marilzae (Ceramiales, Rhodophyta) from the Mexican Caribbean: A New Record for the Tropical Western Atlantic. Bulletin of Marine Science 87(3): 681-686
SENTIES, G. A., FUJII, M. T. AND RODRIGUEZ, D. (2001). Laurencia venusta (Ceramiales, Rhodophyta): a New Record from the Atlantic Ocean. Botanica Marina 44: 95 - 99.
SILVA, P. C., BASSON, P. W. AND MOE, R. L. (1996). Catalogue of the benthic marine algae of the Indian Ocean. University of California Publications in Botany 79: 1-1259.
SONDER, O. G. (1846). Algae L. Agardh. In: Plantae Preissianae sive enumeratio plantarum quas in Australasia occidentali et meridionali-occidentali annis 1838-1841 collegit Ludovicus Preiss. (Ed. Lehmann, C.) Vol. 2, pp. 148-160. Hamburg: sumptibus Meissneri.
SONDER, O. G. (1880). Supplementum ad volumen undecimum Fragmentorum phytographiae Australiae, indices plantarum acotyledonarum complectens. I. - Algae australianae hactenus cognitae. In: Fragmenta phytographiae Australiae. (Ed. Mueller, F. von), pp. 1-42. Melbourne: Auctoriatate Guberni Coloniae Victoriae. Ex officina Joannis Ferres.
STACKHOUSE, J. (1809). Tentamen marino-cryptogamicum, ordinem novum; in genera et species distributum, in Classe XXIVta Linnaei sistens. Mémoires de la Société Imperiale des Naturalistes de Moscou 2: 50-97.
STACKHOUSE, J. (1816). Nereis britannica Editio altera. Nova addita classificatione cryptogamiarum [sic] respectu generis Fuci. pp. i-xii, i-68, 20 pls. Oxford: excudebat S. Collingwood.
SWOFFORD, D. L. (2003). Paup* v4b. computer program. Sinauer Associates, Sunderland, MA.
THIERS, B. (2009). Index Herbariorum: A global directory of public herbaria and associated staff. New York Botanical Garden's Virtual Herbarium. http://sweetgum.nybg.org/ih/
TSENG, C. K. (1943). Marine Algae of Hong Kong. IV the Genus Laurencia. Papers from the Department of Botany of the University of Michigan No. 811.
VAN DEN HOEK, C. (1984). World-wide latitudinal and longitudinal seaweed distribution patterns and their possible causes, as illustrated by the distribution of Rhodophytan genera. Helgolander Meeresunters 38: 227-257
WEBER-VAN BOSSE, A. (1913). Marine algae. Rhodophyceae, of the Sealark expedition, collected by Mr.J. Stanley Gardinder, M.A. London.
WOMERSLEY, H. B. S. (2003). The marine benthic flora of southern Australia - Part IIID Ceramiales - Delesseriaceae, Sarcomeniaceae, Rhodomelaceae. pp. 533. Canberra and Adelaide: Australian Biological Resources Study and State Herbarium of South Australia.
354 WYNNE, M. J. (1995). Benthic marine algae from the Seychelles collected during the R/V Te Vega Indian Ocean Expedition. Contributions of the University of Michigan Herbarium 20: 261- 346, 89 figs.
WYNNE, M. J., D. SERIO, CORMACI, M. AND FURNARI, G. (2005). The species of Chondrophycus and Laurencia (Rhodomelaceae, Ceramiales) occurring in Dhofar, the Sultanate of Oman. Phycologia 44(5): 497 - 509.
YAMADA, Y. (1931). Notes on Laurencia, with special reference to the Japanese species. University of California publications in Botany 16: 185 - 310.
YANG, E. C., KIM, M. S., GERALDINO, P. J. L., SAHOO, D., SHIN, J. A. AND BOO, S. M. (2008). Mitochondrial COX1 and plastid rbcL genes of Gracilaria vermiculophylla (Gracilariaceae, Rhodophyta). Journal of Applied Phycology 20: 161 - 168.
YANG, E. C., LEE, S. Y., LEE, W. J. AND BOO, S. M. (2009). Molecular evidence for recolonization of Ceramium japonicum (Ceramiaceae, Rhodophyta) on the west coast of Korea after the last glacial maximum. Botanica Marina 52(4): 307-315.
YOSHIDA, T. (1998). Marine algae of Japan. pp. 1-2, 1-25, 1-1222. Tokyo: Uchida Rokakuho Publishing Co. Ltd.
YONESHIGUE-VALENTIN, Y., FUJII, M. T., AND GURGEL, C. F. D. (2003). Osmundea lata (M. Howe & W.R. Taylor) comb. nov. (Ceramiales, Rhodophyta) from the Brazilian south-eastern continental shelf. Phycologia 42(3): 301-307.
ZHANG, Z., SCHWARTZ, S., WAGNER, L. AND MILLER, W. (2000). A greedy algorithm for aligning DNA sequences. J. Comput. Biol. 7(1-2):203-14
ZUCCARELLO, G. C. AND WEST, J. A. (2006). Molecular phylogeny of the subfamily Bostrychioideae (Ceramiales, Rhodophyta): subsuming Stictosiphonia and highlighting polyphyly in species of Bostrychia. Phycologia 45(1): 24-36.
355