The Role of LRRC31 & LRRC32
in Allergic Inflammation
A dissertation submitted to
the Graduate School of the University of Cincinnati in partial fulfillment of the requirements for the degree of
Doctor of Philosophy (Ph.D.)
In the Immunology Graduate Program
of the College of Medicine
2015
by Rahul Joseph D’Mello
B.S., The Johns Hopkins University, 2009
Advisory Committee:
Marc E. Rothenberg, M.D., Ph.D. (Chair)
H. Leighton Grimes, Ph.D.
Andrew B. Herr, Ph.D.
Simon P. Hogan, Ph.D.
Ian P. Lewkowich, Ph.D.
Louis J. Muglia, M.D., Ph.D.
ABSTRACT
Eosinophilic esophagitis (EoE) is an allergic inflammatory disease of the esophagus that is caused by both genetic and environmental factors. Herein, we investigated leucine-rich repeat– containing protein 31 (LRRC31), a protein that regulates esophageal epithelial function, and
LRRC32, which was genetically associated with EoE and allergic diseases. We show that
LRRC31 increased in the esophagus of patients with active EoE. LRRC31 mRNA and protein were increased in differentiated, IL-13–treated esophageal epithelial (EPC2) cells grown at the air liquid interface (ALI). LRRC31 overexpressing EPC2 cells had increased epithelial barrier function and RNA sequencing analysis identified 38 dysregulated genes, including 5 kallikrein
(KLK) proteases. Indeed, KLK protein and proteolytic activity levels were decreased in LRRC31- overexpressing EPC2 cells. KLK expression was similarly dysregulated in the esophagus of
EoE patients and in IL-13–treated esophageal epithelial cells. Thus, we propose that LRRC31 is induced by IL-13 and modulates epithelial barrier function, potentially by regulating KLK expression. LRRC32 is an immune-related protein that is similar in structure to LRRC31. We identified rs2155219, a single nucleotide polymorphism (SNP) associated with EoE that was an enhancer of gene transcription. The minor allele at rs2155219 decreased the risk of developing
EoE and increased esophageal expression of LRRC32 mRNA in EoE patients. In addition, IL-13 induced LRRC32 mRNA expression in EPC2 cells. We propose that LRRC32 is important for disease pathogenesis and decreased esophageal expression may correlate with lower risk of
EoE. In conclusion, LRRC31 and LRRC32 are both involved in two independent pathways contributing to EoE pathogenesis. A further understanding of their roles in EoE and allergic diseases may facilitate the development of alternative therapeutics to improve the quality of life for patients.
! ii!
! iii! ACKNOWLEDGEMENTS
I want to thank God, my parents Gilroy and Cheryl, my sister Esther, Dusty, and all my family and friends, especially my roommate Carlton, for getting me to this point in my life. I am grateful for my mentor Dr. Marc Rothenberg, Mel Mingler, Dr. Julie Caldwell, Dr. Ben Davis, Dr. Mark
Rochman, Jared Travers, Kiran KC, Dr. Nurit Azouz, Dr. Ting Wen, Dr. Joe Sherrill, Dr. Tom Lu, and everyone in the Allergy & Immunology family who invested time, energy, and resources in my training and development as a scientist and a co-worker. I am grateful to the Medical
Scientist Training Program and the Immunology Graduate Program, who helped guide and support me through medical and graduate school. I want to thank the mentors on my dissertation committee, Dr. Simon Hogan, Dr. Lee Grimes, Dr. Ian Lewkowich, Dr. Andy Herr, and Dr. Louis Muglia for their support, and Dr. Jim Heubi, who continues to guide me towards success. There were many times where I struggled but your patience and belief in me inspired me to persevere forward towards completion of my PhD. I want to thank my other mentors from all levels of my training, starting from high school with Mr. Bob Berg my biology teacher, to the
Cleveland Clinic with Dr. Anthony Calabro, Dr. Aniq Darr, Dr. Ediuska Laurens, and Stephon
Weber, at Hopkins with Dr. Sharon Gerecht and Dr. Guoming Sun, and here at University of
Cincinnati and Cincinnati Children’s.
I want to thank all the patients with EoE who participate in our studies – thank you for participating and sharing your tissue with us. I also want to thank all the administrative staff, especially Terry Fettig, Dr. Rothenberg’s administrative assistant, who helped coordinate meeting times and scheduling, and everyone I know who wished me the best on this endeavor.
I would like to dedicate this dissertation to the memory of my grandparents Frank, Ettie, Selina, and Reginald.
Thank you and God bless all of you.
! iv! TABLE OF CONTENTS
ABSTRACT…………………………………..……………………………………………………………ii
ACKNOWLEDGEMENTS…………………………..…………………………………………………...iii
TABLE OF CONTENTS…………………………………..…………...………………………………..iv
LIST OF FIGURES……………………………..……………………………………………………..…ix
LIST OF TABLES……………………………..……………………………………………...………….xi
LIST OF ABBREVIATIONS……………………..…………………………………………...…….…..xii
PUBLICATIONS AND CONFERENCE PROCEEDINGS ARISING FROM THIS WORK………xiii
STATEMENT OF AUTHORSHIP…………………………..………………………………….……..xiv
CHAPTER 1: INTRODUCTION………………………………….……..……………………………….1
1.1. Allergic Diseases………………………………………………………..……………………….1
1.1.1. Introduction……………………………………….…….…..…..……………….1
1.1.2. Epidemiology of Allergic Diseases…..………...………...…..……………….1
1.1.3. General Pathogenesis of Allergic Diseases…………...…..……….……….2
1.1.4. Summary………………………………………………..…..….……...…….….3
1.2. Eosinophilic Esophagitis (EoE)..………………………………………...….……………….…4
1.2.1. Introduction……………………………………………..…………………….…4
1.2.2. History of EoE………...……………………...…………………………………4
1.2.3. Pathogenesis of EoE……………………………………………..……………5
1.2.4. EoE Therapy……………………………...………………...…………………12
1.2.5. Summary………………………………………………………….……………15
1.3. Epithelial Cells……..……………………………………………………………………………17
1.3.1. Introduction…………………………………………………………….………17
1.3.2. Epithelial Development...…………………...……………..…………………17
1.3.3. Epithelial Differentiation…………………………..………………...... ……18
! v! 1.3.4. Epithelial Barrier Function…………………………………………………....19
1.3.5. Epithelial Immunity……………………………………………..……………..19
1.3.6. Summary……………………………..……………………..…………………21
1.4. Interleuking-13 (IL-13)………….………………………………..……………………….……23
1.4.1. Introduction…………..……………………………………..………….………23
1.4.2. IL-13 Cytokine and IL-13 Receptor Structure…………….………...... ……23
1.4.3. Regulation of IL-13……………………………………………………………24
1.4.4. IL-13 Function…………………………………………………………………25
1.4.5. IL-13 in EoE………………………………………………………………..….26
1.4.6. Summary………………………………………..…………..…………………27
1.5. Kallikreins (KLKs)………………………………….………….……………..…………………28
1.5.1. Introduction……………………………………………….....…………………28
1.5.2. Serine Proteases……………………….…………………..…………………28
1.5.3. KLKs………………………………….……….……………..…………………29
1.5.4. Regulation of KLKs………………………………………..…………….……29
1.5.5. Epithelial KLKs….………………………………………..………...…………30
1.5.6. Summary………………………………………..…………..…………………31
1.6. Leucine-Rich Repeat (LRR) Domains……………………………………..…………………32
1.6.1. Introduction……………..…………………………………..……...…….……32
1.6.2. LRR Structure……………...……..………………………..………….………32
1.6.3. LRR Function……………………………...………………..…………………32
1.6.4. Summary………………………………………………..…………..…………33
1.7. Leucine-Rich Repeat–Containing Protein 32…………………..…………………….……..35
1.7.1. Introduction……………………………………..…………..….………………35
1.7.2. LRRC32 Structure………...…………………………..………………………35
1.7.3. LRRC32 Function…………………………………………..…………………36
! vi! 1.7.4. Summary…………………………..………………………..…………………37
1.8. References…...……………………………………………..………………..…………………38
CHAPTER 2: LRRC31 IS INDUCED BY IL-13 AND REGULATES KALLIKREIN EXPERSSION
AND BARRIER FUNCTION IN THE ESOPHAGEAL EPITHELIUM…………………………...,…68
2.1. Abstract…...……………………………………………………………………………………..69
2.2. Introduction……..……………………………………………………………………………….70
2.3. Results….…………………………………………………………………………………….…72
2.3.1. Identification of LRRC31….……………………………………………….…72
2.3.2. LRRC31 is specifically induced in EoE……………………….………….…72
2.3.3. LRRC31 is expressed in the colon and mucosal tissue………….…….…72
2.3.4. LRRC31 mRNA parallels disease activity……………………………….…73
2.3.5. LRRC31 mRNA correlates with esophageal eosinophilia and IL13
mRNA…………………………………………………………………………..73
2.3.6. IL-13 induces LRRC31 in epithelial cells….…………………….……….…74
2.3.7. Overexpression of LRRC31 increases barrier function……………..…….76
2.3.8. LRRC31 regulates epithelial serine proteases….…………………...….…77
2.3.9. Loss of LRRC31 increases KLK expression….………………...……….…78
2.3.10. KLK expression in EoE and in response to IL-13….………..…………….79
2.4. Discussion….……………………………………………………………………...……………80
2.5. Methods…………………………………………………………………….……...……………84
2.6. Acknowledgements……..……………………………………………….……...……..………88
2.7. References…...…………………………………………………………….……...……………89
2.8. Figures…………………………………………………………………….……...……….…….95
! vii! CHAPTER 3: ESOPHAGEAL LRRC32 EXPRESSION IS REGULATED BY ALLELIC
VARIATION AT rs2155219……………………………………..……………………...……….……112
3.1. Abstract…..……………………………………………………………….……...……………113
3.2. Introduction……..…………………………………………..……………….……...…………114
3.3. Results……………………….……………………………………….……...………………...117
3.3.1. EoE shares genetic associations with other allergic diseases……….…117
3.3.2. Chromosome 11q13 has SNPs associated with allergic diseases…….117
3.3.3. Epigenetic and transcriptional landscape at rs2155219……...…………118
3.3.4. Expression of LRRC32, C11ORF30, and CAPN5 in the esophagus ....119
3.3.5. Expression of LRRC32, C11ORF30, and CAPN5 in epithelial cells.…..120
3.4. Discussion….…………………………………………………………...…...………………..122
3.5. Methods…………………………………...………………………….……...………………..127
3.6. Acknowledgments…..……...……………………….……………….……...………………..131
3.7. References…..……………………………………………………….……...………………..132
3.8. Figures....…………………………………………………………….……...…………………139
CHAPTER 4: GENERAL DISCUSSION AND SUMMARY……………………..…………………149
4.1. Introduction……..…………………………………………………………….……...………..149
4.2. LRRC31……………………………..……………………………….……...…………………151
4.2.1. Identification of LRRC31……….……...……………………….…….....….151
4.2.2. Expression of LRRC31……….……...……………………….…….....……156
4.2.3. LRRC31 Expression as a Function of Disease Activity…………...…….158
4.2.4. LRRC31 and Markers of Disease……….……...…………….…...... …….159
4.2.5. IL-13 Induced LRRC31……….……...……………………….…….....……160
4.2.6. LRRC31 and the Esophageal Epithelial Barrier……….……...………….162
4.2.7. KLKs Regulate Epithelial Barrier Function……….……...……………….166
! viii! 4.2.8. Implications of LRRC31 Data For New Therapies……….……...……....167
4.2.9. Summary and Conclusions………………………………..…………….…168
4.3. LRRC32……………………………..……………………………….……...…………………169
4.3.1. Identification of Chromosome 11q13………………….……...…………...169
4.3.2. Identification of rs2155219………………….……...………….…………...169
4.3.3. Genes on Chromosome 11q13………………….……...…………...... 170
4.3.4. Minor Allele at rs2155219 and LRRC32 Expression………….…..….….171
4.3.5. LRRC32 and TGF-β Signaling in EoE……………………..…...... ……...172
4.4. Reflections and Conclusions………………………….……...………….….………….…...175
4.5. References………………….……...……………………………….……………….……...... 177
4.6. Figures………………………………………………………………………………………....188
! ix! LIST OF FIGURES
CHAPTER 1: INTRODUCTION
Figure 1.1: 3D structure of LRR proteins..……………………………………………...………….…67
CHAPTER 2: LRRC31 IS INDUCED BY IL-13 AND REGULATES KALLIKREIN EXPERSSION
AND BARRIER FUNCTION IN THE ESOPHAGEAL EPITHELIUM
Figure 2.1: Identification of LRRC31.…………………………………………………………….…...95
Figure 2.2: LRRC31 expression in the esophagus.………………………………………….……...96
Figure 2.3: Expression of LRRC31 in human and murine tissue.………………………..………..97
Figure 2.4: LRRC31 correlation with esophageal eosinophilia and disease-associated gene
expression.…………………………………………………………………………..…..…98
Figure 2.5: LRRC31 expression in esophageal epithelial cells.…………………...….……………99
Figure 2.6: Epithelial barrier function in differentiated LRRC31-overexpressing EPC2 cells.…100
Figure 2.7: Differentiated LRRC31-overexpressing EPC2 cell transcriptome.…………….……101
Figure 2.8: KLK expression following LRRC31 gene-silencing in differentiated EPC2 cells.…102
Figure 2.9: KLK expression in esophageal biopsies and IL-13–treated primary esophageal
epithelial cells.………….…………………………………………………………………103
Figure 2.10: Function of LRRC31 in the esophageal epithelium.………………………………...104
Supplementary Figure 2.1: LRRC31 expression in esophageal epithelial cells.……………..…105
Supplementary Figure 2.2: IL-13–STAT6 effect on LRRC31 gene promoter activity.…………106
Supplementary Figure 2.3: LRRC31 gene-silenced, differentiated EPC2 cells.………………..107
Supplementary Figure 2.4: Paracellular flux measurements in LRRC31 gene-silenced,
differentiated EPC2 cells.…………………………... …………………………………..108
Supplementary Figure 2.5: LRRC31 structure.………………………………………………….…109
Supplementary Figure 2.6: LRRC31 homology and phylogeny.……………………………….…110
! x! CHAPTER 3: ESOPHAGEAL LRRC32 EXPRESSION IS REGULATED BY ALLELIC
VARIATION AT rs2155219
Figure 3.1: Shared genetic associations between allergic and inflammatory diseases………..139
Figure 3.2: Chromosome 11q13 genetic associations with allergic and inflammatory diseses.140
Figure 3.3: Epigenetic and transcriptional landscape at rs2155219……………………………..142
Figure 3.4: Expression of LRRC32, C11ORF30, and CAPN5 mRNA in the esophagus………143
Figure 3.5: Expression of LRRC32, C11ORF30, and CAPN5 mRNA in the esophagus of
genotyped patients………………….……………………………………………………144
Figure 3.6: Expression of LRRC32, C11ORF30, and CAPN5 mRNA in epithelial cells………145
Supplementary Figure 3.1: Roadmap Epigenomics prediction for rs2155219…………………146
CHAPTER 4: GENERAL DISCUSSION AND SUMMARY
Figure 4.2.1: LRRC31 overexpression regulates miR-375 expression………………..…….…..189
Figure 4.2.2: Pathway analysis of genes regulated by LRRC31 expression………………..…..190
Figure 4.2.3: Model of LRRC31 function in the esophageal epithelium……………………..…..191
! xi! LIST OF TABLES
CHAPTER 1: INTRODUCTION
Table 1.1: Subfamilies of leucine-rich repeat (LRR) proteins.………...………………...….…..…66
CHAPTER 2: LRRC31 IS INDUCED BY IL-13 AND REGULATES KALLIKREIN EXPERSSION
AND BARRIER FUNCTION IN THE ESOPHAGEAL EPITHELIUM
Supplementary Table 2.1: Primers used for qPCR.……………………………………………..…111
CHAPTER 3: ESOPHAGEAL LRRC32 EXPRESSION IS REGULATED BY ALLELIC
VARIATION AT rs2155219
Table 3.1: Allele frequency and odds ratio (OR) at rs2155219………………….……………..…141
Supplementary Table 3.1: H3K27Ac peaks from ChIP-seq on TE-7 cells treated with IL-13…147
Supplementary Table 3.2: Primers for qPCR……………………………………………………….148
CHAPTER 4: GENERAL DISCUSSION AND SUMMARY
Table 4.1: Proteins interacting with LRRC31……………………………………………..…….…..188
! xii!
LIST OF ABBREVIATIONS
ADNIV Autosomal dominant neovascular inflammatory vitreoretinopathy
ALI Air-liquid interface
AHR Airway hyper responsiveness
APC Antigen-presenting cell
CE Chronic esophagitis
ChIP-seq Chromatin immunoprecipitation sequencing
CTD Connective tissue disorder
DAMP Damage-associated molecular pattern
DAPA DNA affinity precipitation assay dsRNA Double stranded RNA
EAE Experimental autoimmune encephalomyelitis
EBS Epidermolysis bullosa simplex
ECM Extracellular matrix
EDC Epidermal differentiation complex
EDP EoE diagnostic panel
EGID Eosinophilic gastrointestinal disorders
EMSA Electrophoretic mobility shift assay
EMT Epithelial-mesenchymal transition
ENCODE Encyclopedia of DNA elements
EoE Eosinophilic esophagitis
FP Fluticasone propionate
GERD Gastroesophageal reflux disease
GVHD Graft-versus-host disease
GWAS Genome-wide association studies
! xiii! HMM Hidden Markov model hpf High-power field (400X)
IBD Inflammatory bowel disease
IBF Impaired barrier function
LC-MS/MS Liquid chromatography with tandem mass spectrometry lncRNA Long non-coding RNA
LPS Lipopolysaccharide
LRR Leucine-rich repeat
MAF Minor allele frequency
MEN-1 Multiple endocrine neoplasia type I miRNA MicroRNA
MS Multiple sclerosis
NL Normal controls
NMR Nuclear magnetic resonance
NR Non-responders
ODN Oligodeoxynulceotides
OR Odds ratio
PAMP Pathogen-associated molecular pattern
PAR Protease-activated receptors
PDB Protein database
PHTS PTEN hamartoma tumor syndrome
PPI Proton pump inhibitor
PRR Pattern recognition receptor qPCR Quantitative polymerase chain reaction
R Responders
RBCC RING finger, B-box, and coiled-coil domain
! xiv! RNA-seq Ribonucleic acid sequencing
ROS Reactive oxygen species
SAM Severe dermatitis, multiple allergies, and metabolic wasting shRNA Short hairpin RNA
SC Stratum corneum
SG Stratum germinativum
SNP Single nucleotide polymorphism ssRNA Single stranded RNA
TCR T cell receptor
TER Transepithelial electrical resistance
TLR Toll-like receptor
TSS Transcription start site
! xv! PUBLICATIONS AND CONFERENCE PROCEEDINGS ARISING FROM THIS WORK
Accepted Manuscripts:
D’Mello, R.J. et al. LRRC31 is induced by IL-13 and regulates kallikrein expression and barrier function in the esophageal epithelium. Mucosal Immunology, (2015).
Manuscripts in Progress with timeline:
D’Mello, R.J. et al. 11q13 is an allergic risk-locus that increases EoE risk and decreases
LRRC32 expression. Not submitted. (Will submit before 2016).
D’Mello, R.J. et al. MicroRNA-142 is required for normal eosinophil development and differentiation. Not submitted. (Will submit before 2017).
Conference Abstract Publication
D’Mello, R.J. et al. Identification and characterization of Leucine-Rich Repeat Containing Protein
31 (LRRC31) in Eosinophilic Esophagitis. 2105 Annual Meeting of the American Academy of
Allergy, Asthma & Immunology. Abstract # 560.
Kottyan, L.C., Rothenberg, J.A., D’Mello R.J., et al. Shared Genetic Etiology Between EoE and
Other Allergic Diseases. 2105 Annual Meeting of the American Academy of Allergy, Asthma &
Immunology. Abstract # 124.
! xvi! STATEMENT OF AUTHORSHIP
CHAPTER 1: Rahul J D’Mello and Dr. Marc E Rothenberg were involved in writing and critical revision.
CHAPTER 2: Rahul J D’Mello, Dr. Nurit P Azouz, Dr. Simon P Hogan, and Dr. Marc E
Rothenberg were involved in study concept and design. Rahul J D’Mello, Dr. Julie M Caldwell,
Dr. Ting Wen, and Dr. Joseph D Sherrill were involved in data acquisition. Rahul J D’Mello and
Dr. Marc E Rothenberg analyzed and interpreted data. Rahul J D’Mello, Dr. Julie M Caldwell,
Dr. Simon P Hogan, and Dr. Marc E Rothenberg were involved in the writing and critical revision of the manuscript.
CHAPTER 3: Rahul J D’Mello, Joelle A Rothenberg, Dr. Leah C Kottyan, and Dr. Marc E
Rothenberg were involved in study concept and design. Rahul J D’Mello, Emily M Stucke, Joelle
A Rothenberg, Mark Rochman, and Dr. Leah C Kottyan were involved in data acquisition. Rahul
J D’Mello, Dr. Leah C Kottyan, and Dr. Marc E Rothenberg analyzed and interpreted data.
Rahul J D’Mello, Dr. Leah C Kottyan, and Dr. Marc E Rothenberg were involved in the writing and critical revision of the manuscript.
CHAPTER 4: Rahul J D’Mello and Dr. Marc E Rothenberg were involved in writing and critical revision.
! xvii! CHAPTER 1: INTRODUCTION
1.1. Allergic Diseases
1.1.1. Introduction
Allergic diseases are characterized by hypersensitivity to normally innocuous antigens and manifest in epithelial tissue or as a systemic response.1 Examples of allergic diseases include asthma, dermatitis, bee sting allergy, food allergy, eosinophilic gastrointestinal disorders
(including eosinophilic esophagitis), conjunctivitis, and severe systemic anaphylaxis. These diseases are heterogeneous, increasing in prevalence, and cause significant morbidity and mortality in both developed and developing countries.2,3 Food allergy increased 2-fold in children in the United States and the United Kingdom over the last 2 decades, and standard therapies are based on identification and avoidance of triggering foods.4 However, only modest advances have been made in the diagnosis, prevention, and management of food allergies in the past 2 decades.5 Allergic inflammatory diseases, such as asthma and eosinophilic esophagitis (EoE), are chronic diseases treated with glucocorticoid steroids. However, steroids are not curative and chronic use has undesirable side effects such as osteoporosis, hypertension, dyslipidemia, and type 2 diabetes mellitus.6 In addition, some patients with allergic diseases fail to respond to therapy and suffer significant morbidity with poor quality of life.7,8 In this section we will introduce the epidemiology and pathogenesis of allergic diseases.
1.1.2. Epidemiology of Allergic Diseases
Allergic diseases are common, increasing in prevalence, and have both environmental and genetic components. These diseases affect approximately 20% of the population of the United
States and are the 6th leading cause of chronic disease.2 More concerning is the increasing prevalence of allergic diseases such as asthma and EoE in both developed and developing countries.3,9 Numerous studies have established a role for the environment in the increasing prevalence of allergic diseases. In addition to environmental factors that associated with
1" disease, epidemiologic studies of multigenerational families and monozygotic and dizygotic twins indicate a strong genetic component to allergic disease.10 Additional evidence for a genetic component to allergic diseases came from a prospective study that observed several hundred newborns and found that children with a family history of atopy were more likely to develop allergic disease within the first 5 years of life.11 Recent genome-wide association studies (GWAS) have identified numerous genetic loci (i.e. 5q22, 2p23, and 11q13) that contain single nucleotide polymorphisms (SNPs) associated with allergic diseases.12,13 However, the functional and mechanistic understanding of these genetic associations is weak. Thus, the prevalence of allergic diseases is increasing in both the developed and developing world and is associated with environmental and genetic factors.
1.1.3. General Pathogenesis of Allergic Diseases
Atopy is defined as a general predisposition to develop allergic reactions to otherwise innocuous substances, and genetically predisposed individuals develop hypersensitivity to these substances during early childhood and adolescence. Genetically predisposed individuals are initially sensitized during an encounter with an antigen, which are usually small airborne glycoproteins, food antigens, antibiotics, or metalloproteins.1 The allergen is degraded into peptide fragments that are bound and presented by class II major histocompatibility complex molecules to T helper cells.1 Allergen-specific T helper type 2 (Th2) cells then initiate the allergic response, activating allergen-reactive, surface immunoglobulin-positive B cells to proliferate and differentiate.1 The B cells synthesize allergen-reactive IgE molecules, and this mechanism primes the sensitized individual for subsequent encounters with the same allergen. When the allergen is encountered again, IgE receptor-positive cells (e.g. mast cells and basophils) become activated, resulting in secretion of mediators, such as cytokines, histamines, leukotrienes, and tryptases, that drive the symptoms of allergic disease.1
2" 1.1.4. Summary
Allergic diseases are a challenge, increasing in prevalence worldwide with poor quality of life for patients and limited therapeutic options. They can manifest in specific tissue compartments or as a systemic response, and there is a need to further understand the pathogenesis of these diseases. In this chapter, we will introduce EoE and the relevant molecular and cellular pathways involved in disease, focusing on the epithelium and leucine-rich repeat–containing protein 31 (LRRC31), and genetics and leucine-rich repeat–containing protein 32 (LRRC32).
3" 1.2. Eosinophilic Esophagitis (EoE)
1.2.1. Introduction
EoE is an emerging chronic, immune-mediated, allergic inflammatory esophageal disease that presents clinically with symptoms related to esophageal dysfunction and histologically with an eosinophil-predominant Th2 inflammation that is food antigen driven.8 The typical EoE patient is an atopic male who presents in childhood or during the third or fourth decades of life with dysphagia or food impaction. Pediatric EoE, along with other eosinophilic gastrointestinal disorders (EGIDs), results in the worst health-related quality of life when compared to patients with other chronic pediatric diseases, such as inflammatory bowel disease (IBD), epilepsy, type
1 diabetes, sickle cell disease, post-renal transplantation, and cystic fibrosis.14 In addition, EoE presents a financial burden on the health care system, costing as much as $1.4 billion a year in the United States, which was remarkable for a disease that was essentially unknown 2 decades ago.15 Therefore, investigation of EoE pathogenesis in order to develop new therapies that may improve patient quality of life while reducing the financial burden on the health care system is important. In this section, we review the history of EoE, EoE pathogenesis, and current therapies available for treating EoE.
1.2.2. History of EoE
EoE was first reported in 1993 as a distinctive clinicopathologic syndrome with high concentrations of intraepithelial esophageal eosinophils in patients with dysphagia, normal endoscopy, and normal pH monitoring.16 Shortly afterwards in 1995, it was reported that pediatric patients with chronic gastrointestinal symptoms and esophageal eosinophilic infiltrates that did not respond to standard treatments for gastroesophageal reflux disease (GERD) could be improved by using an elemental diet formula, and in these patients symptoms recurred when specific dietary proteins were reintroduced.17 However, it was not until 2007 that the First
International Gastrointestinal Eosinophil Research Symposium Subcommittees met to establish
4" diagnostic and treatment guidelines for EoE and share consensus recommendations.18 The number of publications on EoE doubled between 2007 and 2011 from 77 to 146. However, the focus of many of these articles was merely esophageal eosinophilia and did not follow the guidelines specified in 2007 regarding the definition of EoE. To resolve this issue, a new consensus group convened and published the Updated Consensus Recommendations for
Children and Adults, highlighting again that EoE was a clinicopathologic disease requiring clinical and pathological criteria, as well as elimination of other causes of esophageal eosinophilia, in order to diagnose disease.8 As a result of these two landmark publications, awareness of EoE, correct diagnosis, treatment of EoE, and investigation of EoE – epidemiology, diagnostic criteria, pathogenesis, and therapy - have increased with PubMed publications increasing from 146 in 2011 to 234 in 2014.
1.2.3. Pathogenesis of EoE
EoE is caused by genetic and environmental factors, particularly early-life events, and the pathogenesis of EoE involves activation of epithelial inflammatory pathways by the Th2 cytokine interleukin 13 (IL-13), increased production and activity of transforming growth factor-β (TGF-β), and induction of allergic inflammation by eosinophils and mast cells. In this section we will review genetic and environmental factors associated with EoE, and briefly discuss the contributions of epithelial cells and immune cells to EoE pathogenesis.
- Genetic Factors
A fraction of patients developed EoE in association with a genetic syndrome. Patients with connective tissues disorders (CTDs) that involve hypermobility syndromes such as Loetyz-Dietz syndrome, Marfan syndrome type II, and Ehlers-Danlos syndrome, have a 8-fold increased risk of EoE.19,20 Both EoE and CTDs have excessive TGF-β and TGF-β signaling.19 EoE is also associated with phosphate and tensin homolog (PTEN) hamartoma tumor syndrome (PHTS)
5" with a >200-fold increased risk of EoE.21 However, there is no known mechanism connecting
PHTS and EoE. Another EoE-associated syndrome is severe dermatitis, multiple allergies, and metabolic wasting (SAM) syndrome caused by homozygous mutations in desmoglein-1
(DSG1).22 DSG1 is a major constituent of desmosomes, intracellular structures that form connections between adjacent cell membranes, anchor cytokeratins to the cell surface, and maintain epithelial integrity and barrier function.22 In addition to genetic syndromes, EoE was observed in 1.8%-2.4% of relatives, depending on relationship and sex, suggesting a substantial rate of heritability.23 EoE risk was associated with SNPs near numerous genes including eotaxin-3 (CCL26), filaggrin (FLG), transforming growth factor-beta (TGFB), thymic stromal lymphopoietin (TSLP), cytokine receptor-like factor 2 (CRLF2; receptor for TSLP), and calpain-
14 (CAPN14).24-29 The known functional contribution of these genes to EoE pathogenesis will be discussed later in this chapter.
- Environmental Factors
Environmental factors also contribute to EoE pathogenesis as epidemiological studies have determined. Early-life exposures, such as antibiotic use in infancy, cesarean delivery, preterm birth, birth season, birth weight, and breastfeeding status, have all been identified as factors that affect the development of EoE.23,30 These factors may alter the microbiome, which influences the developing immune system and the development of atopy.31 Interestingly, a recent study showed the esophageal microbiome was altered in patients with EoE.32 In addition to early life exposures, epidemiological data indicate that aeroallergens also have a role in EoE pathogenesis with a subset of patients having seasonal variation in disease.33-35 Together, these reports indicate that multiple environmental factors including early-life exposures, aeroallergens, and food allergens contributed to EoE pathogenesis, and result in disease in an individual with genetic susceptibility towards developing EoE.
6" - Food and Aeroallergens
EoE pathogenesis was highly linked with atopy, and the success of allergen avoidance in dietary therapy, genetic linkage, and animal models implicated allergic sensitization in disease.
Diet therapy and genetic linkage were previously described in this chapter. Mouse models of experimental EoE utilize allergen exposure through the skin, respiratory tract, and gastrointestinal tract, as well as overexpression of select Th2 cytokines (e.g., IL-5, IL-13, and IL-
15) to reproduce disease pathology.36 Epicutaneous allergen sensitization primed for respiratory allergen-induced experimental EoE, which was interesting because a large portion of EoE patients had concurrent atopic dermatitis.37 For example, repeated intranasal exposure to aeroallergens such as Aspergillus fumigatus induced eosinophilic airway and esophageal inflammation in the absence of lower gastrointestinal eosinophilia in mice.38 In another model of experimental EoE, transgenic overexpression of IL-13 induced an EoE-like disease with molecular features of human EoE.39 Similarly, intratracheal delivery of IL-13 induced a dose- dependent experimental EoE in mice, which could be blocked with an antibody against IL-
13.40,41 In both the aeroallergen and IL-13 models of experimental EoE, IL-13- and STAT6- deficient mice were partially protected from disease.37,40 Taken together, the response of EoE patients to antigen withdrawal through diet therapy, the identified genetic susceptibility in EoE, and the mouse models of experimental EoE established the contributions of food and aeroallergens to EoE pathogenesis.
- Epithelial Pathogenesis
In order to understand the molecular pathogenesis of EoE, a microarray gene expression analysis was conducted on esophageal biopsies from patients with active disease and normal patients that identified a unique profile of genes that were differentially expressed in active
EoE.24 The most upregulated gene was CCL26, which encodes eotaxin-3, an eosinophil chemokine. In addition, IL-13 mRNA and protein were increased, and subsequently primary
7" esophageal epithelial cells from biopsies were cultured and treated with IL-13.24,42 A microarray gene expression analysis of these cells identified an IL-13–induced profile of differentially expressed genes that markedly overlapped with the EoE profile of differentially expressed genes.42 Further analysis showed that genes contained within the epidermal differentiation complex (EDC) on chromosome 1 were differentially expressed in EoE and in IL-13 treatment.25
These genes are known to function in regulating esophageal epithelial barrier function, which is impaired in patients with active EoE.43 FLG, which encodes filaggrin, is in the EDC and is decreased in EoE and in IL-13 treatment. Filaggrin is an epidermal protein that is important for the formation of the stratum corneum (SC) and cornified envelope, and filaggrin degradation products maintain epidermal homeostasis and barrier function.44 SNPs in FLG are associated with atopic diseases such as atopic asthma, allergic rhinitis, eczema, and EoE. Mutations in
FLG cause ichthyosis vulgaris, a skin disease resulting in dry and scaly skin that associates with allergic diseases, further implicating this gene in EoE pathogenesis.45 Another gene with mutations associated with atopic disease is DSG1. DSG1 mRNA and protein are decreased in
EoE and in esophageal epithelial cells with IL-13 treatment.22,42,43 DSG1 is a desmosomal cadherin involved in maintaining epithelial homeostasis that is specifically expressed in the suprabasal epithelial layer. DSG1 regulates cell adhesion, supports epithelial cell differentiation, and maintains epithelial barrier function.46-48 Gene silencing of DSG1 in esophageal epithelial cells weakened esophageal epithelial integrity, inducing distended intracellular spaces and impaired esophageal epithelial barrier function, similar to the changes seen following IL-13 treatment.43 In addition, transcriptional changes that overlapped with the changes seen in the esophagus of EoE patients were also observed. These changes included expression of pro- inflammatory mediators such as periostin (POSTN).43 POSTN and other inflammatory mediators are associated with tissue remodeling in the esophagus of patients with EoE.49 IL-13 and TGF-
β, which are secreted by eosinophils and mast cells, stimulate epithelial cells to undergo epithelial-mesenchymal transition (EMT).49 During EMT epithelial cells acquire fibroblast-like
8" characteristics. Fibroblasts responded to IL-4, IL-13, and TGF-β, activating and transdifferentiating to produce extracellular matrix (ECM) proteins.49 The secretion of ECM proteins such as collagen, fibronectin, tenascin C, and periostin, results in subepithelial fibrosis.
IL-13 treatment also induces neurotrophic tyrosine kinase receptor 1 (NTRK1), a high-affinity receptor for nerve growth factor (NGF), early in the transcriptional response.50 NTRK1 is increased in the esophageal epithelium in EoE and facilitated epithelial NGF signaling, which may contribute to the allergic inflammation.50 TGF-β is increased in the esophagus of patients with EoE and correlates with eosinophil counts and EMT.51 Esophageal epithelial cells treated with TGF-β induce EMT genes, thought the primary effect of TGF-β is on fibroblasts, which are activated and cause lamina propria fibrosis in EoE.49 Finally, a recent study expanded the transcriptome associated with EoE using RNA sequencing and identified dysregulated long non- coding RNA (lncRNA) in disease.52 BRAF-activated non-protein coding RNA (BANCR) is increased in EoE and induced by IL-13 treatment in esophageal epithelial cells.52 Interestingly, gene silencing of BANCR altered the expression of IL-13–induced proinflammatory genes, suggesting a role for lncRNAs in EoE.52 Thus, the epithelial contribution to EoE comes from changes in gene expression and impaired barrier function. However there is still a need to further investigate the role of the epithelium and the regulation of the barrier function in EoE pathogenesis.
- Immune Pathogenesis
Esophageal biopsies from EoE patients have a diverse array of immune cells infiltrating the tissue including eosinophils, mast cells, B lymphocytes, T lymphocytes, antigen-presenting cells
(APCs), and basophils.53,54 Intraepithelial eosinophils are the defining histological characteristic of EoE, with none present in normal esophageal mucosa and peak counts >15 per high power microscope field (hpf) in active EoE.8 These cell types, which evolved as specialized antiparasitic leukocytes, are most commonly associated with atopic inflammation, autoimmune
9" disorders, inflammatory bowel disease, and drug and food sensitivity in the developed world.53
Eosinophils are recruited from blood to tissue by eotaxin-1/CCL11(chemokine [C-C motif] ligand
11), eotaxin-2/CCL24 (chemokine [C-C motif] ligand 24), eotaxin-3/CCL26 (chemokine [C-C motif] ligand 26), and leukotriene B4 in response to IL-4 and IL-13.53,55 Eosinophils enter tissue via integrin-mediated migration, where they are activated by cytokines (IL-3, IL-5, granulocyte macrophage-colony-stimulating factor [GM-CSF]), lipid and inflammatory mediators, and immunogenic antigen exposure.53,56,57 Eosinophil activation results in the release of arachidonic acid metabolites and reactive oxygen species (ROS), followed by the secondary release of cytokines, growth factors, and protein mediators, such as eosinophil-derived neurotoxin (EDN), eosinophil peroxidase (EPO), eosinophil cationic protein (ECP), and major basic protein
(MBP).58 These secondary proteins are cytotoxic and further increase local ROS while stimulating mast cell degranulation. Mast cells are normally present in the esophagus and localized at the basement membrane in the lamina propria.59 In EoE, mast cell numbers increase and some groups have proposed that mast cells are involved in the etiology of EoE.60-
63 Eosinophils and CD4+ T-helper type 9 (Th9) cells produce IL-9, which is increased in EoE and promotes activation and maturation of mast cells.64-67 Mast cell degranulation in EoE results from IgE binding its high affinity receptor (FcεRI) on the surface of mast cells.68,69 Many products mast cells release on activation are known eosinophil attractants, such as histamine, cytokines, and eicosanoids.70 However, treatment of EoE with a mast cell stabilizer does not have any effect on eosinophil counts or symptoms.71 The IgE that activates mast cells comes from IgE+ B cells, which are dependent on Th2 cells for activation. In EoE, B cells are present in the esophageal mucosa, but at similar numbers to GERD patients.61,62,68 Thus, the role of B cells in
EoE pathogenesis is likely, but not critical. T cells are important in EoE pathogenesis, generating a Th2 response with CD4+ and CD8+ T cells accumulating in the esophageal mucosa. CD4+ Th2 cells secrete IL-4, IL-5, and IL-13 into the peripheral blood and in esophageal mucosal biopsies.61,68 IL-4 is produced by T cells and initiates the Th2 response by
10" driving naïve T helper (Tn) cell differentiation into Th2 cells.72 IL-5 is important for eosinophil maturation, activation, and survival in tissue. IL-13 increases local tissue inflammatory responses to Th2-disease, decreases esophageal epithelial differentiation, and decreases the esophageal barrier function.25 In addition, IL-13 increases eotaxins-1, -2, and -3 through STAT6 in epithelial cells.25,42,73 Interestingly, T-helper type 1 (Th1) cytokines are also present in EoE, such as tumor necrosis factor-a (TNFα) and interferon-γ (IFNγ).61,74 CD8+ T cells are also increased in the esophageal mucosa in EoE, but do not appear to be required for disease
62,75 development. Regulatory T (Treg) cells dampen the immune response by secreting anti- inflammatory cytokines. Treg cells are increased in EoE and in GERD, indicating that they are not specifically increased in EoE.53 APCs such as dendritic cells and macrophages are not increased in EoE.62,76 Interestingly, recent studies have shown that esophageal epithelial cells are capable of antigen presentation to CD4+ T helper cells.77 Finally, there is emerging evidence from mouse models of EoE that implicate TSLP signaling and basophil responses in the etiology of EoE.54 Thus, there are many cell types involved in EoE pathogenesis.
- MicroRNAs
MicroRNAs (miRNA) are single-stranded RNA molecules of 19 to 25 nucleotides in length that mediate posttranscriptional gene silencing of target genes.78 They have diverse roles in fundamental biological processes, and in EoE a select group of miRNAs are markedly dysregulated including miR-21, miR-223, and miR-375.78,79 MiR-21 is a hematopoietic miRNA that functions as an oncomiR, affecting critical target genes in cancer.80 In EoE, miR-21 is the most highly increased miRNA and regulates the Th1 versus Th2 response via binding to
IL12p35 and preventing secretion of active IL-12.81 In addition, miR-21 levels correlate with eosinophil levels and IL-5 regulates miR-21 expression. During eosinophil development miR-21 expression increases, and loss of miR-21 results in increased apoptosis of developing eosinophils in ex vivo bone marrow-derived eosinophil culture.82 Another hematopoietic miRNA
11" miR-223 is increased in EoE. MiR-223 modulates the differentiation of hematopoietic lineages.83
The expression of miR-223 also increases during eosinophil development, and loss of miR-223 results in increased proliferation of eosinophil progenitors with increased eosinophils in ex vivo bone marrow-derived eosinophil culture.69 A non-hematopoietic miRNA that is important in EoE is miR-375. MiR-375 is expressed in epithelial cells and is decreased following IL-13 treatment.84 Interestingly, miR-375 overexpression markedly changed the expression of genes in the IL-13-associated inflammatory pathway in epithelial cells.84 Taken together, these data support a key role for miRNAs in regulating and fine-tuning the immune response in EoE.
1.2.4. EoE Therapy
The goals for treatment of patients with EoE are symptom control and improvement of esophageal eosinophilic inflammation, which are accomplished primarily by using a combination of medical management and food elimination diets. In addition, alternative therapies, such as esophageal dilation, are used to manage EoE symptoms. However, due to several reasons that will be further discussed in this section, some patients fail to respond to therapy.
- Medical Management
Medical management of EoE includes PPI-therapy, corticosteroid therapy, and other therapies used for treatment of allergic diseases. PPIs are an important medical therapy in treating EoE as they rule out GERD, treat the subset of patients who have PPI-responsive esophageal eosinophilia, and alleviate the symptoms of secondary GERD in patients with EoE.85 In addition,
PPIs may inhibit the Th2-allergic pathway, which is active and driving inflammation in EoE.86
Corticosteroids are the only pharmacological drugs shown to improve the clinical and histological features of EoE, and reduce tissue fibrosis and esophageal remodeling.26,51
Systemic corticosteroids are effective at rapidly resolving esophageal eosinophilia and
12" improving symptoms, however once they are tapered, symptoms and esophageal eosinophilia recurred rapidly.87 The long-term adverse effects of systemic corticosteroids result in their use only in patients with severe symptoms or growth failure that requires immediate therapy for rapid improvement. In contrast, swallowed corticosteroids intended for inhalation have been shown to be effective in treating EoE.88 Fluticasone dispensed from a multidose inhaler and budesonide administered as a viscous slurry or a swallowed nebulizer are effective therapies for treating EoE.85 Both fluticasone and budesonide showed great efficacy in decreasing or normalizing eosinophil counts. However, histological remission with a reduction in esophageal eosinophils does not always result in symptomatic relief.89 These studies showed that swallowed topical corticosteroids did not cause adrenal axis suppression or any of the complications seen in systemic corticosteroid therapy (mood changes, weight gain, etc.). The only reported complications of swallowed topical corticosteroids for the treatment of EoE were oral candidiasis and herpes esophagitis.89,90 Taken together, topical corticosteroids are a mainstay of treatment for patients with EoE.
Several biological therapies have been tested for the treatment of EoE targeting cytokines such as IL-5 and IL-13. Randomized control trials using two different antibodies targeting IL-5 yielded encouraging histological improvements, but the symptomatic response was disappointing when compared to placebo.91,92 Anti-IL-13 therapy reduced the number of esophageal eosinophils and corrected the molecular signal associated with EoE pathology in the esophageal epithelium.93
However, again symptoms of the disease did not improve. Other biological therapies, such as omalizumab, which targets immunoglobulin E (IgE), and antibodies directed against TNF, were not found to produce a consistent effect and are not recommended for treatment of EoE.94
Other therapies that have been tried include leukotriene antagonists and mast cell stabilizers are not recommended. Immunomodulators, such as 6-mercaptopurine and azathioprine, have been tested and showed improvement in patients. But disease flared as soon as patients
13" stopped taking medication and improved again after patients restarted treatment. Unfortunately the potential toxicity of immunomodulators requires further investigation and validation before they can be recommended for EoE.
- Diet Therapy
Identifying and removing an allergic dietary antigen is also a mainstay of treatment for EoE. Diet therapy often resulted in long-term remission without medication, and was also shown to improve fibrosis and remodeling.51 Dietary therapies to treat EoE include non-directed elimination diets (common food antigens are empirically excluded), directed elimination diets
(based on allergy test results), and elemental diets with an amino acid-based complete liquid formulation.95 Directed and non-directed elimination diets both achieved similar results in regards to clinical responses and reduced number of esophageal eosinophils.96,97 Elemental diets resulted in the greatest improvement in symptoms and histology, but often required a nasogastric tube or a gastrostomy tube for administration.71 An additional consideration is that diet therapy needs to be tailored to the patient and patients should be referred to a dietician with experience treating patients with EoE to provide adequate nutrition and maximize compliance.
- Esophageal Dilation
The goal of esophageal dilation is to induce a mucosal tear, defined as a break in the esophageal mucosa, in order to manage dysphagia and stricture formation in patients with
EoE.85 Esophageal dilation provided immediate and long-lasting relief of dysphagia in patients with strictures. However the optimal role of esophageal dilation as a therapy for EoE is controversial. While dilation improves symptoms of dysphagia, it does not affect the eosinophilic inflammation within the esophagus.98 Dilation also results in chest pain and discomfort in patients, though the pain rarely required emergent evaluation to exclude esophageal perforation.85 Perforation risk for esophageal dilation in EoE is similar to the risk in patients
14" without EoE receiving esophageal dilation.99,100 Until further evidence is collected, esophageal dilation without concomitant medical or diet therapy does not address the underlying inflammatory process and should be used in an individualized manner for adult patients with severe dysphagia resulting from stricture formation.
- Therapy Non-Responders
Between 25% to 50% of EoE patients may not respond to swallowed glucocorticoids and may have treatment-refractory disease.89,101 In order to assess these patients, adherence to the prescribed therapy must be evaluated, followed be identification of disease components that failed to respond to therapy: symptoms, inflammation, or remodeling.85 Once identified, switching to an alternative therapy or using esophageal dilation for a stricture can treat the components failing therapy. Half of patients refractory to initial treatment responded to second- or third-line therapies.102 Thus, there is a need for improved EoE therapies, especially considering the number of patients who fail to respond to therapy. In addition, EoE recurs when therapy is stopped and maintenance therapy for all patients is recommended, further necessitating improved therapies that have reduced side effect profiles when compared to glucocorticoids.
1.2.5. Summary
In summary, EoE is a disease of increasing prevalence that is in the process of being characterized. Diagnosing EoE has been a challenge because it is a diagnosis of exclusion requiring recognition of presenting symptoms, esophageal endoscopy with histology, and failure of alternative therapies. However, recent technological advancements, such as using the EoE molecular signature for diagnosis in the case of the EDP, are rapidly improving the reliability of
EoE diagnosis. With better diagnosis, larger cohorts of EoE patients are being identified in order to conduct research studies and clinical trials with increased reliability. Additional resources to
15" conduct studies facilitates the further understanding of the molecular mechanisms driving EoE, which can be selectively targeted by pharmacologic therapies and tested in clinical trials.
Finally, the recent establishment of the Consortium of Eosinophilic Gastrointestinal Disease
Researchers (CEGIR), a clinical network focused on studying EoE, eosinophilic gastritis, and eosinophilic colitis, will further facilitate the development and implementation of best practice guidelines for EoE, improving the quality of care delivered to EoE patients, and possibly improving the quality of life for them while reducing the resources required to adequately care for these patients.
16" 1.3. Epithelial Cells
1.3.1. Introduction
Epithelial cells define the interface between an organism and the external world, lining the body surface and body cavities and forming barriers that are essential to life.103,104 Epithelial cell barriers support nutrient and water transport while preventing microbial contamination of tissues. In this section we will focus on the development, differentiation, and function of the stratified squamous epithelium, and its role in immune response at the mucosal surface.
1.3.2. Epithelial Development
During development, the epithelium develops from ectoderm, mesoderm, and endoderm.103
Here we will focus on stratified squamous epithelium, which develops from ectoderm and endoderm.105 The primary molecule regulating stratified squamous epithelial development is the p53-like transcription factor p63, which was shown in p63 deficient mice to cause a complete loss of all stratified squamous epithelia and their derivatives, including appendages, mammary, lacrimal, and salivary glands.106,107 Due to a lack of epidermal barrier development, these mice dehydrate and die shortly after birth. In addition, p63 expression in single-layered lung epithelium resulted in a shift to a stratified squamous epithelium.108 In humans, mutations in p63 result in a variety of development defects with malformations of the epithelia. Severity depends on the genotype-phenotype correlation between the site of the p63 mutation and the associated symptoms.105,109,110 Thus, p63 has a central role in specifying the development of stratified squamous epithelium. p63 expression is regulated by several prominent development pathways including Notch, Hedgehog, Wnt, and FGFR2/EGFR.111 Notch activation suppresses p63 expression in keratinocytes, ectodermal progenitor cells, and mammary epithelial cells through the CBF1/RBP-Jk transcription factor.112-114 In contrast, Notch activates p63 in fibroblasts, suggesting different cell-specific modes of regulation.115 Hedgehog signaling, another essential pathway for development, regulates p63 expression to control p63 isoform usage, which
17" modulates the function of p63 and alters the development of cells.116-118 The Wnt signaling pathway directly regulates p63 through binding of Lef1/Tcf with β-catenin to also regulate p63 isoform usage.119,120 FGFR2 also regulates p63 expression, specifically through p38 MAPK.
EGFR regulates p63 expression through phosphatidylinositol-3-kinase (PI3K) and possibly the
STAT3 and mTOR pathways.121-123 Finally, during EMT, p63 expression is inhibited and increased p63 reverses EMT.124,125 In summary, p63 expression is regulated by a variety of developmental signaling pathways including Notch, Hedgehog, Wnt, and FGFR2/EGFR to drive epithelial cell development.
1.3.3. Epithelial Differentiation
Epithelial cell differentiation is an active process in most tissues, where proliferative epithelial stem cells mature to replace terminally differentiated epithelial cells. Differentiation begins with stem cells converting to a protoepithelial phenotype, which is organ specific.126 This protoepithelial cell type has a basic apical compartment, composed of actin and cytokeratins that facilitate the polarized sorting of proteins and lipids essential for polarity, but nothing else.127
Differentiation results in the appearance of the mature apical compartment, which permits the development of more specific apical features, such as sorting machinery for vesicles, cilia, microvilli, etc. Terminal differentiation is driven by the protein hensin (DMBT1). DMBT1 is an extracellular protein that signals, possibly through α6 integrin, to induce a transcriptional program of apical proteins resulting in the formation of the mature apical compartment of terminally differentiated cells.126 Bone morphogenetic protein (BMP) signaling regulates esophageal epithelial differentiation. BMP induces squamous differentiation of basal epithelial stem cells in the esophagus and maintains the balance between stem cells, transit amplifying cells that are actively dividing, and terminally differentiated cells.128 Differentiated epithelia have many layers, specific cell shapes, apical specializations such as flagella or microvilli, secretory granules, and apical functions such as apical endocytosis and exocytosis that facilitate tissue
18" specific functions.129 Thus, through the process of differentiation and maturation, epithelial barriers are maintained by a pool of basal epithelial stem cells.
1.3.4. Epithelial Barrier Function
Epithelial cells are specialized to establish distinct compartments and form barriers to prevent the unrestricted exchange of materials.103 The barrier function of epithelial cells is maintained by the basic defining characteristics of epithelia: different types of junctions (tight and adherent), apical and basal polarity, transepithelial transport, and characteristic ECM proteins.126 The plasma membrane of epithelial cells prevents most hydrophilic solutes from crossing the epithelial barrier, however the paracellular pathway between cells must also be sealed. The paracellular pathway is regulated by apical junctional complexes, which are composed of tight junctions or zonula occludens (ZO), the subjacent adherens junctions or zonula adherens, and desmosomes or macula adherens that are located beneath the adherens junctions along the lateral cell membrane.103,130 The tight junctions seal the paracellular pathway between cells while adherens junctions and desmosomes provide the strength to maintain cellular proximity and allow tight junction assembly.130 The apical junctional complex is also critical for determining epithelial polarization, and contributes to epithelial differentiation, mucosal morphogenesis, and tumor suppression.103 Thus, the epithelial barrier is maintained by a concerted mechanism involving the plasma membranes of cells, apical junctional complexes, adherences junctions, and desmosomes.
1.3.5. Epithelial Immunity
Epithelial cells have key functions in innate immune defense against pathogens, forming a physical barrier that can sense pathogens, which then induces signaling to leukocytes and direct killing of detected pathogens.131 The contribution of epithelial cells towards mucosal immunity was initially unappreciated.132,133 The epithelial innate immune response is dependent
19" on the sensing of microbial and host products, a mixture of pathogen-associated molecular patterns PAMPs) and damage-associated molecular patterns (DAMPs), by pattern recognition receptors (PRRs), such as the Toll-like receptors (TLRs).131,134 Epithelial sensing of pathogenic stimuli directly from microbes or indirectly from nonepithelial host cells and extracellular molecules activates intracellular signaling cascades, leading to the expression of effector molecules involved in microbial defense, inflammation, and modulation of adaptive immunity.131
TLRs were the first class of innate immune receptors identified and are conserved transmembrane proteins with multiple leucine-rich repeats (LRRs) for pattern recognition.133,135
TLR signal transduction occurs via receptor-specific recruitment of cytosolic TIR adaptor protein combinations, such as MyD88.136,137 TLR4 recognizes bacterial lipopolysaccharide (LPS), TLR2 forms heterodimers with TLR1, recognizing triacylated lipopetides, TLR6 recognizes diacylated lipopetides, TLR3 recognizes double-stranded RNA (dsRNA), TLRs 7 and 8 recognize U-rich
(nonmammalian) single stranded RNA (ssRNA), and TLR9 recognizes DNA with unmethylated
CpG motifs (nonmammalian).138 Nucleotide oligomerization domain (NOD)-like receptors
(NLRs) share a C-terminal LRR domain that binds PAMPs, a central NOD, with one of three N- terminal signaling domains.139 NLRs are cytosolic and recognize intracellular pathogens, activating mitogen-activated protein kinase (MAPK), and nuclear factor-κB (NFκB)-dependent production of proinflammatory mediators.131 NLRs also activate the inflammasome and induce
IL-1β, IL-18, and possibly IL-33 secretion. RIG-I-like receptors (RLRs) are also cytosolic PRRs involved in TLR-independent sensing of viruses and activation of the type I interferon pathway.140 Alternatively, epithelial cells indirectly sense pathogens by detecting the release of molecular constituents from injured neighboring cells (DAMPs) including host cell products such as ATP, proteolytic cascades, extracellular matrix products, cytokines, and other inflammatory mediators.131 After sensing of pathogens, the epithelial cells induce an immune response to kill the pathogen. Epithelial cells recruit leukocytes with abundant proinflammatory and chemotactic cytokines including tumor necrosis factor (TNF), IL-1β, IL-6, IL-8, granulocyte monocyte colony-
20" stimulating factor (GM-CSF), CXC-motif chemokine 5 (CXCL5), and leukotrienes, which recruit neutrophils, monocytes, macrophages, and NK cells.141-143 Epithelial cells also express adhesion factors to facilitate and increase leukocyte flux.142,144 The epithelium can also sculpt the adaptive immune response by producing thymic stromal lymphopoietin (TSLP), IL-25, GM-CSF, IL-1β, and IL-33, promoting dendritic cell recruitment and Th2 adaptive immunity.143,145 Finally, epithelial cells also secrete microbicidal products onto the mucosal surface. These microbicidal products disrupt bacterial cell walls, sequester iron and other nutrients, and provide decoy targets for essential microbial metabolic and pathogenic processes.141,146-148 The microbicidal products can be small cationic peptides, such as defensins and cathelicidins.146,149 Larger microbicidal products such as lysozyme, which hydrolyzes peptidoglycan bonds, and lactoferrin, which sequesters iron from pathogens, are secreted and disrupt Gram-positive bacteria.146,150
Finally, epithelia cells may also use reactive oxygen species at bactericidal concentrations in response to infection or therapeutic stimulation.151,152 Together, epithelial pathogen sensing is critical for detection of pathogens, followed by activation of the inflammatory pathways that will synergistically kill pathogens at epithelial surfaces.146,153,154
1.3.6. Summary
In summary, we have described the embryonic origin of epithelia, the development of stratified squamous epithelium, and the differentiation process in mature epithelium. We also reviewed the function of the epithelium, which is critical in maintaining homeostasis. The epithelium regulates water and ion exchange, forms a barrier to pathogens, senses pathogens, and either directly or indirectly kills these pathogens. Thus the epithelium has critical functions in immunity.
Thus, injury or disease resulting in impaired barrier function of epithelia can cause severe inflammation with debilitating symptoms due to the loss of homeostasis.
21" In EoE, homeostasis is lost and the esophageal epithelium is disorganized with basal cell hyperplasia, EMT and impaired barrier function.43,155 BMP signaling in the esophagus is disrupted and results in basal cell hyperplasia, one of the pathologic characteristics of disease.128 Esophageal TGF-β is also increased in EoE, resulting in EMT within the esophageal epithelium.51 In addition, IL-13 decreases expression of genes in the EDC and desmosomal components, resulting in impaired barrier function.43 Together, these changes contribute to EoE pathogenesis and result in an abnormal esophageal epithelium.
22" 1.4. Interleukin-13 (IL-13)
1.4.1. Introduction
IL-13 was first cloned in 1993 from activated human T lymphocytes and the gene mapped in close proximity to the Th2 cytokine IL-4 on chromosome 5q23-31.156 It was later shown to differentiate Tn cells into Th2 cells and to induce B cell production of IgG4 and IgE.157 In allergic inflammation IL-13 is a key regulator of allergen-induced airway inflammation and goblet cell metaplasia.158 In EoE, IL-13 is fundamentally involved in the esophageal epithelial pathogenesis of disease.42 In this section we will review the structure and function of IL-13 in the context of allergic inflammation.
1.4.2. IL-13 Cytokine and IL-13 Receptor Structure
The structure of IL-13 and the IL-13 type I receptor are important in understanding the functional differences between IL-4 and IL-13 signaling, despite having similar biological effects.158 IL-4 and IL-13 are both prototypical four-helix bundle short-chain cytokines.159-161 However, IL-13 shares only ~25% homology with IL-4, yet they both share the IL-13 type I receptor (IL-4 type II receptor) complex, comprising IL-4Rα and IL-13Rα1.162-164 Despite these structural similarities,
IL-4 and IL-13 induce distinct functional responses, with different signaling potencies and kinetics, through identical receptor heterodimer complexes.162,165 IL-4Rα and IL-13Rα1 are structurally similar containing tandem Fibronectin-III domains and the WSXWS box, which forms the classical elbow-shaped cytokine binding homology region that binds to the helical faces of the cytokine.166 IL-4Rα is a classical receptor that binds its ligand in a similar manner to human
167 Growth Hormone system. IL-13Rα1 is evolutionarily similar to γc, but has narrower ligand specificity, suggesting it diverged from a common ancestral family while acquiring an N-terminal
Ig-like domain that is top-mounted and participates in cytokine recognition.168,169 Both IL-4Rα and IL-13Rα1 signal through the Jak/STAT cascade, with IL-4Rα associating with Jak1 and IL-
23" 13Rα1 with Tyk2. Thus, the structure of IL-13 and the IL-13 receptor give us insight into its signaling and function, and the differences when compared to IL-4.
1.4.3. Regulation of IL-13
IL-13 has important functions in regulating resistance to infection, tumor cell growth, asthma and inflammation, and in tissue scaring. Thus, it is important to understand the molecular mechanisms governing the expression and functional activity of IL-13. IL-4 is the central differentiation factor for the Th2 response and production of IL-13 is markedly decreased in the absence of IL-4.170-174 However, there is some IL-4-independent production of IL-13, suggesting
IL-13 might be critical for the Th2 response in vivo.175 There are many ways to inhibit IL-13 production and function. Many of the cytokines and mediators that drive Th1 cell development also inhibit IL-13 production and activity, such as IL-13, IL-18, IFNγ, and immunostimulatory
CpG oligodeoxynulceotides (CpG ODN).176 IL-12 inhibits antigen-induced AHR, inflammation, and Th2 cytokine expression in an IFNγ-dependent manner, in a mouse model of asthma.177
Similar changes were observed with CpG ODN.178,179 Mice deficient in IL-18 have enhanced allergen-induced eosinophilia, which was also dependent on IFNγ and IL-12.180 Additional cytokines such as TNFα, IL-10, and TGF-β have context-dependent antagonizing or promoting effects on IL-13 effector function.176 The IL-13 receptor alpha 2 (IL-13Rα2) binds IL-13 with high affinity and is found as both membrane-bound and soluble forms.181,182 Structural differences in the cytoplasmic region of IL-13Rα1 and IL-13Rα2 suggest distinct functions, with IL-13Rα2 lacking obvious signaling motifs or JAK/STAT binding sequences.181 Furthermore, it has been suggested that IL-13Rα2 is a dominant negative inhibitor, or decoy receptor of IL-13, similar to the IL-1 receptor type II.183 Several experimental models have been used to exploit this endogenous IL-13 dampening system.174,175,184-187 Therefore, both cytokines and the IL-13Rα2 decoy receptor are important in regulating IL-13 production and function.
24# 1.4.4. IL-13 Function
IL-13 is a pleiotropic cytokine that has a diverse array of biological functions including regulation of gastrointestinal parasite expulsion, airway hyper responsiveness (AHR), allergic inflammation, tissue eosinophilia, mastocytosis, IgE Ab production, goblet cell hyperplasia, tissue remodeling and fibrosis, and tumor cell growth.176 IL-13 was first shown to have a unique and nonredundant role in immunity to the gastrointestinal helminth parasite Nippostongylus brasiliensis, which induced a strong Th2 response, activating mast cells, eosinophils, giant cells,
IgE/IgA secretion, and mucus secretion.171,188,189 IL-4 and IL-13 share many properties in the response to helminth parasites, both cause increased intestinal permeability, muscle hypercontractility, and goblet-cell hyperplasia, part of the “weep and sweep” mechanism by which parasites are trapped in mucus within the gut lumen and expelled by increased contractility.188,190,191 IL-13 has a greater effect on intestinal smooth muscle contractility, directly affecting smooth muscle cells and enteric nerves.192 In asthma, IL-4 was first shown to drive Th2 cell development, but was not necessary for induction of allergic asthma, suggesting a more important role for another Th2 cytokine.193 Shortly after, IL-13 was shown to regulate pulmonary eosinophilia, airway epithelial cell hyperplasia, mucus cell metaplasia, subepithelial fibrosis,
Charcot-Leyden-like crystals, airway obstruction, and nonspecific AHR in a transgenic mouse model overexpressing IL-13 in the lung.194 Further studies confirmed the critical and nonredundant role of IL-13 in allergic asthma, as well as the superior effector activity of IL-13 to
IL-4. IL-13 also induces AHR in the absence of T and B cells, suggesting a direct role for IL-13, specifically on epithelial cells.195 In addition, IL-13 induces recruitment of eosinophils to the lung in an IL-5-and eotaxin-dependent manner, but eosinophils were not necessary for AHR development or mucus hypersecretion, though they may regulate IL-13 production.196,197 Th2 cytokines IL-4 and IL-13 are implicated in the fibrotic response to Schistosoma mansoni eggs in the liver, resulting in portal hypertension.198 Studies with loss of IL-4 implicated IL-13 in driving fibrosis and granuloma formation.172,184,198-200 Indeed, further studies conducted with IL-13 on
25" normal skin and fibroblasts showed a direct role for IL-13 in collagen production.201 Th2 cytokines dominate in a variety of disorders where tissue remodeling and fibrosis are important pathologic features, and IL-13 is likely driving this pathology. In cancer, IL-13 can exhibit both pro and antitumorigenic activity, and several studies have targeted IL-13 and its receptor for the treatment of specific malignancies.202-205
1.4.5. IL-13 in EoE
In EoE, IL-13 regulates transcriptional changes within the esophageal epithelial cells.42 IL-13 was not initially identified as dysregulated in esophageal biopsies from EoE patients.24 However, a subsequent study identified increased IL13 mRNA expression in esophageal biopsies from
EoE patients.42 IL-13 has a direct role in regulating the effector function of epithelial cells in asthma, and primary esophageal epithelial cells cultured from esophageal biopsies treated with
IL-13 demonstrate transcriptional changes that markedly overlap with the transcriptional changes seen in esophageal biopsies of patients with EoE.24,42,195 Among the transcripts increased by IL-13 in epithelial cells are eotaxin-1 (CCL11), eotaxin-2 (CCL24), and eotaxin-3
(CCL26), the eosinophil chemokines, which are STAT6-dependent.25,42,73 Furthermore, IL-13 decreases esophageal epithelial cell differentiation in vitro, resulting in impaired barrier function.25,43 IL-13 may be contributing to the impaired esophageal epithelial barrier function in
EoE. In mice, intratracheal administration of IL-13 causes eosinophil accumulation in a dose- dependent manner, and human anti-IL-13 decreases murine experimental EoE.40,41 IL-13- deficient mice develop EoE in response to ovalbumin but not in response to A. fumigatus.37 In addition, IL-13 is expressed by circulating eosinophils in EoE patients.206 Thus, IL-13 is important for EoE pathogenesis, specifically the changes seen in esophageal epithelial cells in patients with EoE.
26" 1.4.6. Summary
In summary, IL-13 is a Th2 cytokine that contributes to EoE pathogenesis. IL-13 has two major receptor complexes, type I, which signals through STAT6 and type II, which is an inhibitory decoy receptor. IL-13 production and function are regulated by other cytokines and the expression of the decoy receptor. IL-13 has a diverse spectrum of functions including regulation of gastrointestinal parasite expulsion, AHR, allergic inflammation, tissue eosinophilia, mastocytosis, IgE Ab production, goblet cell hyperplasia, tissue remodeling and fibrosis, and tumor cell growth. Based on these collective data, there is a strong rationale to target IL-13 in
EoE. However, preliminary studies using anti-IL-13 therapy improved histological changes and reversed the molecular signature of biopsies that was associated with disease, but symptomatic improvements were limited.93
27" 1.5. Kallikreins (KLKs)
1.5.1. Introduction
The kallikrein-related peptidases (KLKs) are a family of 15 (chymo)trypsin-like serine proteases with pleiotropic physiological roles. They are associated with diverse diseases such as hypertension, renal dysfunction, skin disorders, inflammation, neurodegeneration, and cancer.207. As a result, KLKs represent attractive biomarkers for clinical applications and potential therapeutic targets for common human pathologies. In this review, serine proteases will be briefly introduced followed by the structure, function, and regulation of KLKs.
1.5.2. Serine Proteases
KLKs are members of the serine protease family. Serine proteases are named for the nucleophilic serine residue at their active site and are broken down into four clans: chymotrypsin, subtilisin, carboxypeptidase Y, and Clp proteases.208 Serine proteases make up almost one-third of all proteases and chymotrypsin-like proteases are the most abundant with over 240 recognized proteases.209 These chymotrypsin-like proteases are involved in many critical physiological processes and are activated as a result of a cascade of sequential activation of serine proteases.210 Despite their diverse physiological functions, serine protease specificity is determined by the topology of the substrate binding sites adjacent to the catalytic site.211 Structure has a very important function in serine proteases and the structure of serine proteases is generally divided into catalytic, substrate recognition, and zymogen activation domain components.212 The catalytic triad of the catalytic domain consists of 3 residues, serine, aspartic acid, and histidine, which span the active site cleft. The catalytic triad is structurally linked to the oxyanion hole, a pocket of positive charge, which activates the carbonyl of the peptide bond being cleaved and stabilizes the negatively charged oxyanion of the tertrahedral intermediate.208 The substrate recognition domain includes the polypeptide-binding site and the binding pockets for the side chains of the peptide substrate.213 The zymogen activation domain
28" is cleaved by proteolytic processing to form a buried salt bridge that induces a conformational change to order the activation domain.208 Overall, serine proteases are probably the most thoroughly investigated enzyme system and include the KLK family of proteases.
1.5.3. KLKs
The KLKs are chymotrypsin-like family of serine proteases. The 15 KLKs are the largest uninterrupted cluster of protease-encoding genes in the human genome. The KLKs are located on chromosome 19q13.4 and share multiple structural features, including intron/exon organization, conserved intronic intervals, exon lengths, similar lengths (244 to 293 amino acids), and 40% protein identity.207,214,215 Multiple KLKs are often coexpressed in normal tissue and are coordinately dysregulated in disease states.207 Because of their role in common human pathologies, KLKs are under study as biomarkers and potential therapeutic targets. For example, prostate-specific antigen (PSA/KLK3) is used to diagnose prostate cancer and in prostate cancer vaccines.216 Anti-KLK6 antibodies attenuated the severity of symptoms and delayed the course of experimental autoimmune encephalomyeleitis (EAE), a mouse model of multiple sclerosis (MS).217 KLK1 inhibitors suppress breast cancer cell invasiveness as a targeted anticancer therapy.218 In summary, specific KLKs are expressed in the epithelium and have important functions in regulating epithelial differentiation, stratification, and immunity.
1.5.4. Regulation of KLKs
The regulation of KLKs is important because of their functions in regulating differentiation, stratification, and immunity. KLK regulation occurs at multiple levels – transcriptional, post- transcriptional, and post-translational. Transcriptional regulation of KLKs in many tissues was under the control of sex-steroid hormones and vitamin D receptor signaling.215,219,220 In addition, alternatively spliced transcript variants encoding inactive isoforms, DNA methylation and other epigenetic mechanisms, regulated KLK expression.215,219,221 KLKs can be post-transcriptionally
29" regulated by miRNAs, and miRNA regulation of KLKs is involved in prostate cancer, ovarian cancer, and renal cell carcinoma pathogenesis.222-225 Post-transcriptional regulation of KL activity occurs after KLKs are synthesized as inactive prepro-forms. The prepro-KLKs are proteolytically processed into secreted inactive pro-forms. Further proteolytic processing removes the N-terminal propeptide by autocatalytic activity or another KLK or a peptidase in order to become active.226 This cascade of activation is termed the “KLK activome.” KLK5 is a trypsin-like protease and initiates the putative KLK cascades, activating itself as well as pro-
KLK2, -3, -6, -7, -11, -12, and -14.227 Mature KLK enzymes can be inactivated by endogenous inhibitors, such as kallistatin or lymphoepithelial Kazal-type inhibitor (LEKTI), which is encoded by serine protease inhibitor Kazal-type 5 (SPINK5).207 This inhibition of KLK activity by serine protease inhibitors (serpins) occurs through an irreversible suicide substrate mechanism known as the “inhibitor pathway.”215 Inactivation via internal cleavage can also occur, either by autocatalytic cleavage or cleavage by other proteases.228 Zn2+ and pH are also very important reversible inhibitors of KLK enzymatic activities.207 Thus, numerous mechanisms regulate KLK activity including transcriptional regulation, post-translation cleavage, specific inhibitor binding,
Zn2+ and pH.
1.5.5. Epithelial KLKs
Stratified squamous epithelium expresses specific KLKs, including KLK5, KLK7, and KLK14, which regulate differentiation, stratification, and immunity. KLKs modulate growth factor activity, cleaving insulin-like growth factor (IGF)-binding proteins. This results in increased bioavailability of IGFs that regulate cell survival, mitogenesis, and differentiation, and TGF-β binding protein, leading to increased bioavailability of TGF-β.215 In the skin, KLK5 activity is regulated by LEKTI
(SPINK5) and by the pH of the microenvironment. KLK5, KLK7, KLK14, and LEKTI are produced in the stratum granulosum of the skin where the pH was neutral.229 KLK5 has activity at neutral pH and autoactivates, but is immediately inactivated by LEKTI binding. LEKTI binding
30" and inactivation of KLK5 is reversed as the complex diffuses into the SC, where an acidic pH is maintained.230 In the SC, KLK5 activates KLK7 and KLK14, which digest corneocyte-binding proteins such as desmoglein, desmocollin, and corneodesmosin, leading to skin desquamation.229 The expression of KLKs at epithelial interfaces also supports a regulatory function for KLKs in modulating the epithelial innate immune system. This is further supported by KLK5 and KLK7 activation of cathelicidins and α1-defensins, antimicrobial peptides secreted by epithelial cells.231,232 In addition, KLKs activate epithelial cell protease-activated receptors
(PARs), G-protein-coupled receptors that are activated by partial proteolytic cleavage of their extracellular domains and induce TSLP expression.233 Together, KLKs have important roles in regulating keratinocyte differentiation and proliferation via modulating growth factors, stratification and desquamation, and antimicrobial immunity.
1.5.6. Summary
In summary, KLKs are chymotrypsin-like serine proteases expressed in stratified squamous epithelium. KLKs are closely regulated; transcriptionally by sex-steroid hormones and the
Vitamin D receptor, post-transcriptionally by miRNAs, and post-translationally by proteolytic cleavage cascades, inhibitor binding, and microenvironment Zn2+ levels and pH. Multiple forms of regulation of KLKs are important because they have important roles in regulating epithelial differentiation and proliferation. KLKs modulate growth factor activity, epithelial stratification and desquamation, and immune responses of epithelial cells, activating antimicrobial peptides and cytokine signals to recruit leukocytes and induce inflammation. It is interesting to note that the
KLKs have not been characterized in many normal epithelia other than the epidermis. Epithelial differentiation and proliferation are dysregulated in the gastrointestinal system in a number of other diseases, including IBD and KLK expression and activity have not been characterized in these diseases
31" 1.6. Leucine-Rich Repeat (LRR) Domains
1.6.1. Introduction
Structure ultimately determines the function of molecules and understanding the structure of biological molecules has led to the understanding of fundamental concepts in biology, for example, when Watson, Crick, Franklin, and Wilkins solved the structure of DNA.234. Protein structure in particular provides insight into the function of the effector molecules of cells and solving structures is the gateway to understanding a protein’s function. Since the sequencing of the human genome and the establishment of the protein database (PDB), a repository of all known protein structures based on crystallography and nuclear magnetic resonance (NMR) experiments, predicting protein structure has improved and enabled much broader investigation into protein structure-function relationships. Repeating amino acid motifs have been recognized as important components of proteins and their assembly into tertiary protein structures allow for conserved protein structure determination. LRR domains are 20-29 amino acid motifs that assemble in a superhelical fashion and provide a versatile structural framework for the formation of protein-protein interactions. Six subfamilies of LRRs have been proposed, characterized by different lengths and consensus sequences of repeats (Table 1.1).235 In this section we will review the different subfamilies of LRRs as structural and functional domains.
1.6.2. LRR Structure
LRRs are 20-29-residue sequence motifs containing 11-residue segments with the consensus sequence LxxLxLxx(N/C)xL, where x can be any amino acid, N is asparagine, C is cysteine, and
L are leucine, valine, isoleucine, or phenylalanine.236 LRRs were first identified in the leucine- rich α2-glypoprotein.237 The first LRR structure was identified when the crystal structure of ribonuclease/angiogenin inhibitor 1 (RNH1) was solved.238 Following this first insight into the three-dimensional (3D) structural arrangement of LRRs, the crystal structure of complexes of
RNH1 with its ligands provided the first structural views revealing how LRR domains recognize
32# proteins.239,240 LRRs form a structural unit consisting of a β-strand and a α-helix connected by loops. These loops are arranged with all the strands and helices parallel to a common axis, resulting in a non-globular, horseshoe-shaped molecule with a concave β-sheet lining the inner circumference and convex α-helixes flanking the outer circumference.236 Most LRR-containing proteins have horseshoe-shaped structures related to RNH1, but substantial variability exists in the regions between the β-sheet (Figure 1.1). In addition, the helical region may be shorter or substituted in other cases.
1.6.3. LRR Function
The major function of the LRRs is to provide structural framework for the formation of protein- protein interactions. The most comprehensively characterized LRR-containing protein, both structurally and functionally, is RNH1. RNH1 interacts with both ribonuclease A (RNASEA) and angiogenin (ANG) at very similar sites involving mainly residues that lie on the β-strands and β-
α loops.239,240 From these data, ligand-binding sites were mapped onto the surface of other LRR proteins with known structures. In summary, the concave face and the adjacent loops are the most common protein interaction surface on LRR proteins. The concave surface of the LRR domain is ideal for interaction with an α-helix and this is a recurring feature of protein-protein interactions in LRR proteins.241 Thus, the elongated and curved LRR structure, coupled with structural flexibility, provides an outstanding framework for accommodating diverse protein- protein interactions.239,241
1.6.4. Summary
In summary, LRRs are 20-29 amino acid domains that form a β-strand and an α-helix. LRRs assemble to form horseshoe-shaped molecules with hydrophobic binding pockets. Functionally,
LRRs participate in protein-protein interactions and their structure has an important part in determining specificity of substrate binding. Taken together, molecules with LRRs provide the
33" structural framework for protein-protein interactions, which are required for diverse cellular signals and functions.
34" 1.7. Leucine-Rich Repeat–Containing Protein 32
1.7.1. Introduction
LRRC32 is an example of a leucine-rich repeat–containing protein that has a role in immunity.
The LRRC32 gene was first identified in 1992 in the chromosome 11q13 region. The chromosome 11q13 was being investigated because of involvement in several genetic alterations including t(11;14)(q13;q32) translocations in B-cell malignancies (later shown to be the translocation of the BCL1 gene from chromosome 11 to the IGH gene promoter on chromosome 14), gene amplification in solid tumors (later shown to be due to FGF3 gene amplification), gene rearrangements (later shown to be due to FGF3 gene rearrangements), and association with multiple endocrine neoplasia type I (MEN-1 syndrome; later shown to be due to mutations in the MEN1 gene).242-249 After identification, LRRC32 was provisionally named GARP
(glycoprotein A repetitions predominant) and characterized as encoding a transmembrane protein made almost entirely of leucine-rich repeats.242,250 LRRC32 protein was later identified
+ hi + on the surface of CD4 CD25 FOXP3 T regulatory (Treg) cells and then found to induce
FOXP3 expression with a partial Treg phenotype when ectopically expressed in non-Treg T cells.251 This finding led to the continued investigation of this molecule and LRRC32 was found to regulate TGF-β bioavailability and signaling.252 Concurrently, the chromosome 11q13 region began to be recognized as associated with asthma first and then other allergic diseases.253
1.7.2. LRRC32 Structure
LRRC32 is localized to the chromosome 11q13 region and comprises 2 coding exons expressed as two major transcripts of 4.4 and 2.8 KB, respectively, which encode a transmembrane protein of 662 amino acids.250 LRRC32 is a protein that is heavily glycosylated to a molecular weight of 80 KD, with an unglycosylated molecular weight of 72 KD.250 The majority of the protein is extracellular and made of LRR domains, which bind to latent TGF-β and latency-associated peptide (LAP) on the cell surface.250,252 LRRC32 is conserved in mice
35" where Lrrc32 is located on chromosome 7F.242 Characterization of Lrrc32 mRNA expression in mouse showed developmental expression in the skin, lens fiber cells, nasal cavity, smooth and skeletal muscles, lung, and in megakaryocytes in the fetal liver.254 In adult mice it is expressed by megakaryocytes in the spleen and in endothelial cells of the placenta.254 LRRC32 was later shown to be selectively expressed on the surface of activated Treg cells, and functions as a regulator of TGF-β signaling in Treg cells and platelets, which will be discussed in the following section.251
1.7.3. LRRC32 Function
The function of LRRC32 became apparent after it was identified on the surface of activated Treg cells. In the initial report characterizing LRRC32 in Treg cells, LRRC32 was identified on the cell surface of Treg cells activated through the T cell receptor (TCR). Overexpressing LRRC32 in Tn cells inhibited proliferation and cytokine production while inducing expression of FOXP3, the
251 master transcription factor of Treg cells. This suppressive effect caused by LRRC32 overexpression on CD4+ T cells was reversible by inhibiting TGF-β signaling. This also enhanced surface expression of LRRC32 on Treg cells and blocked the induction of FOXP3 in activated CD4+ T cells overexpressing LRRC32.255 Only the extracellular domain of LRRC32 was required for these functions, and LRRC32 was shown to bind latent TGF-β in Treg cells and platelets, a function conserved in humans, mice, and felines.252,256-258 However, while overexpression of LRRC32 in T cells resulted in increased surface binding of latent TGF-β, this did not produce active TGF-β upon stimulation of the TCR.252 Interestingly, gene silencing of
LRRC32 reduced FOXP3 levels in Treg cells and the suppressive activity of FOXP3 overexpressing cells, suggesting LRRC32 has a regulatory role in Treg development and function.251 Similarly, downregulation of FOXP3 resulted in reduced suppressive activity with decreased LRRC32 levels, suggesting FOXP3-LRRC32 shared a positive feedback loop.259
This also provides a rationale for the molecular basis of the known differences between natural
36" and TGF-β-induced Treg cells. Further mechanistic studies showed LRRC32 regulates the bioavailability and activation of TGF-β, regulating activation and secretion of TGF-β via
260 interactions with integrin αvβ6 primarily, and integrin αvβ8 to a lesser extent. Finally, soluble
LRRC32 (sLRRC32) was investigated for therapeutic purposes and found to have potent anti- inflammatory and immunomodulatory effects. sLRRC32 induced FOXP3, decreasing proliferation, and repressed IL-2 and IFNγ production in CD4+ T cells, driving differentiation of
261 Tn cells to Treg cells. Interestingly, sLRRC32 prevented T cell-mediated destructive inflammation in a humanized mouse model of xenogeneic graft-versus-host disease (GVHD) by
261 enhancing Treg cells and inhibiting T effector cell activity. Taken together, these findings indicate that LRRC32 functions as an important regulator of TGF-β bioavailability and signaling, contributing to a positive feedback loop with FOXP3 that promotes Treg cell development, function, and anti-inflammatory effects.
1.7.4. Summary
In summary, LRRC32 is a LRR transmembrane molecule that has an important role in immune regulation. LRRC32 is expressed on activated Treg cells, binds latent TGF-β to regulate bioavailability and TGF-β signaling, and signals in a positive feedback loop with FOXP3 to drive the Treg cell immunosuppressive phenotype. The most intriguing aspect of LRRC32 is the potential of using sLRRC32 as a therapeutic to promote anti-inflammatory and immunomodulatory effects in GVHD and other T cell-mediated inflammatory diseases including transplant rejection, autoimmunity, and allergic diseases such as EoE.
37" 1.8. References
1 Ono, S. J. Molecular genetics of allergic diseases. Annu Rev Immunol 18, 347-366,
doi:10.1146/annurev.immunol.18.1.347 (2000).
2 Broide, D. H. Immunomodulation of allergic disease. Annu Rev Med 60, 279-291,
doi:10.1146/annurev.med.60.041807.123524 (2009).
3 Yoo, Y. & Perzanowski, M. S. Allergic sensitization and the environment: latest update.
Curr Allergy Asthma Rep 14, 465, doi:10.1007/s11882-014-0465-1 (2014).
4 Sicherer, S. H. & Sampson, H. A. Food allergy: recent advances in pathophysiology and
treatment. Annu Rev Med 60, 261-277, doi:10.1146/annurev.med.60.042407.205711
(2009).
5 Sampson, H. A. et al. Food allergy: a practice parameter update-2014. The Journal of
allergy and clinical immunology 134, 1016-1025 e1043, doi:10.1016/j.jaci.2014.05.013
(2014).
6 Coutinho, A. E. & Chapman, K. E. The anti-inflammatory and immunosuppressive
effects of glucocorticoids, recent developments and mechanistic insights. Mol Cell
Endocrinol 335, 2-13, doi:10.1016/j.mce.2010.04.005 (2011).
7 Fajt, M. L. & Wenzel, S. E. Asthma phenotypes and the use of biologic medications in
asthma and allergic disease: the next steps toward personalized care. The Journal of
allergy and clinical immunology 135, 299-310; quiz 311, doi:10.1016/j.jaci.2014.12.1871
(2015).
8 Liacouras, C. A. et al. Eosinophilic esophagitis: updated consensus recommendations
for children and adults. The Journal of allergy and clinical immunology 128, 3-20 e26;
quiz 21-22, doi:10.1016/j.jaci.2011.02.040 (2011).
9 Eder, W., Ege, M. J. & von Mutius, E. The asthma epidemic. N Engl J Med 355, 2226-
2235, doi:10.1056/NEJMra054308 (2006).
38" 10 Hopp, R. J., Bewtra, A. K., Watt, G. D., Nair, N. M. & Townley, R. G. Genetic analysis of
allergic disease in twins. The Journal of allergy and clinical immunology 73, 265-270
(1984).
11 Luoma, R., Koivikko, A. & Viander, M. Development of asthma, allergic rhinitis and
atopic dermatitis by the age of five years. A prospective study of 543 newborns. Allergy
38, 339-346 (1983).
12 Aron, Y. et al. Evidence of a strong, positive association between atopy and the HLA
class II alleles DR4 and DR7. Clin Exp Allergy 26, 821-828 (1996).
13 Senechal, H. et al. Genetics and specific immune response in allergy to birch pollen and
food: evidence of a strong, positive association between atopy and the HLA class II
allele HLA-DR7. The Journal of allergy and clinical immunology 104, 395-401 (1999).
14 Ingerski, L. M. et al. Health-related quality of life across pediatric chronic conditions. The
Journal of pediatrics 156, 639-644, doi:10.1016/j.jpeds.2009.11.008 (2010).
15 Jensen, E. T., Kappelman, M. D., Martin, C. F. & Dellon, E. S. Health-care utilization,
costs, and the burden of disease related to eosinophilic esophagitis in the United States.
Am J Gastroenterol 110, 626-632, doi:10.1038/ajg.2014.316 (2015).
16 Attwood, S. E., Smyrk, T. C., Demeester, T. R. & Jones, J. B. Esophageal eosinophilia
with dysphagia. A distinct clinicopathologic syndrome. Dig Dis Sci 38, 109-116 (1993).
17 Kelly, K. J. et al. Eosinophilic esophagitis attributed to gastroesophageal reflux:
improvement with an amino acid-based formula. Gastroenterology 109, 1503-1512
(1995).
18 Furuta, G. T. et al. Eosinophilic esophagitis in children and adults: a systematic review
and consensus recommendations for diagnosis and treatment. Gastroenterology 133,
1342-1363, doi:10.1053/j.gastro.2007.08.017 (2007).
39" 19 Abonia, J. P. et al. High prevalence of eosinophilic esophagitis in patients with inherited
connective tissue disorders. The Journal of allergy and clinical immunology 132, 378-
386, doi:10.1016/j.jaci.2013.02.030 (2013).
20 Frischmeyer-Guerrerio, P. A. et al. TGFbeta receptor mutations impose a strong
predisposition for human allergic disease. Sci Transl Med 5, 195ra194,
doi:10.1126/scitranslmed.3006448 (2013).
21 Henderson, C. J. et al. Increased prevalence of eosinophilic gastrointestinal disorders in
pediatric PTEN hamartoma tumor syndromes. Journal of pediatric gastroenterology and
nutrition 58, 553-560, doi:10.1097/MPG.0000000000000253 (2014).
22 Samuelov, L. et al. Desmoglein 1 deficiency results in severe dermatitis, multiple
allergies and metabolic wasting. Nature genetics 45, 1244-1248, doi:10.1038/ng.2739
(2013).
23 Alexander, E. S. et al. Twin and family studies reveal strong environmental and weaker
genetic cues explaining heritability of eosinophilic esophagitis. The Journal of allergy and
clinical immunology 134, 1084-1092 e1081, doi:10.1016/j.jaci.2014.07.021 (2014).
24 Blanchard, C. et al. Eotaxin-3 and a uniquely conserved gene-expression profile in
eosinophilic esophagitis. The Journal of clinical investigation 116, 536-547,
doi:10.1172/JCI26679 (2006).
25 Blanchard, C. et al. Coordinate interaction between IL-13 and epithelial differentiation
cluster genes in eosinophilic esophagitis. Journal of immunology 184, 4033-4041,
doi:10.4049/jimmunol.0903069 (2010).
26 Aceves, S. S. et al. Resolution of remodeling in eosinophilic esophagitis correlates with
epithelial response to topical corticosteroids. Allergy 65, 109-116, doi:10.1111/j.1398-
9995.2009.02142.x (2010).
27 Rothenberg, M. E. et al. Common variants at 5q22 associate with pediatric eosinophilic
esophagitis. Nature genetics 42, 289-291, doi:10.1038/ng.547 (2010).
40" 28 Sherrill, J. D. et al. Variants of thymic stromal lymphopoietin and its receptor associate
with eosinophilic esophagitis. The Journal of allergy and clinical immunology 126, 160-
165 e163, doi:10.1016/j.jaci.2010.04.037 (2010).
29 Kottyan, L. C. et al. Genome-wide association analysis of eosinophilic esophagitis
provides insight into the tissue specificity of this allergic disease. Nature genetics 46,
895-900, doi:10.1038/ng.3033 (2014).
30 Jensen, E. T., Kappelman, M. D., Kim, H. P., Ringel-Kulka, T. & Dellon, E. S. Early life
exposures as risk factors for pediatric eosinophilic esophagitis. Journal of pediatric
gastroenterology and nutrition 57, 67-71, doi:10.1097/MPG.0b013e318290d15a (2013).
31 Eigenmann, P. A. Evidence of preventive effect of probiotics and prebiotics for infantile
eczema. Curr Opin Allergy Clin Immunol 13, 426-431,
doi:10.1097/ACI.0b013e3283630bad (2013).
32 Harris, J. K. et al. Esophageal microbiome in eosinophilic esophagitis. PLoS One 10,
e0128346, doi:10.1371/journal.pone.0128346 (2015).
33 Prasad, G. A. et al. Epidemiology of eosinophilic esophagitis over three decades in
Olmsted County, Minnesota. Clin Gastroenterol Hepatol 7, 1055-1061,
doi:10.1016/j.cgh.2009.06.023 (2009).
34 Philpott, H. et al. Seasonal Recurrence of Food Bolus Obstruction in Eosinophilic
Esophagitis. Intern Med J, doi:10.1111/imj.12790 (2015).
35 Chadha, S. N., Wang, L., Correa, H., Moulton, D. & Hummell, D. S. Pediatric
eosinophilic esophagitis: the Vanderbilt experience. Ann Allergy Asthma Immunol 113,
445-451, doi:10.1016/j.anai.2014.07.020 (2014).
36 Rothenberg, M. E. Molecular, genetic, and cellular bases for treating eosinophilic
esophagitis. Gastroenterology 148, 1143-1157, doi:10.1053/j.gastro.2015.02.002 (2015).
41" 37 Akei, H. S., Mishra, A., Blanchard, C. & Rothenberg, M. E. Epicutaneous antigen
exposure primes for experimental eosinophilic esophagitis in mice. Gastroenterology
129, 985-994, doi:10.1053/j.gastro.2005.06.027 (2005).
38 Mishra, A., Hogan, S. P., Brandt, E. B. & Rothenberg, M. E. An etiological role for
aeroallergens and eosinophils in experimental esophagitis. The Journal of clinical
investigation 107, 83-90, doi:10.1172/JCI10224 (2001).
39 Zuo, L. et al. IL-13 induces esophageal remodeling and gene expression by an
eosinophil-independent, IL-13R alpha 2-inhibited pathway. J Immunol 185, 660-669,
doi:10.4049/jimmunol.1000471 (2010).
40 Mishra, A. & Rothenberg, M. E. Intratracheal IL-13 induces eosinophilic esophagitis by
an IL-5, eotaxin-1, and STAT6-dependent mechanism. Gastroenterology 125, 1419-
1427 (2003).
41 Blanchard, C. et al. Inhibition of human interleukin-13-induced respiratory and
oesophageal inflammation by anti-human-interleukin-13 antibody (CAT-354). Clin Exp
Allergy 35, 1096-1103, doi:10.1111/j.1365-2222.2005.02299.x (2005).
42 Blanchard, C. et al. IL-13 involvement in eosinophilic esophagitis: transcriptome analysis
and reversibility with glucocorticoids. The Journal of allergy and clinical immunology 120,
1292-1300, doi:10.1016/j.jaci.2007.10.024 (2007).
43 Sherrill, J. D. et al. Desmoglein-1 regulates esophageal epithelial barrier function and
immune responses in eosinophilic esophagitis. Mucosal immunology 7, 718-729,
doi:10.1038/mi.2013.90 (2014).
44 Thyssen, J. P. & Kezic, S. Causes of epidermal filaggrin reduction and their role in the
pathogenesis of atopic dermatitis. The Journal of allergy and clinical immunology 134,
792-799, doi:10.1016/j.jaci.2014.06.014 (2014).
45 Brown, S. J. & McLean, W. H. One remarkable molecule: filaggrin. The Journal of
investigative dermatology 132, 751-762, doi:10.1038/jid.2011.393 (2012).
42" 46 Simpson, C. L., Patel, D. M. & Green, K. J. Deconstructing the skin: cytoarchitectural
determinants of epidermal morphogenesis. Nat Rev Mol Cell Biol 12, 565-580,
doi:10.1038/nrm3175 (2011).
47 Hanakawa, Y. et al. Differential effects of desmoglein 1 and desmoglein 3 on
desmosome formation. The Journal of investigative dermatology 119, 1231-1236,
doi:10.1046/j.1523-1747.2002.19648.x (2002).
48 Getsios, S. et al. Desmoglein 1-dependent suppression of EGFR signaling promotes
epidermal differentiation and morphogenesis. J Cell Biol 185, 1243-1258,
doi:10.1083/jcb.200809044 (2009).
49 Cheng, E., Souza, R. F. & Spechler, S. J. Tissue remodeling in eosinophilic esophagitis.
Am J Physiol Gastrointest Liver Physiol 303, G1175-1187, doi:10.1152/ajpgi.00313.2012
(2012).
50 Rochman, M. et al. Neurotrophic tyrosine kinase receptor 1 is a direct transcriptional and
epigenetic target of IL-13 involved in allergic inflammation. Mucosal immunology 8, 785-
798, doi:10.1038/mi.2014.109 (2015).
51 Kagalwalla, A. F. et al. Eosinophilic esophagitis: epithelial mesenchymal transition
contributes to esophageal remodeling and reverses with treatment. The Journal of
allergy and clinical immunology 129, 1387-1396 e1387, doi:10.1016/j.jaci.2012.03.005
(2012).
52 Sherrill, J. D. et al. Analysis and expansion of the eosinophilic esophagitis transcriptome
by RNA sequencing. Genes and immunity 15, 361-369, doi:10.1038/gene.2014.27
(2014).
53 Mulder, D. J. & Justinich, C. J. Understanding eosinophilic esophagitis: the cellular and
molecular mechanisms of an emerging disease. Mucosal immunology 4, 139-147,
doi:10.1038/mi.2010.88 (2011).
43" 54 Noti, M. et al. Thymic stromal lymphopoietin-elicited basophil responses promote
eosinophilic esophagitis. Nat Med 19, 1005-1013, doi:10.1038/nm.3281 (2013).
55 Rosenberg, H. F., Phipps, S. & Foster, P. S. Eosinophil trafficking in allergy and asthma.
The Journal of allergy and clinical immunology 119, 1303-1310; quiz 1311-1302,
doi:10.1016/j.jaci.2007.03.048 (2007).
56 Barthel, S. R., Johansson, M. W., McNamee, D. M. & Mosher, D. F. Roles of integrin
activation in eosinophil function and the eosinophilic inflammation of asthma. Journal of
leukocyte biology 83, 1-12, doi:10.1189/jlb.0607344 (2008).
57 Stone, K. D., Prussin, C. & Metcalfe, D. D. IgE, mast cells, basophils, and eosinophils.
The Journal of allergy and clinical immunology 125, S73-80,
doi:10.1016/j.jaci.2009.11.017 (2010).
58 Afshar, K., Vucinic, V. & Sharma, O. P. Eosinophil cell: pray tell us what you do! Curr
Opin Pulm Med 13, 414-421, doi:10.1097/MCP.0b013e328224b90b (2007).
59 Collins, M. H. Histopathologic features of eosinophilic esophagitis and eosinophilic
gastrointestinal diseases. Gastroenterol Clin North Am 43, 257-268,
doi:10.1016/j.gtc.2014.02.007 (2014).
60 Gupta, S. K., Fitzgerald, J. F., Kondratyuk, T. & HogenEsch, H. Cytokine expression in
normal and inflamed esophageal mucosa: a study into the pathogenesis of allergic
eosinophilic esophagitis. Journal of pediatric gastroenterology and nutrition 42, 22-26
(2006).
61 Straumann, A., Bauer, M., Fischer, B., Blaser, K. & Simon, H. U. Idiopathic eosinophilic
esophagitis is associated with a T(H)2-type allergic inflammatory response. The Journal
of allergy and clinical immunology 108, 954-961, doi:10.1067/mai.2001.119917 (2001).
62 Lucendo, A. J. et al. Immunophenotypic characterization and quantification of the
epithelial inflammatory infiltrate in eosinophilic esophagitis through stereology: an
analysis of the cellular mechanisms of the disease and the immunologic capacity of the
44" esophagus. Am J Surg Pathol 31, 598-606, doi:10.1097/01.pas.0000213392.49698.8c
(2007).
63 Kirsch, R., Bokhary, R., Marcon, M. A. & Cutz, E. Activated mucosal mast cells
differentiate eosinophilic (allergic) esophagitis from gastroesophageal reflux disease.
Journal of pediatric gastroenterology and nutrition 44, 20-26,
doi:10.1097/MPG.0b013e31802c0d06 (2007).
64 Goswami, R. & Kaplan, M. H. A brief history of IL-9. Journal of immunology 186, 3283-
3288, doi:10.4049/jimmunol.1003049 (2011).
65 Blanchard, C. et al. A striking local esophageal cytokine expression profile in
eosinophilic esophagitis. The Journal of allergy and clinical immunology 127, 208-217,
217 e201-207, doi:10.1016/j.jaci.2010.10.039 (2011).
66 Veldhoen, M., Hocking, R. J., Atkins, C. J., Locksley, R. M. & Stockinger, B. TGFbeta in
the context of an inflammatory cytokine milieu supports de novo differentiation of IL-17-
producing T cells. Immunity 24, 179-189, doi:10.1016/j.immuni.2006.01.001 (2006).
67 Wang, Y. H., Hogan, S. P., Fulkerson, P. C., Abonia, J. P. & Rothenberg, M. E.
Expanding the paradigm of eosinophilic esophagitis: mast cells and IL-9. The Journal of
allergy and clinical immunology 131, 1583-1585, doi:10.1016/j.jaci.2013.04.010 (2013).
68 Vicario, M. et al. Local B cells and IgE production in the oesophageal mucosa in
eosinophilic oesophagitis. Gut 59, 12-20, doi:10.1136/gut.2009.178020 (2010).
69 Abonia, J. P. et al. Involvement of mast cells in eosinophilic esophagitis. The Journal of
allergy and clinical immunology 126, 140-149, doi:10.1016/j.jaci.2010.04.009 (2010).
70 Minai-Fleminger, Y. & Levi-Schaffer, F. Mast cells and eosinophils: the two key effector
cells in allergic inflammation. Inflamm Res 58, 631-638, doi:10.1007/s00011-009-0042-6
(2009).
71 Liacouras, C. A. et al. Eosinophilic esophagitis: a 10-year experience in 381 children.
Clin Gastroenterol Hepatol 3, 1198-1206 (2005).
45" 72 Paul, W. E. & Zhu, J. How are T(H)2-type immune responses initiated and amplified?
Nat Rev Immunol 10, 225-235, doi:10.1038/nri2735 (2010).
73 Neilsen, C. V. & Bryce, P. J. Interleukin-13 directly promotes oesophagus production of
CCL11 and CCL24 and the migration of eosinophils. Clin Exp Allergy 40, 427-434,
doi:10.1111/j.1365-2222.2009.03419.x (2010).
74 Prussin, C., Lee, J. & Foster, B. Eosinophilic gastrointestinal disease and peanut allergy
are alternatively associated with IL-5+ and IL-5(-) T(H)2 responses. The Journal of
allergy and clinical immunology 124, 1326-1332 e1326, doi:10.1016/j.jaci.2009.09.048
(2009).
75 Mishra, A., Schlotman, J., Wang, M. & Rothenberg, M. E. Critical role for adaptive T cell
immunity in experimental eosinophilic esophagitis in mice. Journal of leukocyte biology
81, 916-924, doi:10.1189/jlb.1106653 (2007).
76 Teitelbaum, J. E. et al. Eosinophilic esophagitis in children: immunopathological analysis
and response to fluticasone propionate. Gastroenterology 122, 1216-1225 (2002).
77 Mulder, D. J. et al. Antigen presentation and MHC class II expression by human
esophageal epithelial cells: role in eosinophilic esophagitis. Am J Pathol 178, 744-753,
doi:10.1016/j.ajpath.2010.10.027 (2011).
78 Sayed, D. & Abdellatif, M. MicroRNAs in development and disease. Physiol Rev 91, 827-
887, doi:10.1152/physrev.00006.2010 (2011).
79 Lu, T. X. et al. MicroRNA signature in patients with eosinophilic esophagitis, reversibility
with glucocorticoids, and assessment as disease biomarkers. The Journal of allergy and
clinical immunology 129, 1064-1075 e1069, doi:10.1016/j.jaci.2012.01.060 (2012).
80 Melnik, B. C. MiR-21: an environmental driver of malignant melanoma? J Transl Med 13,
202, doi:10.1186/s12967-015-0570-5 (2015).
81 Lu, T. X. et al. MicroRNA-21 limits in vivo immune response-mediated activation of the
IL-12/IFN-gamma pathway, Th1 polarization, and the severity of delayed-type
46" hypersensitivity. Journal of immunology 187, 3362-3373, doi:10.4049/jimmunol.1101235
(2011).
82 Lu, T. X. et al. Targeted ablation of miR-21 decreases murine eosinophil progenitor cell
growth. PLoS One 8, e59397, doi:10.1371/journal.pone.0059397 (2013).
83 Johnnidis, J. B. et al. Regulation of progenitor cell proliferation and granulocyte function
by microRNA-223. Nature 451, 1125-1129, doi:10.1038/nature06607 (2008).
84 Lu, T. X. et al. MiR-375 is downregulated in epithelial cells after IL-13 stimulation and
regulates an IL-13-induced epithelial transcriptome. Mucosal immunology 5, 388-396,
doi:10.1038/mi.2012.16 (2012).
85 Dellon, E. S. & Liacouras, C. A. Advances in clinical management of eosinophilic
esophagitis. Gastroenterology 147, 1238-1254, doi:10.1053/j.gastro.2014.07.055 (2014).
86 Molina-Infante, J. & Katzka, D. A. Proton-pump inhibitor-responsive esophageal
eosinophilia. Curr Opin Gastroenterol 30, 428-433,
doi:10.1097/MOG.0000000000000080 (2014).
87 Liacouras, C. A., Wenner, W. J., Brown, K. & Ruchelli, E. Primary eosinophilic
esophagitis in children: successful treatment with oral corticosteroids. Journal of
pediatric gastroenterology and nutrition 26, 380-385 (1998).
88 Faubion, W. A., Jr. et al. Treatment of eosinophilic esophagitis with inhaled
corticosteroids. Journal of pediatric gastroenterology and nutrition 27, 90-93 (1998).
89 Alexander, J. A. et al. Swallowed fluticasone improves histologic but not symptomatic
response of adults with eosinophilic esophagitis. Clin Gastroenterol Hepatol 10, 742-749
e741, doi:10.1016/j.cgh.2012.03.018 (2012).
90 Lindberg, G. M., Van Eldik, R. & Saboorian, M. H. A case of herpes esophagitis after
fluticasone propionate for eosinophilic esophagitis. Nat Clin Pract Gastroenterol Hepatol
5, 527-530, doi:10.1038/ncpgasthep1225 (2008).
47" 91 Assa'ad, A. H. et al. An antibody against IL-5 reduces numbers of esophageal
intraepithelial eosinophils in children with eosinophilic esophagitis. Gastroenterology
141, 1593-1604, doi:10.1053/j.gastro.2011.07.044 (2011).
92 Spergel, J. M. et al. Reslizumab in children and adolescents with eosinophilic
esophagitis: results of a double-blind, randomized, placebo-controlled trial. The Journal
of allergy and clinical immunology 129, 456-463, 463 e451-453,
doi:10.1016/j.jaci.2011.11.044 (2012).
93 Rothenberg, M. E. et al. Intravenous anti-IL-13 mAb QAX576 for the treatment of
eosinophilic esophagitis. The Journal of allergy and clinical immunology 135, 500-507,
doi:10.1016/j.jaci.2014.07.049 (2015).
94 Straumann, A., Bussmann, C., Conus, S., Beglinger, C. & Simon, H. U. Anti-TNF-alpha
(infliximab) therapy for severe adult eosinophilic esophagitis. The Journal of allergy and
clinical immunology 122, 425-427, doi:10.1016/j.jaci.2008.06.012 (2008).
95 Arias, A., Gonzalez-Cervera, J., Tenias, J. M. & Lucendo, A. J. Efficacy of dietary
interventions for inducing histologic remission in patients with eosinophilic esophagitis: a
systematic review and meta-analysis. Gastroenterology 146, 1639-1648,
doi:10.1053/j.gastro.2014.02.006 (2014).
96 Kagalwalla, A. F. et al. Effect of six-food elimination diet on clinical and histologic
outcomes in eosinophilic esophagitis. Clin Gastroenterol Hepatol 4, 1097-1102,
doi:10.1016/j.cgh.2006.05.026 (2006).
97 Spergel, J. M., Andrews, T., Brown-Whitehorn, T. F., Beausoleil, J. L. & Liacouras, C. A.
Treatment of eosinophilic esophagitis with specific food elimination diet directed by a
combination of skin prick and patch tests. Ann Allergy Asthma Immunol 95, 336-343,
doi:10.1016/S1081-1206(10)61151-9 (2005).
48" 98 Schoepfer, A. M. et al. Esophageal dilation in eosinophilic esophagitis: effectiveness,
safety, and impact on the underlying inflammation. Am J Gastroenterol 105, 1062-1070,
doi:10.1038/ajg.2009.657 (2010).
99 Bohm, M. E. & Richter, J. E. Review article: oesophageal dilation in adults with
eosinophilic oesophagitis. Aliment Pharmacol Ther 33, 748-757, doi:10.1111/j.1365-
2036.2011.04593.x (2011).
100 Egan, J. V. et al. Esophageal dilation. Gastrointest Endosc 63, 755-760,
doi:10.1016/j.gie.2006.02.031 (2006).
101 Butz, B. K. et al. Efficacy, dose reduction, and resistance to high-dose fluticasone in
patients with eosinophilic esophagitis. Gastroenterology 147, 324-333 e325,
doi:10.1053/j.gastro.2014.04.019 (2014).
102 Wolf, W. A. et al. Predictors of response to steroid therapy for eosinophilic esophagitis
and treatment of steroid-refractory patients. Clin Gastroenterol Hepatol 13, 452-458,
doi:10.1016/j.cgh.2014.07.034 (2015).
103 Marchiando, A. M., Graham, W. V. & Turner, J. R. Epithelial barriers in homeostasis and
disease. Annu Rev Pathol 5, 119-144, doi:10.1146/annurev.pathol.4.110807.092135
(2010).
104 Colman, D. R. Neuronal polarity and the epithelial metaphor. Neuron 23, 649-651
(1999).
105 Barbieri, C. E. & Pietenpol, J. A. p63 and epithelial biology. Exp Cell Res 312, 695-706,
doi:10.1016/j.yexcr.2005.11.028 (2006).
106 Mills, A. A. et al. p63 is a p53 homologue required for limb and epidermal
morphogenesis. Nature 398, 708-713, doi:10.1038/19531 (1999).
107 Yang, A. et al. p63 is essential for regenerative proliferation in limb, craniofacial and
epithelial development. Nature 398, 714-718, doi:10.1038/19539 (1999).
49" 108 Koster, M. I., Kim, S., Mills, A. A., DeMayo, F. J. & Roop, D. R. p63 is the molecular
switch for initiation of an epithelial stratification program. Genes Dev 18, 126-131,
doi:10.1101/gad.1165104 (2004).
109 van Bokhoven, H. et al. p63 Gene mutations in eec syndrome, limb-mammary
syndrome, and isolated split hand-split foot malformation suggest a genotype-phenotype
correlation. Am J Hum Genet 69, 481-492, doi:10.1086/323123 (2001).
110 van Bokhoven, H. & Brunner, H. G. Splitting p63. Am J Hum Genet 71, 1-13,
doi:10.1086/341450 (2002).
111 Yoh, K. & Prywes, R. Pathway Regulation of p63, a Director of Epithelial Cell Fate. Front
Endocrinol (Lausanne) 6, 51, doi:10.3389/fendo.2015.00051 (2015).
112 Tadeu, A. M. & Horsley, V. Notch signaling represses p63 expression in the developing
surface ectoderm. Development 140, 3777-3786, doi:10.1242/dev.093948 (2013).
113 Nguyen, B. C. et al. Cross-regulation between Notch and p63 in keratinocyte
commitment to differentiation. Genes Dev 20, 1028-1042, doi:10.1101/gad.1406006
(2006).
114 Yalcin-Ozuysal, O. et al. Antagonistic roles of Notch and p63 in controlling mammary
epithelial cell fates. Cell Death Differ 17, 1600-1612, doi:10.1038/cdd.2010.37 (2010).
115 Ross, D. A. & Kadesch, T. Consequences of Notch-mediated induction of Jagged1. Exp
Cell Res 296, 173-182, doi:10.1016/j.yexcr.2004.02.003 (2004).
116 Toftgard, R. Hedgehog signalling in cancer. Cell Mol Life Sci 57, 1720-1731 (2000).
117 Karhadkar, S. S. et al. Hedgehog signalling in prostate regeneration, neoplasia and
metastasis. Nature 431, 707-712, doi:10.1038/nature02962 (2004).
118 Pasca di Magliano, M. & Hebrok, M. Hedgehog signalling in cancer formation and
maintenance. Nat Rev Cancer 3, 903-911, doi:10.1038/nrc1229 (2003).
50" 119 Ferretti, E. et al. A conserved Pbx-Wnt-p63-Irf6 regulatory module controls face
morphogenesis by promoting epithelial apoptosis. Dev Cell 21, 627-641,
doi:10.1016/j.devcel.2011.08.005 (2011).
120 Altschul, S. F. et al. Gapped BLAST and PSI-BLAST: a new generation of protein
database search programs. Nucleic acids research 25, 3389-3402 (1997).
121 Cheng, C. C., Wang, D. Y., Kao, M. H. & Chen, J. K. The growth-promoting effect of
KGF on limbal epithelial cells is mediated by upregulation of DeltaNp63alpha through the
p38 pathway. J Cell Sci 122, 4473-4480, doi:10.1242/jcs.054791 (2009).
122 Barbieri, C. E., Tang, L. J., Brown, K. A. & Pietenpol, J. A. Loss of p63 leads to
increased cell migration and up-regulation of genes involved in invasion and metastasis.
Cancer Res 66, 7589-7597, doi:10.1158/0008-5472.CAN-06-2020 (2006).
123 Ma, J. et al. Mammalian target of rapamycin regulates murine and human cell
differentiation through STAT3/p63/Jagged/Notch cascade. The Journal of clinical
investigation 120, 103-114, doi:10.1172/JCI37964 (2010).
124 Higashikawa, K. et al. Snail-induced down-regulation of DeltaNp63alpha acquires
invasive phenotype of human squamous cell carcinoma. Cancer Res 67, 9207-9213,
doi:10.1158/0008-5472.CAN-07-0932 (2007).
125 Olsen, J. R. et al. p63 attenuates epithelial to mesenchymal potential in an experimental
prostate cell model. PLoS One 8, e62547, doi:10.1371/journal.pone.0062547 (2013).
126 Al-Awqati, Q. Terminal differentiation in epithelia: the role of integrins in hensin
polymerization. Annu Rev Physiol 73, 401-412, doi:10.1146/annurev-physiol-012110-
142253 (2011).
127 Vijayakumar, S., Takito, J., Hikita, C. & Al-Awqati, Q. Hensin remodels the apical
cytoskeleton and induces columnarization of intercalated epithelial cells: processes that
resemble terminal differentiation. J Cell Biol 144, 1057-1067 (1999).
51" 128 Jiang, J. F. et al. Effects of alfalfa meal on growth performance and gastrointestinal tract
development of growing ducks. Asian-Australas J Anim Sci 25, 1445-1450,
doi:10.5713/ajas.2012.12190 (2012).
129 Vijayakumar, S., Takito, J., Gao, X., Schwartz, G. J. & Al-Awqati, Q. Differentiation of
columnar epithelia: the hensin pathway. J Cell Sci 119, 4797-4801,
doi:10.1242/jcs.03269 (2006).
130 Farquhar, M. G. & Palade, G. E. Junctional complexes in various epithelia. J Cell Biol
17, 375-412 (1963).
131 Evans, S. E., Xu, Y., Tuvim, M. J. & Dickey, B. F. Inducible innate resistance of lung
epithelium to infection. Annu Rev Physiol 72, 413-435, doi:10.1146/annurev-physiol-
021909-135909 (2010).
132 Neutra, M. R., Pringault, E. & Kraehenbuhl, J. P. Antigen sampling across epithelial
barriers and induction of mucosal immune responses. Annu Rev Immunol 14, 275-300,
doi:10.1146/annurev.immunol.14.1.275 (1996).
133 Gribar, S. C., Richardson, W. M., Sodhi, C. P. & Hackam, D. J. No longer an innocent
bystander: epithelial toll-like receptor signaling in the development of mucosal
inflammation. Mol Med 14, 645-659, doi:10.2119/2008-00035.Gribar (2008).
134 Medzhitov, R. Recognition of microorganisms and activation of the immune response.
Nature 449, 819-826, doi:10.1038/nature06246 (2007).
135 Kopp, E. & Medzhitov, R. Recognition of microbial infection by Toll-like receptors. Curr
Opin Immunol 15, 396-401 (2003).
136 Kawai, T. & Akira, S. TLR signaling. Cell Death Differ 13, 816-825,
doi:10.1038/sj.cdd.4401850 (2006).
137 O'Neill, L. A. & Bowie, A. G. The family of five: TIR-domain-containing adaptors in Toll-
like receptor signalling. Nat Rev Immunol 7, 353-364, doi:10.1038/nri2079 (2007).
52" 138 Beutler, B. A. TLRs and innate immunity. Blood 113, 1399-1407, doi:10.1182/blood-
2008-07-019307 (2009).
139 Shaw, M. H., Reimer, T., Kim, Y. G. & Nunez, G. NOD-like receptors (NLRs): bona fide
intracellular microbial sensors. Curr Opin Immunol 20, 377-382,
doi:10.1016/j.coi.2008.06.001 (2008).
140 Kawai, T. & Akira, S. Toll-like receptor and RIG-I-like receptor signaling. Ann N Y Acad
Sci 1143, 1-20, doi:10.1196/annals.1443.020 (2008).
141 Bals, R. & Hiemstra, P. S. Innate immunity in the lung: how epithelial cells fight against
respiratory pathogens. Eur Respir J 23, 327-333 (2004).
142 Hippenstiel, S., Opitz, B., Schmeck, B. & Suttorp, N. Lung epithelium as a sentinel and
effector system in pneumonia--molecular mechanisms of pathogen recognition and
signal transduction. Respir Res 7, 97, doi:10.1186/1465-9921-7-97 (2006).
143 Hammad, H. & Lambrecht, B. N. Dendritic cells and epithelial cells: linking innate and
adaptive immunity in asthma. Nat Rev Immunol 8, 193-204, doi:10.1038/nri2275 (2008).
144 Martin, T. R. & Frevert, C. W. Innate immunity in the lungs. Proc Am Thorac Soc 2, 403-
411, doi:10.1513/pats.200508-090JS (2005).
145 Saenz, S. A., Taylor, B. C. & Artis, D. Welcome to the neighborhood: epithelial cell-
derived cytokines license innate and adaptive immune responses at mucosal sites.
Immunol Rev 226, 172-190, doi:10.1111/j.1600-065X.2008.00713.x (2008).
146 Bartlett, J. A., Fischer, A. J. & McCray, P. B., Jr. Innate immune functions of the airway
epithelium. Contrib Microbiol 15, 147-163, doi:10.1159/000136349 (2008).
147 Brogden, K. A. Antimicrobial peptides: pore formers or metabolic inhibitors in bacteria?
Nat Rev Microbiol 3, 238-250, doi:10.1038/nrmicro1098 (2005).
148 Cole, A. M. et al. Cationic polypeptides are required for antibacterial activity of human
airway fluid. Journal of immunology 169, 6985-6991 (2002).
53" 149 Hiemstra, P. S. The role of epithelial beta-defensins and cathelicidins in host defense of
the lung. Exp Lung Res 33, 537-542, doi:10.1080/01902140701756687 (2007).
150 Ganz, T. Antimicrobial polypeptides. Journal of leukocyte biology 75, 34-38,
doi:10.1189/jlb.0403150 (2004).
151 Conner, G. E., Wijkstrom-Frei, C., Randell, S. H., Fernandez, V. E. & Salathe, M. The
lactoperoxidase system links anion transport to host defense in cystic fibrosis. FEBS Lett
581, 271-278, doi:10.1016/j.febslet.2006.12.025 (2007).
152 Gerson, C. et al. The lactoperoxidase system functions in bacterial clearance of airways.
American journal of respiratory cell and molecular biology 22, 665-671,
doi:10.1165/ajrcmb.22.6.3980 (2000).
153 Lai, Y. & Gallo, R. L. AMPed up immunity: how antimicrobial peptides have multiple roles
in immune defense. Trends Immunol 30, 131-141, doi:10.1016/j.it.2008.12.003 (2009).
154 Singh, P. K., Tack, B. F., McCray, P. B., Jr. & Welsh, M. J. Synergistic and additive
killing by antimicrobial factors found in human airway surface liquid. Am J Physiol Lung
Cell Mol Physiol 279, L799-805 (2000).
155 Jiang, M. et al. BMP-driven NRF2 activation in esophageal basal cell differentiation and
eosinophilic esophagitis. The Journal of clinical investigation, doi:10.1172/JCI78850
(2015).
156 Minty, A. et al. Interleukin-13 is a new human lymphokine regulating inflammatory and
immune responses. Nature 362, 248-250, doi:10.1038/362248a0 (1993).
157 Punnonen, J. et al. Interleukin 13 induces interleukin 4-independent IgG4 and IgE
synthesis and CD23 expression by human B cells. Proceedings of the National Academy
of Sciences of the United States of America 90, 3730-3734 (1993).
158 Wills-Karp, M. Interleukin-13 in asthma pathogenesis. Curr Allergy Asthma Rep 4, 123-
131 (2004).
54" 159 Moy, F. J., Diblasio, E., Wilhelm, J. & Powers, R. Solution structure of human IL-13 and
implication for receptor binding. Journal of molecular biology 310, 219-230,
doi:10.1006/jmbi.2001.4764 (2001).
160 Walter, M. R. et al. Crystal structure of recombinant human interleukin-4. The Journal of
biological chemistry 267, 20371-20376 (1992).
161 Wlodawer, A., Pavlovsky, A. & Gustchina, A. Crystal structure of human recombinant
interleukin-4 at 2.25 A resolution. FEBS Lett 309, 59-64 (1992).
162 LaPorte, S. L. et al. Molecular and structural basis of cytokine receptor pleiotropy in the
interleukin-4/13 system. Cell 132, 259-272, doi:10.1016/j.cell.2007.12.030 (2008).
163 Hilton, D. J. et al. Cloning and characterization of a binding subunit of the interleukin 13
receptor that is also a component of the interleukin 4 receptor. Proceedings of the
National Academy of Sciences of the United States of America 93, 497-501 (1996).
164 Obiri, N. I., Debinski, W., Leonard, W. J. & Puri, R. K. Receptor for interleukin 13.
Interaction with interleukin 4 by a mechanism that does not involve the common gamma
chain shared by receptors for interleukins 2, 4, 7, 9, and 15. The Journal of biological
chemistry 270, 8797-8804 (1995).
165 Kelly-Welch, A. E., Hanson, E. M., Boothby, M. R. & Keegan, A. D. Interleukin-4 and
interleukin-13 signaling connections maps. Science 300, 1527-1528,
doi:10.1126/science.1085458 (2003).
166 Bazan, J. F. Structural design and molecular evolution of a cytokine receptor
superfamily. Proceedings of the National Academy of Sciences of the United States of
America 87, 6934-6938 (1990).
167 Hage, T., Sebald, W. & Reinemer, P. Crystal structure of the interleukin-4/receptor alpha
chain complex reveals a mosaic binding interface. Cell 97, 271-281 (1999).
168 Boulay, J. L., O'Shea, J. J. & Paul, W. E. Molecular phylogeny within type I cytokines
and their cognate receptors. Immunity 19, 159-163 (2003).
55" 169 Arima, K. et al. Characterization of the interaction between interleukin-13 and interleukin-
13 receptors. The Journal of biological chemistry 280, 24915-24922,
doi:10.1074/jbc.M502571200 (2005).
170 Nelms, K., Keegan, A. D., Zamorano, J., Ryan, J. J. & Paul, W. E. The IL-4 receptor:
signaling mechanisms and biologic functions. Annu Rev Immunol 17, 701-738,
doi:10.1146/annurev.immunol.17.1.701 (1999).
171 Urban, J. F., Jr. et al. IL-13, IL-4Ralpha, and Stat6 are required for the expulsion of the
gastrointestinal nematode parasite Nippostrongylus brasiliensis. Immunity 8, 255-264
(1998).
172 Jankovic, D. et al. Schistosome-infected IL-4 receptor knockout (KO) mice, in contrast to
IL-4 KO mice, fail to develop granulomatous pathology while maintaining the same
lymphokine expression profile. Journal of immunology 163, 337-342 (1999).
173 Mohrs, M. et al. Differences between IL-4- and IL-4 receptor alpha-deficient mice in
chronic leishmaniasis reveal a protective role for IL-13 receptor signaling. Journal of
immunology 162, 7302-7308 (1999).
174 Wills-Karp, M. et al. Interleukin-13: central mediator of allergic asthma. Science 282,
2258-2261 (1998).
175 Chiaramonte, M. G., Donaldson, D. D., Cheever, A. W. & Wynn, T. A. An IL-13 inhibitor
blocks the development of hepatic fibrosis during a T-helper type 2-dominated
inflammatory response. The Journal of clinical investigation 104, 777-785,
doi:10.1172/JCI7325 (1999).
176 Wynn, T. A. IL-13 effector functions. Annu Rev Immunol 21, 425-456,
doi:10.1146/annurev.immunol.21.120601.141142 (2003).
177 Gavett, S. H. et al. Interleukin 12 inhibits antigen-induced airway hyperresponsiveness,
inflammation, and Th2 cytokine expression in mice. J Exp Med 182, 1527-1536 (1995).
56" 178 Kline, J. N. et al. Modulation of airway inflammation by CpG oligodeoxynucleotides in a
murine model of asthma. Journal of immunology 160, 2555-2559 (1998).
179 Sur, S. et al. Long term prevention of allergic lung inflammation in a mouse model of
asthma by CpG oligodeoxynucleotides. Journal of immunology 162, 6284-6293 (1999).
180 Walter, D. M. et al. Il-18 gene transfer by adenovirus prevents the development of and
reverses established allergen-induced airway hyperreactivity. Journal of immunology
166, 6392-6398 (2001).
181 Donaldson, D. D. et al. The murine IL-13 receptor alpha 2: molecular cloning,
characterization, and comparison with murine IL-13 receptor alpha 1. Journal of
immunology 161, 2317-2324 (1998).
182 Zhang, J. G. et al. Identification, purification, and characterization of a soluble interleukin
(IL)-13-binding protein. Evidence that it is distinct from the cloned Il-13 receptor and Il-4
receptor alpha-chains. The Journal of biological chemistry 272, 9474-9480 (1997).
183 Colotta, F. et al. Interleukin-1 type II receptor: a decoy target for IL-1 that is regulated by
IL-4. Science 261, 472-475 (1993).
184 Chiaramonte, M. G. et al. IL-13 is a key regulatory cytokine for Th2 cell-mediated
pulmonary granuloma formation and IgE responses induced by Schistosoma mansoni
eggs. Journal of immunology 162, 920-930 (1999).
185 Grunig, G. et al. Requirement for IL-13 independently of IL-4 in experimental asthma.
Science 282, 2261-2263 (1998).
186 Terabe, M. et al. NKT cell-mediated repression of tumor immunosurveillance by IL-13
and the IL-4R-STAT6 pathway. Nat Immunol 1, 515-520, doi:10.1038/82771 (2000).
187 Chiaramonte, M. G., Cheever, A. W., Malley, J. D., Donaldson, D. D. & Wynn, T. A.
Studies of murine schistosomiasis reveal interleukin-13 blockade as a treatment for
established and progressive liver fibrosis. Hepatology 34, 273-282,
doi:10.1053/jhep.2001.26376 (2001).
57" 188 Finkelman, F. D. et al. Cytokine regulation of host defense against parasitic
gastrointestinal nematodes: lessons from studies with rodent models. Annu Rev
Immunol 15, 505-533, doi:10.1146/annurev.immunol.15.1.505 (1997).
189 McKenzie, G. J., Bancroft, A., Grencis, R. K. & McKenzie, A. N. A distinct role for
interleukin-13 in Th2-cell-mediated immune responses. Curr Biol 8, 339-342 (1998).
190 Shea-Donohue, T. et al. The role of IL-4 in Heligmosomoides polygyrus-induced
alterations in murine intestinal epithelial cell function. Journal of immunology 167, 2234-
2239 (2001).
191 Madden, K. B. et al. Role of STAT6 and mast cells in IL-4- and IL-13-induced alterations
in murine intestinal epithelial cell function. Journal of immunology 169, 4417-4422
(2002).
192 Morimoto, M. et al. IL-13 receptor alpha2 regulates the immune and functional response
to Nippostrongylus brasiliensis infection. Journal of immunology 183, 1934-1939,
doi:10.4049/jimmunol.0804299 (2009).
193 Cohn, L., Tepper, J. S. & Bottomly, K. IL-4-independent induction of airway
hyperresponsiveness by Th2, but not Th1, cells. Journal of immunology 161, 3813-3816
(1998).
194 Zhu, Z. et al. Pulmonary expression of interleukin-13 causes inflammation, mucus
hypersecretion, subepithelial fibrosis, physiologic abnormalities, and eotaxin production.
The Journal of clinical investigation 103, 779-788, doi:10.1172/JCI5909 (1999).
195 Kuperman, D. A. et al. Direct effects of interleukin-13 on epithelial cells cause airway
hyperreactivity and mucus overproduction in asthma. Nat Med 8, 885-889,
doi:10.1038/nm734 (2002).
196 Pope, S. M. et al. IL-13 induces eosinophil recruitment into the lung by an IL-5- and
eotaxin-dependent mechanism. The Journal of allergy and clinical immunology 108, 594-
601, doi:10.1067/mai.2001.118600 (2001).
58" 197 Mattes, J. et al. Intrinsic defect in T cell production of interleukin (IL)-13 in the absence of
both IL-5 and eotaxin precludes the development of eosinophilia and airways
hyperreactivity in experimental asthma. J Exp Med 195, 1433-1444 (2002).
198 Cheever, A. W. et al. Anti-IL-4 treatment of Schistosoma mansoni-infected mice inhibits
development of T cells and non-B, non-T cells expressing Th2 cytokines while
decreasing egg-induced hepatic fibrosis. Journal of immunology 153, 753-759 (1994).
199 Pearce, E. J. et al. Schistosoma mansoni in IL-4-deficient mice. Int Immunol 8, 435-444
(1996).
200 Kaplan, M. H., Whitfield, J. R., Boros, D. L. & Grusby, M. J. Th2 cells are required for the
Schistosoma mansoni egg-induced granulomatous response. Journal of immunology
160, 1850-1856 (1998).
201 Oriente, A. et al. Interleukin-13 modulates collagen homeostasis in human skin and
keloid fibroblasts. J Pharmacol Exp Ther 292, 988-994 (2000).
202 Lebel-Binay, S. et al. Experimental gene therapy of cancer using tumor cells engineered
to secrete interleukin-13. Eur J Immunol 25, 2340-2348, doi:10.1002/eji.1830250833
(1995).
203 Kobayashi, M., Kobayashi, H., Pollard, R. B. & Suzuki, F. A pathogenic role of Th2 cells
and their cytokine products on the pulmonary metastasis of murine B16 melanoma.
Journal of immunology 160, 5869-5873 (1998).
204 Oshima, Y. & Puri, R. K. Characterization of a powerful high affinity antagonist that
inhibits biological activities of human interleukin-13. The Journal of biological chemistry
276, 15185-15191, doi:10.1074/jbc.M010159200 (2001).
205 Debinski, W., Gibo, D. M., Obiri, N. I., Kealiher, A. & Puri, R. K. Novel anti-brain tumor
cytotoxins specific for cancer cells. Nature biotechnology 16, 449-453,
doi:10.1038/nbt0598-449 (1998).
59" 206 Schmid-Grendelmeier, P. et al. Eosinophils express functional IL-13 in eosinophilic
inflammatory diseases. Journal of immunology 169, 1021-1027 (2002).
207 Sotiropoulou, G., Pampalakis, G. & Diamandis, E. P. Functional roles of human
kallikrein-related peptidases. The Journal of biological chemistry 284, 32989-32994,
doi:10.1074/jbc.R109.027946 (2009).
208 Hedstrom, L. Serine protease mechanism and specificity. Chem Rev 102, 4501-4524
(2002).
209 Rawlings, N. D., Waller, M., Barrett, A. J. & Bateman, A. MEROPS: the database of
proteolytic enzymes, their substrates and inhibitors. Nucleic acids research 42, D503-
509, doi:10.1093/nar/gkt953 (2014).
210 Sim, R. B. & Laich, A. Serine proteases of the complement system. Biochem Soc Trans
28, 545-550 (2000).
211 Czapinska, H. & Otlewski, J. Structural and energetic determinants of the S1-site
specificity in serine proteases. Eur J Biochem 260, 571-595 (1999).
212 Kraut, J. Serine proteases: structure and mechanism of catalysis. Annu Rev Biochem
46, 331-358, doi:10.1146/annurev.bi.46.070177.001555 (1977).
213 Schechter, I. & Berger, A. On the size of the active site in proteases. I. Papain. Biochem
Biophys Res Commun 27, 157-162 (1967).
214 Lundwall, A. et al. A comprehensive nomenclature for serine proteases with homology to
tissue kallikreins. Biol Chem 387, 637-641, doi:10.1515/BC.2006.082 (2006).
215 Borgono, C. A. & Diamandis, E. P. The emerging roles of human tissue kallikreins in
cancer. Nat Rev Cancer 4, 876-890, doi:10.1038/nrc1474 (2004).
216 Madan, R. A., Gulley, J. L. & Arlen, P. M. PSA-based vaccines for the treatment of
prostate cancer. Expert Rev Vaccines 5, 199-209, doi:10.1586/14760584.5.2.199
(2006).
60" 217 Blaber, S. I. et al. Targeting kallikrein 6 proteolysis attenuates CNS inflammatory
disease. FASEB J 18, 920-922, doi:10.1096/fj.03-1212fje (2004).
218 Wolf, W. C., Evans, D. M., Chao, L. & Chao, J. A synthetic tissue kallikrein inhibitor
suppresses cancer cell invasiveness. Am J Pathol 159, 1797-1805, doi:10.1016/S0002-
9440(10)63026-X (2001).
219 Pampalakis, G., Diamandis, E. P. & Sotiropoulou, G. The epigenetic basis for the
aberrant expression of kallikreins in human cancers. Biol Chem 387, 795-799,
doi:10.1515/BC.2006.100 (2006).
220 Lu, J. et al. Transcriptional profiling of keratinocytes reveals a vitamin D-regulated
epidermal differentiation network. The Journal of investigative dermatology 124, 778-
785, doi:10.1111/j.0022-202X.2005.23641.x (2005).
221 Kurlender, L. et al. A survey of alternative transcripts of human tissue kallikrein genes.
Biochim Biophys Acta 1755, 1-14, doi:10.1016/j.bbcan.2005.02.001 (2005).
222 Chow, T. F. et al. Kallikreins as microRNA targets: an in silico and experimental-based
analysis. Biol Chem 389, 731-738, doi:10.1515/BC.2008.071 (2008).
223 White, N. M. et al. The miRNA-kallikrein axis of interaction: a new dimension in the
pathogenesis of prostate cancer. Biol Chem 393, 379-389, doi:10.1515/hsz-2011-0246
(2012).
224 White, N. M. et al. Dysregulation of kallikrein-related peptidases in renal cell carcinoma:
potential targets of miRNAs. Biol Chem 391, 411-423, doi:10.1515/BC.2010.041 (2010).
225 White, N. M. et al. Three dysregulated miRNAs control kallikrein 10 expression and cell
proliferation in ovarian cancer. Br J Cancer 102, 1244-1253, doi:10.1038/sj.bjc.6605634
(2010).
226 Yoon, H. et al. A completed KLK activome profile: investigation of activation profiles of
KLK9, 10, and 15. Biol Chem 390, 373-377, doi:10.1515/BC.2009.026 (2009).
61" 227 Michael, I. P. et al. Human tissue kallikrein 5 is a member of a proteolytic cascade
pathway involved in seminal clot liquefaction and potentially in prostate cancer
progression. The Journal of biological chemistry 281, 12743-12750,
doi:10.1074/jbc.M600326200 (2006).
228 Luo, L. Y., Shan, S. J., Elliott, M. B., Soosaipillai, A. & Diamandis, E. P. Purification and
characterization of human kallikrein 11, a candidate prostate and ovarian cancer
biomarker, from seminal plasma. Clin Cancer Res 12, 742-750, doi:10.1158/1078-
0432.CCR-05-1696 (2006).
229 Brattsand, M., Stefansson, K., Lundh, C., Haasum, Y. & Egelrud, T. A proteolytic
cascade of kallikreins in the stratum corneum. The Journal of investigative dermatology
124, 198-203, doi:10.1111/j.0022-202X.2004.23547.x (2005).
230 Deraison, C. et al. LEKTI fragments specifically inhibit KLK5, KLK7, and KLK14 and
control desquamation through a pH-dependent interaction. Mol Biol Cell 18, 3607-3619,
doi:10.1091/mbc.E07-02-0124 (2007).
231 Shaw, J. L., Petraki, C., Watson, C., Bocking, A. & Diamandis, E. P. Role of tissue
kallikrein-related peptidases in cervical mucus remodeling and host defense. Biol Chem
389, 1513-1522, doi:10.1515/BC.2008.171 (2008).
232 Yamasaki, K. et al. Kallikrein-mediated proteolysis regulates the antimicrobial effects of
cathelicidins in skin. FASEB J 20, 2068-2080, doi:10.1096/fj.06-6075com (2006).
233 Oikonomopoulou, K. et al. Proteinase-activated receptors, targets for kallikrein signaling.
The Journal of biological chemistry 281, 32095-32112, doi:10.1074/jbc.M513138200
(2006).
234 Watson, J. D. & Crick, F. H. Molecular structure of nucleic acids; a structure for
deoxyribose nucleic acid. Nature 171, 737-738 (1953).
235 Kajava, A. V. Structural diversity of leucine-rich repeat proteins. Journal of molecular
biology 277, 519-527, doi:10.1006/jmbi.1998.1643 (1998).
62" 236 Kobe, B. & Kajava, A. V. The leucine-rich repeat as a protein recognition motif. Current
opinion in structural biology 11, 725-732 (2001).
237 Takahashi, N., Takahashi, Y. & Putnam, F. W. Periodicity of leucine and tandem
repetition of a 24-amino acid segment in the primary structure of leucine-rich alpha 2-
glycoprotein of human serum. Proceedings of the National Academy of Sciences of the
United States of America 82, 1906-1910 (1985).
238 Kobe, B. & Deisenhofer, J. Crystal structure of porcine ribonuclease inhibitor, a protein
with leucine-rich repeats. Nature 366, 751-756, doi:10.1038/366751a0 (1993).
239 Kobe, B. & Deisenhofer, J. A structural basis of the interactions between leucine-rich
repeats and protein ligands. Nature 374, 183-186, doi:10.1038/374183a0 (1995).
240 Papageorgiou, A. C., Shapiro, R. & Acharya, K. R. Molecular recognition of human
angiogenin by placental ribonuclease inhibitor--an X-ray crystallographic study at 2.0 A
resolution. EMBO J 16, 5162-5177, doi:10.1093/emboj/16.17.5162 (1997).
241 Kobe, B. & Deisenhofer, J. Proteins with leucine-rich repeats. Current opinion in
structural biology 5, 409-416 (1995).
242 Ollendorff, V., Szepetowski, P., Mattei, M. G., Gaudray, P. & Birnbaum, D. New gene in
the homologous human 11q13-q14 and mouse 7F chromosomal regions. Mamm
Genome 2, 195-200 (1992).
243 Rimokh, R. et al. Rearrangement and overexpression of the BCL-1/PRAD-1 gene in
intermediate lymphocytic lymphomas and in t(11q13)-bearing leukemias. Blood 81,
3063-3067 (1993).
244 Zhou, D. J., Casey, G. & Cline, M. J. Amplification of human int-2 in breast cancers and
squamous carcinomas. Oncogene 2, 279-282 (1988).
245 Lidereau, R. et al. Amplification of the int-2 gene in primary human breast tumors.
Oncogene Res 2, 285-291 (1988).
63" 246 Theillet, C. et al. Amplification of FGF-related genes in human tumors: possible
involvement of HST in breast carcinomas. Oncogene 4, 915-922 (1989).
247 Arnold, A. et al. Molecular cloning and chromosomal mapping of DNA rearranged with
the parathyroid hormone gene in a parathyroid adenoma. The Journal of clinical
investigation 83, 2034-2040, doi:10.1172/JCI114114 (1989).
248 Rosenberg, C. L., Kim, H. G., Shows, T. B., Kronenberg, H. M. & Arnold, A.
Rearrangement and overexpression of D11S287E, a candidate oncogene on
chromosome 11q13 in benign parathyroid tumors. Oncogene 6, 449-453 (1991).
249 Larsson, C., Skogseid, B., Oberg, K., Nakamura, Y. & Nordenskjold, M. Multiple
endocrine neoplasia type 1 gene maps to chromosome 11 and is lost in insulinoma.
Nature 332, 85-87, doi:10.1038/332085a0 (1988).
250 Ollendorff, V., Noguchi, T., deLapeyriere, O. & Birnbaum, D. The GARP gene encodes a
new member of the family of leucine-rich repeat-containing proteins. Cell Growth Differ
5, 213-219 (1994).
251 Wang, R., Wan, Q., Kozhaya, L., Fujii, H. & Unutmaz, D. Identification of a regulatory T
cell specific cell surface molecule that mediates suppressive signals and induces Foxp3
expression. PLoS One 3, e2705, doi:10.1371/journal.pone.0002705 (2008).
252 Stockis, J., Colau, D., Coulie, P. G. & Lucas, S. Membrane protein GARP is a receptor
for latent TGF-beta on the surface of activated human Treg. Eur J Immunol 39, 3315-
3322, doi:10.1002/eji.200939684 (2009).
253 Ferreira, M. A. et al. Identification of IL6R and chromosome 11q13.5 as risk loci for
asthma. Lancet 378, 1006-1014, doi:10.1016/S0140-6736(11)60874-X (2011).
254 Roubin, R. et al. Structure and developmental expression of mouse Garp, a gene
encoding a new leucine-rich repeat-containing protein. Int J Dev Biol 40, 545-555 (1996).
64" 255 Zhou, A. X., Kozhaya, L., Fujii, H. & Unutmaz, D. GARP-TGF-beta complexes negatively
regulate regulatory T cell development and maintenance of peripheral CD4+ T cells in
vivo. Journal of immunology 190, 5057-5064, doi:10.4049/jimmunol.1300065 (2013).
256 Tran, D. Q. et al. GARP (LRRC32) is essential for the surface expression of latent TGF-
beta on platelets and activated FOXP3+ regulatory T cells. Proceedings of the National
Academy of Sciences of the United States of America 106, 13445-13450,
doi:10.1073/pnas.0901944106 (2009).
257 Oida, T. & Weiner, H. L. TGF-beta induces surface LAP expression on murine CD4 T
cells independent of Foxp3 induction. PLoS One 5, e15523,
doi:10.1371/journal.pone.0015523 (2010).
258 Miller, M. M., Fogle, J. E., Ross, P. & Tompkins, M. B. Feline glycoprotein A repetitions
predominant anchors transforming growth factor beta on the surface of activated
CD4(+)CD25(+) regulatory T cells and mediates AIDS lentivirus-induced T cell
immunodeficiency. AIDS Res Hum Retroviruses 29, 641-651, doi:10.1089/aid.2012.0322
(2013).
259 Probst-Kepper, M. et al. GARP: a key receptor controlling FOXP3 in human regulatory T
cells. J Cell Mol Med 13, 3343-3357, doi:10.1111/j.1582-4934.2009.00782.x (2009).
260 Wang, R. et al. GARP regulates the bioavailability and activation of TGFbeta. Mol Biol
Cell 23, 1129-1139, doi:10.1091/mbc.E11-12-1018 (2012).
261 Hahn, S. A. et al. Soluble GARP has potent antiinflammatory and immunomodulatory
impact on human CD4(+) T cells. Blood 122, 1182-1191, doi:10.1182/blood-2012-12-
474478 (2013).
65" Table 1.1: Subfamilies of leucine-rich repeat (LRR) proteins LRR Typical LRR Organism Cellular Structures Consensus Sequence Subfamily Length (range) Origin Location Available xxxLxxLxLxxN/ RNH1-like 28--29 (28-29) Animals Intracellular RNH1, rna1p CxLxxxgoxxLxxoLx-x U2A', TAP, SD22-like 22 (21-23) Animals, fungi Intracellular LxxLxxLxLxxNxIxxIxxLx-x RabGGT, LC1, lnlB Cysteine- Animals, plants, 26 (25-27) Intracellular Skp2 cxxLxxLxLxxcx-xITDxxoxxLax-x containing fungi Gram-negative Bacterial 20 (20-22) Extracellular YopM PxxLxxLxVxxNxLxxLPe/dL- bacteria Typical 24 (20-27) Animals, fungi Extracellular No LxxLxxLxLxxNxLxxLpxxoFx-x Plants, primary, Plant-specific 24 (23-25) Extracellular No Lx-xLxxLxLxxNxLt/sg-xIPxxLGx eukaryotes TpLRR 23 (23-25) Bacteria Extracellular No C/Nx-xLxxIxLx-xxLxxIgxxAFxx Table 1.1 | Subfamilies of leucine-rich repeat (LRR) proteins. LRR subfamily, typical length of LRRs with range, organism subfamily found in, cellular location, solved structures available, and LRR consensus sequence shown for 6 LRR subfamilies. Residues identical or conservatively substituted in more than 50% and 30% of the repeats of a given protein are shown in uppercase and lowercase, respectively; residues directed into the interior of the known protein structures or models are shown in bold; ‘-’, possible insertion site; ‘o’ is a nonpolar residue and ‘x’ is any residue. Table modified from Kobe B & Kajava AV. Current Opinion in Structural Biology, 2001.
66 a b
c d
f
e h
i g
Figure 1.1 | 3D structure of LRR proteins. The LRR domains are shown in cyan, the flanking regions that are an integral part of the LRR domain but do not correspond to LRR motifs are shown in gray, and the other domains/subunits in the structure are shown in magenta. a. RI (PDB code 2BNH). b. rna1p (PDB code 1YRG). c. U2A’-U2B’’ (PDB code 1A9N). d. TAP (PDB code 1FO1). e. RabGGT (PDB code 1DCE). f. dynein LC1 (PDB code 1Ds9). g. lnlB (PDB code 1D0B). h. Skp2-Skp1 (PDB code 1FQV). i. YopM (PDB code 1G9U). Figure modified from Kobe B & Kajava AV. Current Opinion in Structural Biology, 2001.
67 CHAPTER 2: LRRC31 IS INDUCED BY IL-13 AND REGULATES KALLIKREIN EXPRESSION
AND BARRIER FUNCTION IN THE ESOPHAGEAL EPITHELIUM.
RJ D’Mello1, JM Caldwell, PhD1, NP Azouz, PhD1, T Wen, MD, PhD1, JD Sherrill, PhD1, SP
Hogan, PhD1, ME Rothenberg, MD, PhD1
1Division of Allergy and Immunology, Department of Pediatrics, Cincinnati Children’s Hospital
Medical Center, 3333 Burnet Avenue, Cincinnati, OH 45229
Address correspondence to: Marc Rothenberg, Division of Allergy and Immunology,
Cincinnati Children’s Hospital Medical Center, 3333 Burnet Avenue, ML7028, Cincinnati, OH,
45229; Fax, 513-636-3310; Phone, 513-636-7177; Email, [email protected]
68 2.1. Abstract
Eosinophilic esophagitis (EoE) is an allergic inflammatory disease of the esophagus featuring increased esophageal interleukin 13 (IL-13) levels and impaired barrier function. Herein, we investigated leucine-rich repeat–containing protein 31 (LRRC31) in human EoE esophageal tissue and IL-13–treated esophageal epithelial cells. LRRC31 had basal mRNA expression in colonic and airway mucosal epithelium. Esophageal LRRC31 mRNA and protein increased in active EoE and strongly correlated with esophageal eosinophilia and IL13 and CCL26 mRNA expression. IL-13 treatment increased LRRC31 mRNA and protein in air-liquid interface– differentiated esophageal epithelial cells (EPC2s). At baseline, differentiated LRRC31- overexpressing EPC2s had increased barrier function (1.9-fold increase in transepithelial electrical resistance [P < 0.05] and 2.8-fold decrease in paracellular flux [P < 0.05]). RNA sequencing analysis of differentiated LRRC31-overexpressing EPC2s identified 38 dysregulated genes (P < 0.05), including 5 kallikrein (KLK) serine proteases. Notably, differentiated LRRC31- overexpressing EPC2s had decreased KLK expression and activity, whereas IL-13–treated, differentiated LRRC31 gene-silenced EPC2s had increased KLK expression and suprabasal epithelial detachment. We identified similarly dysregulated KLK expression in the esophagus of patients with active EoE and in IL-13–treated esophageal epithelial cells. We propose that
LRRC31 is induced by IL-13 and modulates epithelial barrier function, potentially through KLK regulation.
69 2.2. Introduction
Eosinophilic esophagitis (EoE) is a chronic disease of the esophagus that has emerged over the past two decades as a unique and complex clinicopathologic condition associated with esophageal dysfunction.1 The disease is driven by T helper type 2 (Th2) immune responses to food antigens, and recent genetic and genome-wide association studies suggest that the esophageal epithelium has a critical function in EoE pathogenesis.2-5 Anatomically, the lumen of the esophagus is lined with non-keratinized stratified squamous epithelium that is made of 3 layers, organized from the esophageal lumen to the basement membrane as the stratum corneum (SC), the stratum spinosum, and the stratum germinativum (SG).6 In EoE, esophageal tissue has disorganized epithelium with loss of the SC, expansion of the SG, and impaired barrier function (IBF), demonstrated by decreased transepithelial electrical resistance (TER) and increased small-molecule paracellular flux.7 IBF is at least partially caused by the effects of interleukin 13 (IL-13) on esophageal epithelial cells.3 IL-13, which is highly upregulated in esophageal tissue of patients with EoE, is sufficient to promote IBF in differentiated esophageal epithelial cells (EPC2s) grown at the air-liquid interface (ALI).3,7-9 Interestingly, desmoglein-1
(DSG1) is downregulated by IL-13 treatment of these cells and in the esophagus of patients with
EoE.7,10 Gene silencing of DSG1 in differentiated EPC2s is sufficient to induce IBF, though not to the extent of that induced by IL-13 treatment. Furthermore, IL-13 is sufficient to alter gene expression of esophageal epithelial cells in vitro, and these changes significantly overlap with the transcriptional changes observed in the esophagus of patients with EoE, including downregulation of epidermal differentiation complex (EDC) genes.9,11 Notably, mutations in EDC genes are associated with diseases involving IBF in the skin, a tissue that has a similar mucosal structure to the esophagus.3
Within the skin, barrier function is maintained in the SC by the cornified cell envelope, which is composed of proteins and lipids that provide mechanical strength and form a hydrophobic
70 barrier, and corneodesmosomes, which are made up of cadherins, DSG1, and desmocollins
(DSCs).12 The cornified cell envelope and corneodesmosomes are partially regulated by tissue kallikreins (KLKs), serine proteases that cleave filaggrin (FLG), DSG1, DSCs, and other molecules required for normal barrier formation.12,13 Genetic mutations in FLG and KLK inhibitors, such as serine peptidase inhibitor Kazal type 5 (SPINK5), cause barrier defects in the skin of patients with atopic dermatitis (AD).12 Interestingly, nearly 50% of patients with EoE have concurrent or past AD.3 However, the expression and function of KLKs has not been investigated in the esophageal epithelium or in EoE. Herein, we report that LRRC31 regulates esophageal epithelial barrier function, at least in part by modulating the expression and activity of KLKs.
71 2.3. Results
2.3.1. Identification of LRRC31
We identified 2,789 genes that were differentially expressed ≥ 1.5 fold in EoE (P < 0.05) and
634 genes that were differentially expressed ≥ 1.5 fold in IL-13–treated primary esophageal epithelial cells (P < 0.05) by microarray gene expression analysis. Comparing these two sets of differentially expressed genes, we identified LRRC31 as one of the most highly upregulated genes in the esophagus of patients with active EoE and in IL-13–treated primary esophageal epithelial cells (Figure 2.1).9,11
2.3.2. LRRC31 is specifically induced in EoE
RNA sequencing of esophageal biopsies from controls patients (NL; n = 6) and patients with active EoE (n = 10) showed an EoE-specific 808-fold increase (P < 0.01) in LRRC31 mRNA expression (Figure 2.2a). In an additional cohort, qPCR detected a 137-fold increase (P < 0.01) in esophageal LRRC31 mRNA expression in patients with active EoE (n = 14) compared to in
NL (n = 14) (Figure 2.2b). We found that LRRC31 mRNA expression increased 18 fold (P <
0.05) in patients with active EoE (n = 18) compared to NL (n = 14) as determined by microarray gene expression analysis (Figure 2.2c). Western blot analysis showed that LRRC31 protein was readily detectable in active EoE patient esophageal tissue and increased 6 fold (P < 0.05) in active EoE compared to NL patient esophageal tissue (Figure 2.2d). These cumulative data indicate upregulation of LRRC31 mRNA and protein expression occurs in the esophagus of patients with active EoE.
2.3.3. LRRC31 is expressed in the colon and mucosal tissue
Interestingly, microarray gene expression analysis of a spectrum of human tissues derived from healthy controls retrieved from BioGPS.org revealed that the colon had the highest expression levels of LRRC31 mRNA, whereas the esophagus did not express detectable levels of LRRC31
72 mRNA under homeostatic conditions (Figure 2.3a).14,15 Quantitative PCR (qPCR) analysis of
Lrrc31 mRNA in C57BL/6 murine tissue exhibited a similar pattern of expression, with the colon having the highest mRNA expression and the esophagus having no detectable mRNA expression under homeostatic conditions (Figure 2.3b). An additional survey of microarray gene expression data from more specific human tissue compartments retrieved from
BioGPS.org identified that mucosal epithelia showed the highest LRRC31 mRNA expression, specifically the mucosal epithelium of the large intestine and bronchial and airway epithelial cells
(Figure 2.3c).14,15 Collectively, these data suggest that LRRC31 mRNA displays a conserved pattern of homeostatic expression, in that it is highly expressed in the mucosal epithelium of the colon and lung, and not expressed in the esophagus.
2.3.4. LRRC31 mRNA parallels disease activity
EoE cases were stratified by responsiveness to topical fluticasone propionate (FP), a glucocorticoid that has been shown to be effective in controlling disease activity, and to diet therapy. LRRC31 mRNA expression decreased 17 fold (P < 0.01) in FP-responsive cases (n =
14) but remained increased 32 fold (P < 0.001) in FP-unresponsive cases (n = 8) as determined by microarray gene expression analysis (Figure 2.4a).9 Furthermore, LRRC31 mRNA expression decreased 18 fold (P < 0.05) in diet-responsive cases (n = 10), but did not change in diet-unresponsive cases (n = 5) (Figure 2.4a). These data indicate that LRRC31 mRNA is dynamically expressed as a function of disease activity.
2.3.5. LRRC31 mRNA correlates with esophageal eosinophilia and IL13 mRNA
LRRC31 mRNA expression showed a strong positive correlation (Pearson r = 0.60, P < 0.01) with esophageal eosinophil levels (Figure 2.4b) and with esophageal IL13 mRNA expression
(Pearson r = 0.60, P < 0.0001) (Figure 2.4c).7,9 Esophageal LRRC31 mRNA expression also had a strong positive correlation with chemokine (C-C- motif) ligand 26 (CCL26) mRNA
73 expression (Pearson r = 0.65, P < 0.0001), an eosinophil chemokine and IL-13–induced gene
(Figure 2.4d).9,11 In contrast, LRRC31 mRNA expression had a weak positive correlation with the eosinophil pro-differentiation, activation, and survival cytokine IL5 (Pearson r = 0.27, P <
0.05) (Figure 2.4e).16
2.3.6. IL-13 induces LRRC31 in epithelial cells
Induction of LRRC31 mRNA expression in IL-4–treated human bronchial epithelial cells and in
IL-13–treated human tracheal epithelial cells has been previously reported (Supplementary
Figure 2.1a,b).17,18 Since we identified the colon as the tissue where LRRC31 mRNA is most abundantly expressed, we treated Caco2-bbe cells (colorectal adenocarcinoma cells, brush border expressing clone) with IL-13 and found that LRRC31 mRNA expression increased 2.7 fold (P < 0.05) and CCL26 mRNA expression increased 62 fold (P < 0.05) as determined by qPCR analysis (Supplementary Figure 2.1c). Similarly, in primary esophageal epithelial cells treated with IL-13, LRRC31 mRNA expression increased 28 fold (P < 0.05) and CCL26 mRNA expression increased 56 fold (P < 0.001) as determined by microarray gene expression analysis
(Supplementary Figure 2.1d).9 We used qPCR analysis to replicate this observation in primary esophageal epithelial cells derived from separate patients, treated with IL-13 (100 ng/mL, 48 hours), and found that LRRC31 mRNA expression increased 4.8 fold (P < 0.01) and CCL26 mRNA expression increased 1705 fold (P < 0.0001) (Figure 2.5a). To determine if LRRC31 was a direct target of IL-13–STAT6 signaling, we identified two putative STAT6 binding sites within the 2 kb upstream putative promoter of LRRC31 using publicly available ChIP-Seq data from CD4+ T cells (Supplementary Figure 2.2a).19 However, using a luciferase reporter assay we observed a 1.2 fold decrease in luciferase activity in TE-7 esophageal epithelial cells transfected with the LRRC31 gene promoter following IL-13 treatment; as a positive control, the
CCL26 2 kb upstream gene promoter had an 11 fold increase in luciferase activity following IL-
13 treatment (Supplementary Figure 2.2b). Interestingly, LRRC31 mRNA expression was not
74 induced in EPC2 esophageal epithelial cells grown in vitro in submerged, undifferentiated monolayer culture (data not shown).
Therefore, we used EPC2s grown at the air-liquid interface (ALI) in high-calcium conditions to induce differentiation and stratification, in order to model the in vivo esophageal epithelium more accurately (Figure 2.5b). Briefly, EPC2s were grown on a permeable transwell support in low calcium ([Ca2+] = 0.09 mM) for 2 days, followed by high calcium ([Ca2+] = 1.8 mM) for the next
12 days. Cells were brought to the ALI on day 7 and grown until day 14 at the ALI, resulting in an in vitro stratified squamous epithelium. Hematoxylin and eosin (H&E)-stained differentiated
EPC2s at day 14 demonstrated well-defined SC and SG (Figure 2.5c). The addition of IL-13 at day 8 to EPC2s grown at the ALI followed by H&E staining at day 14 showed disrupted formation of the epithelium with loss of the SC and expansion of the SG, a characteristic seen in the esophagus of patients with active EoE (Figure 2.5c).1,7 In addition, differentiated EPC2s, verified by increased KRT10 mRNA expression, demonstrated a marked increase in barrier function, assessed by increased TER and decreased paracellular flux.7 IL-13 treatment decreased KRT10 mRNA expression levels 3.1 fold (P < 0.05), impaired barrier formation as indicated by decreased TER (1.9 fold, P < 0.05), and increased paracellular flux (2.8 fold, P <
0.05), modeling the IBF observed in the esophageal epithelium of patients with active EoE
(Figure 2.5d-f). Interestingly, LRRC31 mRNA expression was increased 312 fold (P < 0.01) and
CCL26 mRNA expression increased 4853 fold (P < 0.01) in IL-13–treated, differentiated EPC2s compared to untreated, differentiated EPC2s, as demonstrated by qPCR analysis (Figure 2.5g).
In addition, LRRC31 protein expression was detectable by western blot analysis in IL-13– treated, differentiated EPC2s, and its expression relative to HSP90 loading control was increased 14 fold (P < 0.05) compared to untreated, differentiated EPC2s (Figure 2.5h). These data show that LRRC31 mRNA and protein were induced in epithelial cells treated with IL-13.
75
2.3.7. Overexpression of LRRC31 increases barrier function
In order to understand the function of LRRC31 in the esophageal epithelium, we overexpressed
LRRC31 in differentiated EPC2s. Briefly, EPC2s were transduced with either empty vector
(control) or FLAG epitope-tagged LRRC31 lentiviral expression constructs and grown at the ALI.
LRRC31 mRNA expression increased 36 fold (P < 0.05) in IL-13–treated control EPC2s and
4423 fold (P < 0.05) in untreated LRRC31-overexpressing EPC2s when compared to untreated control EPC2s as determined by qPCR analysis (Figure 2.6a). Following IL-13 treatment,
LRRC31 mRNA expression showed a 154-fold increase (P < 0.05) in LRRC31-overexpressing
EPC2s compared to IL-13–treated control EPC2s as determined by qPCR analysis (Figure
2.6a). CCL26 mRNA expression increased 73 fold (P < 0.01) in IL-13–treated control EPC2s and 148 fold (P < 0.01) in IL-13–treated LRRC31-overexpressing EPC2s as determined by qPCR analysis (Figure 2.6a). KRT10 mRNA expression decreased 3.2 fold (P < 0.05) in IL-13– treated control EPC2s and 3.2 fold (P < 0.01) in IL-13–treated LRRC31-overexpressing EPC2s compared to untreated EPC2s as determined by qPCR analysis (Figure 2.6a). Western blot analysis confirmed a marked increase in LRRC31 protein expression in LRRC31- overexpressing EPC2s compared to control EPC2s (Figure 2.6b).
H&E staining of untreated control EPC2s and untreated LRRC31-overexpressing EPC2s showed similar histology (Figure 2.6c). Interestingly, IL-13–treated control EPC2s had increased epithelial thickness (1.8 fold, P < 0.05) with loss of the SC and expansion of the SG when compared to untreated control EPC2s (Figure 2.6d). However, untreated and IL-13– treated LRRC31-overexpressing EPC2s had similar epithelial thickness and morphology
(Figure 2.6c,d). In assessing the IBF of IL-13–treated EPC2s, we found TER decreased 2.2 fold (P < 0.001) in control EPC2s and 2.0 fold (P < 0.01) in LRRC31-overexpressing EPC2s
(Figure 2.6e). However, untreated LRRC31-overexpressing EPC2s had 1.9-fold increased (P <
76 0.05) TER when compared to untreated control EPC2s, and IL-13–treated LRRC31- overexpressing EPC2s had 2.0-fold increased (P < 0.001) TER when compared to IL-13– treated control EPC2s (Figure 2.6e). Similarly, IL-13 treatment increased paracellular flux 2.1 fold (P < 0.05) in control EPC2s and 2.2 fold (P < 0.05) in LRRC31-overexpressing EPC2s
(Figures 2.6f). Furthermore, untreated LRRC31-overexpressing EPC2s had 2.8-fold increased
(P < 0.05) paracellular flux compared to untreated control EPC2s (Figure 2.6f). Taken together, these data suggest a function for LRRC31 in regulating the esophageal epithelial barrier function in vitro.
2.3.8. LRRC31 regulates epithelial serine proteases
We undertook RNA-sequencing analysis to gain insight into the mechanism by which LRRC31 regulated the epithelial barrier. Applying a moderated t-test with Benjamini-Hochberg False
Discovery Rate analysis (P < 0.05), we identified 38 genes that changed ≥ 1.5 fold in differentiated LRRC31-overexpressing EPC2s when compared to control EPC2s (Figure 2.7a).
As expected, the most highly upregulated mRNA transcript in the LRRC31-overexpressing
EPC2s was LRRC31. Among the downregulated mRNA transcripts was noggin (NOG), a ligand that antagonizes bone morphogenetic proteins (BMPs), which are members of the transforming growth factor β (TGFβ)-family of cytokines.20 Interestingly, gene ontology analysis done using the Database for Annotation, Visualization, and Integrated Discovery (DAVID) identified one cluster of 5 KLK serine proteases, KLK5, KLK7, KLK11, KLK12, and KLK13, with an enrichment score of 2.71, which were downregulated in LRRC31-overexpressing EPC2s, suggesting that
LRRC31 may be a negative regulator of KLK proteases.21,22
We further showed decreased KLK5 (4.74 fold, P < 0.01), KLK7 (1.68 fold, P < 0.05), KLK11
(1.35 fold, P < 0.05), and KLK13 (1.81 fold, P < 0.01) mRNA expression in LRRC31- overexpressing EPC2s in an independent experiment by qPCR analysis; KLK1 mRNA
77 expression was unchanged as a control (Figure 2.7b). Moreover, using a protease array, we detected decreased protein expression of KLK5 (1.15 fold, P < 0.05), KLK7 (2.7 fold, P < 0.05),
KLK11 (1.4 fold, P < 0.01), and KLK13 (2.1 fold, P < 0.05) in the supernatants of LRRC31- overexpressing EPC2s; KLK10 protein expression was unchanged as a control (Figure 2.7c).
The supernatants from LRRC31-overexpressing EPC2s also had decreased KLK protease activity (1.25-fold, P < 0.05), assessed using a fluorogenic peptide substrate specific for KLK4,
KLK5, KLK8, KLK13, and KLK14 (Figure 2.7d). Taken together, these data support the observation that KLK proteases are negatively regulated by LRRC31.
2.3.9. Loss of LRRC31 increases KLK expression
In order to understand the function of LRRC31 in response to IL-13 treatment, we used short- hairpin RNA (shRNA) to silence LRRC31 mRNA expression in differentiated EPC2s. Briefly,
EPC2s were transduced with non-silencing control (NSC) or LRRC31-specific shRNA- containing lentiviral expression constructs and grown at the ALI. At baseline, the LRRC31 mRNA expression was below the limit of detection by qPCR (≥ 34 CT). Following IL-13 treatment, LRRC31 mRNA expression was detected in NSC EPC2s and was reduced 31 fold (P
< 0.01) in LRRC31 gene-silenced EPC2s (Figure 2.8a,b). As a control, CCL26 and KRT10 mRNA expression was not decreased in LRRC31 gene-silenced EPC2s (Figure 2.8a). Notably, following IL-13 treatment LRRC31 gene-silenced EPC2s had suprabasal detachment within the
SG (Figure 2.8c, Supplementary Figure 2.2).
Since LRRC31-overexpressing EPC2s had decreased expression of KLK proteases, we used qPCR analysis to determine the expression of KLK mRNA in IL-13–treated LRRC31 gene- silenced EPC2s. We identified increased mRNA expression levels for KLK7 (2.4 fold, P < 0.05),
KLK11 (3.9 fold, P < 0.01), and KLK13 (9.5 fold, P < 0.05) in IL-13–treated LRRC31 gene- silenced EPC2s compared to NSC EPC2s (Figure 2.8d). However, KLK1 and KLK5 mRNA
78 expression did not change in IL-13–treated LRRC31 gene-silenced EPC2s compared to NSC
EPC2s (Figure 2.8d).
In addition, TER decreased 1.4 fold (P < 0.01) in IL-13–treated NSC EPC2s, but was similar in untreated and IL-13–treated LRRC31 gene-silenced EPC2s (Figure 2.8e). However, the TER in untreated LRRC31 gene-silenced EPC2s was increased 1.5 fold (P < 0.05) compared to untreated NSC EPC2s, and the TER in IL-13–treated LRRC31 gene-silenced EPC2s was increased 1.7 fold (P < 0.05) compared to IL-13–treated NSC EPC2s (Figure 2.8e). These data show that IL-13–treated, differentiated LRRC31 gene-silenced EPC2s have disrupted epithelial morphology and decreased IBF, which may result from increased KLK expression.
2.3.10. KLK expression in EoE and in response to IL-13
We sought to characterize the changes in KLK expression in the esophagus of patients with active EoE and in primary esophageal epithelial cells following IL-13 treatment. In the esophagus, we identified downregulation of KLK8 (P < 0.05) and KLK13 (P < 0.05) mRNA expression specifically in patients with active EoE compared to control patients, using ANOVA analysis (P < 0.05) on microarray gene expression data (Figure 2.9a). In contrast, there was increased KLK7 (P < 0.05) and KLK10 (P < 0.01) mRNA expression in both chronic esophagitis
(CE) and EoE. In primary esophageal epithelial cells treated with IL-13, we identified downregulation of KLK5 (P < 0.05), KLK8 (P < 0.05), and KLK10 (P < 0.05) mRNA expression using a moderated t-test analysis (P < 0.05) (Figure 2.9b). No KLKs were significantly upregulated by IL-13 treatment of primary esophageal epithelial cells. Taken together, these data show dysregulation of KLKs, specifically downregulation of KLK13 and KLK5 in EoE and in primary esophageal epithelial cells following IL-13 treatment, respectively.
79 2.4. Discussion
The data presented herein characterize the expression, cytokine regulation, and role of LRRC31 in esophageal cells. We identified LRRC31 as a dysregulated gene in both the active EoE esophagus and in esophageal epithelial cells treated with IL-13. We provide evidence that
LRRC31 mRNA and protein is increased in the esophagus of patients with EoE, is normalized following FP and diet therapy, but remains increased in patients who had EoE resistant to therapy. It is notable that even diet non-responders had a decrease in LRRC31 mRNA expression, suggesting that its change may be an early biomarker of response. LRRC31 mRNA expression significantly correlated with biopsy eosinophils, IL13, and CCL26 mRNA expression and was induced by IL-13 in differentiated esophageal epithelial cells. Furthermore, LRRC31- overexpressing EPC2s had increased epithelial barrier function in parallel with decreased KLK protein expression and protease activity. Several KLKs expressed in the esophagus were dysregulated in EoE and in epithelial cells following IL-13 treatment, which overlapped with
KLKs dysregulated in differentiated LRRC31-overexpressing EPC2s. Taken together, we propose that LRRC31 is induced in the esophageal epithelium by IL-13 and regulates esophageal epithelial barrier function likely by modulating expression and activity of KLKs, at least in part (Figure 2.10).
To understand how LRRC31 may regulate esophageal epithelial barrier function, we undertook
RNA sequencing analysis of differentiated LRRC31-overexpressing EPC2s. Interestingly, overexpressing LRRC31 resulted in downregulation of noggin (NOG) mRNA expression. NOG is an antagonist of the BMP signaling pathway, which regulates esophageal differentiation during development.20,23 Interestingly, BMP signaling was shown to be active in differentiated squamous epithelium but not in basal progenitor cells, which express follistatin, another BMP antagonist like NOG.20 In both human esophageal biopsies from EoE patients and in a mouse model of EoE, reduced esophageal epithelial squamous differentiation is associated with high
80 levels of follistatin and disrupted BMP signaling.20 Thus, downregulation of NOG in LRRC31- overexpressing EPC2s supports a role for LRRC31 as a negative regulator of esophageal epithelial differentiation, possibly contributing to IBF.
Five KLK serine proteases, which have been shown to regulate skin barrier function in AD, were also downregulated in differentiated LRRC31-overexpressing EPC2s.12 This finding was particularly notable considering the recent association of genetic variants in the intracellular cysteine protease calpain-14 (CAPN14) in patients with EoE, and emerging literature indicating that KLKs and CAPNs share common substrates; for example, KLK6 and CAPN1 both cleave
α-synuclein in neurons.5,12,24 KLKs are extracellular proteases that are secreted in the SC of stratified squamous epithelium and cleave substrates such as DSG1, corneodesmosin, and
DSCs.12 Interestingly, DSG1 is downregulated in the esophagus in EoE and in primary esophageal epithelial cells following IL-13 treatment, and gene silencing of DSG1 in differentiated EPC2s resulted in IBF in vitro.7 It is interesting to speculate that the balance between esophageal epithelial proteases such as CAPNs and KLKs, and protease inhibitors such as SPINKs and serine protease inhibitors (SERPINs), may be lost, subsequently compromising the epithelial barrier function, as occurs in AD.12 In vitro models may not accurately replicate the balance between proteases or the complex biological state found in vivo. For example, the barrier function in LRRC31 overexpressing EPC2 cells may have increased in the absence of IL-13, and upon IL-13 treatment decreased similar to control EPC2 cells, because additional molecules in the LRRC31 pathway were not expressed in the absence of IL-13 treatment in EPC2 cells. Alternatively, LRRC31 may be counterregulatory, a function that is further supported by gene silencing of LRRC31 in differentiated EPC2s.
Gene silencing of LRRC31 in differentiated EPC2s showed suprabasal detachment of the epithelium when treated with IL-13. It is notable that LRRC31 gene silenced EPC2s had
81 modulated barrier function using TEER but not paracellular flux (Supplementary Figure 2.4).
LRRC31 gene-silenced EPC2s also had increased mRNA expression of KLK7, KLK11, and
KLK13 following IL-13 treatment. These data further support a role for LRRC31 in regulating
KLK expression, activity, and protease equilibrium, which subsequently disrupts normal differentiation of non-keratinized stratified squamous epithelium in vitro. Interestingly, KLKs are dysregulated in EoE and in IL-13–treated primary esophageal epithelial cells in a manner that overlaps with LRRC31-overexpressing EPC2s. Thus, IL-13–induced LRRC31 may be specifically regulating a subset of KLKs in the esophageal epithelial response to IL-13 and in
EoE.
On the basis of its primary amino acid sequence, the primary isoform of LRRC31 (Q6UY01-1;
552 amino acids) is predicted to contain nine leucine rich repeats (LRRs) (Supplementary
Figure 2.3a). Additionally, LRRC31 contains a putative nuclear export signal (NES; amino acids
113-121) and a nuclear localization signal (NLS; amino acids 517-545).25-27 Differential exon splicing of LRRC31 produces two additional translated isoforms (Q6UY01-2 and Q6UY01-3 are
496 amino acids and 346 amino acids, respectively) that each possess a different complement of LRRs than the primary isoform (Supplementary Figure 2.3a). Using the I-TASSER (Iterative
Threading Assembly Refinement) server for protein and structural predictions, LRRC31 is predicted to have a horseshoe-shaped tertiary structure with a hydrophobic substrate-binding pocket (Supplementary Figure 2.3b).28 This structure suggests LRRC31 participates in protein-protein interactions. Ribonuclease/angiogenin inhibitor 1 (RNH1), a ribonuclease inhibitor that binds to endogenous and exogenous ribonucleases to block ribonuclease activity, shared the highest homology score with LRRC31 (score = 224; E value = 1 x 10-19)
(Supplementary Figure 2.4a).29,30 Additional homologous molecules include other members of the LRR-containing family of proteins such as LRRC32 and LRRC34, members of the NLRP
(NACHT [NAIP – neuronal apoptosis inhibitor protein, CIITA – class II major histocompatibility
82 complex transactivator, HET-E – incompatibility locus protein from Podospora anserine, TP1 – telomerase-associated protein], LRR, and pyrin domain [PYD] or NOD-like receptor family PYD containing) family of inflammasome proteins, antigen-sensing and immune-activating toll-like receptors, and adaptor proteins involved in ubiquitination and post-translational regulation of signaling pathways, such as flightless-1 homolog. These molecules participate in immunomodulatory events within cells.31-33 It is notable that LRRC31 is highly conserved in humans, primates, and even through Xenopus tropicalis, consistent with a non-redundant function for this protein (Supplementary Figure 2.4b).34
In summary, we have shown that LRRC31 is specifically increased in EoE and dynamically expressed as a function of disease activity and therapy, and its expression is proportional to esophageal eosinophilia and IL13 mRNA expression. LRRC31 is induced by IL-13 treatment in epithelial cells, including differentiated esophageal epithelial cells. Considering the downregulation of KLKs and reduced KLK protease activity in differentiated LRRC31- overexpressing cells, we propose that LRRC31 is induced by IL-13 and regulates epithelial barrier function in the esophagus possibly by modulating expression of tissue KLKs.
83 2.5. Methods
Patient sample selection. Diagnosis was established based on the maximum eosinophil count of > 15 per 400X high-power field (hpf).11 Normal control (NL) patients were defined as having no history of EoE, 0 eosinophils per hpf in the esophagus at the time of biopsy, and no concomitant swallowed glucocorticoid treatment. EoE patients were defined as having > 15 eosinophils per hpf in the esophagus and no concomitant swallowed glucocorticoid treatment in patients on proton pump inhibitor (PPI) therapy; except for the samples in the microarray experiment.11 EoE patients receiving topical/swallowed fluticasone propionate glucocorticoid therapy (FP) and diet therapy were defined as responders if they had ≤ 1 eosinophil per hpf at the time of biopsy or as non-responders (NR) if they had ≥ 6 eosinophils per hpf.
Microarray gene expression analysis. For each patient, 1 distal esophageal biopsy sample was immersed in RNAlater (QIAGEN, Hilden, Germany) and total RNA was extracted using the
RNeasy Mini Kit (QIAGEN). Hybridization to human Affymetrix U133 Plus 2.0 GeneChip DNA microarray (Affymetrix, Santa Clara, CA) was performed by the Microarray Core at CCHMC.35
Gene transcript levels were determined following quantification and normalization of microarray data using GeneSpring (Agilent Technologies, Santa Clara, CA).
RNA Sequencing Analysis. RNA isolated from esophageal biopsies or differentiated EPC2s was subjected to RNA sequencing at the Gene Discovery and Genetic Variation Core at
CCHMC.7 The paired-end sequencing reads were aligned against the GRCh37 genome model using TopHat 2.04 with Bowtie 2.03.36,37 The separate alignments were then merged using
Cuffmerge with RefSeq gene models as a reference. The aligned reads were quantified for differential expression analysis using Cuffdiff.38 Normalization and statistical analysis was performed using GeneSpring (Agilent Technologies). qPCR analysis. Total RNA (500 ng) was DNAase treated, and complementary DNA was generated using the iScript complementary DNA synthesis kit (Bio-Rad Laboratories, Hercules,
CA). qPCR was performed with the Applied Biosystems Incorporated 7900HT Fast Real-Time
84 System (Life Technologies, Grand Island, NY) and LightCycler FastStart DNA Master SYBR
Green as a ready-to-use reaction mix with ROX (Roche, Basel, Switzerland). Relative expression was calculated using a standard curve method, as described.39,40 Results were normalized to GAPDH and fold induction compared with controls. cDNAs were amplified using
TaqMan Gene Expression Assay (Hs00226845_m1) and primers (Integrated DNA
Technologies, Coralville, IA) (Supplementary Table 2.1).41
Western blot analysis. Total cell lysates were prepared from biopsy protein following Qiazol
(QIAGEN) RNA extraction. Briefly, protein pellets were resuspended in Laemmli buffer, incubated at 37°C for 30 minutes, vortexed briefly, and heated to 95°C for 5 minutes before electrophoresis. Cells were lysed using MPER lysis buffer (Sigma-Aldrich, St. Louis, MO) supplemented with protease inhibitors (Roche) and sodium orthovanadate (10 mM) (Sigma-
Aldrich). Loading buffer (Life Technologies) was added and samples were heated to 95°C for 5 minutes, subjected to electrophoresis on 4-12% NuPAGE Bis-Tris gels (Life Technologies), transferred to nitrocellulose membranes (Life Technologies), and visualized using the Odyssey
CLx system (LI-COR Biosciences, Lincoln, NE) with IRDye 800RD goat anti-rabbit (LI-COR) and IRDye 680RD goat anti-mouse (LI-COR Biosciences) secondary antibodies. Primary antibodies were: anti-LRRC31 (ab100379; Abcam PLC, Cambridge, UK) and anti-HSP90
(AF7247; R&D Systems, Minneapolis, MN). Blots were quantified using Image Studio (LI-COR).
Primary cell culture. Distal esophageal biopsy specimens from patients with EoE were collected and subsequently digested with trypsin, cultured in modified F-media (3:1 F-
12/Dulbecco Modified Eagle’s medium) supplemented with FBS (5%), adenine (24.2 mg/mL), cholera toxin (1024 mM), insulin (5 mg/mL), hydrocortisone (0.4 mg/mL), and epidermal growth factor (10ng/mL) in the presence of penicillin, streptomycin, and amphotericin (Life
Technologies).9 Cells were cultured for 2 weeks, and fibroblasts were depleted by means of differential trypsinization.
85 EPC2 cell culture. The esophageal epithelial cell line (human telomerase reverse transcriptase-immortalized EPC2 cell line) was a kind gift from Dr. Anil Rustgi (University of
Pennsylvania, Philadelphia, PA).42-44 EPC2s were cultured in Keratinocyte Serum-Free media
(Life Technologies) supplemented with bovine pituitary extract, epidermal growth factor, and amphotericin (Life Technologies). For differentiated EPC2 cell cultures, EPC2s were grown to confluence for 2 days while being fully submerged in low-calcium ([Ca2+] = 0.09 mM) supplemented Keratinocyte Serum-Free media on 0.4 µm pore-size permeable supports
(Corning Incorporated, Corning, NY). Confluent monolayers were then switched to high-calcium
([Ca2+] = 1.8 mM) media for an additional 5 days. The culture medium was removed from the inner chamber of the permeable support in order to expose the cell monolayer to the air interface at day 7. Differentiated EPC2s were analyzed 7 days after ALI induction.
Lentiviral transduction. EPC2s were transduced with virus containing FLAG epitope-tagged
LRRC31 coding sequence or empty vector control using the pMIRNA1 lentiviral system
(SystemBiosciences, Mountain View, CA). EPC2s were transduced with shRNA targeting the coding sequence of LRRC31 or a NSC shRNA using the GIPZ lentiviral system (Thermo Fisher
Scientific, Waltham, MA). Lentiviral particles were prepared at the CCHMC Viral Vector Core.
Twenty-four hours after transduction, EPC2s were selected for stable integration using puromycin (1 µg/mL) for 48 hours. Transduction efficiency was assessed by GFP fluorescence and overexpression or silencing efficiency was assessed by qPCR compared to empty vector control transduced cells.
TER and paracellular flux assays. For differentiated EPC2s, TER and 3-5 kD FITC-Dextran
(Sigma-Aldrich) paracellular flux were measured at day 7 after ALI induction as previously described using an EVOM (World Precision Instruments, Sarasota, FL) and a fluorescence plate reader (BioTek, Winooski, VT), respectively.45
Protease array and KLK activity assay. Supernatants from differentiated EPC2s were collected and total protein was quantified using the BCA assay (Life Technologies). The
86 Proteome Profiler Human Protease Array Kit (R&D Systems) was used to quantify protease expression, which was quantified using Image Studio Software (LI-COR) and normalized to total protein. For the KLK activity assay, equal protein (1µg) was mixed with Boc-V-P-R-AMC
Fluorogenic Peptide Substrate (R&D Systems) and reaction buffer, and the plate containing the reactions was incubated overnight at 37°C. The plate was read with excitation at 380 nm and emission at 460 nm using a fluorescence plate reader (BioTek).
Luciferase activity assay. The 2 kb upstream gene promoter for LRRC31 was cloned into the pGL3-basic construct and co-transfected with pRL-TK into TE-7 cells, which were treated with
IL-13 (100 ng/ml) for 48 hours. Luciferase activity was determined using the Dual-Luciferase
Reporter Assay System (Promega, Madison, WI) as per manufacturer instructions.
Histological analyses. Cross-sectional area of H&E stained sections was calculated using thresholding image processing with ImageJ (US National Institutes of Health, Bethesda, MD).
Statistical analyses. Statistical significance was determined using a t-test and ANOVA test.
Pearson correlation was used to test for correlated gene expression. All statistical analyses were performed using GraphPad Prism (GraphPad Software Incorporated, La Jolla, CA).
Study approvals. For human subjects, written informed consent was obtained before a patient’s enrollment in the studies, and all human studies were approved by the CCHMC
Institutional Review Board (IRB protocol 2008-0090). All experiments involving mice were approved by the CCHMC IACUC.
87 2.6. Acknowledgments
This work was supported in part by NIH U19 AI070235, NIH R01 DK076893, the PHS Grant
P30 DK0789392 (CCHMC DNA Sequencing and Genotyping Facility, CCHMC Pathology
Research Core, and CCHCM Viral Vector Core), the Food Allergy Research & Education, the
Buckeye Foundation, and the Campaign Urging Research for Eosinophilic Diseases (CURED)
Foundation. We thank Dr. Anil Rustgi (University of Pennsylvania) for the EPC2-human telomerase reverse transcriptase cell line. We also thank Shawna Hottinger for editorial assistance, all of the participating families and the Cincinnati Center for Eosinophilic Disorders, and members of the Division of Allergy and Immunology.
88 2.7. References
1 Liacouras, C. A. et al. Eosinophilic esophagitis: updated consensus recommendations
for children and adults. The Journal of allergy and clinical immunology 128, 3-20 e26;
quiz 21-22, doi:10.1016/j.jaci.2011.02.040 (2011).
2 Rothenberg, M. E. et al. Common variants at 5q22 associate with pediatric eosinophilic
esophagitis. Nature genetics 42, 289-291, doi:10.1038/ng.547 (2010).
3 Blanchard, C. et al. Coordinate interaction between IL-13 and epithelial differentiation
cluster genes in eosinophilic esophagitis. Journal of immunology 184, 4033-4041,
doi:10.4049/jimmunol.0903069 (2010).
4 Sherrill, J. D. & Rothenberg, M. E. Genetic dissection of eosinophilic esophagitis
provides insight into disease pathogenesis and treatment strategies. The Journal of
allergy and clinical immunology 128, 23-32; quiz 33-24, doi:10.1016/j.jaci.2011.03.046
(2011).
5 Kottyan, L. C. et al. Genome-wide association analysis of eosinophilic esophagitis
provides insight into the tissue specificity of this allergic disease. Nature genetics 46,
895-900, doi:10.1038/ng.3033 (2014).
6 Orlando, R. C. The integrity of the esophageal mucosa. Balance between offensive and
defensive mechanisms. Best Pract Res Clin Gastroenterol 24, 873-882,
doi:10.1016/j.bpg.2010.08.008 (2010).
7 Sherrill, J. D. et al. Desmoglein-1 regulates esophageal epithelial barrier function and
immune responses in eosinophilic esophagitis. Mucosal immunology 7, 718-729,
doi:10.1038/mi.2013.90 (2014).
8 Straumann, A., Bauer, M., Fischer, B., Blaser, K. & Simon, H. U. Idiopathic eosinophilic
esophagitis is associated with a T(H)2-type allergic inflammatory response. The Journal
of allergy and clinical immunology 108, 954-961, doi:10.1067/mai.2001.119917 (2001).
89 9 Blanchard, C. et al. IL-13 involvement in eosinophilic esophagitis: transcriptome analysis
and reversibility with glucocorticoids. The Journal of allergy and clinical immunology 120,
1292-1300, doi:10.1016/j.jaci.2007.10.024 (2007).
10 Sherrill, J. D. et al. Analysis and expansion of the eosinophilic esophagitis transcriptome
by RNA sequencing. Genes and immunity 15, 361-369, doi:10.1038/gene.2014.27
(2014).
11 Blanchard, C. et al. Eotaxin-3 and a uniquely conserved gene-expression profile in
eosinophilic esophagitis. The Journal of clinical investigation 116, 536-547,
doi:10.1172/JCI26679 (2006).
12 Cork, M. J. et al. Epidermal barrier dysfunction in atopic dermatitis. The Journal of
investigative dermatology 129, 1892-1908, doi:10.1038/jid.2009.133 (2009).
13 Prassas, I., Eissa, A., Poda, G. & Diamandis, E. P. Unleashing the therapeutic potential
of human kallikrein-related serine proteases. Nat Rev Drug Discov 14, 183-202,
doi:10.1038/nrd4534 (2015).
14 Su, A. I. et al. A gene atlas of the mouse and human protein-encoding transcriptomes.
Proceedings of the National Academy of Sciences of the United States of America 101,
6062-6067, doi:10.1073/pnas.0400782101 (2004).
15 Wu, C. et al. BioGPS: an extensible and customizable portal for querying and organizing
gene annotation resources. Genome biology 10, R130, doi:10.1186/gb-2009-10-11-r130
(2009).
16 Sanderson, C. J. Interleukin-5, eosinophils, and disease. Blood 79, 3101-3109 (1992).
17 Shum, B. O. et al. The adipocyte fatty acid-binding protein aP2 is required in allergic
airway inflammation. The Journal of clinical investigation 116, 2183-2192,
doi:10.1172/JCI24767 (2006).
90 18 Alevy, Y. G. et al. IL-13-induced airway mucus production is attenuated by MAPK13
inhibition. The Journal of clinical investigation 122, 4555-4568, doi:10.1172/JCI64896
(2012).
19 Weirauch, M. T. et al. Determination and inference of eukaryotic transcription factor
sequence specificity. Cell 158, 1431-1443, doi:10.1016/j.cell.2014.08.009 (2014).
20 Jiang, M. et al. BMP-driven NRF2 activation in esophageal basal cell differentiation and
eosinophilic esophagitis. The Journal of clinical investigation, doi:10.1172/JCI78850
(2015).
21 Huang da, W., Sherman, B. T. & Lempicki, R. A. Systematic and integrative analysis of
large gene lists using DAVID bioinformatics resources. Nature protocols 4, 44-57,
doi:10.1038/nprot.2008.211 (2009).
22 Huang da, W., Sherman, B. T. & Lempicki, R. A. Bioinformatics enrichment tools: paths
toward the comprehensive functional analysis of large gene lists. Nucleic acids research
37, 1-13, doi:10.1093/nar/gkn923 (2009).
23 Potti, T. A., Petty, E. M. & Lesperance, M. M. A comprehensive review of reported
heritable noggin-associated syndromes and proposed clinical utility of one broadly
inclusive diagnostic term: NOG-related-symphalangism spectrum disorder (NOG-SSD).
Human mutation 32, 877-886, doi:10.1002/humu.21515 (2011).
24 Miners, J. S., Renfrew, R., Swirski, M. & Love, S. Accumulation of alpha-synuclein in
dementia with Lewy bodies is associated with decline in the alpha-synuclein-degrading
enzymes kallikrein-6 and calpain-1. Acta neuropathologica communications 2, 164,
doi:10.1186/s40478-014-0164-0 (2014).
25 Ota, T. et al. Complete sequencing and characterization of 21,243 full-length human
cDNAs. Nature genetics 36, 40-45, doi:10.1038/ng1285 (2004).
26 la Cour, T. et al. Analysis and prediction of leucine-rich nuclear export signals. Protein
engineering, design & selection : PEDS 17, 527-536, doi:10.1093/protein/gzh062 (2004).
91 27 Kosugi, S., Hasebe, M., Tomita, M. & Yanagawa, H. Systematic identification of cell
cycle-dependent yeast nucleocytoplasmic shuttling proteins by prediction of composite
motifs. Proceedings of the National Academy of Sciences of the United States of
America 106, 10171-10176, doi:10.1073/pnas.0900604106 (2009).
28 Zhang, Y. I-TASSER server for protein 3D structure prediction. BMC bioinformatics 9,
40, doi:10.1186/1471-2105-9-40 (2008).
29 States, D. J. & Gish, W. Combined use of sequence similarity and codon bias for coding
region identification. Journal of computational biology : a journal of computational
molecular cell biology 1, 39-50 (1994).
30 Dickson, K. A., Haigis, M. C. & Raines, R. T. Ribonuclease inhibitor: structure and
function. Progress in nucleic acid research and molecular biology 80, 349-374,
doi:10.1016/S0079-6603(05)80009-1 (2005).
31 Wilmanski, J. M., Petnicki-Ocwieja, T. & Kobayashi, K. S. NLR proteins: integral
members of innate immunity and mediators of inflammatory diseases. Journal of
leukocyte biology 83, 13-30, doi:10.1189/jlb.0607402 (2008).
32 McClure, R. & Massari, P. TLR-Dependent Human Mucosal Epithelial Cell Responses to
Microbial Pathogens. Frontiers in immunology 5, 386, doi:10.3389/fimmu.2014.00386
(2014).
33 Wang, T. et al. Flightless I homolog negatively modulates the TLR pathway. Journal of
immunology 176, 1355-1362 (2006).
34 Powell, S. et al. eggNOG v4.0: nested orthology inference across 3686 organisms.
Nucleic acids research 42, D231-239, doi:10.1093/nar/gkt1253 (2014).
35 Zimmermann, N. et al. Dissection of experimental asthma with DNA microarray analysis
identifies arginase in asthma pathogenesis. The Journal of clinical investigation 111,
1863-1874, doi:10.1172/JCI17912 (2003).
92 36 Langmead, B., Trapnell, C., Pop, M. & Salzberg, S. L. Ultrafast and memory-efficient
alignment of short DNA sequences to the human genome. Genome biology 10, R25,
doi:10.1186/gb-2009-10-3-r25 (2009).
37 Trapnell, C. et al. Differential analysis of gene regulation at transcript resolution with
RNA-seq. Nature biotechnology 31, 46-53, doi:10.1038/nbt.2450 (2013).
38 Garber, M., Grabherr, M. G., Guttman, M. & Trapnell, C. Computational methods for
transcriptome annotation and quantification using RNA-seq. Nature methods 8, 469-477,
doi:10.1038/nmeth.1613 (2011).
39 Pfaffl, M. W. A new mathematical model for relative quantification in real-time RT-PCR.
Nucleic acids research 29, e45 (2001).
40 Zuo, L. et al. IL-13 induces esophageal remodeling and gene expression by an
eosinophil-independent, IL-13R alpha 2-inhibited pathway. Journal of immunology 185,
660-669, doi:10.4049/jimmunol.1000471 (2010).
41 Wen, T. et al. Molecular diagnosis of eosinophilic esophagitis by gene expression
profiling. Gastroenterology 145, 1289-1299, doi:10.1053/j.gastro.2013.08.046 (2013).
42 Andl, C. D. et al. Epidermal growth factor receptor mediates increased cell proliferation,
migration, and aggregation in esophageal keratinocytes in vitro and in vivo. The Journal
of biological chemistry 278, 1824-1830, doi:10.1074/jbc.M209148200 (2003).
43 Harada, H. et al. Telomerase induces immortalization of human esophageal
keratinocytes without p16INK4a inactivation. Molecular cancer research : MCR 1, 729-
738 (2003).
44 Oyama, K. et al. AKT induces senescence in primary esophageal epithelial cells but is
permissive for differentiation as revealed in organotypic culture. Oncogene 26, 2353-
2364, doi:10.1038/sj.onc.1210025 (2007).
45 Wu, D. et al. Interleukin-13 (IL-13)/IL-13 receptor alpha1 (IL-13Ralpha1) signaling
regulates intestinal epithelial cystic fibrosis transmembrane conductance regulator
93 channel-dependent Cl- secretion. The Journal of biological chemistry 286, 13357-13369, doi:10.1074/jbc.M110.214965 (2011).
94 2.8. FIGURES EoE IL-13
2471 318 316
Rank Gene Name Fold Increase 1 CCL26 275 2 SERPINB4 139 3 TNFAIP6 59 4 CDH26 50 5 LRRC31 25 Figure 2.1 | Identification of LRRC31. Venn diagram depicting genes differentially expressed ≥ 1.5 fold in the esophagus in EoE (2789 genes) and in IL-13 treated esophageal epithelial cells (634 genes) by microarray gene expression analysis. Genes overlapping between these two data sets were identified (318 genes). LRRC31 is in bold and was increased 25 fold.
95 a b 1000103 100.1-1
2 ** ** 10100 100.01-2 10101 0.00110-3 GAPDH
0 / (FPKM) 101 Expression -4
(FPKM) 0.000110 100.1-1 -5 -2 LRRC31/GAPDH 0.0000110 0.01 LRRC31 LRRC31 LRRC31 10 0.00110-3 0.00000110-6 NL EoEEoE NL EoEEoE c 1000103 d 0.15 0.15 ** * 100102 0.100.10 0.050.05 LRRC31/HSP90 1 1010 0.00 Expression Expression 0 NL EoE
LRRC31/HSP90 NL EoE kDa 75 1010 LRRC31 LRRC31 LRRC31 50
100.1-1 HSP90 100 NL EoE Figure 2.2 | LRRC31 expression in the esophagus. a, LRRC31 mRNA expression in esophageal biopsies of 16 subjects (6 normal controls [NL], 10 active eosinophilic esophagitis [EoE]) determined by RNA sequencing analysis. b, Normalized LRRC31 mRNA expression in esophageal biopsies (13 NL, 14 EoE) determined by quantitative PCR (qPCR) analysis. c, Normalized LRRC31 mRNA expression in esophageal biopsies (14 NL, 18 EoE) determined by microarray gene expression analysis. d, LRRC31 (61.5 kD) protein expression in esophageal biopsies (12 NL, 13 EoE) determined by western blot analysis. Image shown is a representative experiment; HSP90 (90 kD) loading control is shown. Expression level of LRRC31 protein was quantified and normalized to the level of HSP90 protein (mean normalized signal of all patients are graphed). For a-c, data points represent individual subjects. For a-d, data are represented as the mean ± SEM. *P < 0.05, **P < 0.01.
96# Lrrc31 Expression a LRRC31LRRC31 Expression b Lrrc31 Expression 15 -5-5 0 5 10 15 0 2000 4000 6000 ColonColon Colon StomachStomach Ileum RectumRectum Stomach CecumCecum Jejunum c TracheaTrachea Jejunum LRRC31LRRC31 Expression UrethraUrethra Duodenum -5-5 0 5 10 15 BronchusBronchus Kidney LiverLiver Skin SigmoidSigmoid Colon Colon MucosaMucosa ProstateProstate Tongue ColonicColon Mucosa Mucosa Breast Lung RectumRectum Mucosa Mucosa
Breast
BoneBone Marrow Marrow Eyes BronchialBronchial Epithelial Epithelial Cells BloodBlood Heart AirwayAirway Epithelial Epithelial CellsCells SpleenSpleen Head and Neck Epithelial Cells Esophagus Head and Neck Epithelial Cells Esophagus SkeletalSkeletal Muscle Muscle Skeletal Muscle NasopharynxNasopharynx Epithelial Epithelial Cells EsophagusEsophagus Bladder PharyngealPharyngeal MucosaMucosa BrainBrain SinusSinus MucosaMucosa Kidney Peripheral BloodBood Kidney Spleen TonsilTonsil Epithelium Epithelium ThalamusThalamus Oral Mucosa TestesTestes Brain Oral Mucosa AdiposeAdipose Tissue Tissue LiverLiver BreastBreast Epithelial Epithelial Cells SkinSkin
Figure 2.3 | Expression of LRRC31 in human and murine tissue. a, Normalized LRRC31 mRNA expression in various normal human tissues determined by microarray expression analysis. Data from GeneAtlas microarray dataset.14,15 b, Normalized Lrrc31 mRNA expression in various normal murine tissues (C57BL/6) determined by qPCR analysis. c, Normalized LRRC31 mRNA expression in healthy human mucosal epithelium and epithelial cell lines determined by microarray expression analysis. Data from Barcode on Normal Tissue microarray dataset.14,15 For a and c, data are represented as the mean ± SEM.
97#
a 10000104 b 150150 * Pearson r = 0.60 * P < 0.01 1010003 ** NS ** ** *** 100100 101002 Expression Expression Expression Expression 10101 5050 1001 LRRC31 LRRC31 LRRC31 LRRC31 100.1-1 00 NLNL EoEEoE RR NRNR RR NRNR 0 1515 5050 100100 150150 UntreatedUntreated FluticasoneFP DietDiet Therapy Eosinophils/HPFEosinophils/HPF TreatedTreated c d e 0.0030.003 Pearson r = 0.60 0.0200.20 Pearson r = 0.65 0.000250.00025 Pearson r = 0.27 P < 0.0001 P < 0.0001 0.000200.00020 P < 0.05 0.150.15 0.0020.002 0.000150.00015 0.100.10 0.000100.00010 0.001 0.001 IL5/GAPDH IL13/GAPDH IL5/GAPDH
CCL26/GAPDH 0.05 IL13/GAPDH 0.05 0.000050.00005 CCL26/GAPDH
0.0000 0.000 0.000000 0.0000 0.0050.005 0.0100.010 0.0150.015 0.0200.020 0.0000 0.0050.005 0.0100.010 0.0150.015 0.0200.020 0.0000 0.0050.005 0.0100.010 0.0150.015 0.0200.020 LRRC31/GAPDHLRRC31/GAPDH LRRC31/GAPDHLRRC31/GAPDH LRRC31/GAPDHLRRC31/GAPDH Figure 2.4 | LRRC31 correlation with esophageal eosinophilia and disease-associated gene expression. a, Normalized LRRC31 mRNA expression in esophageal biopsies of patients with untreated, fluticasone propionate (FP)–treated, or diet therapy–treated EoE (14 normal controls [NL], 18 active eosinophilic esophagitis [EoE], 24 EoE treatment responders [R], 12 EoE treatment non-responders [NR]) by microarray gene expression analysis. b, Correlation of biopsy eosinophil count per high-power field (hpf) and normalized LRRC31 mRNA expression in esophageal biopsies of patients with active EoE determined by microarray gene expression analysis. Dotted line represents 15 eosinophils/hpf, the diagnostic threshold for EoE. Correlation of normalized LRRC31 mRNA expression with normalized IL13 (c), CCL26 (d), and IL5 (e) mRNA expression in esophageal biopsies of patients with active EoE determined by qPCR analysis. For a, data points represent individual subjects and data are represented as the mean ± SEM. NS, not significant; *P < 0.05, **P < 0.01, ***P < 0.001.
98# a b ±IL-13 0.0040.004 10000104 High-Calcium ALI **** Media ** 10003 0.0030.003 10 101002 Day 0 2 7 8 14 0.0020.002 10101
0.0010.001 CCL26/GAPDH CCL26/GAPDH LRRC31/GAPDH 10
LRRC31/GAPDH 10
0.0000.000 100.1-1 Day 2 Day 14 Control0 IL-13100 Control0 IL-13100 IL-13 Day 7 (ng/mL) c d e f 10 200 33 10 200 * *
0 SC
SG * ) 150 150) 2 2 22
-1 x cm x 100.1 cm x 100100 Ω Ω ( ( T
T 11 R R KRT10/GAPDH IL-13(ng/mL) 5050 KRT10/GAPDH KRT10/GAPDH
SG (ng/ml) FITC-Dextran 100 FITC-Dextran(ng/mL) 100.01-2 00 00 Control0 IL-13100 Control0 IL-13100 Control0 IL-13100 IL-13 (ng/mL) g h 10100 10100 ** 0.60.6 1010-1 1010-1 * 0.4 -2 -2 0.4 1010 ** 1010 Ladder 0.2 Control IL-13 1010-3 1010-3 0.2LRRC31/HSP90 -4 MW (kD) 100 0.0 1010-4 1010-4 0 Control IL-13
LRRC31/HSP90 HSP90 kDa75 0 100 IL-13 (ng/mL) 1010-5 1010-5
CCL26/GAPDH LRRC31/GAPDH
CCL26/GAPDH LRRC31/GAPDH -6 -6 LRRC31LRRC31 1010 1010 50 Ladder Control IL-13
1010-7 1010-7 Control IL-13 MW (kD) 100 0 100 Control0 IL-13100 IL-13 HSP90 75 HSP90 (ng/mL) 75
LRRC31 Figure 2.5 | LRRC31 expression in esophageal epithelial50 cells. a, Normalized LRRC31 and CCL26 mRNA expression in primary esophageal epithelial cells treated with IL-13 (100 ng/mL) for 48 hours determined by qPCR analysis. b, Differentiated EPC2 esophageal epithelial cells were grown for 12 days in high-calcium media. Cells were brought to the ALI starting at day 7, and ±IL-13 treatment (100 ng/mL) started at day 8. c, Hematoxylin and eosin (H&E)-stained sections of differentiated EPC2s at day 14. Stratum corneum (SC, pink layer) and stratum germinativum (SG, purple layer) are indicated. A representative experiment is shown (n = 3). Scale bar represents 20 µm. d, Normalized KRT10 mRNA expression in differentiated EPC2s at day 14 as determined by qPCR. A representative experiment is shown (n = 3). e, Transepithelial electrical resistance (TER) measured across differentiated EPC2s at day 14. A representative experiment is shown (n = 3). RT, resistance. f, Fluorescein isothiocyanate (FITC)-dextran (3-5 kDa) paracellular flux measured at 3h after FITC-dextran was added to luminal surface of differentiated EPC2s at day 14. A representative experiment is shown (n = 3). g, Normalized LRRC31 and CCL26 mRNA expression in differentiated EPC2s at day 14 determined by qPCR. A representative experiment is shown (n = 3). h, LRRC31 protein expression in differentiated EPC2s at day 14 determined by western blot analysis. Image shown is a representative experiment (n = 3); HSP90 (90 kD) loading control is shown. Left lane is the molecular weight ladder. Expression level of LRRC31 protein was quantified and normalized to the level of HSP90 protein. For a and d-h, data are represented as the mean ± SEM; *P < 0.05, **P < 0.01, ****P < 0.0001.
Day 2 Day 7 Day 14
99# a 10101 * * 101002 1010 * NS ** NS * NS NS 1010 ** ** ** 10101 100.1-1 1010 100.1-1 100.01-2 -1 KRT10/GAPDH
10CCL26/GAPDH 0.1 KRT10/GAPDH KRT10/GAPDH -3 CCL26/GAPDH LRRC31/GAPDH 0.00110 LRRC31/GAPDH
0.000110-4 100.01-2 100.01-2 Control0 IL-13100 Control0 IL-13100 Control0 IL-13100 Control0 IL-13100 Control0 IL-13100 Control0 IL-13100 IL-13 EmptyControl Vector LRRC31LRRC31 EmptyControl Vector LRRC31 EmptyControl Vector LRRC31 (ng/mL) b c 0 100 IL-13 (ng/mL)
SC kDa Control LRRC31 SC Control SG SG
LRRC31 50
100 HSP90 75 SC SC SG
LRRC31 SG
d e f 8000008×105 400400 8 NS *** *** ** * NS * ** * ** 5 NS NS 6000006×10 ) 300 6 ) 300 6 2 2
5 x cm x 4000004×10 cm x 200200 4 Ω Ω ( ( T T R Area (pixels) Area
5 R Area(Pixels) 2000002×10 100100 2 FITC-Dextran (ng/ml) FITC-Dextran
0 00 FITC-Dextran(ng/mL) 0 Control0 IL-13100 Control0 IL-13100 Control0 IL-13100 Control0 IL-13100 Control0 IL-13100 Control0 IL-13100 IL-13 EmptyControl Vector LRRC31 EmptyControl Vector LRRC31 EmptyControl Vector LRRC31 (ng/mL) Figure 2.6 | Epithelial barrier function in differentiated LRRC31-overexpressing EPC2 cells. EPC2 esophageal epithelial cells transduced with either empty vector (control) or flag-epitope tagged LRRC31 lentiviral expression constructs were cultured as described in Figure 5b. a, Normalized LRRC31, CCL26, and KRT10 mRNA expression in differentiated control and LRRC31-overexpressing (LRRC31) EPC2s at day 14 determined by qPCR analysis. A representative experiment shown (n = 3). b, LRRC31 (61.5 kD) protein expression in differentiated control and LRRC31-overexpressing EPC2s at day 14 determined by western blot analysis. Image shown is a representative experiment (n = 3); HSP90 (90 kD) loading control is shown. Left lane is the molecular weight ladder. c, H&E staining of differentiated control and LRRC31-overexpressing EPC2s at day 14. Scale bar represents 20 µm. A representative experiment is shown (n = 3). d, Cross-sectional area of H&E stained sections from differentiated control and LRRC31-overexpressing EPC2s at day 14. A representative experiment is shown (n = 3). e, TER measured across differentiated control and LRRC31-overexpressing EPC2s at day 14. A representative experiment is shown (n = 3). RT, resistance. f, FITC-dextran (3-5 kD) paracellular flux measured at 3 hours after FITC-dextran was added to luminal surface of differentiated control and LRR31-overexpressing EPC2s at day 14. A representative experiment is shown (n = 3). For a and d-f, data are represented as the mean ± SEM; NS, not significant; *P < 0.05, **P < 0.01, ***P < 0.001.
100# KLK1 a Control LRRC31 b KLK5 KLK7 0.0150.015 0.0150.015 0.30.3 LRRC31 NS * LRP1B ** 0.010 0.010 0.20.2 HSPA6 0.010 0.010 C3orf49 NEWGENE10 0.0050.005 0.0050.005 0.10.1 KLK5/GAPDH KLK7/GAPDH TRIM31 KLK1/GAPDH1 KLK5/GAPDH KLK7/GAPDH KLK1/GAPDH PCDHB6 0.0000 0.0000 0.00 COL4A3 ControlControl LRRC31 LR ControlControl LRRC31 LR ControlControl LRRC31 LR VN1R1 KLK11 KLK13 GSTM1 0.0080.008 0.003 IGDCC4 * 0.003 ** PYHIN1 0.0060.006 LOC1005 0.0020.002 LRFN5 0.0040.004 DEM1 0.0010.001 0.002 KLK11/GAPDH1 PID1 0.002 KLK13/GAPDH1 KLK11/GAPDH KLK11/GAPDH GAS2L3 KLK13/GAPDH 0.0000 0.0000 LOC1002 ControlControl LRRC31 LR ControlControl LRRC31 LR CHRFAM7 c C17orf53 KLK10KLK10 KLK5KLK5 KLK7KLK7 500000 500000 100000 GLYCTK 5 NS 5 * 10 miR-17HG * 4000004 4000004 800008 KLK11
g Protein 300000
g Protein 60000 g Protein 3000003 3 6 µ µ
KLK13 µ KLK5 2000002 2000002 400004 KLK12 1000001 1000001 200002 Signal per per Signal Signal per per Signal PALM2 per Signal RelativeSignal RelativeSignal RelativeSignal MYCN 00 00 00 Up Control LRRC31 Control LRRC31 ControlControl LRRC31 LR CECR5 11.7 Control LR Control LR FAM1348 KLK11KLK11 KLK13KLK13 d KLK Activity KLK7 4000004 2000002.0 15001500 NAT2 ** * PLSCR2 3000003 1500001.5 **** 10001000 Protein
g Protein GUSBP5 g Protein g µ µ NOG 2000002 1000001.0 µ KCNK15 0 500500 1000001 500000.5 AFU per AFU per
FSCN3 AFU Relative Signal per per Signal -2.2 per Signal RelativeSignal RelativeSignal ZNF442 Down 00 00 00 ControlControl LRRC31 LR ControlControl LRRC31 LR ControlControl LRRC31 LR Figure 2.7 | Differentiated LRRC31-overexpressing EPC2 cell transcriptome. a, Heat diagram representing RNA sequencing analysis of differentiated empty vector (control) and LRRC31-overexpressing EPC2s. Differentially expressed genes were identified by filtering on FPKM ≥ 1, moderated t-test with Benjamini-Hochberg False Discovery Rate (P < 0.05), and fold change ≥ 1.5. KLK family members are bolded. b, Normalized KLK1, KLK5, KLK7, KLK11, and KLK13 mRNA expression in differentiated control and LRRC31-overexpressing (LR) EPC2s determined by qPCR analysis. A representative experiment is shown (n = 3). c, KLK10, KLK5, KLK7, KLK11, and KLK13 protein expression normalized to total protein in differentiated control and LRRC31-overexpressing EPC2 supernatants as determined by protease array analysis. A representative experiment is shown (n = 3). d, KLK serine protease activity in differentiated control and LRRC31-overexpressing EPC2 supernatants (AFU, arbitrary fluorescence units normalized to total protein). A representative experiment is shown (n = 3). For b-d, data are represented as the mean ± SEM; NS, not significant; *P < 0.05, **P < 0.01, ****P < 0.0001.
101# a 100.1-2 101002 1010-1 ** ** NS NS NS *** ** ** NS -2 NS 100.01-3 **** 1010 * 10101 1010-3 0.00110-4 1010 1010-4 0.000110-5 1010-5 -1
CCL26/GAPDH 0.1 -6 10 KRT10/GAPDH CCL26/GAPDH LRRC31/GAPDH 0.0000110 KRT10/GAPDH -6 LRRC31/GAPDH 1010-6 0.00000110-7 100.01-2 1010-7 Control0 IL-13100 Control0 IL-13100 Control0 IL-13100 Control0 IL-13100 Control0 100IL-13 Control0 100IL-13 IL-13 NSCNSC LRRC31LRRC31 shRNA shRNA NSC LRRC31LRRC31 shRNA shRNA NSC LRRC31LRRC31 shRNA shRNA (ng/mL) b c 0 100 IL-13 (ng/mL) 10000104 **
1000103 NSC 101002
Fold Change Fold 1 Fold Change 1010
1001 NSCNSC shLRRC31LRRC31 shRNA shRNA LRRC31
d e KLK1 KLK5 KLK7 -6 -4 80.000008×10 4×0.000410 0.0200.020 * NS NS 100100 ** * 60.000006×10-6 3×0.000310-4 0.0150.015 * NS 8080 ) ) 2 40.000004×10-6 2×0.000210-4 0.0100.010 2 6060 x cm x x cm x KLK1/GAPDH -6 KLK5/GAPDH -4 KLK7/GAPDH KLK7/GAPDH 0.000002 1×0.000110 0.0050.005 Ω
2×10 Ω KLK5/GAPDH KLK1/GAPDH ( 4040 ( T T R R 0.0000000 0.00000 0.0000 2020 NSCNSC LRRC31LRRC31 NSCNSC LRRC31LRRC31 NSCNSC LRRC31LRRC31 shRNAshRNA shRNAshRNA shRNAshRNA KLK11 KLK13 0 Control0 IL-13100 Control0 IL-13100 -5 -6 IL-13 80.00008×10 ** 8×0.0000410 NSCNSC LRRC31LRRC31 shRNA shRNA (ng/mL) * 60.00006×10-5 6×0.0000310-6
40.00004×10-5 4×0.0000210-6
-5 -6 KLK13/GAPDH 2KLK11/GAPDH 0.00002×10 2×0.0000110 KLK11/GAPDH KLK11/GAPDH KLK13/GAPDH
0.000000 0.000000 NSCNSC LRRC31LRRC31 NSCNSC LRRC31LRRC31 shRNAshRNA shRNAshRNA Figure 2.8 | KLK expression following LRRC31 gene-silencing in differentiated EPC2 cells. EPC2 esophageal epithelial cells transduced with either non-silencing control (NSC) or LRRC31 short hairpin RNA (LRRC31 shRNA) lentiviral expression constructs were cultured as described in Figure 5b. a, Normalized LRRC31 and CCL26 mRNA expression in differentiated NSC and LRRC31 shRNA EPC2s at day 14 determined by qPCR analysis. Dashed line represents limit of detection. b, Fold change in LRRC31 mRNA expression following IL-13–treatment in differentiated NSC and LRRC31 shRNA EPC2s at day 14. c, H&E-stained sections from differentiated NSC and LRRC31 shRNA EPC2s at day 14. d, Normalized KLK1, KLK5, KLK7, KLK11, and KLK13 mRNA expression in IL-13–treated differentiated NSC and LRRC31 shRNA EPC2 cells at day 14 determined by qPCR. e, TER measured across differentiated NSC and LRRC31 shRNA EPC2s at day 14. RT, resistance. For a-e, a representative experiment is shown (n = 3). For a, b, d, and e, data are represented as the mean ± SEM; NS, not significant; *P < 0.05, **P < 0.01, ***P < 0.001, ****P < 0.0001.
102# a NL CE EoE b Control IL-13 **KLK7 KLK12 KLK6 KLK12 *KLK7 KLK2 **KLK10 KLK4 ***KLK10 KLK4 *KLK1 KLK2 KLK11 KLK3 KLK4 KLK4 KLK15 KLK3 KLK4 KLK1 KLK3 KLK15 KLK15 KLK2 KLK4 KLK14 KLK2 KLK4 KLK13 KLK9 KLK3 KLK2 KLK8 KLK4 KLK4 KLK15 KLK9 KLK3 KLK15 KLK15 KLK2 KLK15 KLK15 KLK11 KLK2 KLK12 KLK14 KLK13 Up KLK8 Up KLK3 1.7 0.4 KLK2 KLK13 KLK4 KLK7 ***KLK13 KLK7 0 *KLK13 KLK13 *KLK8 0 *KLK5 KLK5 *KLK10 KLK12 *KLK10 *KLK8 KLK12 -1.3 -0.7 KLK12 Down KLK6 Down Figure 2.9 | KLK expression in esophageal biopsies and IL-13–treated primary esophageal epithelial cells. a, Heat diagram of KLK mRNA expression in esophageal biopsies of NL, chronic esophagitis (CE), and EoE patients determined by microarray gene expression analysis. b, Heat diagram of KLK mRNA expression in primary esophageal epithelial cells stimulated with IL-13 (100 ng/mL) for 48 hours determined by microarray gene expression analysis. Each row represents one microarray probe. Hierarchical clustering used to analyze data and generate heat diagrams. Statistical analysis by ANOVA (a) and moderated t-test (b) with P < 0.05. *P < 0.05, **P < 0.01, ***P < 0.001.
103# Esophageal Epithelium
Barrier LRRC31 KLKs Function
IL-13 Figure 2.10 | Function of LRRC31 in the esophageal epithelium. IL-13 induces LRRC31 expression in the esophageal epithelial cells, decreasing the expression of specific KLKs and increasing barrier function.
104# a b
66 1010 1515 2020
**** **** **** **** 88 1515 4 1010 66
Expression 10 Expression 10 Expression Fold Change Fold Change Fold Expression Fold Change Fold Change Fold 44 2 55 5 22 5 CCL26 LRRC31 CCL26 CCL26 LRRC31 CCL26 LRRC31 LRRC31 0 00 00 00 Control0 IL-410 Control0 IL-410 IL-4 Control0 IL-1350 Control0 IL-1350 IL-13 (ng/mL) (ng/mL) c d 2.0×10-6 1000103 5050 1212
2.0×10 * * * *** 4040 1010 1.51.5××1010-6-6 101002 88 3030 -6-6 1 1.0×10 10 Expression 66 1.0×10 10 Expression Expression 2020 Expression 44
-7-7 CCL26/GAPDH 0 0.5LRRC31/GAPDH 5.0××1010 101 CCL26/GAPDH 10 CCL26 LRRC31/GAPDH 10 2 LRRC31 CCL26 2 LRRC31 0.00 100.1-1 00 00 Control0 IL-13100 Control0 IL-13100 IL-13 Control0 IL-13100 Control0 IL-13100 IL-13 (ng/mL) (ng/mL) Supplementary Figure 2.1 | LRRC31 expression in esophageal epithelial cells. a, Fold change in normalized LRRC31 and CCL26 mRNA expression in bronchial epithelial cells treated with IL-4 (10 ng/mL) for 18 hours determined by microarray gene expression analysis.17 b, Normalized LRRC31 and CCL26 mRNA expression in tracheal epithelial cells treated with IL-13 (50 ng/mL) for 23 days determined by microarray gene expression analysis.18 c, Normalized LRRC31 and CCL26 mRNA expression in Caco2-bbe colonic epithelial cells treated with IL-13 (100 ng/mL) for 48 hours determined by microarray gene expression analysis. d, Normalized LRRC31 and CCL26 mRNA expression in esophageal epithelial cells treated with IL-13 (100 ng/mL) for 48 hours determined by microarray gene expression analysis. For a-d, data are represented as the mean ± SEM; *P < 0.05, ***P < 0.001, ****P < 0.0001.
Day 2 Day 7 Day 14
105# a b 0.10.1 *** - CTTCTTAGAAA + ATTTCTAAGA 0.010.01 STAT6 STAT6 LRRC31 -254 -31 TSS 0.0010.001 2 kb 5’ upstream region NS * 0.000010.0001 Relative Firefly/Renilla RelativeFirefly/Renilla 0.000010.00001 0 100 0 100 0 100 IL-13 (ng/mL) Control LRRC31 CCL26 Supplementary Figure 2.2 | IL-13–STAT6 effect on LRRC31 gene promoter activity. a, Identification of putative STAT6 binding sites within the 2 kb 5’ upstream region of the LRRC31 transcription start site (TSS) from publicly available ChIP-Seq data.19 b, Normalized luciferase activity in empty vector control, LRRC31 gene promoter (LRRC31), and CCL26 gene promoter (CCL26) transfected TE-7 esophageal epithelial cells treated with IL-13 (100 ng/ml) for 48 hours. A representative experiment is shown (n = 3). For b, data are represented as the mean ± SEM; NS, not significant; *P < 0.05, ***P < 0.001.
Day 2 Day 7 Day 14
106# 0 100 IL-13 (ng/mL) NSC
100 100 IL-13 (ng/mL) LRRC31 shRNA LRRC31shRNA
Supplementary Figure 2.3 | LRRC31 gene-silenced, differentiated EPC2 cells. Additional images of H&E- stained sections from differentiated NSC and LRRC31 shRNA EPC2s at day 14.
107# 66 NS NS
44
22 FITC-Dextran (ng/ml) FITC-Dextran FITC-Dextran(ng/mL) 00 Control0 IL-13100 Control0 IL-13100 IL-13 NSCNSC LRRC31LRRC31 shRNA shRNA (ng/mL)
Supplementary Figure 2.4 | Paracellular flux measurements in LRRC31 gene-silenced, differentiated EPC2 cells. FITC-dextran (3-5 kD) paracellular flux measured at 3 hours after FITC- dextran was added to luminal surface of differentiated NSC and LRR31 shRNA EPC2s at day 14. A representative experiment is shown (n = 3). Data are represented as the mean ± SEM; NS, not significant.
108# a
NLS LRR LRR LRR LRR LRR LRR LRR NES LRR LRR
1 58 106 162 218 274 330 386 442 552 Isoform 1: 552 aa (61.5 kD) Isoform 2: 496 aa (55.3 kD) Isoform 3: 346 aa (38.0 kD) b
Supplementary Figure 2.5 | LRRC31 structure. a, Representation of LRRC31 protein amino acid primary sequence with 9 exons indicated and putative domains (LRR, leucine-rich repeat; NES, nuclear export signal; NLS, nuclear localization signal).25,26 b, Images representing predicted tertiary structure of LRRC31 generated using I- TASSER Online Protein Structure and Function Predictions.27
109# a
LRRC31 RNH1 CEP78 TLR9 LRRC32 CD180 NLRC4 RANGAP1 NAIP TONSL NLRC5 NLRP14 NLRP4 NLRP12 NLRP13 NLRP2 NLRP7 NLRP5 NLRP1 FLI1 LRRC34
0 0.2 0.4 0.6 0.8 1 1.2 1.4 1.6 1.8 Amino Acid Similarity Distance b
Callithrix jacchus Equus caballus Orcinus orca Loxodonta africana Otolemur garnettii Pongo abelii Pan troglodytes Myotis lucifugus Rattus norvegicus Mus musculus Sacrophilus harrisii Nomascus leucogenys Macaca mulatta Pan paniscus Homo sapiens Bos taurus Gallus gallus Alligator sinesis Xenopus tropicalis Tursiops truncatus Canis lupus Pelodiscus sinensis
0 0.1 0.2 0.3 0.4 0.5 0.6 0.7 0.8 0.9 Evolutionary Distance
Supplementary Figure 2.6 | LRRC31 homology and phylogeny. a, Analysis of LRRC31 amino acid similarity to pBLAST-predicted homologous human proteins using Jukes Cantor modeling.28 b, Analysis of LRRC31 amino acid similarity to eggNOG-predicted orthologous proteins using Jukes Cantor modeling.33
110# Supplementary Table 2.1: Primers used for qPCR. Gene$ Amplicon$ Forward$Primer$ Reverse$Primer$ GAPDH& 351#bp# TGGAAATCCCATCACCATCT GTCTTCTGGGTGGCAGTGAT CCL26& 151#bp# AACTCCGAAACAATTGTACTCAGCTG GTAACTCTGGGAGGAAACACCCTCTCC LRRC31& 131#bp# CAAAAGAGTGTCAAAATATTGGATG TGCTTTAGCATGACCAACTGA KRT10& 126#bp# AGCATGGCAACTCACATCAG## TGTCGATCTGAAGCAGGATG KLK1& 89#bp# GTGCTCACAGCTGCTCATTG AACTGGGCTGTGTTTTCGTC KLK5& 155#bp# AGTCAGAAAAGGTGCGAGGA TAATCTCCCCAGGACACGAG KLK7& 122#bp# CGTCCTGGTCAATGAGCG ACTTCGAGGCCTTGATCCTC KLK11& 101#bp# CACCAGCTGCCTCATTTCC TCTGGTGCTCAATGATGGTG KLK13& 82#bp# CCTAGTGATCGCCTCCCTG GGTCCCATTGGTGTTGAGAA
111# CHAPTER 3: ESOPHAGEAL LRRC32 EXPRESSION IS REGULATED BY ALLELIC
VARIATION AT rs2155219
RJ D’Mello1, EM Stucke1, JA Rothenberg1, M Rochman1, MT Weirauch2,3, LC Kottyan1,2, ME
Rothenberg1
1. Division of Allergy and Immunology, Department of Pediatrics, Cincinnati Children’s Hospital
Medical Center, Cincinnati, OH, USA
2. Center for Autoimmune Genomics and Etiology, Department of Pediatrics, Cincinnati
Children’s Hospital Medical Center, Cincinnati, OH, USA
3. Division of Biomedical Informatics and Developmental Biology, Cincinnati Children’s
Hospital Medical Center, Cincinnati, OH, USA
Address correspondence to: Marc Rothenberg, Division of Allergy and Immunology,
Cincinnati Children’s Hospital Medical Center, 3333 Burnet Avenue, ML7028, Cincinnati, OH,
45229; Fax, 513-636-3310; Phone, 513-636-7177; Email, [email protected]
! 112! 3.1. Abstract
Eosinophilic esophagitis (EoE) is a chronic allergic inflammatory disease of the esophagus. EoE is complex, with both genetic and environmental factors contributing to pathogenesis. We compared EoE genetic associations from previous genome-wide association studies (GWAS) with genetic associations from asthma, allergic rhinitis, and atopic dermatitis, identifying chromosome 11q13 as a shared genetic association. In this locus, we identified rs2155219, an intergenic single nucleotide polymorphism (SNP) between leucine-rich repeat–containing protein 32 (LRRC32) and chromosome 11 open reading frame 30 (C11ORF30) that was highly associated with allergic diseases. We showed that rs2155219 associated with EoE at genome- wide significance (P = 3.21x10-9) with an odds ratio (OR) of 0.72. In esophageal epithelial cells, we observed IL-13–induced epigenetic activation peaks and a putative signal transducer and activator of transcription 6 (STAT6)-binding site 15 bases away from rs2155219. Another gene in the 11q13 locus is calpain 5 (CAPN5), a homolog of calpain 14, which was genetically associated and functionally implicated in the esophageal response to IL-13 in EoE. In order to further elucidate the causal genes and/or variants at 11q13, we examined the mRNA expression of LRRC32, C11ORF30, and CAPN5 as a function of the genotype at rs2155219. In the esophagus of EoE patients CAPN5 mRNA expression was decreased (6-fold, P < 0.001), and
LRRC32 and C11ORF30 mRNA expression was unchanged. Interestingly, in the esophagus of
EoE patients stratified on genotype at rs2155219, LRRC32 mRNA expression was increased (4- fold, P < 0.05) when the minor allele (T) was present, while C11ORF30 and CAPN5 mRNA expression were unchanged. In addition, in IL-13–treated esophageal epithelial cells, LRRC32 mRNA was upregulated (31-fold, P < 0.05), C11ORF30 mRNA was decreased (1.2-fold, P <
0.01), and CAPN5 mRNA was increased (2-fold, P < 0.05). Taken together, we propose that genetic variation at rs2155219 regulates expression of LRRC32 mRNA, and LRRC32,
C11ORF30 and CAPN5 may be contributing to EoE pathogenesis.
! 113! 3.2. Introduction
Eosinophilic esophagitis (EoE) is a chronic, inflammatory, food-antigen driven disease of the esophagus characterized by marked mucosal eosinophil accumulation that is often associated with fibrosis and impaired motility.1-4 EoE is associated with a dysregulated esophageal transcriptome that is enriched in elements involved in allergic inflammation, including the inflammatory mediators IL-13 and transforming growth factor-beta (TGF-β).5-7 Additionally, EoE co-occurs in atopic individuals with other allergic diseases such as asthma, eczema, and food anaphylaxis, suggesting common elements in pathogenesis.2-4
EoE is complex, like other allergic diseases, with both environmental and genetic factors contributing to pathogenesis.8 The first EoE genome-wide association study (GWAS) identified
5q22, which contains thymic stromal lymphopoietin (TSLP), as a genetic susceptibility locus associated with disease.9 Candidate gene studies also showed EoE genetic associations with
TSLP, the TSLP receptor [cytokine receptor-like factor 2 (CRLF2)], the eosinophil chemokine eotaxin-3 [chemokine (C-C motif) ligand 26 (CCL26)], and the regulator of stratified squamous epithelial terminal differentiation, filaggrin (FLG).10-13 Interestingly, there is a marked overlap between genetic variations associated with EoE and other allergic diseases.14-16 A second EoE
GWAS was conducted that identified 20 associated single nucleotide polymorphisms (SNPs) at
17 loci, and characterized genetic variation at 2p23, specifically in the calpain 14 (CAPN14) locus, as contributing to the tissue specific nature of EoE.17
In this study, we compared genetic loci associated with EoE, asthma, allergic rhinitis, and atopic dermatitis, and identified 11q13 as a shared genetic locus between allergic diseases.
Furthermore, we investigated rs2155219, an intergenic SNP between leucine-rich repeat- containing protein 32 (LRRC32; also known as glycoprotein A repetitions predominant, GARP) and chromosome 11 open reading frame 30 (C11ORF30; also known as EMSY), since it was
! 114! known as EMSY), since it was one of the most highly associated SNPs with allergic diseases and with nonspecific sensitization to different allergens18,19 In addition, we found rs2155219 had activating epigenetic marks with a putative signal transducer and activator of transcription 6
(STAT6)-binding site. This was interesting because STAT6 is activated by IL-13 to induce the transcription of IL-13–responsive genes, and has been shown to be important in driving allergic diseases. 11q13 also contains calpain 5 (CAPN5), which is in the same gene family as calpain
14, a protease associated with the EoE-specific, IL-13–inducible esophageal response.
LRRC32 is a leucine-rich repeat membrane protein that is expressed on the surface of activated
+ hi + CD4 CD25 FOXP3 T regulatory (Treg) cells and is part of a positive feedback loop with
FOXP3, the master transcription factor for Treg cell differentiation, and regulates transforming
20-24 growth factor-β (TGF-β) bioavailability and signaling. It is notable that TGF-β and Treg cells were previously implicated in EoE.25-28 C11ORF30 is an oncogene encoding a novel breast cancer 2, early onset (BRCA2)-like protein. C11ORF30 is increased in breast and ovarian epithelial cancers, disrupting the BRCA2/RAD51 pathway in the DNA-damage response resulting in chromosome instability and tumor progression with increased size and metastasis.29-
32 C11ORF30 also represses transcription of the anti-metastatic microRNA miR-31 in breast cancer.33 CAPN5 is a member of the calpain family of cysteine proteases and is expressed in the nucleus of T cells and cells of the central nervous system, though its function remains to be determined.34,35 CAPN5 mutations result in autosomal dominant neovascular inflammatory vitreoretinopathy (ADNIV), which causes autoimmune uveitis, retinal neovascularization, and photoreceptor degeneration, further suggesting a function for CAPN5 in regulating immune responses.36 We selected CAPN5 following our recent genetic analysis where we identified the related gene, CAPN14, at genome-wide significance (P < 1x10-8) in association with EoE, a finding that was later confirmed in an independent study.17,37
! 115! In this study, we demonstrated that individuals with the minor allele (T) at rs2155219 on chromosome 11q13 had decreased risk of developing EoE and increased LRRC32 mRNA expression. In addition, IL-13 stimulation of esophageal epithelial cells induced LRRC32 mRNA expression. Taken together, our data show that expression of C11ORF30, LRRC32, and
CAPN5 mRNA are altered in EoE and genetic variation associated with disease can modulate
LRRC32 mRNA expression. Thus, these three genes may contribute to disease pathogenesis.
! 116! 3.3. Results
3.3.1. EoE shares genetic associations with other allergic diseases
We surveyed published GWAS data for asthma, allergic rhinitis, atopic dermatitis, and Celiac disease and compared these genetic associations with the 9 genetic associations we previously reported.9,17 EoE and asthma shared 2 common genetic associations at chromosomes 5q22 and 11q13, EoE and allergic rhinitis shared 1 common genetic association at chromosome
11q13, and EoE and atopic dermatitis shared 1 genetic association at chromosome 11q13
(Figure 3.1a-c). EoE and celiac disease shared 2 genetic associations at chromosomes 2p23 and 21q22 (Figure 3.1d). These results identified chromosome 11q13 as a shared locus between EoE and asthma, allergic rhinitis, and atopic dermatitis, but not Celiac disease.
Interestingly, asthma, allergic rhinitis, and atopic dermatitis were all allergic diseases. Taken together, these data support a shared genetic association between EoE, asthma, and atopic dermatitis.
3.3.2. Chromosome 11q13 has SNPs associated with allergic diseases.
We visualized the distribution of SNPs and haplotypes in linkage disequilibrium across 11q13, plotting known disease-associated loci on a genome browser track with genes annotated.
Known genetic associations with EoE, allergic sensitization, Crohn’s disease, inflammatory bowel disease, allergic rhinitis, allergic sensitization, self-reported allergy, ulcerative colitis, asthma, and atopic dermatitis within the chromosome 11q13 locus were first plotted over the locus (Figure 3.2a). Further focusing on the intergenic region between LRRC32 and
C11ORF30, we showed specific SNPs that were known to associate with allergic diseases: rs7130588 was associated with atopic dermatitis, asthma, and EoE, rs2155219 was associated with allergic sensitization, inflammatory bowel diseases, allergic rhinitis, and EoE, rs79279894 was associated with atopic dermatitis, Crohn’s Disease, and EoE, and rs11236809 was associated with atopic dermatitis and EoE (Figure 3.2b). Taken together, the identification of
! 117! multiple genetic variants within 11q13 that were associated with allergic and inflammatory diseases suggests this region is important in the regulation of immune and inflammatory responses.
A previous EoE GWAS by Kottyan, et. al. identified a minor allele frequency (MAF, the frequency of the second most common allele in a given population) for rs2155219 of 0.491 for normal controls (NL; n = 9,246) and a MAF of 0.412 for EoE patients (n = 736) with an OR of
0.73 (P = 3.65x10-7), which did not reach genome-wide significance.17 The MAF for NL in this study was similar to the MAF reported by the International HapMap Consortium for Utah residents with Northern and Western European ancestry (MAF = 0.487, n = 226).38 In order to reach genome-wide significance, we genotyped an additional independent cohort of patients and identified a MAF of 0.554 for NL (n = 42) and a MAF of 0.405 for EoE (n = 369), which resulted in an OR of 0.55 (P = 0.067) (Table 3.1). We used a meta-analysis to combine the results from these two studies and found a MAF of 0.493 for NL, a MAF of 0.412 for EoE, and an OR of 0.72 (P = 3.21x10-9), achieving genome-wide significance for rs2155219. These data show an OR of 0.72 for the minor allele (T) at rs2155219, suggesting that having the minor allele is associated with reduced risk of developing EoE. Interestingly, an independent GWAS reported genome-wide significance for the C11ORF30 locus, making our findings at rs2155219, which is located in the C11ORF30 locus, the second report identifying genome-wide significant associations with EoE on chromosome 11q13.37
3.3.3. Epigenetic and transcriptional landscape at rs2155219
We examined the epigenetic and transcriptional landscape around rs2155219, which was located in an intragenic region between LRRC32 and C11ORF30. Histone 3, lysine 27 acetylation (H3K27Ac) epigenetic modifications are often indicative of active chromatin, and we used H3K27Ac chromatin immunoprecipitation with sequencing (ChIP-seq) from IL-13–treated
! 118! TE-7 esophageal epithelial cells and identified an IL-13–induced H3K27Ac peak upstream of rs2155219.39 Interestingly, we also showed 2 H3K27Ac epigenetic peaks flanking rs2155219 from H3K27Ac ChIP-seq data retrieved from the encyclopedia of DNA elements (ENCODE), and the upstream peak overlapped with the IL-13–induced peak (Figure 3.3a). In addition, rs2155219 was predicted to be an active chromatin site with enhancer or weak promoter activity by the publicly available dataset Roadmap Epigenomics, which integrates ENCODE datasets to make functional predictions about chromatin activity (Supplementary Figure 3.1). Furthermore, we predicted a putative signal transducer and activator of transcription 6 (STAT6) binding site
(AGATTCCTTTGAG) that was 15 bases upstream of rs2155219, and that overlapped with the
IL-13–induced H3K27Ac mark (Figure 3.4b; Supplementary Table 3.1).40 STAT6 is the transcription factor activated by IL-13 treatment of epithelial cells and regulates the induction of the epithelial cell transcriptome in EoE.41,42 STAT6 has been shown to regulate chromatin structure via H3K27Ac, which subsequently regulates gene expression, and STAT6 can function as an activator of transcription at distal enhancers through chromatin looping.43,44 In addition,
STAT6 KO mice fail to develop experimental EoE, further supporting a critical function for
STAT6 in driving EoE pathogenesis.45
3.3.4. Expression of LRRC32, C11ORF30, and CAPN5 in the esophagus.
We used microarray gene expression analysis and determined the mRNA expression of
LRRC32, C11ORF30, and CAPN5 in esophageal biopsies of patients with active EoE (n = 18) and in NL (n = 14). The expression of LRRC32 and C11ORF30 mRNA were not changed in the esophagus of EoE compared to NL (Figure 3.4a,b). In contrast, CAPN5 mRNA expression decreased 6-fold (P < 0.001) in the esophagus of EoE compared to NL (Figure 3.4c). However, the genotypes of these NL and EoE patients at rs2155219 were unknown. Therefore, we sought to further investigate if changes in mRNA expression were dependent on a specific genotype at rs2155219. In order to determine this, we genotyped an independent cohort of NL and EoE
! 119! patients and measured the expression of LRRC32, C11ORF30, and CAPN5 mRNA by quantitative PCR (qPCR) from their corresponding esophageal biopsies. We determined that in
NL patients (n = 41), there were no significant changes in LRRC32, C11ORF30, or CAPN5 mRNA expression that were dependent on major allele homozygous (G/G), heterozygous (T/G), or minor allele homozygous (T/T) genotypes (Figure 3.5a-c). Interestingly, in EoE patients (n =
79) with the minor allele homozygous genotype there was a decrease of 4-fold (P < 0.05) in
LRRC32 mRNA expression compared to the major allele homozygous genotype (Figure 3.5d).
There were no changes in C11ORF30 or CAPN5 mRNA expression in EoE patients that were dependent on genotypes (Figure 3.5e,f). Note that mRNA expression analysis for NL and EoE were done independently, thus these relative expression levels cannot be compared. These data show that LRRC32 mRNA expression was not significantly changed in the esophagus of
EoE patients with mixed genotypes at rs2155219. However, the expression of LRRC32 mRNA was decreased in EoE patients with the minor allele at rs2155219.
3.3.5. Expression of LRRC32, C11ORF30, and CAPN5 in epithelial cells.
We aimed to identify the cell type that was expressing LRRC32, C11ORF30, and CAPN5 mRNA and selected esophageal epithelial cells, which are the predominant cell type contained within esophageal biopsies. We treated primary esophageal epithelial cells, which were cultured from esophageal biopsies of patients with EoE, with IL-13 (100 ng/mL) for 48 hours and found no changes in LRRC32, C11ORF30, and CAPN5 mRNA expression by microarray gene expression analysis (Figure 3.6a-c). In addition, we examined LRRC32, C11ORF30, and
CAPN5 mRNA expression in differentiated esophageal epithelial cells grown at the air-liquid interface (ALI). We cultured EPC2 immortalized esophageal epithelial cells in high calcium media for 7 days, following which they were differentiated at the ALI for an additional 7 days.
The differentiated esophageal epithelial cells were treated with IL-13 (100 ng/mL) for 6 days starting at day 8 in order to characterize the IL-13–response of differentiated esophageal
! 120! epithelial cells (Figure 3.6d).46 In differentiated EPC2 cells, LRRC32 mRNA expression did not change from Day 7 to Day14, increased 18-fold (P < 0.05) with IL-13 treatment at Day 14, and increased 31-fold (P < 0.05) from Day 7 to Day 14 with IL-13 treatment by RNA-sequencing
(RNA-Seq) gene expression analysis (Figure 3.6e). In differentiated EPC2 cells, C11ORF30 mRNA expression increased 1.7-fold (P < 0.001) from Day 7 to Day 14, decreased 1.2-fold (P <
0.01) with IL-13 treatment at Day 14, and increased 1.4-fold (P < 0.01) from Day 7 to Day 14 with IL-13 treatment by RNA-Seq gene expression analysis (Figure 3.6f). In differentiated EPC2 cells, CAPN5 mRNA expression did not change from Day 7 to Day 14, increased 2-fold (P <
0.05) at Day 14 with IL-13 treatment, and increased 1.4-fold (P < 0.001) from Day 7 to Day 14 with IL-13 treatment by RNA-Seq gene expression analysis (Figure 3.6g). Taken together, these data suggest that differentiated EPC2 cells, treated with IL-13 differentially expressed
LRRC32, C11ORF30, and CAPN5 mRNA. LRRC32 mRNA expression was the most markedly changed as it was increased 18-fold (P < 0.05) with IL-13 treatment, C11ORF30 mRNA expression increased with differentiation but decreased 1.2-fold (P < 0.01) with IL-13 treatment, and CAPN5 mRNA expression increased 2-fold (P < 0.05) with IL-13 treatment.
! 121! 3.4. Discussion
EoE is a complex disease with both genetic and environmental factors contributing to the pathogenesis of the allergic inflammation observed in the esophagus.8 Several genetic factors contributing to EoE are known such as the chromosome 5q22 locus, which encodes TSLP and
WDR36, and the chromosome 2p23 locus, which encodes CAPN14.9,17 Here, we evaluated an additional genetic association, the chromosome 11q13 locus, which is also associated with other allergic diseases such as asthma, allergic rhinitis, and atopic dermatitis. Haplotype analysis of 11q13 identified additional genetic associations with allergic and inflammatory diseases such as Crohn’s Disease and Ulcerative Colitis, and a more specific haplotype analysis examining SNPs associated with allergic inflammatory disease identified 4 SNPs in the intergenic region between the genes LRRC32 and C11ORF30.
We evaluated the transcriptional and epigenetic landscapes of these 4 SNPs at 11q13 and identified rs2155219 as a possible enhancer or weak promoter of transcription that was one of the most highly associated SNPs with allergic diseases and sensitization. Therefore we focused our investigation on rs2155219. Previously, an EoE GWAS associated the minor allele at rs2155219 with a lower risk of EoE but failed to reach genome-wide significance. We genotyped an independent cohort and used a meta-analysis to combine our results with the previous EoE
GWAS data in order to reach genome-wide significance for rs2155219.17 Surprisingly, the NL in the independent cohort did not have an MAF similar to the previous EoE GWAS data or the
International HapMap Consortium, which may have been because there were only 42 NLs.
However, using the meta-analysis we reached genome wide-significance for rs2155219, combining the previous EoE GWAS data and the independent cohort.
H3K27Ac ChIP-seq of TE-7 cells treated with IL-13 identified a peak upstream of rs2155219 that overlapped with an H3K27Ac ChIP-seq peak retrieved from ENCODE. Screening for
! 122! predicted transcription factor binding to this region, we identified a putative STAT6 binding site
15 bases upstream of rs2155219. This was relevant because STAT6 is activated by IL-13 signaling; IL-13 binds to its receptor, STAT6 is phosphorylated, homodimerizes, translocates to the nucleus, and binds DNA to activate transcription of IL-13–induced genes.41 STAT6 was shown to regulate gene expression via modulating H3K27Ac, functioning as a molecular switch to regulate higher-order chromatin remodeling, dynamically orchestrating co-activators (CREB binding protein/Tudor Staphylococcal Nuclease [CBP/Tudor-SN]) and co-repressors (histone deacetylase 1/splicing factor proline/glutamine-rich [HDAC1/PSF]) in response to IL-4 stimulation.43 STAT6 was also shown to participate in promoter/enhancer looping interactions in the context of Ig class switch recombination, regulating the transcriptional activity at distal promoters.44 Interestingly, rs2155219 was predicted to have enhancer with weak transcriptional activity by Roadmap Epigenomics, which integrated ChIA-PET, hidden Markov model (HMM),
DNaseI hypersensitivity, H3K4Me1, and DNase Digital Genomics Footprinting data retrieved from ENCDOE. Taken together, these data suggest rs2155219 is an active chromatin site in esophageal epithelial cells.
Chromosome 11q13 encodes several genes that may function in regulating the immune response in allergy. LRRC32 encodes a transmembrane protein that regulates TGF-β bioactivity and signaling by binding latent TGF-β to the surface of cells.23 This function of LRRC32 was observed and characterized in Treg cells, which are present in the esophagus in EoE and in mouse models of experimental EoE.25-27 C11ORF30 is an oncogene encoding a protein that disrupts the BRAC2/RAD51 DNA-damage repair pathway and promotes increased tumor size and metastasis, primarily in epithelial cancers.29-32 CAPN5 encodes a calpain-family cysteine protease that is related to CAPN14, a gene on chromosome 2p23 that is associated with EoE and other allergic diseases.17 We identified these genes on chromosome 11q13 and hypothesize that they will have a role in regulating immune and allergic responses. We next
! 123! focused on determining if the mRNA expression of these 3 genes was a function of disease status and/or genotype at rs2155219.
In esophageal biopsies from NL and EoE patients we identified a decrease in CAPN5 mRNA expression and no change in LRRC32 or C11ORF30 mRNA expression. However, when we stratified esophageal biopsies on genotype (major allele homozygous, heterozygous, and minor allele homozygous), we observed an increase in LRRC32 mRNA expression in the minor allele homozygous compared to major allele homozygous, but no change in C11ORF30 or CAPN5 mRNA expression. These data show that LRRC32 expression may be a function of genotype at rs2155219, with increased expression when the minor allele is present.
We further characterized LRRC32, C11ORF30, and CAPN5 mRNA expression in primary esophageal epithelial cells and differentiated EPC2 cells following IL-13 treatment. We did not identify any changes in LRRC32, C11ORF30, and CAPN5 mRNA expression in primary esophageal epithelial cells that were cultured from esophageal biopsies collected from patients with EoE. However, in differentiated EPC2 cells LRRC32 mRNA expression was increased following IL-13 treatment, C11ORF30 mRNA expression increased with differentiation and decreased following IL-13 treatment, and CAPN5 mRNA expression also increased following IL-
13 treatment. These findings suggest that LRRC32, C11ORF30, and CAPN5 mRNA are regulated by IL-13 in the esophageal epithelial and may be altered in EoE.
Thus, 11q13 is a recently identified genetic association with EoE that has genome-wide significance. 11q13 is also associated with other allergic inflammatory diseases and encodes several genes that may have a functional role in the pathogenesis of allergic diseases.
Specifically, SNP rs2155219 reached genome-wide significance associating with EoE and was predicted to be an enhancer or weak activator of transcriptional activity, with predicted STAT6
! 124! binding in an IL-13–induced epigenetically active site. However, further investigation is required to establish a functional and mechanistic understanding of the associations we have identified.
We need to show that LRRC32 mRNA expression is dependent on rs2155219 genotype (major allele homozygous compared to minor allele homozygous) in an independent cohort of NL and
EoE patients. The IL-13 regulation of LRRC32, C11ORF30, and CAPN5 mRNA expression needs to be reproduced in primary cells (n = 1) and in differentiated EPC2 cells (n = 1), and protein expression also characterized. In order to further understand the mechanistic function of genetic variation at rs2155219, STAT6 binding needs to be confirmed by ChiP-Seq and gene expression changes need to be evaluated in a STAT6 null model, such as esophageal epithelial cells expressing a dominant negative STAT6. Furthermore, the direct binding of STAT6 to rs2155219 needs to be evaluated with both the major allele homozygous and the minor allele homozygous genotypes by DNA affinity precipitation assay (DAPA) followed by mass spectrometry, and a difference in STAT6 DNA binding affinity needs to be evaluated by electrophoretic mobility shift assay (EMSA). Completion of these experiments may reveal the mechanistic function of rs2155219.
The functional contributions of LRRC32 to EoE pathogenesis have yet to be determined. We showed that esophageal epithelial cells induced LRRC32 mRNA expression following IL-13 treatment, however Treg cells may be the dominant cell type expressing LRRC32. In addition, the contribution of TGF-β to EoE pathogenesis is not clear and further understanding of the regulation of TGF-β signaling may be required in order to directly implicate LRRC32 in contributing to EoE pathogenesis. Furthermore, LRRC32 may be important for the general pathogenesis of allergic disease because of the shared genetic association of 11q13 with EoE, asthma, allergic rhinitis, and atopic dermatitis. For example, in a humanized mouse model of allergen-induced IgE-dependent gut inflammation administration of LRRC32 prevented gut
47 inflammation. In addition, while Treg cells decreased gut inflammation, blocking LRRC32 while
! 125! 47 co-administrating activated Treg cells restored gut inflammation. This study further supports an important function for LRRC32 in allergic inflammation.
In conclusion, we identified rs2155219, a SNP that reached genome-wide significance in association with EoE with the minor allele associated with decreased risk of EoE. However, it is not clear whether rs2155219 is the only SNP within the 11q13 locus that is regulating gene expression and allergic diseases, and further investigation of other SNPs is important to understand their contributions to disease. LRRC32 mRNA expression was a function of genotype at rs2155219, with increased expression when the minor allele was present. LRRC32 mRNA was induced by IL-13 in esophageal epithelial cells, but further investigation is required to characterize the cell types expressing LRRC32 mRNA within the esophagus. Finally, we identified an EoE genetic association that correlated with changes in mRNA expression of
LRRC32, a regulator of TGF-β signaling, which further reinforces the need to investigate the function of TGF-β in the esophageal epithelium and in allergic disease. Taken together, these 3 genes in the 11q13 locus, C11ORF30, LRRC32, and CAPN5 may be important for EoE pathogenesis.
! 126! 3.5. Methods
Association and linkage disequilibrium analysis. After removing genetic outliers, we performed logistic regression to calculate P values and OR estimates for each SNP using
PLINK with sex as a covariate.48 For some analyses, atopy and the most significant SNP in the region were also used as covariates. For analyses that used atopy as a covariate, only subjects with know atopic status (EoE cases and local Cincinnati controls) were included. For cases, atopy was defined by a physician-documented history of positive skin-prick test results, allergic rhinitis, atopic dermatitis/eczema, asthma or food allergy. The prevalence of atopy for the local
CCHMC and CoFAR EoE cohorts was 96.2% and 91.3%, respectively. For the Cincinnati
Genomic Control Cohort, atopy was defined by a parent-reported history of allergic rhinitis, eczema, asthma or food allergy; the atopy prevalence of this cohort was 28.6%. LocusZoom and R were used to map the associated loci in the context of chromosomal recombination and nearby genes.49
SNP Sequencing. Buccal swab DNA was collected from normal control (NL; n = 42) and EoE patients (n = 369) after informed consent. DNA was isolated by alkaline extraction. Sequencing of rs2155219 was done using the ABI TaqMan allelic discrimination assay C_16139992_20
(Applied Biosystems Inc., Foster City, CA), and performed on the ABI 7900HT Fast Real-Time
System (Life Technologies, Grand Island, NY) as per the manufacturers dry protocol. Briefly,
DNA was loaded into wells, dried overnight, and reaction mix with assay probes and TaqMan
Genotyping Master Mix (Applied Biosystems) added. Plate was pre-read, PCR performed, post- read, and analyzed for genotype at rs2155219.
H3K27Ac ChIP sequencing. We fixed 10-20 million TE-7 cells (a kind gift from P. Hainault,
International Agency for Research on Cancer) with 0.8% formaldehyde by adding 1 mL of 10X fixation buffer (50 mM HEPES-KOH, pH 7.5, 100 mM NaCl, 1 mM EDTA, 0.5 mM EGTA, 8% formaldehyde) to 9 mL of growth medium for 8 min at room temperature with shaking. The reaction was stopped by adding glycine to a final concentration of 125 mM for an additional 5
! 127! min. Nuclei were prepared with the trueChIP High Cell Chromatin Shearing Kit with SDS
Shearing Buffer (Covaris, Woburn, MA) according to the manufacturer’s recommendations.
Sonication was performed using a Covaris S220 Focused ultrasonicator (Covaris) at 175 pip,
10% output, and 200 bursts for 8 min. Efficient DNA fragmentation was verified by agarose gel electrophoresis. ChIP was performed with 2ug of antibody to H3K27ac (ab4729, Abcam PLC,
Cambridge, UK) in the SX-8G IP-Star Automated System (Diagenode, Liège, Belgium) in RIPA buffer (TE with 0.1% SDS, 1% Triton X-100, 150 mM NaCl, and 0.1% sodium deoxycholate) following the protocol of the manufacturer. Fastq files from the Illumina pipeline were aligned by
Bowtie (version 1.0.0), and unique reads were identified with no more than one error allowed for alignments.50 MACS2 (version 2.0.10.20130712) was used to identify islands of enrichment (q- value threshold less than 0.2) and estimated fragment size. For visualization, data were uploaded to the UCSC Genome Browser.
Patient sample selection. Diagnosis was established based on the maximum eosinophil count of > 15 per 400X high-power field (hpf).13 Normal control (NL) patients were defined as having no history of EoE, 0 eosinophils per hpf in the esophagus at the time of biopsy, and no concomitant swallowed glucocorticoid treatment. EoE patients were defined as having > 15 eosinophils per hpf in the esophagus and no concomitant swallowed glucocorticoid treatment in patients on proton pump inhibitor (PPI) therapy; except for the samples in the microarray experiment.13
Microarray gene expression analysis. For each patient, 1 distal esophageal biopsy sample was immersed in RNAlater (QIAGEN, Hilden, Germany) and total RNA was extracted using the
RNeasy Mini Kit (QIAGEN). Hybridization to human Affymetrix U133 Plus 2.0 GeneChip DNA microarray (Affymetrix, Santa Clara, CA) was performed by the Microarray Core at CCHMC.51
Gene transcript levels were determined following quantification and normalization (normalized to median value) of microarray data using GeneSpring (Agilent Technologies, Santa Clara, CA).
! 128! RNA Sequencing Analysis. RNA isolated from esophageal biopsies or differentiated EPC2s was subjected to RNA sequencing at the Gene Discovery and Genetic Variation Core at
CCHMC.46 The paired-end sequencing reads were aligned against the GRCh37 genome model using TopHat 2.04 with Bowtie 2.03.50,52 The separate alignments were then merged using
Cuffmerge with RefSeq gene models as a reference. The aligned reads were quantified for differential expression analysis using Cuffdiff.53 Normalization and statistical analysis was performed using GeneSpring (Agilent Technologies). qPCR analysis. Total RNA (500 ng) was DNase treated, and complementary DNA was generated using the iScript complementary DNA synthesis kit (Bio-Rad Laboratories, Hercules,
CA). qPCR was performed with the ABI 7900HT Fast Real-Time System (Life Technologies,
Grand Island, NY) and LightCycler FastStart DNA Master SYBR Green as a ready-to-use reaction mix with ROX (Roche, Basel, Switzerland). Relative expression was calculated using a standard curve method, as described.11,54 Results were normalized to GAPDH and fold induction compared with controls. cDNAs were amplified using TaqMan Gene Expression Assay
(Hs00226845_m1) and primers (Integrated DNA Technologies, Coralville, IA) (Supplementary
Table 2.1).55
Primary cell culture. Distal esophageal biopsy specimens from patients with EoE were collected and subsequently digested with trypsin, cultured in modified F-media (3:1 F-
12/Dulbecco Modified Eagle’s medium) supplemented with FBS (5%), adenine (24.2 mg/mL), cholera toxin (1024 mM), insulin (5 mg/mL), hydrocortisone (0.4 mg/mL), and epidermal growth factor (10ng/mL) in the presence of penicillin, streptomycin, and amphotericin (Life
Technologies).42 Cells were cultured for 2 weeks, and fibroblasts were depleted by means of differential trypsinization.
EPC2 cell culture. The esophageal epithelial cell line (human telomerase reverse transcriptase-immortalized EPC2 cell line) was a kind gift from Dr. Anil Rustgi (University of
Pennsylvania, Philadelphia, PA).56-58 EPC2s were cultured in Keratinocyte Serum-Free media
! 129! (Life Technologies) supplemented with bovine pituitary extract, epidermal growth factor, and amphotericin (Life Technologies). For differentiated EPC2 cell cultures, EPC2s were grown to confluence for 2 days while being fully submerged in low-calcium ([Ca2+] = 0.09 mM) supplemented Keratinocyte Serum-Free media on 0.4 µm pore-size permeable supports
(Corning Incorporated, Corning, NY). Confluent monolayers were then switched to high-calcium
([Ca2+] = 1.8 mM) media for an additional 5 days. The culture medium was removed from the inner chamber of the permeable support in order to expose the cell monolayer to the air interface at day 7. Differentiated EPC2s were analyzed 7 days after ALI induction.
Statistical analyses. Statistical significance was determined using a t-test and Χ2 test. Fisher’s method was used to perform the meta-analysis. T-tests were performed using GraphPad Prism
(GraphPad Software Incorporated, La Jolla, CA) and Χ2 test and Fisher’s method were performed using Microsoft Excel (Microsoft Corporation, Redmond, WA).
Study approvals. For human subjects, written informed consent was obtained before a patient’s enrollment in the studies, and all human studies were approved by the CCHMC
Institutional Review Board (IRB protocol 2008-0090). All experiments involving mice were approved by the CCHMC IACUC.
! 130! 3.6. Acknowledgments
This work was supported in part by NIH U19 AI070235, NIH R01 DK076893, the PHS Grant
P30 DK0789392, the Food Allergy Research & Education, the Buckeye Foundation, and the
Campaign Urging Research for Eosinophilic Diseases (CURED) Foundation. We thank Shawna
Hottinger for editorial assistance, all of the participating families and the Cincinnati Center for
Eosinophilic Disorders, and members of the Division of Allergy and Immunology.
! 131! 3.7. References
1 Liacouras, C. A. et al. Eosinophilic esophagitis: updated consensus recommendations
for children and adults. The Journal of allergy and clinical immunology 128, 3-20 e26;
quiz 21-22, doi:10.1016/j.jaci.2011.02.040 (2011).
2 Rothenberg, M. E. Biology and treatment of eosinophilic esophagitis. Gastroenterology
137, 1238-1249, doi:10.1053/j.gastro.2009.07.007 (2009).
3 Collins, M. H. et al. Clinical, pathologic, and molecular characterization of familial
eosinophilic esophagitis compared with sporadic cases. Clin Gastroenterol Hepatol 6,
621-629, doi:10.1016/j.cgh.2008.01.004 (2008).
4 Putnam, P. E. & Rothenberg, M. E. Eosinophilic esophagitis: concepts, controversies,
and evidence. Curr Gastroenterol Rep 11, 220-225 (2009).
5 Abonia, J. P. & Rothenberg, M. E. Eosinophilic esophagitis: rapidly advancing insights.
Annu Rev Med 63, 421-434, doi:10.1146/annurev-med-041610-134138 (2012).
6 Davis, B. P. & Rothenberg, M. E. Emerging concepts of dietary therapy for pediatric and
adult eosinophilic esophagitis. Expert Rev Clin Immunol 9, 285-287,
doi:10.1586/eci.13.15 (2013).
7 Rothenberg, M. E. et al. Working with the US Food and Drug Administration: progress
and timelines in understanding and treating patients with eosinophilic esophagitis. The
Journal of allergy and clinical immunology 130, 617-619, doi:10.1016/j.jaci.2012.06.051
(2012).
8 Alexander, E. S. et al. Twin and family studies reveal strong environmental and weaker
genetic cues explaining heritability of eosinophilic esophagitis. The Journal of allergy and
clinical immunology 134, 1084-1092 e1081, doi:10.1016/j.jaci.2014.07.021 (2014).
9 Rothenberg, M. E. et al. Common variants at 5q22 associate with pediatric eosinophilic
esophagitis. Nature genetics 42, 289-291, doi:10.1038/ng.547 (2010).
! 132! 10 Sherrill, J. D. et al. Variants of thymic stromal lymphopoietin and its receptor associate
with eosinophilic esophagitis. The Journal of allergy and clinical immunology 126, 160-
165 e163, doi:10.1016/j.jaci.2010.04.037 (2010).
11 Zuo, L. et al. IL-13 induces esophageal remodeling and gene expression by an
eosinophil-independent, IL-13R alpha 2-inhibited pathway. J Immunol 185, 660-669,
doi:10.4049/jimmunol.1000471 (2010).
12 Blanchard, C. et al. Coordinate interaction between IL-13 and epithelial differentiation
cluster genes in eosinophilic esophagitis. J Immunol 184, 4033-4041,
doi:10.4049/jimmunol.0903069 (2010).
13 Blanchard, C. et al. Eotaxin-3 and a uniquely conserved gene-expression profile in
eosinophilic esophagitis. The Journal of clinical investigation 116, 536-547,
doi:10.1172/JCI26679 (2006).
14 McAleer, M. A. & Irvine, A. D. The multifunctional role of filaggrin in allergic skin disease.
The Journal of allergy and clinical immunology 131, 280-291,
doi:10.1016/j.jaci.2012.12.668 (2013).
15 Fallon, P. G. et al. A homozygous frameshift mutation in the mouse Flg gene facilitates
enhanced percutaneous allergen priming. Nature genetics 41, 602-608,
doi:10.1038/ng.358 (2009).
16 Batra, J. et al. A hexanucleotide repeat upstream of eotaxin gene promoter is associated
with asthma, serum total IgE and plasma eotaxin levels. J Med Genet 44, 397-403,
doi:10.1136/jmg.2006.046607 (2007).
17 Kottyan, L. C. et al. Genome-wide association analysis of eosinophilic esophagitis
provides insight into the tissue specificity of this allergic disease. Nature genetics 46,
895-900, doi:10.1038/ng.3033 (2014).
! 133! 18 Bonnelykke, K. et al. Meta-analysis of genome-wide association studies identifies ten
loci influencing allergic sensitization. Nature genetics 45, 902-906, doi:10.1038/ng.2694
(2013).
19 Amaral, A. F. et al. The locus C11orf30 increases susceptibility to poly-sensitization.
Allergy 70, 328-333, doi:10.1111/all.12557 (2015).
20 Ollendorff, V., Noguchi, T., deLapeyriere, O. & Birnbaum, D. The GARP gene encodes a
new member of the family of leucine-rich repeat-containing proteins. Cell Growth Differ
5, 213-219 (1994).
21 Wang, R., Wan, Q., Kozhaya, L., Fujii, H. & Unutmaz, D. Identification of a regulatory T
cell specific cell surface molecule that mediates suppressive signals and induces Foxp3
expression. PLoS One 3, e2705, doi:10.1371/journal.pone.0002705 (2008).
22 Stockis, J., Colau, D., Coulie, P. G. & Lucas, S. Membrane protein GARP is a receptor
for latent TGF-beta on the surface of activated human Treg. Eur J Immunol 39, 3315-
3322, doi:10.1002/eji.200939684 (2009).
23 Tran, D. Q. et al. GARP (LRRC32) is essential for the surface expression of latent TGF-
beta on platelets and activated FOXP3+ regulatory T cells. Proc Natl Acad Sci U S A
106, 13445-13450, doi:10.1073/pnas.0901944106 (2009).
24 Wang, R. et al. GARP regulates the bioavailability and activation of TGFbeta. Mol Biol
Cell 23, 1129-1139, doi:10.1091/mbc.E11-12-1018 (2012).
25 Fuentebella, J. et al. Increased number of regulatory T cells in children with eosinophilic
esophagitis. J Pediatr Gastroenterol Nutr 51, 283-289,
doi:10.1097/MPG.0b013e3181e0817b (2010).
26 Tantibhaedhyangkul, U., Tatevian, N., Gilger, M. A., Major, A. M. & Davis, C. M.
Increased esophageal regulatory T cells and eosinophil characteristics in children with
eosinophilic esophagitis and gastroesophageal reflux disease. Ann Clin Lab Sci 39, 99-
107 (2009).
! 134! 27 Zhu, X., Wang, M., Crump, C. H. & Mishra, A. An imbalance of esophageal effector and
regulatory T cell subsets in experimental eosinophilic esophagitis in mice. Am J Physiol
Gastrointest Liver Physiol 297, G550-558, doi:10.1152/ajpgi.00148.2009 (2009).
28 Frischmeyer-Guerrerio, P. A. et al. TGFbeta receptor mutations impose a strong
predisposition for human allergic disease. Sci Transl Med 5, 195ra194,
doi:10.1126/scitranslmed.3006448 (2013).
29 Madjd, Z. et al. Expression of EMSY, a novel BRCA2-link protein, is associated with
lymph node metastasis and increased tumor size in breast carcinomas. Asian Pac J
Cancer Prev 15, 1783-1789 (2014).
30 Cousineau, I. & Belmaaza, A. EMSY overexpression disrupts the BRCA2/RAD51
pathway in the DNA-damage response: implications for chromosomal
instability/recombination syndromes as checkpoint diseases. Mol Genet Genomics 285,
325-340, doi:10.1007/s00438-011-0612-5 (2011).
31 Brown, L. A. et al. Amplification of EMSY, a novel oncogene on 11q13, in high grade
ovarian surface epithelial carcinomas. Gynecol Oncol 100, 264-270,
doi:10.1016/j.ygyno.2005.08.026 (2006).
32 Benusiglio, P. R. et al. Common variation in EMSY and risk of breast and ovarian
cancer: a case-control study using HapMap tagging SNPs. BMC Cancer 5, 81,
doi:10.1186/1471-2407-5-81 (2005).
33 Vire, E. et al. The breast cancer oncogene EMSY represses transcription of
antimetastatic microRNA miR-31. Mol Cell 53, 806-818,
doi:10.1016/j.molcel.2014.01.029 (2014).
34 Singh, R. et al. Calpain 5 is highly expressed in the central nervous system (CNS),
carries dual nuclear localization signals, and is associated with nuclear promyelocytic
leukemia protein bodies. J Biol Chem 289, 19383-19394, doi:10.1074/jbc.M114.575159
(2014).
! 135! 35 Franz, T., Winckler, L., Boehm, T. & Dear, T. N. Capn5 is expressed in a subset of T
cells and is dispensable for development. Mol Cell Biol 24, 1649-1654 (2004).
36 Mahajan, V. B. et al. Calpain-5 mutations cause autoimmune uveitis, retinal
neovascularization, and photoreceptor degeneration. PLoS Genet 8, e1003001,
doi:10.1371/journal.pgen.1003001 (2012).
37 Sleiman, P. M. et al. GWAS identifies four novel eosinophilic esophagitis loci. Nat
Commun 5, 5593, doi:10.1038/ncomms6593 (2014).
38 International HapMap, C. et al. Integrating common and rare genetic variation in diverse
human populations. Nature 467, 52-58, doi:10.1038/nature09298 (2010).
39 Rochman, M. et al. Neurotrophic tyrosine kinase receptor 1 is a direct transcriptional and
epigenetic target of IL-13 involved in allergic inflammation. Mucosal immunology 8, 785-
798, doi:10.1038/mi.2014.109 (2015).
40 Weirauch, M. T. et al. Determination and inference of eukaryotic transcription factor
sequence specificity. Cell 158, 1431-1443, doi:10.1016/j.cell.2014.08.009 (2014).
41 Hershey, G. K. IL-13 receptors and signaling pathways: an evolving web. The Journal of
allergy and clinical immunology 111, 677-690; quiz 691 (2003).
42 Blanchard, C. et al. IL-13 involvement in eosinophilic esophagitis: transcriptome analysis
and reversibility with glucocorticoids. The Journal of allergy and clinical immunology 120,
1292-1300, doi:10.1016/j.jaci.2007.10.024 (2007).
43 Fu, X. et al. Histone H3k9 and H3k27 Acetylation Regulates IL-4/STAT6-Mediated
Igepsilon Transcription in B Lymphocytes. Anat Rec (Hoboken) 298, 1431-1439,
doi:10.1002/ar.23172 (2015).
44 Feldman, S. et al. Constraints contributed by chromatin looping limit recombination
targeting during Ig class switch recombination. J Immunol 194, 2380-2389,
doi:10.4049/jimmunol.1401170 (2015).
! 136! 45 Mishra, A. & Rothenberg, M. E. Intratracheal IL-13 induces eosinophilic esophagitis by
an IL-5, eotaxin-1, and STAT6-dependent mechanism. Gastroenterology 125, 1419-
1427 (2003).
46 Sherrill, J. D. et al. Desmoglein-1 regulates esophageal epithelial barrier function and
immune responses in eosinophilic esophagitis. Mucosal immunology 7, 718-729,
doi:10.1038/mi.2013.90 (2014).
47 Eschborn, M. et al. Activated glycoprotein A repetitions predominant (GARP)-expressing
regulatory T cells inhibit allergen-induced intestinal inflammation in humanized mice. The
Journal of allergy and clinical immunology 136, 159-168, doi:10.1016/j.jaci.2015.04.020
(2015).
48 Purcell, S. et al. PLINK: a tool set for whole-genome association and population-based
linkage analyses. Am J Hum Genet 81, 559-575, doi:10.1086/519795 (2007).
49 Pruim, R. J. et al. LocusZoom: regional visualization of genome-wide association scan
results. Bioinformatics 26, 2336-2337, doi:10.1093/bioinformatics/btq419 (2010).
50 Langmead, B., Trapnell, C., Pop, M. & Salzberg, S. L. Ultrafast and memory-efficient
alignment of short DNA sequences to the human genome. Genome Biol 10, R25,
doi:10.1186/gb-2009-10-3-r25 (2009).
51 Zimmermann, N. et al. Dissection of experimental asthma with DNA microarray analysis
identifies arginase in asthma pathogenesis. The Journal of clinical investigation 111,
1863-1874, doi:10.1172/JCI17912 (2003).
52 Trapnell, C. et al. Differential analysis of gene regulation at transcript resolution with
RNA-seq. Nature biotechnology 31, 46-53, doi:10.1038/nbt.2450 (2013).
53 Garber, M., Grabherr, M. G., Guttman, M. & Trapnell, C. Computational methods for
transcriptome annotation and quantification using RNA-seq. Nature methods 8, 469-477,
doi:10.1038/nmeth.1613 (2011).
! 137! 54 Pfaffl, M. W. A new mathematical model for relative quantification in real-time RT-PCR.
Nucleic acids research 29, e45 (2001).
55 Wen, T. et al. Molecular diagnosis of eosinophilic esophagitis by gene expression
profiling. Gastroenterology 145, 1289-1299, doi:10.1053/j.gastro.2013.08.046 (2013).
56 Andl, C. D. et al. Epidermal growth factor receptor mediates increased cell proliferation,
migration, and aggregation in esophageal keratinocytes in vitro and in vivo. The Journal
of biological chemistry 278, 1824-1830, doi:10.1074/jbc.M209148200 (2003).
57 Harada, H. et al. Telomerase induces immortalization of human esophageal
keratinocytes without p16INK4a inactivation. Molecular cancer research : MCR 1, 729-
738 (2003).
58 Oyama, K. et al. AKT induces senescence in primary esophageal epithelial cells but is
permissive for differentiation as revealed in organotypic culture. Oncogene 26, 2353-
2364, doi:10.1038/sj.onc.1210025 (2007).
! 138! 3.8. FIGURES a b Allergic EoE Asthma EoE Rhinitis
7 2 26 8 1 0
5q22 11q13 11q13
c Atopic d Celiac EoE Dermatitis EoE Disease
8 1 16 7 2 31
11q13 2p23 21q22
Figure 3.1 | Shared genetic associations between allergic and inflammatory diseases. Venn diagrams showing shared genetic associations between EoE and (a) Asthma, (b) Allergic Rhinitis, (c) Atopic Dermatitis, and (d) Celiac Disease with the common shared locus, 11q13, bolded. Meta-analysis done comparing single nucleotide polymorphisms (SNPs) reaching genome-wide significance ( P < 1x10-8).
139 a C11ORF 30 LRRC32 CAPN5
Chr 11 76.2 Mb 76.3 Mb 76.4 Mb 76.5 Mb 76.6 Mb 76.8 Mb
Atopic Dermatitis EoE Asthma Allergic Sensitization Allergic Rhinitis Allergic Sensitization Self-Reported Allergy Ulcerative Colitis Inflammatory Bowel Disease
Crohn’s Disease
b C11ORF30 LRRC32 Chr 11 76.2 Mb 76.3 Mb 76.4 Mb
rs7130588 Atopic Dermatitis Asthma EoE rs11236809 Atopic Dermatitis EoE rs2155219 Allergic Sensitization rs79279894 Inflammatory Bowel Disease Atopic Dermatitis Allergic Rhinitis Crohn’s Disease EoE EoE
Figure 3.2 | Chromosome 11q13 genetic associations with allergic and inflammatory diseases. a, Haplotype analysis with linkage disequilibrium of genetic associations for different allergic and inflammatory diseases within the chromosome 11q13 locus plotted. b, Identification of specific single nucleotide polymorphisms (SNPs) in linkage disequilibrium between the genes LRRC32 and C11ORF30, located on chromosome 11q13, that have genetic associations with allergic and inflammatory diseases.
140 Table 3.1: Allele frequency and odds ratio (OR) at rs2155219. Study SNP MAF EoE/MAF NL P value OR Kottyan, et al. 2014 rs2155219 0.412/0.491 3.65x10-7 0.73 Independent Cohort rs2155219 0.405/0.554 0.067 0.55 Meta-Analysis rs2155219 0.412/0.493 3.21x10-9 0.72 Table 3.1 | Allele frequency and odds ratio (OR) at rs2155219. Table reporting minor allele frequency (MAF, T allele at rs2155219), P values (Fisher’s method), and odds ratio at rs2155219 for published GWAS (Kottyan, et al. 2014; NL n = 9,246, EoE n = 736), independent cohort (NL n = 42, EoE n = 369), and meta-analysis of combined data.
141 Scale 50 kb hg19 a chr11: 76,240,000 76,250,000 76,260,000 76,270,000 76,280,000 76,290,000 76,300,000 76,310,000 76,320,000 76,330,000 76,340,000 76,350,000 76,360,000 76,370,000 76,380,000 User Supplied Track H3K27ac marks induced by IL-13 RefSeq Genes C11orf30 LRRC32 C11orf30 LRRC32 C11orf30 C11orf30 NHGRI Catalog of Published Genome-Wide Association Studies rs7130588 rs2155219 rs11236809 rs7130588 rs2155219 rs2155219 rs2155219 rs2155219 rs2155219 rs7927894 rs7927894 rs7927997 100 _ H3K27Ac Mark (Often Found Near Active Regulatory Elements) on 7 cell lines from ENCODE Layered H3K27Ac 0 _ DNaseI Hypersensitivity Clusters in 125 cell types from ENCODE (V3) DNase Clusters Transcription Factor ChIP-seq (161 factors) from ENCODE with Factorbook Motifs Txn Factor ChIP Simple Nucleotide Polymorphisms (dbSNP 141) All SNPs(141) Repeating Elements by RepeatMasker RepeatMasker UCSC Genes (RefSeq, GenBank, CCDS, Rfam, tRNAs & Comparative Genomics)
b Scale 20 bases hg19 chr11: 76,299,160 76,299,170 76,299,180 76,299,190 76,299,200 76,299,210 76,299,220 76,299,230 ---> ATTAATATGAATAGAGCAGATTCCTTTGAGTTAATATTTGTCTGGGGTGTTTTATTTCATCCACTGACTTCTAACTTTTCTGTGTTCTTA Perfect Matches to Short Sequence (AGATTCCTTTGAG) +76,299,166Putative STAT6 Binding Site NHGRI Catalog of Published Genome-Wide Association Studies rs2155219 rs2155219 rs2155219 rs2155219 rs2155219 Figure 3.3 | Epigenetic and transcriptional landscapers2155219 at rs2155219. a. Genome browser image showing Simple Nucleotide Polymorphisms (dbSNP 138) Found in >= 1% of Samples User Supplied track of chromatin Immunoprecipitation-sequencingrs2155219 (ChIP-seq) of H3K27Acrs10219259 epigenetic peaks in TE-7 cells treated with IL-13 (100 ng/mL, 24 hours) with activation peak of interest indicated with red box (see Supplementary Table 1 for raw data). RefSeq Genes track shows C11ORF30 and LRRC32 with black arrows indicating direction of transcription. NHGRI Catalog of Published Genome-Wide Association Studies track shows rs2155219. H3K27Ac peaks track shows encyclopedia of DNA elements (ENCODE) ChIP-seq data with active regulatory elements indicated with blue box. DNase Hypersensitivity Clusters track and Transcription (Txn) Factor ChIP-seq track also show open chromatin corresponding to H3K27Ac peaks, indicated with black rectangles. All tracks except User Supplied track retrieved from UCSC Genome Browser and ENCODE. b. Genome browser image showing Perfect Matches to Short Sequence AGATTCCTTTGAG, which is predicted putative STAT6 binding site, near rs2155219 indicated with black rectangle. NHGRI Catalog of Published Genome-Wide Association Studies track shows rs2155219.
142 a LRRC32 b C11ORF30 c CAPN5 1.0 NS 2 NS 2 ***
1 0.5 1 0 0.0 0 -1 -0.5 -1 -2 Normalized Expression Normalized Expression Normalized Expression -1.0 -2 -3 NL EoE NL EoE NL EoE
Figure 3.4 | Expression of LRRC32, C11ORF30, and CAPN5 mRNA in the esophagus. Normalized esophageal mRNA expression of (a) LRRC32, (b) C11ORF30, and (c) CAPN5 from normal control patients (NL; n = 14) or patients with active EoE (n = 18), by microarray gene expression analysis. For a-c, data points represent individual subjects and data are represented as the mean ± SEM. NS, not significant; ***P < 0.001.
143 a LRRC32 b C11ORF30 c CAPN5 0.1 0.1 NS 0.1 NS NS NS NS NS NS NS *
0.01 NL 0.01 0.001 CAPN5/GAPDH LRRC32/GAPDH C11ORF30/GAPDH
0.0001 0.001 0.01 T/T T/G G/G T/T T/G G/G T/T T/G G/G Genotype Genotype Genotype
d LRRC32 e C11ORF30 f CAPN5 -5 -4 -3 10 10 NS 10 NS * NS NS NS NS NS NS 10-4 10-6 10-5 10-5 EoE 10-7 10-6 10-6 10-7
-8 -7 CAPN5/GAPDH LRRC32/GAPDH
10 C11orf30/GAPDH 10 10-8
10-9 10-8 10-9 T/T T/G G/G T/T T/G G/G T/T T/G G/G Genotype Genotype Genotype
Figure 3.5 | Expression of LRRC32, C11ORF30, and CAPN5 mRNA in the esophagus of genotyped patients. Normalized esophageal mRNA expression of (a) LRRC32, (b) C11ORF30, and (c) CAPN5 from NL patients (n = 41) stratified by rs2155219 genotypes of T/T, T/G, and G/G, by qPCR analysis. Normalized esophageal mRNA expression of (d) LRRC32, (e) C11ORF30, and (f) CAPN5 from EoE patients (n = 79) stratified by rs2155219 genotypes of T/T, T/G, and G/G, by qPCR analysis. For a-f, data points represent individual subjects and data are represented as the mean ± SEM. NS, not significant; *P < 0.05.
144 a LRRC32 b C11ORF30 c CAPN5 0.5 NS 0.4 NS 0.2 NS
0.3 0.0 0.0 0.2 -0.2 Primary -0.5 0.1 -0.4 Cells 0.0 -0.6 -1.0 -0.1 -0.8 Normalized Expression Normalized Expression Normalized Expression -1.5 -0.2 -1.0 Control IL-13 Control IL-13 Control IL-13
d ±IL-13 High-Calcium ALI Media
Day 0 2 7 8 14
Day 2 Day 7 Day 14
e LRRC32 f C11ORF30 g CAPN5 4 3 8 *** * ** NS * NS * *** ** 3 6 2 EPC2 2 4 FPKM FPKM FPKM Cells 1 1 2
0 0 0 Day 7 Day 14 Day 14 Day 7 Day 14 Day 14 Day 7 Day 14 Day 14 Control IL-13 Control IL-13 Control IL-13
Figure 3.6 | Expression of LRRC32, C11ORF30, and CAPN5 mRNA in epithelial cells. Primary esophageal epithelial cell normalized mRNA expression of (a) LRRC32, (b) C11ORF30, and (c) CAPN5 following IL-13 treatment (100 ng/mL), by microarray gene expression analysis. d. Differentiated EPC2 esophageal epithelial cells were grown for 12 days in high-calcium media. Cells were brought to the ALI starting at day 7, and ±IL-13 treatment (100 ng/mL) started at day 8. c, Hematoxylin and eosin (H&E)-stained sections of differentiated EPC2s at day 14. Stratum corneum (SC, pink layer) and stratum germinativum (SG, purple layer) are indicated. A representative experiment is shown (n = 3). Scale bar represents 20 µm. Differentiated EPC2 esophageal epithelial cell normalized mRNA expression of (e) LRRC32, (f) C11ORF30, and (g) CAPN5 at Day 7, before differentiation at the air-liquid interface (ALI), or at Day 14, following ALI induced differentiation and with IL-13 treatment (100 ng/ml for 6 days), by RNA sequencing analysis. For a-c, data collected in triplicate, n = 1. For e-g, data collected in triplicate, n = 1. For a-f data are represented as the mean ± SEM. NS, not significant; *P < 0.05, ** P < 0.01, ***P < 0.001.
145 Supplementary Figure 3.1 | Roadmap Epigenomics prediction for rs2155219. Genome browser showing Roadmap Epigenomics data at rs2155219 with the following active layers: gene track, Chromatin Interaction Analysis Paired-End Tags (ChIA-PET) retrieved from ENCODE, Chromatin State Segmentation by Hidden Markov Model (HMM) retrieved from ENCODE, DNaseI Hypersensitivity Clusters retrieved from ENCODE, H3K4Me1 marks retrieved from ENCODE, and DNaseI Digital Genomics Footprinting retrieved from ENCODE.
146 Supplementary Table 3.1
Gene ID Chr Start End -Log10 P value Region C11orf30 chr11 76154563 76156665 17.25 promoter C11orf30 chr11 76154563 76156665 63.62 promoter C11orf30 chr11 76156836 76157309 9.66 promoter LRRC32 chr11 76285892 76286132 6.92 intergenic LRRC32 chr11 76286924 76292054 27.34 intergenic LRRC32 chr11 76286924 76292054 45.78 intergenic LRRC32 chr11 76286924 76292054 69.78 intergenic LRRC32 chr11 76286924 76292054 69.78 intergenic LRRC32 chr11 76286924 76292054 67.72 intergenic LRRC32 chr11 76286924 76292054 69.78 intergenic LRRC32 chr11 76286924 76292054 23.88 intergenic LRRC32 chr11 76286924 76292054 47.71 intergenic LRRC32 chr11 76286924 76292054 49.65 intergenic LRRC32 chr11 76286924 76292054 43.86 intergenic LRRC32 chr11 76292090 76295196 9.66 intergenic LRRC32 chr11 76292090 76295196 14.11 intergenic LRRC32 chr11 76292090 76295196 25.59 intergenic LRRC32 chr11 76292090 76295196 36.34 intergenic LRRC32 chr11 76292090 76295196 51.61 intergenic LRRC32 chr11 76292090 76295196 76.03 intergenic LRRC32 chr11 76292090 76295196 36.34 intergenic LRRC32 chr11 76292090 76295196 12.59 intergenic Supplementary Table 3.1 | H3K27Ac peaks from ChIP-seq on TE-7 cells treated with IL-13. Table listing peaks identified from H3K27Ac ChIP-seq on TE-7 cells treated with IL-13.
147 Supplementary,Table,3.2, Gene Forward Primer Reverse Primer Amplicon (bases) GAPDH TGGAAATCCCATCACCATCT GTCTTCTGGGTGGCAGTGAT 351 LRRC32 GCAAAATGTGCCGAGACTG GTCTTGGTGTTGTGCAGCC 122 C110ORF30 ACAGAAGCAGCAATGCCTGT GCCCGAAGTGCACTGATAAC 122 CAPN5 GCAGCCTGCTCGTCACTT AGTGGAAGTGGAAGATGCCC 121 Supplementary Table 3.2 | Primers for qPCR. Primers used for qPCR analysis evaluating mRNA expression of GAPDH, LRRC32, C11ORF30, and CAPN5.
148 CHAPTER 4: GENERAL DISCUSSION AND SUMMARY
4.1. Introduction
The primary aim of this dissertation was to determine the role of leucine-rich repeat–containing protein 31 (LRRC31) in allergic disease. We determined that LRRC31 was induced by the T helper type 2 (Th2) cytokine interleukin 13 (IL-13), regulated epithelial barrier function in the esophagus, and inversely regulated kallikrein (KLK) protease expression, specifically in the context of eosinophilic esophagitis (EoE). We also identified a single nucleotide polymorphism
(SNP), rs2155219 on chromosome 11q13, which associated with EoE and possibly regulates the expression of leucine-rich repeat–containing protein 32 (LRRC32). LRRC32 regulates TGF-
β signaling, and TGF-β was increased in the esophagus of EoE patients and may have a role in disease pathogenesis.1-3 Together, these two leucine-rich repeat (LRR) proteins may be important for allergic disease. The studies described herein demonstrate that:
For LRRC31:-
- LRRC31 is expressed in the colon and was increased in the esophagus in EoE.
- Levels of LRRC31 reflect disease activity, and correlate with esophageal eosinophilia
and EoE-associated gene expression levels.
- IL-13 induced LRRC31 in epithelial cells.
- LRRC31 overexpression increased epithelial barrier function by decreasing KLK
activity, while gene-silencing of LRRC31 increased KLK expression.
- KLK expression was altered in EoE and IL-13–treated epithelial cells.
For LRRC32:-
- Chromosome 11q13 is a shared genetic association with EoE, asthma, allergic
rhinitis, and atopic dermatitis.
- Chromosome 11q13 encodes three genes of interest that may be related to allergic
inflammatory disease: LRRC32, chromosome 11 open reading frame 30
(C11ORF30), and calpain 5 (CAPN5).
! 149 - The intergenic SNP rs2155219 on chromosome 11q13 associated with EoE and is
between the genes LRRC32 and C11ORF30.
- Rs2155219 is a predicted transcription enhancer with a putative binding site for
signal transducer and activator of transcription 6 (STAT6) 15 bases away.
- EoE patients with the minor allele at rs2155219 have increased esophageal
expression of LRRC32 mRNA.
The implications of these collective findings are summarized and further discussed below.
! 150 4.2. LRRC31
4.2.1. Identification of LRRC31
We first identified LRRC31 as a gene of interest following microarray gene expression studies.
In these studies we observed that LRRC31 mRNA expression was increased in both the esophagus of patients with active EoE and in IL-13–treated esophageal epithelial cells, when compared to controls, by microarray gene expression analysis.4,5 However there were no publications on LRRC31 and its function was unknown. The possibility that this molecule contributed to EoE, specifically the esophageal epithelial IL-13–response and pathogenesis, was intriguing and we proceeded to investigate the expression and function of LRRC31.
Initially, we identified publicly available information on LRRC31. LRRC31 is located on chromosome 3 in the q26.2 locus and was first identified as encoding the hypothetical protein
FLJ23259.6 LRRC31 has 10 exons resulting in 3 major splice variants with differential exon usage. The mouse ortholog Lrrc31 is located on chromosome 3 in the A3 locus and also has 3 major splice variants. Both human and mouse LRRC31 proteins have 3 isoforms resulting in differential domain usage. The primary isoform of LRRC31 protein consists of 9 leucine-rich repeat (LRR) domains, which are 20-29 residues long and contain a conserved 11-residue
N segment with the consensus sequence LxxLxLxx /CxL, where x is any amino acid and L is a leucine, valine, isoleucine, or phenylalanine.7 Interestingly, the primary isoform of human and mouse LRRC31 proteins are 62% similar, suggesting that function is conserved. Further phylogenetic analysis using known sequences for LRRC31 from different species retrieved from the NCBI Gene database show LRRC31 proteins are conserved from humans through bony fish, further suggesting an important function for this molecule.
We investigated other proteins that are homologous to LRRC31 and identified ribonuclease/angiogenin inhibitor 1 (RNH1) as having the closest homology score to LRRC31
! 151 (score = 224; E value = 1 x 10-19). RNH1 inhibits ribonuclease activity, complexing with its target ribonucleases to render them inactive in some of the tightest known biomolecular interactions, a process mediated by LRRs.8 The structure of RNH1 is also interesting, being characterized by alternating units of α-helix and β-strand that form a horseshoe shape with a hydrophobic protein-binding pocket.8 We showed that structural predictions for LRRC31 are similar to the known structure of RNH1, having a horseshoe shape with a hydrophobic binding pocket. Interestingly, RNH1 functions beyond ribonuclease inhibition, regulating microRNA
(miRNA) biogenesis and epithelial-to-mesenchymal transition (EMT).9,10 RNH1 binds Drosha, the ribonuclease III enzyme that executes the initiation step of miRNA processing, and specifically for miR-21, interrupts this interaction by phosphate and tensin homolog (PTEN).9
MiR-21 was upregulated in esophageal biopsies of patients with EoE compared to normal controls (NL), and regulated the balance between the T helper type 1 (Th1) and Th2 immune response by targeting IL-12p35 expression.11 Overexpressing RNH1 in melanoma cells and in a mouse model of melanoma suppressed EMT, increased expression of E-cadherin, and decreased the expression of EMT–associated proteins N-cadherin, snail, slug, vimentin, and twist.10 However, the underlying mechanism by which RNH1 regulates EMT gene expression is not fully understood.10 Furthermore, overexpressing RNH1 inhibited cell proliferation, migration, and invasion of cells, changing cell morphology, adhesion, and rearranging the cytoskeleton in vitro, and suppressing metastasis by the experimental metastasis models of melanoma in vivo.10 In EoE, EMT may be contributing to esophageal remodeling and epithelial pathology.2,3
Taken together, these findings suggest that RNH1 functions as a molecular adaptor, regulating important cellular processes, and LRRC31 may have similar functions. However, this is less likely since ribonuclease inhibitor 2 (RNH2) was structurally similar to RNH1 but was characterized as a regulator of the inflammasome and renamed NLR family, pyrin domain containing 4 (NLRP4). This example shows that structural similarity may not translate into functional similarity.
! 152
LRRC31 also shared homology with other LRR proteins such as LRRC32, LRRC34, the NLRP family of inflammasome proteins, antigen-sensing and immune-activating toll-like receptors
(TLRs), and adaptor proteins involved in ubiquitination and post-translational regulation of signaling pathways, such as flightless 1 homolog (FLII).
LRRC32 is a transmembrane protein expressed on the surface of activated T regulatory (Treg) cells that regulates the expression of FOXP3, the primary transcription factor driving Treg differentiation, and modulates the local bioavailability of TGF-β by binding latent TGF-β.1 TGF-β and its signaling pathway were genetically associated with EoE in genome-wide association studies (GWAS) and there was increased TGF-β in the esophagus of EoE patients compared to
NL, suggesting that TGF-β is important for EoE pathogenesis.2,3,12 LRRC31 is less likely to be functionally similar to LRRC32 because LRRC31 is intracellular while LRRC32 is a transmembrane protein. In addition, LRRC31 has 9 LRRs while LRRC32 has 20 LRRs. LRRC34 is expressed in pluripotent stem cells and may have a role in ribosomal biogenesis, though a mechanism has not proposed.13 LRRC31 is less likely to be functionally similar to LRRC34 because LRRC34 has only 2 LRRs. NLRPs modulate the initial immune response to pathogens, regulating inflammation by activating caspase-dependent apoptosis and caspase-independent necrotic cell death.14 Unfortunately, the role of NLRPs in EoE has not been characterized at this time and LRRC31 is less likely to be functionally similar to NLRPs because it lacks the NLR domain of the NLRPs. TLRs bind pathogen-associated molecular patterns (PAMPs), activate immune responses, and are essential for inhibiting pathogen dissemination.15 The extracellular ectodomain of TLRs contained LRRs that form an arc (fewer LRRs) or horseshoe (more LRRs) shape, and recognize and bind PAMPs such as lipopolysaccharides, lipopeptides, nucleotides, and bacterial flagellins.15 Activation of TLR3 induces expression of TSLP mRNA and genetic associations between TLR6 and allergic diseases have been reported.16,17 LRRC31 is less likely
! 153 to be a member of the TLR family because it is intracellular without a transmembrane domain.
FLII is a LRR protein that functions as an adapter protein, participating in protein-protein interactions and having important functions in inflammation and wound healing. FLII interacts with TLR-binding proteins, binding to MyD88 and suppressing TLR4-MyD88-mediated activation of NF-κB, and binding LPS to reduce macrophage alteration and cytokine secretion.18-20 In addition, FLII binds caspase-1 and inhibits NLRP3 inflammasome activation.21 FLII was a member of the gelsolin family of actin-binding proteins and regulated wound healing by mediating cellular adhesion, hemisdesmosome structure, and collagen deposition.22-24 Finally, a preliminary report showed that FLII modulated chromatin accessibility of the estrogen receptor
α, suggesting a function in regulating gene expression.25 Taken together, FLII regulates wound healing and inflammation by transducing cell-signaling events into cytoskeletal remodeling and links different signaling pathways with the actin cytoskeleton. LRRC31 may have a function similar to FLII. We hypothesize that LRRC31 functions as an adapter protein participating in protein-protein interactions to regulate signaling pathways in allergic inflammation. We will test this hypothesis by using immunoprecipitation to determine if LRRC31 participates in protein- protein interactions.
In order to determine if LRRC31 participated in protein-protein interactions and to identify interacting partners, we will use immunoprecipitation followed by mass spectrometry. In preliminary experiments, we overexpressed LRRC31 with a flag-epitope in EPC2 cells and performed flag-affinity immunoprecipitation on lysates from EPC2 cells that were differentiated at the air-liquid interface (ALI) and treated with IL-13. The elution from the immunoprecipitation was analyzed by silver stain to identify differential protein bands and to asses quality of immunoprecipitation, followed by liquid chromatography with tandem mass spectrometry (LC-
MS/MS) to identify specific proteins. We conducted a preliminary experiment using HEK 293T cells that were overexpressing LRRC31 with a flag-epitope in EPC2 cells, performed flag-affinity
! 154 immunoprecipitation on lysates followed by LC-MS/MS, and identified 6 proteins that were interacting with LRRC31 (Table 4.1). Four of the 6 proteins identified, arginine N- methyltransferase 5 (PRMT5), 6-phosphofructo-2-kinase/fructose-2,6-bisphosphatase 3
(PFKFB3), TGF-β-activated kinase 1 and MAP3K7 binding protein 1 (TAB1), and heterogeneous nuclear ribonucleaoprotein H1 (HNRNPH1), have functions that may be related to cell signaling. PRMT5 is the major type II symmetric arginine methyltransferase that regulates transcription and signal transduction to control cell proliferation and development.26 PRMT5 is a potential candidate for protein-protein interactions with LRRC31 and has diverse functions regulating the activity of other proteins including chromatin remodelers, co-repressors, transcription factors and co-activators, and developmental regulators.26 PFKFB3 produces fructose 2,6-bisphosphate (F-2,6-BP), which serves as a switch to activate phosphofructokinase-1, a rate-limiting glycolytic enzyme.27 Furthermore, PFKFB3 promotes cell cycle progression, suppresses apoptosis, and is regulated by PTEN and by differential methylation by the PRMT-family of methyl transferases.28 TAB1 is a key regulator of TAK1, which is essential in TNFα and IL-1β-mediated activation of nuclear factor κB (NF-κB), c-Jun N- kinase (JNK), and p38, all regulators of the inflammatory response.29 HNRNPH1 is a heterogeneous RNA binding protein that complexes with pre-mRNAs in the nuclease and influences RNA processing, metabolism, and transport.30 Validation and reproduction of these results by co-immunoprecipitation are necessary in a primary culture system treated with IL-13, in esophageal biopsies, and in ALI differentiated EPC2 cells treated with IL-13.
An additional candidate protein that may interact with LRRC31 is tripartite motif–containing 31
(TRIM31), a RING finger, B-box, and coiled-coil domain (RBCC) E3 ubiquitin ligase that correlated with LRRC31 mRNA expression in global tissue expression datasets (correlation =
0.91) and was also increased in LRRC31 overexpressing EPC2 cells differentiated at the ALI.
The co-regulation of LRRC31 and TRIM31 mRNA expression suggests a shared pathway or
! 155 interaction and we hypothesize that LRRC31 was co-expressed with TRIM31. TRIM31 was involved in the antiviral response and in cellular proliferation, negatively regulating anchorage- independent growth of cells in the gastrointestinal epithelium.31-33 To test this hypothesis, we will determine if LRRC31 interacts with TRIM31 by co-immunoprecipitation followed by characterizing the function of TRIM31 in the esophageal epithelium using overexpressing and gene-silenced TRIM31 EPC2 cells differentiated at the ALI and treated with IL-13. We expect that TRIM31 overexpressing EPC2 cells will have increased barrier function, similar to LRRC31 overexpressing EPC2 cells.
Taken together, LRR proteins functioned in protein-protein interactions, with some having specific functions related to immunity. Therefore, we hypothesize that LRRC31 functions as an adaptor protein similar to FLII, involved in protein-protein interactions with regulators of cell proliferation and apoptosis such as PRMT5, TAB1, and TRIM31, with regulators of metabolism such as PFKFB3, and with regulators of RNA biogenesis such as HNRNPH1.
4.2.2. Expression of LRRC31
In order to characterize the tissue expression of LRRC31, we used publicly available microarray gene expression data. We determined that LRRC31 mRNA is normally expressed in the colon, specifically in the epithelial mucosa of the colon and rectum, and that it is not expressed in the esophagus as baseline.34 These data suggested a function for LRRC31 within the colonic epithelium, possibly in regulating epithelial homeostasis.
We investigated LRRC31 expression and function in the colon using the Caco2-bbe colonic adenocarcinoma cell line. In Caco2 cells grown to 100% confluence, the expression kinetics of
LRRC31 were characterized and endogenous LRRC31 mRNA was induced following IL-13 treatment (data shown in Chapter 2). We also characterized the expression kinetics of miR-375
! 156 in Caco2 cells treated with IL-13. MiR-375 was identified as dysregulated in allergic disease and was downregulated in the esophagus in EoE and in IL-13 treated esophageal epithelial cells.35
Remarkably, the expression kinetics of LRRC31 and miR-375 both showed a rapid upregulation of expression in the first 90 minutes. Therefore, we hypothesized that LRRC31 may be regulating miR-375 biogenesis. Further rationale for this hypothesis came from LRRC31 interacting with HNRNPH1, which is a member of the hnRNP family that regulate miRNA biogenesis.36,37 Thus, when LRRC31 was overexpressed in Caco2 cells that were treated with
IL-13, miR-375 gene expression was increased when compared to empty vector control cells
(Figure 4.1). These data suggest a function for LRRC31 in regulating miRNA biogenesis. Taken together, these data need validation in an independent system in order to determine the contribution of LRRC31 to miRNA biogenesis. LRRC31 gene-silenced cells treated with IL-13 may show decreased miR-375, however it is important to first determine if altering the expression of LRRC31 affects the biogenesis of all miRNA.
In EoE there was pathologic expression of LRRC31 mRNA in the esophagus.4 We showed that
LRRC31 mRNA and protein were both being expressed in the esophagus in EoE and were absent from the normal (NL) esophagus. In addition, examining esophageal biopsies from patients with gastroesophageal reflux (GERD) showed no difference between NL and GERD esophagus. However, there was a marked difference between NL esophagus and active EoE esophagus. Furthermore, we were able to replicate these data in two independent cohorts of patients, confirming that LRRC31 is pathologically expressed in the esophagus in active EoE.
The mechanism of increased LRRC31 expression was not known. We hypothesize that
LRRC31 is induced by IL-13 primarily in basal cells in the esophagus, and not diffusely throughout the stratified squamous epithelium. In EoE, esophageal basal cell hyperplasia is reported as a pathologic marker of disease.38 Therefore we further hypothesize that increased
! 157 LRRC31 expression is a consequence of basal cell hyperplasia. To test this hypothesis, we will stain biopsies and EPC2 cells differentiated at the ALI with a validated LRRC31-specific antibody, in order to determine the cellular distribution and localization of LRRC31 within the epithelium in the esophagus and in vitro culture of esophageal epithelial cells treated with IL-13.
Keratins will be used to characterize the stratified squamous layer in which LRRC31 is expressed. We expect to see differential expression of LRRC31 through the stratified squamous epithelial with higher concentrations in the more basal cells. In another experiment, disrupting the expression of keratins by either overexpression of gene-silencing will impact the expression of LRRC31 following IL-13 treatment in ECP2 cells differentiated at the ALI. Thus, LRRC31 expression requires epithelial cells to be in a specific differentiation state, which is determined and maintained by the expression of specific keratins.39
4.2.3. LRRC31 Expression as a Function of Disease Activity
We determined that LRRC31 mRNA expression in the esophagus was a function of EoE disease status, specifically patients’ responding to therapy. In this study a responder was defined as a patient undergoing therapy followed by an esophageal biopsy with 1 > eosinophils per hpf. In stratifying LRRC31 mRNA expression among EoE patients that were untreated and those who were given a therapeutic intervention, we observed that EoE patients responding to either swallowed steroid fluticasone propionate (FP) or a food elimination diet had LRRC31 mRNA expression returning to NL. EoE patients who did not respond to FP had increased
LRRC31 mRNA expression. In contrast, EoE patients who did not respond to diet therapy had decreased LRRC31 mRNA expression. Swallowed FP and diet therapy utilize different mechanisms to induce remission of disease in EoE patients. FP is a glucocorticoid that non- specifically suppressed the immune-mediated inflammatory response.40 In contrast, diet therapy removes the antigen that triggered the inflammatory response. Therefore, we propose that
! 158 LRRC31 mRNA expression is dynamically regulated by disease status and differentially responded to glucocorticoid versus antigen withdrawal therapy.
These data suggest that antigen withdrawal may be sufficient to reduce the expression of
LRRC31 mRNA in these patients despite the persistence of EoE symptoms and pathology
(esophageal eosinophilia). Therefore, LRRC31 may be an early-response epithelial gene dynamically regulated by antigen sensing, decreasing in expression with antigen withdrawal regardless of symptomatic response. In contrast, swallowed glucocorticoids suppress the immune response by several mechanisms including induction of apoptosis in immune cells, but do not affect antigen sensing. In addition, these data highlight several limitations of studying
EoE, specifically when considering esophageal biopsies. With most patients the esophageal biopsy was collected at time of diagnosis of EoE or during follow up, making the kinetics of disease pathogenesis challenging to characterize. Mouse models of experimental EoE did not induce LRRC31 mRNA expression (data not shown) and are limited in their similarity to human disease. Thus, it is challenging to make mechanistic conclusions or hypotheses about LRRC31 mRNA expression and response to therapy, especially when a limited number of patients did not respond to diet therapy and had reduced LRRC31 mRNA expression (n = 5).
4.2.4. LRRC31 and Markers of Disease
We characterized the relationship between LRRC31 mRNA expression and several markers, such as eosinophilia and gene expression, previously correlated to EoE disease status and severity. LRRC31 mRNA expression had a strong positive correlation with biopsy eosinophils, suggesting a common pathway may be regulating both markers of disease. In addition, LRRC31 mRNA expression had strong positive correlations with IL13 and CCL26 mRNA expression. IL-
13 mRNA and protein were increased in EoE, and IL-13 regulated the expression of a subset of esophageal epithelial mRNA that were dysregulated in active disease including CCL26 and
! 159 LRRC31.4,5 CCL26, which encodes eotaxin-3, an eosinophil chemokine, was the most highly
upregulated mRNA in EoE and in esophageal epithelial cells treated with IL-13.4,5 In contrast,
LRRC31 mRNA expression had a weak positive correlation with IL5 mRNA expression. IL-5 is a
hematopoietic cytokine that promotes bone marrow eosinophil differentiation, and tissue
recruitment and survival in the esophagus, and is secreted by Th2 cells in allergic diseases.41
The weak correlation between LRRC31 and IL5 mRNA expression suggests LRRC31 does not
regulate eosinophils or other hematopoietic cells, and the strong correlation of LRRC31 and
IL13 mRNA suggests that LRRC31 is an epithelial gene. Taken together, we showed that
LRRC31 was important in EoE because it had strong positive correlations with other markers of
EoE disease severity, such as eosinophilia, and EoE disease activity, such as IL-13 and CCL26.
We further speculated whether LRRC31 might be used as a biomarker for disease activity.
Interestingly, a probe targeting LRRC31 was included on the EoE diagnostic panel (EDP).42
Further analysis needs to be completed in order to generate clinically relevant correlations
between EoE patients’ symptoms, status, and LRRC31 mRNA expression, and an ongoing
study aims to use the EDP and EoE questionnaire to generate clinically relevant correlations
between disease status and gene expression.
4.2.5. IL-13 Induced LRRC31
IL-13 drove expression of a subset of EoE-associated mRNAs and induced LRRC31 in primary
esophageal epithelial cells. IL-13 induced LRRC31 mRNA and protein in primary esophageal
epithelial cells and several cell lines including bronchial, tracheal, and colonic epithelial cells.
However, the greatest induction of LRRC31 mRNA and protein by IL-13 occurred in EPC2
esophageal epithelial cells that were grown and differentiated at the air-liquid interface (ALI).
EPC2 cells differentiated at the ALI more closely mimick the in vivo esophageal epithelium,
providing a system in which to characterize the function of LRRC31. In addition, it was
interesting to note that IL-13 induced LRRC31 more robustly in EPC2 cells differentiated at the
! 160 ALI than in EPC2 cells that were grown in submerged conditions. This may have resulted from a tissue-specific effect of LRRC31 in ALI differentiated or stratified squamous epithelia and it’s dependence on IL-13 for expression.43 ALI differentiation results in differential expression of keratins corresponding to the stratified squamous epithelia. Thus, if LRRC31 were expressed in an epithelial stratum absent in homogenous submerged cultures, the ALI differentiation cultures would be expected to express more LRRC31 following IL-13 treatment.
IL-13 induces gene expression by binding the IL-13 receptor, resulting in phosphorylation of
STAT6, homodimerization and translocation to the nucleus, where phospho-STAT6 binds DNA and activates transcription.44 We aimed to characterize the transcriptional regulation of LRRC31 mRNA expression by IL-13 and STAT6 in esophageal epithelial cells. We did not identify any elements regulating LRRC31 mRNA transcription using a luciferase expression assays with the
2 Kb upstream sequence from the transcription start site (TSS) of LRRC31 in TE-7 cells treated with IL-13. However, one limitation of these experiments was the use of TE-7 cells grown in submerged cultures, which only induce LRRC31 2-4 fold following IL-13 treatment (data not shown). In addition, luciferase expression assays can be validated using CRISPER/Cas to specifically delete a transcription factor binding site, which should result in loss of expression of target gene following IL-13 treatment. There is an additional putative STAT6 binding site within the first intron of LRRC31 that we did not evaluate. To further investigate the role of STAT6 in regulating LRRC31 gene expression, we will perform STAT6 chromatin immunoprecipitation
(ChIP)-seq to determine if STAT6 bound to the LRRC31 gene locus in esophageal epithelial cells treated with IL-13. Luciferase expression assays will be used to sequentially test different permutations where putative transcription factor binding sites were deleted in order to define the minimum required genetic sequence that induces transcription of LRRC31 mRNA. In addition, we will use clustered regularly interspaced short palindromic repeats (CRISPR)/Cas to selectively delete putative transcription factor binding sites within the LRRC31 gene locus, and
! 161 expect changes in gene expression to signify identification of critical transcription factor binding sites in the context of IL-13 treatment. Taken together, these experiments will characterize the transcriptional mechanism utilized by IL-13 to induce LRRC31 mRNA expression in esophageal epithelial cells.
4.2.6. LRRC31 and the Esophageal Epithelial Barrier
LRRC31 mRNA and protein were induced by IL-13 treatment of EPC2 cells differentiated at the
ALI, suggesting LRRC31 may be involved in regulating esophageal epithelial barrier function. In order to evaluate the role of LRRC31 in regulating barrier function, we overexpressed and gene- silenced LRRC31 in EPC2 cells that were differentiated at the ALI. We observed that overexpressing LRRC31 increased barrier function. IL-13 treatment decreased barrier function, and the change was similar to the change seen in control cells. These data suggest that
LRRC31 overexpression in the absence of IL-13 increases barrier function, but does not prevent the IL-13–induced decrease in barrier function. In LRRC31 gene-silenced EPC2 cells differentiated at the ALI we also observed increased barrier function. However, IL-13 treatment failed to change the barrier function of LRRC31 gene-silenced EPC2 cells differentiated at the
ALI. These findings suggest that LRRC31 functions in regulating the barrier function in the esophageal epithelium.
In manipulating the expression of LRRC31 in EPC2 cells, we observed paradoxical regulation of esophageal epithelial barrier function. Both LRRC31 overexpressing and gene-silenced EPC2 cells differentiated at the ALI had increased barrier function compared to control EPC2 cells.
However, IL-13 treated LRRC31 overexpressing EPC2 cells demonstrated a marked decrease in barrier function while LRRC31 gene-silenced cells had no change in barrier function after IL-
13 treatment. Thus we hypothesize that LRRC31 interacts with IL-13–induced proteins to decrease barrier function, and in the absence of interacting proteins, LRRC31 conversely
! 162 increases barrier function. We will test this hypothesis by conducting immunoprecipitation with a
LRRC31 specific antibody in EPC2 cells differentiated at the ALI and treated with IL-13, characterizing the LRRC31 protein interactome. We expect to find protein-protein interactions that are a function of IL-13 treatment. These proteins are likely involved in regulating the esophageal epithelial barrier.
In order to determine the mechanism by which LRRC31 regulates the esophageal epithelial barrier function, we used RNA-seq analysis to determine if there were transcriptional changes in
LRRC31 overexpressing EPC2 cells differentiated at the ALI. We initially screened for changes in mRNA expression of several genes known to regulate epithelial differentiation and barrier function, but did not detect any changes. Using RNA-seq, we identified dysregulated mRNA expression in 38 genes, including decreased expression of 5 kallikrein (KLK) serine proteases.
Furthermore, we showed that LRRC31 overexpressing cells had decreased KLK protein levels and KLK activity levels. In LRRC31 gene-silenced EPC2 cells, we observed increased mRNA expression of KLKs, further supporting a function for LRRC31 in regulating KLK expression. In
EoE and in IL-13 treated primary esophageal epithelial cells, we observed dysregulation in the expression of KLKs, a change that may be regulated by LRRC31, but more importantly implicated the KLK proteases in EoE disease pathogenesis and the IL-13 response of esophageal epithelial cells. Taken together, these data identified a novel function for LRRC31 in modulating the barrier function possibly via regulation of KLKs.
The mechanism by which LRRC31 regulates KLK expression is not known and is intriguing because LRRC31 does not have a DNA-binding domain to direct regulator of gene expression.
Therefore, we hypothesize that LRRC31 indirectly regulates KLK expression. We used
Ingenuity Pathway Analysis (IPA) to examine the protein-protein interaction network generated from the 38 dysregulated genes we identified in LRRC31 overexpressing EPC2 cells
! 163 differentiated at the ALI (Figure 4.2). We identified ubiquitin C (UBC) and amyloid protein precursor (APP), which interact with a large number of proteins dysregulated in LRRC31 overexpressing EPC2 cells. UBC monomers are conjugated onto proteins leading to various functional effects within a cell, depending on where the UBC is conjugated, suggesting post- translation modifications may be important.45 In addition, APP, which regulates synapse formation and transmission in neurons, undergoes extensive post-translational modifications including proteolytic processing. IPA also identified keratin 14 (KRT14) as a shared upstream regulator of the genes dysregulated by LRRC31 overexpression in EPC2 cells. KRT14 and
KRT5 are the primary intermediate filament cytoskeleton of proliferating basal keratinocytes.
Mutations in KRT14 cause the hereditary skin disease epidermolysis bullosa simplex (EBS), which is characterized by skin blistering as a result of comparatively mild mechanical trauma.46
Increased expression of KRT14 was associated with increased levels of jun N-terminal kinase
(JNK)/activator protein 1 (AP1)-mediated mitogen activated protein kinase (MAPK) stress signaling, which altered gene expression.47 However, we did not detect altered KRT14 gene expression in LRRC31 overexpressing EPC2 cells. Therefore, we hypothesize that KRT14 is regulated post-translationally to modulate the expression of genes that are dysregulated in
LRRC31 overexpressing EPC2 cells. Alternatively, KLKs can be post-transcriptionally regulated by miRNAs, and miRNA regulation of KLKs is involved in prostate cancer, ovarian cancer, and renal cell carcinoma pathogenesis.48-51 We would determine the role of miRNA in regulating
KLKs by identifying the most highly expressed miRNAs in LRRC31 overexpressing cells and sequentially gene-silence them, expecting to identify conserved miRNA that regulate KLKs in the prostate, ovaries, and kidneys.
In addition to the dysregulated KLKs in LRRC31 overexpressing EPC2 cells differentiated at the
ALI, there are several additional genes of interest, such as low density lipoprotein receptor- related protein 1B (LRP1B) and noggin (NOG). LRP1B mRNA expression was increased in
! 164 LRRC31 overexpressing EPC2 cells. LRP1B is a member of the low-density lipoprotein (LDL) receptor family that functions as a tumor suppressor. LRP1B attenuates cell migration by reducing membrane localization of urokinase-type plasminogen activator (uPA) receptor (uPAR) and platelet-derived growth factor receptor (PDGFR) β, and by regulating motility via the
RhoA/Cdc42 pathway and actin cytoskeleton reorganization.52-54 uPA is a serine protease that is similar to the KLKs and uPA-uPAR overexpressing oral squamous carcinoma cells increased
KLK mRNA expression.55 In addition, a GWAS on atopic patients identified genetic variants in
LRP1B that associated with allergic diseases.56 Thus we hypothesize that LRP1B functions in esophageal epithelial cells as a modulator of cell motility and barrier function through regulation of actin cytoskeletal reorganization. We will test this hypothesis by overexpressing LRP1B in
EPC2 cells, treating with IL-13, and evaluating cell motility using a scratch assay, measuring intracellular adherence with a dispase assay, and determining barrier function by differentiating cells at the ALI. We expect LRP1B overexpressing EPC2 cells will have decreased mobility, increased clumping by dispase assay, and increased barrier function when differentiated at the
ALI. NOG was downregulated in LRRC31 overexpressing EPC2 cells. This is interesting because NOG inhibited bone morphogenetic protein (BMP) signaling and is an important secreted protein regulating development.57 Specifically, BMPs are signaling proteins of the TGF-
β superfamily that regulate esophageal development.58-60 Furthermore, BMP signaling regulates normal squamous epithelial differentiation of basal cells, and basal cell hyperplasia is promoted by disrupted BMP signaling in EoE with increased expression of follistatin, another BMP antagonist.61 In EoE, Taken together, these findings suggest NOG may have a function in EoE pathogenesis. Thus, we hypothesize that NOG regulates basal cell hyperplasia in the esophageal epithelium. We will test this hypothesis by generating NOG gene-silenced EPC2 cells differentiated at the ALI, which will have increased basal cell hyperplasia and decreased barrier function. Taken together, we expect to see changes similar to LRRC31 overexpressing
EPC2 cells in LRP1B overexpressing EPC2 cells and in NOG gene-silenced EPC2 cells.
! 165
LRRC31 does not contain any DNA-binding domains to directly regulate gene expression as a transcription factor, yet LRRC31 overexpressing EPC2 cells have altered gene expression.
Therefore, we hypothesize that LRRC31 indirectly regulates gene expression as an adaptor protein. We further hypothesize that LRRC31 interacts with an E3 ubiquitin ligase, such as
TRIM31, resulting in activation and nuclear translocation or proteasomal degradation of target proteins. Using this mechanism, LRRC31 can indirectly regulate gene expression by proteins such as hormone receptors, which regulate KLK gene expression, or cytokeratins such as
KRT14, which regulate epithelial differentiation. We will test this hypothesis by querying the
LRRC31 interactome for transcription factors, or using a candidate approach to test protein- protein interactions between these specific proteins and LRRC31 in esophageal epithelial cells treated with IL-13. We expect to identify transcription factors that regulate some, if not all the 38 genes that are dysregulated in LRRC31 overexpressing EPC2 cells.
4.2.7. KLKs Regulate Epithelial Barrier Function
The function of KLKs is not well characterized in the human esophagus. However, the esophageal epithelium is similar in morphology to the epidermis, a tissue in which the function of KLKs is well characterized.62 The epithelial barrier is formed by the stratum corneum (SC), which regulates barrier permeability, balancing lipid and protein factors.62 Lipids secreted by the cells of the SC form a hydrophobic barrier that maintains fluid and ion homeostasis.62 Proteins expressed by the cells of the SC form cell-cell junctions and regulate the intracellular permeability of the SC through structures such as tight junctions, adherens junctions, and desmosomes.62 KLKs regulate the integrity of the barrier and desquamation by cleaving desmosomal proteins such as corneodesmosin and desmocollin.63 As a result of increased KLK activity, desmosomes are cleaved and barrier function is decreased. However, if KLK activity is decreased, barrier function increased due to the decreased baseline proteolytic activity. We
! 166 hypothesize that in EoE, KLK activity is dysregulated, resulting in decreased barrier function.
However, it is not clear whether dysregulated KLK activity caused pathological disease or is a sequelae of disease. In order to further understand the role of KLKs in regulating the esophageal epithelial barrier function, we further hypothesize that increased KLK activity results in decreased esophageal epithelial barrier function. We will test this hypothesis by first characterizing the activity of KLKs in NL and EoE esophagus. We expect increased KLK activity in the esophagus in EoE because of the previously described decrease in barrier function associated with the esophagus in EoE.43 In addition, we hypothesize that increased KLK expression results in decreased barrier function in esophageal epithelial cells. We will test this hypothesis by overexpressing candidate KLKs in EPC2 cells differentiated at the ALI and then measuring epithelial barrier function following IL-13 treatment. We expect KLK overexpression, specifically KLK5 and KLK7, which initiate the KLK activation cascade and cleave desmosomal components, will result in decreased barrier function.62 Taken together, these data will show that the KLKs have an important role in regulating esophageal epithelial barrier function at homeostasis and in diseases, and thus are a possible therapeutic target.
4.2.8. Implications of LRRC31 Data For New Therapies
We propose a novel therapeutic strategy in EoE that derives from our understanding of the role of LRRC31 in the esophageal epithelium – targeting the KLKs in order to improve barrier function in the esophagus of patients with active EoE. EoE is a food/antigen driven disease that results in allergic inflammation of the esophagus.38 In active disease, the esophageal epithelial barrier function is decreased, possibly facilitating increased exposure of antigens to the immune system. We propose using KLK inhibitors, such as the endogenous family of serine protease inhibitor Kazal-type (SPINK), exogenous chemical inhibitors like aminoethyl bezenesulfonyl fluoride (AEBSF, Pubchem CID 1701), or bacterial inhibitors like leupeptin (acetyl-Leu-Leu-
Arginal).64 The topical delivery of these inhibitors in slurry to the esophageal epithelium in
! 167 patients with active EoE may help restore barrier function and resolve allergic inflammation, relieving symptoms, and possibly preventing future relapsing disease.
4.2.9. Summary and Conclusions
In summary, we propose the following model for the function of LRRC31 in the esophagus
(Figure 4.3). We identified LRRC31, a novel gene of previously unknown function that was dysregulated in the esophagus in EoE and induced by IL-13 treatment in esophageal epithelial cells. We hypothesize that IL-13 activates STAT6, which directly binds to the LRRC31 gene locus to activate transcription of LRRC31 mRNA. We also hypothesize that LRRC31 functions as an adaptor protein with TRIM31 E3 ubiquitin ligase to modulate gene expression, increasing
LRP1B and decreasing KLKs and NOG. We showed that decreased KLK expression correlated with increased barrier function. We hypothesize that increased LRP1B decreases cell motility and increased barrier function, and that decreased NOG increases basal cell hyperplasia and decreases barrier function. Finally, we hypothesize that LRRC31 also regulates miRNA biogenesis. In this chapter, we have described our findings, synthesized new hypotheses, and proposed additional experiments for testing these hypotheses. We hope the findings described here will assist in the development of improved therapies in order to improve EoE patient quality of life, especially for pediatric patients.
! 168 4.3. LRRC32
4.3.1. Identification of Chromosome 11q13
EoE is a complex disease with both environmental and genetic contributions.65 Several genetic associations were shared by allergic diseases such as 5q22 and 2p23, which identified TSLP and CAPN14 expression as a function of genotype and contributing to the pathogenesis of allergic diseases.66,67 We identified an EoE genetic association on chromosome 11q13 that was also associated with asthma, allergic rhinitis, and atopic dermatitis. Therefore, we hypothesize that 11q13 also contains genes that are important for the pathogenesis of allergic diseases. We tested this hypothesis by identifying a specific single nucleotide polymorphism (SNP) based on epigenetic markers to focus our investigation. Further characterizing gene expression and function of genes adjacent to rs2155219 may increase the understanding of role of genetics in
EoE.
4.3.2. Identification of rs2155219
We identified the SNP rs2155219 on chromosome 11q13 as a SNP of interest. This SNP is located in the intergenic region between the genes LRRC32 and C11ORF30. Therefore, we hypothesize that this region must be open and functions as a gene promoter for transcription.
We used publicly available chromatin immunoprecipitation (ChIP)-seq data and data we generated in our lab, to identify rs2155219 as a transcriptional activator, increasing gene transcription as an enhancer or weak promoter. Encyclopedia of DNA elements (ENCODE)
ChIP-seq data for the transcriptional activation peaks histone 3, lysine 17, acetylation
(H3K27Ac) showed peaks flanking rs2155219. In addition, ChIP-seq of H3K27Ac in TE-7 esophageal epithelial cells treated with IL-13 showed a peak that corresponded with the
ENCODE H3K27Ac peak upstream of rs2155219. These data suggest that rs2155219 was likely open chromatin, activated following IL-13 treatment. Furthermore, we identified a putative
STAT6 binding site near rs2155219, which was interesting because IL-13 signals through
! 169 STAT6 phosphorylation and activation of transcription. Additional evidence of enhancer activity at rs2155219 was obtained using Roadmap Epigenomics to analyze publicly available datasets of chromatin interaction analysis with paired-end tags (ChIA-PET), ChIP-seq, DNase hypersensitivity, and DNase Digital Genomics Footprinting. Taken together, these data suggest that rs2155219 will be a transcriptionally active site that may have allele specific interactions with DNA-binding proteins.
In order to prove the epigenetic enhancer activity of rs2155219 we propose several experiments. We will use H3K4me1 ChIP-seq of TE-7 cells treated with IL-13. We expect to see
H3K4me1 peaks at rs2155219, further supporting enhancer activity. We will conduct STAT6
ChIP-seq to confirm the putative STAT6 binding site near rs2155219 and to characterize additional STAT6 binding sites within 11q13. We will also use an enhancer luciferase expression assay and evaluate the major and minor alleles at rs2155219, and their effect on transcriptional activation. Taken together, these data suggest a transcriptional enhancer function for rs2155219.
4.3.3. Genes on Chromosome 11q13
Chromosome 11q13 encodes numerous genes, however we focused on 3 specific genes:
LRRC32 and C11ORF30, which are adjacent to rs2155219, and CAPN5. LRRC32 encodes a transmembrane protein expressed on T regulatory (Treg) cells that regulates the Treg expression of FOXP3, the primary transcription factor driving Treg differentiation, and the local bioavailability of TGF-β, which is increased in allergic diseases and in the esophagus in EoE.68,69 C11ORF30 encodes an oncogene that interrupts BRCA2/RAD51 DNA-damage repair.70 In the esophagus
C11ORF30 may regulate proliferation of epithelial cells in EoE, where basal cell hyperplasia was reported.38 Finally, CAPN5 was selected because it is related to CAPN14, which was previously shown to be associated with allergic diseases, specifically EoE.67 The calpain family
! 170 of cysteine proteases regulates diverse cell signaling pathways and mutations in CAPN5 are associated with autoimmune uveitis, retinal neovascularization, photoreceptor degeneration, and promyelocytic leukemia protein bodies.71,72 However the molecular function of CAPN5 is not known. Conveniently, the 3 genes we selected are expressed in EPC2 esophageal epithelial cells differentiated at the ALI and treated with IL-13, providing a system in which to study rs2155219. Note that EPC2 cells are heterozygous for the major and minor alleles at rs2155219. Taken together, these 3 candidate genes on chromosome 11q13 may be expressed as a function of rs2155219 genotype and may have important functions in allergic disease.
4.3.4. Minor Allele at rs2155219 and LRRC32 Expression
In order to determine if there is a relationship between genotype at rs2155219 and gene expression, we genotyped a cohort of NL and EoE patients at rs2155219 and measured the esophageal expression of LRRC32, C11ORF30, and CAPN5 mRNA. Esophageal LRRC32 gene expression was increased in patients with active EoE carrying the minor allele at rs2155219. NL and EoE patients that were homozygous for the major allele or heterozygous at rs2155219 did not have differences in expression of LRRC32, C11ORF30, or CAPN5 mRNA.
These data suggest that LRRC32 mRNA is dynamically regulated as a function of the genotype at rs2155219, increasing when the minor allele is present.
We hypothesize that rs2155219 differentially binds a transcription factor depending on genotype. In order to test this hypothesis, we will use DNA affinity purification assays (DAPAs) with oligomers containing the major and minor alleles at rs2155219 to determine if there was protein binding to DNA at rs2155219. Next, we will identify the DNA-binding protein by mass spectrometry. We further hypothesize that STAT6 binds at rs2155219 based on the predicted putative binding site 15 bases away. We will test STAT6 binding at rs2155219 by using DAPA or electrophoretic mobility shift assays (EMSAs) to test differential binding of STAT6 to the
! 171 major and minor allele in the presence of recombinant STAT6 with or without anti-STAT6 blocking antibody. We expect recombinant STAT6 to bind both the major and minor allele and saturate binding, while adding the anti-STAT6 blocking antibody should block STAT6 DNA- binding. Furthermore, we will use CRISPR/Cas to delete the major and minor alleles at rs2155219 and abrogate DNA-binding protein activity, further decreasing the expression of
LRRC32 mRNA. Taken together, these data and experiments will show that the major and minor alleles at rs2155219 differentially bind transcription factors that regulate the enhancer activity of rs2155219 on LRRC32 mRNA expression. Specifically, the minor allele binds increased transcription factor relative to the major allele, resulting in increased expression of
LRRC32 mRNA.
4.3.5. LRRC32 and TGF-β Signaling in EoE
After identifying the EoE genetic association at rs2155219 and characterizing the dependence of LRRC32 expression on rs2155219 genotype, we hypothesize that LRRC32 is important for the pathogenesis of EoE. LRRC32 regulates TGF-β bioavailability and signaling in Treg cells, where it is expressed on the cell service upon activation and binds latent TGF-β.1 In EoE, TGF-
β is increased in the esophagus of patients with active disease and TGF-β levels correlate with disease pathology.2,3 We reported that LRRC32 was induced in EPC2 esophageal epithelial cells treated with IL-13. Thus, we hypothesize that LRRC32 function is conserved in EPC2 cells as a regulator of TGF-β bioavailability and signaling, and that decreased LRRC32 will correlate with increased TGF-β signaling. We will test this hypothesis in LRRC32 overexpressing and gene-silencing EPC2 cells differentiated at the ALI that are treated with IL-13 in the presence or absence of TGF-β. We expect LRRC32 overexpressing cells to have decreased TGF-β signaling when compared to controls, which we can evaluate by measuring phosphorylation of mothers against decapentaplegic (SMAD) proteins, the signal transducers of TGF-β signaling, or by measuring mRNA expression of TGF-β–induced transcripts such as snail family zinc finger
! 172 1 (SNAI1).73 In contrast, we hypothesize that LRRC32 gene-silenced EPC2 cells will have increased TGF-β signaling.
An additional factor to consider before characterizing LRRC32 in epithelial cells is that the esophageal source of LRRC32 is not known. It is possible that Treg cells may be the primary source of LRRC32 in the esophagus, with esophageal epithelial cells being a secondary source.
However, preliminary studies on esophageal biopsies that were digested into single cell suspensions and analyzed by flow cytometery for immune cell composition did not identify many
LRRC32 positive Treg cells. In addition, we can use flow cytometery to quantify LRRC32 surface expression on Treg cells from patients with active EoE. We expect patients with the minor allele to have increased expression of LRRC32. Thus, having the minor allele at rs2155219 resulted in decreased risk of disease because of increased expression of LRRC32. LRRC32 expression has been associated with decreased inflammation in a humanized mouse model of allergen- induced IgE-dependent gut inflammation using PBMC-engrafted immunodeficient mice.74
Briefly, administration of Treg cells or LRRC32 decreased gut inflammation and blockade of Treg
LRRC32 abrogated the inhibition of gut inflammation.74 Therefore, we hypothesize that levels of
LRRC32 expression will correlate with the development and severity of disease. We would test this hypothesis using several different clones of transgenic mice with different expression levels of LRRC32. We expect the mice with increased expression of LRRC32 to be have less severe allergic disease in a mouse model of allergic asthma, with decreased TGF-β signaling, fewer eosinophils infiltrating the lungs, and decreased airway hyper responsiveness, a physiologic measurement of disease severity.
In order to make mechanistic conclusions regarding the contribution of LRRC32 to disease pathogenesis, we need to evaluate whether TGF-β signaling is a function of genotype at rs2155219. We hypothesize that TGF-β signaling will be decreased in esophageal biopsies from
! 173 patients carrying the minor allele at rs2155219. Thus we propose that the minor allele at rs2155219 reduces the risk of developing allergic disease by decreasing the bioavailability of
TGF-β.73
! 174 4.4. Reflections and Conclusions
Taken together, this dissertation focused on two markedly different LRR proteins that regulated two independent pathways, which both contributed to EoE pathogenesis. We investigated the epithelial pathogenesis of EoE when characterizing LRRC31, identifying and characterizing
LRRC31 in the esophageal epithelium by mastering techniques in molecular biology and tissue culture. We investigated the genetic association of 11q13 with allergic diseases, identifying rs2155219 as a transcriptional enhancer, and characterized the dependence of LRRC32 mRNA expression on genotype at rs2155219. Investigating LRRC31 provided insight into the regulation of the esophageal epithelial barrier function and identified the KLK pathway as dysregulated in
EoE and IL-13 treatment, and some direction for future studies have been described here. It will be interesting to understand the molecular mechanism by which LRRC31 regulates KLK expression and barrier function. Further characterization of the IL-13 regulation of LRRC31 may also provide additional insight into IL-13 signaling mechanisms. However, it does not appear that LRRC31 will be a suitable therapeutic target for treating patients with EoE. In contrast,
LRRC32 is a more-likely target for therapeutic development and a recent report showed that administration of recombinant LRRC32 prevented gut inflammation in a humanized mouse model of allergen-induced IgE-dependent gut inflammation and blockade of LRRC32 completely
74 abrogated inhibition by Treg cells. These data suggest that increased Treg cells result in decreased inflammation.
Interestingly, KLK4 and KLK14 have been shown to cleave latency-associated propeptide (LAP) and contribute to TGF-β activation in semen.75 In addition, KLK5 may also contribute to TGF-β activation by nicking LAP and inducing conformational changes that aid in the subsequent processing of LAP.75 These data bring together LRRC31, which regulates KLK expression, and
LRRC32, which binds latent TGF-β and regulates active TGF-β bioavailability. Therefore, we hypothesize that in the esophageal epithelium LRRC31 is induced by IL-13 and decreases KLK
! 175 activity, decreasing TGF-β signaling in the esophageal epithelium. We will test this hypothesis by measuring TGF-β activity levels in KLK overexpressing and gene-silenced EPC2 cells differentiated at the ALI.
Taken together, the work contained within this dissertation has been a team effort and has taught me how to think like a scientist in asking important questions, postulating hypothetical answers, designing experiments to test my hypothesis, and synthesizing conclusions from the data. In addition, this dissertation has taught me perseverance and determination, mixed with a little luck, can prepare you to make a difference in the world. I hope to take my experiences training under the guidance of Dr. Marc Rothenberg and my dissertation committee to a clinical setting, where I will identify questions and gaps in medical knowledge to which I can apply my skills learned during my PhD, in order to improve return to basic biology to find answers and improve health.
! 176 4.5. References
1! Tran,!D.!Q.!et!al.!GARP!(LRRC32)!is!essential!for!the!surface!expression!of!latent!TGFB
beta!on!platelets!and!activated!FOXP3+!regulatory!T!cells.!Proceedings!of!the!
National!Academy!of!Sciences!of!the!United!States!of!America!106,!13445B13450,!
doi:10.1073/pnas.0901944106!(2009).!
2! Cheng,!E.,!Souza,!R.!F.!&!Spechler,!S.!J.!Tissue!remodeling!in!eosinophilic!esophagitis.!
Am!J!Physiol!Gastrointest!Liver!Physiol!303,!G1175B1187,!
doi:10.1152/ajpgi.00313.2012!(2012).!
3! Kagalwalla,!A.!F.!et!al.!Eosinophilic!esophagitis:!epithelial!mesenchymal!transition!
contributes!to!esophageal!remodeling!and!reverses!with!treatment.!The!Journal!of!
allergy!and!clinical!immunology!129,!1387B1396!e1387,!
doi:10.1016/j.jaci.2012.03.005!(2012).!
4! Blanchard,!C.!et!al.!EotaxinB3!and!a!uniquely!conserved!geneBexpression!profile!in!
eosinophilic!esophagitis.!The!Journal!of!clinical!investigation!116,!536B547,!
doi:10.1172/JCI26679!(2006).!
5! Blanchard,!C.!et!al.!ILB13!involvement!in!eosinophilic!esophagitis:!transcriptome!
analysis!and!reversibility!with!glucocorticoids.!The!Journal!of!allergy!and!clinical!
immunology!120,!1292B1300,!doi:10.1016/j.jaci.2007.10.024!(2007).!
6! Ota,!T.!et!al.!Complete!sequencing!and!characterization!of!21,243!fullBlength!human!
cDNAs.!Nature!genetics!36,!40B45,!doi:10.1038/ng1285!(2004).!
7! Kobe,!B.!&!Kajava,!A.!V.!The!leucineBrich!repeat!as!a!protein!recognition!motif.!
Current!opinion!in!structural!biology!11,!725B732!(2001).!
! 177 8! Dickson,!K.!A.,!Haigis,!M.!C.!&!Raines,!R.!T.!Ribonuclease!inhibitor:!structure!and!
function.!Progress!in!nucleic!acid!research!and!molecular!biology!80,!349B374,!
doi:10.1016/S0079B6603(05)80009B1!(2005).!
9! Kim,!Y.!J.!et!al.!PTEN!modulates!miRB21!processing!via!RNABregulatory!protein!
RNH1.!PLoS!One!6,!e28308,!doi:10.1371/journal.pone.0028308!(2011).!
10! Pan,!X.!et!al.!UpBregulating!ribonuclease!inhibitor!inhibited!epithelialBtoB
mesenchymal!transition!and!metastasis!in!murine!melanoma!cells.!Int!J!Biochem!Cell!
Biol!44,!998B1008,!doi:10.1016/j.biocel.2012.03.008!(2012).!
11! Lu,!T.!X.!et!al.!MicroRNA!signature!in!patients!with!eosinophilic!esophagitis,!
reversibility!with!glucocorticoids,!and!assessment!as!disease!biomarkers.!The!
Journal!of!allergy!and!clinical!immunology!129,!1064B1075!e1069,!
doi:10.1016/j.jaci.2012.01.060!(2012).!
12! Abonia,!J.!P.!et!al.!High!prevalence!of!eosinophilic!esophagitis!in!patients!with!
inherited!connective!tissue!disorders.!The!Journal!of!allergy!and!clinical!immunology!
132,!378B386,!doi:10.1016/j.jaci.2013.02.030!(2013).!
13! Luhrig,!S.!et!al.!Lrrc34,!a!novel!nucleolar!protein,!interacts!with!npm1!and!ncl!and!
has!an!impact!on!pluripotent!stem!cells.!Stem!Cells!Dev!23,!2862B2874,!
doi:10.1089/scd.2013.0470!(2014).!
14! Ting,!J.!P.,!Willingham,!S.!B.!&!Bergstralh,!D.!T.!NLRs!at!the!intersection!of!cell!death!
and!immunity.!Nat!Rev!Immunol!8,!372B379,!doi:10.1038/nri2296!(2008).!
15! Gong,!J.!&!Wei,!T.!Structure!modeling!of!TollBlike!receptors.!Methods!Mol!Biol!1169,!
45B53,!doi:10.1007/978B1B4939B0882B0_5!(2014).!
! 178 16! Sherrill,!J.!D.!et!al.!Variants!of!thymic!stromal!lymphopoietin!and!its!receptor!
associate!with!eosinophilic!esophagitis.!The!Journal!of!allergy!and!clinical!
immunology!126,!160B165!e163,!doi:10.1016/j.jaci.2010.04.037!(2010).!
17! Bonnelykke,!K.!et!al.!MetaBanalysis!of!genomeBwide!association!studies!identifies!ten!
loci!influencing!allergic!sensitization.!Nature!genetics!45,!902B906,!
doi:10.1038/ng.2694!(2013).!
18! Wang,!T.!et!al.!Flightless!I!homolog!negatively!modulates!the!TLR!pathway.!Journal!
of!immunology!176,!1355B1362!(2006).!
19! Dai,!P.!et!al.!Modulation!of!TLR!signaling!by!multiple!MyD88Binteracting!partners!
including!leucineBrich!repeat!FliBIBinteracting!proteins.!Journal!of!immunology!182,!
3450B3460,!doi:10.4049/jimmunol.0802260!(2009).!
20! Lei,!N.!et!al.!Flightless,!secreted!through!a!late!endosome/lysosome!pathway,!binds!
LPS!and!dampens!cytokine!secretion.!J!Cell!Sci!125,!4288B4296,!
doi:10.1242/jcs.099507!(2012).!
21! Jin,!J.!et!al.!LRRFIP2!negatively!regulates!NLRP3!inflammasome!activation!in!
macrophages!by!promoting!FlightlessBIBmediated!caspaseB1!inhibition.!Nat!Commun!
4,!2075,!doi:10.1038/ncomms3075!(2013).!
22! Mohammad,!I.!et!al.!Flightless!I!is!a!focal!adhesionBassociated!actinBcapping!protein!
that!regulates!cell!migration.!FASEB!J!26,!3260B3272,!doi:10.1096/fj.11B202051!
(2012).!
23! Kopecki,!Z.,!Arkell,!R.,!Powell,!B.!C.!&!Cowin,!A.!J.!Flightless!I!regulates!
hemidesmosome!formation!and!integrinBmediated!cellular!adhesion!and!migration!
! 179 during!wound!repair.!The!Journal!of!investigative!dermatology!129,!2031B2045,!
doi:10.1038/jid.2008.461!(2009).!
24! Kopecki,!Z.!et!al.!Overexpression!of!the!Flii!gene!increases!dermalBepidermal!
blistering!in!an!autoimmune!ColVII!mouse!model!of!epidermolysis!bullosa!acquisita.!
J!Pathol!225,!401B413,!doi:10.1002/path.2973!(2011).!
25! Jeong,!K.!W.!Flightless!I!(Drosophila)!homolog!facilitates!chromatin!accessibility!of!
the!estrogen!receptor!alpha!target!genes!in!MCFB7!breast!cancer!cells.!Biochem!
Biophys!Res!Commun!446,!608B613,!doi:10.1016/j.bbrc.2014.03.011!(2014).!
26! Karkhanis,!V.,!Hu,!Y.!J.,!Baiocchi,!R.!A.,!Imbalzano,!A.!N.!&!Sif,!S.!Versatility!of!PRMT5B
induced!methylation!in!growth!control!and!development.!Trends!Biochem!Sci!36,!
633B641,!doi:10.1016/j.tibs.2011.09.001!(2011).!
27! Yamamoto,!T.!et!al.!Reduced!methylation!of!PFKFB3!in!cancer!cells!shunts!glucose!
towards!the!pentose!phosphate!pathway.!Nat!Commun!5,!3480,!
doi:10.1038/ncomms4480!(2014).!
28! Yalcin,!A.!et!al.!6BPhosphofructoB2Bkinase!(PFKFB3)!promotes!cell!cycle!progression!
and!suppresses!apoptosis!via!Cdk1Bmediated!phosphorylation!of!p27.!Cell!Death!Dis!
5,!e1337,!doi:10.1038/cddis.2014.292!(2014).!
29! Kim,!S.!Y.,!Shim,!J.!H.,!Chun,!E.!&!Lee,!K.!Y.!Reciprocal!inhibition!between!the!
transforming!growth!factorBbetaBactivated!kinase!1!(TAK1)!and!apoptosis!signalB
regulating!kinase!1!(ASK1)!mitogenBactivated!protein!kinase!kinase!kinases!and!its!
suppression!by!TAK1Bbinding!protein!2!(TAB2),!an!adapter!protein!for!TAK1.!The!
Journal!of!biological!chemistry!287,!3381B3391,!doi:10.1074/jbc.M111.317875!
(2012).!
! 180 30! Russo,!A.!et!al.!hnRNP!H1!and!intronic!G!runs!in!the!splicing!control!of!the!human!
rpL3!gene.!Biochim!Biophys!Acta!1799,!419B428,!doi:10.1016/j.bbagrm.2010.01.008!
(2010).!
31! Watanabe,!M.,!Tsukiyama,!T.!&!Hatakeyama,!S.!TRIM31!interacts!with!p52(Shc)!and!
inhibits!SrcBinduced!anchorageBindependent!growth.!Biochem!Biophys!Res!Commun!
388,!422B427,!doi:10.1016/j.bbrc.2009.08.028!(2009).!
32! Sugiura,!T.!&!Miyamoto,!K.!Characterization!of!TRIM31,!upregulated!in!gastric!
adenocarcinoma,!as!a!novel!RBCC!protein.!J!Cell!Biochem!105,!1081B1091,!
doi:10.1002/jcb.21908!(2008).!
33! Sugiura,!T.!The!cellular!level!of!TRIM31,!an!RBCC!protein!overexpressed!in!gastric!
cancer,!is!regulated!by!multiple!mechanisms!including!the!ubiquitinBproteasome!
system.!Cell!Biol!Int!35,!657B661,!doi:10.1042/CBI20100772!(2011).!
34! Su,!A.!I.!et!al.!A!gene!atlas!of!the!mouse!and!human!proteinBencoding!transcriptomes.!
Proceedings!of!the!National!Academy!of!Sciences!of!the!United!States!of!America!101,!
6062B6067,!doi:10.1073/pnas.0400782101!(2004).!
35! Lu,!T.!X.!et!al.!MiRB375!is!downregulated!in!epithelial!cells!after!ILB13!stimulation!
and!regulates!an!ILB13Binduced!epithelial!transcriptome.!Mucosal!immunology!5,!
388B396,!doi:10.1038/mi.2012.16!(2012).!
36! Michlewski,!G.,!Guil,!S.!&!Caceres,!J.!F.!Stimulation!of!priBmiRB18a!Processing!by!
hnRNP!A1.!Adv!Exp!Med!Biol!700,!28B35,!doi:10.1007/978B1B4419B7823B3_3!(2011).!
37! Hope,!N.!R.!&!Murray,!G.!I.!The!expression!profile!of!RNABbinding!proteins!in!
primary!and!metastatic!colorectal!cancer:!relationship!of!heterogeneous!nuclear!
! 181 ribonucleoproteins!with!prognosis.!Hum!Pathol!42,!393B402,!
doi:10.1016/j.humpath.2010.08.006!(2011).!
38! Liacouras,!C.!A.!et!al.!Eosinophilic!esophagitis:!updated!consensus!recommendations!
for!children!and!adults.!The!Journal!of!allergy!and!clinical!immunology!128,!3B20!
e26;!quiz!21B22,!doi:10.1016/j.jaci.2011.02.040!(2011).!
39! Loschke,!F.,!Seltmann,!K.,!Bouameur,!J.!E.!&!Magin,!T.!M.!Regulation!of!keratin!
network!organization.!Curr!Opin!Cell!Biol!32,!56B64,!doi:10.1016/j.ceb.2014.12.006!
(2015).!
40! Coutinho,!A.!E.!&!Chapman,!K.!E.!The!antiBinflammatory!and!immunosuppressive!
effects!of!glucocorticoids,!recent!developments!and!mechanistic!insights.!Mol!Cell!
Endocrinol!335,!2B13,!doi:10.1016/j.mce.2010.04.005!(2011).!
41! Swain,!S.!L.,!McKenzie,!D.!T.,!Dutton,!R.!W.,!Tonkonogy,!S.!L.!&!English,!M.!The!role!of!
IL4!and!IL5:!characterization!of!a!distinct!helper!T!cell!subset!that!makes!IL4!and!
IL5!(Th2)!and!requires!priming!before!induction!of!lymphokine!secretion.!Immunol!
Rev!102,!77B105!(1988).!
42! Wen,!T.!et!al.!Molecular!diagnosis!of!eosinophilic!esophagitis!by!gene!expression!
profiling.!Gastroenterology!145,!1289B1299,!doi:10.1053/j.gastro.2013.08.046!
(2013).!
43! Sherrill,!J.!D.!et!al.!DesmogleinB1!regulates!esophageal!epithelial!barrier!function!and!
immune!responses!in!eosinophilic!esophagitis.!Mucosal!immunology!7,!718B729,!
doi:10.1038/mi.2013.90!(2014).!
44! Hershey,!G.!K.!ILB13!receptors!and!signaling!pathways:!an!evolving!web.!The!Journal!
of!allergy!and!clinical!immunology!111,!677B690;!quiz!691!(2003).!
! 182 45! Kessler,!B.!M.!Ubiquitin!B!omics!reveals!novel!networks!and!associations!with!human!
disease.!Curr!Opin!Chem!Biol!17,!59B65,!doi:10.1016/j.cbpa.2012.12.024!(2013).!
46! Garcia,!M.!et!al.!Two!novel!recessive!mutations!in!KRT14!identified!in!a!cohort!of!21!
Spanish!families!with!epidermolysis!bullosa!simplex.!Br!J!Dermatol!165,!683B692,!
doi:10.1111/j.1365B2133.2011.10428.x!(2011).!
47! Wagner,!M.,!Trost,!A.,!Hintner,!H.,!Bauer,!J.!W.!&!Onder,!K.!Imbalance!of!intermediate!
filament!component!keratin!14!contributes!to!increased!stress!signalling!in!
epidermolysis!bullosa!simplex.!Exp!Dermatol!22,!292B294,!doi:10.1111/exd.12112!
(2013).!
48! Chow,!T.!F.!et!al.!Kallikreins!as!microRNA!targets:!an!in!silico!and!experimentalB
based!analysis.!Biol!Chem!389,!731B738,!doi:10.1515/BC.2008.071!(2008).!
49! White,!N.!M.!et!al.!Dysregulation!of!kallikreinBrelated!peptidases!in!renal!cell!
carcinoma:!potential!targets!of!miRNAs.!Biol!Chem!391,!411B423,!
doi:10.1515/BC.2010.041!(2010).!
50! White,!N.!M.!et!al.!Three!dysregulated!miRNAs!control!kallikrein!10!expression!and!
cell!proliferation!in!ovarian!cancer.!Br!J!Cancer!102,!1244B1253,!
doi:10.1038/sj.bjc.6605634!(2010).!
51! White,!N.!M.!et!al.!The!miRNABkallikrein!axis!of!interaction:!a!new!dimension!in!the!
pathogenesis!of!prostate!cancer.!Biol!Chem!393,!379B389,!doi:10.1515/hszB2011B
0246!(2012).!
52! Liu,!C.!X.,!Li,!Y.,!ObermoellerBMcCormick,!L.!M.,!Schwartz,!A.!L.!&!Bu,!G.!The!putative!
tumor!suppressor!LRP1B,!a!novel!member!of!the!low!density!lipoprotein!(LDL)!
receptor!family,!exhibits!both!overlapping!and!distinct!properties!with!the!LDL!
! 183 receptorBrelated!protein.!The!Journal!of!biological!chemistry!276,!28889B28896,!
doi:10.1074/jbc.M102727200!(2001).!
53! Tanaga,!K.!et!al.!LRP1B!attenuates!the!migration!of!smooth!muscle!cells!by!reducing!
membrane!localization!of!urokinase!and!PDGF!receptors.!Arterioscler!Thromb!Vasc!
Biol!24,!1422B1428,!doi:10.1161/01.ATV.0000133607.80554.09!(2004).!
54! Ni,!S.!et!al.!Down!expression!of!LRP1B!promotes!cell!migration!via!RhoA/Cdc42!
pathway!and!actin!cytoskeleton!remodeling!in!renal!cell!cancer.!Cancer!Sci!104,!
817B825,!doi:10.1111/cas.12157!(2013).!
55! Dorn,!J.!et!al.!Function!and!clinical!relevance!of!kallikreinBrelated!peptidases!and!
other!serine!proteases!in!gynecological!cancers.!Crit!Rev!Clin!Lab!Sci!51,!63B84,!
doi:10.3109/10408363.2013.865701!(2014).!
56! Cotterchio,!M.!et!al.!Association!between!Variants!in!AtopyBRelated!Immunologic!
Candidate!Genes!and!Pancreatic!Cancer!Risk.!PLoS!One!10,!e0125273,!
doi:10.1371/journal.pone.0125273!(2015).!
57! Potti,!T.!A.,!Petty,!E.!M.!&!Lesperance,!M.!M.!A!comprehensive!review!of!reported!
heritable!nogginBassociated!syndromes!and!proposed!clinical!utility!of!one!broadly!
inclusive!diagnostic!term:!NOGBrelatedBsymphalangism!spectrum!disorder!(NOGB
SSD).!Human!mutation!32,!877B886,!doi:10.1002/humu.21515!(2011).!
58! De!Santa!Barbara,!P.!et!al.!Bone!morphogenetic!protein!signaling!pathway!plays!
multiple!roles!during!gastrointestinal!tract!development.!Dev!Dyn!234,!312B322,!
doi:10.1002/dvdy.20554!(2005).!
59! Rishniw,!M.!et!al.!Molecular!aspects!of!esophageal!development.!Ann!N!Y!Acad!Sci!
1232,!309B315,!doi:10.1111/j.1749B6632.2011.06071.x!(2011).!
! 184 60! Rodriguez,!P.!et!al.!BMP!signaling!in!the!development!of!the!mouse!esophagus!and!
forestomach.!Development!137,!4171B4176,!doi:10.1242/dev.056077!(2010).!
61! Jiang,!M.!et!al.!BMPBdriven!NRF2!activation!in!esophageal!basal!cell!differentiation!
and!eosinophilic!esophagitis.!The!Journal!of!clinical!investigation,!
doi:10.1172/JCI78850!(2015).!
62! Cork,!M.!J.!et!al.!Epidermal!barrier!dysfunction!in!atopic!dermatitis.!The!Journal!of!
investigative!dermatology!129,!1892B1908,!doi:10.1038/jid.2009.133!(2009).!
63! Charteris,!W.!P.,!Kelly,!P.!M.,!Morelli,!L.!&!Collins,!J.!K.!Development!and!application!
of!an!in!vitro!methodology!to!determine!the!transit!tolerance!of!potentially!probiotic!
Lactobacillus!and!Bifidobacterium!species!in!the!upper!human!gastrointestinal!tract.!
J!Appl!Microbiol!84,!759B768!(1998).!
64! Goettig,!P.,!Magdolen,!V.!&!Brandstetter,!H.!Natural!and!synthetic!inhibitors!of!
kallikreinBrelated!peptidases!(KLKs).!Biochimie!92,!1546B1567,!
doi:10.1016/j.biochi.2010.06.022!(2010).!
65! Alexander,!E.!S.!et!al.!Twin!and!family!studies!reveal!strong!environmental!and!
weaker!genetic!cues!explaining!heritability!of!eosinophilic!esophagitis.!The!Journal!
of!allergy!and!clinical!immunology!134,!1084B1092!e1081,!
doi:10.1016/j.jaci.2014.07.021!(2014).!
66! Rothenberg,!M.!E.!et!al.!Common!variants!at!5q22!associate!with!pediatric!
eosinophilic!esophagitis.!Nature!genetics!42,!289B291,!doi:10.1038/ng.547!(2010).!
67! Kottyan,!L.!C.!et!al.!GenomeBwide!association!analysis!of!eosinophilic!esophagitis!
provides!insight!into!the!tissue!specificity!of!this!allergic!disease.!Nature!genetics!46,!
895B900,!doi:10.1038/ng.3033!(2014).!
! 185 68! Wang,!R.!et!al.!GARP!regulates!the!bioavailability!and!activation!of!TGFbeta.!Mol!Biol!
Cell!23,!1129B1139,!doi:10.1091/mbc.E11B12B1018!(2012).!
69! Aceves,!S.!S.!et!al.!Resolution!of!remodeling!in!eosinophilic!esophagitis!correlates!
with!epithelial!response!to!topical!corticosteroids.!Allergy!65,!109B116,!
doi:10.1111/j.1398B9995.2009.02142.x!(2010).!
70! Cousineau,!I.!&!Belmaaza,!A.!EMSY!overexpression!disrupts!the!BRCA2/RAD51!
pathway!in!the!DNABdamage!response:!implications!for!chromosomal!
instability/recombination!syndromes!as!checkpoint!diseases.!Mol!Genet!Genomics!
285,!325B340,!doi:10.1007/s00438B011B0612B5!(2011).!
71! Mahajan,!V.!B.!et!al.!CalpainB5!mutations!cause!autoimmune!uveitis,!retinal!
neovascularization,!and!photoreceptor!degeneration.!PLoS!Genet!8,!e1003001,!
doi:10.1371/journal.pgen.1003001!(2012).!
72! Singh,!R.!et!al.!Calpain!5!is!highly!expressed!in!the!central!nervous!system!(CNS),!
carries!dual!nuclear!localization!signals,!and!is!associated!with!nuclear!
promyelocytic!leukemia!protein!bodies.!The!Journal!of!biological!chemistry!289,!
19383B19394,!doi:10.1074/jbc.M114.575159!(2014).!
73! Massague,!J.!TGFbeta!signalling!in!context.!Nat!Rev!Mol!Cell!Biol!13,!616B630,!
doi:10.1038/nrm3434!(2012).!
74! Eschborn,!M.!et!al.!Activated!glycoprotein!A!repetitions!predominant!(GARP)B
expressing!regulatory!T!cells!inhibit!allergenBinduced!intestinal!inflammation!in!
humanized!mice.!The!Journal!of!allergy!and!clinical!immunology!136,!159B168,!
doi:10.1016/j.jaci.2015.04.020!(2015).!
! 186 75! Emami,!N.!&!Diamandis,!E.!P.!Potential!role!of!multiple!members!of!the!kallikreinB
related!peptidase!family!of!serine!proteases!in!activating!latent!TGF!beta!1!in!semen.!
Biol!Chem!391,!85B95,!doi:10.1515/BC.2010.007!(2010).!
!
! 187 Table&4.1:&Proteins&Interac4ng&with&LRRC31& Protein Full Name MW (kD) Score Queries HSP90AB1 Heat Shock Protein 90β 84 370 5 PRMT5 Arginine N-Methyltransferase 5 62 129 5 LRRC31 Leucine-Rich Repeat-Containing Protein 31 62 1063 316 PFKFB3 6-Phosphofructo-2-Kinase/Fructose-2,6-Bisphosphatase 3 55 424 15 TAB1 TGF-β-Activated Kinase 1 and MAP3K7 Binding Protein 1 55 156 2 ATP5A1 ATP Synthase Subunit α Precursor 46 115 1 HNRNPH1 Heterogeneous Nuclear Ribonucleaoprotein H1 49 83 2 Table 4.1 | Proteins interacting with LRRC31. Proteins that co-immunoprecipitate with LRRC31 flag-epitope tag following flag Immunoprecipitation in HEK 293T cells overexpressing LRRC31 flag-epitope. Identified by LC-MS:MS. Interactions considered significant if score > 100 or queries > 2. Only differentially binding, significant proteins shown. n = 1.
188# 12
10 LRRC31 overexpressed 8 LRRC31 control
6
4 miRNA-375/U6snRNA miRNA-375/U6snRNA 2
0 Control 90 minutes 180 minutes Time Figure 4.1 | LRRC31 overexpression regulates miR-375 expression. Control cells and LRRC31 overexpressing Caco2-bbe cells were treated with IL-13 and normalized miRNA-375 expression measured at 0 minutes (Control), 90 minutes, and 180 minutes by qPCR gene expression analysis. n = 3.
189# Figure 4.2 | Pathway analysis of genes regulated by LRRC31 overexpression. Ingenuity Pathway Analysis of genes significantly dysregulated in LRRC31 overexpression in EPC2 cells grown at the ALI. Red indicates upregulation and green indicates downregulation.
190# Cell Esophageal Epithelium LRP1B Motility
Barrier LRRC31 TRIM31 KLKs Function
NOG Basal Cell Hyperplasia STAT6 IL-13 Figure 4.3 | Model of LRRC31 function in the esophageal epithelium. IL-13 activates STAT6 to induce LRRC31 expression in esophageal epithelial cells. LRRC31 interacts with TRIM31 to modulate gene expression of LRP1B, KLKs, and NOG. Increased LRP1B decreases cell motility, increased KLKs decreases barrier function, and decreased NOG increases basal cell hyperplasia. Boxes that are gray are hypothesized. Modified from D’Mello RJ, et al. Mucosal Immunology (In Press).
191#