University of Nebraska - Lincoln DigitalCommons@University of Nebraska - Lincoln
Theses and Dissertations in Animal Science Animal Science Department
Spring 5-2014 The ffecE ts of Feed Additives, Housing Systems, and Stress on Salmonella Shedding in Single Comb White and Brown Laying Hens Dana L. Hahn University of Nebraska-Lincoln, [email protected]
Follow this and additional works at: http://digitalcommons.unl.edu/animalscidiss Part of the Poultry or Avian Science Commons
Hahn, Dana L., "The Effects of Feed Additives, Housing Systems, and Stress on Salmonella Shedding in Single Comb White and Brown Laying Hens" (2014). Theses and Dissertations in Animal Science. 84. http://digitalcommons.unl.edu/animalscidiss/84
This Article is brought to you for free and open access by the Animal Science Department at DigitalCommons@University of Nebraska - Lincoln. It has been accepted for inclusion in Theses and Dissertations in Animal Science by an authorized administrator of DigitalCommons@University of Nebraska - Lincoln.
THE EFFECTS OF FEED ADDITIVES, HOUSING SYSTEMS AND STRESS ON SALMONELLA SHEDDING IN SINGLE COMB WHITE AND BROWN LAYING HENS
by
Dana L. Hahn
A DISSERTATION
Presented to the Faculty of
The Graduate College at the University of Nebraska
In Partial Fulfillment of Requirements
For the Degree of Doctor of Philosophy
Major: Animal Science
Under the Supervision of Professor Sheila E. Purdum
Lincoln, Nebraska
May 2014
THE EFFECTS OF FEED ADDITIVES, HOUSING SYSTEMS AND STRESS ON SALMONELLA SHEDDING IN SINGLE COMB WHITE AND BROWN LAYING HENS
Dana Leigh Hahn, Ph.D.
University of Nebraska, 2014
Adviser: Sheila E. Purdum
A series of studies were conducted examining feed additives, housing systems and stress on Salmonella shedding. Alternative feed additives such as prebiotics, probiotics and essential oils have been shown to reduce pathogenic bacteria colonization.
Furthermore, stressors such as movement have been shown to increase Salmonella shedding. The goal of the studies was to examine if alternative ingredients reduce
Salmonella shedding in alternative housing systems and through movement stress. Study
1 examined cage and cage-free housing with mannan oligosaccharide (MOS) supplementation. Treatments were arranged in a 2x2 factorial design: cage or cage free;
MOS (0% or 0.08%). There was no effect on housing system or MOS for Salmonella. E. coli fecal counts increased at 73 wks of age for MOS diets. E. coli and coliforms were three times more likely to be found on eggshells from cage free pens then cage. MOS reduced E. coli colonization in duodenum. Study 2 examined the effect of transportation stress at 16 wks of age on S. enteritidis (SE) shedding through peak lay (33 wks).
Incidence of SE positive increased leading up to peak lay. Study 3 examined Salmonella vaccination, movement stress and feed additives in laying hens (43-50 wks of age).
Treatments were arranged in a 3x2 factorial design: vaccination (yes or no), feed additive
(control, 0.03% MOS or 0.15% synergistic). Feed additives did not have a significant
effect on production parameters or Salmonella. Vaccinated hens fed MOS had the highest egg wt. Study 4 examined feed additives on pullets (1 day-22 wks), gut microbiome and SE prevalence (12-22 wks of age). Six treatments were arranged in a completely randomized design: control, 0.01% 1x1010 P. acidilactici , 0.01% 2x1010 live
S. cerevisiae boulardii, 0.1% MOS, .01% 1x1010 P. acidilactici+ 0.1% MOS, 0.01%
2x1010 live S. cerevisiae boulardii + 0.1% MOS. Treatments did not have an impact on
Salmonella fecal counts, E. coli, coliform fecal and ceca counts or Enterobacteriacea fecal counts. No Salmonella was found in the ceca. All treatments saw a decrease in
Enterobacteriacea except for MOS. Current vaccination programs are reducing the risk for Salmonella.
Keywords: Laying hens, Salmonella, prebiotic, probiotic, MOS
i
DEDICATION
This dissertation is dedicated to my loving and supportive family and husband. Without you, none of this would be possible.
ii
AKNOWLEDGEMENTS
There are many people that I need to thank, first of which are the members of my committee. I have thoroughly enjoyed learning from all of you.
Dr. Sheila Purdum, working with you these past 5 years has been quite a journey.
It is very difficult to put into words my gratitude to you, but I will try. I’ve grown leaps and bounds under your patient and watchful eye. You taught me so many lessons and instilled confidence in me that I will never forget. Thank you for allowing me to learn and grow, thank you for seeing something in me that I didn’t realize I had. You have been a wonderful mentor, I’m forever greatful for this experience.
Dr. Kathy Hanford, thank you for working with me these past 5 years. You taught me so much, words cannot express my gratitude towards you. Thank you for serving not only on my M.S. committee, but also on my Ph.D. committee.
Dr. Samodha Fernando, thank you for your guidance and expertise while allowing me to learn from you and members in your lab. I’m truly thankful for the experience.
Dr. Julie Albrecht, thank you for serving on this committee. You have offered a unique persepective and I have learned a great amount from you.
Thank you to the University poutry group, Brett Kriefles, Pamela Eusebio, Anna
Stiener and Leo Sweet for all of your support. Special thank you to David Giraud, Chris
Anderson, and Nirosh Aluthge for all of your assistance with lab work and answering all of my questions. iii
I had the unique opportunity to leave early and work for Smart Chicken. Many thanks go to Bill Schellpeper for taking a chance on me while also allowing me to finish my degree. The entire live operations team: Mandy Wood, Trish Weber, Chris
Thompson, Bertus Byleveld, Derek Kraayenbrink, Dave Smith and Steve Helser, thank you for your support.
This section would not be complete without giving thanks to my close circle of friends I made here: Adria Bhatnager, Katie Lucot, and Kim Varnold. You all were my anchor through this crazy journey called grad school. I cannot put into words how much your support ment to me, so a simple thank you will have to do.
I would like to extend my deepest gratitude to my parents, Mark and Sue Hahn,
Sister, Laura Hahn and my newest extended family: Michael and Debra Didde and Sarah
Didde. You all offered so much support throughout this whole process, even if you didn’t completely understand what I was doing, you offered unconditional and unwavering support, for that, thank you. To all of my close friends down in KC and
Nashville, thank you, I love you all.
Last, but most definitely not least, my deepest thanks to my loving husband, Mark
Didde. You were with me every step of the way from day one of my Master’s to now.
You supported me through everything; I’m so excited to share this with you. This dissertation is as much your accomplishment as it is mine. Thank you and I love you.
iv
TABLE OF CONTENTS
Chapter 1—Literature Review……………………………………………………….. 1
1.1 Introduction………………………………………………..…………………..1
1.2 History of Salmonella in Poultry Production………………………………….3
1.4 Infection Biology of Avian Salmonellosis…………………………………….6
1.5 The Carrier State and Shedding…………………………...…………....……..9
1.6 Methods of Egg Contamination of S. enteritidis...………….…………..…....12
1.7 Control Programs of S. enteritidis………………...………...….……….....…14
1.8 Introduction to Poultry Microbiome…………...…………….……………….17
1.9 Probiotics………………………………………...……….……………….….19
1.10 Prebiotics……………………………………………………………………22
1.11 Organic Acids and Essential Oils…...... 25
1.11.1 Organic Acids……………………………………………..26
1.11.2 Essential Oils……………………………………………...28
1.12 Alternative Housing in Poultry……………………………………………..31
1.13 Types of Housing Systems…………...…………………………………….32
1.14 Food Safety and Alternative Housing…...... 35
1.15 Conclusions………………………………………………………………...38
1.16 References………………………………………………………...……...... 39
Chapter 2—The Effects of a Mannanoligosaccharide on Salmonella, E. coli, and Coliform Shedding in Cage and Cage Free Environments………………………………57
2.1 Abstract………………………………....…………………………………….57
v
2.2 Introduction…………………………...…….………………………………...58
2.3 Materials and Methods……………..………………………………………..61
2.4 Results and Discussion…………...…………...……………………………..68
2.5 References………………………………...………………………………….79
Tables and Figures………………………………………………………………...83
Chapter 3—Observation of Salmonella Enterica serovar Enteritidis in Laying Hens During Travel Stress Through Peak Lay………………………………………………...99
3.1 Abstract………………………………………………………………………99
3.2 Introduction…………………………….……...…………………………....100
3.3 Materials and Methods……………………………...……………………...102
3.4 Results and Discussion……………………………………………………..105
3.5 References…………………...……………………………………………..109
Tables and Figures……………….…………………………………………..…111
Chapter 4—Effects of a MOS or Prebiotic Combination on Salmonella Shedding Through a Transport Stress in Laying Hens…………………………………………....113
4.1 Abstract…..…………………………………..……………………………..113
4.2 Introduction………….….…………….…………………………………….114
4.3 Materials and Methods………………….………………………………….118
4.4 Results and Discussion………...…………..……………………………….123
4.5 References……………………………..……………………………………130
Tables and Figures………………………..……………………………………..135
Chapter 5—Prebiotics or Probiotics Used Alone or in Combination and Effects on Pullet Growth and Intesitinal Microbiome…………………………………………………...141
5.1 Abstract……………………………………………………………………141
5.2 Introduction………………………………………………………………..142 vi
5.3 Materials and Methods…………………...……………………………….144
5.4 Results and Discussion…………………………………………………….152
5.5 References…………………………….…………………………………....156
Tables………………………………………………………………………160
Chapter 6-Implications
6.1 Implications……………………….………………………………….……165
vii
LIST OF TABLES
Chapter 2—The Effects of a Mannanoligosaccharide on Salmonella, E. coli, and Coliform Shedding in Cage and Cage Free Environments
2.1 Diet Composition….……………………...………………………………….83
2.2 Production Data: Feed Intake, Egg Production, Egg Wt, and Feed Conversion…………………….….………………………………….84
2.3 Fecal E. coli and Coliform CFU/g………....……...…………………………88
2.4 Fecal Salmonella Prevalence……………...…………….……………………89
2.5 Fecal Salmonella Prevalence 72, 74, and 76 wks of age………....…………..90
2.6 Prevalence of E. coli on Eggshell……………………………..……………...91
2.7 Prevalence of Coliforms on Eggshell………………………..……………….92
2.8 Prevalence of Salmonella on the Eggshell……………………..…………….93
2.9 Effect of MOS and Housing on E. coli Eggshell Prevalence wks 73, 75, and 77……………….………………………………………………94
2.10 Effect of MOS and Housing on Coliform Eggshell Prevalence wks 73,75, and 77………..………………………………………………………95
2.11 Effect of MOS and Housing on Salmonella Eggshell Prevalence wks 72, 74 and 76………………………………………………………………..96
2.12 Effect of MOS on E. coli Population in Duodenum and Ceca…...….……..97
2.13 Effect of MOS on Salmonella Populaiton in Duodenum and Ceca………..98
Chapter 3—Observation of Salmonella Enterica serovar Enteritidis in Laying Hens During Travel Stress Through Peak Lay
3.1 Presumptive and Confirmed SE Positives by Pen Assignment and Age..…111
Chapter 4—Effects of a MOS or Prebiotic Combination on Salmonella Shedding Through a Transport Stress in Laying Hens
4.1 Diet Composition…………………………………………………………...135
viii
4.2 Production Results: Egg Production, Feed Intake, Egg Wt, Egg Mass, and Feed Conversion…………………………....…...... 136
4.3 Cloaca Salmonella Counts and Hen Wts……………...………..…………..138
4.4 Cloaca Salmonella Prevalence……………………………………..……….139
4.5 Odds Ratios: Cloaca Salmonella Prevalence……………………………….140
Chapter 5—Prebiotics or Probiotics Used Alone or in Combination and Effects on Pullet Growth and Intestinal Microbiome
5.1 Diet Compositions………………………………………………………….160
5.2 Influence of Probiotics, Prebiotics, or Combination on ADFI, Average BW, BWG, and FCR………………………………………………….161
5.3 CFU/g Counts for Fecal Samples…………………………………………..162
5.4 CFU/g Counts for Ceca Samples………………….………………………..163
5.5 Treatment Effects on Fecal SE Prevalence…………….…………………...164
Chapter 6 –Implications
6.1 Overview of Measurements……………………………………………...…167
ix
LIST OF FIGURES
Chapter 2—The Effects of a Mannanoligosaccharide on Salmonella, E. coli, and Coliform Shedding in Cage and Cage Free Environments
2.1 Feed Intake: Housing System by Time…………...…………………………85
2.2 Egg Production: Housing System by Time…………...……………………..86
2.3 Egg Wt: Housing System by Time………………………………………..….87
Chapter 3—Observation of Salmonella Enterica serovar Enteritidis in Laying Hens During Travel Stress Through Peak Lay
3.1 Egg Production vs. Presumptive Positive and Confirmed Positive by Wk of Age……………………………….……………112
Chapter 4—Effects of a MOS or Prebiotic Combination on Salmonella Shedding Through a Transport Stress in Laying Hens
4.1 Egg Wt by Treatment………………………………………………………137
1
CHAPTER 1: LITERATURE REVIEW
1.1 INTRODUCTION
Each year in the US there are approximately 42,000 cases of salmonellosis reported, with 400 being fatal in 2012 (CDC, 2012). In an analysis conducted in 1998, estimated that salmonellosis costs the US nearly 2.3 billion dollars (Frenzen et al., 1999).
A majority of these costs are due to of medical care (Frenzen et al., 1999). Overall, incidence of salmonellosis has declined since 1987, but still remain at high levels (Cogan and Humphrey, 2003). There are 2,400 different Salmonella serovars associated with human salmonellosis cases with, S. Typhimurium and S. Enteritidis being the two most frequently serotypes reported (Cogan and Humphrey, 2003). Of the two, S. Enteritidis is to be closely associated with poultry and eggs (Cogan and Humphrey, 2003).
As a result of the profound health and economic impact salmonellosis has in the
US and worldwide, it is imperative that precautions be taken to reduce the amount of
Salmonella in poultry environments and eggs. One of the strategies being examined currently is the use of feed additives such as prebiotics, probiotics, essential oils, and organic acids. Each of these feed additives has different properties that have been shown to be effective against Salmonella. Prebiotics are nondigestible food ingredients for the host that selectively stimulates the growth or activity of one or a limited number of bacteria in the colon (Gibson and Roberfroid, 1995; Gaggia et al., 2010). Probiotics are live microorganisms that when administered exhibit health benefits to the host, which include: regulation of bacterial homeostasis, stabilization of gastrointestinal barrier function (Salminen et al., 1996; Gaggia et al., 2010), expression of bacteriocins 2
(Mazmanian et al., 2008; Gaggia et al., 2010), immunomodulatory effects (Salzman et al., 2003; Gaggia et al., 2010). The hypothesis for the use of prebiotics and probiotics in animal industry is similar, attempting to modulate the animal’s gut microbiota of the animal for better gut health and a reduction of pathogen invasion.
The use of both essential oils and organic acids has gained recent attention due to the public pressure to stop antibiotics as growth promoters and also because of their antimicrobial properties (Van Immerseel et al., 2006). Essential oils are complex mixtures of plant metabolites consisting of low-boiling-phenylpropenes and terpenes
(Brenes and Roura, 2010). Essential oils can be extracted from plant material such as: flowers, buds, seeds, leaves, twigs, bark, herbs, wood, fruits and roots (Brenes and Roura,
2010). Essential oils offer a potential natural method of reducing pathogens in the gastrointestinal tract of poultry. Organic acids are short chain or medium chain fatty acids that have a long history of being utilized in food production as an antimicrobial.
Organic acids can either be directly added to feed or are the result of fermentation of starter cultures. Both essential oils and organic acids have shown promising results in reducing Salmonella in vitro, however more studies need to be conducted in vivo to evaluate their efficacy.
Adding to food safety concerns, alternative systems such as cage-free, aviary and enriched cages are becoming more prevalent in the US. In California, due to Proposition
2, laying hens will not be allowed to be housed in conventional cages. As a result, United
Egg Producers (UEP) and the Humane Society of the US (HSUS) have come forth with a bill that will require all hens in the US to be housed in enriched colony cages by 2029
(O’Keefe, 2011; Green and Cowan, 2012). As a result, studies are being conducted 3 examining the food safety aspect of eggs produced in conventional systems versus alternative systems. Results have been varied, with some studies finding no differences between conventional and alternative systems (Jones et al., 2012), some finding large differences in favor of conventional cages (Methner et al., 2006; Wales et al., 2007; Snow et al., 2009). As a result, more work needs to be conducted examining the impact alternative systems have on egg food safety.
1.2 INTRODUCTION TO SALMONELLA
Salmonella is a gram negative, facultative, mobile bacteria of the phyla enterobacteriacea (Brenner et al., 2000; Grimont et al., 2000; Kim et al., 2006; Park et al.,
2009; Park et al., 2013). Salmonella are further divided taxonomically into Salmonella enterica and Salmonella bongori (Park et al., 2013). Salmonella enterica cause a variety of diseases, which are commonly referred to as salmonellosis in humans and other mammals (Grimont et al., 2000; D’Aoust and Maurer, 2007; Park et al., 2013).
Salmonella enterica species are composed of more than 2,500 serotypes, which are determined by the somatic (O), flagellar (H) and capsular (K) antigens (Grimont and
Weill, 2007; Park et al., 2013).
In humans, Salmonella infection can be divided into two categories: typhoid fever which is caused by Salmonella Typhi and Paratyphi or gastroenteritis (Kim et al.,
2006; Nester et al., 2006; Park et al., 2013). Gastroenteritis occurs in animals as well as humans and is caused by other S. enterica serovars, for the purpose of this review the focus will be on gastroenteritis. The symptoms of gastroenteritis in humans are characterized by nausea, headache, diarrhea and fever (Park et al., 2013). In the US 4 alone, approximately 40,000 cases are reported each year which result in approximately
1% mortality level (Park et al., 2013). Most cases resolve themselves within a few days, in some individuals such as the very young and old, the infections may become serious.
Most Salmonella infections in both humans and animals are transmitted in a fecal to oral route. This is by ingesting food or water that has been contaminated with fecal matter. For a human to exhibit symptoms of salmonellosis, at least 106 to 109 cells need to be ingested (Nester et al., 2009; Park et al., 2013). Salmonella are sensitive to acidic conditions, but if introduced to slightly acidic conditions, they can express acid shock proteins during log or stationary growth (Foster, 1991; Foster and Spector, 1995; Park et al., 2013). Through this mechanism, they survive the stomach and enter the small intestine where they adhere to epithelial cells by the type III secretion system, and from there can access different tissues within the body such as liver, bile, bloodstream and spleen (Raskin et al., 1997; Lamont, 2004; Nester et al., 2009; Park et al., 2013).
In poultry, it has been speculated that more than 200 serovars of Salmonella have the ability to colonize the gastrointestinal (GI) tract (Gast, 2007; Foley et al., 2011). The outcomes of these infections can range from a subclinical infection that is not noticed by the producer to death (Park et al., 2013). None the less, because of the number of
Salmonella serovars that are capable of colonizing the chicken GI tract, poultry serve as an important vector for Salmonella in humans (Ricke et al., 2001; Ricke 2003b; Howard et al., 2012; Park et al., 2013). It is most commonly passed from poultry to humans through meat and egg products, posing a food safety risk for consumers and a challenge to keep Salmonella at reasonable levels for producers. 5
1.3 HISTORY OF SALMONELLA IN POULTRY PRODUCTION
Salmonella enteritidis has been a constant battle for the poultry industry reportedly since the mid-1970’s (Baumer et al., 2000; Guard-Petter, 2001). However, it is interesting to note that it has not always been on the forefront. There is evidence that
S. enteritidis gained a foothold in poultry production as early as the mid 1960’s (Baumer et al., 2000). This is because of the interplay between S. pullorum, S. gallinarum and the possibility of competitive exclusion of S. enteritidis.
In the 1930’s in both Britain and the US, pullorum disease, caused by S. pullorum had a serious economic threat on the poultry industry (Bullis, 1977; Baumer et al., 2000).
In response, the National Poultry Improvement Plan (NPIP) was established in the US in
1935 and voluntary testing of poultry flocks began (Baumer et al., 2000). The testing was done by a whole blood agglutination assay of a stained antigen; in 1956 the testing was expanded to include S. gallinarum (Baumer et al., 2000). The test expanded to both types of Salmonella as both were part of the O9 serotype group (Baumer et al. 2000). As a result of the testing, any birds testing positive were culled, thus by the mid-1970’s S. pullorum and S. gallinarum were eliminated from poultry flocks in the US (Baumer et al.,
2000).
Before the 1930’s, S. enteritidis was primarily found in rodents, as they are the animal reservoir for this pathogen (Baumer et al., 2000; Rabsch et al., 2000; Guard-
Petter, 2001). However; the exclusion of S. pullorum and S. gallinarum likely led to an open niche that was quickly filled by S. enteritidis. This is exhibited by the frequency of
S. enteritidis infections in the US, where it moved from the sixth most causative serotype 6 in 1963 to the third most common in 1967 (Aserkoff et al., 1970; Baumer et al., 2000).
One hypothesis as to why and how S. enteritidis gained its foothold in poultry houses is proposed by Baumer et al. (2000), “…the elimination of S. pullorum “reactors” may have increased the ability of S.enteritidis to gain a foothold in poultry flocks. The O antigen of
S. enteritidis, S. pullorum and S. gallinarum consists of the O12 antigen (a sugar backbone composed of O-polysaccharide repeating units) and the O9 antigen (a tyvelose sugar chain). Chickens infected with S.gallinarum or S. pullorum develop O9 antibody titers that are > 10 fold higher than O12 antibody titers (Barrow et al., 1992) suggesting that the O9 antigen is immunodominant.” In short, this explains that how chickens exposed to S. gallinarum and S. pullorum, develop a very effective immune response to
S.enteritidis, which also explains why it was not seen in high numbers in chickens until the mid 1960’s. S. enteritidis incidence continued to rise and by 1990, displaced
S.typhimurium as the primary cause of salmonellosis in the world (Guard-Petter, 2001;
Baumer et al., 2000). With this rise, epidemiological studies confirmed that eggs were the food most commonly associated with S.enteritidis (Guard-Petter 2001; Anonymous,
1999; 2001; St Louis et al., 1988; Ullmann and Scholtze, 1989). As a result of the unique method S. enteritidis gained its foothold in poultry, it is the only serovar of Salmonella routinely found in eggs, thus creating a unique food safety challenge (Guard-Petter,
2001).
1.4 INFECTION BIOLOGY OF AVIAN SALMONELLOSIS
Laying hens are housed in a variety of environments ranging from conventional cages to cage free with outdoor access. As a result of this range in housing, along with pest inhabitation such as rodents, insects and in some cases, wild birds, a wide variety of 7 niches are provided are provided to bacteria to fill within the environment (Guard-Petter,
2001). S. enteritidis is most commonly passed from rodents and insects to the laying hen, which is why it cannot be eliminated as easily as S. pulloreum and S. gallinarum
(Baumler et al., 2000; Guard-Petter, 2001). S.enteritidis is continually being reintroduced into the environment as pests gain access to the hen house, reproduce and allow S.enteritidis to continue to colonize. Hens gain access to S.enteritidis by ingesting contaminated insects, feed or water; from there it is most likely to colonize in the ileum and ceca (Chappell et al., 2009). One interesting characteristic of S.enteritidis is that it is not likely to cause illness in hens (Guard-Petter, 2001). This is in distinct contrast to
S.enteritidis predecessors S. gallinarum and S. pullorum, which caused mortality, weight loss, and a distinct decrease in egg production (Guard-Petter, 2001; Shivaprasad, 2000;
Snoeyenbos, 1991).
A systemic infection of Salmonella has three distinct phases (Chappell et al.,
2009). During each of these phases, the immune system is heavily involved. The first phase is invasion of the gastrointestinal tract; second establishment of systemic infection by intracellular infection of macrophages (Chappell et al., 2009); third, there are three possible end results: infection is cleared by immune response, bird succumbs to the infection or a carrier state develops (Chappell et al., 2009).
Beginning with intestinal invasion, in mammals Salmonella invades the Peyer’s patches and M cells in the ileum (Chappell et al. 2009). A gastrointestinal invasion results in enteritis through a combination of secretion effectors of Salmonella pathogenicity island 1 type III secretion system and recognition of flagella and lipopolysaccharide (LPS) through toll like and other pattern recognition receptors (Wallis 8 et al., 1999; Shivaprasad, 2000; Gerwirtz et al., 2001; Zeng et al., 2003; Chappell et al.,
2009;). This leads to a pro-inflammatory cytokine and chemokine response (Chappell et al., 2009).
The avian gastrointestinal tract is much different than the mammalian species, with noted differences being the crop, gizzard and lymph system. Outside infecting bacteria pass through the crop prior to entering the proventriculus and gizzard. The crop has a pH of 4-5, which induces acid adaptation mechanisms of Salmonella that help with passage through the proventriculus and gizzard (Chappell et al., 2009). Entering the small intestine, which is the main infection site in mammals, the chicken does not have distinct lymph nodes and Peyer’s patches but more diffuse lymphoid aggregates and
Peyer’s patches (Chappell et al., 2009). The main site of Salmonella colonization is the ceca. Cecal tonsils are the largest secondary lymphoid organs of the chicken gastrointestinal tract and located at the ileo-cecal junction (Chappell et al., 2009).
Following intestinal invasion, it is believed that Salmonella are taken up by macrophages or dendritic cells and transported to the spleen and liver (Mastroeni and
Menager, 2003; Chappell et al., 2009) It is there that Salmonella develops a key relationship with macrophages, as it is crucial to its survival in the host (Barrow et al.,
1994; Chappell et al., 2009). The pathogencity island 2 (SPI-2) type III secretion system has a key role in this relationship. Once Salmonella is within the phagocyte vacuole of a macrophage, there is an injection of effector proteins that prevents fusion of phagosomes with lysosomes (Cheminay et al., 2005; Chappell et al., 2009). Lysosomes contain degenerative enzymes and other antimicrobial compounds that would destroy Salmonella 9 encapsulated in the phagosomes. In order for Salmonella to survive in its host, it must be able to survive and multiply in the macrophage, which will lead to a systemic infection.
After establishment of a systemic infection, three scenarios will play out. First, the chicken may clear or control the replication of bacteria then clear the infection through adaptive (learned) immunity (Chappell et al., 2009). If replication is not controlled by innate (first response) immunity, Salmonella replicates in the spleen and liver leading to lesions and can shed back into the gastrointestinal tract (Chappell et al.,
2009). If this occurs, it will result in death of the bird within 6 to 10 days following infection (Shivaprasad, 2000; Wigley et al., 2002a; Chappell et al., 2009;). Carrier state infections frequently occur in birds more than a few days old; the majority of bacteria appear to be cleared by the immune response, with small numbers persisting within intracellular niches (Chappell et al., 2009).
1.5 THE CARRIER STATE AND SHEDDING
Although there have not been many studies examining the carrier state and shedding, especially in older laying hens, there are some inferences that can be made.
The consensus among researchers is that the bird develops the carrier state when infection occur early post hatch (Cox et al., 1996; Gast and Holt, 1998). Furthermore,
Cox et al., (1996) conducted a series of studies in which day old broiler chicks were subjected to S. typhimurium inoculation through a variety of methods: naval, oral, and aerosol. The findings showed regardless of the source, exposure to low levels of
Salmonella in newly hatched chicks leads to gut colonization (Milner and Shaffer, 1952; 10
Cox et al., 1991; Cox et al., 1996). This is attributed to the chick lacking a mature gut microbiome to compete with Salmonella, allowing for colonization (Cox et al., 1996).
To further expand on the above study, Gast and Holt (1998) examined the shedding of S. enteritidis in experimentally inoculated one day old layer chicks until maturity. Their findings were that after 4 weeks of age, there were no positives in spleen or liver samples, however 40% of cecal samples tested positive through 16 weeks of age
(Gast and Holt, 1998). In addition, colonization persisted into early stages of lay as 58% of hens shed S. enteritidis into feces from 18-24 weeks of age. In addition to the positive hens, there were 448 egg pools conducted during the study, with only 2 egg pools testing positive (Gast and Holt, 1998). Conclusions drawn were although there were high colonization rates of cecum, liver and spleen initially, only the intestinal tract was colonized after 4 weeks postinoculation (Gast and Holt, 1998). In addition, neither immunological maturation nor the development of microflora could dislodge S. enteritidis from the ceca (Gast and Holt, 1998).
The above studies focused on experimental colonization, where the results are more dramatic and dosage levels are much higher than what they would be in production systems. To account for this, there have been a few studies conducted which examine the dynamics of shedding within layer flocks in production. One study conducted by Schulz et al. (2011) monitored 41 flocks throughout their layer cycle in countries throughout
Europe. Flocks were sampled either three or four times at different intervals. Findings were that hens early in the lay cycle or just reaching sexual maturity, approximately 11-
20 weeks of age, had higher shedding rates than when they were older (51-60 weeks of age) (Schulz et al., 2011). These findings show that the previous thinking that hens that 11 are older have an increase in shedding does not hold true for infected flocks (Schulz et al., 2011). To further confirm these assertions, Johnston et al. (2012) found that as the hen approaches point-of-lay there is a sharp decrease in T lymphocyte and particularly
CD4+ cells. In addition, there have been substantial changes in the organization of lymphocytes in the reproductive tract which was likely to increase susceptibility of reproductive tract infection (Johnston et al., 2012). Finally, due to the immunosuppression that occurs during point-of-lay the efficacy of the vaccine is substantially reduced (Johnston et al., 2012). Possibly leading to an increase in fecal shedding and egg contamination.
Immunosuppression, while a large factor in early shedding of S. enteritidis was most likely not the only factor. Stressors such as transport, feed and climate changes, stocking density and housing can all have a negative effect on the hen’s gastrointestinal tract which most likely results in shedding. A study conducted by Nakamura et al. (1993) found that stressors such as introduction of new hens to the flock and removal of feed and water for 48 hours results in an increase in shedding that lasts several days. Studies have found that any type of feed withdrawal will result in an increase in corticosterone levels
(Freeman et al., 1981; Harvey and Klandorf, 1983) . In addition to these findings, the above stressors including molt had a profound effect on cell-mediated immunity resulting in a decrease in the number of CD4 T-lymphocytes (Holt, 1993). This confirms that at key times in the laying hen’s productive life, shedding occurs through immunosuppression due to an induction of stressors.
12
1.6 METHODS OF EGG CONTAMINATION OF S.ENTERITIDIS
Egg contamination of S. enteritidis is broken down into two possible routes of infection; the first laying contamination and penetration through the egg shell, the second by direct contamination of the yolk or albumen (Humphrey, 1994; Guard-Petter, 2001;
De Buck et al., 2004; Messens et al., 2005a; De Reu et al., 2006; Gantois et al., 2009).
Egg shell contamination is commonly called horizontal transmission, which is characterized by penetration through the eggshell from the colonized gut, contaminated feces, during or after ovoposition (Gantois et al., 2009). Direct contamination of yolk, albumen and eggshell membranes before oviposition, with the infection originating from colonized reproductive organs is called vertical transmission (Timoney et al., 1989;
Keller et al., 1995; Miyamoto et al., 1997; Okamura et al., 2001 a, b; Gantois et al.,
2009). The method of contamination that is most important is debated, however most authors can agree that vertical transmission is most likely the more common route of contaminated eggs (Gast and Beard, 1990; Miyamoto et al., 1997; Guard-Petter, 2001;
Gantois et al., 2009).
Horizontal transmission and inoculation of the outer shell happens after oviposition if the egg is laid in a contaminated environment (Gantois et al., 2009).
Numerous studies have shown that the eggshell appears to be more easily penetrated immediately after lay (Sparks & Board, 1985; Padron, 1990; Miyamoto et al., 1998a;
Gantois et al., 2009). It is hypothesized to that immediately after oviposition, the cuticle covering the pores of the eggshell is not yet mature, which allows for some pores to be 13 open (Gantois et al., 2009). This is compounded by the fact that the egg is laid in a cooler environment than the hen’s body temperature (42°C) creating a negative pressure, allowing bacteria to move more easily through the shell and into the shell membranes
(Gantois et al., 2009). Coupled with the presence of chicken manure facilitates S. enteritidis survival in the environment as it provides protection and nutrients (Schoeni et al., 1995; Gantois et al., 2009). However, it has also been shown that S. enteritidis can survive and grow on the eggshell without fecal contamination, especially at low temperatures and relative humidity (Messens et al., 2006; Gantois et al., 2009). In addition, Salmonella in general, most likely survives for a longer time on the shell surface in storage than other bacteria due to a slowdown in metabolism brought on by low temperatures along with the disadvantageous conditions of a dry egg shell (Gantois et al.,
2009). As a result of these concerns, there is a need to rapidly remove fecal matter from the egg shell surface. Unfortunately, it has been found that rigorous disinfecting and washing practices cannot eliminate S. enteritidis contamination in the egg (Braden, 2006;
Gantois et al., 2009). This is possibly due to egg contamination via penetration has occurred before inspecting the eggs.
Colonization of the eggs during formation is called vertical transmission; this is the method by which most researchers believe to be the most common means of S. enteritidis contamination. Several studies have shown S. enteritidis isolated from reproductive tissues while being absent from the gastrointestinal tract (Lister, 1998;
Gantois et al., 2009). S. enteritidis has adapted and is able to thrive in the reproductive organs of laying hens even though the hen has an innate and adaptive immune response 14 to the infection illustrating that S. enteritidis resides intracellularly to escape the host defense mechanisms (Gantois et al., 2009).
Which region of the hen’s oviduct does S. enteritidis colonizes most frequently is still being debated. The hen’s oviduct is subdivided into five different regions: the ovary, infundibulum, magnum, isthmus, uterus and cloaca (Gantois et al., 2009). The roles of each region are as follows: infundibulum catches the follicles, the magnum manufactures albumen, the isthmus deposits the eggshell membranes, the uterus forms the eggshell and the cloaca is involved in oviposition (Gantois et al., 2009). Thus, S. enteritidis could potentially be incorporated into the albumen, eggshell membranes or the eggshell itself, all depending on which portion of the oviduct it has colonized in. It is debated on which area S. enteritidis is found with the most frequency, the yolk or albumen. Some authors claim albumen is the most frequently contaminated site, leading to colonization to be the highest frequency in the oviduct (Gast and Beard, 1990;
Humphery et al., 1991b; Keller et al., 1995; Miyamoto et al., 1997; De Buck et al.,
2004c; Gantois et al., 2009); others claim S. enteritidis contamination in higher frequency in yolk, lending the ovary to be the primary site of colonization (Bichler et al.,
1997; Gast and Holt, 2000a; Gast et al., 2002; Gantois et al., 2009). After a review of the literature, yolk is most likely the most common place for S. enteritidis to colonize.
1.7 CONTROL PROGRAMS OF S. ENTERITIDIS
Two programs helpful to control S. enteritidis on layer farms include the guidelines set forth by the Food and Drug Administration (FDA) Egg Rule and vaccination of pullets. The egg rule was finalized in 2009 which stated by summer 2012, 15 all producers with greater than 3,000 laying hens and are in the business of providing shell eggs must adhere to this rule (FDA Final Egg Rule, 2009). This rule serves as a guideline and contains minimum requirements farms must comply with in order to continue selling shell table eggs. The program stresses placing a healthy pullet flock, routine testing and monitoring for S.enteritidis while also cleaning and sanitizing between flocks while maintaining adequate biosecurity. In addition, the FDA Egg Rule also requires environmental testing of the flock throughout its lay cycle. If a positive test is found, eggs must be tested to prove that S. enteritidis has not contaminated the eggs.
The first, and one of the most important steps in S.enteritidis control, is ensuring the pullets are S.enteritidis free. This is done by ensuring that the pullets come from a farm where the flock is monitored and come from breeder flocks that are “US S. enteritidis Clean” (FDA Egg Rule Compliance Guide, 2009). One of the methods that has been widely adopted to control S. enteritidis in laying hens is vaccination.
Vaccination of layer flocks has been shown to offer protection against Salmonella invasion, decreasing the level of farm contamination (Van Immerseel et al., 2005). None the less, there are several different factors that can change the effectiveness of vaccines against S. enteritidis.
There are two different classes of Salmonella that invade poultry. One is unrestricted or broad host-range serotypes, which induce self-limiting gastroenteritis in a broad spectrum of hosts (Van Immerseel et al., 2005). The second class is host restricted serotypes, such as S. Gallinarum in poultry, which induce a severe systemic infection and may result in death of the animal (Van Immerseel et al., 2005). Although there has been great response to vaccination against host-specific diseases such as S. Gallinarum, there 16 has been varying success with vaccination against host non-specific serotypes such as S. enteritidis (Smith, 1956; Barrow and Wallis, 2000; Van Immerseel et al., 2005). The differences between the two success rates relates back to the mode of infection. Invasion of host specific serotypes results in a systemic infection and recruitment of monocyte- macrophage series and very little intestinal colonization, whereas non host adapted
Salmonella serotypes results in the exact opposite immune response (Barrow et al., 1994;
Uzzau et al., 2000; Van Immerseel et al., 2005).
As a result of different modes of infection, finding the most effective vaccination method has proven challenging. To begin, there are two types of vaccinations, inactivated (killed) or attenuated (live) (Van Immerseel et al., 2005; Gast and Guard,
2011). Although killed vaccines have been used with success in the poultry industry; it has been shown that live vaccines have advantages over killed vaccines (Van Immerseel et al., 2005; Gast and Guard, 2011). Live vaccines have been shown to have a longer lasting effect on the immune system by stimulating both cell-mediated and humoral responses while recruiting appropriate antigens (Collins, 1974; Van Immerseel et al.,
2005). Killed vaccines have a disadvantage when compared to live vaccines as they only stimulate antibody production (Van Immerseel., 2005). Killed vaccines can destroyed rapidly and eliminated from the host and are unable to produce a cytotoxic T cells; whereas live vaccines have been shown to increase lymphocyte proliferation in response to S. enteritidis antigens (Barrow et al., 1991; Babu et al., 2004; Van Immerseel et al.,
2005). Finally, live vaccines can be administered easily through the water supply, which is helpful to producers (Gast and Guard, 2011). The downside to live vaccines is public acceptability, this issue needs to be addressed as handling of live and killed vaccines are 17 different (Van Immerseel et al., 2005). It is important to highlight that although vaccines against S. enteritidis have been shown to reduce colonization, no vaccine has completely inhibited S. enteritidis. Therefore, a holistic approach of vaccination, sanitation, biosecurity and possibly feed additives such as prebiotics and probiotics may lead to the most well rounded program for prevention of S. enteritidis.
1.8 INTRODUCTION TO POULTRY MICROBIOME
The intestinal tract of the chicken harbors a complex environment and community, including enzymes of digestion, immune function, bacteria and viruses (Wei et al., 2013). This community is best described as a microbiome, which is defined as,
“the ecological community of commensal, symbiotic and pathogenic microorganisms that literally share body space” (NIH HMP Working Group, 2009). Bacteria in the gastrointestinal tract can be divided into two broad categories, commensal or pathogenic bacteria (Wei et al., 2013). Commensal bacteria have an impact on a wide range of functions in poultry such as, the mucosal immune system (Erickson and Hubbard, 2000;
Spellburg and Edwards, 2001; Patterson and Burkholder, 2003), intestinal epithelium
(Freitas and Cayuela, 2000; Deplancke and Gaskins, 2001; McCracken and Lorenz, 2001;
Patterson and Burkholder, 2003) and the gut microbiome which can have positive impacts on feed efficiency (Yeoman et al., 2012). As a result of the impact that commensal bacteria have on gut health, it is important to understand this relationship and how altering commensal bacteria impacts the overall health of the host. Research continues to investigate the relationship of improving gut health and reduction of foodborne pathogens during production. 18
In the past, composition of the poultry microbiome was investigated using culturing techniques. Although some bacteria are culturable, especially areotolerant bacteria, it became evident that not all gut bacteria can be cultured within the lab (Wei et al., 2013),until the early 2000s, when 16S rRNA gene-targeted analyses were applied
(Gong et al., 2002; Zhu et al., 2002; Wei et al., 2013). This technology allowed for an expanded view of the bacteria that inhabit the gut. Wei et al. (2013) examined the contents of chicken and turkey small intestine and ceca contents,and reported that the chicken small intestine is mainly comprised of the following phyla: Firmicutes (70%),
Bacteroidetes (12.3%), and Proteobacteria (9.3%) (Wei et al., 2013). An example of the genera of bacteria found within the phyla Firmicutes includes: Clostridium,
Ruminococcus, Lactobacillus, Eubacteria, Fecalibacterium, Butyrivibrio,
Ethanoligenens, Alkaliphillus, Butyricicoccus, Blautia, Hespellia, Roseburia and
Megamonas (Wei et al., 2013). As for Proetobacteria, the genus Desulohalobium was well represented by the sequences and within Bacteroidetes the genera that were well represented were Bacteroides, Prevotella, Parabacteroides and Alistipes (Wei et al.,
2013). In the ceca, the most prominent phyla were Firmicutes (78%) and Bacteriodetes
(11%), Proteobacteria and Actinobacteria also made up a small number along with other phyla (Wei et al., 2013). Upon closer examination of genera present in the ceca, it differed slightly from the small intestine. In the phylum Frimicutes the following made up the most prominent genera: Ruminococcus, Closdridium and Eubacterium (Wei et al.,
2013). Within Bacteroidetes, the genera Bacteroides was most predominantly expressed; in Proteobacteria phylum, Desulfohalobium, Escherichia/Shigella and Neissenia were the 19 most predominant genera (Wei et al., 2013). Although the function of these bacteria are not discussed, this study assisted in illustrating the chicken mircobiome.
Although the microbiome is very stable, it can be influenced by diet changes, disease and environmental factors (Choct, 2009). Environmental factors can include clean vs. dirty environment, pathogen load, humidity of the houseand various feed additives (Choct, 2009). Finally stress can greatly impact the gut microbiome, such as heat stress, changes in feed or water availability or changes in feed. Feed additives such as probiotics, prebiotics, essential oils, and organic acids are used to modulate the gut microbiome and lead to a healthier gut for the bird.
1.9 PROBIOTICS
The use of live bacteria to modulate gut bacteria is not a new concept. It was first proposed by Elie Metchnikoff based on an observation that Bulgarian peasants lived longer, and they also consumed large amounts of fermented milk products. In 1907,
Metchnikoff proposed that commensal gut bacteria were harmful and consumption of lactic acid bacteria in fermented milk products had a health benefit (Stavric and
Kornegay, 1995; Rolfe, 2000; Patterson and Burkholder, 2003; Walter, 2008). A number of years later, scientists began to discover that there was validity to the original observations and consuming live bacteria cultures could ultimately improve health of the host. Numerous in vivo and in vitro studies have shown that commensal bacteria inhibit pathogens and the addition of probiotics increase resistance to infection by opportunistic pathogens (Stavric and Kornegay, 1995; Rolfe, 2000; Patterson and Burkholder, 2003). 20
Probiotics are best described as a product that contains sufficient numbers of viable bacteria that can alter the microbiome of the host while having beneficial health effects for the host (Fuller, 1992; Patterson and Burkholder, 2003; Park et al., 2013). In order for bacteria to be classified as a probiotic, it must meet specific characteristics and safety criteria. These bacteria have to by non-toxic, non-pathogenic, normal inhabitants of target species, must survive, be able to colonize and be metabolically active in the target site which means that they are able to survive gastric juice and bile, have persistence in the gut, attach to epithelium or mucus and compete with resident microbiota (Gaggia et al., 2010). Probiotics should also produce antimicrobial substances which go along with being antagonistic towards pathogenic bacteria while also modulating the immune response (Gaggia et al., 2010). The genera used for probiotics within the poultry industry are Lactobacillus, Enterococcus, Bacillus, Saccharomyces,
Bifidobacterium, Streptococcus, Aspergillus, and Candida (Lutful Kabir, 2009; Gaggia et al., 2010). Species used for probiotics are varied, the majority of the list is:
Lactobacillus bulgaricus, Lactobacillus acidophilus, Lactobacillus casei, Lactobacillus helveticus, Lactobacillus lactis, Lactobacillus salivarisu, Lactobacillus plantarum,
Streptococcus thermophilus, Enterococcus faecium, Enterococcus faecalis,
Bifidobacterium spp. and Escherichia coli (Lutful Kabir, 2009).
To determine which bacteria should be selected as a probiotic, in vitro assays have been developed (Ehrmann et al., 2002; Lutful Kabir, 2009). If a bacteria strain performs well during in vitro assays, it is selected for use in vivo for its effectiveness and persistence in the gut (Garriga et al., 1998; Lutful Kabir, 2009). During in vivo evaluation, the potential probiotic must exhibit its potential beneficial effects in the host 21
(Lutful Kabir, 2009). Finally, the potential probiotic must still be viable under normal storage conditions and withstand manufacture (Lutful Kabir, 2009).
There are several proposed modes of action for probiotics in poultry. Probiotics function by maintaining a healthy microbiome by competitive exclusion and antagonism
(Rada et al., 1995; Jin et al., 1998; Line et al., 1998; Higgins et al., 2007; Mountzoris et al., 2007), stimulating the immune system while altering intestinal morphology (Kabir et al., 2004; Kabir et al., 2005; Nayebpor et al., 2007; Lutful Kabir, 2009). In addition to competitive exclusion effects, probiotics can exhibit nutritional effects for the host.
These can include a reduction of metabolic reactions that produce toxic substances, stimulation of indigenous enzymes and production of vitamins or antimicrobial substances (Hassanein and Soliman, 2010).
The efficacy of probiotics within poultry is well documented. Oral dosing of poultry with native gut organisms to prevent Salmonella infection was first reported by
Nurmi and Rantala in 1973. In this study, day old broiler chicks were administered normal adult microbiota and its affects against Salmonella infantis infection were tested.
Chicks that were administered the probiotic solution showed a significant inhibition of
S.infantis infection compared to chicks not administered the probiotic solution. Watkins et al., (1982) again demonstrated the beneficial effects of probiotics with germ free chicks inoculated with pathogenic E. coli. Reporting chicks administered Lactobacillus acidophilus before exposure to pathogenic E. coli, L. acidophilus successfully prevented excess mortality. Their study showed L. acidophilus can successfully compete with E. coli in germ free chicks and also showed that competitive exclusion is successful in preventing pathogenic bacteria from colonizing. More recently, Menconi et al. (2011) 22 reported that administering a mixed culture of Lactobacillus to broiler chicks and turkey poults challenged with Salmonella Heidelberg reduced colonization of S. Heidelberg.
Chicks were administered lactic acid bacteria mixture one hour after being challenged orally with S. Heidelberg (Menconi et al., 2011). Results show administration of probiotic mixture one hour after challenge significantly reduced colonization, for broiler chicks, only one had S. Heidelberg colonization. In turkey poults, only nine out of 20 had S. Heidelberg colonization in cecal tonsils compared to the untreated group, in which all poults had S. Heidelberg.
Effects have been similar for laying hens, in a study conducted by Hassanien and
Soliman (2010), laying hens were administered four different levels (0.4%, 0.8%, 1.2%,
1.6%) of a probiotic of Saccharomyces cerevisiae. Results show that inclusion of the probiotic lowered E. coli counts while Lactobacillus spp. increased. The decrease in E. coli is most likely attributed to a binding specificity for the sugar mannose found within the cell wall of Saccharomyces cerevisiae (Line et al., 1998; Laegreid and Bauery, 2004;
Hassanien and Soliman, 2010). As a result of this, mannose, which is a component of S. cerevisiae cell wall, has been found to be an effective prebiotic.
1.10 PREBIOTICS
A prebiotic is classified as “nondigestible food ingredients that beneficially affect the host by selectively stimulating the growth and/or activity of one or a limited number of bacteria in the colon” (Gibson and Roberforid, 1995; Gaggia et al., 2010). For a substrate to be classified as a prebiotic the substrate cannot be hydrolyzed by the stomach or small intestine, it must select for beneficial bacteria in the large intestine, and 23 fermentation of the substrate should have beneficial effects for the host ( Scantlebury-
Manning and Gibson, 2004; Gaggia et al., 2010). Most prebiotics are carbohydrates and oligosaccharides, fiber is one of the main candidates for prebiotics but another is nondigestible oligosaccharides (NDOs) (Gaggia et al., 2010).
Nondigestible oligosaccharides are fructooligosaccharides (FOS, oligofructose and inulin), galactooligosaccharides (GOS), transgalacto-oligosaccharides (TOS), and lactulose (Gaggia et al., 2010). Oligosaccharides consist of 2-10 sugar units with a differing chemical structure (Hajati and Rezaei, 2010). FOS are named by chain length
(degree of polymerization=DP), inulin contains 2-60 DP, synthetic fructan (FOS) contains 2-4 DP and oligofructose (2-9 DP) is formed from partial enzymatic hydrolysis of inulin (Hajati and Rezaei, 2010). Oligosaccharides are naturally occurring and found in plants and vegetables, the most common sources are: onions, bamboo shoots, chicory roots and bananas (Hajati and Rezaei, 2010).
The mode of action of prebiotics in the host are: lowering gut pH through lactic acid production (Chio et al., 1994; Gibson and Wang, 1994; Hajati and Rezaei, 2010), inhibiting or preventing colonization of pathogens (Morgan et al., 1992; Bengmark, 2001;
Hajati and Rezaei, 2010), modifying metabolic activity of commensal bacteria (Demigne et al., 1986; Patterson and Burkholder, 2003; Hajati and Rezaei, 2010) and stimulation of the immune system (Monsan and Paul, 1995; Patterson and Burkholder, 2003;
Janardhana et al., 2009; Hajati and Rezaei, 2010). Prebiotics have also been shown to increase short chain fatty acids, lowering the pH of the cecum and stimulating growth of
Bifidobacterium and Lactobacillus (Cummings and Macfarlane, 2002; Donalson, 2005). 24
Prebiotics have been shown to be most effective in the cecum (Cummings et al., 2001;
Donalson, 2005).
Fructooligosacchrides has been successfully utilized in poultry as a control method for foodborne pathogens such as Salmonella. Yusrizal and Chen (2003b) found that supplementation of FOS increased lactobacilli within the gastrointestinal tract and decreased Campylobacter and Salmonella counts. More recently, Donalson et al. (2008) conducted a study examining the effects of alfalfa and FOS and inhibition of Salmonella.
Results indicated that hens fed diets containing alfalfa and FOS had significantly reduced
S. enteritidis colonization in liver and ovaries of hens undergoing feed withdraw
(Donalson et al., 2008). FOS also increased the levels of acetate, proprionate, butyrate, volatile fatty acid, and lactic acid concentrations (Donalson et al., 2008; Park et al.,
2013). Kim et al. (2011) successfully showed that FOSsupplemented at 0.25, increased
Lactobacillus count while reduced E. coli and C. perfringens.
Mannan oligosaccharides (MOS) are another group of prebiotics that are extensively utilized inthe poultry industry. MOS is a component of the yeast
Saccharomyces cervisiae (Patterson and Burkholder, 2003; Geier et al., 2009; Hajati and
Rezaei, 2010). These components are within the outer layer of yeast cell wall, which includes proteins, glucans, phosphate radicals and mannose (Klis et al., 2002). The cell wall contains 30% mannan, 30% glucan, and 12.5% protein (Hajati and Rezaei, 2010).
MOS protein contains relatively high proportions of serine, threonine, aspartic and glutamic acids and methionine (Song and Li, 2001; Hajati and Rezaei, 2010). The mode of action of MOS is different than other prebiotics, it is proposed that the structure of
MOS acts as a binding site for type 1 fimbrae of pathogenic bacteria such as Salmonella 25
(Park et al., 2013). When the pathogen binds to MOS, it is not able to bind to the gut epithelium and are eliminated from the gut lumen (Newman, 1994; Patterson and
Burkholder, 2003; Park et al., 2013).
Mannanoligosacchrides have been effectively used in poultry to reduce
Salmonella and other pathogenic bacteria colonization while altering gastrointestinal morphology. Spring et al., (2000) showed that MOS can effectively reduce Salmonella colonization, with a 26% decrease in colony forming unit count of S. typhimurium and a
38% decrease of colonization of S. dublin. Fernandez et al. (2000) also found that supplementation of MOS with a competitive exclusion mixture provided effective protection against S. enteritidis in broiler chicks. Baurhoo et al. (2009) found that with the inclusion of MOS, there was an increase in goblet cell number, Bifidobacteria and
Lactobacillus. In addition, at the conclusion of the study, there was a significant decrease in the number of E.coli and Camplyobacter from cecal samples (Baurhoo et al., 2009).
Finally, Kim et al. (2011) showed that supplementation of MOS increased Lactobacillus counts while significantly decreasing E. coli and C. perfringens counts in the small intestine of broiler chicks.
1.11 ORGANIC ACIDS AND ESSENTIAL OILS
Two fairly new groups of feed additives in poultry for pathogen control are organic acids and essential oils. Although used within the food industry for years, they have recently been used in livestock and poultry as feed additives to combat the colonization of foodborne pathogens in the gastrointestinal tract. Organic acids are being examined as possible replacements for antibiotic growth promoters in broilers, turkeys 26 and other livestock as they have been shown to enhances diet palatability, improved nutrient digestibility and feed conversion and growth (Van Immerseel et al., 2006).
Essential oils have shown to have beneficial effects beyond their well known antimicrobial properties. These benefits are on lipid metabolism, stimulation of digestive system, antioxidant properties and anti-inflammatory potential (Acamovic and Brooker,
2005; Brenes and Roura, 2010). In addition, both organic acids and essential oils are generally recognized as safe (Ricke, 2003; Burt, 2004), making both attractive as replacements for antibiotic growth promoters and as control for foodborne pathogens.
1.11.1 Organic Acids
In general, organic acids primarily include saturated straight-chain monocarboxylic acids and their respective derivatives (unsaturated, hydroxylic, phenolic, and multicarboxylic versions) (Ricke, 2003). Organic acids are also generally referred to as fatty acids, volatile fatty acids, weak or carboxylic acids (Cherrington et al., 1991;
Ricke, 2003). Organic acids such as acetate, propionate and butyrate are produced in millimolar amounts in the gastrointestinal tract of poultry, while occurring in higher amounts in areas where strict anaerobes are predominant (Ricke, 2003). In recent years, short chain fatty acids such as formic and propionic acids and medium chain fatty acids have been shown to be effective against foodborne pathogens, especially Salmonella
(Ricke, 2003; Van Immerseel et al., 2006).
The mechanism behind organic acid’s antimicrobial properties is not clearly understood. In the past, the main mode of action was thought to be based around pH lowering properties. This was because organic acids are small and traditionally thought 27 to cross the cell membrane in undissociated form (Ricke, 2003; Van Immerseel et al.,
2006). Once inside the cell cytoplasm, the organic acid dissociates into anions and protons, altering the neutral pH of the cell (Cherrington et al., 1990, 1991; Ricke, 2003;
Van Immerseel et al., 2006). However, it has been shown that fermentative bacteria have the ability to lower intracellular pH when extracellular pH is also low; allowing the cell to adjust its pH gradient (Russell, 1992; Van Immerseel et al., 2006). This observation complements the observation that neutrophilic bacteria are more susceptible to organic acids than acid tolerant bacteria (Van Immerseel et al., 2006). It has also been proposed that organic acids interfere with the bacterial cell membrane and membrane proteins such that electron transport is uncoupled and adenosine triphosphate (ATP) production is reduced (Russell, 1992; Axe and Bailey, 1995; Ricke, 2003). It has also been proposed that organic acids can alter gene expression of hilA, which is a regulator of the pathogenicity island I and is directly involved in the invasion of intestinal epithelial cells
(Bajaj et al., 1996; Darwin and Miller, 1999; Lostroh and Lee, 2001; Van Immerseel et al., 2004).
Organic acids have been used with some success in the poultry industry; however there appears to be conflicting findings about which type of organic acid is the best to use. Iba and Berchieri (1995) reported that adding a mixture of the short chain fatty acids
(SCFA), formic and propionic acid in feed contaminated with different Salmonella spp. decreased the amount of Salmonella recovered in the feed and young broiler chicks. To complement this, Van Immerseel et al (2003) conducted an in vitro study examining the invasion properties of S. enteritidis in avian intestinal epithelial cells in the presence of different SCFA. They reported that when S. enteritidis is exposed to propionate and 28 butyrate, there was a decrease invasion of avian intestinal epithelial cells, whereas acetic and formic acids did not have this effect (Van Immerseel et al., 2003). Medium chain fatty acids (MCFA) have also been shown to be effective against Salmonella. In fact, it has been shown that MCFA are more bacteriocidal to gram negative and gram positive bacteria than SCFA (Nakai and Siebert, 2003). Van Immerseel and coworkers (2004) reported that the MCFA caproic acid was the most effective in decreasing colonization of ceca and internal organs in poultry when given as a feed supplement. In addition, MCFA decreased invasion at the same extent as butyric acid, but at a lower concentration (Van
Immerseel et al., 2004).
1.11.2 Essential Oils
Essential oils are aromatic oily liquid obtained from plant material such as: flowers, buds, seeds, leaves, twigs, bark, herbs, wood, fruits, and roots (Burt, 2004;
Brenes and Roura, 2010). There are a variety of methods to obtain essential oils such as: expression, fermentation, enfleurage or extraction, but steam distillation is most commonly used for commercial production (Van de Braak and Leijten, 1999; Burt,
2004). Although essential oils are most well known for their antibacterial properties
(Carson et al., 1995; Mourey and Canillac, 2002; Burt, 2004), they also have hypolipidemic (Srinivasan, 2004; Brenes and Roura, 2010), antioxidant (Kempaiah and
Srinivasan, 2002; Botsoglou et al., 2004; Brenes and Roura, 2010), digestive stimulant
(Platel and Srinivasan, 2004; Brenes and Roura, 2010), antiviral (Bishop, 1995; Burt,
2004; Brenes and Roura, 2010), antimycotic (Jayashree and Subramanyam, 1999; Mari et al., 2003; Burt, 2004; Brenes and Roura, 2010), antiparasitic (Pessoa et al., 2002; Burt,
2004; Brenes and Roura, 2010) and insecticidal (Karpouhtsis et al., 1998; Burt, 2004; 29
Brenes and Roura, 2010) properties. Although essential oils have a variety of properties, for the purposes of this review the focus will be on antimicrobial properties and use as a poultry feed additive.
Essential oils are very complex and contain many components, which makes it difficult to explain their mode of action (Senatore, 1996; Russo et al., 1998; Brenes and
Roura, 2010). In a broad overview, mixtures contain terpenoids (linalool, geraniol, thujanol, borenol, methol, citronnillol, α-terpineol) and low molecular weight aliphatic hydrocarbons (phenols as thymol, carvacrol, eugenol, gaiacol, and aromatic aldehydes as cinnamaldehyde, cuminal and phellandral) (Dorman and Deans, 2000; Brenes and Roura,
2010). The mixture components can be broken down into two categories, major components (up to 85% of mixture) and minor components (Senatore, 1996; Bauer et al.,
2001, Burt, 2004; Brenes and Roura, 2010). Antimicrobial activity of essential oils is mostly due to its phenolic components (Cosentino et al., 1999; Burt, 2004). It has been speculated that there is a synergistic interplay between major and minor components which is critical for antibiotic activity (Gill et al., 2002; Mourey and Canillac, 2002;
Brenes and Roura, 2010). This is true for sage (Marino et al., 2001), some species of
Thymus (Lattaoui and Tantaoui-Elaraki, 1994; Paster et al., 1995; Marino et al., 1999) and oregano (Paster et al., 1995).
There are many factors that play a part in the chemical composition of essential oils (Burt, 2004; Brenes and Roura, 2010). These factors include species and subspecies, geographical location, harvest time, plant part used, and method of isolation all affect the chemical composition (Consentio et al., 1999; Marino et al., 1999; Juliano et al., 2000;
Faleiro et al., 2002; Burt, 2004; Brenes and Roura, 2010). Generally, essential oils 30 extracted from herbs harvested during or immediately after flowering contain the largest antimicrobial activity (McGimpsey et al., 1994; Marino et al., 1999; Burt, 2004). Since the composition of essential oils is diverse and variable, it is difficult to determine the mode of action of its antimicrobial effects. Researchers attribute the antimicrobial mode of action to their lipophilic character (Greathead, 2003; Applegate et al., 2010), where essential oils may be able to suppress pathogenic bacteria by penetrating into the cell or by disintegrating the cell membrane (Applegate et al., 2010). In addition, it has been shown that essential oils suppress more gram negative bacteria rather than gram positive, which is important for pathogen suppression (Brenes and Roura, 2010).
The antimicrobial affects of essential oils has been well documented in vitro.
Thyme essential oil has been shown to inhibit E. coli growth in media (Farag, et al.,
1989; Hammer et al., 1999; Marino et al., 1999; Griggs and Jacob, 2005). Thymol has been shown to inhibit the growth of both S. typimurium and E. coli (Karapinar and
Aktuğ; 1987; Helander et al., 1998; Griggs and Jacob 2005). The complete essential oils of clove and oregano have been shown to be effective against E. coli and S. typhimurium in culture medium as well (Karapinar and Aktuğ 1987; Farag et al., 1989; Kim et al.,
1995; Helander et al., 1998; Friedman et al., 2002; Griggs and Jacob, 2005). More specifically, eugenol, an essential oil component from cloves has been shown to inhibit S. typhimurium (Karapinar and Aktuğ; 1987; Griggs and Jacob, 2005) and carvacrol, an essential oil component of oregano has been shown to be effective inhibitor of E. coli
(Friedman et al., 2002; Griggs and Jacob, 2005).
The efficacy of essential oils on pathogenic bacteria has just begun to be demonstrated in vivo for poultry with mixed results. Results indicate that certain blends 31 of essential oils are effective against Clostridium perfringens (Mitsch et al., 2004). In their study, two blends of essential oils were administered, one blend (A) contained thymol, eugenol, curcumin and piperin; the other blend (B) contained thymol, carvacrol, eugenol, curcumin and piperin which were added to the basal diet, another diet was administered as a control (Mitsch et al., 2004). This study effectively showed that the two blends of essential oils controlled the amount of C. perfringens colonization and proliferation in the gut of broiler chickens (Mitsch et al., 2004). Timbermont et al (2010) also found that an essential oil combination of thymol, cinnamaldehyde and essential oil of eucalyptus controls the amount of necrotic enteritis caused by Clostridum perfringens.
A study conducted by Abildgaard et al (2010) failed to confirm the findings of previous work when examining the effects of an essential oil mixture of thymol, eugenol and piperin on the number of Clostridium perfringens colonized in the ileum or ceca.
Essential oil mixtures have been shown to be successful inhibitors of Salmonella spp. and
E. coli spp. in vivo as well. An essential oil mixture of cinnamaldehyde and thymol was shown to be effective in preventing horizontal transmission of Salmonella heidelberg in broiler chickens (Amerah et al., 2012). Jang et al (2007) reproted that an essential oil mixture of thymol, eugenol and piperin effectively reduced the amount of E. coli found in ileo-cecal digesta in 35 day old broiler chickens. While these results are promising, more research needs to be conducted examining the efficacy of different combinations of essential oils and their components against pathogenic bacteria in vivo.
1.12 ALTERNATIVE HOUSING IN POULTRY
The move to alternative housing systems for laying hens has been fairly recent.
The move from conventional cages to alternative housing systems in the US and 32
European Union (EU) has been brought to the attention of layer producers mainly due to public and consumer pressure. In the EU, the Council Directive 1999/74/EC, stated that on January 1, 2012 onward, the housing of laying hens in conventional battery cages would be forbidden in all EU member states (Van Hoorebeke et al., 2010). The ban on conventional cages in the EU was started due to public outcry over hens housed in battery cages (Appleby, 2003; Van Hoorebeke et al., 2010). In the US, Proposition 2 passed in
California in November 2008, which outlawed the conventional cage by 2015 (Mench et al., 2011). This proposition will likely affect interstate commerce of table eggs. As a result of proposition 2, legislation has been proposed as an amendment to the Farm Bill in the US in a joint venture with United Egg Producers (UEP) and the Humane Society of the US (HSUS) which would allow a 16 year phase out of conventional cages and replaced with colony or furnished cages (Greene and Cowan, 2012). Questions remain about what housing options are classified as alternative systems, how they will impact food safety, improve welfare of the laying hen and possibly most importantly the economics of egg production.
1.13 TYPES OF HOUSING SYSTEMS
In the US and around the world, the most common type of housing system for laying hens is the conventional battery cage housing system (Mench et al., 2011).
Conventional battery cages were developed in the 1930s and began to be adopted on a large scale in the 1950s (Mench et al., 2011). The main advantage of this type of system was and still is the separation of the hens and their eggs from feces, decreasing the likelihood of pathogenic bacteria transmission from fecal matter, improving egg cleanliness (Mench et al., 2011). An added bonus of this system was efficiency, 33 conventional battery cages allow feeding, watering and egg collection to be automated while also allowing more control over environmental variables (Mench et al., 2011).
Originally, this type of housing system was developed for one bird per cage, however larger cages were eventually adopted that allowed groups of 6 to 10 hens, which further increased efficiency due to increased stocking density within the house (Mench et al.,
2011). This type of housing system was criticized in Europe as early as the 1960s with the publication of Ruth Harrison’s book Animal Machines (Harrison, 1964; Mench et al.,
2011) as well as the Brambell Report, which was a UK government report on farm animal welfare (Brambell, 1965; Mench et al., 2011). These events led to changes in multiple facets of farm animal production, which included laying hen housing (Mench et al., 2011).
Currently, there are two broad categories of alternative housing systems for laying hens: non-cage of enriched cage systems (Mench et al., 2011). Non-cage systems are broken down further into single level systems (floor systems) or aviary systems, both of these housing types can have outdoor access while also having nest boxes and may or may not have perch space (LayWel 2006a; Mench et al., 2011). According to the
LayWel (2006a) housing description, single level systems have, “ ...contain all alternative systems where the ground floor area is fully or partially covered with litter and/or perforated floors in any combination. Birds have no access under the perforated floors.
There is only one level for the birds at any one point, even if this level is stepped.”
Aviary systems are similar to single level systems, but allow for maximum use of the barn space by having multi-tiered platforms (Mench et al., 2011). The LayWel (2006a) report further breaks down aviary housing style into three different categories: aviaries 34 with non-integrated nest boxes, aviaries with integrated nest boxes, and portal aviaries.
Aviaries with non-integrated nest boxes have several levels of perforated floors with manure belts under them and separately arranged nest boxes, with feeders and drinkers distributed for equal access for all hens (LayWel, 2006a). Aviaries with integrated nest boxes are similar; however nest boxes are integrated within the blocks of perforated floor
(LayWel, 2006a). Finally, portal aviaries have a top tier which is a single level and links the lower stepped platforms, workers can walk under or on the top of the top tier and nest boxes are integrated into the system (LayWel, 2006a). In all aviary systems, the floor space is covered with litter.
Both systems described above can allow two types of outdoor access, covered verandas or free-range (LayWel, 2006a). Covered verandas are an area outside but still connected to the hen house, which is available during daylight hours. The verandas also have concrete floors which are usually covered with litter (LayWel, 2006a). Free-range is an outside, uncovered area with vegetation (LayWel, 2006a). Hens have access from fixed or mobile houses in this area by popholes in the walls of the hen house, these units may be mobile and moved to maintain good pasture quality and control parasites
(LayWel, 2006a). Free-range systems are usually relatively small and are sometimes called pastured or pasture-based systems in the US (Mench et al., 2011).
Enriched cage systems (also called furnished, modified or enriched colony systems) are seen as a compromise between conventional cages and allowing the hen to act out natural behaviors. They are cages, but they are larger and equipped with perches, nesting areas and a “scratch pad” which allows the hen to forage and dust bathe (Mench et al., 2011). The configuration of the colony cages was based on research evaluating the 35 behavioral priorities of the laying hen (Lay et al., 2011; Mench et al., 2011). Currently, there are three different types of group sizes for enriched cage systems: small (up to 15 hens), medium (15 to 30 hens) and large (30 to 60 hens) (LayWel, 2006a; Mench et al.,
2011). The system that has been the most widely adopted in Europe is the enriched colony system, which allows 20 to 60 hens at the EU-mandated stocking density (Mench et al., 2011). These systems allow freedom of movement, a nesting area composed of a nest mat (made of Astroturf), nesting curtains, one or more perches, and a scratching area
(Mench et al., 2011). The scratch area either has feed or loose litter (sand or shavings) for the hens to scratch in (Mench et al., 2011).
Each housing system offers its own benefits and drawbacks. As a result, there are still management concerns as producers move away from conventional cages to alternative housing. In addition to greater costs, there are also welfare and food safety concerns, especially with cage free options.
1.14 FOOD SAFETY AND ALTERNATIVE HOUSING
There are numerous welfare issues when examining the acceptability and feasibility of alternative systems. Welfare concerns ranging from disease, skeletal and foot health, nutrition, pests and parasites, behavior, stress and genetics that need to be examined before fully converting to alternative systems (Lay et al., 2011). For the purpose of this review, the focus will be the potential impact alternative systems could have on food safety while also reviewing studies which have begun to examine possible food safety implications. 36
There have been studies conducted in recent years examining the effects of alternative housing and the potential impact for food safety. Most of these studies have been conducted in the EU, however there are a growing number of studies in the US that are being conducted examining the effects of alternative housing and food safety. There have been conflicting reports on alternative systems and how they impact microbial load of the environment and the implications on food safety. In the EU, environmental testing of layer flocks have shown that there is a higher prevalence of Salmonella in flocks housed in conventional cages than those housed in floor pens in multiple countries including: Germany, United Kingdom, and Belgium (Methner et al., 2006; Wales et al.,
2007; Snow et al., 2009; Mahé et al., 2008; Namata et al., 2008; Holt et al., 2011). There have been conflicting reports from other EU countries stating that there is a lower incidence of Salmonella in conventional cage systems than cage-free systems (Schaar et al., 1997; Mollenhorst et al., 2005; Holt et al., 2011).
Most of the studies examining alternative systems have been done in Europe due to the ban on conventional cages that took effect in 2012. There are a growing number of studies being conducted in the US in recent years examining the food safety risks of conventional cages and a variety of alternative systems, with conflicting results. A survey conducted by the USDA/Animal and Plant Health Inspection Service National
Animal Health Monitoring System Layers ’99 found pullets raised in conventional cages had lower Salmonella enteritidis incidence than pullets raised in a cage-free environment
(USDA/APHIS, 2000a; Holt et al., 2011). An epidemiology study conducted by Kinde et al. (1996) in Southern California examined the prevalence of Salmonella enteritidis
Phage Type 4 on a layer farm having both conventional cages and cage free hens. 37
Findings were that the highest prevalence of Salmonella enteritidis was in the cage free houses; conventional cage houses having the lowest incidence (Kinde et al., 1996). A study conducted by Jones et al (2011), compared environmental and egg microbiology in cage and cage free environments found significant differences between conventional and cage free environments. Samples were collected during spring, summer, fall and winter to examine the effect of season on microbial population as well. Findings indicated that nest boxes and grass clippings from free range paddocks had significantly higher numbers of coliforms with environmental swabs throughout all four seasons (Jones et al.,
2011). This trend continued with examination of the eggshell. With the exception of winter, which was not significant between housing types, eggs from cage free environments had higher numbers of coliforms than conventional cage counterparts.
Conversely, a study conducted by Jones et al., (2012) where hens were housed in cage or cage free environments, environmental and eggshell samples were analyzed for
Camplyobacter, Listeria, E. coli, and Salmonella. Results showed that there was no significant difference in detection of the aforementioned bacteria in the different housing types (Jones et al., 2012).
A study conducted by Gast et al. (2013) examined horizontal transmission of
Salmonella enteritidis in conventional and enriched cages. This study showed significant differences in organ colonization between the housing types. Conventional cage has significantly higher colonization frequencies in livers, spleens, and oviducts than enriched cage counterparts (Gast et al., 2013). There were no significant differences between housing type on ovary colonization or cecal colonization (Gast et al., 2013).
Conversely in a study conducted by Hannah et al (2011) there were differences between 38 cage and cage free housing and horizontal transmission of Salmonella and
Campylobacter. Although overall there were no differences of horizontal transmission in cage and cage free housing, there were differences when examining residual environmental samples with the conventional cage system having 15% recovery and cage-free on shavings having 38% (Hannah et al., 2011). Furthermore, horizontal transmission of Campylobacter was higher in cage-free on shavings (47%) than conventional cage (28%) (Hannah et al., 2011).
The results these referenced studies show that a definite conclusion on the effects of alternative laying hen housing systems on food safety cannot be proclaimed at this time. De Reu et al. (2009) concluded that farm practices have a strong influence on microbial quality of eggs, and the same could be stated for overall environment. Results vary widely depending on season, bird management, sampling method, age of flock and equipment (Jones et al., 2012). As a result, more studies examining housing effects on food safety of eggs and health of laying hens need to be conducted in alternative environments.
1.15 CONCLUSIONS
Based on previous research, there are definite gaps in knowledge that exist. First, most prebiotics, probiotics, and essential oils have been tested under extreme challenge conditions. There have been very few studies examining the efficacy of these products in laying hens that are not exhibiting clinical signs of infection or heavy shedding.
Furthermore, little research exists testing prebiotics, probiotics and essential oils in alternative systems. Therefore, the following studies were designed to examine the 39 efficacy of prebiotics, probiotics, and essential oils in alternative and conventional systems on pathogenic bacteria shedding. Finally, few studies in the US have examined
SE shedding in pullets that have undergone a typical transportation stress. Therefore, a study was designed to examine SE shedding in pullets prior to and after transport and through peak lay.
1.16 REFERENCES
Abildgaard, L., O. Hojberg, A. Schramm, K.M. Balle, R.M. Engberg. 2010. The effect of feeding a commercial essential oil product on Clostridium perfringens numbers in the intestine of broiler chickens measured by real-time PCR targeting the α-toxin-encoding gene (plc). An. Feed Sci. and Tech. 157:3-4(11): 181-189. Acamovic, T., and J.D. Brooker. 2005. Biochemistry of plant metabolites and their effects in animals. Proc. Nutr. Soc. 64:403-412. Amerah, A.M., G. Mathis, and C.L. Hofacre. 2012. Effect of xylanase and a blend of essential oils on performance and Salmonella colonization of broiler chickens challenged with Salmonella Heidelberg. Poult. Sci. 91(4): 943-947. Anonymous. 1999. President’s council on food safety. http://www.foodsafety.gov. USDA, HHS, EPA, Dept. of Commerce.
Anonymous. 2001. Salmonella in humans: England and Wales (1981-99). Public Heath Laboratory Service. http://www.phls.co.uk.
Appleby, M.C. 2003. The European Union ban on conventional cages for laying hens: History and prospects. J. Appl. Anim. Wel. Sci. 6(2): 103-121.
Applegate, T.J., V. Klose, T. Steiner, A. Ganner, and G. Schatzmayr. 2010. Probiotics and phytogenics for poultry: Myth or reality? J. Appl. Poult. Res. 19:194-210. Aserkoff, B., S.A. Schroeder and P.S. Brachman. 1970. Salmonellosis in the US-A five year review. Am. J. Epidemiol. 92:13.
Axe, D.D., and J.E. Bailey. 2004. Transport of lactate and acetate through the energized cytoplasmic membrane of Escherichia coli. Biotech. Bioeng. 47(1): 8-19. Babu, U., R.A. Dalloul, M. Okamura, H.S. Lillehoj, H. Xie, R.B. Raybourne, D. Gaines, R.A. Heckert. 2004. Salmonella enteritidis clearance and immune responses in chickens following Salmonella vaccination and challenge. Vet. Immun. and Immunopath. 101(3- 4): 251-257. 40
Bajaj, V., R.L. Lucas, C. Hwang, and C.A. Lee. 1996. Co-ordinate regulation of Salmonella typhimurium invasion genes by environmental and regulatory factors is medicated by control of hilA expression. Mol. Microbiol. 22: 703-714. Barrow, P.A., M.A. Lovell, and A. Berchieri. 1991. The use of two live attenuated vaccines to immunize egg-laying hens against Salmonella enteritidis phage type 4. Avian Path. 20(4): 681-692.
Barrow, P.A., M.B. Huggins, M.A. Lovell. 1994. Host specificity of Salmonella infection in chickens and mice is expressed in vivo primarily at the level of reticuloendothelial system. Infect. Immun. 62:4602-4610.
Barrow, P.A. and T.S. Wallis. 2000. Vaccination against Salmonella infections in food animals: rationale, theroteical basis and practical application. Salmonella in domestic animals. pp. 323-334. C. Wray and A. Wray (ed.) CABI Publishing, New York, NY.
Bӓumler, A.J., B.M. Hargis, R.M. Tsolis. 2000. Tracing the origins of Salmonella outbreaks. Science 287:50-52.
Bauer, K., D. Garbe, H. Surburg. 2001. Common Fragrance and Flavor Materials: Preparation, Properties and Uses, fourth ed. Wiley-VCH, Weinheim. Baurhoo, B., P.R. Ferket, X. Zhao. 2009. Effects of diets containing different concentrations of mannanoligosaccharide or antibiotics on growth performance, intestinal development, cecal and litter microbial populations, and carcass parameters of broilers. Poult. Sci. 88:2262-2272. Bengmark, S. 2001. Pre-, pro- and symbiotics,. Current opinion in clinical nutrition and metabolic car. 4:571-579.
Bichler, L.A., V. Kabambi, D.V.M. Nagaraja, and D.A. Halverson. 1996. Salmonella enteritidis in eggs, cloacal swab specimens and internal organs of experimentally infected white leghorn chickens. Am J Vet. Res. 57:489-95.
Bishop, C.D. 1995. Anitviral activity of the essential oil of Melaleuca alternifolia (Maiden and Betche) Cheel (tea tree) against tobacco mosaic virus. J. Ess. Oil Res. 7 641-644. Botsoglou, N.A., E. Christaki, P. Floro-Paneri, I. Giannenas, G. Papageorgiou, A.B. Spais. 2004. The effect of a mixture of herbal essential oils or a α-tocopherylacetate on performance parameters and oxidation of body lipid in broilers. S. Afr. J. Anim. Sci. 34:52-61. Braden, C.R. 2006. Salmonella enterica serotype Enteritidis and eggs: a national epidemic in the US. Clin. Infect. Dis. 43: 512-517. Brambell, F. 1965. Report of the technical committee to enquire into the welfare of animals kept under intensive 41 husbandry systems. Command Paper 2836. Her Majesty’s Stationary Office, London, UK.
Brenes, A., and E. Roura. 2010. Essential oils in poultry nutrition: Main effects and modes of action. Animal Feed Sci. and Tech. 158: 1-14.
Brenner, F.W., R.G. Villar, F.J. Angulo, R. Tauxe, and B. Swaminthan. 2000. Salmonella nomenclature. J. Clin. Microbiol. 38:2465-2467. Bullis, K.L. 1977. The history of avian medicine in the US II. Pullorum disease and fowl typhoid. Avian Dis. 21:422-429.
Burt, S. 2004. Essential oils: their antibacterial properties and potential applications in foods-a review. Int J. of Food Microbiol. 94(3): 223-253. Carson, C.F. and T.V. Riley. 1995. Antimicrobial activity of the major components of the essential oil of Melaleuca alternifolia. J. Appl. Microbiol. 78:264-269. Center for Disease Control (CDC). 2012. What is Salmonellosis? Accessed April 15, 2013. www.cdc.gov/salmonella/general/. Chappell, L., P. Kaiser, P. Barrow, M.A. Jones, C. Johnston, P. Wigley. 2009. The immunobiology of avian systemic salmonellosis. Vet. Immun. and Immunopath. 128(1- 3):53-59.
Cheminay, C., A. Mohlenbrink, M. Hensel. 2005. Intracellular Salmonella inhibit antigen presentation by dendritic cells. J. Immunol. 174:2892-2899.
Cherrington C.A., M. Hinton, and I. Chopra. 1990. Effect of short-chain organic acids on macromolecular synthesis in Escerichia coli. J. Bacteriol. 68:69-74. Cherrington, C.A., M. Hinton, G.C. Mead, and I. Chopra. 1991. Organic acids: Chemistry, antibacterial activity and practical applications. Adv. Microb. Physiol. 32:87- 108. Choct, M. 2009. Managing gut health through nutrition. Br. Poult. Sci. 50(1):9-15.
Choi, K.H., H. Namkung, I.K. Paik. 1994. Effects of dietary fuctooligosaccharides on suppression of intestinal colonization of Salmonella typhimurium in broiler chickens. Korean J. of Anim. Sci. 36:271-284.
Cogan, T.A., and T.J. Humphrey. 2003. The rise and fall of Salmonella Enteritidis in the UK. J. Appl. Microbiology 94:114S-119S.
Consentino, S., C.I.G. Tuberoso, B. Pisano, M. Satta, V. Mascia, E. Arzedi, F. Palmas. 1999. In vitro antimicrobial activity and chemical composition of Sardinian Thymus essential oils. Letters in Appl. Microbiol. 42
Collins, F.M. 1974. Vaccines and cell-mediated immunity. Bacteriol Rev. 38(4): 371- 402.
Council Directive 1999/74/EC. 1999. Laying down minimum standards for the protection of laying hens. Off. J. L. 203:53-57.
Cox, N.A., J.S. Bailey, J.M. Mauldin, L.C. Blankenship, and J.L. Wilson. 1991. Extent of salmonellae contamination in the breeder hatcheries. Poult. Sci. 70:416-418.
Cox, N.A., J.S. Bailey, and M.E. Berrang. 1996. Alternative routes for Salmonella intestinal tract colonization of chicks. J. Appl. Poult. Res. 5:282-288.
Cummings, J.H., G.T. Macfarlane, and H.N. Englyst. 2001. Prebiotic digestion and fermentation. Am J Clinical Nutr. 73(Suppl.): 415S-420S.
Cummings, J.H. and G.T. Macfarlane. 2002. Gastrointestinal effects of prebiotics. Br. J Nutr. 87(Suppl. 2): S145-S151. D’Aoust, J.Y. and J. Maurer. 2007. Salmonella species. Pages 187-236 in Food Microbiology-Fundamentals and Frontiers 3rd ed. M.P. Doyle and L.R. Beuchat, ed. ASM Press, Washington, D.C. Darwin, K.H. and V.L. Miller. 1999. Molecular basis of the interaction of Salmonella with the intestinal mucosa. Clin. Microbiol. Rev. 12:405-428. De Buck, J., F. Van Immerseel, F. Haesebrouck, R. Ducatelle. 2004c. Colonization of the chicken reproductive tract and egg contamination by Salmonella. J. Appl. Microbiol. 97:233-245.
De Reu, K., K. Grijspeerdt, W. Messens, M. Heyndrikw, M. Uyttndaele, J. Debevere, and L. Herman. 2006. Eggshell factors influencing eggshell penetration and whole egg contamination by different bacteria, including Salmonella enteritidis. Int. J. Food Microbiol. 112: 253-260.
De Reu, K., T.B. Rodenburk, K. Grijspeerdt, W. Messens, M. Heyndrickx, F.A.M. Tuyttens, B. Snock, J. Zoons, and L. Herman. 2009. Bacteriological contamination, dirt, and cracks of eggshells in furnished cages and noncage systems for laying hens: An international on-farm comparison. Poult. Sci. 88:2442-2448.
Demigen, C., C. Yacoub, C. Remezy, and P. Fafournoux. 1986. Effects of absorption of large amounts of volatile fatty acids on rat liver metabolism. J. Nutr. 116:77-86.
Department of Health and Human Services, FDA. 2009. Prevention of Salmonella enteritidis in shell eggs during production, storage and transport. http://www.gpo.gov/fdsys/pkg/FR-2009-07-09/pdf/E9-16119.pdf. 43
Deplancke, B., and H.R. Gaskins. 2001. Microbial modulation of innate defense: Goblet cells and the intestinal mucus layer. Am. J. Clin. Nutr. 73(Suppl. 1):1131S-1141S.
Donalson, L.M. 2005. The in vivo and in vitro effect of a fructooligosaccharide in prebiotic combined with alfalfa molt diets on egg production and Salmonella in laying hens. M.S. Thesis. Texas A&M University.
Donalson, L.M., J.L. McReynolds, W.K. Kim, V.I. Chalova, C.L. Woodward, L.F. Kubena, D.J. Nisbet, and S.C. Ricke. 2008. The influence of a fructooligosaccharide prebiotic combined with alfalfa molt diets on the gastrointestinal tract fermentation, Salmonella enteritidis infection and intestinal shedding in laying hens. Poult. Sci. 87:1253-1262.
Dorman, H.J.D., and S.G. Deans. 2000. Antimicrobial agent from plants: antibacterial activity of plant volatile oils. J. Appl. Microbiol. 88: 308-316. Ehrmann, M.A., P. Kurzak, J. Bauer, and R.F. Vogel. 2002. Characterization of lactobacilli towards their use as probiotic adjuncts in poultry. J. Appl. Microbiol. 92: 966- 975.
Erickson, K.L.,and N.E. Hubbard. 2000. Symposium: Probiotic bacteria: implications for human health. Probiotic immunomodulation in heath and disease. Am. Soc. Nutr. Sci. 130:403S-409S.
Faleiro, M.L., M. G. Miguel, f. Ladeiro, F. Venancio, R. Tavares, J.C. Brito, A.C. Figueiredo, J.G. Barroso, L.G. Pedro. 2002. Antimicrobial activity of essential oils isolated form Portuguese endemic species of Thymus. Lett. Appl. Microbiol. 36: 3-40. Farag, R.S., Z.Y. Daw, F.M. Hewedi, and G.S.A. El-Baroty. 1989. Antimicrobial activity of some Egyptian spice essential oils. J. Food Prot. 52:665-667. Friedman, M., P.R. Henika, and R.E. Mandrell. 2002. Bactericidal activities of plant essential oils and some of their isolated constituents against Camplyobacter jejuni, Esherichia coli, Listeria monocytogenes, and Salmonella enterica. J. Food Prot. 65:1545- 1560. Foley, S.L., R. Nayak, I.B. Hanning, T.J. Johnson, H. Jing, and S.C. Ricke. 2011. Population dynamics of Salmonella enterica serotypes in commercial egg and poultry production. Appl. Environ. Microbiol. 77:4273-4279. Foster, J.W. 1991. Salmonella acid shock proteins are required for the adaptive acid tolerance response. J. Bacteriol. 173:6896-6902. 44
Foster, J.W. and M.P. Spector. 1995. How Salmonella survive against the odds. Annu. Rev. Microbiol. 49:145-174. Freeman, M.B., A.C.C. Manning, and I.H. Flack. 1981. The effects of restricted feeding on arenal cortical activity I the immature domestic fowl. Br. Poult. Sci. 22:295-303.
Fernandez, F., M. Hinton, B. Van Gils. 2000. Evaluation of the effect of mannan- oligosaccharides on the competitive exclusion of Salmonella Enteritidis colonization in broiler chickens. Avian Path. 29:6, 575-581. Freitas, M. and C. Cayuela. 2000. Microbial modulation of host intestinal glycosylation patterns. Microb. Ecol. Health Dis. 12(Suppl. 2):165-178.
Frenzen, P., T. Riggs, J. Buzby, . Breuer, T. Roberts, D. Voetsch, S. Reddy, and the FoodNet Working Group. 1999. Salmonella cost estimate update using FoodNet data. Food Review 22:10-15.
Gaggia, F., P. Mattarelli, B. Biavati. 2010. Probiotics and prebiotics in animal feeding for safe food production. Int. J. of Food Microbiol. 141(31): S15-S28.
Gantois, I., R. Ducatelle, F. Pasmans, F. Haesebrouck, R. Gast, T.J. Humphrey, and F.V. Immerseel. 2009. Mechanisms of egg contamination by Salmonella enteritidis. FEMS Microbiol. Rev. 33(4):718-738.
Garriga, M., M. Pascual, J.M. Monfort, and M. Hugas. 1998. Selection of lactobacilli for chicken probiotic adjuncts. J. Appl. Microbiol. 84: 125-132.
Gast, R.K. and C.W. Beard. 1990. Production of Salmonella enteritidis-contaminated eggs by experimentally infected hens. Avian Dis. 34: 438-446.
Gast, R.K. and P.S. Holt. 1998. Persistence of Salmonella enteritidis from one day of age until maturity in experimentally infected layer chickens. Poult. Sci. 77:1759-1762.
Gast, R.K., J. Guard-Petter, and P.S. Holt. 2002. Characteristics of Salmonella enteritidis contamination in eggs after oral, aerosol, and intravenous inoculation of laying hens. Avian Dis. 46:629-635.
Gast, R.K. 2007. Serotype-specific and serotype-independent strategies of preharvest control of food-borne Salmonella in poultry. Avian Dis. 51:817-828. Gast, R. and J. Guard. 2011. Controlling egg contamination with Salmonella enteritidis by understanding its pathobiology. Proceedings from XXII Latin American Poultry Conference. 45
Gast, R.K., R. Guraya, D.R. Jones, and K.E. Anderson. 2013. Colonization of internal organs by Salmonella Enteritidis in experimentally infected laying hens housed in conventional or enriched cages. Poult. Sci. 92(2):468-473. Geier, M.S., V.A. Torok, G.E. Allison, K. Ophel-Keller, R.J. Hughes. 2009. Indigestible carbohydrates alter the intestinal microbiota but do not influence the performance of broiler chickens. J. Appl. Microbiol. 106(5): 1540-1548.
Gewirtz, A.T., P.O. Simon Jr., C.K. Schmitt, L.J. Taylor, C.H. Hagedorn, A.D. O’Brien, A.S. Neish, and J.L. Madara. 2001. Salmonella tyhimurium translocates flagellin across intestinal epithelia, inducing a proinflammatory response. J. Clin. Invest. 107(1):99-109.
Gibson, G.R. and X. Wang. 1994. Regulatory effects of bifidobacteria on the growth of other colonic bacteria. J. Appl. Bact. 77(4): 412-420.
Gibson, G.R., and M.B. Roberfroid. 1995. Dietary modulation of the human colonic microbiota: introducing the concept of prebiotics. J. Nutr. 125: 1401-1412.
Gill, A.O., P. Delaquis, P. Russo, R.A. Holley. 2002. Evaluation of antilisterial action of cilantro oil on vacuum packed ham. Int. J. Food Microbiol. 73: 83-92. Gong, J., R.J. Forster, H. Yu, J.R. Chambers, R. Wheatcroft, P.M. Sabour, and S. chen. 2002. Molecular analysis of bacterial populations in the ileum of broiler chickens and comparison with bacteria in the cecum. FEMS Microbiol. Ecol. 41:171-179.
Greathead, H. 2003. Plants and plant extracts for improving animal productivity Proc. Nutr. Soc. 62:279-290. Greene, J.L. and T. Cowan. 2012. Table egg production and hen welfare: the UEP-HSUS agreement and H.R. 3798. Congressional Research Service.
Griggs, J.P. and J.P. Jacob. 2005. Alternatives to antibiotics for organic poultry production. J. Appl. Poult. Res. 14:750-756. Grimont, P.A.D., F. Grimont, and P. Bouvet. 2000. Taxonomy of the genus Salmoenlla. Pages 1-17 in Salmonella in Domestic Animals. C. Wray and A. Wray ed. CABI Publishing, Wallingford, UK. Grimont, P.A.D., and F.-X. Weill. 2007. Antigenic formulae of the Salmonella servars. 9th ed. Institut Pasteur, Paris, France. Guard-Petter, J.2001. The chicken, the egg and Salmonella Enteritidis. Environ. Micro. 3:421-430.
Hannah, J.F., J.L. Wilson, N.A. Cox, J.A. Cason, D.V. Bourassa, M.T. Musgrove, L.J. Richardson, L.L. Rigsby and R.J. Buhr. 2011. Comparison of shell bacteria from 46 unwashed and washed table eggs harvested from caged laying hens and cage-free floor- housed laying hens. Poult. Sci. 90:2010-2015.
Hammer, K.A., C.F. Carson, and T.V. Riley. 1999. Antimicrobial activity of essential oils and other plant extracts. J. Appl. Microbiol. 86:985-990. Hajati, H. and M. Rezaei. 2010. The application of prebiotics in poultry production. Int. J. Poult. Sci. 9(3): 298-304.
Harrison, R. 1964. Animal Machines. Vincent Stuart, London, UK.
Harvey, S., and H. Klandorf. 1983. Reduced adrenocortical function and increased thyroid function in fasted and refed chickens. J. Endocrinol. 98:129-135.
Hassanein, S.M., and N.K. Soliman. 2010. Effect of probiotic (Saccharomyces cerevisiae) adding to diets on intestinal microflora and performances of Hy-Line layers hens. J. Am. Sci. 6(11): 159-166.
Helander, I.M., H.L. Alakomi, K. Latva-Kala, T. Mattila-Sandholm, I. Pol, J. Smid, L.G.M. Gorris and A. von Wright. 1998. Characterization of the action of selected essential oil components on gram-negative bacteria. J. Agric. Food Chem. 46:3590-3595. Higgins, J.P., S.E. Higgins, J.L. Vicente, A.D. Wolfenden, G. Tellez, and B.M. Hargis. 2007. Temporal effects of lactic acid bacteria probiotic culture on Salmonella in neonatal broilers. Poult. Sci. 86:1662-1666.
Holt, P.S. 1993. Effect of induced molting on the susceptibility of White Leghorn hens to a Salmonella enteritidis infection. Avian Dis. 37:412-417.
Holt, P.S., R.H. Davies, J. Dewulf, R.K. Gast, J.K. Huwe, D.R. Jones, D. Waltman, and K.R. Willian. 2011. The impact of different housing systems on egg safety and quality. Poult. Sci. 90(1): 251-262.
Howard, Z.R., C.A. O’Bryan, P.G. Crandall, and S.C. Ricke. 2012. Salmonella Enteritidis in shell eggs: Current issues and prospects for control. Food Res. Int. 45:755- 764.
Humphrey, T.J., A. Baskerville, H. Chart, B. Rowe, and A. Whitehead. 1991a. Salmonella enteritidis PT4 infection in specific pathogen free hens: influence of infecting dose. Vet. Rec. 129: 482-485.
Iba, A.M., and A. Berchieri Jr. 1995. Studies on the use of a formic acid-propionic acid mixture (Bio-addTM) to control experimental Salmonella infection in broiler chickens. Av. Path. 24(2):303-311. 47
Janardhana, V., M.M. Broadway, M.P. Bruce, J.W. Lowenthal, M.S. Geier, R.J. Hughes, and A.G.D. Bean. 2009. Prebiotics modulate immune responses in the gut-associated lymphoid tissue of chickens. J. Nutr. 139:1404-1409.
Jang, I.S., Y.H. Ko, S.Y. Kang, and C.Y. Lee. 2007. Effect of a commercial essential oil on growth performance, digestive enzyme activity and intestinal microflora population in broiler chickens. An. Feed Sci. Tech. 134(3-4): 304-315. Jayashree, T., and C. Subramanyam. 1999. Antiaflatoxigenic acitivyt o feugenol is due to inhibition of lipid peroxidation. Letters in Appl Microbiol. 28: 179-183. Jin, L.Z., Y.W. Ho, M. Abdullah, and S. Jalaludin. 1998. Growth performance, intestinal microbial populations and serum cholesterol of broilers fed diets containing Lactobacillus cultures. Poult. Sci. 77:1259-1265.
Johnston, C.E., C. Hartley, A.M. Salisbury, P. Wigley. 2012. Immunological changes at point-of-lay increases susceptibility to Salmonella enterica serovar enteritidis infection in vaccinated chickens. PLoS ONE 7(10):e48195.
Jones, D.R., K.E. Anderson, and M.T. Musgrove. 2011. Comparison of environmental and egg microbiology associated with conventional and free-range laying hen management. Poult. Sci. 90:2063-2068. Jones, D.R., K. E. Anderson, J.Y. Guard. 2012. Prevalence of coliforms, Salmonella, Listeria, and Campylobacter associated with eggs and the environment of conventional cage and free-range egg production. Poult. Sci. 91:1195-1202. Juliano, C., A. Mattana, M. Usai. 2000. Composition and in vitro antimicrobial activity of the essential oil Thymus herba-barona Loisel growing wild in Sardinia. J. Ess. Oil Res. 12: 516-522. Kabir, S.M.L., M.M. Rahman, M.B. Rahman, M.M. Rahman, and S.U. Ahmed. 2004. The dynamics of probiotics on growth performance and immune response in broilers. Int. J. Poult. Sci. 3(5): 361-364.
Kabir, S.M.L., M.M. Rahman, M.B. Rahman, M.Z. Hosain, M.S.I. Akand, and S.K. Das. 2005. Viability of probiotics in balancing intestinal flora and effecting histological changes of crop and caecal tissues of broilers. Biotechnology, 4:325-330.
Kabir, S.M.L. 2009. The role of probiotics in the poultry industry. Int. J. Mol. Sci. 10: 3531-3546.
Karapinar, M., and Ș.E. Aktuğ. 1987. Inhibition of foodborne pathogens by thymol, eugenol, menthol, and anethole. Int. J. Food Microbiol. 4:161-166. 48
Karpouhtsis, I., E. Pardali, E. Feggou, S. Kokkini, Z.G. Scouras, P. Mavragani-Tsipidou. 1998. Insecticcidal and genotoxic activities of oregano essential oils. J. Ag. Food Chem. 46:1111-1115. Keller, L.H., C.E. Benson, K. Krotec, and R.J. Eckroade. 1995. Salmonella enteritidis colonization of the reproductive tract and forming freshly laid eggs of chickens. Infect. Immun. 63:2443-2449.
Kempaiah, R.K., and K. Srinivasan. 2002. Integrity of erythrocytes of hypercholesterelomic rats during spices treatment. Mol. Cell. Biochem. 236:155-161. Kim, G.-B., Y.M. Seo, C.H. Kim, and I.K. Paik. 2011. Effect of dietary prebiotic supplementation on the performance, intestinal microflora, and immune response of broilers. Poult. Sci. 90: 75-82.
Kim, H.J., S.H. Park, T.H. Lee, B.H. Nahm, Y.H. Chung, K.H. Seo, and H.Y. Kim. 2006. Identification of Salmonella enterica serovar Typhimurium using specific PCR primers obtained by comparative genomics in Salmonella serovars. J. Food Prot. 69:1653-1661. Kim, J., M.R. Marshall, and C.I. Wei. 1995. Antibacterial activity of some essential oil compounds against five foodborne pathogens. J. Agric. Food Chem. 43:2839-2845. Kinde, H., D.H. Read, R.P. Chin, A.A. Bickford, R.L. Walker, A. Ardans, R.E. Breitmeyer, D. Willoughby, H.E. Little, D. Kerr, and I.A. Gardner. 1996b. Salmonella enteritidis phage type 4 infection in a commercial layer flock in Southern California: Bacteriological and epidemiologic findings. Avian Dis. 40:665-671.
Klis, F.M., P. Mol, K. Hellingwerf, and S. Brul. 2002. Dynamics of cell wall structure in Saccharomyces cerevisiae. FEMS Microbiol. Rev. 26: 239-247.
Laegreid, W.W., and N. Bauer. 2004. Probiotics for pathogen control in poultry and livestock. American Meat Science Association Conference Reciprocal Proceedings.
Lamont, R.J. 2004. Bacterial invasion of host cells. Pages 1-24. Cambridge University Press, Cambridge, UK. Lattaoi, N., and A. Tantaoui-Elaraki. 1994. Individual and combined antibacterial activity of the main components of three thyme essential oils. Riv. Italiana EPPOS 13:13-19. LayWel. 2006a Deliverable 2.3-Description of housing systems for laying hens. Accessed April 20, 2011. www.LayWel.eu.
Lay Jr., D.C., R.M. Fulton, P.Y. Hester, D.M. Karcher, J.B. Kjaer, J.A. Mench, B.A. Mullens, R.C. Newberry, C.J. Nicol, N.P. O’Sullivan, and R.E. Porter. 2011. Hen welfare in different housing systems. Poult. Sci. 90:278-294. 49
Line, E.J., S.J. Bailey, N.A. Cox, N.J. Stern, and T. Tompkins. 1998. Effect of yeast- supplemented feed on Salmonella and Camplyobacter populations in broilers. Poult. Sci. 77:405-410.
Lister, S.A. 1988. Salmonella enteritidis infection in broilers and broiler breeders. Vet. Rec. 123:350.
Lostroh, C.P. and C.A. Lee. 2001. The HilA box and sequences outside it determine the magnitude of HilA-dependent activation of Ppgh from Salmonella pathogenicity island 1. Bacteriol. 183: 4876-4885. Mahé, A., S. Bougeard, A. Huneau-Salaün, S. Le Bouquin, I. Petetin, S. Rouxel, F. Lalande, P.A. Beloeil, and N. Rose. 2008. Bayesian estimation of flock-level sensitivity of detection of Salmonella spp., Enteritidis and Typhimurium according to the sampling procedure in French laying-hen houses. Prev. Vet. Med. 84:11-26.
Mahmoud, S.S., and R.B. Croteau. 2002. Strategies for transgenic manipulation of monoterpene biosynthesis in plants. Trends Plant Sci. 7(8): 366-373. Mari, M., P. Bertolini, G.C. Pratella. 2003. Non-conventional methods for the control of post-harvest pear diseases. J. Appl. Microbiol. 94:761-766. Marino, M., C. Bersani, G. Comi. 1999. Antimicrobial activity of the essential oils of Thymus vulgaris L. measured using a bioimpedometric method. J. of Food Prot. 62(9): 1017-1023. Marino, M. C. Bersani, G. Comi. 2001. Impedance measurements to study the antimicrobial activity of essential oils from Lamiacea and Compositae. Int. J. Food Microbiol. 67: 187-195. Mastroneni, P., N. Menager. 2003. Development of acquired immunity to Salmonella. J. Med. Microbiol. 52:453-459.
Mazmanian, S.K., J.L. Round, D. Kasper. 2008. A microbial symbiosis factor prevents inflammatory disease. Nature 453, 620-625.
McCracken, V.J. and R.G. Lorenz. 2001. The gastrointestinal ecosystem: A precarious alliance among epithelium, immunity and microbiota. Cell. Microbiol. 3:1-11.
McGimpsey, J.A., M.H. Douglas, J.L. Van Klink, D.A. Beauregard, N.B. Perry. 1994. Seasonal variation in essential oil yield and composition from naturalized Thymus vulgaris L. in New Zealand. Flav. Freg. J. 9:347-352. Mench, J.A., D.A. Sumner, and J.T. Rosen-Molina. 2011. Sustainability of egg production in the US-The policy and market context. Poult. Sci. 90:229-240. 50
Menconi, A., A.D. Wolfenden, S. Shivaramaiah, J.C. Terraes, T. Urbano, J. Kuttel, C. Kermer, B.M. Hargis, and G. Tellez. Effect of lactic acid bacteria probiotic culture for the treatment of Salmonella enterica serovar Heidelberg in nonatal broiler chickens and turkey poults. Poult. Sci. 90: 561-565.
Messens, W., K. Grijspeerdt, and L. Herman. 2005a. Eggshell penetration by Salmonella: a review. World Poultry Sci. J. 61:71-85.
Messens, W., K. Grijspeerdt, and L. Herman. 2006. Eggshell penetration of hen’s eggs by Samlonella enterica serovar enteritidis upon various storage conditions. Brit. Poult. Sci. 47:554-560.
Methner, U., R. Diller, R. Reiche, and K. Bohland. 2006. Eggshell penetration by Salmonella: A review. Berl. Muench. Tieraerztl. Wochenschur, 119: 467-473. Methner, U., R. Diller, R. Reiche, and K. Bohland. 2006. Occurance of salmonellae in laying hen in different housing systems and conclusion of the control. Berl. Muench. Tieraerztl. Wochenschur. 119:467-473.
Milner, K.C. and M.F. Shaffer. 1952. Bacteriologic studies of experimental salmonellae infections in chicks. J. Infect. Dis. 90:81-96.
Mitsch, P., K. Zitterl-Eglseer, B. Kohler, C. Gabler, R. Losa, and I. Zimpernik. 2004. The effect of two different blends of essential oil components on the proliferation of Clostridium perfringens in the intestines of broiler chickens. Poult. Sci 83:66-675. Miyamoto, T., E. Baba, T. Tanaka, K. Sasai, T. Fukata, and A. Arakawa. 1997. Salmonella enteritidis contamination of eggs from hens inoculated by vaginal, cloacal and intravenous routes. Avian Dis. 41: 296-303.
Miyamoto, T., T. Horie, E. Baba, K. Sasai, T. Fukata, A. Arakawa. 1998a. Salmonella penetration through eggshell associated with freshness of laid eggs and refrigeration. J. Food Protect. 61:350-353.
Mollenhorst, H., C.J. van Woudenbergh, E.G.M. Bokker, and I.J.M de Boer. 2005. Risk factors for Salmonella enteritidis infections in laying hens. Poult. Sci. 84:1308-1313.
Monsan, P.F. and F. Paul. 1995. Oligosaccharide feed additives. In: Biotechnology in Animal Feeds and Feeding. R.J. Wallace and A. Chesson (Eds.). VCH verlagsgesellschaft, Weinheim and New York, pp: 233-245.
Morgan, A., A.J. Mul, G. Beldman, and A.G.J. Voragen. 1992. Dietary oligosaccharides. New insights. Agro. Food Ind. Hi-tech. 11:35-38.
Mountzoris, K.C., P. Tsirtsikos, E. Kalamara, S. Nitsch, G. Schatzmayr, and K. Fegeros. 2007. Evaluation of the efficacy of a probiotic containing Lactobacillus, Bifidobacterium, 51
Enterococcus, and Pediococcus strains in promoting broiler performance and modulating cecal microflora composition and metabolic activities. Poult. Sci. 86:309-317. Mourey, A., and N. Canillac. 2002. Anti-Listeria monocytogenes activity of essential oil components of conifers. Food Cont. 13:289-292. Nakai, S.A., and K.J. Siebert. 2003.Validation of bacterial growth inhibition models based on molecular properties of organic acids. Int. J. Food Microbiol. 86(3): 249-255. Nakamura, M., N. Nagamine, T. Takahashi, S. Suzuki, M. Kijima, Y. Tamura, and S. Sato. 1994. Horizontal transmission of Salmonella enteritidis and effect of stress on shedding in laying hens. Avian Dis. 32:282-288.
Namata, H., E. Méroc, M. Aerts, C. Faes, J. Cortiñas, H. Imberechts, and K. Mintiens. 2008. Salmonella in Belgian laying hens: An identification of risk factors. Prev. Vet. Med. 83:323-336.
Nayebpor, M., P. Farhomand, and A. Hashemi. 2007. Effects of different levels of direct fed microbial (Primalac) on growth performance and humoral immune response in broiler chickens. J. Ani. Vet. Adv. 6(11): 1308-1313.
Nester, E.W., D.G. Anderson, C.E. Roberts Jr., and M.T. Nester. 2009. Pages 601-603 in Microbiology (A Human Perspective). 6th ed. McGraw Hill, New York, NY. Newman, K. 1994. Manna-oligosaccharides: Natural polymers with significant impact on the gastrointestinal microflora and the immune system. Pages 167-174 in Biotechnology in the Feed Industry. Proc. Alltech’s 10th Annu. Symp. T.P. Lyons and K. A. Jacques, ed. Nottingham University Press, Nottingham UK.
NIH HMP Working Group. 2009. The NIH Human Microbiome Project. Genome Res. 19(21): 2317-2323.
Nurmi, E., and M. Rantala. 1973. New aspects of Salmonella infection in broiler production. Nature 24:210-211.
Okamura, M., Y. Kamijima, T. Miamoto, H. Tani, K. Sasai, and E. Baba. 2001a. Differences among six Salmonella serovars in abilities to colonize reproductive organs and to contaminate eggs in laying hens. Avian Dis 45:61-69.
Okamura, M., T. Miyamoto, Y. Kamijima, H. Tani, K. Sasai, and E. Baba. 2001b. Differences in abilities to colonize reproductive organs and to contaminate eggs in intravaginally inoculated hens and in vitro adherences to vaginal explants between Salmonella enteritidis and other Salmonella serovars. Avian Dis 45:962-971.
O’Keefe, T. 2011. Egg producers hear case or laying hen welfare agreement. Egg Industry Oct: 6. 52
Padron, M.N. 1990. Salmonella typhimurium penetration through the eggshell of hatching eggs. Avian Dis. 34:463-465.
Park, S.H., H.J. Kim, W.H. Cho, J.H. Kim, M.H. Oh, S.H. Kim, B.K. Lee, S.C. Ricke, and H.Y. Kim. 2009. Identification of Salmonella enterica subspecies I, Salmonella enterica serovars Typhimurium, Enteritidis, and Thyphi using multiplex PCR. FEMS Microbiol.. Lett. 301:137-146. Park, S.H, I. Hanning, A. Perrota, B.J. Bench, E. Alm, and S.C. Ricke. 2013. Modifying the gastrointestinal ecology in alternatively raised poultry and the potential for molecular and metabolomic assessment. Poult. Sci. 92:546-561. Paster, N., M. Menasherov, U. Ravid, B. Juven. 1995. Antifungal activity of oregano and thyme essential oils applied as fumigants against fungi attacking stored grain. J. Food Prot. 58(1): 81-85. Patterson, J.A. and K.M. Burkholder. 2003. Applications of prebiotics and probiotics in poultry production. Poult. Sci. 82:627-631.
Pessoa, L.M., S.M. Morais, C.M.L. Bevilaqua, J.H.S. Luciano. 2002. Anthelmintic activity of essential oil of Ocimum gratissimum Linn. And eugenol against Haemonchus contortus. Vet. Parasite. 109(1-2): 59-63. Platel, K., and K. Srinivasan. 2004. Digestive stimulant action of species: A myth or reality? Indian J. Med. Res. 119:167-179. Rabsch, W., B.M. Hargis, R.M. Tsolis, R.A. Kingsley, K.H. Hinz, H. Tschӓape, A.J. Bӓumler. 2000. Competitive exclusion of Salmonella enteritidis by Salmonella gallinarum in poultry. Emerg. Infect. Dis. 6(5):443-448.
Rada, V., and I. Rychly. 1995. The effect of Lactobacillus salivarius administration on coliform and enterococci in the crop and ceca of chicken broilers. Vet Med. (Praha) 40:311-315.
Raskin, L., W. Capman, R. Sharp, L. Poulsen, and D. Stahl. 1997. Molecular ecology of gastrointestinal ecosystem. Pages 243-298 in Gastrointestinal Microbiology R.I. Mackie and B.A. White, ed Chapman & Hall, Internatonal Thomson Publishing, New York, NY. Ricke, S.C. 2003. Perspectives on the use of organic acids and short chain fatty acids as antimicrobials. Poult Sci. 82(4): 632-639. Ricke, S.C. 2003b. The gastrointestinal tract ecology of Salmonella Enteritidis colonization in molting hens. Poult. Sci. 82:1003-1007. Ricke, S.C., L. Casendra, L. Woodward, Y.M. Kwon, L.F. Kubena, and D.J. Nisbet. 2004. Limiting avian gastrointestinal tract Salmonella colonization by cecal anaerobic bacteria, and a potential role for methanogens. Pages 141-150 in Preharvest and 53
Postharvest Food Safety, Contemporary Issues and Future Direction. R. C. Deier, S.D. Pillai, and T.D. Phillips, ed. Blackwell Publishing Professional, Ames, IA. Rolfe, R.D. 2000. The role of probiotic cultures in the control of gastrointestinal health. J. Nutr. 130:396A-402S.
Russell, J.B. 1992. Another explanation for the toxicity of fermentation acids at low pH: anion accumulation versus uncoupling. J. Appl. Bact. 73(5): 363-370. Russo, M., G.C. Galletti, P. Bocchini, A. Carnacini. 1998. Essential oil chemical composition of wild populations of Italian oregano spice (Origanum vulgare ssp. hirtum (Link) letswaart): A preliminary evaluation of their use in chemotaxonomy by cluster analysis: 1. Inflorescences. J. Agric. Food Chem. 46: 3741-746. Salminen, S., E. Isolauri, E. Salminen. 1996. Clincial uses of probiotics for stabilizing the gut mucosal barrier: successful strains and future challenges. Antonie van Leeuwenhoek 70(2-4): 347-358.
Salzman, N.H., D. Ghosh, K.M. Huttner, Y. Paterson C.L. Bevins. 2003. Protection against enteric salmonellosis in transgenic mice expressing a human intestinal defensing. Nature 422(6931): 522-6.
Scantlebury Manning, T., and G.R. Gibson. 2004. Prebiotics. Best Prac. Res. Clinical Gastr. 18(2): 287.
Schaar, U., E.F. Kaleta, and B. Baumbach. 1997. Comparative studies on the prevalence of Salmonella enteritidis and Salmonella typhimurium in laying chickens maintained in batteries or on floor using bacteriological isolation techniques and two commercially available ELISA kits for serological monitoring. Tierarztl. Prax. 2:451-459.
Schoeni, J.L., K.A. Glass, J.L. McDermott, and A.C. Wang. 1995. Growth and penetration of Salmonella enteritidis, Salmonella heidelberg and Salmonella typhimurium in eggs. Int J Food Mircobiol 24:385-393.
Schulz, J., S. Van Hoorebeke, B. Hald, J. Hartung, F. Van Immerseel, I. Radtke, S. Kabell, and J. Dewulf. 2011. The dynamics of Salmonella occurrence in commercial laying hen flocks throughout a laying period. Avian Path. 40(3):243-248.
Senatore, F. 1996. Influence of harvesting time on yield and composition of the essential oil of a thyme (Thymus puleioides L.) growing wild in Campania (Southern Italy). J. Agric. Food Chem. 44: 1327-1332. Shivaprasad, H.L. 2000. Fowl typhoid and pullorum disease. Rev. Sci. Tech. 19:405-424. 54
Smith, W.H. 1956. The use of live vaccines in experimental Salmonella gallinarum infection in chickens with observations on their interference effect. J. of Hygine 54(3): 419-432.
Snoeyenbos, G.H. 1991. Pullorum disease. In Disease of Poultry. B.W. Calnek (ed) Ames: Iowa State University Press. Pp. 73-86.
Snow, L.C., R.H.. Davies, K.H. Christiansen, J.J. Carrique-Mas, A.J.C. Cook and S.J. Evans. 2010. Investigation of risk factors for Salmonella on commercial egg-laying farms in Great Britian 2004-2005. Vet. Rec. 16:579-586.
Sparks, N.H.C. and R.G. Board. 1985. Bacterial penetration of the recently developed oviposited shell of hens’ eggs. Aust. Vet. J. 62: 169-170.
Spellburg, B., and J.E. Edwards, Jr. 2001. Type1/type 2 immunity and infections diseases. Clin. Infect. Dis. 32:76-102.
Spring P., C. Wenk, K.A. Dawson, and K.E. Newman. 2000. The effects of dietary mannan-oligosaccharides on cecal parameters and the concentrations of enteric bacteria in the ceca of Salmonella challenged broiler chicks. Poult. Sci. 79:205-211. Srinivasan, K. 2004. Spices as influencers of body metabolism: an overview of three decades of research. Food Res. Int. 38:77-86. Stavric, S., and E.T. Kornegay. 1995. Microbial probiotics for pigs and poultry. Pages 205-231 in Biotechnology in Animal Feeds and Animal Feeding. RJ. Wallace and A. Chesson, ed. VCH, New York.
St. Louis, M.E., D.L. Morse, M.E. Potter, T.M. DeMelfi, J.J. Guzewich, R.V. Tauxe, P.A. Blake. 1988. The emergence of grade A eggs as a major source of Salmonella enteritidis infections. New implications for the control of salmonellosis. JAMA 259: 2103-2107.
Timbermont, L., A. Lanckriet, J. Dewulf, N. Nollet, K. Schwarzer, F. Haesebrouck, R. Ducatelle, F. Van Immerseel. 2010. Control of Clostridium perfringens induced necrotic enteritis in broilers by target-released butyric acid, fatty acids and essential oils. Av. Path. 39(2): 117-121. Timoney, J.F., H.L. Shivaprasad, R.C. Baker, and B. Rowe. 1989. Egg transmission after infection of hens with Salmonella enteritidis phage type 4. Vet. Rec. 125:600-601.
Ullmann, R., and H.K. Scholtze. 1989. Salmonella occurrence in the Erfut district. Z Gesamte Hyg 35:676-679.
USDA/APHIS. 2000a. NAHMS Layers’99 Salmonella enterica serotype Enteritidis in table egg layers in the US. Accessed May 21, 2011. 55 http://www.aphis.usda.gov/vs/ceah/ncahs/nahms/poultry/layers99/Layers99_dr_Salmonel la.pdf.
Uzzau, S., D.J. Brown, T. Wallis, S. Rubino, G. Leori, S. Bernard, J. Casadesús, D.J. Platt and J.E. Olsen. 2000. Host adapted serotypes of Salmonella enterica. Epid. and Infect. 125(2): 229-255.
Van de Braak, S.A.A.J., and G.C.J.J. Leijten. 1999. Essential oils and oleoresins: a survey in the Netherlands and other major markets in the European Union. CBI, Centre for the Promotion of Imports from Developing Countries, Rotterdam, p. 116.
Van Hoorebeke, S., F. Van Immerseel, F. Haesebrouck, R. Ducatelle, J. Dewulf. 2010. The influence of the housing system on Salmonella infections in laying hens: A review. Zoo. Pub. Health. 58(5): 304-311.
Van Immerseel, F., J. De Buck, F. Pasmans, P. Velge, E. Bottreau, V. Fievez, F. Haesenbrouck, R. Ducatelle. 2003. Invasion of Salmonella enteritidis in avian intestinal epithelia cells in vitro is influenced by short-chain fatty acids. Int. J. Food Microbiol. 85(3): 237-248. Van Immerseel, F., V. Fievez, J. de Buck, F. Pasmans, A. Martel, F. Haesebrouck, and R. Ducatelle. 2004. Microencapsulated short-chain fatty acids in feed modify colonization and invasion early after infection with Salmonella enteritidis in young chickens. Poult. Sci. 83: 69-74. Van Immerseel, F., U. Methner, I. Rychlik, B. Nagy, P. Velege, G. Martin, N. Foster, R. Ducatelle, and P.A. Barrow. 2005. Vaccination and early protection against non-host- specific Salmonella serotypes in poultry: exploitation of innate immunity and microbial activity. Epid. and Inf. 133(6): 959-978.
Van Immerseel, F., J.B. Russell, M.D. Flythe, I. Gantois, L. Timbermont, F. Pasmans, F. Haesebrouck, R. Ducatelle. 2006. The use of organic acids to combat Salmonella in poultry: a mechanistic explanation of the efficacy. Avian Pathology 35(3): 182-188.
Wales, A., M. Breslin, B. Carter, R. Sayers, and R. Davies. 2007. A longitudinal study of environmental Salmonella contamination in caged and free-range layer flocks. Avian Pathol. 36:187-197. Wallis, T.S., M. Wood, P. Watson, S. Paulin M. Jones, E. Galyov. 1999. Sips, sops, and SPIs but not stn influence Salmonella enteropathogen. Adv. Exp. Med. Biol. 473, 275- 280. 56
Walter, J. 2008. Ecological role of Lactobacilli in the gastrointestinal tract: Implications for fundamental and biomedical research. Appl. and Environ. Microbiol. 74(16):4985- 4996.
Watkins, B.A., B.F. Miller, and D.H. Neil. 1982. In vivo effects of Lactobacillus acidophilus against pathogenic Esherichia coli in gnotobiotic chicks. Poult. Sci. 61:1298- 1308.
Wei, S., M. Morrison, and Z. Yu. 2013. Bacterial census of poultry intestinal microbiome. Poult. Sci. 92:671-683.
Wigley, P., S.D. Hulme, N. Bumstead, P.A. Barrow. 2002a. In vivo and in vitro studies of genetic resistance to systemic salmonellosis in the chicken encoded by the SAL1 locus. Microbes Infect. 4:1111-1120.
Yeoman, C.J., N. Chia, P. Jeraldo, M. Sipos, N.D. Goldenfeld, and B.A. White. 2012. The microbiome of the chicken gastrointestinal tract. An. Health Res. Rev. 13(1): 89-99.
Yusrizal and T.C. Chen. 2003. Effect of adding chicory fructans in feed on broiler growth performance, serum cholesterol and intestinal length. Int. J. Poult. Sci., 2: 214-219.
Zeng, H., A.Q. Carlson, Y. Guo, Y. Yu, L.S. Collier-Hyams, J.L. Madara, A.T. Gewirtz, A.S. Neish. 2003. Flagellin is the major proinflammatory determinant of enteorpathogenic Salmonella. J. Immunol. 171:3668-3674.
Zhu, X.Y., T. Zhong, Y. Pandya, and R.D. Joerger. 2002. 16S rRNA-based analysis of microbiota from the cecum of broiler chickens. Appl. Environ. Microbiol. 68:124-137.
57
CHAPTER 2: THE EFFECTS OF A MANNANOLIGOSACCHARIDE ON SALMONELLA, E. COLI, AND COLIFORM SHEDDING IN CAGE AND CAGE FREE SYSTEMS
D. Hahn, S.E. Purdum, K. Hanford, S.C. Fernando
2.1 ABSTRACT
A study was conducted examining the effects of supplementing a mannanoligosaccharide (MOS) on performance parameters and pathogenic bacteria colonization in cage and cage free laying hens. Bovan Robust White Leghorn laying hens
(n=96) 72-77 weeks of age were utilized. Experimental treatments were arranged in a 2x2 factorial design, the factors being: with or without MOS (0.00% or 0.08%) and housed in conventional cage or cage free systems. Parameters measured were: daily egg production, weekly egg weight, feed intake and feed conversion ratio was determined. Weeks 72, 74, and 76 Salmonella presence was determined in fecal and eggshell samples. Weeks 73,
75, and 77 E. coli and coliform counts were conducted for fecal samples and eggshell presence. At the conclusion of the study, duodenum and ceca samples were taken to determine colonization of E. coli and Salmonella. Feed intake (P≤0.0001), egg production (P≤0.001), egg wt. (P≤0.005), and FCR (P≤0.015) had significant housing by time effects, cage-free increased through the study. There was not a significant MOS by housing by time interaction for E. coli (P≤0.403) or coliform (P≤0.365) colony counts.
There was a significant difference during wk 73 of age, where diets containing 0.08%
MOS had significantly higher (P≤0.037) E. coli colony counts in fecal samples than diets containing 0.00% MOS. Eggshells from cage free hens had significantly higher prevalence of E. coli (P≤0.033) and coliforms (P≤0.020) than conventional cages. There was not a significant MOS by housing effect for Salmonella prevalence in fecal samples 58
(P≤0.781) or on eggshells (P≤0.181). Control rations had significantly higher E. coli populations in the duodenum (P≤0.0007) than diets supplemented with MOS.
Salmonella colonization was not significantly different in the duodenum or ceca.
Overall, MOS reduced E. coli in the duodenum and tended to reduce the risk of E. coli and coliforms in both cage and cage free housing systems.
2.2 INRODUCTION
In recent years, there has been a push in the US layer industry to move away from conventional housing to alternative housing which includes aviary, cage free and colony cages. As a result of consumer outcry against conventional cages, Proposition 2 passed in November, 2008 in California, which banned conventional cages with the wording,
“..a person shall not thether or confine any covered animal, on a farm, for all or the majority of any day, in a manner that prevents such animal from: (a) Laying down, standing up, and fully extending his or her limbs; and (b) Turning around freely” additional wording for laying hens included “fully spreading both wings without touching the side of an enclosure or other egg-laying hen”, which takes effect in 2015 (Mench et al., 2011). Although the proposal never states banning of conventional cages, it is the wording added for laying hens that effectively outlawed conventional cages (Mench et al., 2011). As a result of Proposition 2, 2013 legislation was unsuccessfully proposed as an amendment to the farm bill in the US in a joint venture with United Egg Producers
(UEP) and the Humane Society of the US (HSUS) which would allow a 16 year phase out of conventional cages and replaced with colony or furnished cages (O’Keefe, 2011;
Green and Cowan, 2012). Alternative systems are ideal from a hen welfare standpoint as they do allow the hen to act out natural behaviors such as dust bathing, perching and 59 laying eggs in a nest box. However, there are numerous questions from a food safety standpoint that need to be addressed.
Alternative environments, such as cage free, can result in an increased food safety risk. Jones and coworkers (2011) found significant differences in environmental and egg microbiology in cage and cage free housing. It was reported that nest box and grass clippings from free range paddocks had a significantly higher number of coliform counts than conventional cage counterparts. This trend continued with examination of the eggshell, eggs from a cage free environment had a higher number of coliforms than eggs from conventional cages. Furthermore, a study conducted by Hannah et al. (2011) showed an increase in Salmonella and Camplyobacter in residual environmental samples in cage free pens with shavings.
The potential for increased food safety risks in alternative environments along with an increased knowledge of the gut microbiome has increased interests in feed additives such as prebiotics. Prebiotics are classified as “nondigestible food ingredients that beneficially affect the host by selectively stimulating the growth and/or activity of one or a limited number of bacteria in the colon” (Gibson and Roberforid, 1995; Gaggia et al., 2010). For a substrate to be classified as a prebiotic it cannot be hydrolyzed in the stomach or small intestine, it must select for beneficial bacteria in the large intestine, and fermentation of the substrate should have beneficial effects for the host ( Scantlebury-
Manning and Gibson, 2004; Gaggia et al., 2010). One of the most studied prebiotics in poultry feeds is mannanoligosaccharides (MOS). 60
Mannanoligosaccharides (MOS) are derived from the yeast cell wall of
Saccharomyces cervisiae (Patterson and Burkholder, 2003; Geier et al., 2009; Hajati and
Rezaei, 2010). The proposed mode of action is that the MOS structure acts as a binding site for type 1 fimbrae of pathogenic bacteria such as Salmonella and E. coli (Park et al.,
2013). When the pathogen binds to MOS, it is not able to bind to the gut epithelium and eliminated from the gut lumen (Newman, 1994; Patterson and Burkholder, 2003; Park et al., 2013).
Mannanoligosaccharides have been shown to have positive effects on decreasing the number of pathogenic bacteria in the gut. Spring et al., (2000) showed that MOS was successful in reducing Salmonella colonization with a 26% decrease in colony forming units (CFU’s) with S. typhimurium and a 38% decrease of colonization of S. dublin.
Fernandez et al. (2000) also found that supplementation of MOS with a competitive exclusion mixture provided effective protection against S. enteritidis in broiler chicks.
MOS has also been shown to be effective at modifying intestinal morphology while having a positive impact on host bacteria along with decreasing the amount of pathogenic bacteria. Baurhoo et al. (2009) reported that when MOS was added to the diet, there was an increase in goblet cell number, Bifidobacteria and Lactobacillus. At the conclusion of the study, there was a significant decrease in the number of E.coli and Camplyobacter from cecal samples (Baurhoo et al., 2009). Kim et al. (2011) showed that supplementation of MOS increased Lactobacillus counts while significantly decreasing
E. coli and C. perfringens counts in the small intestine of broiler chicks.
The potential for foodborne illness from bacterial contamination of eggs exists when hens are housed in alternative systems. As a result, strategies need to be examined 61 to reduce the risk of egg contamination with pathogenic bacteria. This study was conducted to examine the effects of MOS in cage and cage free housing systems on layer performance and Salmonella, E. coli and coliform intestinal colonization fecal shedding, egg shell contamination.
2.3 MATERIALS AND METHODS
Birds and Experimental Design
Ninety six Bovan Robust White Leghorn laying hens were used. Hens were 72-
77 weeks of age and not challenged with Salmonella in this study. The treatments were arranged in a 2x2 factorial design; the two factors being housing and dietary treatment.
Hens were either housed in conventional cages or a cage free floor pen. Dietary treatments were either 1) control or 2) basal diet with Actigen®1 (MOS), which is a concentrated mannose-rich oligosaccharide fraction derived from Saccharomyces cerevisiae. There were 16 pens in total, with 8 cages for conventional cage system and eight cage free pens for cage free floor pen system. Each pen was randomly assigned one of two dietary treatments for a total of six weeks; resulting in four replicate conventional cages and four replicate cage free pens per dietary treatment. Hens were housed in separate but identical rooms (blocks) with 4 conventional cages and four floor pens in each room. Each room had a photoperiod of 16h light 8h dark and was held at an ambient temperature of 22°C. Hens in conventional cages had access to 75 sq. in. with four hens per cage. Cage free hens had access to 16 sq. ft. with eight hens per floor pen, which allowed the hen approximately 1.6 sq ft/hen (UEP, 2010). Each cage free pen had
1 Alltech, Nicholasville, KY 40356. 62 two nest boxes and 6 in. of usable perching space per hen (UEP, 2010). Cage free pens were bedded with fresh pine shavings prior to the start of the study. Daily egg production, weekly feed intake and egg weight were recorded per pen and feed conversion ratio (g egg:g feed) was calculated per pen. All procedures were approved by the University of Nebraska-Lincoln Institute of Animal Care and Use Committee2.
Diets
Hens were fed a corn-soy basal diet to meet Bovan nutrient intake recommendations3 and NRC poultry recommendations (Table 2.1). Hens in the control group were fed the basal diet with no MOS additive. Hens in the experimental group were fed the same basal diet with the addition of MOS which was added on top of the formulated diet. The MOS additive had an inclusion rate of 800g/ton. Hens were given access to 110 g/hen/d and water was provided ad libitum via nipple drinker system in cages and bell drinkers for cage free pens.
Sample Collection
Fecal and Litter Samples
Fecal samples from conventional cage hens, approximately 10 g manure was collected from four equidistant points from the manure tray placed directly below each cage and placed into a sterile Whirl Pak bag. When placed into the bag, samples were hand mixed thoroughly. Latex gloves were used to collect the samples and were changed between cages. Litter and fresh fecal samples were taken from four points equidistant
2 Insitutional Animal Care Program, [email protected]. 3 ISA North America, Kitchener, Ontario, Canada, N2K 3S2. 63 from the center of the pen, placed into sterile Whirl Pak4 bags and hand massaged to mix
(Baurhoo et al., 2009). Latex gloves were used to collect the samples and were changed between each cage free pen. Samples were then weighed and placed in a 1:10 dilution of either 0.85% saline solution (E. coli enumeration) or buffered peptone water5 (Salmonella presence).
Egg Shell Crush
Two eggs per conventional cage and four eggs per cage free pen were collected; gloves were changed between cages/pens. Eggs were placed onto a plastic egg flat disinfected with Tek-Trol®6 according to manufacture instructions and taken to the microbiology lab for analysis. Egg shell crush was done in a modified method described by Hannah et al., (2011). Egg contents were aseptically removed by breaking the egg on a sterile surface and contents discarded. Egg shells were then placed into sterile 50 mL tubes and further crushed with a sterile glass rod. Then, 20 mL of buffered peptone water7 (for Salmonella presence) or 0.85% saline solution (for E. coli enumeration) was added to the tubes and egg shells were further crushed for 1 minute.
Bacterial Analysis
Salmonella presence was determined during weeks 1, 3, and 5 of the 6 week study. E. coli and coliform enumeration took place during weeks 2, 4, and 6. To determine presence of Salmonella, buffered peptone water8 was added in a 1:10 dilution
4 Nasco, Fort Atkinson, WI, 53538. 5 Remel Products, Lenexa, KS, 66215. 6 Bio-Tek Industries, Atlanta, GA, 30318. 7 Remel Products, Lenexa, KS, 66215. 8 Remel Products, Lenexa, KS, 66215. 64 by sample weight and incubated for 24 hours at 37°C. Then, 1 mL aliquots inoculated 9 mL tubes of RV broth9 and incubated at 42°C for 18-24 hours, 10 µL were then plated onto CHROMagar Salmonella10 plates and incubated aerobically for 24-48 hours at 37°C.
Plates were then evaluated for the presumptive presence of Salmonella colonies. Mauve colored colonies were identified as presumptive positive Salmonella (Wolfenden et al.,
2011; Huff et al., 2013). E. coli enumeration was conducted as follows; samples were diluted ten-fold to 10-5 in sterile 0.85% NaCl solution and 10 µL were plated onto
CHROMagar ECC11 for enumeration of E. coli and coliforms (Hinton et al., 2007).
Plates were incubated aerobically at 42°C for 24 hours. E. coli and coliform colonies were differentiated by blue and red gas producing colonies respectively. Total coliform count was done by combining the count of the blue and red colonies. Bacterial numbers were converted to log10 colony-forming units per gram of sample for statistical analysis.
Intestinal Samples
At the conclusion of the study, two hens per conventional cage and four hens per cage free pen were euthanized by cervical dislocation. Duodenal and ceca samples were collected aseptically. Contents of the duodenum and ceca were gently squeezed into sterile 50 mL tubes, immediately taken to the lab and frozen at
-20°C until further analysis.
Real-Time PCR Analysis of Intestinal Samples
9 BD Difco, Franklin Lakes, NJ, 07417. 10 DRG International, Springfield, NJ 07081. 11 DRG International, Springfield, NJ 07081.
65
DNA extraction of duodenal and ceca samples was done using MagMax Pathogen
RNA/DNA kit12 done to manufacturer instructions. Quantity and quality of DNA was determined using a NanoDrop ND-1000 spectrophotometer13 . Quantitative real time
PCR was conducted to determine presence and enumeration of Salmonella and E. coli.
Salmonella specific primers (ttr-6 (forward)) CTCACCAGGATATTACAACATGG; ttr-
4(reverse) AGGCAGACCAAAAGTGACCATC)14 were chosen to amplify a 94-base pair fragment (Malorny et al., 2004). E. coli subgroup primers (D Ecoli F 5’-GTT AAT
ACC TTT GCT CAT TGA-3’ and D Ecoli R-5’-ACC AGG CTA TCT AAT CCT GT-3’) were chosen to amplify a 340-base pair fragment (Kim et al., 2011). The standard organism for Salmonella analysis was S. enteritidis phage type 13a, isolated from a poultry sample and graciously donated from the University of Georgia15. E. coli standard was an isolate from poultry feces at the University of Nebraska-Lincoln16.
Amplification of Salmonella was performed using 15 µL final reaction volume containing 10 mM primers, 10 mM TaqMan17 Salmonella specific probe, 4 µL template
DNA, 2.525 µL PCR grade water, and 7.5 µL TaqMan Gene Master Mix18. The
Salmonella target probe was labeled at the 5’ end with the reporter dye 6- carboxyfluorescein (FAM) and at the 3’ end with Eclipse Dark Quencher (Malorny et al.,
2004). A standard curve was constructed using S. enteritidis isolate using Quick Extract
12 Life Technologies, Grand Island, NY, 14072. 13 NanoDrop Technologies, Wilmington, DE, 19810. 14 Integrated DNA Technologies, Coralville, IA. 15 USDA, ARS, SAA Laboratory, Athens, GA 30605. 16 University of Nebraska-Lincoln, Animal Science Complex, 68583. 17 Life Technologies, Grand Island, NY, 14072. 18 Life Technologies, Grand Island, NY, 14072.
66
Bacterial DNA Extraction kit19. The DNA was then serial diluted down to 1011 and real time PCR using 7500 Real-Time PCR System20 was conducted to determine efficiency.
The thermocycle utilized during the real time PCR reaction was 50ºC for 2 min, 95ºC for
10 min, 50 cycles of 95ºC for 15 sec and 60ºC for 30 sec.
Amplification of E. coli was performed using 10 µL final reaction containing 5
µL 2x Power SYBR® Green Master Mix21 (SYBR Green I Dye, AmpliTaq® Gold DNA
Polymerase, UP, dNTPs, Passive reference, Optimized buffer components),0.4 µL primers (0.2 µL forward, 0.2 µL reverse, diluted down to 10µM concentration each), 3
µL DNA template, and 1.6 µL PCR-grade water. The standard curve was constructed by using DNA from an E. coli isolate extracted using Quick Extract Bacterial DNA
Extraction kit22. The DNA was then serial diluted down to 1010 and real time PCR using
7500 Fast Real-Time PCR System23 was conducted to determine efficiency. The thermocycle utilized during the PCR reaction 95.0°C for 3 min, 40 cycles of was at
95.0°C 30s, 58°C 30s, and 72°C 30s and a final extension a 72°C for 5 min. All real time
PCR runs had a melting curve analysis conducted to ensure that primers were binding at the correct temperatures (De Medici et al., 2003).
Statistical Analysis
All data were analyzed using the Proc Glimmix procedure in SAS for randomized complete block design with a 2x2 factorial arrangement. Hens were housed in separate but identical rooms, with room serving as block. Feed intake, egg production, egg
19 Epicentre Biotechnologies, Madison, WI, 53719. 20 Life Technologies, Grand Island, NY, 14072. 21 Life Technologies, Grand Island, NY, 14072. 22 Epicentre Biotechnologies, Madison, WI, 53719. 23 Life Technologies, Grand Island, NY, 14072. 67 weight, feed conversion, fecal E. coli and coliform counts were analyzed by repeated measures analysis and tested for the effects of MOS supplementation and housing over time. Repeated measures analysis was conducted to determine changes in production data throughout the course of the study. Covariance patterns were tested to determine the best fit for the model. Covariance patterns tested were compound symmetry (CS), autoregressive (ar(1)), toeplitz (toep), unstructured (un), and heterogeneous autoregressive (arh(1)). The model is shown below:
Y=µ + Bi + Mj + Hk + Tl + MHjk + MTjl + HTkl + MHTjkl + εijkl
Where µ is the overall mean; Bi is the block effect; Mj is the MOS addition; Hk is the housing effect; Tl is the time effect; MHjk is the MOS by housing effect; MTjl is the MOS by time effect; HTkl is the housing by time effect; MHTjkl is the MOS by housing by time effect; εijkl is the residual error. Means were separated using the LS means statement.
Weekly fecal E. coli and coliform counts as well as copy number of E. coli and
Salmonella were analyzed via Proc Glimmix using the following model:
Y=µ + Bi + Mj + Hk + MHjk + εijk
Where µ is the overall mean; Bi is the block effect; Mj is the MOS addition; Hk is the housing effect; MHjk is the MOS by housing effect; εijk is the residual error.
Fecal and egg shell crush Salmonella prevalence, shell crush E. coli and coliform prevalence results were combined for across the study and analyzed by logistic regression analysis using the logit function in SAS, resulting in formation of an odds ratio. Odds ratios are used to measure the association between exposure and outcome 68
(Szumilas, 2010). An odds ratio was used in this study to the association of recovering a positive sample over the total number of samples taken. This was calculated by taking the expodential of the estimate for each treatment and main effect. The model is shown below:
Log (µij/(1- µij))=Mi + Hj
Where µij is the mean and 1- µij is the varience; Mi is the MOS effect; Hj is the housing effect.
2.4 RESULTS AND DISCUSSION
Production Results
There was not a significant three way interaction between MOS, housing type and time (P≤0.719) for feed intake (Table 2.2). There was not a significant interaction with
MOS over time (P≤0.102) or when examining MOS by housing type interaction
(P≤0.163) (Table 2.2). There was a significant effect between housing and time
(P≤0.0001) (Table 2.2). Although feed intake was the same for hens in cage and cage free systems at the start of the study, from week 73 to 77 feed intake was markedly increased for cage free compared to cage (Figure 2.1). This finding contradicts Singh et al., (2009) and Golden et al., (2012), who found no differences in feed intake between cage and cage free housing systems. A possible reason for increased feed intake could be due in part to feed wastage and in part to an increase in consumption.
There was not a three way interaction between MOS, housing system and time
(P≤0.378) when examining egg production (Table 2.2). Furthermore, there was not a 69 significant interaction between MOS and housing system (P≤0.214) or MOS and time
(P≤0.153) (Table 2.2). However, there was a significant interaction with housing system over time (P≤0.001) (Table 2.2). Examining the data over the course of the study, hens housed in cages had on average a higher percent egg production, however at 75 weeks of age, egg production for cages continued to decrease while egg production for cage free increased (Figure 2.2). The increase in egg production for cage free hens is most likely a result of increased feed intake observed. Singh et al. (2009) showed similar findings.
Cage hens had higher initial egg production; cage free caught up and then surpassed cage hens at the final time point (Singh et al., 2009). Even though over time egg production in cage free pens increased, the main effect of housing showed no significant difference
(P≤0.287). Golden et al., (2012) found that hens housed in cages had higher egg production than hens in a free range housing system. These contradicting results indicate that more research needs to be conducted on the effects of alternative housing systems and egg production.
Examining main effects, MOS had a significant negative impact on egg production (P≤0.008) which showed that diets supplemented with MOS had lower egg production (77.66%) compared to hens fed the basal diet (81.98%) (Table 2.2). A similar depression in egg production in older laying hens with MOS supplemented diets was found by Shashidhara and Devegowda (2003). These findings are contrary to Berry and
Lui (2000) and Stanley et al. (2000), who found egg production percentage was significantly improved in hens fed a MOS supplemented diet.
Overall, there was not a significant effect of MOS, housing type and time for egg weight (P≥0.990) or feed conversion (P≥0.697) (Table 2.2). Furthermore, there was not a 70 significant interaction between MOS and housing type for egg weight and feed conversion (P≥0.355, 0.695). There was a significant housing by time interaction for egg weight (P≤0.005) (Table 2.2). Egg weight increased for cage free hens during 76-77 weeks of age while decreasing for conventional cage hens. Singh et al. (2009) and Vits et al. (2005) also found higher egg weights with hens housed in floor pens than hens in conventional cages. The increase in egg weight could be attributed to a large increase in feed intake from 76-77 weeks of age. There was a significant time by housing type interaction (P≤0.015) for feed conversion ratio, mirroring feed intake and egg production
(Table 2). These results contradict the previous findings of Singh et al., 2009, who found no feed conversion differences and the findings of Golden et al., (2012), who found cage hens had a significantly higher feed conversion ratio than free range counterparts.
Even though alternative housing remains a priority among consumers, little research has been conducted examining performance parameters in cage free housing systems. A study conducted by Singh et al., (2009) compared laying hens in cage and cage free housing. This group found no significant differences in performance parameters. This complements our findings of no significant differences of the main effect of housing system on general production parameters; however the effect of housing system on feed intake, egg production and egg weight across time is more difficult to explain. Although hens were initially given access to 110 g/hen/d, cage free pens frequently ran out of feed more quickly than hens in conventional cages. Comparing our findings to the literature, feed intake was not unnaturally high for hens in alternative housing. A study examining aviary systems found that hens consumed on average 122 g/hen/d spanning 20-80 weeks of age (Abrahamsson and Tauson, 1998) which is similar 71 to our findings. As a result of an increase in feed intake in cage free hens, egg production and egg weight were positively affected. Singh et al., (2009) found that cage free hens had a greater body weight and had higher egg production and egg weight as the hens aged. Body weight was not measured in the current study, increased feed intake was likely the cause of higher egg weight.
Mannanoligosaccharides have been utilized with great success in broiler and turkey production, having a positive impact on performance without the use of antibiotic growth promoters (Hooge, 2004; Sims et al., 2004; Kim et al., 2011). However, reports of performance improvement in laying hens remains limited (Bozkurt et al., 2012).
Results of studies conducted examining layer performance while supplementing with
MOS remain mixed, while some report very positive results (Berry and Lui, 2000;
Stanley et al., 2000) others report no differences to a slight depression in layer performance (Shashidhara and Devegowda, 2003; Zaghini et al., 2005; Bozkurt et al.,
2012). More research needs to be conducted examining the effects of MOS supplementation and layer performance in conventional and alternative systems.
Bacteriology Results
Fecal Samples
Focusing on E. coli, there was not a significant housing by MOS effect for weeks
73 (P≤0.398), 75 (P≤0.562), and 77 (P≤0.288) or across all three weeks (P≤0.742) nor was there a significant three way interaction between housing, MOS and time (P≤0.403)
(Table 2.3). Examining main effects of housing and MOS for weeks 73, 75 and 77, there was not a significant effect for housing (P≤0.403,0.752, and 0.180 respectively) or time 72
(P≤0.139) (Table 2.3). There was a significant effect on MOS at week 73 (P≤0.037) and
75, trending toward significance (P≤0.062) with no significance time effect at week 77
(P≤0.307) (Table 2.3). As a result, there was a significant effect for MOS over time
(P≤0.021) (Table 2.3). Upon closer examination, during week 73, hens fed MOS had higher shedding of E. coli (6.20 CFU/g) than control diet counterparts (4.51 CFU/g)
(Table 3). However, during week 75, hens fed the control diets had a trend of shedding more E. coli (6.23 CFU/g) than MOS (5.56 CFU/g) fed hens (Table 2.3). Most studies examining MOS and its effect on pathogenic bacteria have focused on intestinal and ceca sampling, very few have done direct examination of feces. The proposed function of
MOS in the gut is to attach to E. coli and Salmonella and as a result less is excreted in the feces (Newman, 1994; Baurhoo et al., 2007). However, our results show an increase in
E. coli excretion during week 73 of age, which could be an indication of a “shedding effect”. Although it is not significantly different, during weeks 75 and 77, E. coli is numerically lower. Similar results have been observed by Yang et al., (2007) and Brzoska et al., (2005) who found that MOS increased E. coli counts in young birds. A purge or gut shedding in response to MOS can be a positive effect (Yang et al., 2007).
Housing did not have a significant effect on E. coli shedding (Table 2.3). Results from previous studies examining the presence of pathogenic bacteria in alternative housing systems have had mixed results (Holt et al., 2011; Jones et al., 2011; Jones et al.,
2012). De Reu et al., 2009 stated that microbiology results for housing will continue to be mixed as a result of differing production practices and management.
Coliform results mirror E. coli, although not as dramatic as E.coli. There was no significant housing by MOS effect was found for weeks 73, 75, and 77 (P≤0.532,0.531, 73 and 0.192, respectively) nor was there significant housing or MOS by time effects when all weeks were compared (P≤0.365) (Table 2.3). Examining main effects of MOS and housing type, during week 73, diets containing MOS were approaching significance
(P≤0.067). Diets that contained MOS tended to have higher shedding of coliforms (6.46
CFU/g) compared to control diets (4.86 CFU/g) early on in the trial (Table 3). This trend did not continue for weeks 75 and 77 or when all weeks were compared. Housing type was approaching significance during week 75 (P≤0.093), showing a trend of cage housing having higher shedding (6.42 CFU/g) than cage free (6.01 CFU/g). Jones et al.,
(2011) reported that free-range hens had a higher coliform count than cage counterparts.
Our findings differ as we found no significant differences between the housing type and coliform presence in the feces or litter. Which could be due to the nature of the sampling.
In the study conducted by Jones et al., (2011), swabs of the environment were taken, rather than direct sampling of feces.
Presumptive Salmonella prevalence is shown as number positive over total tested in Table 2.4 and Table 2.5 shows the odds ratio analysis results for all weeks combined.
Overall, there were a high number of positive samples; this most likely resulted from the hens having a natural low grade infection of Salmonella prior to the start of the trial.
There was no significant interaction between MOS and housing (P≤0.781) or in the main effects of MOS (P≤0.268) and Housing type (P≤0.781). These results contradict those found by Lilly et al., (2011) who found administering MOS in an organic broiler production system significantly reduced the presence of Salmonella. Furthermore,
Spring et al., (2000) and Fernandez et al., (2000) found MOS reduced the amount of
Salmonella enteritidis colonization in broiler chicks. Since we examined the feces 74 directly, this could have led to the differences. As Lilly et al., (2011) examined the litter and Spring et al., (2000) and Fernandez et al., (2000) examined intestinal content and
Salmonella attachment. Possible reasons for our differing results when examining MOS and Salmonella could be that unlike the studies conducted by Spring et al., (2000) and
Fernandez et al., (2000), our hens were not inoculated with Salmonella and therefore did not observe such a dramatic drop in Salmonella prevalence when administered MOS. The study conducted by Lilly and coworkers (2011) was done on recycled litter, which contributed a greater challenge than fresh shavings.
Shell Crush Samples
E. coli, coliform, and Salmonella proportions of positive over total tested are presented in Tables 2.6, 2.7, and 2.8. Odds ratios for E. coli, coliform, and Salmonella are presented in Tables 2.9, 2.10, and 2.11. There was not a significant interaction between MOS and housing for E. coli (P≤0.407) or MOS inclusion (P≤0.893) (Table
2.9). There was a significant housing effect (P≤0.033), the odds of an egg shell testing positive for E. coli in cages was 0.17 and in cage free was 0.52 (Table 2.9). Although the odds of finding a positive egg shell crush were higher in cage free than cage, both of the odds are below 1, indicating a low risk of egg shell contamination. Examining proportions of positive over total tested for the main effect of housing type, cages had
12.5% positive throughout the study and cage free pens had 34.5% positive. The differences found between housing units were similar to what was found by Hannah et al., (2011). Although statistical analysis was not conducted on the eggshell results due to the low number of positive results, the prevalence of E. coli was 15% in cage free floor pens and 11% in cages. There has been very little work conducted examining the effects 75 of prebiotics on eggshell bacteria presence. Our work is one of the first examining the effects of prebiotics and eggshell contamination of pathogenic bacteria. Because of the consumer health risk associated with eggshell contamination, more work needs to be conducted in this area.
Coliforms exhibited a similar pattern as E. coli. There was not a significant interaction between MOS supplementation and housing type (P≤0.753) (Table 2.10).
Examining main effects, there was not a significant effect of MOS supplementation
(P≤0.753), there was a significant housing effect (P≤0.020) (Table 2.10). The housing effect showed that the odds of coliform presence on eggshells was higher (0.71) than in cages (0.23) (Table 10). Even though the odds of finding coliform on the eggshell is higher in cage free pens, the odds ratio is still below 1. This is an indication that the overall odds of finding coliforms on the eggshell are low. Cage free eggs had a higher recovery of E.coli is due to the fact that the eggs were in closer contact with manure and shavings. Even if layed in the nest box, manure still got on the egg shell which resulted in a higher ratio of E. coli positives than cage counterparts. These results are similar to
Hannah et al., (2011) and Jones et al., (2011). Hannah and coworkers (2011) found lower incidence of coliforms on eggshells coming from cages than cage free pens. Similarly,
Jones and coworkers (2011) had lower CFU/g coliform counts on eggshells that came from cages rather than free-range environment.
There was not a significant interaction between MOS and housing for presumptive Salmonella egg shell prevalence (P≤0.181) (Table 2.11). Examining the main effects, MOS was not significant (P≤0.826) and housing was not significant
(P≤0.272) (Table 2.11). The lack of differences between cage and cage-free presumptive 76
Salmonella prevalence on the egg shell complements the findings of Jones et al., (2011).
Jones et al., (2011) found no significant differences on presumptive Salmonella prevalence on the egg shell in cage and free-range environments. There have not been many studies conducted examining the effect of MOS or other prebiotics on presence of
Salmonella on the egg shell. Since Salmonella presence in the house and in egg contents serve as an indicator of contamination, there is a need for more research to be conducted examining the effects of prebiotics and egg shell microbiome differences.
Real Time PCR Analysis
Examining E. coli populations in the duodenum, there was no significant interaction differences between MOS supplementation and housing type (P≤0.229)
(Table 2.12). Housing type did not influence the amount of E. coli in the duodenum (P≤
0.835) (Table 10). MOS supplementation showed to have a very significant effect on E. coli population (P≤0.0007) (Table 2.12). Diets containing MOS had a 12% reduction in
E. coli numbers compared to the control treatment. Ceca E. coli populations did not show the same responses as in the duodenum. MOS supplementation by housing type was not significant in the ceca (P≤0.466) (Table 2.12). The main effects of MOS supplementation and housing type were also not significant in the ceca (P≤0.274; 0.421)
(Table 2.12). There was not a significant MOS by housing interaction for Salmonella for duodenum or ceca samples (P≤0.16, 0.801) (Table 2.13). The main effects of MOS were not significant for duodenum and ceca on Salmonella populations (P≤0.286, 0.486) and housing was not a significant effect (P≤0.344, 0.072) (Table 2.13). In fact, Salmonella population was very consistant in duodenum and ceca among the various treatments. 77
It has been proposed that MOS mode of action is to attach to the type 1 fimbrae found on E. coli and Salmonella, absorb and remove harmful bacteria from the gastrointestinal tract (Newman, 1994; Patterson and Burkholder, 2003; Park et al., 2013).
E. coli population in the duodenum showed a significant effect in this study, however there was not a significant effect in the cecum. Very few studies have been conducted examining the effects of MOS on the upper gastrointestinal tract. Therefore, it is difficult to compare the results. However, based our results it could be suggested that MOS has a greater effect on reducing E. coli in the upper gastrointestinal tract rather than the lower.
The impact MOS has on E. coli populations in the ceca have been mixed. An E. coli challenge study conducted by Baurhoo et al (2009) found MOS effectively lowered cecal
E. coli counts. Zdunczyk et al., (2005) found with increasing inclusion of MOS, cecal E. coli population decreased. However, Biggs et al. (2007) found that MOS did not significantly alter E. coli populations in the cecum.
Supplementing with MOS has previously been shown to lower Salmonella population in the cecum (Spring et al., 2000; Fernandez et al., 2000); however, such studies were challenge studies. Therefore, comparing the results from our study to challenge studies may not be a completely accurate comparison. Our results showed that
MOS supplementation did not have an influence on natural Salmonella populations in the upper intestine or lower. In order to provide industry with applicable information, there is a need for more studies to be conducted examining the effects of prebiotics on a natural
Salmonella infection.
In conclusion, MOS had a significant positive effect on E. coli populations in the upper gastrointestinal tract. However, MOS supplementation did not have a significant 78 effect on Salmonella or E.coli counts and presence in the ceca, fecal samples or eggshell.
Overall, supplementation with MOS did reduce E. coli and coliform fecal counts through the study. Finally, housing system did not have a significant effect on fecal E. coli, coliform or Salmonella populations. However, housing did have a significant effect on egg shell E. coli and coliform prevalence, with cage free having higher odds of E. coli and coliform contamination. Finally, housing did not have an effect on intestinal E. coli and Salmonella population numbers. More research needs to be conducted examining the effects of MOS in alternative systems for laying hens and how changes in the gut microbiome affect litter, egg shell and intestinal microbiology.
79
2.5 REFERENCES
Abrahamsson, P., and R. Tauson. 1998. Performance and egg quality of laying hens in an aviary system. J. Appl. Poultry Res. 7:225-232.
Baurhoo, B., P.R. Ferket, X. Zhao. 2009. Effects of diets containing different concentrations of mannanoligosaccharide or antibiotics on growth performance, intestinal development, cecal and litter microbial populations, and carcass parameters of broilers. Poult. Sci. 88:2262-2272.
Berry, W.D., and P. Lui. 2000. Egg production, egg shell quality and bone parameters in broiler breeder hens receiving Bio-Mos. Poult. Sci. 79(Suppl. 1): 124 (Abstr.). Biggs, P., C.M. Parsons, and G.C. Fahey,. 2007. The effects of several oligosaccharides on growth performance, nutrient digestibilities and cecal microbial populations in young chicks. Poult. Sci. 86:2327-2336.
Bozkurt, M., K. Kucukyilmaz, A.U. Catli, M. Cinar, E. Bintas, and F. Coven. 2012. Performance, egg quality and immune response of laying hens fed diets supplemented with mannan-oligosaccharides or an essential oil mixture under moderate and hot environmental conditions. Poult. Sci. 91¨1379-1386. Brozoska, F., S. B. Buluchevskij, B. Sliwinski and K.Stecka. 2005. Preliminary study of the microbial spectrum of the digestive tract in broilers fed diets with and without antibiotic supplementation. J. Anim. Feed Sci. (Suppl. 1):431-434. De Medici, D., L. Croci, E. Delibato, S. Di Pasquale, E. Filetici, and L. Toti. 2003. Evaluation of DNA extraction methods for use in combination with SYBR Green I real- time PCR to detect Salmonella enterica serotype enteritidis in poultry. Appl. Environ. Microbiol. 69(6): 3456-3461.
De Reu, K., T.B. Rodenburk, K. Grijspeerdt, W. Messens, M. Heyndrickx, F.A.M. Tuyttens, B. Snock, J. Zoons, and L. Herman. 2009. Bacteriological contamination, dirt, and cracks of eggshells in furnished cages and noncage systems for laying hens: An international on-farm comparison. Poult. Sci. 88:2442-2448.
Fernandez, F., M. Hinton, B. Van Gils. 2000. Evaluation of the effect of mannan- oligosaccharides on the competitive exclusion of Salmonella Enteritidis colonization in broiler chickens. Avian Path. 29:6, 575-581. Gaggia, F., P. Mattarelli, B. Biavati. 2010. Probiotics and prebiotics in animal feeding for safe food production. Int. J. of Food Microbiol. 141(31): S15-S28.
Gibson, G.R., and M.B. Roberfroid. 1995. Dietary modulation of the human colonic microbiota: introducing the concept of prebiotics. J. Nutr. 125: 1401-1412. 80
Golden, J.B., D.V. Arbona, and K.E. Anderson. 2012. A comparative examination of rearing parameters and layer production performance for brown egg-type pullets grown either for free-range or cage production. J. Appl. Poult. Res. 21:95-102.
Greene, J.L. and T. Cowan. 2012. Table egg production and hen welfare: the UEP-HSUS agreement and H.R. 3798. Congressional Research Service.
Hannah, J.F., J.L. Wilson, N.A. Cox, J.A. Cason, D.V. Bourassa, M.T. Musgrove, L.J. Richardson, L.L. Rigsby and R.J. Buhr. 2011. Comparison of shell bacteria from unwashed and washed table eggs harvested from caged laying hens and cage-free floor- housed laying hens. Poult. Sci. 90:2010-1115.
Hinton, A.J., J.K. Northcutt, D.P. Smith, M.T. Musgrove, and K.D. Ingram. 2007. Spoilage microflora of broiler carcasses washed with electrolyzed oxidizing or chlorinated water using an inside out bird washer. Poult. Sci. 86:123-127.
Holt, P.S., R.H. Davies, J. Dewulf, R.K. Gast, J.K. Huwe, D.R. Jones, D. Waltman, and K.R. William. 2011. The impact of different housing systems on egg safety and quality. Poult. Sci. 90:251-262.
Hooge, D.M. 2004. Meta-analysis of broiler chicken pen trials evaluating mannan oligosaccharides, 1993-2003. Int. J. Poult. Sci. 3:163-174. Huff, G.R., W.E. Huff, S. Jalukar, J. Oppy, N.C. Rath, and B. Packialashmi. 2013. The effects of yeast feed supplementation on turkey performance and pathogen colonization in a transport stress/Escherichia coli challenge. Poult. Sci. 92:655-662.
Jones, D.R., K.E. Anderson, and M.T. Musgrove. 2011. Comparison of environmental and egg microbiology associated with conventional and free-range laying hen management. Poult. Sci. 90:2063-2068. Jones, D.R., K. E. Anderson, J.Y. Guard. 2012. Prevalence of coliforms, Salmonella, Listeria, and Campylobacter associated with eggs and the environment of conventional cage and free-range egg production. Poult. Sci. 91:1195-1202. Kim, G.B., Y.M. Seo, C.H. Kim, and I.K. Paik. 2011. Effect of dietary prebiotic supplementation on the performance, intestinal microflora, and immune response of broilers. Poult. Sci. 90:75-82. Lilly, K.G.S., L.K. Shires, B.N. West, K.R. Beaman, S.A. Loop, P.J. Turk, G.K. Bissonnette, and J.S. Moritz. 2011. Strategies to improve performance and reduce preslaughter Salmonella in organic broilers. J. Appl. Poult. Res. 20:313-321.
Malorny, B., E. Paccassoni, P. Fach, C. Bunge, A. Martin, R. Helmuth. 2004. Diagnostic real-time PCR for detection of Salmonella in food. Appl. Environ. Microbiol. 70(12): 7046-7052. 81
Mench, J.A., D.A. Sumner, and J.T. Rosen-Molina. 2011. Sustainability of egg production in the US-The policy and market context. Poult. Sci. 90:229-240.
Newman, K. 1994. Mannan-oligosaccharides: Natural polymers with significant impact on the gastrointestinal microflora and the immune system. Pages 167-174 in Proc. Alltech’s 10th Annual Symposium: Biotechnology in the feed industry. T.P. Lyons and K.A. Jacques, ed. Nottingham University Press, Nottingham, UK. NRC. 1994. Nutrient Requirements of Poultry. 9th ed. Natl. Acad. Press, Washington, DC. O’Keefe, T. 2011. Egg producers hear case or laying hen welfare agreement. Egg Industry Oct: 6.
Park, S.H, I. Hanning, A. Perrota, B.J. Bench, E. Alm, and S.C. Ricke. 2013. Modifying the gastrointestinal ecology in alternatively raised poultry and the potential for molecular and metabolomic assessment. Poult. Sci. 92:546-561. SAS Institute. 2009. SAS User’s Guide: Statistics. Version 9.2 Edition. SAS Institude Inc. Cary, NC.
Scantlebury Manning, T., and G.R. Gibson. 2004. Prebiotics. Best Prac. Res. Clinical Gastr. 18(2): 287.
Shashidhara, R.G. and G. Devegowda. 2003. Effect of dietary mannan oligosaccharide on broiler breeder production traits and immunity. Poult. Sci. 82:1319-1325. Sims, M.D., K.A. Dawson, K.E. Newman, P. Spring, and D.M. Hooge. 2004. Effects of dietary mannan oligosaccharide, bacteracin methylene disalicylate or both on the live performance and intestinal microbiology of turkeys. Poult. Sci. 83:1148-1154. Singh, R., K.M. Cheng, and F.G. Silversides. 2009. Production performance and egg quality of four strains of laying hens kept in conventional cages and floor pens. Poult. Sci. 88:256-264. Spring P., C. Wenk, K.A. Dawson, and K.E. Newman. 2000. The effects of dietary mannan-oligosaccharides on cecal parameters and the concentrations of enteric bacteria in the ceca of Salmonella challenged broiler chicks. Poult. Sci. 79:205-211. Stanley, V.G., C. Brown, and T. Sefton. 2000. Single and combined effects of dietary protease and mannanoligosaccharide on the performance of laying hens. Poult. Sci. 79(Suppl. 1):62 (Abstr.). Szumilas, M. 2010. Explaining odds ratios. J. Can. Acad. Child Adolesc. Psychiatry. 19(3): 227-229. Vits, A., D. Weizenburger, H. Hamann, and O. Distl. 2005. Influence of different small group systems on production traits, egg quality and bone breaking strength of laying 82 hens. First communication: Production traits and egg quality. Zuchtungskunde 77:303- 323. Wolfenden, R.E., N.R. Pumford, M.J. Morgan, S. Shivaramaiah, A.D. Wolfenden, C.M. Pixley, J. Green, G. Tellez, and B.M. Hargis. 2011. Evaluation of selected direct-fed microbial candidates on live performance and Salmonella reduction in commercial turkey brooding houses. Poult. Sci. 90:2627-2631.
Yang, Y., P.A. Iji, A. Kocher, L.L. Mikkelsen, and M. Choct. 2007. Effects of mannanoligosaccharide on growth performance, the development of gut microflora, and gut function of broiler chickens raised on new litter. J. Appl. Poult. Res. 16:280-288.
Zaghini, A., G. Martelli, P. Roncada, M. Simioli, and L. Rizzi. 2005. Mannanoligosaccharides and aflatoxin B1 in feed for laying hens: effects on egg quality, aflatoxins B1 and M1 residues in eggs and aflatoxin B1 levels in liver. Poult. Sci. 84:825- 832. Zdunczyk, Z., J. Juskiewicz, J. Jankowski, E. Biedrzycka, and A. Koncicki. 2005. Metabolic response of the gastrointestinal tract of turkeys to diets with different levels of mannan-oligosaccharides. Poult. Sci. 84:903-909.
83
Table 2.1: Diet Composition Ingredient Diet 1 Diet 2 Corn (%) 48.34 48.34 DDGS (%) 15.00 15.00 Soybean Meal (%) 21.68 21.68 Veg. Oil (%) 2.98 2.98 Limestone Powder (%) 9.84 9.84 L-Lysine (%) 0.16 0.16 DL-Methionine (%) 0.16 0.16 Dical. Phos. (%) 1.30 1.30 Vit.-Min. Premix (%)1 0.20 0.20 Actigen (%) 0.08 0.00 Calculated Values Metab. Energy (kcal/kg) 2860.00 Protein (%) 18.00 Methionine (%) 0.45 Meth. + Cystine (%) 0.80 Lysine(%) 1.00 Calcium (%) 4.20 Av. Phosphorous (%) 0.41 Linoliec Acid (%) 2.80 Crude Fiber (%) 2.88 Sodium (%) 0.65 Arginine (%) 1.14 Cystine (%) 0.35 Tryptophan (%) 0.20 Threonine (%) 0.68 Selenium (mg/kg) 0.13 1Vitamin and trace minerals provided the following per kilogram: vitamin A (retinyl acetate, 6,600 IU); vitamin D3, 2,805 IU vitamin E (DL-α-tocopheryl acetate, 10 IU); vitamin K3 (menadione dimethpyrimidinol, 2.0mg); riboflavin (4.4 mg); pantothenic acid (6.6 -1 -1 mg); niacin (24.2 mg); choline (110 mg ); vitamin B7 (biotin, 8.8 mg ); and ethoxyquin (1.1 m%). Mn (MnO, 88 mg); Cu (CuSO4H2O, 6.6 mg); Fe (FeSO4H2O, 8.5mg); Zn (ZnO, 88 mg); and Se (Na2SeO3, 0.30 mg).
84
Table 2.2: Production Data: Feed Intake, Egg Production, Egg Wt., Feed Conversion Egg Feed Intake Egg Feed Conversion Treatment Pen Type Production (g/hen/d) Wt. (g) (g feed:g egg) (%)
MOS1 Cage 103.36 78.27 67.22 2.17 MOS1 Cage Free 114.10 78.17 66.45 2.11 Basal Cage 102.80 86.75 66.64 2.01 Basal Cage Free 121.44 80.99 67.12 2.20 SEM 2.64 2.66 0.633 0.102 Main Effects % MOS1 0.08 108.74 77.66 b 66.84 2.14 0.00 112.14 81.98a 66.88 2.10 P-Value 0.222 0.008 0.953 0.696 Housing Cage 103.10 b 80.88 66.93 2.09 Cage Free 117.78a 78.76 66.79 2.15 P-Value 0.0001 0.287 0.833 0.554 Interactions Housing*MOS1 0.163 0.214 0.355 0.217 Housing*Time 0.0001 0.001 0.005 0.015 MOS1*Time 0.102 0.153 0.563 0.254 Housing*MOS1*Time 0.719 0.378 0.990 0.750 a-b Means within main effects without a common subscript differ significantly. 1Actigen® Alltech, Nicholasville, KY.
85
Figure 2.1: Feed Intake: Housing System x Time
150.00 140.00
130.00 120.00 110.00 100.00 Cage 90.00 Cage Free
Feed Intake: FeedIntake: g/hen/d 80.00 70.00 60.00 72 73 74 75 76 77 Week of Age
86
Figure 2.2: Egg Production: Housing System x Time
110.00
100.00
90.00
80.00
70.00 Cage Cage Free
% % Egg Production 60.00
50.00
40.00 72 73 74 75 76 77 Week of Age
87
Figure 2.3: Egg Wt: Housing System by Time
71.00 70.00 69.00
68.00
67.00 66.00 Cage 65.00 Egg(g) Wt. Cage Free 64.00 63.00 62.00 61.00 72 73 74 75 76 77 Week of Age 88
Table 2.3: Fecal E. coli and Coliform CFU/g 1
E. coli log10 CFU/g Coliform log10 CFU/g Wk Wk Wk Wk Wk Wk Treatment Pen Type 73 75 77 All Weeks 73 75 77 All Weeks MOS2 Cage 6.20 5.41 4.28 5.30 6.57 6.32 5.82 6.24 MOS2 Cage Free 6.20 5.71 6.15 6.02 6.35 5.77 6.17 6.10 Basal Cage 3.89 6.27 5.89 5.35 4.46 6.51 6.26 5.74 Basal Cage Free 5.14 6.18 6.12 5.81 5.27 6.24 6.17 5.89 SEM 0.718 0.325 0.737 0.382 0.794 0.225 0.156 0.275 Main Effects MOS2 (%) 0.08 6.20a 5.56 5.22 5.66 6.46 6.05 6.00 6.17 0.00 4.51b 6.23 6.01 5.58 4.86 6.37 6.22 5.82 P Value 0.037 0.062 0.307 0.841 0.067 0.169 0.195 0.222 Housing Type Cage 5.04 5.84 5.09 5.32 5.51 6.42 6.04 5.99 Cage Free 5.67 5.94 6.14 5.92 5.81 6.01 6.17 6.00 P Value 0.403 0.752 0.180 0.139 0.715 0.093 0.416 0.983 Interactions Housing * MOS 0.398 0.562 0.288 0.742 0.532 0.531 0.192 0.604 Housing * Time 0.401 0.187 MOS*Time 0.021 0.110 Housing*MOS*Time 0.403 0.365 a,b Means with different superscripts differ significantly. 1 Mean of n=4 2 Actigen® Alltech, Nicholasville, KY.
89
Table 2.4: Fecal Salmonella Prevalence1 Number positive for Salmonella/number tested (%) Treatment Housing wk 72 wk 74 wk 76 All Weeks MOS2 Cage 4/4 (100%) 4/4 (100%) 1/4 (25%) 9/12 (75%) MOS2 Cage Free 3/4 (75%) 4/4 (100%) 4/4 (100%) 11/12 (92%) Control Cage 4/4 (100%) 4/4 (100%) 3/4 (75%) 11/12 (92%) Control Cage Free 4/4 (100%) 4/4 (100%) 2/4 (50%) 10/12 (83%) % MOS 0.08% 7/8 (88%) 8/8 (100%) 5/8 (63%) 20/24 (83%) 0.00% 8/8 (100%) 8/8 (100%) 5/8 (63%) 21/24 (88%) Housing Cage 8/8 (100%) 8/8 (100%) 4/8 (50%) 20/24 (83%) Cage Free 7/8 (88%) 8/8 (100%) 6/8 (75%) 21/24 (88%) 1 Presumptive Salmonella was determined by mauve colony color on Chromagar® Salmonella. 2 Actigen® Alltech, Nicholasville, KY.
90
Table 2.5: Fecal Salmonella1 prevalence wks 72, 74, and 76 Odds3 Lower 95% Upper 95% Diet Housing Odds3 Confidence Interval Confidence Interval MOS2 Cage 2.99 0.70 12.82 MOS2 Cage Free 4.99 0.92 27.03 Control Cage 11.00 1.13 107.08 Control Cage Free 11.00 1.13 107.08 Main Effects % MOS2 0.08% 3.87 1.27 11.70 0% 11.00 2.20 54.99 Housing Cage 5.74 1.49 22.15 Cage Free 7.42 1.80 30.58 Odds Ratio P-Value MOS2 0.268 Housing 0.781 MOS*Housing 0.781 Odds Lower 95% Upper 95% Treatment Ratio4 Confidence Interval Confidence Interval Cage, 0.08%2 Cage Free,0.08%2 0.60 0.07 5.56 Cage, 0.08%2 Cage, 0.0% 0.27 0.02 4.06 Cage, 0.08%2 Cage Free, 0.0% 0.27 0.02 4.06 Cage Free,0.08%2 Cage, 0.0% 0.46 0.03 7.73 Cage Free, 0.08%2 Cage Free, 0.0% 0.46 0.03 7.73 Cage, 0.0% Cage Free, 0.0% 1.00 0.04 24.99 Main Effects MOS%2 0.08% 0.0% 0.35 0.05 2.50 Housing Cage Cage Free 0.78 0.11 5.48 1 Presumptive Salmonella was determined by mauve colony color on Chromagar® Salmonella. 2 Actigen® Alltech, Nicholasville, KY. 3 Odds of having fecal Salmonella over not having it for each treatment group. 4 Ratio of the odds of having Salmonella for two treatment groups.
91
Table 2.6: Prevalence of E. coli on the eggshell
Treatment Number of positive E. coli/number tested (%) Feed Additive Housing wk 73 wk 75 wk 77 All wks MOS1 Cage 0/8 (0%) 3/8 (37.5%) 1/8 (12.5%) 3/24 (12.5%) MOS1 Cage Free 4/16 (25%) 6/16 (37.5%) 5/16 (31.3%) 15/48 (31.3%) Control Cage 0/8 (0%) 1/8 (12.5%) 2/8 (25%) 3/24 (12.5%) Control Cage Free 5/16 (31.3%) 7/16 (47.8%) 6/16 (37.5%) 18/48 (37.5%) Main Effects MOS%1 0.08% 4/24 (16.6%) 8/24 (33.3%) 6/24 (25%) 18/72 (25%) 0.00% 6/24 (25%) 8/24 (33.3%) 8/24 (33.3%) 22/72 (30.6%) Housing Cage 0/16 (0%) 4/16 (25%) 2/16 (12.5%) 6/48 (12.5%) Cage Free 10/32 (31.3%) 8/24 (33.3%) 12/32 (37.5%) 34/96 (35.4%) 1 Actigen® Alltech, Nicholasville, KY.
92
Table 2.7: Prevalence of coliforms on the eggshell
Treatment Number of positive coliform/number tested (%) Feed Additive Housing wk 73 wk 75 wk 77 All wks MOS1 Cage 0/8 (0%) 3/8 (37.5%) 1/8 (12.5%) 4/24 (16.7%) MOS1 Cage Free 7/16 (43.8%) 8/16 (50%) 5/16 (31.3%) 20/48 (41.7%) Control Cage 1/8 (12.5%) 2/8 (25%) 2/8 (25%) 4/24 (16.7%) Control Cage Free 6/16 (37.5%) 7/16 (47.8%) 7/16 (37.5%) 20/48( 41.7%) Main Effects MOS%1 0.08% 7/24 (29.2%) 11/24 (45.8%) 6/24 (25%) 24/72 (33.3%) 0.00% 7/24 (29.2%) 9/24 (37.5%) 9/24 (37.5%) 25/72 (34.7%) Housing Cage 1/16 (6.25%) 5/16 (31.3%) 3/16 (18.8%) 9/48 (18.8%) Cage Free 13/32 (40.6%) 15/32 (46.9%) 12/32 (37.5%) 40/96 (41.7%) 1 Actigen® Alltech, Nicholasville, KY.
93
Table 2.8: Prevalence of Salmonella1 on the eggshell
Treatment Number of positive Salmonella1/number tested (%) MOS2 Housing Wk 72 wk 74 wk 76 All wks MOS2 Cage 0/8 (0%) 2/8 (25%) 3/8 (37.5%) 5/24 (20.8%) MOS2 Cage Free 0/16 (0%) 6/16 (37.5%) 6/16 (37.5%) 12/48 (25%) Control Cage 1/8 (12.5%) 1/8 (12.5%) 1/8 (12.5%) 3/24 (12.5%) Control Cage Free 4/16 (25%) 5/16 (31.3%) 9/16 (56.3%) 18/48 (37.5%) Main Effects MOS%2 0.08% 0/24 (0%) 8/24 (33.3%) 9/24 (37.5%) 17/72 (23.6%) 0.00% 5/24 (20.8%) 6/24 (25%) 10/24 (41.7%) 21/72 (29.2%) Housing Cage 1/16 (6.3%) 3/16 (18.8%) 4/16 (25%) 8/48 (16.7%) Cage Free 4/32 (12.5%) 11/32 (34.4%) 15/32 (46.9%) 30/96 (31.3%)
1 Presumptive Salmonella was determined by mauve colony color on Chromagar® Salmonella. 2 Actigen® Alltech, Nicholasville, KY.
94
Table 2.9: Effect of MOS and housing on E. coli egg shell prevalence wk 73, 75,and 77 Odds2 Upper 95% Lower 95% confidence Odds2 confidence limit limit Diet Housing MOS1 Cage 0.20 0.06 0.66 Cage MOS1 Free 0.41 0.21 0.82 Control Cage 0.14 0.04 0.55 Cage Control Free 0.66 0.34 1.25 Main Effects MOS%1 0.08% 0.29 0.14 0.57 0.00% 0.31 0.15 0.64 Housing Cage 0.17b 0.07 0.42 Cage Free 0.52a 0.32 0.83 Odds Ratio P-Value MOS1 0.893 Housing 0.033 MOS1*Housing 0.407 Upper 95% Odds Lower 95% confidence Treatment Ratio3 confidence limit limit
Cage, 0.08% 1 Cage Free, 0.08%1 0.54 0.13 2.16
Cage, 0.08%1 Cage, 0.0% 2.20 0.30 16.31 Cage, 0.08%1 Cage Free, 0.0% 0.67 0.16 2.75 Cage Free, 0.08%1 Cage, 0.0% 4.09 0.70 23.70 Cage Free, 0.08%1 Cage Free, 0.0% 1.25 0.45 3.50 Cage, 0.0% Cage Free, 0.0% 0.31 0.05 1.80 Main Effects MOS %1 0.08% 0.0% 1.66 0.54 5.11 Housing Cage Cage Free 0.41 0.13 1.25 1 Actigen®, Alltech Nicholasville, KY. 2 Odds of having eggshell E. coli over not having it for each treatment group. 3 Ratio of the odds of having E. coli over two treatment groups.
95
Table 2.10: Effect of MOS1 and Housing on coliform egg shell prevalence wk 73,75, and 77 Odds2
Lower 95% Upper 95% Diet Housing Odds2 confidence limit confidence limit MOS1 Cage 0.20 0.06 0.66 MOS1 Cage Free 0.71 0.38 1.35 Control Cage 0.26 0.09 0.79 Control Cage Free 0.71 0.38 1.35 Main Effects MOS%1 0.08% 0.38 0.19 0.74 0.00% 0.43 0.23 0.82 Housing Cage 0.23b 0.10 0.52 Cage Free 0.71a 0.45 1.12 Odds Ratio P-Value MOS1 0.753 Housing 0.020 MOS1*Housing 0.753 Odds Lower 95% Upper 95% Treatment Ratio3 confidence limit confidence limit Cage, 0.08%1 Cage Free, 0.8%1 0.27 0.05 1.59 Cage, 0.08%1 Cage, 0.0% 1.00 0.10 9.74 Cage, 0.08%1 Cage Free, 0.0% 0.78 0.12 5.28 Cage Free, 0.08%1 Cage, 0.0% 3.67 0.63 21.43 Cage Free, 0.08%1 Cage, 0.0% 2.87 0.81 10.11 Cage, 0.0% Cage Free, 0.0% 0.78 0.12 5.28 Main Effects MOS 0.08%1 0.0% 1.69 0.46 6.22 Housing Cage Cage Free 0.46 0.13 1.70 1 Actigen®, Alltech Nicholasville, KY. 2 Odds of having fecal coliforms over not having it for each treatment group. 3 Ratio of the odds of having coliforms for two treatment groups.
96
Table 2.11: Effect of MOS2 and housing on Salmonella1 egg shell prevalence wks 72, 74, and 76 of age
Odds3
Lower 95% Upper 95% Treatment Odds3 confidence limit confidence limit Diet Housing MOS2 Cage 0.333 0.199 0.930 MOS2 Cage Free 0.297 0.140 0.628 Control Cage 0.200 0.060 0.659 Control Cage Free 0.600 0.313 1.149 Main Effects % MOS2 0.08% 0.314 0.167 0.594 0.00% 0.346 0.175 0.683 Housing Cage 0.258 0.117 0.567 Cage Free 0.422 0.257 0.693 P-Value MOS2 0.826 Housing 0.272 MOS2*Housing 0.181 Odds Lower 95% Upper 95% Treatment Ratio4 confidence limit confidence limit Cage, 0.08%2 Cage Free, 0.0% 1.12 0.32 4.00 Cage, 0.08%2 Cage, 0.0% 1.67 0.35 8.05 Cage, 0.08%2 Cage Free, 0.0% 0.56 0.17 1.87 Cage Free, 0.08%2 Cage, 0.0% 1.49 0.36 6.08 Cage Free, 0.08%2 Cage Free, 0.0% 0.50 0.18 1.34 Cage, 0.0% Cage Free, 0.0% 0.33 0.09 1.30 Main Effects % MOS2 0.08% 0.0% 0.91 0.36 2.30 Housing Cage Cage Free 0.61 0.24 1.55 1 Presumptive Salmonella prevalence based on mauve colony color on Chromagar® Salmonella. 2 Actigen®, Alltech Nicholasville, KY. 3 Odds of having fecal Salmonella over not having it for each treatment group. 4 Ratio of the odds of having Salmonella for two treatment groups.
97
Table 2.12: Effect of MOS supplementation on E. coli population in Duodenum and Ceca Duodenum Ceca Treatment CFU/g1 CFU/g1 MOS2 Cage 1.508 2.060 MOS2 Cage Free 1.459 2.084 Control Cage 1.658 1.482 Control Cage Free 1.727 1.964 SEM 0.046 0.304 Main Effects MOS2% 0.08% 1.484b 2.072 0.00% 1.693a 1.723 P Value 0.0007 0.274 Housing Cage 1.583 1.771 Cage Free 1.593 2.024 P Value 0.835 0.421 Interaction MOS MOS2*Housing 0.229 0.466 1 Copy numbers were converted to log10 prior to statistical analysis. 2 Actigen®, Alltech Nicholasville, KY.
98
Table 2.13: Effect of MOS supplementation on Salmonella population in Duodenum and Ceca Duodenum Ceca Treatment CFU/g1 CFU/g1 MOS2 Cage 1.330 1.329 MOS2 Cage Free 1.329 1.330 Control Cage 1.329 1.329 Control Cage Free 1.330 1.330 SEM 0.000016 0.000054 Main Effects MOS2% 0.08% 1.330 1.330 0.00% 1.329 1.330 P Value 0.286 0.486 Housing Cage 1.330 1.329 Cage Free 1.329 1.330 P Value 0.344 0.072 Interaction MOS2*Housing 0.136 0.801 1 Copy numbers were converted to log 10 prior to statistical analysis 2 Actigen®, Alltech Nicholasville, KY. 99
CHAPTER 3: OBSERVATION OF SALMONELLA ENTERICA SEROVAR
ENTERITIDIS IN LAYING HENS DURING TRAVEL STRESS THROUGH
PEAK LAY
D. Hahn, A. Ampire, B. Kriefles, S.E. Purdum, K. Hanford, and S.C. Fernando
3.1 ABSTRACT
A study was conducted to observe the frequency of Salmonella enteritidis (SE) shedding starting with a transportation (approx. 200 mi) stress at 16 wks of age through
33 weeks of age. Pullets were vaccinated with Poulvac® ST vaccine at 1 day, 3 and 13 wks. Cloacal swabs were taken from 290 16 wk old Hy-Line W-36 white laying pullets at a commercial pullet rearing facility, as they were placed into numbered transport coops which corresponded to randomly assigned pens at the University of Nebraska-Lincoln laying hen research facility. Upon arrival at the research facility, 4 hens were placed into a multitered housing system, which resulted in 216 pullets housed in 54 pens. Cloaca swabs were taken 12 hours after arrival at the research facilityand then weekly from 16-
21 wks of age, biweekly from 22-29 wks of age and monthly until 33 wks of age. Egg pool samples were conducted the same week of cloaca swabbing by taking all eggs from each pen over a 48 hour period and pooling together by pen. All swabs and egg pools were initially screened for SE using a commercial SE quick test and confirmation of any presumptive positives was conducted by PCR. All pullets were negative for SE upon arrival to the research facilities. Out of 2,151 cloaca swabs taken throughout the course of the study, there were 11 presumptive positives, 4 were confirmed SE positives by PCR, 100 all egg pools were negative for SE. Since there were so few positives, traditional statiscal analysis could not be conducted. An intersesting observation of increased number of presumptive positives (n=3) occured 19 wks of age (1.38%), which is around point-of- lay. Frequency of presumptive positives decreased as the hens reached peak lay towards middle age (24-33 wks of age). Based on this observation, the current vaccination program is deturring SE shedding and more research needs to be conducted examining larger number of layers during this critical age of 16-20 wks of age.
3.2 INTRODUCTION
Salmonellosis in humans is one of the most prevalent food safety risks, with approximately 40,000 cases reported annually in the US alone (Park et al., 2013). Since
1990, 40 Salmonella outbreaks have been a result of poultry products or eggs (CDC,
2012). Furthermore, in 2010, the largest egg recall in US history took place due to an outbreak of Salmonella entertidis (SE) traced back to eggs from a layer facility. This outbreak caused the poultry industry to re-evaulate its control measures for SE and traceability, details are available in the Final Egg Rule (FDA Egg Rule Compliance
Guide, 2009). This program requires routine testing of pullet flocks and laying hen environment. If environmental samples come back positive, eggs are tested to prove that they are not infected with SE. It is very important that egg producers bring in a clean pullet flock into their facilities, in addition to keeping the layer hen’s environment clean.
Laying hens are exposed to SE by a variety of vectors including: ingesting contaminated insects, feed or water, and rodents inhabiting the layer house (Baumler et al., 2000; Guard-Petter, 2001). If hens have been exposed to SE, it is most likely to 101 colonize in the ileum or the ceca (Chappell et al., 2009). Once colonization of SE takes place, the carrier state developes (Chappell et al., 2009). The carrier state occurs in birds more than a few days old and the majority of the bacteria are cleared by the immune system while some survive in intracellular niches (Chappell et al., 2009). It has been shown that once a flock is acquires SE, it is difficult to dislodge from the intestine after colonization (Gast and Holt, 1998).
There have been previous studies conducted examining colonization of SE and S.
Typhimurium in poultry models. Cox et al., (1996) conducted a series of studies examining broiler chicks infected with S. Typhimurium via aresol, naval and oral infection modes. Conclsions were that chicks developed a carrier state infection after a few days of age, before the gut microbiome could be established, blocking S.
Typhimurium from colonizing. Gast and Holt (1998) examined laying hens experimentally incoluated with SE from one day old to 24 weeks of age. Conclusions reached were that a systemic infection occurred initially, resulting in the liver, cecum, and spleen to be highly colonized, after 4 weeks of age only the intestinal tract was colonized (Gast and Holt, 1998).
It has been clearly shown that carrier state infection of SE can develop in laying hens, however there are times where laying hens shed more SE. This was shown by
Schulz and coworkers (2011) as hens approached point-of-lay (11-20 weeks of age) had a higher frequency of shedding than middle age and older laying hens. Furthermore,
Johnston et al., (2012) showed as hens approach point-of-lay, there are signs of immunosuppression with a reduction of T lymphocytes and CD4+ cells. In addition, stressors such as transport and feed withdrawal have shown an increase in shedding that 102 can last several days (Freeman et al., 1981; Harvey and Klandorf, 1983; Nakamura et al.,
1993).
There have been various reports of SE prevalence in US flocks (Main and Frana,
2013). However, no study to the researchers knowledge been conducted in the US observing a normal flock through production cycles that mirror current production practices. As a result, the current study was conducted to evaluate SE shedding of vaccinated pullets pre lay thorugh peak lay and through a movement stress.
3.2 MATERIALS AND METHODS
Birds and Housing
Two hundred and ninety Hy-Line W-36 SE vaccinated 16 week old pullets were cloacal swabbed placed into 54 randomized travel coops. Pullets were vaccinated for SE on day 1 and 3 weeks of age with Poulvac® ST24 and at 13 weeks of age with Poulvac®
SE24. The travel coops were comprised of 7 decks with 14 pens per rack. Upon arrival at the University of Nebraska-Lincoln, 4 hens per travel pen were randomly selected and placed into a pre assigned layer cage based on travel pen assignment. This resulted in 216 hens that were monitored throughout the study. Hens were housed four per cage (600 cm2 per hen) in a four tiered manure belt cage system.25 The experiment was conducted early fall to mid winter in a tunnel-ventilated room. Hens were maintained on a 16L:8D photoperiod. Beginning at 21 weeks of age, during the weeks of swabbings, egg pool tests were conducted for SE presence. Egg pool analysis was conducted by collecting all eggs laid over a 48 hour period.
24 Zoetis Global Poultry, Durham, NC 27703 25 Farmer Automatic of America, Statesboro, GA 30452 103
Swabbing
After placement into travel coops, cloacal swabs were taken from all hens to determine Salmonella enteritidis (SE) status and placed on ice and transported to the lab for analysis. Cloacal swabbing was conducted by placing a sterile cotton tipped applicator within the cloaca, then gently moving in a circular motion. The samples were stored at 4°C overnight and processed the next morning. To determine SE status of the laying hens, cloaca swabs were processed using Romer SE Quick Tests26.
Approximately 12 hours after the hens arrived at the University of Nebraska-Lincoln poultry research facility, two swabs per hen were taken, one for SE analysis and one held at -20°C until further analysis was needed. Two swabs per hen were taken weekly until
21 weeks of age, and then swabbed biweekly until 29 weeks of age, then monthly until 33 weeks of age. Egg pools were conducted at 20 weeks of age and eggs were collected during the same week as cloaca swabbing. Eggs were collected from each pen over a 48 hr period and pooled for SE presence.
SE quick test analysis and confirmation
All swabs were analyzed for SE presence using RapidChek® SE quick tests26 test kits. Swabs were taken to the lab immediately following sampling and 10 mL of primary enrichment broth made to manufacturer instructions was added to each bag.
Samples were mixed and then allowed to incubate at 42°C for 16-22 hours. Following primary enrichment, a second broth was made from the kit supplied by the RapidChek®
SE quick tests26 and made to manufacturer’s instructions. Following primary enrichment,
26 Romer Labs Technology Inc., Newark, DE, 19713 104
0.2 mL of each primary sample was taken and placed into the secondary enrichment broth and allowed to incubate for an additional 16-22 hours at 42°C. Following the second enrichment, samples were removed and indicator strips were placed into each sample and allowed to incubate at room temperature for 10 minutes. The indicator strips were utilized to identify presumptive positive SE samples. The indicator strips read as follows: a negative result showed one line; a presumptive positive result showed two lines. Egg pool testing was conducted using RapidChek® SE quick tests26 kits. Egg contents were pooled by pen number (n=8), 20 mL of primary enrichment media was added and allowed to incubate for 40-48 hours at room tempearature. Following primary enrichment, 0.2 mL of each sample was added to a secondary enrichment. The samples were then allowed to incubate for 8 hours at 42ºC and tested by strip test as previously described.
Samples that showed a presumptive positive result, were placed on 40% glycerol stocks and stored at -80°C. A small portion was also taken for PCR confirmation. PCR confirmation of SE quick tests was conducted using S. enteritidis specific primers, SEFA-
1 (5’-GCAGCGGTTACTATTGCAGC-3’) and SEFA-2 (5’-
CTGTGACAGGGACATTTAGCG-3’)27, which are specific for sefA gene chosen to amplify a 310 base pair product (De Medici et al., 2003). DNA was extracted from the final enrichment broth by transferring 20 µL into 80 µL of double distilled RNA-DNA free PCR grade water and boiled at 95°C for 10 min in aVeriti® Thermal Cycler28. The samples were then centrifuged for 3 min at 1000 g and supernatant was used for PCR analysis. The PCR mixture used was the following: 3 µL DNA template, 0.25 µL Terra
27 Integrated DNA Life Technologies, Coralville, IA, 52241 28 Life Technologies, Grand Island, NY, 14072. 105
Taq Polymerase29, 5 mM dNTP, 10 mM primers, 2.5 µL buffer solution30, and 17.75 µL double distilled PCR grade water for a final reaction volume of 25µL. Samples were then placed in Veriti® Thermal Cycler31 and designated a thermal cycle of: 50°C for 2 min, 95°C for 10 min, and 35 cycles of: 95°C for 1 min, 55°C for 1 min, and 72°C 1 min and a final extension phase of 60° for 1 min (De Medici et al., 2003).
Statistical Analysis
Data was initially analyzed using chi squared analysis in SAS, however due to the fact that there were a small number of positive samples through the course of the study, an adequate chi square analysis could not be conduted. Therefore, the data presented has been analyzed by Microsoft Excel and formatted as a proportion positive over total sampled at each time point through the study.
3.4 RESULTS AND DISCUSSION
Out of 2,151 samples taken throughout the study, only 11 were presumptive positive; when ran through confirmation analysis, only 4 samples were confirmed as positive for SE by PCR analysis. Our findings were lower than industry standards, there were 0.51% presumptive positive and 0.19% confirmed positive; industry has found
1.39% of environmental sample positives (Main and Frana, 2013). Swabs of hens taken at the pullet facility were all negative. All egg pool samples were also negative for SE. The number of positives throughout the study and cage assignment in layer unit are displayed in Table 3.1. Overall, hens housed in the middle row of the layer unit observed the
29 Clontech Laboratories, Mountian View, CA 94043. 30 Clontech Laboratories, Mountian View, CA 94043. 31 Life Technologies, Grand Island, NY, 14072. 106 highest number of presumptive and confirmed positives. This could have been due to a variety of factors, such as fecal matter falling on hens during cleaning of the manure belts, a result of random selection of the hens housed in those units, or contamination of the waterlines.
Beyond the location of the hens in the layer unit was a time effect of more presumptive positives were noted at weeks 19, 20 and 23 with 3, 2 and 2 presumptive positives respectively. Furthermore, week 19 had the highest number of confirmed positives with 2 of the 3 samples confirmed positive. As the hens aged, the number of presumptive positives and confirmed positives decreased with the last confirmed positive to happen at 20 weeks of age and the final presumptive positives at 23 weeks of age
(Figure 3.1).
These findings complement previous work of Gast and Holt (1998), who inoculated day old layer chicks and monitored SE shedding through 24 weeks of age.
Findings showed that SE colonization persisted through 24 weeks of age with 58% of hens shedding SE into feces. More remarkable was dispite the high number of SE positive feces, out of 448 egg pools tested, only 2 were positive for SE. This complements our findings, as out of 270 egg pools, none tested positive. Our results also complement the findings of Schulz et al., (2011), who found in sampling different layer facilities across Europe that laying hens between 11-20 weeks of age compared to laying hens 51-60 weeks of age had similar SE shedding. Although the Schulz et al., (2011) study was conducted in Europe with different management practices, it is encouraging to note the same response to age. 107
A possible explanation as to why there are more observed positive SE shedding laying hens early in the lay cycle is explained by the effects of stressors immunosuppression. It has been previously reported that as the hen approaches point-of- lay there is a reduction in T lymphocyte and CD4+ cells (Johnston et al., 2012).
Furthermore, changes occur in the organization of T lymphocytes in the reproductive tract which can lead to infection of SE (Johnston et al., 2012). In the current study pullets in this study were vaccinated using a live attenuated vaccine for day 1 and 3 weeks of age vaccination and with a killed vaccine at 13 weeks of age. Live attenuated vaccines have a longer lasting effect on the immune system by stimulated both cell-mediated and humoral response (Van Immerseel et al., 2005). Killed vaccines are at a disadvantage as they are destroyed rapidly and eliminated from the host and unable to produce cytotoxic T cells
(Babu et al., 2004; Van Immerseel et al., 2005). A result of the immunosuppression at point-of-lay, vaccine efficacy is decreased (Johnston et al., 2012). The combination of immunosuppression and vaccination method could have contributed to the amount of presumptive positives of SE until 23 weeks of age, and possibly why the number reduced as the hens moved through peak lay. Schultz et al., (2011) also saw a reduction in SE positives as the hens moved through peak lay.
Another element of this study was the stress of movement from the hatchery facility to the research facility. Samples taken at the hatchery were SE negative; however, when swabbed 12 hours later, there were two presumptive positive samples with one confirmed. This was most likely attributed to transportation stress. A study conducted by Nakamura et al., (1993) showed that introduction of new hens to a layer flock and removal of feed and water resulted in shedding that lasted several days. 108
Furthermore, previous studies have shown that feed withdrawal will result in an increase in coticosterone levels (Freeman et al., 1981; Harvey and Klandorf, 1983). The aformentioned studies show that stressors such as movement to a new facility contribute to increased pathogen shedding, which most likely why there were two presumptive positives (0.92% of samples) and one confirmation (0.46% of samples) 12 hours after arrival at the research facilities.
Our study presented is one of the first looking at natural infection in vaccinated pullets through peak lay in the US. Although there have been a handful of studies conducted in Europe and we are seeing similar observations, there needs to be more large scale research conducted in the US. This will assist the US in examining the efficacy of current regulations and find areas of improvement for further management strategies to control SE in commercial egg production
109
3.5 REFERENCES
Babu, U., R.A. Dalloul, M. Okamura, H.S. Lillehoj, H. Xie, R.B. Raybourne, D. Gaines, R.A. Heckert. 2004. Salmonella enteritidis clearance and immune responses in chickens following Salmonella vaccination and challenge. Vet. Immun. and Immunopath. 101(3- 4): 251-257.
Bӓumler, A.J., B.M. Hargis, R.M. Tsolis. 2000. Tracing the origins of Salmonella outbreaks. Science 287:50-52.
Center for Disease Control (CDC). 2012. What is Salmonellosis? Accessed April 15, 2013. www.cdc.gov/salmonella/general/. Chappell, L., P. Kaiser, P. Barrow, M.A. Jones, C. Johnston, P. Wigley. 2009. The immunobiology of avian systemic salmonellosis. Vet. Immun. and Immunopath. 128(1- 3):53-59.
Cox, N.A., J.S. Bailey, and M.E. Berrang. 1996. Alternative routes for Salmonella intestinal tract colonization of chicks. J. Appl. Poult. Res. 5:282-288.
De Medici, D., L. Croci, E. Delibato, S. Di Pasquale, E. Filetici, and L. Toti. 2003. Evaluation fo DNA extraction methods fo ruse in combination with SYBR Green ( real- time PCR t odetect Salmonella enterica serotype enteritidis in poultry. Appl. Envron. Microbiol. 69: 3456-3461.
Department of Health and Human Services, FDA. 2009. Prevention of Salmonella enteritidis in shell eggs during production, storage and transport. http://www.gpo.gov/fdsys/pkg/FR-2009-07-09/pdf/E9-16119.pdf.
Freeman, M.B., A.C.C. Manning, and I.H. Flack. 1981. The effects of restricted feeding on arenal cortical activity I the immature domestic fowl. Br. Poult. Sci. 22:295-303.
Gast, R.K. and P.S. Holt. 1998. Persistence of Salmonella enteritidis from one day of age until maturity in experimentally infected layer chickens. Poult. Sci. 77:1759-1762.
Guard-Petter, J.2001. The chicken, the egg and Salmonella Enteritidis. Environ. Micro. 3:421-430.
Harvey, S., and H. Klandorf. 1983. Reduced adrenocortical function and increased thyroid function in fasted and refed chickens. J. Endocrinol. 98:129-135.
Johnston, C.E., C. Hartley, A.M. Salisbury, P. Wigley. 2012. Immunological changes at point-of-lay increases susceptibility to Salmonella enterica serovar enteritidis infection in vaccinated chickens. PLoS ONE 7(10):e48195. 110
Main, R. and T. Frana. 2013. Salmonella Enteritidis testing at Iowa State Univerisity-An Update. Iowa Egg Symposium.
Microsoft Corporation. 2010. Redmond, WA 98052.
Nakamura, M., N. Nagamine, T. Takahashi, S. Suzuki, M. Kijima, Y. Tamura, and S. Sato. 1994. Horizontal transmission of Salmonella enteritidis and effect of stress on shedding in laying hens. Avian Dis. 32:282-288.
Park, S.H, I. Hanning, A. Perrota, B.J. Bench, E. Alm, and S.C. Ricke. 2013. Modifying the gastrointestinal ecology in alternatively raised poultry and the potential for molecular and metabolomic assessment. Poult. Sci. 92:546-561. SAS. 2009. Cary, NC, 27531. Schulz, J., S. Van Hoorebeke, B. Hald, J. Hartung, F. Van Immerseel, I. Radtke, S. Kabell, and J. Dewulf. 2011. The dynamics of Salmonella occurrence in commercial laying hen flocks throughout a laying period. Avian Path. 40(3):243-248.
Van Immerseel, F., U. Methner, I. Rychlik, B. Nagy, P. Velege, G. Martin, N. Foster, R. Ducatelle, and P.A. Barrow. 2005. Vaccination and early protection against non-host- specific Salmonella serotypes in poultry: exploitation of innate immunity and microbial activity. Epid. and Inf. 133(6): 959-978.
Table 3.1: Presumptive1 and confirmed2 positives by pen assignment and age Pen Number 203 204 205 206 207 208 209 210 211 212 213 214 215 216 217 218 219 220 Pres. Pos1 x x Confirmed2 * Wk of Age 19 18
225 226 227 228 229 230 231 232 233 234 235 236 237 238 239 240 241 242 Pres. Pos1 x x x x x x x 2 Confirmed * * * Wk of Age 19 20 18 16 23 23 19 247 248 249 250 251 252 253 254 255 256 257 258 259 260 261 262 263 264 Pres. Pos1 x x Confirmed2 Wk of Age 16 20
1 Presumptive positive defined by positive strip test using RapidChek® SE Quick Test Strips. 2 Confirmed positive defined by presence or absence of DNA band during PCR confirmation.
111
112
Figure 3.1: Egg production vs. presumptive positive1 and confirmed positive2 by wk of age
120.00 3.5
100.00 3
2.5
80.00 No.
2
60.00 of Positives Presumptive 1.5 positives 40.00 Confirmed
1 Positive EggProduction (%) Egg Production 20.00 0.5
0.00 0 16 17 18 19 20 21 23 25 27 33 Wk of Age
1 Presumptive positive defined by positive strip test using Romel SE Quick Test Strips. 2 Confirmed positive defined by presence or absence of DNA band during PCR confirmation.
113
CHAPTER 4: EFFECTS OF MOS OR A PREBIOTIC COMBINATION ON
SALMONELLA SHEDDING THROUGH A TRANSPORT STRESS IN LAYING
HENS
D. Hahn, A. Ampire, S.E. Purdum K. Hanford, S.C. Fernando,
4.1 ABSTRACT
Feed additives such as mannanoligosacchrides (MOS), fructooligosaccharides
(FOS) and essential oils have gained attention due to their ability to assist in preventing pathogenic bacteria from colonizing the gastrointestinal tract. Therefore, a study was conducted examining the effect of MOS and synergistic compound of MOS, FOS and essential oils in reducing Salmonella spp. shedding through a movement stress in laying hens both unvaccinated and vaccinated hens for S. enteritidis. A total of 96 Lohmann
Brown laying hens (43-50 wks of age) were used, with 48 unvaccinated and 24 vaccinated, which resulted in an unbalanced design. Hens were housed in 24 cages with
3 hens per cage. Treatments were arranged in a 3x2 factorial design. The factors were dietary treatment: basal (no additive), 0.03% MOS, or 0.15% synergistic compound; and vaccination status: vaccinated or unvaccinated. Measurements included: daily egg production, weekly feed intake and egg weight, egg mass, monthly hen weight and before and after movement stress. Cloaca swabs testing for Salmonella spp. were taken directly before and after the movement stress and weekly thereafter. There was not a significant difference between treatment, vaccination and time for egg production (P≤0.977), feed intake (P≤0.605), egg wt (P≤0.818), egg mass (P≤0.831), feed conversion (P≤0.942), hen wt (P≤0.385), and Salmonella spp. counts (P≤0.708). There was not a two way 114 interaction between treatment and vaccination for Salmonella spp. prevalence (P≤0.954).
Vaccinated hens had a higher feed intake than unvaccinated hens (P≤0.015). Egg wt had a significant treatment by vaccination interaction (P≤0.035), hens that were vaccinated for S. enteritidis and supplemented with MOS had higher egg weights than any other treatment. In addition, MOS supplemented diets had the highest overall egg weight
(P≤0.002). Hen weight treatment by vaccination interaction was significant (P≤0.018), which showed unvaccinated hens fed a basal diet had a higher hen weight. Furthermore, vaccination status was significant for hen weight, with unvaccinated hens weighing more than vaccinated. More research needs to be conducted examining prolonged performance effects along with a greater challenge to elicit more of a stress response to possibly have greater pathogen shedding.
4.2 INTRODUCTION
In 2012, there were 42,000 reported cases of salmonellosis with 400 being fatal
(CDC, 2012). A cost analysis in 1998, estimated that human salmonellosis costs the US nearly $2.3 billion (Frenzen et al., 1999). According to the CDC, approximately 45
Salmonella outbreaks have been linked to poultry or eggs since the 1990’s with 8 outbreaks happening in 2012 (CDC, 2012). With movement away from subclinical use of antibiotics, the poultry industry has been examining alternatives to control Salmonella along with other pathogenic bacteria.
As a result, alternative feed additives such as prebiotics and essential oils are being investigated to control Salmonella enteritidis (SE) proliferation in live poultry gut microbiome. Prebiotics are indigestible to the host and serve as substrates for growth of 115 the commensal bacteria in the ceca (Gibson and Roberfroid, 1995; Gaggía et al., 2010).
Prebiotics have been shown to lower gut pH through lactic acid production along with modifying the activity of commensal bacteria (Chio et al., 1994; Gibson and Wang, 1994;
Hajati and Rezaei, 2010), inhibit or prevent colonization of pathogens (Bengmark, 2001;
Hajati and Rezaei, 2010), and finally they stimulate the immune system (Patterson and
Burkholder, 2003; Hajati and Rezaei, 2010).
Two of the most prevalent prebiotics utilized in the poultry industry are fructooligosaccharides (FOS) and mannanoligosaccharides (MOS).
Fructooligosaccharides are naturally occurring compounds found in plants and vegetables; the most common sources being: onions, bamboo shoots, chicory roots and bananas (Hajati and Rezaei, 2010). Mannanoligosaccharide is a component of the yeast cell wall of Saccharomyces cerevisiae (Patterson and Burkholder, 2003; Geier et al.,
2009; Hajati and Rezaei, 2010). The mode of action for MOS is slightly different from
FOS. It has been suggested that MOS acts as a binding site for type 1 fimbrae of pathogenic bacteria such as Salmonella and E. coli (Park et al., 2013).
Prebiotics have been shown to be effective at preventing Salmonella colonization in poultry. Supplementing with FOS has been shown to reduce Salmonella, E. coli, and
Camplyobacter counts while increasing Lactobacilli (Yusrizal and Chen, 2003b;
Donalson et al., 2008; Kim et al., 2011). Mannanoligosaccharides have been effectively used in poultry to reduce pathogenic bacteria. Previously, Spring et al., (2000) showed that MOS significantly decreased the colonization rate of S typhimurium and S. dublin.
Furthermore Baurhoo et al., (2009) found MOS increased the number of Bifidobacteria and Lactobacillus while significantly decreasing E. coli and Camplyobacter. Kim et al., 116
(2011) also showed that MOS effectively decreased the amount of E. coli and C. perfringens in the small intestine of broiler chickens.
Essential oils have been examined for use in the poultry industry because of their antibiotic properties (Burt, 2004). Essential oils are aromatic oily liquids obtained from plant materials such as flowers, buds, seeds, twigs, herbs, wood, fruits and roots (Burt,
2004; Brenes and Roura, 2010). Antimicrobial activity of essential oils is mostly due to their phenolic compounds (Consentino et al., 1999; Burt, 2004). Researchers have concluded that antimicrobial activity of essential oils are attributed to their lipophilic character (Greathead, 2003; Applegate et al., 2010) and may be able to suppress pathogenic bacteria by penetrating into the cell or by disintegrating the cell membrane
(Applegate et al., 2010). It has also been shown that essential oils suppress more gram negative bacteria than gram positive, which is important for pathogen suppression
(Brenes and Roura, 2010).
Previous work examining the efficacy of essential oils and its impact on potentially pathogenic bacteria have been mixed. It has been shown that various combinations of thymol, eugenol, curcumin, piperin, carvacrol, cinnamaldehyde and essential oil of eucalyptus successfully reduce C. perfirngens in the intestine of broiler chickens (Mitsch et al., 2004; Timbermont et al., 2010) The combination of cinnamaldehyde and thymol has been shown to be effective in preventing horizontal transmission of S. Heidelberg (Amerha et al., 2010). Additionally, the essential oil mixture of thymol, eugenol, and piperin reduced E. coli in the ileo-cecal junction of broiler chickens. However, Abildgaard and coworkers (2010) findings fail to confirm 117 the above results, a mixture of thymol, eugenol and piperin failed to reduce C. perfringens colonization in the ileum or cecum.
Stress situations, such as transport, feed and climate changes, stocking density and housing can all have negative effects on the hen’s gastrointestinal tract, resulting in increased Salmonella shedding. It has been shown that stressors such as feed withdrawal or introduction of new hens to the flock results in increased corticosterone levels
(Freeman et al., 1981; Harvey and Klandorf, 1983; Nakamura et al., 1993). Holt (1993) also found that the above stressors including molt have a profound effect on cell- mediated immunity resulting in a decrease in the number of CD4 T-lymphocytes.
To assist controlling Salmonella and specifically, SE, vaccination programs have been implemented in the US to help reduce on farm contamination. Currently, there are two types of vaccination, inactivated (killed) or attenuated (live) (Van Immerseel et al.,
2005; Gast and Guard, 2011). Attenuated vaccines offer a longer lasting effect on the immune system, through stimulation of cell-mediated and humoral responses (Van
Immerseel et al., 2005). Attenuated vaccines are also administered through water, being more helpful to producers (Gast and Guard, 2011). However, handling must be done with care, since attenuated vaccines are live and contain active ST cells (Neto et al.,
2008). Inactivated vaccines have a disadvantage when compared to attenuated vaccines, as they only stimulate antibody production, can be destroyed quickly and are unable to produce cytotoxic T cells (Babu et al., 2004; Van Immerseel et al., 2005). Inactivated
SE vaccinations must be given subcutaneously, being more difficult for the producer.
However, it has been shown that killed vaccines do effectively reduce SE shedding
(Nakamura et al., 1994; Liu et al., 2001; Woodward et al., 2002; Neto et al., 2008). 118
As a result of the significant risk Salmonella poses to food safety, more work needs to be done examining possible solutions to prevent and clear pathogenic bacteria from the laying hen. Therefore, this study was conducted using hens not vaccinated for
Salmonella that had previously tested positive for Salmonella; along with hens vaccinated for Salmonella to test the effectiveness of a MOS and synergistic product containing FOS and essential oils on Salmonella shedding and layer performance through a transport stress.
4.3 MATERIALS AND METHODS
Experimental Design
Seventy-two Lohmann Brown Classic laying hens32 from 43 to 50 weeks of age were randomly assigned to 24 cages in separate but identical rooms resulting in12 cages/room with 3 hens per cage. There were 48 unvaccinated SE hens and 24 SE vaccinated hens in the study. Hens were housed in separate but identical rooms, which served as block. Because of the uneven number of vaccinated vs unvaccinated hens, treatments were arranged in an incomplete block design. This arrangement resulted in an uneven amount of replication for each treatment; however each treatment combination had at least two replicates. Treatments were arranged in a 2x3 factorial design and consisted of vaccination for Salmonella enteritidis: yes or no along with dietary treatments of control (no additive), BioSecure® MOS33 (MOS), and BioSecure®
Biolex®32 (synergistic). Vaccinated and unvaccinated hens were randomly assigned to cages, and then assigned one of three dietary treatments. Hens were given ad libitum
32 Nelson Hatchery, Manhattan, KS 66506. 33 BioMatrix International, Princeton, MN 55371. 119 access to 110 g/hen/d of feed and ad libitum access to water. “Unvaccinated” pullets were not given the SE booster vaccine at 13 weeks of age. Performance parameters measured were egg production, feed intake, egg weight, feed conversion, egg mass, and hen weight. Egg production was recorded daily and calculated as weekly egg production.
Feed intake and egg weight were determined weekly. Egg mass was determined by multiplying egg production by average egg weight. Body weights were taken at the start of the study (43 wk of age), immediately after the movement stress (44 wk of age), and at
48 wk of age and at the conclusion of the study. All procedures were approved by the
University of Nebraska-Lincoln Institute of Animal Care and Use Committee34.
Diets
Hens were fed a basal corn-soy diet based on Lohmann Brown management guide35 and NRC recommendations (NRC,1994). Experimental treatments consisted of
BioSecure® MOS (MOS)30 included at a rate of 0.5 lbs/ton, and Biolex®30 (Synergistic) included at a rate of 3 lbs/ton. Both feed additives were added on top of the already mixed feed. BioMOS is a mannanoligosaccharide (MOS), MOS is obtained from the outer wall of the yeast, Saccharomyeces cereviseae and is used to help rid the gastrointestinal tract of pathogenic bacteria such as Salmonella. Biolex®30 is a proprietary combination of chicory pulp, lactic acid, inulin, fructooligosaccharide (FOS) and mannanoligosaccharide (MOS), beta-glucan and essential oils. The synergistic effect of lactic acid, prebiotics and essential oils of oregano (Origanum sp.) and cassia
(Cinnamomum cassia) are to help rid the gastrointestinal tract of pathogenic bacteria
33 Insitutional Animal Care Program, [email protected]. 35 Lohmann GB Limited, Worcester, WR4 9FA. 120 while providing nutrients to beneficial bacteria such as Lactobacillus and
Bifidobacterium.
Sampling
All hens were cloacal swabbed weekly by insertion of sterile cotton tipped applicator into cloaca and gently circling the cloaca. Samples were then immediately taken to the lab for analysis. Salmonella enumeration was conducted by the direct plating method (Hinton et al., 2000). Swabs were then placed into 2mL tubes and 1 mL of tryptic soy broth (TSB)36 was placed into each tube and vortexed to mix. A 50 µL aliquot was then plated with spiral plater (Eddy Jet®)37 for enumeration of Salmonella on CHROMagar Salmonella38. Typical mauve colored colonies were counted. Colony counts were converted to log10 for statistical analysis.
Suspect Salmonella colonies were selected, grown in tryptic soy broth overnight and placed in a 40% glycerol solution and stored at -80°C until further analysis. At the conclusion of the study, samples from glycerol stocks were grown overnight in TSB35 and confirmed by PCR, using Salmonella specific primers (Rijpens et al, 1999).
Salmonella specific primers (Styniva-JHO-2-left-5’-TCGTCATTCCATTACCTACC-3’ and right 5’-AAACGTTGAAAAACTGAGGA-3’) were chosen to amplify a 119-base pair fragment of invasion (invA) gene (Nam et al., 2005). ). The PCR mixture used was the following: 3 µL DNA template, 0.25 µL Terra Taq Polymerase39, 5 mM dNTP, 10
36 ThermoFisher Scientific, Waltham, MA 02454 37 Neutec Group, Farmingdale, NY 11735 38 DRG International, Springfield, NJ 07081 39 Clontech Laboratories, Mountian View, CA 94043. 121 mM primers, 2.5 µL buffer solution40, and 17.75 µL double distilled PCR grade water for a final reaction volume of 25µL. Samples were then placed in Veriti® Thermal Cycler41 and designated a thermal cycle of: 50°C for 2 min, 15 min at 95°C, then 40 cycles of: 15 sec at 95°C, 15 sec at 55°C, and 30 sec at 72°C and a final extension at 72°C for 5 min
(Nam et al., 2005).
These samples were also screened for Salmonella enteritidis using RapidChek®
S.E. quick tests42. Any suspect positives from the quick test were subjected to PCR confirmation. PCR confirmation of SE quick tests was conducted using S. enteritidis specific primers, SEFA-1 (5’-GCAGCGGTTACTATTGCAGC-3’) and SEFA-2 (5’-
CTGTGACAGGGACATTTAGCG-3’)43, which are specific for sefA gene were chosen to amplify a 310 base pair product (De Medici et al., 2003). DNA was extracted from the final enrichment broth by transferring 20 µL into 80 µL of double distilled RNA-DNA free PCR grade water and boiled at 95°C for 10 min in a Veriti® Thermal Cycler44. The samples were then centrifuged for 3 min at 1000 g and supernatant was used for PCR analysis. The PCR mixture used was the same as outlined above, with Salmonella enteritidis specific primers. Samples were then placed in Veriti® Thermal Cycler45 and designated a thermal cycle of: 50°C for 2 min, 95°C for 10 min, and 35 cycles of: 95°C for 1 min, 55°C for 1 min, and 72°C 1 min and a final extension phase of 60° for 1 min
(De Medici et al., 2003). Egg content pools were also taken weekly from two days of
40 Clontech Laboratories, Mountian View, CA 94043. 41 Life Technologies, Grand Island, NY, 14072. 42 Romer Labs Technology Inc., Newark, DE, 19713 43 Integrated DNA Life Technologies, Coralville, IA, 52241 44 Life Technologies, Grand Island, NY, 14072 45 Life Technologies, Grand Island, NY, 14072. 122 egg production for screening of Salmonella enteritidis using RapidChek® SE quick tests46.
Statistical Analysis
Data were analyzed using Proc Glimmix function of SAS47 for an unbalanced block design with treatments arranged in a 2x3 factorial design. Hens were housed in separate but identical rooms which served as block. Blocking was done to account for the variance between the rooms. Feed intake, egg production, egg weight, feed conversion, egg mass, hen weight and weekly Salmonella swabbing counts were analyzed by repeated measures analysis and tested for the effects of MOS or combined treatment over time. Repeated measures analysis was conducted to determine changes in production data throughout the course of the study. Covariance patterns were tested to determine the best fit for the model. Covariance patterns tested were compound symmetry (CS), autoregressive (ar(1)), toeplitz (toep), unstructured (un), and heterogeneous autoregressive (arh(1)). The model is shown below:
Y=µ + Bi + Trj+Vk+Tl+TrVjk+TrTjl+VTkl+TrVTjkl+ɛijkl
Where µ is the overall mean; Bi is block effect; Tr is the treatment (control, MOS, or combination); Vk is vaccination status of laying hen (unvaccinated or vaccinated); Tl is time; TrVjk is treatment by vaccination interaction; TrTjl is treatment by time interaction;
VTkl is vaccination by time interaction; TrVTjkl is treatment by vaccination by time interaction; ɛijkl is random error. Means were separated using the LS means function and the slicediff option when applicable.
46 Romer Labs Technology Inc., Newark, DE, 19713 47 SAS 2009, Cary, NC. 123
Number of hens that tested positive for Salmonella spp. results were combined for across the study and analyzed by logistic regression analysis using the logit function in
SAS, resulting in formation of an odds ratio. Odds ratios are used to measure the association between exposure and outcome (Szumilas, 2010). An odds ratio was used in this study to the association of recovering a positive sample over the total number of samples taken. This was calculated by taking the expodential of the estimate for each treatment and main effect. The model is shown below:
Log (µij/(1- µij))=Ti + Vj
Where µij is the mean and 1- µij is the varience; Ti is the dietary treatment effect;
Vj is the vaccination effect.
4.4 RESULTS AND DISCUSSION
There not a significant three way or two way interaction for egg production when examining dietary treatment, vaccination and time (P≤0.997, P≤0.490 respectively)
(Table 2). The main effects of dietary treatment (P≤0.904) and vaccination (P≤0.262) were not significant. The lack of differences between MOS supplemented diets and basal diets are consistent with previous findings (Shashidhara and Devegowda, 2003).
However, previous studies have found MOS supplementation significantly improved laying hen performance (Berry and Lui 2000; Stanley et al., 2000). It has been reported that inulin and chicory oligofructose improves laying hen performance (Chen et al.,
2005). Fructooligosaccharides have also been reported to have a positive impact on egg production (Li et al., 2007). Bozkut and colleagues (2012) found an essential oil blend had no impact on egg production in older laying hens, which complements our findings. 124
It should be noted, although our results were not significant, there was an increase in egg production of approximately 1% for unvaccinated hens and 4% in vaccinated hens for diets containing the combination compound over MOS or basal diets.
Feed intake did not show a significant three way interaction of dietary treatment, vaccination, and time (P≤ 0.605) (Table 2). Furthermore, there was not a vaccination by time effect (P≤0.253) or a dietary treatment by time effect (P≤ 0.288) (Table 2).
Examining main effects, there was not a significant effect for dietary treatment (P≤0.119)
(Table 2). However, there was a significant effect of vaccination (P≤0.015), which showed vaccinated hens consumed more g of feed per day (107.06 g/hen/d) than unvaccinated counterparts (103.73g/hen/d) (Table 2). Closer examination of the data showed that the unvaccinated hens fed the basal ration had significantly lower feed intake compared to any other treatment, unvaccinated or vaccinated. Unvaccinated hens fed the
MOS or synergistic product had feed intake that was not significantly different from vaccinated hens. Previous reports examining MOS, FOS, inulin, chicory and essential oil blends have not found significant differences in feed intake (Hernández et al., 2004; Chen et al., 2006; Amerah et al., 2012; Bozkurt et al., 2012). It has also been reported that
FOS can have a positive impact on feed intake (Li et al., 2007). Although there was not a significant difference, there was a numeric increase for feed intake for hens fed diets containing synergistic compound.
Vaccination status of the hen had more of an impact on feed intake than feed additive. Hens not vaccinated for Salmonella had a significantly lower feed intake than hens vaccinated for Salmonella. Since vaccination for Salmonella control is widely practiced, there have not been studies examining its effect on laying hen performance. 125
Furthermore, vaccination against Salmonella enteritidis colonization most likely improves not only gut health but overall health status of the laying hen. It has been suggested that administration of prebiotics such as MOS, FOS, chicory and inulin have beneficial effects of stimulating the immune system (Monsan and Paul, 1995; Patterson and Burkholder, 2003; Janardhana et al., 2009; Hajati and Rezaei, 2010). Furthermore, essential oils have been credited as an antioxidant (Kempaiah and Srinivasan, 2002;
Botsoglou et al., 2004; Brenes and Roura, 2010) and a digestive stimulant (Platel and
Srinivasan, 2004; Brenes and Roura, 2010). Based on our results, an increase in feed intake among vaccinated hens and hens administered MOS or the synergistic compound benefited from improved intestinal health and observed an increased feed intake. This observation of an increase in feed intake can be seen in the egg production, although not significant vaccinated hens fed the synergistic compound had the highest egg production of 89.57% (Table 4.2).
Egg weight and egg mass did not have a significant three way interaction between dietary treatment, vaccination status and time (P≤ 0.818, P≤0.831, respectively) (Table
4.2). There was not a significant vaccination status by time effect for either egg weight or egg mass (P≤ 0.784, P≤0.911) (Table 4.2). Egg mass did not have a treatment by time effect (P≤0.868), egg weight treatment by time effect was approaching significance
P≤0.078 (Table 4.2). Closer examination of the data revealed that hens fed diets containing MOS had higher egg weight through the study than hens fed either basal or synergistic diets. Vaccination by dietary treatment interaction was not significant for egg mass (P≤0.921). Egg weight did have a significant dietary treatment by time effect 126
(P≤0.035) (Table 4.2). Vaccinated hens fed MOS supplemented diets had higher egg weight than any other treatment combination (Table 4.2, Figure 4.1).
There was not a significant three way interaction for feed conversion (P≤0.942), nor was there a significant two way interaction for vaccination status and time (P≤0.998), dietary treatment by time (P≤960) or dietary treatment by vaccination status (P≤0.998)
(Table 4.2). The main effect of vaccination status was not significant (P≤0.174) and dietary treatment was not significant (P≤0.986) (Table 4.2). Our results concur with the results from Stanley et al., (2000), who found MOS supplementation improved egg weight. However, more recently Bozkurt et al., (2012) did not see improvement in egg weight with supplementation of MOS or essential oils. Furthermore, Chen et al., (2006) did not find any significant differences between control diets and hens supplemented with oligofructose or inulin. Improvement in egg weight with MOS supplementation could have been due to improved intestinal health and nutrient utilization. Dietary addition of
MOS has been shown to increase villus height and goblet cell number (Baurhoo et al.,
2007). Prebiotics such as MOS have been credited to altering the intestinal commensal bacteria by stimulating vascularization and development of intestinal villi to assist with digestion (Stappenbeck et al, 2002; Solis de los Santos et al., 2005). This may explain the improvement in egg weight with hens supplemented with MOS.
Hen weight did not show a significant three way interaction between dietary treatment, vaccination and time (P≤0.385) (Table 4.3). There was not a significant interaction between dietary treatment and time (P≤0.783) or vaccination and time
(P≤0.643) (Table4.3). The lack of differences between the treatments is consistent with the findings of Bozkurt et al., (2012).There was a significant dietary treatment by 127 vaccination effect (P≤0.018), which showed that unvaccinated hens fed the basal diet had the highest hen weights (Table 4.3). To go along with this, the main effect of vaccination was significant (P≤0.001), which showed unvaccinated hens had a higher body weight
(1946.03 g) than vaccinated hens (1806.19 g) (Table 4.3). Further examination revealed that unvaccinated hens fed the basal diet had significantly higher body weights than all other treatments. Unvaccinated hens fed either MOS or synergistic had similar body weights to vaccinated hens.
The different responses between vaccinated and unvaccinated hens can be attributed to differences in immune response. Poultry have an innate and adaptive immune system (Lensing et al., 2012). Innate immunity acts as broad protection against a variety of pathogens, whereas adaptive immunity is effective against pathogens after a second exposure (Kimbrell and Beutler, 2001; Lensing et al., 2012). Normally the nutritional costs of maintaining the innate immunity is low, however when faced with a challenge, the nutritional costs increase. Also, when faced with a significant challenge, feed intake will decrease and the demand for nutrients shifts to maintaining an elevated immune response (Klasing, 2007; Lensing et al., 2012). Along with an increased immune response, this may have led to increased gut inflammation, which impairs absorption of nutrients which most likely contributed to a lower egg weight (Lensing et al., 2012). Most literature points to a reduced body weight during an immune response
(Klasing, 2007), however these results show the opposite effect. This could be attributed to a combination of higher body weight at the start of the study and having a low stress environment after the movement stress. 128
All Salmonella enteritidis quick tests for cloaca swabbing and eggs tested negative. The following interactions were not significant for Salmonella spp. counts: between dietary treatment, vaccination and time (P≤0.708); treatment by time (P≤0.214), vaccination by time (P≤.0.819), or dietary treatment by vaccination (P≤0.435) (Table
4.3). Examining prevalence, there was not a significant treatment by vaccination interaction (P≤0.954), nor were there significant effects for treatment (P≤0.246) or vaccination (P≤0.832) (Table 4.4). Furthermore, all odds ratios were well below 1, indicating a low incidence of Salmonella spp. after direct plating. Most studies that have examined the effects of prebiotics, essential oils and Salmonella shedding have been challenge studies design. However, a handful of studies have examined the effects of
MOS and other prebiotics in a natural Salmonella challenge, similar to this trial. Yusrizal and Chen (2003b) found supplementing with chicory fructans reduced overall Salmonella counts. Furthermore, an essential oil mixture that contained cinnamaldehyde and thymol has been shown to prevent horizontal transmission of Salmonella Heidelberg in broiler chickens (Amerah et al., 2012). Previous reports have shown that FOS is very effective at preventing Salmonella enteritidis infection in molting laying hens during an artificial inoculation (Donalson et al., 2008). Shanmugasundaram et al., (2013) found that supplementing broilers with a yeast cell wall product decreased Salmonella population in the ceca by 20%, however these results were not statistically significant.
Although these results show promise, especially in layer performance, more work needs to be contucted. Future studies need to be conducted examining these products in a more challenging environment where hens would come in contact with more fecal matter, such as aviary or cage free systems on used litter. Our findings show the hens handled 129 the movement stress well overall; therefore it would be beneficial to examine these products with a more prolonged stress, such as a feed withdrawal, to elicit a more distinct stress response. Additionally, a longer study should be conducted further examining the positive effects on layer performance. Finally, although there were no differences in
Salmonella spp. colony counts, future work should examine the effects on other bacteria species and groups such as Lactobacilli, E. coli and coliforms.
130
4.5 REFERENCES
Abildgaard, L., O. Hojberg, A. Schramm, K.M. Balle, R.M. Engberg. 2010. The effect of feeding a commercial essential oil product on Clostridium perfringens numbers in the intestine of broiler chickens measured by real-time PCR targeting the α-toxin-encoding gene (plc). An. Feed Sci. and Tech. 157:3-4(11): 181-189. Amerah, A.M., G. Mathis, and C.L. Hofacre. 2012. Effect of xylanase and a blend of essential oils on performance and Salmonella colonization of broiler chickens challenged with Salmonella Heidelberg. Poult. Sci. 91: 94-947.
Applegate, T.J., V. Klose, T. Steiner, A. Ganner, and G. Schatzmayr. 2010. Probiotics and phytogenics for poultry: Myth or reality? J. Appl. Poult. Res. 19:194-210.
Baurhoo, B., L. Phillip, and C.A. Ruiz-Feria. 2007. Effects of purified lignin and manna oligosaccharides on intestinal integrity and microbial populations in the ceca and litter of broiler chickens. Poult. Sci. 86:1070-1078. Bengmark, S. 2001. Pre-, pro- and symbiotics,. Current opinion in clinical nutrition and metabolic car. 4:571-579.
Berry, W.D., and P. Lui. 2000. Egg production, egg shell quality and bone parameters in broiler breeder hens receiving Bio-Mos and Eggshell 49. Poult. Sci. 79(Suppl. 1): 124 (Abstr.). Botsoglou, N.A., E. Christaki, P. Florou-Paneri, I. Giannenas, G. Papageorgiou, and A.B. Spais. 2004. The effect of a mixture of herbal essential oils or α-tocopheryl acetate on performance parameters and oxidation of body lipids in broilers. S. Afr. J. Ani. Sci. 34(1):52-61. Bozkurt, M., K. Kucukyilmaz, A.U. Catli, M. Cinar, E. Bintas, and F. Coven. 2012. Performance, egg quality and immune response of laying hens fed diets supplementedwith mannan-oligosaccharides or an essential oil mixture under moderate and hot environmental conditions. Poult. Sci. 91¨1379-1386. Brenes, A., and E. Roura. 2010. Essential oils in poultry nutrition: main effects and modes of actions. Anim. Feed Sci. and Tech. 158(2):1-14. Burt, S. 2004. Essential oils: their antibacterial properties and potential applications in foods-a review. Int. J. of Food Micro. 94(3): 223-253. Center for Disease Control (CDC). 2012. What is Salmonellosis? Accessed April 15, 2013. www.cdc.gov/salmonella/general/. Chen, Y.C., C. Nakthong, and T.C. Chen. 2005. Improvement of laying hen performance by dietary prebiotic chicory oligofructose and inulin. Int. J. Poult. Sci. 4(2): 103-108. 131
Chio, K.H., H. Namkung, and I.K. Paik. 1994. Effects of dietary fructooligosaccharides on the suppression of intestinal colonization of Salmonella typhimurium in broiler chickens. Korean J. Anim. Sci. 36:271-284.
Consentino, S., C.I.G. Tuberoso, B. Pisano, M. Satta, V. Mascia, E. Arzedi, F. Palmas. 1999. In-vitro antimicrobial activity and chemical composition of Sardinian Thymus essential oils. 29(2): 130-135.
De Medici, D., L. Croci, E. Delibato, S. Di Pasquale, E. Filetici, and L. Toti. 2003. Evaluation fo DNA extraction methods fo ruse in combination with SYBR Green ( real- time PCR t odetect Salmonella enterica serotype enteritidis in poultry. Appl. Envron. Microbiol. 69: 3456-3461.
Donalson, L.M., J.L. McReynolds, W.K. Kim, V.I. Chalova, C.L. Woodward, L.F. Kubena, D.J. Nisbet, and S.C. Ricke. 2008. The influence of a fructooligosaccharide prebiotic combined with alfalfa molt diets on the gastrointestinal tract fermentation, Salmonella enteritidis infection, and intestinal shedding in laying hens. Poult. Sci. 87:1253-1262.
Freeman, B.M., A.G.G. Manning, and I.H. Flack. 1981. The effects of restricted feeding on adrenal cortical activity in the immature domestic fowl. Br. Poult. Sci. 22(3): 295-303.
Frenzen, P., T. Riggs, J. Buzby, . Breuer, T. Roberts, D. Voetsch, S. Reddy, and the FoodNet Working Group. 1999. Salmonella cost estimate update using FoodNet data. Food Review 22:10-15.
Gaggia, F., P. Mattarelli, B. Biavati. 2010. Probiotics and prebiotics in animal feeding for safe food production. Int. J. of Food Microbiol. 141(31): S15-S28.
Gast, R. and J. Guard. 2011. Controlling egg contamination with Salmonella enteritidis by understanding its pathobiology. Proceedings from XXII Latin American Poultry Conference.
Geier, M.S., V.A. Torok, G.E. Allison, K. Ophel-Keller, and R.J. Hughes. 2009. Indigestible carbohydrates alter the intestinal microbiota but do not influence the performance of broiler chickens. J. Appl. Micro. 106(5): 1540-1548.
Gibson, G.R., and M.B. Roberfroid. 1995. Dietary modulation of the human colonic microbiota: introducing the concept of prebiotics. J. Nutr. 125: 1401-1412.
Gibson, G.R., and X. Wang. 1994. Bifidogenic properties of different types of fructooligosaccharides. Food Microbiol. 11:491-498.
Greathead, H. 2003. Plants and plant extracts for improving animal productivity Proc. Nutr. Soc. 62:279-290. 132
Hajati, H., and M. Rezaei. 2010. The application of prebiotics in poultry production. Int. J. Poult. Sci. 9(3):298-304.
Harvey, S., and H. Klandorf. 1983. Reduced adrenocortical function and increased thyroid function in fasted and refed chickens. J. Endocrinol. 98:129-135.
Hernández, F., J. Madrid, V. García, J. Oregano, and M.D. Megías. 2004. Influence of two plant extracts on broiler performance, digestibility, and digestive organ size. Poult. Sci. 83:169-174.
Holt, P.S. 1993. Effect of induced molting on the susceptibility of white leghorn hens to a Salmonella enteritidis infection. Avian Dis. 37:41-417.
Janardhana, V., M.M. Broadway, M.P. Bruce, J.W. Lowenthal, M.S. Geier, R.J. Hughes, and A.G.D. Bean. 2009. Prebiotics modulate immune responses in the gut-associated lymphoid tissue of chickens. J. Nutr. 139:1404-1409.
Kimbrell, D.A., and B. Beutler. 2001. The evolution and genetics of innate immunity. Nat. Rev. Genet. 2:56-267.
Klasing, K.C. 2007. Nutrition and the immune system. Br. Poult. Sci. 48:525-537.
Lensing, M., J.D. van der Klis, I. Yoon, and D.T. Moore. 2012. Efficacy of Saccharomyces cerevisiae fermentation product on intestinal heath and productivity of coccidian-challenged laying hens. Poult. Sci. 91:1590-1597.
Li, X., L. Liu, K. Li, K. Hao and C. Xu. 2007. Effect of fructooligosaccharides and antibioticson laying hen performance of chickens and cholesterol content of egg yolk. Br. Poult. Sci. 48(2): 185-189.
Liu, W., Y. Yang, N. Chung, and J. Kwang. 2001. Induction of humoral immune response and protective immunity in chickesn against Salmonella enteritidis after a single dose of killed bacterium-loaded microspheres. Avian Dis. 45(4)797-806.
Mitsch, P., K. Zitterl-Eglseer, B. Kohler, C. Gabler, R. Losa, and I. Zimpernik. 2004. The effect of two different blends of essential oil components on the proliferation of Clostridium perfringens in the intestines of broiler chickens. Poult. Sci 83:66-675. Nakamura, M., N. Nagamine, T. Takashi, S. Suzuki, and S. Sato. 1994. Evaulation of the efficacy of a bacterin against Salmonella Enteritidis infection and the effect of stress after vaccination. Avian Dis. 38(4): 717-724. Nakamura, M., N. Nagamine, T. Takahashi, S. Suzuki, M. Kijima, Y. Tamura, and S. Sato. 1994. Horizontal transmission of Salmonella enteritidis and effect of stress on shedding in laying hens. Avian Dis. 32:282-288. 133
Nam, H.M., V. Srinivasan, B.E. Gillespie, S.E. Murinda, S.P. Oliver. 2005. Application of SYBR green real-time PCR assay for specific detection of Salmonella spp. in dairy farm environmental samples. Int. J. Food Microbiol. 102(2): 161-171.
Neto, Caetano de Freitas, O. A. Lopes Mesquita, J. Boldrin de Paiva, F. Zotesso, and A. Berchieri Júnior. 2008. Control of Salmonella enterica serovar Etneritidis in laying hens by inactivated Salmonella Enteritidis vaccines. Braz. J. Microbiol. 39(2): 390-396.
Park, S.H, I. Hanning, A. Perrota, B.J. Bench, E. Alm, and S.C. Ricke. 2013. Modifying the gastrointestinal ecology in alternatively raised poultry and the potential for molecular and metabolomic assessment. Poult. Sci. 92:546-561. Patterson, J.A., and K.M. Burkholder. 2003. Application of prebiotics and probiotics in poultry production. Poult. Sci. 2:627-631.
Shanmugasundaram, R., M. Sifri, and R.K. Selvaraj. 2013. Effects of yeast cell product supplementation on broiler cecal microflora species and immune responses during an experimental coccidial infection. Poult. Sci. 92:1195-1201.
Shashidhara, R.G., and G. Devegowda. 2003. Effect of dietary mannan oligosaccharide on broiler breeder production traits and immunity. Poult. Sci. 82:1319-1325.
Spring P., C. Wenk, K.A. Dawson, and K.E. Newman. 2000. The effects of dietary mannan-oligosaccharides on cecal parameters and the concentrations of enteric bacteria in the ceca of Salmonella challenged broiler chicks. Poult. Sci. 79:205-211. Stanley, V.G., C. Brown, and T. Sefton. 2000. Single and combined effects of dietary protease and mannanoligosaccharide on the performance of laying hens. Poult. Sci. 79(Suppl. 1):62 (Abstr.). Solis de los Santos, F., M.B. Farnell, G. Tellez, J.M. Balog, N.B. Anthony, A. Torres- Rodriguez, S. Higgins, B.M. Hargis, and A.M. Donoghue. 2005. Effect of prebiotic on gut development and ascites incidence of broilers reared in a hypoxic environment. Poult. Sci. 84:1092-1100. Stappenbeck, T.S., L.V. Hooper, and J.I. Gordon. 2002. Developmental regulation of intestinal angiogenesis by indigenous microbes via Paneth cells. Proc. Natl. Acad. Sci. USA 99:15451-1455. Szumilas, M. 2010. Explaining odds ratios. J. Can. Acad. Child Adolesc. Psychiatry. 19(3): 227-229. Timbermont, L., A. Lanckriet, J. Dewulf, N. Nollet, K. Schwarzer, F. Haesebrouck, R. Ducatelle, F. Van Immerseel. 2010. Control of Clostridium perfringens induced necrotic enteritis in broilers by target-released butyric acid, fatty acids and essential oils. Av. Path. 39(2): 117-121. 134
Van Immerseel, F., U. Methner, I. Rychlik, B. Nagy, P. Velege, G. Martin, N. Foster, R. Ducatelle, and P.A. Barrow. 2005. Vaccination and early protection against non-host- specific Salmonella serotypes in poultry: exploitation of innate immunity and microbial activity. Epid. and Inf. 133(6): 959-978.
Woodward, M.J., G. Gettingby, M.F. Breslin, J.D. Corkish, and S. Houghton. 2002. The efficacy of Salenvac, a Salmonella enterica subsp. Enterica serotype Enteritidis iron- restricted bacterin vaccine, in laying chickens. Avian Path. 31(4): 383-392. Yuziral, C. and T.C. Chen. 2003. Effect of adding chicory fructans in feed on fecal and intestinal microflora and excreta volatile ammonia. Int. J. Poult. Sci., 2:188-194. 135
Table 4.1: Diet Composition Ingredient (%) Control MOS1 Synergistic2 Corn 53.36 53.36 53.36 Soybean Meal 18.37 18.37 18.37 DDGS 15.00 15.00 15.00 Dicalcium Phosphate 2.07 2.07 2.07 Limestone (Unical S) 0.68 0.68 0.68 Limestone (Shell&Bone) 3.89 3.89 3.89 Salt 5.83 5.83 5.83 Lysine 0.34 0.34 0.34 Methionine 0.15 0.15 0.15 Vitamin&Mineral Premix3 0.20 0.20 0.20 Amprolium 0.01 0.01 0.01 MOS1 0.00 0.03 0.00 Synergistic2 0.00 0.00 0.15 Nutrient Analysis ME (Kcal/kg) 2775.00 2775.00 2775.00 Protein (%) 17.00 17.00 17.00 Methioinine (%) 0.39 0.39 0.39 TSAA (%) 0.74 0.74 0.74 Lysine (%) 0.90 0.90 0.90 Tryptophan (%) 0.19 0.19 0.19 Threonine (%) 0.66 0.66 0.66 Sodium (%) 0.18 0.18 0.18 Ca (%) 4.01 4.01 4.01 AvP (%) 0.40 0.40 0.40 1 BioSecure®, BioMatrix International, Princeton, MN 55371. 2 Biolex® BioMatrix International, Princeton, MN 55371. 3Vitamin and trace minerals provided the following per kilogram: vitamin A (retinyl acetate, 6,600 IU); vitamin D3, 2,805 IU vitamin E (DL-α- tocopheryl acetate, 10 IU); vitamin K3 (menadione dimethpyrimidinol, 2.0mg); riboflavin (4.4 mg); pantothenic acid (6.6 mg); niacin (24.2 mg); -1 -1 choline (110 mg ); vitamin B7 (biotin, 8.8 mg ); and ethoxyquin (1.1 m%). Mn (MnO, 88 mg); Cu (CuSO4H2O, 6.6 mg); Fe (FeSO4H2O, 8.5mg); Zn (ZnO, 88 mg); and Se (Na2SeO3, 0.30 mg).
Table 4.2: Production Results: Egg Production, Feed Intake, Egg Wt., Egg Mass, and Feed Conversion Egg Feed Egg Feed Conversion Production Intake Egg Mass Wt. (g) (g:g) Treatment Vaccination (%) (g/hen/d) (g) Basal Unvaccinated 77.03 101.09 60.59c 47.33 2.33 MOS1 Unvaccinated 77.46 104.64 62.71ab 48.63 2.37 Synergistic2 Unvaccinated 78.10 105.44 61.86bc 51.05 2.32 Basal Vaccinated 85.43 106.02 61.91bc 53.07 2.04 MOS1 Vaccinated 82.29 107.33 64.46a 53.08 2.05 Synergistic2 Vaccinated 89.57 107.83 59.70c 53.64 2.02 Pooled SEM 0.086 1.413 1.023 3.743 0.248 Main Effects Treatment Basal 81.23 103.56 61.25b 50.20 2.18 MOS1 79.87 105.99 63.59a 50.86 2.21 Synergistic2 83.83 106.64 60.78b 52.35 2.17 p-value 0.904 0.119 0.002 0.856 0.986 Vaccination Unvaccinated 77.53 103.73b 61.73 49.01 2.34 Vaccinated 85.76 107.06a 62.02 53.26 2.04 p-value 0.262 0.015 0.623 0.184 0.174 Interactions Treatment*Vaccination 0.932 0.635 0.035 0.921 0.998 Treatment*Time 0.938 0.288 0.078 0.868 0.946 Vaccination*Time 0.490 0.253 0.784 0.911 0.960 Treatment*Vaccination*Time 0.977 0.605 0.818 0.831 0.942 a-b Means within main effects without a common subscript differ significantly. 1
BioSecure®, BioMatrix International, Princeton, MN 55371. 136 2 Biolex® BioMatrix International, Princeton, MN 55371.
137
Figure 4.1: Egg weight by treatment
65.00 a
64.00
63.00 ab bc bc 62.00
61.00 c
Egg Egg Wt. (g) 60.00 c
59.00
58.00
57.00 Treatment
U Basal U Synergistic U MOS V Basal V Synergistic V MOS P≤0.035
138
Table 4.3: Cloaca Salmonella Counts and Hen Wt. Counts.
Cloaca Salmonella Counts Hen Wt. Treatment Vaccination (CFU/g) (g) Basal Unvaccinated 0.454 2055.90a MOS1 Unvaccinated 0.685 1833.67cb Synergistic2 Unvaccinated 0.443 1948.51b Basal Vaccinated 0.567 1782.45c MOS1 Vaccinated 0.218 1832.86cb Synergistic2 Vaccinated 0.678 1803.25c SEM 0.282 42.919 Main Effects Treatment Basal 0.511 1919.17 MOS1 0.451 1875.88 Synergistic2 0.561 1833.26 P-Value 0.932 0.165 Vaccination Unvaccinated 0.527 1946.03a Vaccinated 0.488 1806.19b P-Value 0.867 0.001 Interactions Treatment x Vaccination 0.435 0.018 Treatment x Time 0.214 0.783 Vaccination x Time 0.891 0.643 Treatment x Vaccination x Time 0.708 0.385 a-b Means within main effects without a common subscript differ significantly. 1 BioSecure®, BioMatrix International, Princeton, MN 55371. 2 Biolex® BioMatrix International, Princeton, MN 55371.
.
139
Table 4.4: Cloaca Salmonella prevalence Odds3
Lower 95% Upper 95% Diet Vaccination Odds3 confidence limit confidence limit Basal Unvaccinated 0.06 0.02 0.14 MOS1 Unvaccinated 0.04 0.02 0.10 Synergistic2 Unvaccinated 0.09 0.05 0.18 Basal Vaccinated 0.04 0.01 0.15 MOS1 Vaccinated 0.04 0.01 0.20 Synergistic2 Vaccinated 0.09 0.04 0.22 Main Effects Treatment Basasl 0.05 0.02 0.11 MOS1 0.04 0.02 0.10 Synergistic2 0.09 0.05 0.16 Vaccination Unvaccinated 0.06 0.04 0.10 Vaccinated 0.06 0.03 0.11 Odds Ratio P-Value Treatment 0.246 Vaccination 0.832 Treatment x Vaccination 0.954
1 BioSecure®, BioMatrix International, Princeton, MN 55371. 2 Biolex® BioMatrix International, Princeton, MN 55371. 3 Odds of having fecal Salmonella over not having it for each treatment group.
140
Table 4.5: Odds Ratios3: cloaca Salmonella prevalence Odds Lower 95% Upper 95% Treatment Ratio3 confidence limit confidence limit Unvac Basal Vac Basal 1.30 0.29 5.96 Unvac Basal Unvac Syn.2 1.30 0.38 4.51 Unvac Basal Vac Syn.2 1.30 0.23 7.53 Unvac Basal Unvac MOS1 0.62 0.20 1.91 Unvac Basal Vac MOS1 0.62 0.18 2.19 Vac Basal Unvac Syn.2 1.00 0.22 4.56 Vac Basal Vac Syn.2 1.00 0.14 7.09 Vac Basal Unvac MOS1 0.48 0.16 1.46 Vac Basal Vac MOS1 0.48 0.10 2.21 Unvac Syn.2 Vac Syn.2 1.00 0.17 5.77 Unvac Syn.2 Unvac MOS1 0.48 0.16 1.46 Unvac Syn.2 Vac MOS1 0.48 0.14 1.67 Vac Syn.2 Unvac MOS1 0.48 0.09 2.54 Vac Syn.2 Vac MOS1 0.48 0.08 2.79 Unvac MOS1 Vac MOS1 1.00 0.32 3.11 Main Effects Treatment Basal Syn.2 1.14 0.36 3.64 Basal MOS1 0.55 0.21 1.41 Syn.2 MOS1 0.48 0.17 1.36 Vaccination Unvac Vac 1.09 0.46 2.58 Odds Ratio P-Value Treatment 0.246 Vaccination 0.832 Treatment x Vaccination 0.954 1 BioSecure®, BioMatrix International, Princeton, MN 55371. 2 Biolex® BioMatrix International, Princeton, MN 55371. 3 Ratio of the odds of having Salmonella for two treatment groups.
141
CHAPTER 5: PREBIOTICS AND PROBIOTICS USED ALONE OR IN
COMBINATION AND EFFECTS ON PULLET GROWTH AND
INTESTINAL MICROBIOME
D. Hahn, B. A. Kreifels, S.E. Purdum, K.A. Hanford, and S.C. Fernando
5.1 ABSTRACT
A study was conducted examining the effects of prebiotics, probiotics separately and in combination on growth parameters, fecal and cecal microbiota.
Six dietary treatments consisted of: 1) control, 2) control + 0.2 lb/ton 1x1010
Pediococcus acidilactici , 3) control + 0.2 lb/ton 2x1010 live Saccharomyces cerevisiae boulardii, 4) control + 2 lb/ton MOS, 5) control + 0.2 lb/ton 1x1010
Pediococcus acidilactici and + 2 lb/ton MOS, and 6) control + 0.2 lb/ton 2x1010 live Saccharomyces cerevisiae boulardii + 2 lb/ton MOS. During the booder phase (0-4 wks), a total of 600 Bovan white pullet chicks were randomly assigned to 60 pens. At 5 wks of age, pullets were moved to 36 grower pens with 10 chicks per pen. At 17 wks, all pullet chicks were moved to a tiered layer unit with
4 layers per pen placed. Measurements included feed intake (biweekly until 4 wks of age, then weekly), weekly egg production starting at 19 wks, biweekly body wt, body wt gain and FCR were calculated. Microbial sampling was as follows: fecal Salmonella enteritidis prevalence testing at wks 15, 19, and 22 wks of age. Fecal and cecal E.coli, Enterobacteriacea, and coliform testing was conducted at 12, 16, 20, and 22 wks of age and Salmonella spp. counts were 142
determined at 16, 20, and 22 wks of age. There was not a significant difference
between treatments for feed intake, body weight, body weight gain or feed
conversion. There were not significant differences between treatments for
Salmonella enteritidis prevalence, E.coli, coliform or Salmonella spp. fecal
counts. Cecal E. coli and coliform counts were not affected by treatment. There
was a significant treatment by time effect for Enterobacteriacea cecal counts.
Enterobacteriacea counts spiked at 16 wks of age and decreased through the
study for all treatments, except for MOS. The addition of prebiotics and
probiotics, individually or in combination did not significantly improve growth or
alter the potentially pathogenic bacteria microbiome of fecal or cecal in pullet
chicks.
5.2 INTRODUCTION
Interest in examining the effects of probiotics and prebiotics in poultry production has increased due to understanding the impact a healthy gut microbiome can have on bird performance. The proposed beneficial effects of prebiotics and probiotics are multifold: positive stabilization of the intestinal microbiome, stimulation of the immune system, reduce inflammatory reactions, prevention of pathogen colonization, decrease ammonia and urea excretion, increased production of VFAs, and increase vitamin B synthesis
(Stavric and Kornegay, 1995; Jenkins et al., 1999; Monsan and Paul, 1995; Piva, 1998;
Simmering and Blaut, 2001; Patterson and Burkholder, 2003).
Prebiotics are defined as, “nondigestible food ingredients that beneficially affect the host by selectively stimulating growth and/or activity of one or a limited number of 143 bacteria in the colon” (Gibson and Roberforid, 1995; Gaggia et al., 2010). Prebiotics cannot be hydrolyzed in the gut by the host, but rather serve as a substrate to encourage the growth of beneficial bacteria (Gaggi et al., 2010). The more dominant prebiotics utilized to modulate gut bacteria in poultry have been fructooligosaccharide (FOS) products, oligofructose, and inulin. Mannan oligosaccharides (MOS) are prebiotics, however they have a different mode of action compared to FOS. Mannan oligosaccharides are hypothesized to work by binding type 1 fimbrae of pathogenic bacteria, removing them from the gastrointestinal tract and stimulating the immune system (Spring et al., 2000; Patterson and Burkholder, 2003). MOS products have been shown to be effective at inhibiting the invasion of Salmonella in the poultry gastrointestinal tract (Spring et al., 2000; Fernandez et al., 2000). MOS has also been effective at reducing E.coli and Camplyobacter numbers in broiler chicks (Baurhoo et al.,
2009; Kim et al., 2011).
In addition to prebiotics, probiotics have been shown to have a similar impact on gastrointestinal health. Probiotics are best defined as a product that contains a sufficient number of viable bacteria that have a positive impact on the gut microbiome for the host
(Fuller, 1992; Patterson and Burkholder, 2003; Park et al., 2013). There have been a variety of microbial species that have been examined as viable probiotics in poultry production including, Bacillus, Bifidobacterium, Enterococcus, Lactobacillus,
Lactococcus, Streptococcus, and yeast cultures (Mikulski et al., 2012). The main bacteria examined and fed to livestock are Bacillus, Enterococcus, Saccharomyces yeast and
Lactobacillus (Simon et al., 2001; Mikulski et al., 2012). Probiotics have similar health effects on the gut microbiome as prebiotics. It has been shown that probiotics have a 144 positive impact on hen performance, egg quality and feed efficiency (Mohan et al., 1995;
Tortuero and Fernandez, 1995; Abdulrahim et al., 1996; Davis and Anderson, 2002;
Panda et al., 2003; Mikulski et al., 2012).
Due to the numerous potential benefits using alternative feed additives such as prebiotics and probiotics have on the digestive tract and overall health of the bird, they warrant further investigation. Most prebiotic and probiotic research has been conducted in broilers, and has shown great promise. However, a limited number of studies have examined their use in pullets and laying hens. Thus, this study was conducted to examine the effects of supplementing with prebiotics, probiotics, or a combination thereof on pullet performance and their effects on the gut microbiome and fecal shedding of potentially pathogenic bacteria.
5.3 MATERIALS AND METHODS
Birds and Housing
Bovan white pullet chicks were obtained from a commercial hatchery48. Pullets were housed in the Poultry Research facilities in the Animal Science building at the
University of Nebraska-Lincoln under the guidance of the University of Nebraska
Institutional Animal Care and Use Committee. A step down day long lighting program was implemented, with 20 to 22 h of light provided the first week and then stepped down weekly to 12 h at 10 wk of age. A photoperiod of 12 h of light was maintained until 19 wk of age.
48 Nelson Hatchery, Manhattan, KS 66506. 145
Brooder cage dimensions49 were 61x61 cm for a total of 3, 721 cm2 with 10 chicks per cage, resulting in 372.1 cm2 per chick during the first 4 weeks. Brooder waterers were a trough design allowing 7.62 cm per chick. After 4 wks, 8 pullet chicks per pen were placed into cages allowing 465.5 cm2 per chick. Cages were supplied with
2 nipple drinkers per pen and 7.8 cm/chick of feeder space. Chicks were allowed ad libitum access to feed and water.
Eggs were vaccinated for infectious bronchitis, Marek’s disease, E. coli and SE in ovo. Chicks were vaccinated for infectious bronchitis, and Newcastle at 2, 4, 7, 13, and
14 weeks of age. At 13 weeks of age, pullets were given killed vaccine injection of
Salmonella enteritidis subcutaniously.
At 17 wk of age, the remaining 6 pullets in cages were moved into layer cages.
All pullets remained on the same dietary treatments. Four hens per pen were placed on a continuing growth and performance study while 2 hens per pen were placed in separate cages for the microbiology measurement of the study. Cage dimensions50 were 800x800 cm resulting in 400 cm2 /hen, each cage was outfitted with 2 nipple drinkers and hens had adequate feeder space of 8 cm/hen. The study was conducted under the approval of the
University of Nebraska Animal Care Committee.
Diets and Measurements
Six dietary treatments were formulated and implemented in a phase feeding program for growing pullets according to recommendations for in the Bovan White
49 Petersime, Zulte, Belgium. 50 Chore-TimeBrock Inc. A Berkshire Hathaway Company, Milford, IN 46542. 146
Laying Hen manual 51 recommendations and to meet NRC (1994) requirements. The 6 dietary treatments were 1) control (without supplement), 2) control with 1x1010
Pediococcus acidilactici (Probiotic (Pro) 1)52, included at 0.2 lb/ton, 3) Control 2x1010 of live Saccharomyces cerevisiae boulardii (Pro2)53, included at 0.2 lb/ton, 4) control with
MOS54 which contained 24% mannanoligosaccharides and 25% beta-glucan content, included at 2 lb per ton, 5)control with Pro1 included at 0.2 lb/ton and MOS50,52 at 2 lb/ton and 6) control with Pro2 and MOS51,52 included in at 0.2 lb/ton and 2 lb/ton respectively. All diets are shown in Table 5.1. All feed additives were included in the vitamin mineral premix at the above inclusion rates.
During the brooder period (1 day old-4 wks of age), chicks were housed in brooder units55 that contained 6 pens per unit with 10 units resulting in 60 pens that were fed 1 of 6 dietary treatments, allocating10 replicates per treatment. At four weeks of age, pullet chicks were moved into pullet rearing cages and housed in those cages from 4-
16 weeks. The experimental units were reduced from 60 to 36 with 8 pullet chicks per pen that were fed 1 of 6 dietary treatments. At 17 weeks of age, the remaining 6 pullet chicks were moved to a multi-tiered belt system56 to match commercial practices. At this point, 4 hens per pen were placed on a continuing growth and performance study while 2 hens per pen were placed in separate cages for the microbiology portion of the study.
The two studies were housed in the same layer cage unit, with 36 pens for each study receiving the dieary treatments, resulting in 6 replicate pens per treatment.
51 ISA Poultry, Kitchener, Ontario, Canada, N2K 3S2. 52 Bactocell®, Lallemand Animal Nutrition, Milwaukee, WI, 53218. 53 Levucell®, Lallemand Animal Nutrition, Milwaukee, WI, 53218. 54 AgriMOS®, Lallemand Animal Nutrition, Milwaukee, WI, 53218. 55 Petersime, Zulte, Belgium. 56 Chore-TimeBrock Inc. A Berkshire Hathaway Company, Milford, IN 46542.
147
During the first four weeks, biweekly feed intake and average chick weight was measured. Average chick weight consisted of weighing all chicks in the pen and then dividing by the number of chicks. Feed intake was measured by weighing feed alloted for two weeks into a labeled bucket and then weighing back what was left in the feeders to determine total pen feed intake. Total pen feed intake was then averaged over number of chicks in the cage and number of days. Weekly feed intake was determined from five weeks of age on using the same principle. Weight gain was determined biweekly by subtracting day old body weight from final body weight. Feed conversion was calculated biweekly dividing chick feed intake over chick body weight. Mortality was recorded daily and feed intake and body weight measurements were adjusted accordingly. Egg production was recorded on a daily basis from week 19 onward.
Microbiology Measurements and Assays
At 12, 16, 20, and 23 weeks of age, fecal and ceca samples were taken for microbiological analysis of E. coli, Enterobacteriacea and coliforms. Salmonella spp. enumeration was conducted at 16, 20 and 23 weeks of age. During the pullet stage, fecal samples were collected by placing a sheet of aluminum foil under each cage for approximately 2 hours (Donalson et al., 2008). At 17 weeks of age, hens had been moved to a multi-tiered belt system. Therefore collection of fecal samples was taken directly off the manure belt. Prior to collection, the belt was cleaned and fecal samples were aseptically collected after approximately 2 hours. Fecal material was weighed and placed into sterile Whirl Pak57 bags and immediately taken to the University of Nebraska-
Lincoln Animal Science microbiology lab for microbial analysis. Ceca samples were
57 Nasco, Fort Atkinson, WI, 53538. 148 taken from one chick per pen after euthanasia by cervical dislocation, samples were aseptically removed and contents were gently squeezed into pre weighed sterile Whirl
Pak56 bags and immediately taken to the University of Nebraska-Lincoln Animal Science microbiology lab for analysis. Fecal and cecal samples were analyzed for
Enterobacteriacea, Salmonella, E. coli and coliforms using modified methods described in Hinton et al. (2000) and Baurhoo et al. (2007), which differed only in agars used.
Samples were placed into a 1:10 sterile Phosphate Buffer Solution58 solution by weight.
Samples were then diluted 10-fold to 10-2 and 50µL was plated by spiral plater onto the following media: Violet Red Bile Glucose59 agar, CHROMagar Salmonella60 and
CHROMagar ECC58for the enumeration of Enterobacteriacea, Salmonella, E. coli and total coliforms respectively. Violet Red Bile Glucose57 agar plates were incubated at
37°C for 18-24 hours and typical red to red-pink colonies were counted. CHORMagar
Salmonella58 plates were incubated at 37°C for 24 hours, typical mauve colonies counted.
Suspect positive colonies were selected for PCR confirmation (Rijpens et al., 1999). For enumeration of E. coli, CHROMagar ECC58 plates were incubated at 42°C for 24 hours, typical blue colonies were counted. For enumeration of total coliforms, CHROMagar
ECC58 plates were incubated at 30°C for 24 hours; both blue and red colonies were counted. All plates were incubated aerobically. Bacterial numbers were converted to log10 colony-forming units per gram of sample for statistical analysis.
During weeks 15, 19, and 22 fecal samples were collected from each pen to determine Salmonella enteritidis presence. S. enteritidis shedding detection was
58 Fisher Scientific, Pittsburgh, PA 15275. 59 Remel Products, Lenexa, KS, 66215. 60 DRG International, Springfield, NJ 07081. 149 conducted using RapidChek® Select Salmonella enteritidis (SE) tests61. Tests were conducted to manufacture instructions59. Confirmation of suspect positive samples was done by PCR as described below. During week 22, one week’s of egg production was collected and egg contents were also tested for S. enteritidis using RapidChek® Select
Salmonella enteritidis tests59.
PCR Confirmation
For confirmation of suspect colonies, a modified method described by Rijpens et al. (1999) was used. In brief, suspect colonies were selected and grown in tryptic soy broth overnight, then 20µL of tryptic soy broth was placed into 80µL of PCR-grade water, vortexed to mix and boiled at 95°C for 10 minutes in a Veriti® Thermal Cycler62.
The sample was then centrifuged at 3000 g for 3 min and the supernatant was used for
PCR analysis. Salmonella specific primers (Styniva-JHO-2-left-5’-
TCGTCATTCCATTACCTACC-3’ and right 5’-AAACGTTGAAAAACTGAGGA-3’)63 were chosen to amplify a 119-base pair fragment of invasion (invA) gene (Hoorfar et al.,
2000; Nam et al., 2005). The PCR mixture used was the following: 3 µL DNA template,
0.25 µL Terra Taq Polymerase64, 5 mM dNTP, 10 mM primers, 2.5 µL buffer solution62, and 17.75 µL double distilled PCR grade water for a final reaction volume of 25µL.
Samples were then placed in Veriti® Thermal Cycler60 and designated a thermal cycle of:
50°C for 2 min, 15 min at 95°C, then 40 cycles of: 15 sec at 95°C, 15 sec at 55°C, and 30 sec at 72°C and a final extension at 72°C for 5 min (Nam et al., 2005).
61 Romer Labs Technology Inc., Newark, DE, 19713. 62 Life Technologies, Grand Island, NY, 14072. 63 Integrated DNA Life Technologies, Coralville, IA, 52241. 64 Clontech Laboratories, Mountian View, CA 94043. 150
PCR confirmation of SE quick tests was conducted using S. enteritidis specific primers, SEFA-1 (5’-GCAGCGGTTACTATTGCAGC-3’) and SEFA-2 (5’-
CTGTGACAGGGACATTTAGCG-3’)61, which are specific for sefA gene were chosen to amplify a 310 base pair product (De Medici et al., 2003). DNA was extracted from the final enrichment broth by transferring 20 µL into 80 µL of double distilled RNA-DNA free PCR grade water and boiled at 95°C for 10 min in a Veriti® Thermal Cycler60. The samples were then centrifuged for 3 min at 1000 g and supernatant was used for PCR analysis. The PCR mixture used was the same as outlined above, with Salmonella enteritidis specific primers. Samples were then placed in Veriti® Thermal Cycler60 and designated a thermal cycle of: 50°C for 2 min, 95°C for 10 min, and 35 cycles of: 95°C for 1 min, 55°C for 1 min, and 72°C 1 min and a final extension phase of 60° for 1 min
(De Medici et al., 2003).
Statistical Analysis
Data were analyzed using Proc Glimmix function of SAS for an unbalanced block design with treatments arranged in a completely randomized design until week 17.
Blocking was unbalanced due to the treatments not being equally represented in each block. Pullet cage unit served as block. At 17 weeks of age, pullets were transferred to a layer unit where data was analyzed by randomized complete block design, blocking was done by tier. Feed intake, body weight, feed conversion ratio, total microbiology analysis for fecal and cecal samples were analyzed by repeated measures analysis and tested for the effects of treatment over time. Repeated measures analysis was conducted to determine changes in production data throughout the course of the study. Covariance patterns were tested to determine the best fit for the model. Covariance patterns tested 151 were compound symmetry (CS), autoregressive (ar(1)), toeplitz (toep), unstructured (un), and heterogeneous autoregressive (arh(1)). The model is shown below:
Y=µ + Bi + Trj + Tk + TrTjk + εijk
Where µ is the overall mean; Bi is the block effect; Trj is the treatment effect; Tk is the time effect; TrTjk is the treatment by time effect; εijk is the random error.
Body weight gain and weekly microbiology results were analyzed using Proc
Glimmix analysis in SAS and was analyzed using a similar model as above. However, since there is not a time effect for these measurements, repeated measures was not conducted. The model analyzed is shown below:
Y=µ + Bi + Trj +εijk
Where µ is the overall mean; Bi is the block effect; Trj is the treatment effect; εijk is the random error.
SE prevalence was determined by grouping all three time points together, as there were not enough positive samples to allow for repeated measures analysis. Therefore, data was analyzed using Proc Glimmix in SAS and analyzed by logistic regression analysis using the logit function in SAS, resulting in formation of an odds ratio. Odds ratios are used to measure the association between exposure and outcome (Szumilas,
2010). An odds ratio was used in this study to determine the association of recovering a positive sample over the total number of samples taken. This was calculated by taking the exponential of the estimate for each treatment and main effect. The model is shown below: 152
Log (µi/(1- µi))=Tri
Where µi is the overall mean; 1- µi is the variance; and Tri is the overall treatment effect.
5.4 RESULTS AND DISCUSSION
There was not a significant effect on feed intake at 0-4 (P≤0.732), 5-10 (P≤0.998),
11-13 (P≤0.093), 14-19 (P≤0.376) or 20-23 (P≤0.444) weeks of age (Table 5.2). Nor were there any significant differences when examining the main effect of treatment at any time interval (Table 5.2). Although not significant, during 11-13 weeks of age, treatment was approaching significance (P≤0.094) (Table 5.2), showing that the hens fed the control diets tended to have a slightly higher feed intake (58.45 g/hen/d) than the other five experimental treatments.
There were no significant treatment by time interactions for body weight at 0-4
(P≤0.358), 5-10 (P≤0.684), 11-13 (P≤0.875), and 14-19 (P≤0.451) (Table 5.2). There was also no significant differences on the main effect of treatment across all weeks
(Table 5.2). Body weight and gain were not significant across all five growth periods
(Table 5.2). However, during the starter period (0-4 wks of age), weight gain approached significance (P≤0.085), which showed that diets containing Pro1 tended to have a higher weight gain than any other dietary treatment. Finally, there was no significant treatment by time interaction across all five growing periods for FCR (Table 2). Nor were there any significant differences when examining the effect of treatment for FCR (Table 2).
Treatment effects on feed intake, body weight and FCR complement the findings of
Mountzouris et al.,(2007), Geier et al., (2009), and Daşkiran et al., (2012) who found no 153 significant differences between control rations and rations that contained a probiotic or prebiotic compound in broilers. Bozkurt and coworkers (2014), showed that supplementing with a probiotic mixture can have an improvement on early weight gain in broiler chicks, which complements our findings where Pro 1 tended to have higher body weight gain than other treatments. This trend for early weight gain could be attributed to the beneficial effects Pediociccus acidilactici has on the gut microbiome and health
(Taheri et al., 2010; Mikulski et al., 2012).
Examining fecal samples for microbiology analysis, there were no significant treatment by time effects for E. coli (P≤0.844), total coliforms (P≤0.833),
Enterobactereacea (P≤0.834) or Salmonella (P≤0.317) (Table 5.3). There was a significant treatment effect during week 12 (P≤0.54) for Enterobactereacea (Table 5.3).
This showed that diets containing Pro2 and MOS had the lowest Enterobactereacea counts. Ceca samples had no significant treatment by time effect for E. coli (P≤0.207) or total coliforms (P≤0.220), however there was a significant treatment by time effect for
Enterobactereacea (P≤0.051) (Table 5.4). Enterobacteriacea counts spiked at16 wk of age for all treatments, and decreased at wks 20 and 22, except for MOS (Table 5.4).
Enterobacteriacea ceca counts were higher for MOS at wks 20 and 22 than all other treatments (Table 5.4). There were no Salmonella detected in the ceca samples, therefore they are not reported. All egg pools tested negative for SE. Examining the odds of finding SE in fecal samples, there were no significant differences between treatments
(P≤0.351) (Table 5.5). It should be noted that although SE was detected in the feces, the odds of finding positive samples were very low, as the odds ratios were well below 1
(Table 5.5). This is an indication that our SE vaccination program which involves in ovo 154 and subcutaneous injection at 13 weeks was highly effective at keeping SE prevalence to a minimum.
There have been mixed results using prebiotics and probiotics on changes in the gut microbiome. Yang et al., (2007) reported that MOS supplementation increased the amount of coliforms found in the duodenum and ileum but had no effect on ceca counts in broilers, their study was conducted on fresh litter. Sims et al., (2004) found no significant differences on coliform and E. coli counts in turkeys supplemented with MOS, furthermore, turkeys were raised on used litter and therefore a more challenging environment than the Yang et al., (2007) study. Our results are complementary to the previous findings; MOS did not have an effect on cecal or fecal E. coli and coliform counts. Our results contradict the findings of Baurhoo and coworkers (2007) who found the addition of MOS significantly reduced the amount of E. coli in both litter and ceca samples in broilers. Varied responses to probiotics are common. Our results contradict the findings of Wu et al., (2011) who found supplementing probiotics significantly reduced the amount of E. coli in the cloaca of broilers. Our findings complement the results of Mountzouris and coworkers (2007) who found supplementing with a probiotic containing a mixture of bacteria did not have an effect on total anaerobic bacteria, coliforms, or Bacteroides. Finally, Salim et al., (2013) reported that probiotic supplementation did not have an impact on Salmonella counts, which compliments our findings, but did find a reduction in E. coli numbers.
There are many various factors that contribute to variation between studies when examining different prebiotics and probiotics. These factors could be breeder flock, hatchery conditions, growing conditions, or feed substrates. The lack of response within 155 the production parameters and microbial population assessment indicate that our pullets were not sufficiently challenged. The effects of prebiotics, probiotics and their synergistic effect seem to be more pronounced when the birds are raised in an environment that offers a bacterial challenge, such as raising on the floor with used litter.
In addition, with the flock having good general health, it is difficult to determine if the addition of probiotic will have an impact on growth, performance and gut microbiota. In this study, the pullet chicks were housed in an environment that was thoroughly cleaned on a weekly basis until pullets were moved into the multi-tiered layer unit. This practice most likely impacted the level of challenge the birds were exposed to and ultimately the results.
There was a positive effect observed with increased weight gain from 0-4 weeks of age in pullet chicks fed rations supplemented with Pro 1(Pediococcus acidilactici65).
Although this was a trend toward significance, it is a trend worth exploring. Producers will most likely observe the largest benefit to supplementing prebiotics and probiotics in enviornments that are high challenge. Such as alternative housing systems such as free range, cage free, aviary and colony cages on recycled litter. More research should be conducted examining the effects of prebiotics and probiotics in a system that presents more challenges on gut health.
65 Bactocell®, Lallemand Animal Nutrition, Milwaukee, WI, 53218. 156
5.5 REFERENCES Abdulrahim, S.M., S.Y. Haddadin, E.A. Hashlamoun, and R.K. Robinson. 1996. The influence of Lactobacillus acidophilus and bacitracin on layer performance of chickens and cholesterol content of plasma and egg yolk. Br. Poult. Sci. 37:341-346.
Baurhoo, B., L. Phillip, and C.A. Ruiz-Feria. 2007. Effects of purified lignin and mannan oligosaccharides on intestinal integrity and microbial populations in the ceca and litter of broiler chickens. Poult. Sci. 86:1070-1078. Baurhoo, B., F. Goldflus, and X. Zhao. 2009. Purified cell wall of Saccharomyces cerevisiae increases protection against intestinal pathogens in broiler chickens. Int. J. Poult. Sci. 8(2): 133-137. Bozkurt, M., N. Aysul, K. KüҫüKyilmaz, S. Aypak, G. Ege, A.U. Çatli, H. Akşkit, F. Çöven, K. Seyrek, and M. Çınar. 2014. Efficacy of in-feed preparations of an anticoccidia, multienzyme, prebiotic, probitoc, and herbal essential oil mixture in healthy and Eimeria spp.-infected broilers. Poult. Sci. 93:389-399. Daşkiran, M., A. G. Önol, Ö. Cengiz, H. Ünsal, S. Türkyilmaz, O. That, and O. Sevim. 2012. Influence of dietary probiotic inclusion on growth performance, blood parameters, and intestinal microflora of male broiler chickens exposed to posthatch holding time. J. Appl Poult. Res. 21:612-622. Davis, G.S., and K.E. Anderson. 2002. The effects of feeding the direct-fed microbial PrimaLac on growth parameters and egg production in Single White Leghorn hens. Poult. Sci. 81:755-759.
De Medici, D., L. Croci, E. Delibato, S. Di Pasquale, E. Filetici, and L. Toti. 2003. Evaluation of DNA extraction methods for use in combination with SYBR Green I real- time PCR to detect Salmonella enterica serotype enteritidis in poultry. Appl. Enviro. Micro. 69:3456-3461.
Donalson, L.M., J.L. McReynolds, W.K. Kim, V.I. Chalova, C.L. Woodward, L.F. Kubena, D.J. Nisbet, and S.C. Ricke. 2008. The influence of a fructooligosaccharide prebiotic combined with alfalfa molt diets on the gastrointestinal tract fermentation, Salmonella enteritidis infection and intestinal shedding in laying hens. Poult. Sci. 87:1253-1262.
Ferket, P.R., C.W. Parks, and J.L. Grimes. 2002. Mannan oligosaccharides versus antibiotics for turkeys. Pages 43-63 in Proc. Alltech 18th Annu. Symp. Lexington, KY. Nottingham Univ. Press, U.K. Fernandez, F., M. Hinton, and B. Van Gils. 2000. Evaluation of the effect of mannan- oligosaccharides on the competitive exclusion of Salmonella Enteritidis colonization in broiler chicks. Avian Pathol. 29:575-581. 157
Fuller, R. 1989. Probiotics in man and animals. J. Appl. Bacteriol. 66:365-378.
Gaggia, F., P. Mattarelli, B.Biavati. 2010. Probiotics and prebiotics in animal feeding for safe food production. Inter. J. Food Micro. 141:S15-S28.
Geier, M.S., V.A. Torok, G.E. Allison, K. Ophel-Keller, R.J. Hughes. 2009. Indigestible carbohydrates alter the intestinal microbiota but do not influence the performance of broiler chickens. J. Appl. Microbiol. 106(5): 1540-1548.
Gibson, G.R., and M.B. Roberfroid. 1995. Dietary modulation of the human colonic microbiota: introducing the concept of prebiotics. J. Nutr. 125:1401-1412.
Hinton Jr., A., R.J. Buhr, K.D.Ingram. 2000. Reduction of Salmonella in the crop of broiler chickens subjected to feed withdrawal. Poult. Sci. 9:1566-1570.
Hoorfar, J., P. Ahrens, and P. Rådstrōm. 2000. Automated 5’ nuclease PCR assay for identification of Salmonella enterica. J. Clinical Micro. 38:3429-3435.
Hughes, R.J. 2003. Variation in the digestion of energy by broiler chickens. PhD. Diss. Univ. Adelaide, Australia. Jenkins, D.J.A., C.W.C. Kendall, and V. Vuksan. 1999. Inulin, oligofructose and intestinal function. J. Nutr 129:1431S-1433S.
Kim, G.-B., Y.M. Seo, C.H. Kim, and I.K. Paik. 2011. Effect of dietary prebiotic supplementation on the performance, intestinal microflora, and immune response of broilers. Poult. Sci. 90: 75-82.
Mikulski, D., J. Jankowski, J. Naczmanski, M. Mikulska, V. Demey. 2012. Effects of dietary probiotic (Pediococcus acidilactici) supplementation on performance, nutrient digestibility, egg traits, egg yolk cholesterol, and fatty acid profile in laying hens. Poult. Sci. 91:2691-2700. Mohan, B., R. Kadirvel, B. Bhaskaran and A. Natarajan. 1995. Effect of probiotic supplementation on serum/yolk cholesterol and on eggshell thickness in layers. Br. Poult. Sci. 36:799-803.
Monsan, P. and F. Paul. 1995. Oligosaccharide feed additives. Pages 233-245 in Biotechnology in Animal Feeds and Animal Feeding. R.J. Wallace and A. Chesson, ed. VCH, New York.
158
Mountzoris, K.C., P. Tsirtsikos, E. Kalamara, S. Nitsch, G. Schatzmayr, and K. Fegeros. 2007. Evaluation of the efficacy of a probiotic containing Lactobacillus, Bifidobacterium, Enterococcus, and Pediococcus strains in promoting broiler performance and modulating cecal microflora composition and metabolic activities. Poult. Sci. 86:309-317. Nam, H.M., V. Srinivasan, B.E.Gillespie, S.E. Murinda, S.P. Oliver. 2005. Application of SYBR green real-time PCR assay for specific detection of Salmonella spp. In dairy farm environmental samples. Int. J. Food Microbiol. 102:161-171.
NRC. 1994. Nutrient Requirements of Poultry. 9th ed. Natl. Acad. Press, Washington, DC.
Panda, A.K., M.R. Reddy, S.V. Rama Rao and N.K. Praharaj. 2003. Production performance, serum/yolk cholesterol and immune competence of white leghorn layers as influenced by dietary supplementation with probiotic. Trop. Anim. Health Prod. 35:85- 94.
Park, S.H., I. Hanning, A. Perrota, B.J. Bench, E. Alm, and S.C. Ricke. 2013. Modifying the gastrointestinal ecology in alternatively raised poultry and the potential for molecular and metabolic assessment. Poult. Sci. 92:546-561.
Patterson, J.A., and K.M. Burkholder. 2003. Application of prebiotics and probiotics in poultry production. Poult. Sci. 2:627-631.
Piva, A 1998. Non-conventional feed additives. J. Anim. Feed Sci. 7:143-157.
Rijpens, N., L. Herman, F. Vereecken G. Jannes, J. De Smedt, L. De Zutter. 1999. Rapid detection of stressed Salmonella spp. In dairy and egg products using immunomagnetic separation and PCR. Inter. J. Food Micro. 46:37-44.
Salim, H.M., H.K. Kang, N. Akter, D.W. Kim, J.H. Kim, M.J. Kim, J.C. Na, H.B. Jong, H.C. Choi, O.S. Suh, and W.K. Kim. 2013. Supplementation of direct-fed microbials as an alternative to antibiotic on growth performance, immune response, cecal microbial population, and ileal morphology of broiler chickens. Poult. Sci. 92:204-2090.
SAS Institute. 2009. SAS User’s Guide: Statistics. Version 9.2 Edition. SAS Institude Inc. Cary, NC.
Scott, T.A. and F. Boldaji. 1997. Comparison of inert markers [chromic oxide or insoluble ash (Celite TM)] for determining apparent metabolizable energy of wheat-or- barley based broiler diets with or without enzymes. J. Poult. Sci. 76:594-598. 159
Simmering, R., and M. Blaut. 2001. Pro-and prebiotics-the tasty guardian angles? Appl. Microbiol. Biotechnol. 55:19-28.
Simon, O., A. Jadamus, and W. Vahjen. 2001. Probiotic feed additives-Effectiveness and expected modes of action. J. Anim. Feed Sci. 10:51-67.
Sims, M.D., K.A. Dawson, K.E. Newman, P. Spring, D.M. Hooge. 2004. Effects of dietary mannan oligosaccharide, bacitracin methylene dislicylate, or both on the live performance and intestinal microbiology of turkeys. Poult. Sci. 83:1148-1154. Spring, P., C. Wenk, K.A. Dawson, and K.E. Newman. 2000. The effects of dietary mannanoligosaccharides on cecal parameters and the concentrations of enteric bacteria in the ceca of Salmonella-challenged broiler chicks. Poult. Sci. 79:205-211.
Stavric, S., and E.T. Kornegay. 1995. Microbial probiotics for pigs and poultry. Pages 205-231 in Biotechnology in Animal Feeds and Animal Feeding. R.J. Wallace and A. Chesson, ed. VCH, New York.
Szumilas, M. 2010. Explaining odds ratios. J. Can. Acad. Child Adolesc. Psychiatry. 19(3): 227-229. Taheri, H.R., H. Moravej, A. Malakzadegan, F. Tabandeh, M. Zaghari, M. Shivazad, and M. Abidmoradi. 2010. Efficiacy of Pediococcus acidlactici-based probiotic on intestinal coliforms and villus height, serum cholesterol level and performance of boriler chickens. Afr. J. Biotechnol. 9:7564-7567. Tortuero, F., and E. Fernandez. 1995. Effects of inclusion of microbial cultures in barley- based diets fed to laying hens. Anim. Feed Sci. Technol. 53:255-265.
Van Keulen, J. and B.A. Young. 1977. Evaluation of acid-insoluble ash as a natural marker in ruminant digestibility studies. J. Anim.Sci. 44:282-287. Wu, B.Q. T. Zhang, L.Q. Guo, and J.F. Lin. 2011. Effects of Bacillus subtilis KD1 on broiler intestinal flora. Poult. Sci. 90:2493-2499. Yang, Y., P.A. Iji, A. Kocher, L.L. Mikkelsen, and M. Choct. 2007. Effects of mannanoligosaccharide on growth performance, the development of gut microflora, and gut function of broiler chickens raised on new litter. J. Appl Poult. Res. 16:280-288.
160
Table 5.1: Diet Compositions Starter Grower Developer Pre-Lay Phase 1 Ingredient Diet Diet Diet Diet Diets Corn (%) 59.71 67.31 70.00 61.64 47.61 Soybean Meal Hi-Pro(%) 29.08 23.58 20.36 20.88 28.72 Oil (veg) (%) 2.09 0.28 0.30 2.85 5.09 Dicalcium Phosphate (%) 1.61 1.55 1.35 1.36 1.56 DDGS (%) 5.00 5.00 5.00 5.00 5.00 Limestone (%) 1.65 1.43 1.89 7.18 11.08 Salt (%) 0.12 0.07 0.37 0.39 0.43 DL-Methionine (%) 0.16 0.14 0.106 0.11 0.19 L-Lysine HCl (%) 0.08 0.12 0.12 0.05 0.004 Vitamin-Mineral Premix1 (%) 0.50 0.50 0.50 0.50 0.30 L-Threonine 0.00 0.026 0.00 0.00 0.00 Calculated Values Metab. Energy (kcal/kg) 3020.00 2970.00 2975.00 2935.00 2875.00 Protein (%) 20.00 18.00 16.45 16.00 18.60 Lysine (%) 1.10 1.00 0.89 0.82 0.96 Methionine (%) 0.46 0.42 0.36 0.36 0.47 Calcium (%) 1.00 0.90 1.00 2.75 4.10 Av. Phosphorous (%) 0.42 0.40 0.36 0.36 0.40 Sodium (%) 0.18 0.18 0.17 0.18 0.19 Crude Fiber (%) 3.76 3.87 3.86 3.55 3.26 TSAA (%) 0.80 0.73 0.65 0.63 0.78 Tryptophan (%) 0.26 0.22 0.19 0.19 0.24 Cystine (%) 0.34 0.31 0.29 0.28 0.31 Threonine (%) 0.77 0.71 0.62 0.60 0.71 1Vitamin and trace minerals provided the following per kilogram: vitamin A (retinyl acetate, 6,600 IU); vitamin D3, 2,805 IU vitamin E (DL-α-tocopheryl acetate, 10 IU); vitamin K3 (menadione dimethpyrimidinol, 2.0mg); riboflavin (4.4 mg); pantothenic acid (6.6 mg); niacin -1 -1 (24.2 mg); choline (110 mg ); vitamin B7 (biotin, 8.8 mg ); and ethoxyquin (1.1 m%). Mn (MnO, 88 mg); Cu (CuSO4H2O, 6.6 mg); Fe (FeSO4H2O, 8.5mg); Zn (ZnO, 88 mg); and Se (Na2SeO3, 0.30 mg).
Table 5.2: Influcence of probiotics, prebiotics or a combination on ADFI, average BW, BWG and FCR1 Feed Intake (g/d) Body Wt (g) Body Wt Gain (g) FCR (g:g) 0-4 5-10 11-13 14-19 20-23 0-4 5-10 11-13 14-19 20-23 0-4 5-10 11-13 14-19 20-23 0-4 5-10 11-13 14-19 20-23 Treatment wks wks wks wks wks wks wks wks wks wks wks wks wks wks wks wks wks wks wks wks Control 17.42 44.28 58.45 61.11 86.45 134.59 527.33 1108.51 1388.92 2025.67 199.36 531.58 143.27 227.15 522.67 1.69 3.52 2.42 4.62 5.23 Pro 1 18.11 44.19 57.79 61.09 88.11 140.12 544.13 1137.84 1429.36 2040.67 216.38 556.95 144.76 241.63 496.17 1.66 3.58 2.34 4.58 4.74 Pro 2 17.61 45.03 57.67 61.21 84.11 132.37 540.73 1118.94 1352.03 1959.33 194.40 558.00 139.55 98.24 584.33 1.82 3.04 2.46 3.30 5.84 MOS 17.99 44.08 56.09 60.77 82.11 137.95 526.90 1110.82 1374.76 1955.67 207.30 541.82 140.91 193.60 492.83 1.78 3.82 2.36 4.59 5.05 Pro 1+MOS 17.47 44.58 57.51 60.18 86.59 130.91 537.14 1096.92 1379.88 1957.67 191.82 546.08 144.35 196.19 499.33 1.72 3.03 2.47 3.86 4.99 Pro 2 +MOS 17.35 43.78 57.65 59.62 83.98 130.84 522.06 1092.99 1349.37 1997.00 192.48 557.46 134.49 162.57 584.33 1.85 3.23 2.61 4.38 5.84 SEM 0.43 0.52 0.64 0.61 1.87 3.08 0.89 10.44 20.20 51.34 6.80 11.40 6.48 41.30 43.88 0.06 0.51 0.33 0.82 0.48 P-Values Trt 0.669 0.998 0.094 0.437 0.261 0.437 0.684 0.353 0.368 0.748 0.085 0.500 0.875 0.205 0.447 0.861 0.867 0.861 0.730 0.491 Trt x time 0.732 0.998 0.093 0.376 0.440 0.358 0.684 0.875 0.451 0.806 0.872 0.861 0.730 1 Mean n=6 for each dietary treatment
161
Table 5.3: CFU/g1 Counts for Fecal Samples2 E. coli Coliforms Enterobactereacea Salmonella All All All All Treatment 12 16 20 23 Wks 12 16 20 23 Wks 12 16 20 23 Wks 16 20 23 Wks Control 5.54 5.97 5.05 4.74 5.33 5.26 0.05 5.15 4.83 5.58 5.95 6.00 5.01 4.99 5.59 1.24 0.90 0.00 0.73 Pro 1 5.34 5.76 5.00 4.55 4.55 5.36 5.92 5.00 4.94 5.48 5.87 5.94 4.85 4.69 5.45 2.28 1.12 1.26 1.50 Pro 2 5.24 5.94 5.15 4.66 5.26 5.22 6.17 5.27 5.03 5.70 5.99 6.17 5.27 4.88 5.75 0.85 0.53 0.00 0.47 MOS 5.34 6.00 4.94 5.04 5.34 5.46 6.04 5.23 5.07 5.64 5.93 6.08 5.20 5.16 5.71 2.93 0.39 0.93 1.30 Pro 1+MOS 5.49 5.93 4.76 4.48 5.16 5.45 5.95 4.79 5.58 5.39 5.94 6.24 4.68 4.62 5.58 0.77 1.57 0.00 0.87 Pro 2 +MOS 5.38 5.83 5.10 4.72 5.27 5.04 6.08 5.24 4.72 5.59 5.85 6.16 5.12 4.73 5.66 0.00 0.91 1.18 0.72 SEM 0.13 0.07 0.25 0.43 0.13 0.22 0.13 0.24 0.39 0.12 0.05 0.10 0.21 0.39 0.13 0.81 0.59 0.45 0.33 P-Values Trt 0.575 0.155 0.868 0.956 0.951 0.740 0.774 0.687 0.936 0.929 0.488 0.308 0.346 0.909 0.904 0.149 0.768 0.123 0.352 Trt x time 0.844 0.833 0.834 0.317 1CFU/g counts were transformed log10 prior to statistical analysis. 2 Mean of n=6 for each dietary treatment.
162
Table 5.4: CFU/g1 Counts for Ceca Samples2 E. coli Coliforms Enterobactereacea All All All Treatment 12 16 20 23 Wks 12 16 20 23 Wks 12 16 20 23 Wks Control 5.14 5.93 5.10 5.59 5.45 5.00 6.18 4.89 5.66 5.43 5.69 6.21 4.68 5.60 5.55 Pro 1 5.20 6.46 5.69 5.45 5.69 5.18 6.48 5.70 5.29 5.66 5.35 6.35 5.64 5.25 5.65
Pro 2 5.40 5.45 5.06 5.31 5.56 5.14 6.02 5.85 5.22 5.56 5.23 6.11 5.83 5.37 5.63 MOS 5.10 5.33 5.30 6.03 5.44 5.35 6.12 5.27 6.10 5.71 5.45 6.10 6.09 6.27 5.73
Pro 1+MOS 5.17 5.95 5.37 5.37 5.47 5.58 6.05 5.37 5.46 5.61 5.70 6.11 5.17 5.33 5.58
Pro 2 +MOS 5.07 5.89 5.84 5.39 5.54 5.72 6.02 5.75 5.26 5.69 5.40 6.97 5.76 5.23 5.60 SEM 0.29 0.26 0.33 0.37 0.18 0.19 0.12 0.36 0.38 0.14 0.27 0.10 0.33 0.36 0.15 P-Values Trt 0.968 0.062 0.302 0.757 0.923 0.061 0.099 0.409 0.567 0.753 0.786 0.198 0.125 0.305 0.972
Trt x time 0.207 0.220 0.051
1 CFU/g counts were transformed log10 prior to statistical analysis. 2 Mean of n=6 for each dietary treatment.
163
164
Table 5.5: Treatment effects on fecal SE prevalence1 Lower 95% Confidence Upper 95% Confidence Treatment Odds2 Interval Interval Control 0.059 0.007 0.481 Pro1 0.059 0.007 0.481 Pro 2 0.125 0.027 0.578 MOS 0.385 0.131 1.127 Pro 1+MOS 0.125 0.027 0.578 Pro 2+MOS 0.059 0.007 0.481 Odds Ratio P-Value Treatment 0.351 Odds Lower 95% Confidence Upper 95% Confidence Treatment Ratio3 Interval Interval Basal Pro 1 1.00 0.05 19.53 Basal Pro 2 0.47 0.04 6.34 Basal MOS 0.15 0.01 1.62 Basal Pro1+MOS 0.47 0.04 6.34 Basal Pro 2+MOS 1.00 0.05 19.53 Pro 1 Pro 2 0.47 0.04 6.35 Pro 1 MOS 0.15 0.01 1.62 Pro 1 Pro 1+MOS 0.47 0.04 6.34 Pro 1 Pro 2+MOS 1.00 0.05 19.53 Pro 2 MOS 0.33 0.05 2.11 Pro 2 Pro 1+MOS 1.00 0.12 8.73 Pro 2 Pro 2+MOS 2.13 0.16 28.62 MOS Pro 1+MOS 3.08 0.47 19.99 MOS Pro 2+MOS 6.54 0.62 69.27 Pro 1+MOS Pro 2+MOS 2.13 0.16 28.62 1 All three time points added together to evaluate incidence. 2 Odds of having fecal Salmonella over not having it for each treatment group. 3 Ratio of the odds of having Salmonella for two treatment groups.
165
6.1 IMPLICATIONS
Each study had different parameters being measured with different ages of hens, housing systems and objectives, but there were several similarities. Throughout all studies, Salmonella incidence and counts were not affected by dietary treatments, whether that be MOS, probiotic or a synergistic combination. However, when
Salmonella was enumerated in Studies 3 and 4, the counts were very low, furthermore the odds of hens shedding Salmonella were low. The vaccination effect is clearly seen in
Study 2, where SE shedding was so low, statistics couldn’t be run. All of this data clearly shows that the current vaccination programs do work, coupled with producers being more aware of how Salmonella is transmitted leads to a healthier, safer food source and flock.
Housing systems do have a clear impact on food safety as well. Although MOS did not impact potential pathogenic bacteria shedding, there was a clear housing effect.
Eggs shells collected from cage free pens had 3 times higher likelihood of having E. coli and coliforms present. Although Salmonella risk was not different between the housing systems in this study, the increased risk of E. coli and coliforms should not be ignored.
Because of this, producers may need to reevaulate how they wash eggs from a cage free environment to ensure that the consumer has a safe food source.
Alternative ingredients such as prebiotics, probiotics, and essential oils do have a place in poultry production. There are other benefits to modulating the gut microflora beyond reducing the risk of infection of pathogenic bacteria. 166
There could be stimulation of the immune system, which was seen in Study 3 and improved feed utilization as was seen in Study 4. Feeding alternative feed additives coupled with the current vaccination programs leads to an overall healthier flock and safer food source for the consumer.
Table 6.1: Overview of Measurements
Measurement
Egg SE2 Egg Shell Enterobacteria Real Treatment Study Sal.1 Sal.1 SE2 Egg Shell Egg Shell E. Coliform E. coli cea Time No. Prevalence Enumeration Prevalence Pool Sal. Coliform coli Enumeration Enumeration Enumeration PCR MOS3 1 x x x x x x x
Movement Stress 2 x x
MOS4/Synergistic5 3 x x x x
Probiotic6,7/MOS8 4 x x x x x
1 Salmonella 2 S. enteritidis 3Actigen® Alltech, Nicholasville, KY. 4 BioSecure®, BioMatrix International, Princeton, MN 55371. 5 Biolex® BioMatrix International, Princeton, MN 55371. 6 Bactocell®, Lallemand Animal Nutrition, Milwaukee, WI, 53218. 7 Levucell®, Lallemand Animal Nutrition, Milwaukee, WI, 53218. 8AgriMOS®, Lallemand Animal Nutrition, Milwaukee, WI, 53218.
167