Characterization of Novel Ligand-Gated Chloride Channel Subunits from Haemonchus Contortus

Characterization of novel ligand-gated chloride channel subunits from Haemonchus contortus

Vijayaraghava T. S. Rao

Institute of Parasitology McGill University Montreal

July 2010

A thesis presented to the Faculty of Graduate Studies and Research in partial fulfillment of the requirements of the degree of Doctor of Philosophy

Abstract

Ligand-gated chloride channels (LGCCs) are key components that form the inhibitory neurotransmission system in animals. Nematodes possess LGCCs that are gated by unique ligands such glutamate, serotonin and acetylcholine. Higher living forms such as mammals are not known to possess similar receptors. Hence nematodes can be deemed to comprise a phylum with a divergent inhibitory neurotransmission system. Based on this premise, the current project aimed to better understand the inhibitory nervous system of the parasitic nematode, Haemonchus contortus through the characterization of novel LGCC subunits and the localization of relevant ligands believed to function as inhibitory neurotransmitters. The first novel LGCC subunit gene to be isolated was named Hco- GGR-3 (previously named as HcGGR3). Electrophysiological analyses of this subunit in Xenopus laevis oocytes revealed the homomeric assembly of the channel which was predominately gated by dopamine (DA). Immuno-staining of H. contortus adult worms using antibodies raised against a peptide exclusive to Hco-GGR-3 showed that this subunit localized to deirid (cervical papilla) socket and sheath cells. Gender specific differences in localization of this subunit were also observed. In addition, a single nucleotide polymorphism located in the 3’ untranslated region (UTR) of Hco-ggr-3 was found to be associated with the selection for resistance towards macrocyclic lactones (MLs) – moxidectin (MOF) and ivermectin (IVM) in H. contortus. A second amine-gated chloride channel gene called Hco-lgc-55 was also isolated. Electrophysiology of this subunit revealed that this channel was gated mainly by tyramine (TA) [EC50 5.8 ± 1.0 μM (n=5)] and a lesser extent by dopamine (DA) and octopamine (OA). Semi-quantitative reverse transcription polymerase chain reaction (SqRT-PCR) showed the presence of mRNA for Hco-lgc-55 in all the life-cycle stages of the parasite. A detailed examination of the localization and characterization of dopamine (DA) and serotonin [5-hydroxy tryptamine (5-HT)], two key neurotransmitters that have been shown to be ligands for LGCCs, was also performed. 5-HT was found mainly in the amphidial and pharyngeal neurons in both sexes; in males, neurons located in the bursa as well as in a few cell bodies of the ventral cord possessed 5-HT. DA was detected in the neuronal commissures restricted to the mid body region on the lateral sides, in both the sexes. Furthermore, an experiment where female adult worms were exposed to exogenously III supplied DA, 5-HT or TA revealed that each molecule had an effect on worm movement. However, the most profound effect was seen in the case of DA, which paralyzed the mid body of the worm. These studies provide novel information on unique LGICs and the role of novel LGIC ligands in an important parasitic nematode.

Abrégé Les canaux chlorures ligand-dépendants (CCLDs) sont la composante clef du système d’inhibition de la neurotransmission chez les animaux. Les nématodes possèdent des CCLDs qui sont activés par des ligands uniques tels que le glutamate, la sérotonine et l’acétylcholine. Les mammifères ne possèdent pas ce type de récepteurs. Il est possible d’émettre l’hypothèse que le phylum des nématodes a un système d’inhibition de la neurotransmission divergent. Basé sur cette caractéristique, le projet a pour objectif de mieux comprendre le système nerveux inhibiteur chez le nématode parasite, Haemonchus contortus, en caractérisant de nouvelles sous-unités de CCLD, et en localisant des ligands valables, connus pour fonctionner comme neurotransmetteur inhibiteur. La première nouvelle sous-unité du gène de CCLD à avoir été isolée, a été appelé Hco-GGR-3 (précédemment nommé HcGGR3). Les analyses électrophysiologiques de cette sous- unité, réalisées dans les ovocytes de Xenopus laevis, ont permis d’identifier un assemblage homomérique de ce canal qui est majoritairement dépendant de la dopamine (DA). L’immunocoloration de vers adultes d’H. contortus, faite à partir d’anticorps spécifiques à un peptide exclusif à Hco-GGR3, a permis de montrer que cette sous-unité était localisée au niveau des ports des deirids (papille cervicale) et des cellules de gaines. Il a été aussi observé qu’il y avait une différence de localisation de cette sous-unité en fonction du genre des vers. De plus, un polymorphisme mononucléotidique au niveau de la région 3’ non transduite (UTR) de Hco-ggr3 s’est avéré être associé à une sélection pour la résistance aux lactones macrocycliques (LM) - la moxidectine (MOF) et l’ivermectine (IVM) - chez H. contortus. Un second gène d’un canal chlorure dépendant d’un acide aminé appelé Hco-lgc-55 a aussi été isolé. L’électrophysiologie de cette sous-unité a permis de montrer que ce canal était majoritairement dépendant de la tyramine (TA) [EC50 5.8 ± 1.0 μM (n=5)], mais aussi un peu dépendant de la dopamine (DA) et de l’octopamine (OA). La présence d’ARNm de Hco-lgc-55 a été observée dans tous les stades du cycle biologique du parasite grâce à une transcription inverse semi-quantitative de la réaction en chaîne de la polymérase (SqRT-PCR). Un examen détaillé sur la localisation et sur la caractérisation de la dopamine (DA) et de la sérotonine [5-hydroxy tryptamine (5-HT)], qui sont deux neurotransmetteurs important connus comme étant des V ligands des CCLDs, a été effectué. La 5-HT a été plus particulièrement observée dans les neurones pharyngés et amphidiales chez les deux sexes. La 5-HT a aussi été observée chez les mâles au niveau de neurones localisés dans la bourse et dans quelques cellules du cordon ventral. La DA a été détectée dans les commissures neuronales au niveau du milieu du corps sur les cotés latéraux chez les deux sexes. De plus, l’exposition exogène des vers femelles à de la DA, 5-HT et TA a montré que chaque molécule avait un effet sur la mobilité des vers. Cependant, l’effet le plus important a été observé avec la DA qui avait pour effet de paralyser la partie centrale du corps du vers. Ces études fournissent de l’information nouvelle sur ces CCLDs uniques et sur le rôle des ligands sur ces nouveaux CCLDs chez un important nématode parasite.

Acknowledgements

I would like to thank my supervisors Drs. Sean Forrester and Roger Prichard for providing me the opportunity to perform research in their labs. I am grateful to both of them for their mentorship and financial support for this study. Each one of my advisory committee member has helped me immensely in my project. Dr. Robin Beech has guided me all through my studies. He has helped me with the scanning of H. contortus genome in the search for novel genes. I thank him for all the innumerable number of discussions we had on many aspects of my research. It was Dr. Joseph Dent who introduced me to two electrode voltage clamp electrophysiology in his lab. I have learnt many things from Dr. Dent. He will always remain a truly inspirational teacher to me. Dr. Timothy Geary has not only been an advisor, he has been very kind in guiding me through all kinds of problems that I faced during my Ph. D. I thank him for just being there for me every time I was in trouble. I am very grateful to Ms. Kathy Keller for all her help, support and advice. I shall always remember Kathy as someone who values humanism. I have always had many things to learn, each time I have interacted with her. I wish to thank all the faculty members of the Institute. Thanks to Dr. Paula Ribeiro for all the valuable guidance and to Dr. Reza Salavati for providing me the RACE anchor primer which was very useful in my project. I wish to thank Mr. Jamie Sánchez-Dardón, Dr. Florence Dzierzinski and Mr. Dernovici for their help in confocal microscopy. Special thanks to Dr. Manami Nishi who taught me many things about microscopy. I am very grateful to Dr. Catherine Bouguinat for translating the abstract of my thesis in to French. Thanks to Dr. Jeffrey Eng and Dr. Maria de Lourdes Mottier for their help and friendship. I wish to thank all the present and past members of both Dr. Prichard’s and Dr. Forrester’s labs. I would like to thank Gordie and Shirley for their help. Finally I would like to thank my wife, Indu and all members of my family. Without their support, it would have been difficult for me to undertake this course.

VII

Contribution of authors

The design and execution of experiments were carried out by the author with supervision from Drs. Sean Forrester and Roger Prichard. Both supervisors have provided the laboratory space, financial support and resources to conduct these experiments. Chapter II (manuscript I) is co-authored by Ms. Salma Siddiqui who performed the electrophysiological analysis. Chapter III (manuscript II) is co-authored by Ms. Salma Siddiqui and Mr. Michael Accardi who shared the electrophysiology work with me; Dr. Robin Beech performed the phylogenetic analysis. Chapter IV (manuscript III) is co- authored by Ms. Kathy Keller. She performed the culturing of H. contortus worms in sheep. Appendix 3 - manuscript was written by Ms. Salma Siddiqui with editorial contributions from the author. This thesis (inclusive of all chapters) was written by the author with editorial contributions from both Drs. Sean Forrester and Roger Prichard.

VIII

Statement of originality

To the best of the authors’ knowledge all material in this thesis are original contributions to the field.

Manuscript I…. Rao VTS, Siddiqui SZ, Prichard RK, Forrester SG (2009) A dopamine- gated ion channel (HcGGR3*) from Haemonchus contortus is expressed in the cervical papillae and is associated with macrocyclic lactone resistance. Mol and Biochem Parasitol 166: 54-61. This manuscript describes the characterization of the first dopamine-gated chloride channel subunit from any organism (Hco-GGR-3), which was isolated from the parasitic nematode, H. contortus. This article highlights the possibility of involvement of this subunit in mechanosensation, suggesting a novel role for a ligand-gated chloride channel in this parasite. The ortholog of this subunit is yet to be characterized in C. elegans.

Manuscript II…. Rao VTS, Accardi MV, Siddiqui SZ, Beech R, Prichard RK, Forrester SG (2010) Characterization of a novel tyramine-gated chloride channel from Haemonchus contortus. Mol and Biochem Parasitol 173: 64-68. This manuscript describes the isolation and characterization of a tyramine-gated chloride channel (Hco-LGC-55) from H. contortus, which previously has not been described in any parasitic nematode. In addition, this paper is the first report of effect of exogenous tyramine on adult parasitic worms. Finally, this paper provides the preliminary evidence for the existence of fast tyraminergic inhibitory neurotransmission in this parasite.

Manuscript III…. Rao VTS, Forrester SG, Kathy Keller, Prichard RK (2010) Localization of serotonin and dopamine in Haemonchus contortus (Accepted in International Journal for Parasitology; doi: 10.1016/j.ijpara.2010.09.002). This manuscript describes the immunolocalization of both serotonin and dopamine in the adult worms of H. contortus. This article depicts some of the most detailed images of amphidial and pharyngeal neurons of this parasite, to date. This is the first description of such neurons in the adult stages of the parasite.

Table of contents

Title I Abstract II Abrégé IV Acknowledgements VI Contribution of authors VII Statements of originality VIII Table of contents IX List of figures XIII Table XV List of abbreviations XVI

Chapter I – Introduction and Literature Review 1 Introduction 1

Literature Review 3 1.0 Haemonchus contortus 4 2.0 General Nematode Neuroanatomy 5 2.1 Nervous system of H. contortus 5 3.0 The nematode nervous system as a target for nematicides 6 4.0 Ligand-gated ion channel (LGIC) super families 7 5.0 The cys-loop ligand-gated ion channels 7 5.1 Architecture of LGICs 8 5.2 Channel pore and gating 9 5.3 M2 domain and ion selectivity 9 5.4 Subunit composition 10 6.0 Did diversity of cys-loop receptors diminish in higher organisms - during evolution? 11 7.0 LGIC diversity in nematodes 12 7.1 GABA and GABA-gated ion channels (GGIC) in nematodes 12 7.2 Glycine-gated ion channels (GlyGICs) 13 7.3 Glutamate and Glutamate-gated ion channels (GluICs) 13 7.4 Acetylcholine (ACh) and ACh-gated ion channels 14 7.5 Biogenic amines and amine-gated ion channels 15 7.5a Biogenic amine neurotransmitters 15 7.5b Dopaminergic and serotonergic neurons in C. elegans 15 7.5.1 5-HT and 5-HT-gated ion channels 16 7.5.2 Dopamine (DA) and tyramine (TA)-gated ion channels 16 8.0 The function of LGICs in H. contortus 17 9.0 LGICs and resistance to MLs in nematodes 18 References 20

Chapter II – Hco-GGR-3, a dopamine-gated ion channel 32 Abstract 33

1.0 Introduction 34 2.0 Materials and methods 35 2.1 Cloning and sequencing of HcGGR3 35 2.2 Examination of HcGGR3 in ML selected strains 36 2.3 Life-stage transcription levels of HcGGR3 37 2.4 Immunolocalization of HcGGR3 in adult worms 38 2.5 Expression of HcGGR3 in Xenopus laevis oocytes 38 2.6 Electrophysiology recordings 39 3.0 Results 40 3.1 Cloning of HcGGR3 40 3.2 Examination of HcGGR3 in ML selected strains of H. contortus 42 3.3 HcGGR3 expression levels in different life-stages of H. contortus 44 3.4 Immunolocalization of HcGGR3 44 3.5 Pharmacological characterization of HcGGR3 channel 46 4.0 Discussion 47 Acknowledgements 50 References 51

Connecting Statement I 55

Chapter III – Hco-LGC-55, a tyramine-gated chloride channel 56 Abstract 57

1.0 Introduction 58 2.0 Materials and methods 59 2.1 Cloning and sequencing of Hco-lgc-55 59 2.2 Phylogenetic analysis 60 2.3 Semi-quantitative reverse transcriptase-polymerase chain reaction - (sqRT-PCR) of Hco-lgc-55 in various life-cycle stages of H. contortus 60 2.4 Expression of Hco-lgc-55 in Xenopus laevis oocytes 60 2.5 Electrophysiological recordings 61 3.0 Results 62 3.1 Cloning of Hco-lgc-55 62 3.2 Gene identification 62 3.3 Hco-lgc-55 expression in different stages of H. contortus 64 3.4 Pharmacological characterization of Hco-LGC-55 64 4.0 Discussion 66 Acknowledgements 68 XI

References 69 Supplementary data information 72

Connecting Statement II 73

Chapter IV – Serotonin and dopamine localization 74 Abstract 75

1.0 Introduction 76 2.0 Materials and methods 77 2.1 Immunolocalization of serotonin and dopamine 77 2.1.1 Nematodes and fixation 77 2.1.2 Primary antibody incubation 77 2.1.3 Secondary antibody incubation 78 2.2 Effect of exogenously supplied serotonin and dopamine on - H. contortus female worms 78 3.0 Results 79 3.1 Immunolocalization 79 3.1.1 Immunolocalization of serotonin 79 3.1.2 Immunolocalization of dopamine 83 3.2 Effect of exogenously supplied neurotransmitters on adult worms 85 3.2.1 Effect of dopamine 85 3.2.2 Effect of serotonin 85 4.0 Discussion 86 Acknowledgements 89 References 89 Supplemental images 94

Chapter V – General discussion 100 References 104

Appendix 1. Clozapine is a weak inhibitor of Hco-LGC-55 105

2. Cloning full length cDNA of Hco-lgc-53 106

3. Manuscript IV: An UNC-49 GABA receptor subunit from the parasitic - nematode Haemonchus contortus is associated with enhanced GABA - sensitivity in nematode heteromeric channels 107 Abstract 108 1.0 Introduction 109

2.0 Experimental procedures 110 XII

2.1 Cloning and sequencing of Hco-unc-49B and Hco-unc-49C 110 2.2 Isolation of Hco-unc-49C 111 2.3 Isolation of Hco-unc-49B 111 2.4 Sequence analysis 112 2.5 Expression of UNC-49B and UNC49C in X. laevis oocytes 112 2.6 Electrophysiological recordings 113 3.0 Results 114 3.1 Cloning of Hco-UNC-49 genes 114 3.2 Pharmacological characterization of Hco-UNC-49B and C 116 3.3 The Hco-UNC-49B/C channel has a higher sensitivity to muscimol - compared to the Hco-UNC-49B channel 118 3.4 The Hco-UNC-49B subunit is associated with increased GABA - sensitivity in nematode heteromeric channels 119 4.0 Discussion 121 Acknowledgements 124 References 125

XIII

List of figures

Chapter I Fig. 1-1: Cartoon representation of a LGIC subunit 8

Chapter II Fig. 2-1: HcGGR3 protein sequence information and phylogenetic analysis 41

Fig. 2-2: HcGGR3 genotyping results and HcGGR3 expression levels in the ML selected strains of H. contortus 43

Fig. 2-3: HcGGR3 immunolocalization results 45

Fig. 2-4: Results of pharmacological characterization of HcGGR3 channel 46

Chapter III Fig. 3-1: Hco-LGC-55 protein sequence information and phylogenetic analysis 63

Fig. 3-2: Expression levels of Hco-lgc-55 in different life-stages - of H. contortus 64

Fig. 3-3: Results of electrophysiology analysis of Hco-LGC-55 65

Chapter IV Fig. 4-1: Immunolocalization of serotonin in H. contortus female worms 81

Fig. 4-2: Immunolocalization of serotonin in H. contortus male worms 82

Fig. 4-3: Immunolocalization of dopamine in H. contortus male and female worms 84

Supplemental Images Supplementary Fig. 4-S1: Serotonin localization and serotonin-phase - contrast merge images of the same H. contortus worm 94

Supplementary Fig. 4-S2: Serotonin localization in the anterior region of a H. contortus female worm 95

Supplementary Fig. 4-S3: Serotonin-phase contrast merge image of the - anterior region of a H. contortus female worm 96

Supplementary Fig. 4-S4: Schematic diagram of serotonin localization - in the anterior region, common for H. contortus male and female worms 97

XIV

Supplementary Fig. 4-S5: Serotonin localization in the bursal region - of a H. contortus male worm; another image showing DAPI-serotonin - co-staining in the ventral cord cell bodies 98

Supplementary Fig. 4-S6: Images of negative control worms 99

Appendix Appendix 1 Figs. A and B: Clozapine inhibition of Hco-LGC-55 105

Appendix 3 Fig. 1: Protein sequence alignment of H. contortus and - C. elegans UNC-49B and C 115

Appendix 3 Fig. 2: Hco-UNC-49 channel response to GABA 117

Appendix 3 Fig. 3: GABA dose response for homomeric and heteromeric - channels of Hco-UNC-49 and current voltage relationship 117

Appendix 3 Fig. 4: Hco-UNC-49B/C is more resistant to the inhibiting - effects of picrotoxin compared to Hco-UNC-49B 118

Appendix 3 Fig. 5: Muscimol activates the Hco-UNC-49 channels 120

Appendix 3 Fig. 6: Hco-UNC-49 and Cel-UNC-49 cross-assembled - heteromeric channels have differing GABA sensitivities 121

Table

Appendix 3 Table 1: Comparison of EC50 and Hill coefficient values for H. contortus and C. elegans UNC-49 homomeric, heteromeric and cross assembled heteromeric channels 119

XVI

Abbreviations

5-HT, serotonin; 5-hydroxytryptamine ACC, acetylchline-gated chloride channel ACh, acetylcholine cDNA, copy deoxyribonucleic acid cRNA, copy ribonucleic acid DA, dopamine DAPI, 4',6-diamidino-2-phenylindole GABA, γ-aminobutyric acid GluCl, glutamate-gated chloride channel IVF23, Laboratory strain of H. contortus selected by treating PF 23 strain with ivermectin IVM, ivermectin LGCC, ligand-gated chloride channel LGIC, ligand-gated ion channel MOF23, Laboratory strain of H. contortus selected by treating PF 23 with moxidectin mRNA, messenger ribonucleic acid nAChR, nicotinic acetylcholine receptor OA, octopamine PCR, polymerase chain reaction PF23, Laboratory strain of H. contortus which is sensitive to ivermectin and moxidectin qPCR, quantitative PCR RACE, rapid amplification of cDNA ends RPMI, Roswell Park Memorial Institute medium SNP, single nucleotide polymorphism sqRT-PCR, semi-quantitative reverse transcriptase PCR TA, tyramine UTR, untranslated region 1

Chapter I

Introduction Receptors present in the neuro-musculature of nematodes have long been attractive as drug targets. Ligand-gated ion channels (LGICs) superfamily has a major subset called cys-loop receptors which, in the free-living nematode C. elegans, include about 90 individual subunits. Nematodes have ligand-gated chloride channel (LGCC) subunits which are gated by unique ligands such as glutamate, 5-hydroxy tryptamine (5-HT) and acetylcholine (ACh) which so far have only been found in invertebrates. Glutamate-gated chloride channels (GluCls) have been previously characterized as a major target of the most widely employed anthelmintic – ivermectin (Cully et al., 1994; Dent, 1997; Forrester et al., 2002). A single 5-HT-gated chloride channel subunit (MOD-1) was identified in C. elegans where it appears to control locomotion (Ranganathan et al., 2000). There are also two ACh-gated chloride channel subunits Cel-ACC-1 and Cel-ACC-2, reported in C. elegans (Putrenko et al., 2005), that are part of the same clade as MOD-1 (Dent, 2006). Interestingly all three of the molecules for the above mentioned LGCCs have traditionally been thought to only act on excitatory LGICs in vertebrate organisms. The unveiling of these novel and likely primitive subset of inhibitory receptors for these traditionally excitatory molecules suggest that nematodes exhibit unique proteins that may be attractive as drug targets. In addition, research that examines this diverse array of LGCC subunits will provide further information on their role in the biology of nematodes. The following research began at a time when data pertaining to the genome of H. contortus was becoming available. At this time, research on the potential diversity of LGCCs in this parasite was limited. Therefore we used this newly available genome data to search for unique LGCCs. The rational in the formative stages of the project was to characterize novel chloride channels in H. contortus for which there was very little or no information available about their C. elegans homologs. Based on this criterion, three full- length (Hco-ggr-3, Hco-lgc-55 and Hco-lgc-53) and one partial (Hco-lgc-51) copy-DNA (cDNA) were cloned. These four cDNAs appeared to encode subunits that were members of the clade that includes MOD-1 and the ACC subunits. The next step in this research 2 was to de-orphanize these novel LGCC subunits and to understand their role in nematode biology. Of the three full-length cDNAs that were cloned only two showed heterologous expression in X. laevis oocytes. Chapter II describes the characterization of Hco-GGR-3 which is a dopamine (DA)-gated chloride channel. This channel is plausibly important for mechanosensation as it is expressed around deirids or cervical papillae. Chapter III describes the functional characterization of a second novel LGCC subunit, Hco-LGC-55 which is a TA-gated chloride channel. In addition to describing two new LGCCs from H. contortus, this project has also provided novel information on the function of two neurotransmitters. Chapter IV describes the localization of neurotransmitters- DA and 5- HT in the nervous system of H. contortus and the effect of exogenously supplied DA and 5-HT on adult worms. Therefore, as a whole, this thesis successfully demonstrates the importance of two new novel LGCC subunits in H. contortus and also provides novel insight into serotonergic and dopaminergic components of the nervous system in this important veterinary parasite.

Literature review

1.0 Haemonchus contortus H. contortus is an important gastrointestinal nematode which decreases productivity and increases disease control costs, for the production of small ruminants, in many parts of the world including temperate regions such as Canada (Mederos et al., 2010). Small subunit ribosomal DNA sequences have been used to design a resolute taxonomy for the phylum Nematoda, which places H. contortus in clade V as part of Strongylida. This clade includes the hookworms as well as the Rhabditoidea, including C. elegans (Blaxter et al., 1998). H. contortus is visible to the human eye, with female worms measuring about 2 -3 cms and male worms being shorter and more slender. Since these worms feed on blood they generally have a reddish appearance. The common name, "barber pole" worm is derived from the appearance of the white ovaries that wind around the blood filled intestine of female worms – which resembles a "barber pole". The fine anatomy of this parasite has been fairly well explored. However, the only detailed holistic description of this parasite dates back to 1915 (Veglia, 1915). This parasite has a simple and direct life cycle. Adults mate and reproduce in the abomasum of the host animal. A single female can lay thousands of eggs in a few days. The eggs pass out, with the host feces, on to pasture. The eggs hatch which gives rise to the first stage larvae (L1). These L1 larvae feed on bacteria and molt into the L2 stage and subsequently into the infective L3 stage. This whole process under optimal conditions happens in about a week. The L3 stage is incapable of feeding. These larvae enter the host animal as part of their feed. The ingested larvae enter the abomasum and develop into L4 stage. Early L4 larvae can arrest development in the host as has been reported in the case of the closely related nematode, Ostertagia ostertagi (Armour and Duncan,1987). In many parts of England, significant numbers of arrested H. contortus larvae have been reported to be present in sheep in the month of August indicating hypobiosis (Soulsby, 1982). This diapause is induced by the onset of winter, but eventually they will develop into adults in the spring (Urquhart et al., 1987). These worms possess a buccal lancet in their mouth which helps them pierce through blood vessels in the abomasal wall (Weise, 1977). This is a blood sucking parasite and in large numbers can cause severe anemia and eventually death of the host. 5

Total body length, vulvar morphology, spicule length and cervical papillae (deirids) have always been considered as markers of physical adaptation. In this context one of the studies has revealed that there were more ridges in H. contortus from goats compared to those from sheep. Interestingly, deirids were seen as slightly longer in parasites from sheep as compared to those of goats (Rahman and Abd Hamid, 2007).

2.0 General Nematode Neuroanatomy The overall architecture of nervous system in Nematoda is simple. The nerve ring or the neuropile, which surrounds the pharynx, is the network of neuronal processes (axonal and dendritic) together without the cell bodies of the neurons. This structure is comparable to the gray matter of the brain and spinal cord present in mammals. The cylindrical shaped worms possess multiple nerve cords present along the length of the body. A nerve cord is an organized bundle of nerve processes. The two major nerve cords are dorsal and ventral. In addition, there are two lateral cords (right and left) and four sub-lateral cords (right and left sub-dorsal and sub-ventral). The nerve cords are interconnected via commissures. In higher animals a commissure always consists of many processes traveling in parallel to reach a shared destination. However, in nematodes, a commissure can consist of a single neuronal process. Such commissural axons always travel in direct contact with a thin coating of the hypodermis, and most run circumferentially along the outer body wall. In addition, both the anterior (amphids) and posterior (tail / bursa) ends are innervated with many neurons which are important for sensory as well as locomotory functions (Veglia, 1915; Skinner et al., 1998; WormAtlas: Altun et al., 2002-2010; Portillo et al., 2003)

2.1 Nervous system of H. contortus Information on the neuroanatomy of H. contortus is limited. However, there is ample description of amphidial and pharyngeal neurons of this parasite. In one particular study (Li et al., 2000a), first stage larvae were used in differential interference contrast (DIC) microscopy and electron microscopy to examine the neurons in the head region. Twelve amphidial neurons were subsequently identified in this study. A similar study was carried out in the infective L3 larval stage. This study revealed no changes in the number of amphidial neurons between the stages, but some differences in the pattern of a few 6 sensory cilia were found. For example, the two cilia of neuron ADB were shown to occupy different positions in L3, unlike L1, and the tip of neuron ASA were shown to terminate more posteriorly in the L3 than in the L1 (Li et al., 2001). In another study, cell bodies of the amphidial neurons were ablated from the L1 stage and further cultured to the L3 stage to study the importance of these neurons in thermosensory control. This study showed that amphidial neurons AFD, and interneurons RIA, were the thermoreceptor and thermosensory integrative neurons. Interestingly this study also provided evidence that the driving factor for the thermal preference of L3 larvae was in fact conditioned upon the animal's previous thermal experience (Li et al., 2000b). There are other studies where antibodies specific to either a neurotransmitter or a neurotransmitter receptor have been used to immunolocalize components of neuromusculature of this parasite. These studies detected the presence of these components in the nerve ring, amphids and pharynx, as well as motor neuron commissures (Delany et al., 1998; Skinner et al., 1998; Portillo et al., 2003). The only neurotransmitter that has been localized in H. contortus is γ-aminobutyric acid (GABA) which was found in motor neuronal commissures.

3.0 The nematode nervous system as a target for nematicides Many drugs that are currently employed in the control of nematode infections target receptors in the neuro-musculature tissue. The most widely used class of drugs, the MLs, are known to bind to cys-loop receptors glutamate-gated chloride channel (GluCls). MLs are widely used for the control of infections such as Onchocerca volvulus in mass drug administration programmes (Osei-Atweneboana et al., 2007). MLs are also employed in combating veterinary nematode infections including that of H. contortus (Gasbarre et al., 2009). In addition, levamisole has been shown to bind nicotinic ACh receptor (nAChr) (Boulin et al., 2008). Piperazine is a γ-amino-butyric acid (GABA) agonist at receptors on nematode muscles and causes flaccid paralysis (Martin, 1997). The putative target for the recently developed novel drug amino-acetonitrile derivative, monepantel, has been shown to be acetylcholine (ACh) receptors (Rufener et al., 2009). Hence it is clear that many of the current antiparasitic drugs target ligand-gated ion channels in parasites.

4.0 Ligand-gated ion channel (LGIC) super families The LGICs activated by extracellular ligands may be divided into four super families: the Cys-loop superfamily, the glutamate receptors [NMDA (N-methyl-D-aspartate), AMPA (α-amino-3-hydroxy-5-methyl-4-isoxazolepropionic acid) and kainate], the TRP (transient receptor potential) channels and the ATP-gated channels (Connolly and Wafford, 2004). The focus of this review is the cys-loop ligand-gated ion channels.

5.0 The cys-loop ligand-gated ion channels LGICs are hetero-pentameric membrane proteins whose main function is the conversion of chemical messages into electric signals mainly in neuron and muscle cells (Grutter et al., 2005). Since these receptors function by conducting the flow of ions, ion selectivity is the major criterion that divides these channels into two broad categories of cation and anion conducting channels. In vertebrates, cation channels (excitatory) are chiefly gated by ACh, 5-HT and glutamate (Glu), while anion channels (inhibitory) by GABA and glycine (Gly) (Unwin, 1993a). These receptors possess a highly conserved loop between two cysteine residues in the ligand binding domain (LBD) and hence are also called cys- loop receptors [see Fig. 1-1] (Schofield et al., 1987; Cockcroft et al., 1990). There exists a subfamily of presumably only anionic receptors that are characterized by a second cys- loop typically occurring about 45 residues downstream from the signature cys-loop in the LBD and are referred to here as 2-cys-loop receptors (Kehoe et al., 2009). The origin of LGICs dates back 2500 million years, which was before the first eukaryotes (Ortells and Lunt, 1995). Interestingly LGIC receptors are present in all kinds of life forms starting from bacteria (Corringer et al., 2007) to nematodes (Dent, 2006) to humans (Osta et al., 2010). These receptors are widely distributed in phylogenetic terms and there exists great variability in the composition of the subunits that make up the pentameric receptor complexes. Bacterial LGIC homologs lack cys-loops, so it is believed that the cys-loop receptors could have evolved from these bacterial proteins (Tasneem et al., 2004; Dent, 2006; Corringer et al., 2007).

Fig. 1-1. Cartoon representation of a single cys-loop LGIC subunit depicting the N- terminal ligand binding domain (LBD) and the four transmembrane domains (M1, M2, M3 and M4). 5.1 Architecture of LGICs Each LGIC subunit consists of an N-terminal LBD, which is the longest extra cellular region, four transmembrane domains (TMD) – M1, M2, M3 and M4. There is a long intracellular loop between M3 and M4 [see Fig. 1-1] (Grenningloh et al., 1987; Schofield et al., 1987; Betz, 1990). The subunits are predicted to have a similar topology wherein five subunits assemble to form a functional channel (Brisson and Unwin, 1985; Langosch et al., 1988). The most intensively studied muscle nicotinic ACh receptor (nAChr) is comprised of α2βγδ subunits (Zouridakis et al., 2009). The nomenclature of the α-subunit was assigned based on the presence of adjacent cysteine residues in the region homologous to the ligand binding region in muscle nAChr (Boulter et al., 1986). The 9 agonist binds at the interface between an α-subunit and either another α- or a non-α- subunit (Chiara and Cohen, 1997; Brejc et al., 2001). Two or three ACh molecules need to bind for maximal activation (Karlin, 2002; Rayes et al., 2009). The overall architectural template for these receptor complexes in bacteria are comparable to those belonging to higher metazoans (Corringer et al., 2010).

5.2 Channel pore and gating To date, there are no published structures of any anion selective LGIC. Most of the data pertaining to the ultra structure of the channel pore has come from cryo-electron microscopy studies of the nAChR from the electric organ of Torpedo marmorata (Unwin, 2005) and crystallographic studies on the ACh-binding protein (AChBP) from the snail, Lymnaea stagnalis (Brejc et al., 2001). In addition, the structures of AChBP from the molloscs, Bulinus truncates and Aplysia californica, which have been co-crystallized with agonists and antagonists (Celie 2005; Hansen et al., 2005), have contributed immensely to understanding the fine secondary structure of these receptors. Among the four TMDs (M1–M4) it is the second, the M2 region, from each subunit that contributes to the formation of the centrally located channel pore. The N-terminal LBD of each subunit with β-strands are understood to be arranged in a β-sandwich with the ligand binding pocket occurring at the interface of adjacent subunits. Many loops that link the β-strands interface with the TMD are thought to play an important role in transduction of the ligand binding event to cause channel opening (Lester et al., 2004). It is interesting to note that the recently solved crystal structure of cation channels from the prokaryotes, Erwinia chrysanthemi and Gloeobacter violaceus exhibit different pore structures between them, in an open conformation (Hilf and Dutzler, 2008; Bocquet et al., 2009; Hilf and Dutzler, 2009).

5.3 M2 domain and ion selectivity The second TMD has always been considered important as a ‘lining’ of the ion channel as well as a contributor to the formation of the pore (Ortells and Lunt, 1995). An important breakthrough came in a study in which a negatively charged glutamate was substituted by alanine (at position 237 of nAChR) and a proline residue was added (in 10 between positions 236 and 237) at the N-terminal end in the second TMD, which converted the channel from a cation conducting one to that of an anion channel. In addition, a threonine residue at position 251 was also found to be critical in terms of ion selectivity (Galzi et al., 1992). The effect of proline insertion and its impact on ion selectivity has been further corroborated by other studies (Corringer et al., 1999). The importance of this domain has also been established in other receptors such as those gated by glycine (Keramidas et al., 2000), 5-HT (Gunthorpe and Lummis, 2001) and GABA (Jensen et al., 2005). In addition, modeling studies have also confirmed the important role of TMDs to the overall function and ion selectivity of LGICs (Song and Corry 2009; 2010). However, the extracellular LBD may also play a key role in ion selectivity (Peters et al., 2010).

5.4 Subunit composition Aside from the nAChR and GABA-gated chloride channels, the native subunit compositions of most LGICs remain to be discovered. The subunits that make up the pentameric receptor complex dictate the functional properties of nAChRs which are mainly affected by the number of α-subunits present in any assembly. Pertaining to vertebrate muscle nAChRs, α-, β-, δ-, γ- and ε-subunits are known to contribute to combinations such as α 2βδγ or α 2βδε and vary in different developmental stages (Mishina et al., 1986). However, in C. elegans, three α-subunits: Cel-UNC-38, Cel-UNC-63, Cel- LEV-8, two non α-subunits: Cel-LEV-1, Cel-UNC-29 and other essential assembling factors such as RIC-3, UNC-50 and UNC-74 have been shown to be required for the reconstitution of the C. elegans levamisole-sensitive ACh-receptor (Boulin et al., 2008). ACh-anion receptors have also been discovered in C. elegans and subunit composition appears to play a role in channel function. Specifically, the interaction of ACC-1 with ACC-3 has been demonstrated to produce a channel which has lower affinity to ACh as compared to the homomeric assembly of ACC-1 (Putrenko et al., 2005). However, the composition of the native ACh-gated chloride channel is still not known.

LGCCs which are gated by GABA are referred to as GABAA- receptors. In humans, there are nineteen genes for GABAA-R subunits (Simon et al., 2004). These include 16 11 subunits (α1–6, β1–3, γ1–3, δ, ε, θ, π) that can assemble in different combinations to form

GABAA receptors, and three rho (ρ) subunits, that are part of complexes which are sometimes referred to as GABAC receptors. The receptor subunit combination that is the most abundant in the vertebrate brain is α1β2γ2 (Pirker et al., 2000). In C. elegans, a Cel- UNC-49B GABA receptor subunit is able to form a functional homomeric channel and can assemble with Cel-UNC-49C to form a functional heteromeric channel that exhibits a reduced sensitivity to GABA (Bamber et al., 1999). However in similar studies in H. contortus, the heteromeric channel (Hco-UNC-49B/C) was found to have a higher sensitivity to GABA than did the homomeric channel (Hco-UNC-49B) (Siddiqui et al., 2010). Although all α subunits assemble efficiently into homomeric glycine receptors in recombinant expression systems, there is scant evidence to date for the existence of homomeric α1, α3 and α4 GlyRs in adult vertebrates in vivo. A wide variety of evidence suggests that heteromeric α1β glycine receptors mediate the majority of glycinergic neurotransmission in adult vertebrates (Lynch 2009). Recombinant co-expression of 5-HT(3A) and 5-HT(3B) subunits produced a functional heteromeric 5-HT(3A/3B) receptor with pharmacological and electrophysiological properties different from those displayed by the 5-HT(3A) homomeric receptor and in the rat these two subunits have been found to be co-expressed in neurons of the dorsal root ganglion (Morales et al., 2001).

6.0 Did diversity of cys-loop receptors diminish in higher organisms during evolution? Possibilities of a reduction in cys-loop receptor diversity in chordates cannot be ruled out as there seems to be some evidence supporting this. However the overall pattern suggests both a reduction and expansion of LGIC families after ecdysozoa split from chordates. This split preceded the subsequent loss of many subunit types from the chordate lineage that are currently found only in invertebrates. All of the invertebrate- specific lineages might have expanded by at least one duplication event (Dent, 2006). This clearly relates to the fact that nematodes possessed diverse LGIC types. This is vindicated in the discovery of unique LGCCs such as GluCls (Cully et al., 1994), ACCs (Putrenko et 12 al., 2005) and 5-HT-gated chloride channels (Ranganathan et al., 2000; Ringstad et al., 2009) as well as GABA-gated cation selective channels (Beg and Jorgensen, 2003) in nematodes.

7.0 LGIC diversity in nematodes

7.1 GABA and GABA-gated ion channels (GGIC) in nematodes

GABA is synthesized from glutamate using the enzyme L-glutamic acid decarboxylase. GABA is a major inhibitory neurotransmitter in both vertebrates and invertebrates. In H. contortus, a putative GGIC was initially characterized as one that evoked small responses to glycine and not GABA (Laughton et al., 1994). In a later study two cDNAs encoding Hco-HG-1A (previously called HG-1A) and Hco-HG-1E (previously called HG1E) were isolated and each of these two subunits was co-expressed with another subunit from C. elegans named Cel-GAB-1 (previously called GAB-1). Co- expression resulted in heteromeric channels which were responsive to GABA (Feng et al., 2002). Hco-HG-1 has been shown to be expressed in the ventral nerve cord and in a few neurons associated with the nerve ring around the pharynx (Skinner et al., 1998). The UNC-49 locus in H. contortus has been shown to encode two subunits, Hco-UNC49B and C, which form a GABA-gated chloride channel. Hco-UNC-49B was shown to form a homomeric channel that was responsive to GABA whereas Hco-UNC-49C alone was not responsive to GABA. The two subunits together formed heteromeric channels with a higher sensitivity to GABA compared to that of Hco-UNC-49B homomeric channels. Co- expressing Cel-UNC-49B with Hco-UNC-49C produced a heteromeric channel with a reduced sensitivity to GABA as compared to that of the Cel-UNC-49B homomeric channel. Co-expression of Hco-UNC-49B with Cel-UNC-49C produced a heteromeric channel that, like the Hco-UNC-49B/C heteromeric channel, exhibited an increased sensitivity to GABA. These results suggested that the Hco-UNC-49B subunit was the key determinant for the high agonist sensitivity of heteromeric channels (Siddiqui et al., 2010). In C. elegans, UNC49 subunits are expressed at neuromuscular junctions and play important roles in locomotion (Bamber et al., 1999). Finally, a cation selective GABA receptor called Cel-EXP-1 has been characterized where it mediates enteric muscle 13 contraction in C. elegans (Beg and Jorgensen, 2003). Thus, GABA clearly plays a role in both inhibitory as well excitatory neurotransmission in nematodes and appears to be a major player involved in the control of locomotion (Eisenmann, 2005) GABA neurotransmission has been demonstrated in the parasitic nematodes Ascaris suum (Martin, 1980; Martin, 1985; Guastella et al., 1991; Martin et al., 1991), H. contortus (Laughton et al., 1994; Portillo et al., 2003) and Trichinella spiralis (Ros- Moreno et al., 1999). Genomes of Brugia malayi and Trichinella spiralis also appear to encode GGICs. There are indications that these two organisms also possess UNC-49 homologs and that of GAB-1 appears to be missing (Williamson, 2007). Thus, it appears that the components that form the nematode GABA nervous system are not completely conserved in this phylum.

7.2 Glycine-gated ion channels (GlyGICs) To date there are no reports of LGICs that evoke significant response to glycine in nematodes. As mentioned earlier Hco-HG-1 remains the only subunit which produces a minor response. However, in a recent study a GlyGIC was characterized in the invertebrate chordate, Ciona intestinalis and shown to play a key role in coordinating swimming movements (Nishino et al., 2010). There is also evidence to believe that inhibitory glycine receptors are present in Hydra vulgaris (Ruggieri et al., 2004).

7.3 Glutamate and Glutamate-gated ion channels (GluICs) L-glutamate acts as a major excitatory neurotransmitter in vertebrates. The ionotropic glutamate receptors (iGluRs) comprise three major pharmacological classes, including the α-amino-3-hydroxy-5-methyl-4-isoxazolepropionic acid (AMPA) receptors, kainate (KA) receptors, and N-methyl-D-aspartate (NMDA) receptors. However, these cation selective iGluRs have a different architecture as compared to cys-loop receptors. Each subunit has three TMDs and an extracellular LBD. The ion pore domain is formed by a hairpin where the polypeptide chain bends into the cytoplasmic membrane from its cytosolic face (Villmann and Becker, 2007). A large number of glutamate receptor subunits have been identified in C. elegans which suggests that the worm has the potential to express a diverse number of functional 14 iGluRs. At least 10 putative iGluR subunits are expressed in this organism. Members of the non-NMDA class (GLR-1 to GLR-8) include subunits most similar to either the AMPA or kainate subfamilies. The 2 NMDA subunits, NMR-1 and NMR-2, belong to the NR1 and NR2A subfamilies, respectively (Brockie and Maricq, 2006). NR1 type subunits bind the co-agonist glycine and the NR2 type subunits do not bind glycine. In addition to the cation selective iGluRs, a family of GluCls has been identified in nematodes. There are five confirmed genes that encode receptor subunits, avr-14, avr-15, glc-1, glc-2 and glc-3 in C. elegans. The nomenclature for the respective subunits is GluClα3, GluClα2, GluClα1, GluClβ and GluClα4. In addition, a sixth gene, glc-4, is related to these sequences but has yet to be confirmed to encode a functional GluCl. One member of this gene family, avr-14, is widely conserved and has been found in Caenorhabditis elegans (Laughton et al., 1997), Ascaris suum (Jagannathan et al., 1999 ), Cooperia oncophora (Njue et al., 2004), the cyathostomins (parasites of horses) (Yates and Wolstenholme, 2004; Tandon et al., 2006), and the filarial parasites infecting humans and companion animals (Yates and Wolstenholme, 2004; Tandon et al., 2006). H. contortus is host to many GluCls such as Hco-GLC-5 (previously known as HcGluCla) (Forrester et al., 1999), Hco-AVR-14A (previously known as HcGBR-2A) and Hco-AVR- 14B (previously known as HcGBR-2B) (Jagannathan et al., 1999 ) and Hco-GLC-2

(previously known as HG4) (Delany et al., 1998). Hco-GLC-5 and Hco-AVR-14B have been shown to form homomeric channels that respond to glutamate (Forrester et al., 2003; McCavera et al., 2009). It has become increasingly clear, mostly from studies in C. elegans and H. contortus, that GluCls have an important role in the modulation of pharyngeal pumping as well locomotion (Yates et al., 2003).

7.4 Acetylcholine (ACh) and ACh-gated ion channels Synthesis of acetylcholine is facilitated by the enzyme, choline acetyl transferase (CAT). This enzyme combines choline with acetate derived from acetyl coenzyme A (CoA). The C. elegans genome is extraordinarily rich in genes encoding nAChRs which are ligand-gated sodium channels (Rand, 2007). The muscles of the body wall express two major types of ACh receptors: one type responds to levamisole and the other type responds to nicotine, but not levamisole (Richmond and Jorgensen, 1999). The nicotine- 15 sensitive receptors appear to be homomeric, containing only the ACR-16 α subunit (Francis et al., 2005; Touroutine et al., 2005). Three α-subunits: Cel-UNC-38, Cel-UNC- 63, Cel-LEV-8 and two non α-subunits: Cel-LEV-1, Cel-UNC-29 are components of a C. elegans levamisole-sensitive ACh-receptor (Boulin et al., 2008). Two subunits of ACh-gated chloride channel (ACC), ACC-1 and ACC-2, form homomeric channels which respond to ACh, in C. elegans. These channels are blocked by d-tubocurarine but not by the prototypical antagonist of nAChR, α-bungarotoxin. Nicotine which is the classical agonist of mammalian nAChRs, inhibits the ACCs. Two additional subunits, ACC-3 and ACC-4, have been shown to interact with ACC-1 and ACC-2. Overall, this research suggests that the ACh-binding domain of these channels appears to have diverged substantially from that of nAChRs (Putrenko et al., 2005). Even though there are no reports on characterization of ACCs from other nematodes, there is enough evidence to believe that this subfamily of channels exists in many other nematode species as well as other invertebrate phyla.

7.5 Biogenic amines and amine-gated ion channels 7.5a Biogenic amine neurotransmitters The biogenic amines (BAs) are synthesized from amino acid precursors. Based on these precursors, BAs can be divided into three categories – catecholamines (dopamine, epinephrine and norepinephrine), derivatives of tyrosine, indelamines (5-HT, tryptamine), derivatives of tryptophan, and histamine which is derived from histidine (Golan et al., 2008). Other biogenic amines are tyramine and octopamine which are synthesized from tyrosine. Many of these BAs function as neurotransmitters in both vertebrates and invertebrates. Furthermore, epinephrine and norepinephrine appear to be absent in nematodes (Smith et al., 2007). 7.5b Dopaminergic and serotonergic neurons in C. elegans Dopamine is synthesized in eight neurons (pairs of CEPD, CEPV, ADE and PDE) in the hermaphrodite and in an additional six neurons (pairs of R5A, R7A and R9A) located in the tail of the male. Each of these fourteen neurons are thought to be mechanosensory, and ablation of these cells or mutations that block synthesis or release of dopamine cause defects in the animal's ability to sense or respond to changes in its 16 environment. Serotonin is made in seven neurons (pairs of NSM, ADF and AIM as well as the single RIH) in both hermaphrodites and males. HSN, VC4 and VC5 neurons are serotonergic which are exclusive to hermaphrodites. CP (1-6), CA (1-4) and RN (1B, 3B and 9B) neurons possess serotonin and are present only in males. Serotonin signaling allows C. elegans to respond to changes in its environment by modulating locomotion behavior. It also plays important roles in chemosensory and egg laying functions (WormAtlas 2002-2010; Chase and Koelle, 2007).

7.5.1 5-HT and 5-HT-gated ion channels

L-Tryptophan is converted into 5-hydroxytryptophan by the enzyme tryptophan hydroxylase. Aromatic amino acid decarboxylase then converts 5-hydroxy tryptophan to

5-hydroxy tryptamine (5-HT). In vertebrates, the 5-HT3 receptor is a cation-selective LGIC mediating neuronal depolarization and excitation within the central and peripheral nervous systems (Barnes et al., 2009). C. elegans expresses a divergent cys-loop receptor, Cel-MOD-1 (previously known as MOD-1), which is a chloride channel and has been shown to be gated by 5-HT. Cel-MOD-1 is mainly involved in 5-HT mediated locomotion (Ranganathan et al., 2000). Cel-MOD-1 and another GPCR named SER-6 have been proposed as components of signaling mechanisms linking neural 5-HT to peripheral mobilization of fat stores (Srinivasan et al., 2008). In addition, both receptors have been shown to be required for the slowing effect of 5-HT (Dernovici et al., 2007) as well as being essential in modulating sensitivity to dilute octanol (Harris et al., 2009). Very recently, Cel-LGC-40 has been shown to be a low-affinity 5-HT-gated chloride channel that is also gated by choline and ACh (Ringstad et al., 2009). In H. contortus there are no reports of 5-HT-gated ion channels to date. However, a GPCR called SER-4 has been characterized (Smith et al., 2004).

7.5.2 Dopamine (DA) and tyramine (TA)-gated ion channels

Tyrosine is converted to L-DOPA by tyrosine hydroxylase. L-DOPA is then converted to DA by L-DOPA decarboxylase. DA is known to be involved in food sensing in C. elegans by mechanosensation. DA is known to act humorally and hence a direct synaptic connection is not necessary for dopamine signaling (Suo et al., 2009). Four DA 17 receptors (DOP-1 through DOP-4) belonging to GPCR class have been identified in C. elegans, including homologs of each of the two classes of dopamine receptors (D1- and D2-like) found in mammals (Chase and Koelle, 2007). The only ion channel characterized as gated by DA is Cel-LGC-53 which was identified very recently in C. elegans (Ringstad et al., 2009). TA is generated by the decarboxylation of tyrosine by the enzyme tyrosine decarboxylase. Recently a chloride channel subunit Cel-LGC-55 has been found to be gated by TA (Pirri et al., 2009; Ringstad et al., 2009). This subunit has been shown to be directly involved in the finer control of the head movement (suppression of oscillation) in response to touch (Pirri et al., 2009). To date, there are no reports of any TA-receptors in any parasitic nematode.

8.0 The function of LGICs in H. contortus Given the lack of genetic tools for parasitic nematodes, much research on the in vivo function of LGICs has been accomplished through the use of in situ localization. A putative GABA like subunit Hco-HG-1 was detected in putative ring motor- and interneurons and in a possible sensory neuron equivalent to the AQR cell of C. elegans. Staining for this subunit was also seen in the ventral nerve cord. In A. suum, immunoreactivity was limited to the muscle arms, the post-synaptic component of the neuromuscular junction. Based on these localization studies, it appears as though Hco- HG-1 functions as post synaptic receptor (Skinner et al., 1998). Immunoreactivity to a GluCl subunit, Hco-GLC-2 (previously known as HG4) was detected in commissures crossing sub lateral cords. These commissures were observed just below the mid-region of the pharynx, approximately at the level of the nerve ring (Delany et al., 1998). Hco-GLC-5A (previously known as HcGluCla) expression in transgenic C. elegans showed that this subunit was expressing in two pairs of M2 and MC neurons in the pharynx (Liu et al., 2004). Hco-GLC-5A (previously known as HcGluCla) and Hco-GLC-5B (previously known as HcGluClb) subunits were shown to co-localize in motor neuron commissures in adult H. contortus, suggesting that these subunits were probably part of the same receptor. The anti-Hco-AVR-14A (previously known as HcGBR-2A or HcGluClα3A) antibodies stained a pair of lateral neurons in the head of the 18 worms and a pair of sensory, possibly amphid neurons in the head, in addition to the motor neuronal commissures. Hco-AVR-14B (previously known as HcGBR-2B or HcGluClα3B) was detected in pharyngeal neurons, neuronal commissures as well as sub lateral and ventral nerve cords (Portillo et al., 2003).

9.0 LGICs and resistance to MLs in nematodes Ivermectin (IVM) activates GluCls that contain α-type subunits: the Cel-avr-14, Cel- avr-15, Cel-glc-1 and Cel-glc-3 gene products all individually form ivermectin-sensitive channels (McCavera et al., 2007). Functionally null mutations in Cel-avr-14, Cel-avr-15 and Cel-glc-1 genes (individually) do not lead to significant loss of sensitivity. However, a triple GluCl mutant displays >4000-fold loss of sensitivity (Dent et al., 2000). In H. contortus, Hco-GLC-5A (previously known as HcGluCla) (Forrester et al., 2003) and Hco-AVR-14B (previously known as HcGBR-2B or HcGluClα3B) (Cheeseman et al., 2001; McCavera et al., 2009) have been shown to be targets of IVM. Even though GluCls have been elucidated as targets for IVM, it is not clear how IVM induced death occurs in nematodes. It could be speculated that IVM inhibits GluCl mediated pharyngeal pumping resulting in animals starving to death. In a study aimed at understanding the effect of ivermectin (IVM), nematodes recovered from sheep treated with ivermectin 4 h prior to the [3H]inulin administration showed equivalent feeding levels (over a 1 h period) to those recovered from sheep not treated with IVM. Moreover no difference in the radioactivity was detected in nematodes of an IVM-susceptible and an IVM-resistant isolate recovered from individual sheep with concurrent infections after a dose with IVM, indicated that the drug had no effect on feeding by H. contortus in vivo under the specified experimental conditions (Sheriff et al., 2005). In addition, many GluCl subunits have been shown to be expressed in motor neuronal commissures in H. contortus (Portillo et al., 2003) which could cause paralysis in worms leading to their death. Many single nucleotide polymorphisms (SNPs) have been reported in avr-14 in White River isolate of H. contortus (McCavera et al., 2007) and Cooperia oncophora (Njue et al., 2004). One other piece of evidence that might indirectly implicate Hco-avr-14 in ML resistance in H. contortus was a study that revealed that the amphid structure in ML- resistant worms was severely deformed (Freeman et al., 2003). 19

IVM resistance has also been linked to changes in LGIC allele frequency. Allele frequency changes were noted in GluClα (Blackhall et al., 1998) and HG1 (Blackhall et al., 2003) genes in IVM selected strains of H. contortus. In addition, when two different alleles in HG1 (A – ‘wild type’ and E – ‘ivermectin selected’) were co-expressed with GAB-1, the GABA induced current from the GAB-1/HG1A (‘ML sensitive’) channel was potentiated by ivermectin, while the GAB-1/HG1E (‘ML resistant’) channel was attenuated (Feng et al., 2002). Most of the studies on parasites considered so far have concentrated on SNPs that change the amino acid sequence of the individual proteins and subunits. However it remains to be investigated as to how these polymorphisms affect gross changes in the expression of the receptor function leading to resistance.

References:

Absalom, N.L., Schofield, P.R., Lewis, T.M. (2009). "Pore Structure of the Cys-loop Ligand-gated Ion Channels " Neurochem Res 10.1007/s11064-009-9971-2. Armour, J., Duncan, M. (1987). "Arrested larval development in cattle nematodes." Parasitol Today 3: 171-176. Bamber, B.A., Beg, A.A., Twyman, R.E., Jorgensen, E.M. (1999). "The Caenorhabditis elegans unc-49 locus encodes multiple subunits of a heteromultimeric GABA receptor." J Neurosci 19: 5348–5359. Barnes, N.M., Hales, T.G., Lummis, S.C., Peters, J.A. (2009). "The 5-HT3 receptor--the relationship between structure and function." Neuropharmacol 56: 273-284. Beg, A.A., Jorgensen, E.M. (2003). "EXP-1 is an excitatory GABA-gated cation channel." Nat Neurosci 6: 1145-1152. Betz, H. (1990). "Ligand-gated ion channels in the brain: the amino acid receptor superfamily." Neuron 5: 383–392. Blackhall, W.J., Pouliot, J.F., Prichard R.K., Beech, R.N. (1998). "Haemonchus contortus: selection at a glutamate-gated chloride channel gene in ivermectin- and moxidectin-selected strains." Exp Parasitol 90: 42–48. Blackhall, W.J., Prichard, R.K., Beech, R.N. (2003). "Selection at a γ-aminobutyric acid receptor gene in Haemonchus contortus resistant to avermectins/milbemycins." Mol Biochem Parasitol 131: 137–145. Blaxter, M.L., De Ley, P., Garey, J.R., Liu, L.X., Scheldeman, P., Vierstraete, A., Vanfleteren, J.R., Mackey, L.Y., Dorris, M., Frisse, L.M., Vida, J.T., Thomas, W.K. (1998). "A molecular evolutionary framework for the phylum Nematoda." Nature 392: 71-75. Bocquet, N., Nury, H., Baaden, M., Le Poupon, C., Changeux, J.P., Delarue. M., Corringer, P.J. (2009). " X-ray structure of a pentameric ligand-gated ion channel in an apparently open conformation." Nature 457: 111-114. Boulin, T., Gielen, M., Richmond, J.E., Williams, D.C., Paoletti. P., Bessereau, J.L. (2008). "Eight genes are required for functional reconstitution of the 21

Caenorhabditis elegans levamisole-sensitive acetylcholine receptor." Proc Natl Acad Sci U S A 105: 18590-18595. Boulter, J., Evans, K., Goldman, D., Martin, G., Treco, D., Heinemann S., Patrick, J. (1986). "Isolation of a cDNA clone coding for a possible neural nicotinic acetylcholine receptor α-subunit. ." Nature 319: 368–374. Brejc, K., van Dijk, W.J., Klaassen, R.V., Schuurmans, M., van der Oost, J., Smit, A.B, Sixma, T.K. (2001). "Crystal structure of an ACh-binding protein reveals the ligand-binding domain of nicotinic receptors." Nature 411: 269-276. Brisson, A., Unwin, P. N. T. (1985). "Quaternary structure of the acetylcholine receptor. ." Nature 315: 693–695. Brockie, P. J., and Maricq, A.V. (2006). "Ionotropic glutamate receptors: genetics, behavior and electrophysiology." WormBook 19: 1-16. Celie, P.H., Klaassen, R.V., van Rossum-Fikkert, S.E., van Elk, R., van Nierop. P., Smit. A.B., Sixma, T.K. (2005). "Crystal structure of acetylcholine-binding protein from Bulinus truncatus reveals the conserved structural scaffold and sites of variation in nicotinic acetylcholine receptors." J Biol Chem 280: 26457-26466. Chase, D. L. and Koelle, M.R. (2007). "Biogenic amine neurotransmitters in C. elegans." WormBook, ed. The C. elegans Research Community. Cheeseman, C.L., Delany, N.S., Woods, D., Wolstenholme, A. J. (2001). "High-affinity ivermectin binding to recombinant subunits of the Haemonchus contortus glutamate-gated chloride channel." Mol Biochem Parasitol 114: 161–168. Chiara, D.C. and Cohen, J.B. (1997). "Identification of amino acids contributing to high and low affinity d-tubocurarine sites in the Torpedo nicotinic acetylcholine receptor." J Biol Chem 272: 32940–32950 Cockcroft, B., Osguthorpe, D.J., Barnard, E.A., Lunt, G.G. (1990). "Modeling of agonist binding to the ligand-gated ion channel superfamily of receptors." Proteins: Struct Funct Genet 8: 386–397. Connolly, C.N. and Wafford, K.A. (2004). "The Cys-loop superfamily of ligand-gated ion channels: the impact of receptor structure on function." Biochem Soc Trans 32: 529-534. 22

Corringer, P.J., Baaden, M., Bocquet, N., Delarue, M., Dufresne, V., Nury, H., Prevost, M., Van Renterghem, C. (2007). "Atomic structure and dynamics of pentameric ligand-gated ion channels: new insight from bacterial homologues." Nature 4: 116- 119. Corringer, P.J., Baaden, M., Bocquet, N., Delarue, M., Dufresne, V., Nury, H., Prevost, M., Van Renterghem, C. (2010). "Atomic structure and dynamics of pentameric ligand-gated ion channels: new insight from bacterial homologues." J Physiol 15: 565-572. Corringer, P.J., Bertrand. S., Galzi, J.L., Devillers-Thiéry, A., Changeux, J.P., Bertrand, D. (1999). "Mutational analysis of the charge selectivity filter of the alpha7 nicotinic acetylcholine receptor." Neuron 22: 831-843. Cully, D.F., Vassilatis, D.K., Liu, K.K., Paress, P.S., Van der Ploeg, L.H., Schaeffer, J.M., Arena, J.P. (1994). "Cloning of an avermectin-sensitive glutamate-gated chloride channel from Caenorhabditis elegans." Nature 20: 707-711. Delany, N.S., Laughton, D.L., Wolstenholme, A.J. (1998). "Cloning and localisation of an avermectin receptor-related subunit from Haemonchus contortus." Mol Biochem Parasitol 97: 177-187. Dent, J. A. (1997). "avr-15 encodes a chloride channel subunit that mediates inhibitory glutamatergic neurotransmission and ivermectin sensitivity in Caenorhabditis elegans." EMBO J 1: 5867-5879. Dent, J. A. (2006). "Evidence for a diverse cys-loop ligand-gated ion channel superfamily in early bilateria." J Mol Evol 62: 523-535. Dent, J.A., Smith, M.M., Vassilatic, D.K., Avery, L. (2000). "The genetics of ivermectin resistance in Caenorhabditis elegans." Proc Natl Acad Sci 97: 2674–2679. Dernovici, S., Starc, T., Dent, J.A., Ribeiro P. (2007). "The serotonin receptor SER-1 (5HT2ce) contributes to the regulation of locomotion in Caenorhabditis elegans." Dev Neurobiol 67(2): 189-204. Eisenmann, D.M. (2005). "WormBook, ed. The C. elegans Research Community,." WormBook doi/10.1895/wormbook.1.7.1, http://www.wormbook.org. 23

Feng, X.P., Hayashi, J., Beech, R.N., Prichard, R.K. (2002). "Study of the nematode putative GABA type-A receptor subunits: evidence for modulation by ivermectin. ." J Neurochem 83: 870–878. Forrester, S.G., Hamdan, F.F., Prichard, R.K., Beech, R.N. (1999). "Cloning, sequencing, and developmental expression levels of a novel glutamate-gated chloride channel homologue in the parasitic nematode Haemonchus contortus." Biochem Biophys Res Commun 254: 529-534. Forrester, S.G., Prichard, R.K., Beech, R.N. (2002). "A glutamate-gated chloride channel subunit from Haemonchus contortus: expression in a mammalian cell line, ligand binding, and modulation of anthelmintic binding by glutamate." Biochem Pharmacol 63: 1061-1068. Forrester, S.G., Prichard, R.K., Dent, J.A., Beech, R.N. (2003). "Haemonchus contortus: HcGluCla expressed in Xenopus oocytes forms a glutamate-gated ion channel that is activated by ibotenate and the antiparasitic drug ivermectin." Mol Biochem Parasitol 129: 115-121. Francis, M.M., Evans, S.P., Jensen, M., Madsen, D.M., Mancuso, J., Norman, K.R., Maricq, A.V. (2005). "The Ror receptor tyrosine kinase CAM-1 is required for ACR-16-mediated synaptic transmission at the C. elegans neuromuscular junction." Neuron 46: 581-594. Freeman, A.S., Nghiem, C., Li, J., Ashton, F.T., Guerrero, J., Shoop, W.L., Schad, G.A. (2003). "Amphidial structure of ivermectin-resistant and -susceptible laboratory and field strains of Haemonchus contortus." Vet Parasitol: 217–226. . Galzi, J.L., Devillers-Thiéry, A., Hussy , N., Bertrand, S., Changeux, J.P, Bertrand, D. (1992). "Mutations in the channel domain of a neuronal nicotinic receptor convert ion selectivity from cationic to anionic." Nature 359: 500-505. Gasbarre, L.C., Smith, L.L., Lichtenfels, J.R., Pilitt, P.A. (2009). "The identification of cattle nematode parasites resistant to multiple classes of anthelmintics in a commercial cattle population in the US." Vet Parasitol 166: 281-285. Golan, D.E., Tashjian, Jr, A.H., Armstrong, E.J., Armstrong, A.W. (2008). "Principles of pharmacology - The pathophysiologic basis of drug discovery." LippincottWilliams and Wilkins, USA: 101. 24

Grenningloh, G., Rienitz, A., Schmitt, B., Methfessel, C., Zensen, M., Beyreuther, K., Gundelfinger, E.D., Betz, H. (1987). "The strychnine-binding subunit of the glycine receptor shows homology with nicotinic acetylcholine receptors." Nature 16-22: 215-220. Grutter, T., de, Carvalho, L.P., Dufresne, V., Taly, A., Edelstein, S.J., Changeux. J.P. (2005). "Molecular tuning of fast gating in pentameric ligand-gated ion channels." Proc Natl Acad Sci 13: 18207-18212. Guastella, J., Johnson, C.D., Stretton, A. O. W. (1991). "GABA-immunoreactive neurons in the nematode Ascaris." J Comp Neurol 307: 584-597. Gunthorpe, M J., Lummis, S.C. (2001). "Conversion of the ion selectivity of the 5-HT(3a) receptor from cationic to anionic reveals a conserved feature of the ligand-gated ion channel superfamily." J Biol Chem 276: 10977-10983. Hansen, S.B., Sulzenbacher, G., Huxford, T., Marchot. P., Taylor, P., Bourne, Y. (2005). "Structures of Aplysia AChBP complexes with nicotinic agonists and antagonists reveal distinctive binding interfaces and conformations." EMBO J 24: 3635-3646. Harris, G.P., Hapiak, V.M., Wragg, R.T., Miller, S.B., Hughes, L.J., Hobson, R.J., Steven, R., Bamber, B., Komuniecki, R.W. (2009). "Three distinct amine receptors operating at different levels within the locomotory circuit are each essential for the serotonergic modulation of chemosensation in Caenorhabditis elegans." J Neurosci 29: 1446-1456. Hilf, R.J.C. and Dutzler, R. (2008). "X-ray structure of a prokaryotic pentameric ligand- gated ion channel." Nature 452: 375–379. Hilf, R. J. C. and Dutzler, R. (2009). "Structure of a potentially open state of a proton- activated pentameric ligand-gated ion channel. ." Nature 457: 115-118. Jagannathan, S., Laughton, D.L., Critten, C.L., Skinner, T.M., Horoszok, L., Wolstenholme, A.J. (1999 ). "Ligand-gated chloride channel subunits encoded by the Haemonchus contortus and Ascaris suum orthologues of the Caenorhabditis elegans gbr-2 (avr-14) gene." Mol Biochem Parasitol 103: 129-140. Jensen, M.L., Pedersen, L.N., Timmermann, D.B., Schousboe, A., Ahring, P.K. (2005). "Mutational studies using a cation-conducting GABAA receptor reveal the 25

selectivity determinants of the Cys-loop family of ligand-gated ion channels." J Neurochem 92: 962-972. Karlin, A. (2002). " Emerging structure of the nicotinic acetylcholine receptors. ." Nat Rev Neurosci 2: 102–114. Kehoe, J., Buldakova, S., Acher, F., Dent, J., Bregestovski, P., Bradley, J. (2009). "Aplysia cys-loop glutamate-gated chloride channels reveal convergent evolution of ligand specificity." J Mol Evol 69: 125-141. Keramidas, A., Moorhouse, A.J., French, C.R., Schofield, P.R., Barry, P.H. (2000). "M2 pore mutations convert the glycine receptor channel from being anion- to cation- selective." Biophys J 79: 247-259. Langosch, D., Thomas, L., Betz, H. (1988). "Conserved quaternary structure of ligand- gated ion channels: the postsynaptic glycine receptor is a pentamer." Proc Natl Acad Sci 85: 7394-7398. Laughton, D.L., Amar, M., Thomas, P., Towner, P., Harris, P., Lunt, GG., Wolstenholme, A.J. (1994). "Cloning of a putative inhibitory amino acid receptor subunit from the parasitic nematode Haemonchus contortus." Receptors Channels 2: 155-163. Laughton, D.L., Lunt, G.G., Wolstenholme, A.J. (1997). "Alternative splicing of a Caenorhabditis elegans gene produces two novel inhibitory amino acid receptor subunits with identical ligand binding domains but different ion channels." Gene 12: 119-125. Lester, H.A., Dibas, M.I., Dahan, D.S., Leite, J.F., Dougherty, D.A. (2004). "Cys-loop receptors: new twists and turns." Trends Neurosci 27: 329-336. Li, J., Ashton, F.T., Gamble, H.R., Schad, G.A. (2000a). "Sensory neuroanatomy of a passively ingested nematode parasite, Haemonchus contortus: Amphidial neurons of the first stage larva." J Comp Neurol 417: 299-314. Li, J., Zhu, X., Ashton, F.T., Gamble, H.R., Schad, G.A. (2001). "Sensory neuroanatomy of a passively ingested nematode parasite, Haemonchus contortus: Amphidial neurons of the third-stage larva. ." J Parasitol 87: 65-72. Li, J., Zhu, X., Boston, R., Ashton, F.T., Gamble, H.R., Schad, G.A. (2000b). "Thermotaxis and thermosensory neurons in infective larvae of Haemonchus contortus, a passively ingested nematode parasite." J Comp Neurol 424: 58-73. 26

Liu, J., Dent, J.A., Beech, R.N., Prichard, R.K. (2004). "Genomic organization of an avermectin receptor subunit from Haemonchus contortus and expression of its putative promoter region in Caenorhabditis elegans." Mol Biochem Parasitol 134: 267-274 Lynch, J. W. (2009). "Native glycine receptor subtypes and their physiological roles." Neuropharmacol 56(1): 303-309. Martin, R. J. (1980). "The effect of y-aminobutyric acid on the input conductance and membrane potential of Ascaris muscle." Br J Pharmacol 71: 99-106. Martin, R. J. (1985). "Y-Aminobutyric acid and Piperazine activated single channel currents from Ascaris suum body muscle." Br J Pharmacol 84: 445-461. Martin, R. J. (1997). "Modes of action of anthelmintic drugs." Vet J 154: 11-34. Martin, R.J., Pennington, A.J., Duittoz, A.H., Robertson, S., Kusel, J.R. (1991). "The physiology and pharmacology of neuromuscular transmission in the nematode parasite, Ascaris suum." Parasitology 102 Suppl: S41-58. McCavera, S., Rogers, A.T, Yates, D.M., Woods, D.J, Wolstenholme, A.J. (2009). "An ivermectin-sensitive glutamate-gated chloride channel from the parasitic nematode Haemonchus contortus." Mol Pharmacol 75: 1347-1355. McCavera, S., Walsh T.K., Wolstenholme, A.J. (2007). "Nematode ligand-gated chloride channels: an appraisal of their involvement in macrocyclic lactone resistance and prospects for developing molecular markers." Parasitol 134: 1111-1121. Mederos, A., Fernández, S., Vanleeuwen, J., Peregrine, A.S., Kelton, D., Menzies, P., Leboeuf, A., Martin, R. (2010). "Prevalence and distribution of gastrointestinal nematodes on 32 organic and conventional commercial sheep farms in Ontario and Quebec, Canada (2006-2008)." Vet Parasitol. Mishina, M., Takai, T., Imoto, K., Noda, M., Takahashi, T., Numa, S., Methfessel, C., Sakmann, B. (1986). "Molecular distinction between fetal and adult forms of muscle acetylcholine receptor." Nature 321: 406-411. Morales, M., McCollum, N., Kirkness, E.F. (2001). "5-HT(3)-receptor subunits A and B are co-expressed in neurons of the dorsal root ganglion." J Comp Neurol 438: 163- 172. 27

Nishino, A., Okamura, Y., Piscopo, S., Brown, E.R. (2010). "A glycine receptor is involved in the organization of swimming movements in an invertebrate chordate." BMC Neurosci 19: 10.1186/1471-2202-1111-1186. Njue, A.I., Hayashi, J., Kinne, L., Feng, X.P., Prichard, R.K. (2004). "Mutations in the extracellular domains of glutamate-gated chloride channel alpha3 and beta subunits from ivermectin-resistant Cooperia oncophora affect agonist sensitivity." J Neurochem 89: 1137-1147. Ortells, M.O., Lunt, G.G. (1995). "Evolutionary history of the ligand-gated ion-channel superfamily of receptors." Trends Neurosci 18: 121-127. Osei-Atweneboana, M.Y., Eng, J.K., Boakye, D.A., Gyapong, J.O., Prichard, R.K. (2007). "Prevalence and intensity of Onchocerca volvulus infection and efficacy of ivermectin in endemic communities in Ghana: a two-phase epidemiological study." Lancet 369: 2021-2029. Osta, W.A., El-Osta, M.A., Pezhman, E.A., Raad, R.A., Ferguson, K., McKelvey, G.M., Marsh, H.M., White, M., Perov, S. (2010). "Nicotinic Acetylcholine Receptor Gene Expression Is Altered in Burn Patients." Anesth Analg In press. Peters, J.A., Cooper, M.A., Carland, J.E., Livesey, M.R., Hales, T.G., Lambert, J.J. (2010). "Novel structural determinants of single channel conductance and ion selectivity in 5-hydroxy tryptamine type 3 and nicotinic acetylcholine receptors." J Physiol 588: 587-596. Pirker, S., Schwarzer, C., Wieselthaler, A., Sieghart, W., Sperk, G. (2000). "GABA(A) receptors: immunocytochemical distribution of 13 subunits in the adult rat brain,." Neurosci 101: 815–850. Pirri, J., McPherson, A.D., Donnelly, J.L., Francis, M.M., Alkema M.J. (2009). "A tyramine-gated chloride channel coordinates distinct motor programs of a Caenorhabditis elegans escape response." Neuron 62: 526-538. Portillo, V., Jagannathan, S., Wolstenholme, A.J. (2003). "Distribution of Glutamate- gated Chloride Channel Subunits in the Parasitic Nematode Haemonchus contortus." J Comp Neurol 462: 213-222. Putrenko, I., Zakikhani, M., Dent, J.A. (2005). "A family of acetylcholine-gated chloride channel subunits in Caenorhabditis elegans." J Biol Chem 280: 6392–6398. 28

Rahman, W.A., Abd Hamid, S. (2007). "Morphological characterization of Haemonchus contortus in goats (Capra hircus) and sheep (Ovis aries) in Penang, Malaysia." Trop Biomed 24: 23-27. Rand, J.B. (2007). "Acetylcholine (January 30, 2007), WormBook, ed. The C. elegans Research Community, WormBook." doi/10.1895/wormbook. Ranganathan, R., Cannon, S.C., Horvitz, H.R. (2000). "MOD-1 is a serotonin-gated chloride channel that modulates locomotory behaviour in C. elegans." Nature 23: 470-475. Rayes, D., De Rosa, M.J., Sine, S.M., Bouzat, C. (2009). "Number and locations of agonist binding sites required to activate homomeric Cys-loop receptors. ." J Neurosci 29: 6022–6032 Richmond, J. E., Jorgensen, E.M. (1999). "One GABA and two acetylcholine receptors function at the C. elegans neuromuscular junction. ." Nat Neurosci 2: 791-797. Ringstad, N., Abe, N., Horvitz, H.R. (2009). "Ligand-gated chloride channels are receptors for biogenic amines in C. elegans." Science 325: 96-100. Ros-Moreno, R.M., Moreno-Guzman, M.J., Jimenez-Gonzalez, A., Rodriguez-Caabeiro, F. (1999). "Interaction of ivermectin with γ-aminobutyric acid receptors in Trichinella spiralis muscle larvae. ." Parasitol Res 85: 320-323. Rufener, L., Mäser, P., Roditi, I., Kaminsky, R. (2009). "Haemonchus contortus acetylcholine receptors of the DEG-3 subfamily and their role in sensitivity to monepantel." PLoS Pathog. Apr;5(4):e1000380. Ruggieri, R.D., Pierobon, P., Kass-Simon, G. (2004). "Pacemaker activity in hydra is modulated by glycine receptor ligands." Comp Biochem Physiol A Mol Integr Physiol 138: 193-202. Schofield, P.R., Darlison, M.G., Fujita, N., Burt, D.R., Stephenson, F.A., Rodriguez, H., Rhee, L.M., Ramachandran, J., Reale, V., Glencorse, T.A. (1987). "Sequence and functional expression of the GABA A receptor shows a ligand-gated receptor super-family." Nature 16-22: 221-227. Sheriff, J.C., Kotze, A., Sangster, N., Hennessy, D.R. (2005). "Effect of ivermectin on feeding by Haemonchus contortus in vivo." Vet Parasitol 31: 341-346. 29

Siddiqui, S.Z., Brown, D.R., Rao, V.T.S., Forrester, S.G. (2010). "An UNC-49 GABA receptor subunit from the parasitic nematode Haemonchus contortus is associated with enhanced GABA sensitivity in nematode heteromeric channels." J Neuro Chem 113:1113-1122. Simon, J., Wakimoto, H., Fujita, N., Lalande, M., Barnard, E.A. (2004). "Analysis of the set of GABA(A) receptor genes in the human genome." J Biol Chem 279: 41422– 41435. Skinner, T.M., Bascal, Z.A., Holden-dye, L., Lunt, G.G., Wosltenholme, A.J. (1998). "Immunocytochemical localization of a putative inhibitory amino acid receptor subunit in the parasitic nematodes Haemonchus contortus and Ascaris suum." Parasitol 117: 89-96. Smith, K.A., Komuniecki, R.W., Ghedin, E., Spiro, D., Gray, J. (2007). "Genes encoding putative biogenic amine receptors in the parasitic nematode Brugia malayi." Invert Neurosci 7: 227-244. Smith, M.W., Borts, T.L., Emkey, R., Cook, C.A., Wiggins, C.J., Gutierrez, J.A. (2004). "Characterization of a novel G-protein coupled receptor from the parasitic nematode H. contortus with high affinity for serotonin." J Neurochem 86: 255- 266. Song, C., Corry, B. (2009). "Role of acetylcholine receptor domains in ion selectivity." Biochim Biophys Acta 1788. Song, C., Corry, B. (2010). "Ion conduction in ligand-gated ion channels: Brownian dynamics studies of four recent crystal structures." Biophys J 98: 404-411. Soulsby, E.J.L. (1982). "Helminths, Arthropods and Protozoa of domesticated animals." 7th Edition: 234. Srinivasan, S., Sadegh, L., Elle, I.C., Christensen, A.G., Faergeman, N.J., Ashrafi K. (2008). "Serotonin regulates C. elegans fat and feeding through independent molecular mechanisms." Cell Metab 7: 533-544. Suo, S., Culotti, J.G., Van Tol, H.H. (2009). "Dopamine counteracts octopamine signalling in a neural circuit mediating food response in C. elegans." EMBO J 28: 2437-2448. 30

Tandon, R., LePage, K.T., Kaplan, R.M. (2006). "Cloning and characterization of genes encoding alpha and beta subunits of glutamate-gated chloride channel protein in Cylicocyclus nassatus." Mol Biochem Parasitol 150: 46-55. Tasneem, A., Lakshminarayan, M.I., Jakobsson, E., Aravind, L. (2004). "Identification of the prokaryotic ligand-gated ion channels and their implications for the mechanisms and origins of animal Cys-loop ion channels." Genome Biol 6(R4). Touroutine, D., Fox, R.M., Von Stetina, S.E., Burdina, A., Miller, D.M., III, Richmond, J.E. (2005). "acr-16 encodes an essential subunit of the levamisole-resistant nicotinic receptor at the Caenorhabditis elegans neuromuscular junction." J Biol Chem 280: 27013–27021. Unwin, N. (1993a). "Neurotransmitter action: opening of ligand-gated ion channels. ." Cell 72: 31-41. Unwin, N. (2005). "Refined structure of the nicotinic acetylcholine receptor at 4A resolution." J Mol Biol 346: 967-989. Urquhart, G., Armour, J., Duncan, J.L., Jennings, F.W. (1987). "Veterinary Parasitology." 286pp (Book). Veglia, F. (1915). "The anatomy and life history of Haemonchus contortus." A Afr Res Dir Rep 13: 350-500. Villmann, C., Becker, C.M. (2007). "On the hypes and falls in neuroprotection: targeting the NMDA receptor." Neuroscientist 13: 594-615. Weise, R. (1977). "A light and electron microscopic study of the dorsal buccal lancet of Haemonchus contortus." J Parasitol 63: 854-857. Williamson, S.M., Walsh, T.K., Wolstenholme, A.J. (2007). "The cys-loop ligand-gated ion channel gene family of Brugia malayi and Trichinella spiralis: a comparison with Caenorhabditis elegans." Invert Neurosci 7: 219-226. WormAtlas, Altun, Z.F., Herndon, L.A., Crocker, C., Lints, R., Hall, D.H. (2002-2010). "http://www.wormatlas.org." Yates, D.M., Portillo, V., Wolstenholme, A.J. (2003). "The avermectin receptors of Haemonchus contortus and Caenorhabditis elegans." Int J Parasitol 33: 1183- 1193. 31

Yates, D. M., Wolstenholme, A.J. (2004). "An ivermectin-sensitive glutamate-gated chloride channel subunit from Dirofilaria immitis." Int J Parasitol 34: 1075-1081. Zouridakis, M., Zisimopoulou, P., Poulas, K., Tzartos, S.J. (2009). "Recent advances in understanding the structure of nicotinic acetylcholine receptors." IUBMB Life 61: 407-423.

Chapter II

Manuscript I

A dopamine-gated ion channel (HcGGR3) from Haemonchus contortus is expressed in the cervical papillae and is associated with macrocyclic lactone resistance

Vijayaraghava T. S. Rao, Salma Z. Siddiqui, Roger K. Prichard and Sean G. Forrester

Molecular Biochemical Parasitology, 166, 54-61 (2009)

Abstract Haemonchus contortus, a parasitic nematode of great economic importance, is a major challenge for the livestock industries. The parasite is controlled by nematocidal drugs, several of which target ligand-gated chloride channels (LGCCs). In addition, drug resistance has become a major problem in controlling this parasite and other trichostrongylids. Therefore, identification of new drug targets may assist in the discovery of novel drugs which is essential for maintaining the level of parasite control required in modern agriculture. We have isolated a novel LGCC gene, which has been named HcGGR3. Protein sequence analysis indicates that this channel is anion selective and possesses all the signature motifs of a chloride channel subunit. Analysis of the cDNA sequence shows putative microRNA recognition sites which could be important in relation to developmental expression of this subunit. qRT-PCR analysis of HcGGR3 shows that it is differentially expressed among the various life stages and the rank order of expression was eggs > adult female > larvae > adult male. Apart from this, HcGGR3 is significantly down regulated in macrocyclic lactone selected laboratory strains of H. contortus. We also found a single nucleotide polymorphism in the 3’ UTR that appears to be associated with macrocyclic lactone selection. Immunolocalization of this subunit in adult worms has revealed some differences in the expression patterns between males and females. In females, the localization is distinctly punctate around the cervical papillae, suggesting a possible role in mechanosensation. In males, expression was observed around the cervical papillae and possibly some sheath cells. Electrophysiological analysis of this protein expressed in Xenopus laevis oocytes revealed that it forms a homomeric channel that responds primarily to dopamine.

1.0 Introduction Ligand-gated chloride channels (LGCCs), a subset of cysteine-loop ligand-gated ion channels (LGICs) play important roles in inhibitory neurotransmission in both vertebrates and invertebrates. These membrane receptor complexes are made up of five homologous subunits, which sit around a central pore [1]. The cysteine-loop, which is found in the N- terminal ligand- binding domain, is important for subunit association and receptor assembly [2]. The overall subunit composition of the ion channel determines ion selectivity, neurotransmitter affinity, subcellular localization, gating kinetics, and pharmacology [3]. Invertebrates, such as nematodes, are known to use a variety of LGCC subtypes that are not found in vertebrates. These unique channels have been shown to be gated by neurotransmitters such as glutamate [4, 5], acetylcholine [6], and serotonin [7] and are expressed in both muscle and nerve tissue. Amino acid sequence and phylogenetic analysis of the model free living nematode, C. elegans has revealed a wide array of diverse cys-loop LGCC receptors [8]. This accentuates the fact that nematodes possess a divergent inhibitory neurotransmission system which makes it an attractive target for nematocides. In fact, LGCCs form the targets of the most widely used nematocides, the macrocyclic lactones (MLs), ivermectin and moxidectin [9]. For the discovery of new targets such as these, it is important that we enhance our understanding of the key components that make up the inhibitory nervous system in parasitic nematodes. Haemonchus contortus is a gastrointestinal parasitic nematode that infects ruminants such as cattle, sheep and goats [10]. This parasite is a menace to the production of small ruminants across the world causing great economic losses. Although other tri- chostrongylid nematodes can add to the burden of parasitism in small ruminants, H. contortus is the primary cause of losses in much of the United States [11]. Currently, the predominant method of treating this infection is through the use of MLs as well as benzimidazoles (BZs). However, increasing drug resistance in H. contortus as well as many other veterinary helminths and the human parasitic nematode Onchocerca volvulus, the causative agent of African river blindness, necessitates an urgent need to discover new drug targets and to develop novel nematocides [12–14]. In the current study, we have isolated and characterized a novel LGCC subunit in H. 35 contortus that we named, HcGGR3. The aim of this study was to unravel the biological relevance of this unique subunit. Surprisingly, we have found that this subunit is probably expressed in neuronal/support cells associated with mechanosensory structures called the deirids. In addition, the HcGGR3 channel expressed in Xenopus oocytes produces a robust response to the biogenic amine dopamine. How HcGGR3 and possibly dopamine are contributing to the function of these structures is unknown at this time. In addition, we have also found evidence that the HcGGR3 gene is under selective pressure in ML selected laboratory strains of H. contortus.

2. Materials and methods

2.1 Cloning and sequencing of HcGGR3

Total ribonucleic acid (RNA) was isolated from female worms belonging to the PF23 strain of H. contortus using RNAStat (TelTest Inc.). First strand cDNA (copy DNA) was synthesized using 1 μg of total RNA and an oligo-dT adapter primer, 5’-

CCTCTGAAGGTTCACGGATCACGGATCCACATCTAGA(T)17VN-3’ [15] with Omniscript reverse transcriptase (Qiagen). The RT reaction was always preceded by a genomic DNA elimination step.

A partial sequence of HcGGR3 was obtained by searching for unique LGCC sequences using the server at the Sanger Institute (Cambridge, UK). Using this partial sequence, primers were designed for use in a 5’ and 3’ RACE procedure [16]. The 5’ RACE reaction was performed using the SL1 primer, 5’ -GGTTTAATTACCCAAGTTTGAG-3’ and a gene specific anti-sense primer, 5’ -TCGGGTATCAATCCAGAAGGC-3’. The putative 3’ end of this gene was amplified using the gene specific primer, 5’-

CCTGCCTACATATCTGTCAGTATTC-3’, and a primer targeting the adapter sequence in a PCR. Confirmation of the full length coding sequence was accomplished by designing primers that target the 5’ and 3’ ends of the gene. Several clones were sequenced to obtain 36 a consensus.

For phylogenetic analysis, several LGCC subunit amino acid sequences from different species were aligned using the program MacVector (MacVector Inc.) and the resultant alignment was edited to remove gaps and adjusted manually to maximize homologous characters. The resultant 121 residues containing conserved regions of the N-terminal domain and transmembrane regions (M1–M4) were then subjected to phylogenetic analysis using the neighbor joining (N) algorithm in MacVector.

2.2 Examination of the HcGGR3 gene in ML selected strains

We examined the genetic variability of HcGGR3 in three genetically related strains of H. contortus: PF23, IVF23 and MOF23. All of these strains were obtained by passaging the original PF strain over 23 generations. PF23 was not subjected to any anthelmintic selection and is a ML-susceptible strain. MOF23 and IVF23 are strains which have been selected from the PF strain, with moxidectin and ivermectin, respectively, over 23 generations [17]. Genomic DNA was extracted (Qiagen kit) from individual male worms from each strain (a minimum of 30 individual worms per strain). A 190 base pair sequence corresponding to the 3’ UTR of the longer splice variant was amplified using the primer set: 5’-TGAGCAGAGAACGCCACTGA-3’ and 5’-

GGTGGGTAAACGATAGATCAAC-3’ and the corresponding amplicons were sequenced. Statistical significance of the differences in allele frequencies were calculated through Fisher’s exact test (Graph Pad).

Quantitative reverse transcriptase-polymerase chain reaction (qRT-PCR) was used to study the expression of HcGGR3 in the ML selected strains (MOF23, IVF23) versus the unselected (PF23) strain of H. contortus using the standard curve relative quantification method. Three different batches of cultures for each strain were employed in the study. The assay was performed using Quantitect SYBR-green master mix (Qiagen) with the sense primer 5’-CCTGCCTACATATCTGTCAGTATTC-3’ and the antisense primer 5’- 37

CCAAATTGGAAGGTCAGCG-3’ which are specific for both of the spliced variants of HcGGR3. The endogenous reference, 18s rRNA gene was amplified using sense primer,

5’-AATGGTTAAGAGGGACAATTCG-3’ and anti-sense primer, 5’-

CTTGGCAAATGCTTTCGC-3’ [18]. Individual reactions were performed at a final volume of 10 μL which was comprised of 5 μL of the master mix, 2 μM sense and antisense primer and ≤100 ng/reaction of cDNA. The reaction steps included an initial denaturation step at 95 ◦ C for 10 min. Each cycle included incubation of samples at 95 ◦ C for 15 s followed by annealing at 55 ◦ C for 15 s and an extension at 72 ◦ C for 15 s. The total number of cycles was 45. Melting curves were performed at the temperature range of 55–95 ◦ C. All reactions were carried out in a Rotor gene thermo-cycler, RG 3000 (Corbett Research). Standard curves were generated using 300 ng/μL of plasmid containing the amplicons of interest {for both the endogenous reference, 18s ribosomal-RNA (18s rRNA) and gene of interest, HcGGR3} and were diluted to produce various dilution standards. Each sample was measured in duplicate. Concomitant control-RT reactions containing a relevant quantity of RNA, but no reverse transcriptase enzyme, were performed routinely to rule out possible genomic DNA contamination. Experiments were repeated on three independent samples for each strain, with each sample being analyzed in triplicate.

Standard curves were generated by plotting cycle time (CT) values for all the dilution standards against copy numbers, for both 18s rRNA and HcGGR3. CT values for the test samples were then plotted onto the corresponding standard curve to arrive at their copy numbers. The copy number for each sample was normalized with that of the endogenous reference (18s rRNA). Two-way ANOVA (analysis of variance) was performed to measure both batch as well as strain variations using Graphpad Prism (version 4.0).

2.3 Life-stage transcription levels of HcGGR3

Quantitative reverse transcriptase-polymerase chain reaction was used to quantify HcGGR3 expression levels in different life stages of H. contortus (male, female, eggs and

L3 larvae) belonging to the PF23 strain. Five different batches of each of the life stages were used in the study. Each sample was measured in duplicate using the same qRT-PCR 38 method as above. Two-way ANOVA (analysis of variance) was performed to measure both batch as well as life stage variation using Graphpad Prism (version 4.0).

2.4 Immunolocalization of HcGGR3 in adult worms

A peptide (NQRKSILRDLLEDYDKT) corresponding to the N-terminal region of HcGGR3 was synthesized commercially (Alpha Diagnostics Intl. Inc.) and was used to immunize rabbits. Antibodies were affinity purified and tested for specificity using ELISA. Adult H. contortus worms belonging to the PF23 strain were fixed, permeabilized, and collagenase digested as described elsewhere [19]. Worms were washed with PBS and incubated for 72 h at 4 ◦ C with either a 1/200 or 1/300 dilution of the primary antibody in PBS containing: 0.1% (w/v) bovine serum albumin (BSA), 0.5% (v/v) Triton X-100, and 0.05% (w/v) sodium azide. Unbound antibodies were removed by a wash in PBS/0.1% (v/v) Triton X-100 at 4 ◦ C.

Worms were then incubated at 4 ◦ C with a 1/1000 dilution (or greater) of fluorescein goat anti-rabbit IgG (Invitrogen) for 15–18 h. Worms were finally washed several times (minimum of 5 times) with PBS/0.1% (v/v) Triton X-100 at 4 ◦ C. Worms were then mounted on slides using mounting medium (Sigma) and examined with a confocal microscope. Controls included the omission of primary antibody and the use of peptide-adsorbed primary antibodies. In the latter case, an excess of peptide (30–40 μg/ml) was added to the antibody working dilution and incubated at 4 ◦ C for a minimum of 16 h before being used for immunocytochemistry. Other controls included incubating the worms with a 1/50 dilution of pre-immune serum and a permeabilization control where collagenase was omitted from the permeabilization buffer.

2.5 Expression of HcGGR3 in Xenopus laevis oocytes

The coding sequence of HcGGR3 was sub cloned into a pT7TS transcription vector that 39

introduces Xenopus laevis β-globin untranslated DNA to the 5’ and 3’ end of the gene. The construct was then linearized and used as template in an in vitro transcription reaction using T7 RNA polymerase provided in a capped RNA transcription kit (mMessage mMachine kit, Ambion). Capped HcGGR3 copy RNA (cRNA) was precipitated using lithium chloride and dissolved in water at a concentration of 0.5 ng/nl.

Oocytes were extracted surgically from X. laevis females, which were anaesthetized using 0.15% (w/v) 3-aminobenzoic acid ethyl ester, methane sulphonate salt (MS-222) (Sigma). The follicular layers were defolliculated from the oocytes using 2 mg/ml collagenase (Sigma) in OR2 buffer (82 mM NaCl, 2 mM KCl, 1 mM MgCl2, 5 mM Hepes pH 7) for 2 h while shaking at room temperature. Oocytes were then transferred to ND96 buffer (96 mM NaCl, 2 mM KCl, 1 mM MgCl2 , 1.8 mM CaCl2 , 5 mM Hepes pH 7.5) supplemented with 275 μg/ml pyruvate (as a carbon source), and gentamycin (50 μg/ml) (Sigma).

Each oocyte was injected cytoplasmically using a Drummond Nanoject microinjector with 50 nl of capped HcGGR3 cRNA (0.5 ng/nl). Injected oocytes were placed at 20 ◦ C and allowed to incubate for 1–5 days with replacement of supplemented ND96 every 24 h. Recordings were made 2–5 days after injection.

2.6 Electrophysiological recordings

Two-electrode voltage clamp was performed using an Axoclamp 900 A voltage clamp (Molecular Devices). Recordings were made in ND96 frog saline. Electrode pipettes were filled with 3 M KCl and had a resistance of between 1 and 5 M₃. Oocytes were held at a membrane potential of −60 mV during the experiments. Drugs such as dopamine, tyramine, octopamine, serotonin, GABA, and glutamate (all from Sigma) were dissolved in ND96. Oocytes were perfused with the various drugs in an RC-1Z recording chamber (Warner Instrument Inc.). Data were acquired and analyzed with Clampex software (Molecular Devices). 40

3. Results

3.1 Cloning of HcGGR3

Using the 5’ and 3’ RACE procedure, we obtained a 1971 bp cDNA fragment, named

HcGGR3. The complete gene sequence is predicted to include 42 bp of 5’ UTR with the SL1 sequence, 1299 bp of coding sequence and either 630 bp (long form) or 124 bp (short form) of 3’ UTR. The 3’ UTR of both the long and short forms of HcGGR3 exhibit putative microRNA recognition sites such as a K box (5’ -TGTGAT-3’ ) and CAAC motifs (see GenBank accession number EF202570).

When translated the predicted HcGGR3 polypeptide is 432 amino acids in length and includes a signal peptide sequence at the extreme N-terminus ( http://www.cbs.dtu.dk/services). HcGGR3 has all the typical features of a cys-loop ligand- gated ion channel subunit such as an N-terminal ligand binding region, the characteristic cys-loop and four transmembrane regions (M1–M4) (Fig. 2-1A). The M2 region, which determines ion selectivity, exhibits the PAR-motif which is characteristic of anion channels [20] (Fig. 2-1A and 2-1B). The protein sequence of HcGGR3 shares 84% similarity with its presumed C. elegans orthologue, CeGGR3 (Fig. 2-1A). The protein also shares similarity to other C. elegans subunits such as Ce LGC-53 at 58%, Ce LGC-52 at 62% and Ce MOD-1 at 46%. Phylogenetic analysis revealed that the HcGGR3 subunit groups within the clade that includes serotonin and acetylcholine-gated chloride channels (Fig. 2-1C).

Fig. 2-1 (A) Alignment of HcGGR3 and CeGGR3 protein sequences. The two cysteine residues that make up the cysteine loop (CX13 C) are indicated (•). The four membrane spanning domains (M1–M4) are underlined and the predicted signal peptide cleavage site is indicated by (∇). Dark shading indicates identity and light shading indicates similarity. (B) Alignment of second transmembrane region of various LGIC protein subunits indicating that HcGGR3 is an anion selective channel. (C) Phylogenetic analysis of HcGGR3 with various other LGICs. Hs nAChR is used as an out-group and Hc GGR3 is outlined. Bootstrap values are indicated. The GenBank accession numbers of the sequences included in the analysis are as follows: Hs nAChR (NP 000734), Ce ACR-12 (AAC98095), Ce ACC-3 (AAW34234), Ce MOD-1 (NP 741580), Ce Gab1 (O18276), Hs GABA pi (NP 055026), Hs GABA beta (NP 000803), Rn GABA beta (NP 037088), Hs GABA alpha (P14867), Ce Unc49C (AAD42386), Ce Unc49B.1 (AAD42383), Ce Unc49A (AAD42382), Dr Gly (NP 571477), Hs Gly (AAC39919), Ma Gly (AAM23270), Ce GluCl 2 (NP 491470), Hc GluCla (AAD13405), Ce GluCl1 (AAA50785), Ce GluCl3 (CAB51708), Ce C39B10.2 (NP 509753), Dm HisCl2 (AAL66188), Dm HisCl1 (AAL66186), CeGGR3 (NP 494951), Ce LGC-52 (NP 502839) and Ce LGC-53 (NP 741945). 42

3.2 Examination of HcGGR3 in ML selected strains of H. contortus

We examined the nucleotide sequence of a 190 bp region of genomic DNA corresponding to the 3’ UTR from at least 30 worms from three different strains of H. contortus (PF23, IVF23 and MOF23). In this region of genomic DNA there was only a single nucleotide that was polymorphic (Fig. 2-2A). All the sequences belonging to the PF23 unselected strain were homozygous (T/T) at this position. In contrast, 47% and 17% of the worms belonging to the IVF23 and MOF23, respectively, were heterozygous (T/C) for this position (Fig. 2-2B). The differences in allele frequencies were found to be statistically significant with P < 0.03.

The transcript levels of HcGGR3 were then examined in female worms through qRT- PCR in the same three strains. We found that the transcript level of HcGGR3 is significantly down regulated in the ML selected laboratory strains compared to the unselected PF23 strain. Transcript levels were at least 5 times lower in the IVF23 strain and 25 times lower in the MOF23 strains compared to PF23 (Fig. 2-2C). The differences in the expression levels between the strains were statistically significant (P < 0.0001). The batch variations were not significant.

Fig. 2-2 (A) The genomic DNA sequence of the region corresponding to the 3’ UTR that was analyzed for single nucleotide polymorphisms. The SNP is underlined and bolded. (B) Allele frequency in the three stains (PF23, IVF23, MOF23) that were analyzed [n = 30]. Designation of T/T indicates homozygous for this position and T/C indicates heterozygous. The frequency of each allele is depicted by the graph. (C) Quantitative real- time RT-PCR analysis of the expression of HcGGR3 in female worms of the unselected PF23 strain and the ML selected strains, IVF23 and MOF23. The values are expressed as a fold change as compared to the PF23 strain (n = 3). Error bars indicate the standard deviation from mean.

3.3 HcGGR3 expression in different life-stages of H. contortus

Using qRT-PCR we examined the expression levels of HcGGR3 in different life stages of H. contortus. All PCRs were normalized using the 18s rRNA gene. The highest expression of all the stages was found in eggs, followed by females and L3 larvae. The lowest expression was found in adult male worms. Based on the two-way ANOVA performed using the absolute copy numbers for each of the life stages and batches, life stages had a significant effect (P < 0.0001). The batch variations were not significant. If the fold changes are calculated using the males as calibrator, the relative expression (fold increase) in females, eggs and larvae were (mean ± standard error) 905 ± 486, 1900 ± 1004 and 383 ± 205, respectively. In the female worms, expression in the anterior (free of eggs) and the posterior (containing eggs) were similar.

3.4 Immunolocalization of HcGGR3

Using an affinity purified antibody that was raised against a peptide of the predicted HcGGR3 polypeptide, we observed specific and distinct immunoreactivity in tissue associated with the anterior deirids; also referred to as cervical papillae. In females, the expression is punctate just around the anterior deirids (Fig. 2-3A to C). In males, the expression is seen around the anterior deirids as well as two processes that project laterally towards the posterior (Fig. 2-3F and 2-3G). No specific reactivity was observed in any of the controls used in these experiments (Fig. 2-3E and 2-3H).

Fig. 2-3 Immunolocalization of HcGGR3 in adult H. contortus (A–E are confocal images of the head region of female worms and F–H are of male worms). (A) Expression of HcGGR3 on the pair of deirids. (B) Magnified image of a single deirid. (C) Localization of HcGGR3 around the deirid of a second worm. (D) Phase contrast version of image C showing the spine-like projection of the deirid. (E) Negative control (peptide adsorbed antibody treated preparation). (F) Expression in one of the deirid bodies of a male worm and possibly sheath cells. (G) A second male worm showing expression in both the deirid bodies and sheath cells. (H) Negative control (peptide adsorbed antibody treated preparation). (AD, anterior deirid; DSo, deirid socket; ShC, sheath cell.)

3.5 Pharmacological characterization of the HcGGR3 channel

When expressed in Xenopus oocytes, HcGGR3 was able to form a homomeric channel that produced a robust response to 100 μM dopamine with an average amplitude of 866 ± 187 nA (n = 6 oocytes) and this current was dose dependent (Fig. 2-4A). This robust response was observed in oocytes from several frogs. No dopamine responses were observed in oocytes injected with H2 O. The channel also produced small responses to 1 mM octopamine and 1 mM serotonin and moderate responses to 1 mM tyramine (Fig. 2- 4B and 2-4C). In addition, 1 mM GABA and glutamate produced small currents in some oocytes (data not shown).

Fig. 2-4 HcGGR3 forms a homomeric ion channel that is activated by dopamine. (A) Response of HcGGR3 using 10 μM, 25 μM and 50 μM dopamine. Replicate experiments gave similar results. (B) Representative recording of the response of HcGGR3 to 100 μM dopamine compared to other biogenic amines at 1 mM. (C) Comparison of the mean amplitude of responses using various biogenic amines (n = 6 oocytes).

4. Discussion

Our study appears to be the first published report of the isolation and characterization of a LGIC subunit that, when expressed in Xenopus oocytes, forms a channel which responds to dopamine. In earlier reports, dopamine has been shown to elicit both fast excitatory post-synaptic potentials and slow post-synaptic inhibitory potentials in the giant dopamine neuron of the snails, Helisoma trivolvis and Planorbis corneus [21–23]. Whether the responses observed in these previous reports are the result of the presence of LGICs similar to HcGGR3 are unknown. Phylogenetically, HcGGR3 falls under the same clade as MOD-1, a serotonin-gated chloride channel [3], which places HcGGR3 among other biogenic amine channels. Dopamine is generally accepted to be a neurotransmitter for G- protein coupled receptors (GPCRs) and in C. elegans these include DOP-1 to DOP-4 [24]. One of the roles of dopamine in C. elegans includes being mediators of mechanosensation [25].

Nematodes appear to contain many unique LGCC subunits that may exhibit a variety of functions. For example, in C. elegans, the UNC-49 GABA-gated chloride channels are found predominately in somatic muscle at neuromuscular junctions and have an important function in locomotion [26]. The avr-15 glutamate-gated chloride channel is expressed in pharyngeal muscle and is important for glutamate mediated regulation of pharyngeal pumping [5]. Finally, the MOD-1 channel is expressed in the cell bodies and axons of several neurons in the head, ventral cord and tail and plays an important role in locomotion [7]. The completion of the C. elegans genome sequencing project [27] has unveiled a large number of LGCC subunit genes that have yet to be characterized. Therefore, it is clear that we are only beginning to unravel the functional diversity of this large group of nematode channels. Our results on the isolation of HcGGR3, a dopamine- gated ion channel and its localization to the deirids suggest a possible role for LGCCs as mediators of mechanosensation in parasitic nematodes.

Examination of the HcGGR3 gene has revealed a number of interesting characteristics. 48

For instance, the 3’ UTR displays putative regulatory motifs such as a K box sequence surrounded by CAAC motifs. The K box is a TGTGAT – motif present in the 3’ UTR of many genes in different organisms. This motif was first reported in a group of genes coding for the enhancer of split complex [E(spl)-C] in Drosophila and is a microRNA recognition site that regulates translational efficiency. The CAAC motifs appear to regulate mRNA stability [28]. It is generally believed that microRNA mediated regulation of gene expression is a key mode of regulation during development as it confers spatiotemporality. There are only a few genes in the C. elegans genome which possess these motifs in their 3’ UTR (V. Rao, personal observation). One that is pertinent to our study is a gene called mec-8, which encodes an RNA binding protein. This protein regulates the alternative splicing of unc-52 transcripts in C. elegans hypodermal cells and hence is important in mechanosensory function [29]. However, the exact function of these putative regulatory sites in the HcGGR3 gene is unknown at this time. The presence of various putative regulatory motifs in 3’ UTR and the fact that we see highest mRNA expression in the eggs indicate that HcGGR3 may also be important in development. In addition, we have observed a striking difference in expression between male and female worms. This gender bias is a phenomenon that has been reported in several transcripts in the filarial nematode, Brugia malayi [30]. We have found some key changes in the HcGGR3 gene that appear to be associated with

ML selection. Firstly, in a portion of the 3’ UTR, we have discovered a SNP that was only detected in worms that have been selected with MLs. The implications for this observation are unknown at this time. Second, we have found significant down regulation in the transcript levels of HcGGR3 in two separate ML selected strains as compared to the genetically related unselected strain. The fact that we have observed lower expression of

HcGGR3 in the ML-selected laboratory stains of H. contortus and the SNP in 3₃ UTR suggests that HcGGR3 is somehow under selective pressure when these worms are treated with MLs over a number of generations. However, based on our results, we cannot demonstrate a definite link between the SNP and the lower transcript levels of HcGGR3 in the drug selected strains. Genotyping of a longer stretch of 3₃ UTR sequence could shed 49 more light on this. However, changes in LGCC channel genes in H. contortus due to ML selection is not a new phenomenon as it has been reported for genes encoding both glutamate-gated chloride channels and GABA receptors [31]. Future studies on the possible interaction of MLs with the HcGGR3 channel could prove useful in determining any possible role for this subunit in ML resistance.

Using an antibody that was raised against a peptide of the HcGGR3 amino acid sequence, we have detected distinct immunoreactivity around structures called the anterior deirids. Deirids are a pair of cervical papillae present in the head region of both male and female worms and are thought to be involved in mechanosensation [32]. In our study, both male and female worms showed HcGGR3 expression around the anterior deirids. However, there were some gender differences in the expression patterns. In female worms, HcGGR3 is expressed in what we believe are socket cells that surround the deirid and, in male worms, it is expressed in both socket and what we believe to be sheath cells.

The socket and sheath cells are modified glial cells. Socket cells act to join the sensillum to the hypodermis, while the sheath cell envelops the endings of neurons [33]. In C. elegans, the socket cell ending is responsible for forming a compartmentalized space under the cuticle. Hence, it is also called a modified hypodermal cell. The sheath cells may also have secretory function in the amphids [34]. Socket cells are also known to play a role in calcium-dependent olfactory and temperature adaptation [35]. Glial cells are known to provide axonal guidance for the formation of synaptic interface between the external environment and the nervous system [36].

We believe that HcGGR3 is the first ligand-gated anion channel subunit discovered to be expressed in glial like cells in nematodes. It is interesting to note that LEV-8, a nicotinic acetylcholine receptor subunit has been reported to be expressed in the mechanosensory inner labial and outer labial socket cells in C. elegans [37]. In mammals, glial cells have been shown to possess ionotropic receptors for various ligands including GABA [38–40]. Furthermore, in Drosophila, a histamine-gated chloride channel has been shown to be expressed in the lamina epithelial glial cells, where it plays a subtle but 50 significant role in shaping the large monopolar cell (LMC) response at the photoreceptor synapse [41].

Since HcGGR3 is gated by dopamine and the subunit is localized to deirid socket/sheath cells, one can summarize that this subunit may be playing a role in dopamine mediated mechanosensation in H. contortus. Similarly in C. elegans, the dopamine receptor DOP-1, a GPCR, has been shown to be important for mechanosensation and is expressed in major mechanosensory neurons as well as head muscles, excretory gland cells, amphid and labial support cells in C. elegans [25]. Further examination of the role of dopamine and HcGGR3 in H. contortus may shed some light on the importance of ion channel mediated neurotransmission in the mechanosensory processes that are important in the biology of parasitic nematodes.

Acknowledgments

Financial support for this study was from NSERC, the FQRNT Centre for Host-Parasite Interactions, Fort Dodge Animal Health, and UOIT. We wish to thank Ms. Kathy Keller for providing the worms. We wish to convey our thanks to Dr. Umashankar PK for his help in cloning of HcGGR3 and Dr. Robin Beech for his comments and suggestions on the phylogenetic analysis and the manuscript. We are grateful to Dr. Paula Ribeiro for her comments and advice on qRT-PCR as well as the immunolocalization results. Thanks to Dr. Paul Kreig for the pT7Ts vector. Finally, we would like to thank the anonymous reviewers whose comments greatly improved the manuscript.

References

[1] Sine SM, Engel AG. Recent advances in Cys-loop receptor structure and function. Nature 2006;440:448-55. [2] Green WN, Wanamaker CP. The role of the cysteine loop in acetylcholine receptor assembly. J Biol Chem 1997;272:20945–953. [3] Dent JA. Evidence for a diverse cys-loop ligand-gated ion channel superfamily in early bilateria. J Mol Evol, 2006;62:523-35. [4] Cully DF, Vassilatis DK, Liu KK, Paress PS, Van der Ploeg LH, Schaeffer JM, Arena JP. Cloning of an avermectin-sensitive glutamate-gated chloride channel from Caenorhabditis elegans. Nature 1994;20:707-11. [5] Dent JA. avr-15 encodes a chloride channel subunit that mediates inhibitory glutamatergic neurotransmission and ivermectin sensitivity in Caenorhabditis elegans. EMBO J 1997;1:5867-879. [6] Putrenko I, Zakikhani M, Dent JA. A family of acetylcholine-gated chloride channel subunits in Caenorhabditis elegans. J Biol Chem 2005;280:6392–398. [7] Ranganathan R, Cannon SC, Horvitz HR. MOD-1 is a serotonin-gated chloride channel that modulates locomotory behaviour in C. elegans. Nature 2000;23:470- 75. [8] Jones A, Sattelle DB. The cys-loop ligand-gated ion channel gene superfamily of the nematode Caenorhabditis elegans. Invert Neurosci 2008;8:41-7. [9] Forrester SG, Prichard RK, Beech RN. A glutamate-gated chloride channel subunit from Haemonchus contortus: expression in a mammalian cell line, ligand binding, and modulation of anthelmintic binding by glutamate. Biochem Pharmacol 2002;63:1061-68. [10] Prichard RK, Geary TG. Drug discovery: Fresh hope to can the worms. Nature 2008; 452:157-58. [11] Fleming S, Craig T, Kaplan RM. Anthelmintic resistance of gastrointestinal parasites in small ruminants. J Vet Intern Med 2006;20:435-44. 52

[12] Eng JK, Blackhall WJ, Osei-Atweneboana MY, Bourguinat C, Galazzo D, Beech RN, Unnasch TR, Awadzi K, Lubega GW, Prichard RK. Ivermectin selection on beta-tubulin: evidence in Onchocerca volvulus and Haemonchus contortus. Mol Biochem Parasitol 2006;150:229-35. [13] Osei-Atweneboana MY, Eng JK, Boakye DA, Gyapong JO, Prichard RK. Prevalence and intensity of Onchocerca volvulus infection and efficacy of ivermectin in endemic communities in Ghana: a two-phase epidemiological study.

Lancet 2007; 369:2021-9. [14] Wolstenholme AJ, Fairweather I, Prichard RK, von Samson-Himmelstjerna G, Sangster NC. Drug resistance in veterinary helminthes. Trends in Parasitology 2004;20:469-76. [15] Weston D, Patel B, Van Voorhis WC. Virulence in Trypanosoma cruzi infection correlates with the expression of a distinct family of sialicase superfamily genes. Parasitology 1999;98:105-16. [16] Frohman MA, Dush MK, Martin GR. Rapid production of full-length cDNAs from rare transcripts: amplification using a single gene-specific oligonucleotide primer. Proc Natl Acad Sci 1988;85:8998-9002. [17] Ranjan S, Wang GT, Hirschlein C, Simkins KL. Selection for resistance to macrocyclic lactones by Haemonchus contortus in sheep. Vet Parasitol 2002;103:109-17. [18] Bagnall NH, Kotze AC. cDNA cloning and expression patterns of a peroxiredoxin, a catalase and a glutathione peroxidase from Haemonchus contortus. Parasitol Res 2004; 94:283-89. [19] Delany NS, Laughton DL, Wolstenholme AJ. Cloning and localisation of an avermectin receptor-related subunit from Haemonchus contortus. Mol Biochem Parasitol 1998;97:177-87. [20] Galzi JL, Devillers-Thiéry A, Hussy N, Bertrand S, Changeux JP, Bertrand D. Mutations in the channel domain of a neuronal nicotinic receptor convert ion selectivity from cationic to anionic. Nature 1992;359:500-5. [21] Green KA, Harris SJ, Cottrell GA. Dopamine directly activates a ligand-gated channel in snail neurons. Pflfigers Arch Eur J Physiol 1996;431:639-44 53

[22] Berry MS, Cottrelt GA. Ionic basis of different synaptic potentials mediated by an identified dopamine-containing neuron in Planorbis. Proc R Soc Lond Biol 1979;203:427-444 [23] Berry MS, Cottrell GA. Excitatory, inhibitory and biphasic synaptic potentials mediated by an identified dopamine-containing neurone. J Physiol (Lond) 1975;225:73-209 [24] Chase DL, Pepper JS, Koelle MR. Mechanism of extra synaptic dopamine signaling in C. elegans. Nat. Neurosci 2004;7:1096–1103 [25] Sanyal S, Wintle R., Kindt KS, Nuttley WM, Arvan R, Fitzmaurice P, Bigras E, Merz DC, Hebert TE, van der Kooy D, Schafer WR, Culotti JG, Van Tol HH. Dopamine modulates the plasticity of mechanosensory responses in C. elegans. EMBO J 2004;23: 473–82. [26] Bamber BA, Beg AA, Twyman RE, Jorgensen EM. The Caenorhabditis elegans unc-49 locus encodes multiple subunits of a heteromultimeric GABA receptor. J Neurosci 1999;19:5348-359. [27] The C. elegans consortium. Genome sequence of the nematode C. elegans: a platform for investigating biology. Science 1998;282:2012-18. [28] Lai EC, Burks C, Posakony JW. The K box, a conserved 3' UTR sequence motif, negatively regulates accumulation of enhancer of split complex transcripts. Development 1998;125:4077-88. [29] Spike CA, Davies AG, Shaw JE, Herman RK. MEC-8 regulates alternative splicing of unc-52 transcripts in C. elegans hypodermal cells. Development 2002;129:4999–5008. [30] Li BW, Rush AC, Tan J, Weil GJ. Quantitative analysis of gender-regulated transcripts in the filarial nematode Brugia malayi by real-time RT-PCR. Mol Biochem Parasitol 2004; 137:329-37. [31] Prichard RK. Ivermectin resistance and overview of the Consortium for Anthelmintic Resistance SNPs. Expert Opin Drug Discov 2007;2:S41-S52. [32] Gibbons LM. SEM guide to the morphology of nematode parasites of vertebrates. CABI, UK 1986. 54

[33] White JG, Southgate E, Thomson JN, Brenner S. The structure of the nervous system of the nematode Caenorhabditis elegans. Philos Trans R Soc Lond B Biol Sci 1986;314:1–340. [34] Ashton F, Li J, Schad GA. Chemo- and thermosensory neurons: structure and function in animal parasitic nematodes. Vet Parasitol 1999;84:297-316. [35] Culetto E, Baylis HA, Richmond JE, Jones AK, Fleming JT, Squire MD, Lewis JA, Sattelle DB. Odorant-specific adaptation pathways generate olfactory plasticity in C. elegans. Neuron 1995.14:803-12. [36] Shaham S, Glia–neuron interactions in the nervous system of Caenorhabditis elegans. Current Opinion in Neurobiology 2006;16:522–28. [37] Towers PR, Edwards B, Richmond JE, Sattelle DB. The Caenorhabditis elegans lev-8 gene encodes a novel type of nicotinic acetylcholine receptor alpha subunit. J Neurochem 2005;93:1-9. [38] Bormann J, Kettenmann H. Patch clamp study of GABA receptor chloride channels in rat cultured astrocytes. Proc Natl Acad Sci U S A, 1988;85:9336-40. [39] Walz W. Chloride/anion channels in glial cell membranes. Glia, 2002;40:1-10. [40] Williamson AV, Mellor JR, Grant AL, Randall AD. Properties of GABAA receptors in cultured rat oligodendrocyte progenitor cells. Neuropharmacology, 1998;37:859-73. [41] Pantazis A, Segaran A, Che-Hsiung Liu, Nikolaev A, Rister J, Thum AS, Roeder T, Semenov E, Juusola M, Hardie RC. Distinct roles for two histamine receptors (hclA and hclB) at the Drosophila photoreceptor synapse. The Journal of Neuroscience, 2008;28:7250-59.

Connecting statement I The prime objective of this research project has been to deorphanize LGCCs from H. contortus. The previous manuscript has described the characterization of a DA-gated chloride channel subunit. Since, DA is a biogenic amine; I was interested to investigate other potential amine-gated ion channels that were closely related to Hco-GGR-3 (previously known as HcGGR3). As part of the search for new subunits, I managed to clone full length of Hco-LGC-55. Phylogenetic analysis suggested that this subunit could also be gated by a biogenic amine. Hence, I chose to functionally characterize this subunit. The next chapter describes the characterization of Hco-LGC-55.

Chapter III

Manuscript II

Characterization of a novel tyramine-gated chloride channel from Haemonchus contortus

Vijayaraghava T. S. Rao, Michael V. Accardi, Salma Z. Siddiqui, Robin N. Beech, Roger K. Prichard and Sean G. Forrester

Molecular Biochemical Parasitology, 173, 64-68 (2010)

Abstract Tyramine (TA), a trace amine, is becoming accepted as a main stream neurotransmitter in invertebrates. Recent evidence indicates that part of the function of TA in nematodes involves a novel receptor (Cel-LGC-55) from the ligand-gated chloride channel class of ionotropic receptors. However, the role of TA or its receptors in the biology of nematode parasites is limited. Haemonchus contortus is a deadly parasitic worm which causes significant economic burden in the production of small ruminants in many parts of the world. In this study, we have cloned and characterized a novel LGCC from H. contortus which we have named Hco-LGC-55. This receptor subunit is a clear ortholog of Cel- LGC-55 and is able to form a homomeric chloride channel that is gated by tyramine, dopamine and octopamine. Semi-quantitative reverse transcription-polymerase chain reaction (sqRT-PCR) shows that this subunit is expressed in all life-cycle stages of the worm, but appears to have reduced mRNA expression in the adult male.

1. Introduction

Infection with the parasitic nematode Haemonchus contortus is one of the biggest challenges in the production of small ruminants causing high economic losses worldwide [1]. H. contortus and the model free living nematode Caenorhabditis elegans are both members of clade V [2] and as such, many of the proteins that are found in C. elegans appear to have counterparts with similar sequence homology in H. contortus. This is especially true for a very large family of proteins called ligand-gated chloride channels (LGCCs). LGCCs are pentameric membrane proteins that play an important role in fast- synaptic inhibitory neurotransmission [3]. There appears to be several unique LGCC families found in both C. elegans and H. contortus that are activated by a wide range of neurotransmitters such as glutamate [4, 5], GABA [6], and acetylcholine [7]. In addition, recent finding have revealed that both nematodes utilize a novel family of LGCCs that are receptors for biogenic amines, such as serotonin [8], dopamine [9, 10] and tyramine [10, 11]. The fact that these novel amine receptors have only been found in nematodes and not mammals, may position them as novel targets for future anthelmintic development. However, the first endeavor is to clearly define their importance in the biology of parasitic nematodes such as H. contortus. Furthermore, since many of these receptors appear to be common in C. elegans and H. contortus, this will facilitate future investigations that compare the function of these proteins between two nematodes with completely different lifestyles.

TA is a biogenic amine that is more abundant in invertebrate organisms compared with vertebrates [12], and has long been considered as a biosynthetic intermediate of octopamine and not as a neurotransmitter per se. However, recent research on C. elegans indicates that TA is, in fact, a true neurotransmitter. For instance, it has been demonstrated that in C. elegans tyraminergic cells are distinct from octopaminergic cells [13] while TA itself plays a crucial role in the suppression of head oscillations during the worm’s response to anterior touch. This action is the direct result of the activation of a novel type of TA-gated chloride channel called Cel-LGC-55 [11]. Furthermore, there are other C. elegans tyramine receptors from the G-protein-coupled receptor class (SER-2, TYRA-2 59 and TYRA-3) that have also been identified [14–17]. While these findings have contributed to mounting evidence of the importance of this biogenic amine in C. elegans, there is not much known about the significance of TA as a neurotransmitter in parasitic nematodes. Previous research has demonstrated the presence of TA in the parasite Nippostrongylus brasiliensis [18] and Trichostrongylus colubriformis [19], while TA- receptors from the GPCR class have been identified in Brugia malayi [20]. These findings indicate that, as in C. elegans, TA and its receptors may play important roles in parasitic nematodes. In our study, we have cloned and characterized a novel TA-gated chloride channel (Hco-LGC-55) subunit from H. contortus. This channel responds strongly to TA and dopamine (DA) and to a lesser extent octopamine (OA).

2. Materials and methods

2.1 Cloning and sequencing of Hco-lgc-55

Total RNA was isolated from female worms belonging to the PF23 strain [21] of H. contortus using RNAStat (Tel-Test Inc.). First strand copy DNA (cDNA) was synthesized using 1 μg of total RNA and an oligo-dT adapter primer, 5’ -

CCTCTGAAGGTTCACGGATCACGGATCCACATCTAGA(T)17VN-3’ [22] with Omniscript reverse transcriptase (Qiagen). The RT reaction was always preceded by a genomic DNA elimination step. A partial sequence of Hco-lgc-55 was obtained by searching for unique LGCC sequences using the server at the Sanger Institute (Cambridge,

UK). Using this partial sequence, a gene specific primer: 5’ -

CGACACAGCCGAACATAAAAAG-3’, along with a spliced leader (SL2) primer: 5’ -

GGTTTTAACCCAGTTACTCAAG-3’, was used in a 5’ rapid amplification of cDNA ends (RACE) polymerase chain reaction (PCR) [23]. To isolate the 3’ end of Hco-lgc-55, the gene specific primer: 5’ -GTTTCTTCACTTATGGCTCTTAC-3’ along with a primer annealing to the oligo-dT-anchor sequence were used in a second RACE PCR reaction.

The full length cDNA of Hco-lgc-55 was isolated using primers specific to the 5’ and 3’ 60 ends of the gene in a PCR. Several clones were sequenced in order to construct the consensus sequence.

2.2 Phylogenetic analysis

Maximum likelihood phylogenies of LGCCs were reconstructed using the PhyML [24] plugin of Geneious (Biomatters Ltd.) based on sequences depicted in the tree (Fig. 3-1C), and aligned using PromalS3D [25]. Specified additional structures used in the alignment were 2BG9 chains A, B, C and E. These were used to align the sequences base on their secondary structure.

2.3 Semi-quantitative reverse transcription-polymerase chain reaction (sqRT- PCR) of Hco-lgc-55 in various life-cycle stages of H. contortus

cDNA from various life stages of H. contortus was prepared as described above. A 594 base pair fragment of Hco-lgc-55 was PCR-amplified using the forward primer: 5’ -

GTTTCTTCACTTATGGCTCTTAC-3’ and the reverse primer: 5’ -

TCAATCTTTTGACTTTGCTGTATAG-3’. A 352 base pair fragment of a house keeping gene, α-tubulin, Hco-tub-1 (GenBank: X80046) was amplified using the forward primer:

5’ -GTTCTTCAGGAGGCAAGTATG-3’ and the reverse primer: 5’ -

CCATTCCAGATCCAGTGC-3’ . The PCR products were analyzed by 1% agarose-gel electrophoresis.

2.4 Expression of Hco-lgc-55 in Xenopus laevis oocytes

The coding sequence of Hco-lgc-55 was sub-cloned into the oocyte expression vector, pT7Ts. The vector was then linearized and used as template in an in vitro transcription reaction (T7 mMessage mMachine kit, Ambion) producing the corresponding copy RNA (cRNA). The cRNA was subsequently precipitated using lithium chloride. X. laevis 61 oocytes were injected with 50 nL of Hco-lgc-55 cRNA (0.5 ng/nL) using a Drummond Nanoject microinjector and incubated at 20 ◦ C in ND96 (96 mM NaCl, 2 mM KCl, 1 mM

MgCl2, 1.8 mM CaCl2, 5 mM HEPES pH 7.5) supplemented with 0.275 μg/mL pyruvate and 100 μg/mL gentamycin (Sigma). Recordings were routinely made 2–5 days post cRNA injection [6].

2.5 Electrophysiological Recordings

Two-electrode voltage clamp electrophysiology was performed using the Axoclamp 900A voltage clamp (Molecular Devices). Glass electrodes containing Ag|AgCl wire were filled with 3M KCl and had a resistance between 1 and 5 MΩ. Oocytes were clamped at a -60 mV for the duration of the experiments. Ligands such as TA, DA and octopamine (Sigma) were dissolved in ND96. These were washed over the oocytes using an RC-1Z recording chamber (Warner Instrument Inc.). Data was obtained and analyzed using the Clampex software (Molecular Devices) and graphs were produced using GraphPad Prism

Software 5.0 (San Diego, California, USA). EC50 values were determined by generating dose response curves fitted to the equation:

Imax = 1 ______

{1 + (EC50/[D])h}

In the above equation, Imax denotes the maximal response, [D] is the concentration of drug,

EC50 is the concentration of drug that is required to produce half-maximal current, and h is the Hill coefficient. Imax, EC50 and h are free parameters. The curves were then normalized to the estimated Imax. The same equation was then used to fit the data into a sigmoidal curve of variable slope to the normalized data (GraphPad) [6]. Current voltage relationships were performed by changing the holding potential in 20 mV steps from -60 mV to +60 mV, and at each step the oocyte was exposed to 1 mM TA. For reduced chloride trials, NaCl was partially substituted with Na-gluconate (Sigma) in - the ND96 for a final Cl concentration of 67.3 mM.

3. Results

3.1 Cloning of Hco-lgc-55

Using the 5’ and 3’ RACE procedure, we obtained an 1870 bp cDNA fragment, named

Hco-lgc-55. The complete gene is predicted to include a short 27 bp stretch of 5’ UTR with the spliced leader (SL2) sequence, 1578 bp of coding sequence and 265 bp of 3’ UTR sequence (see GenBank accession number FJ817373). When translated the predicted Hco- LGC-55 is 525 amino acids in length and includes a signal peptide sequence at the extreme N-terminus ( http://www.cbs.dtu.dk/services). Hco-LGC-55 has all the typical features of a cys-loop ligand-gated ion channel subunit including an N-terminal ligand binding domain, the characteristic cys-loop and four transmembrane regions (M1–M4) (Fig. 3-1A). The M2 region, which determines ion selectivity, exhibits the PAR (Proline– Alanine–Arginine) motif which is characteristic of anion channels [26] (Fig. 3-1B). The Hco-LGC-55 protein shares 89% similarity with its C. elegans ortholog, Cel-LGC-55 (Fig. 3-1A). The protein also shares similarity to other C. elegans subunits such as Cel- LGC-53 at 63%, Cel-LGC-54 at 60%, Cel-LGC-51 at 65% and Cel-LGC-52 at 68%.

3.2 Gene identification

The nomenclature of nematode genes is based on the genetic relationship with homologous genes in C. elegans [27]. Phylogenetic analysis places Hco-LGC-55 within a clade of LGCC subunits that includes other dopamine, serotonin and acetylcholine-gated chloride channels including Hco-GGR-3 [9]. There is strong boot-strap support that Hco- LGC-55 is orthologous to the Cel-LGC-55 gene and it has been named accordingly (Fig. 3-1C).

Fig. 3-1 (A) Alignment of Hco-LGC-55 and Cel-LGC-55 protein sequences. The two cysteine residues that make up the cysteine loop (CX13 C) have been highlighted within rectangular boxes. The four membrane spanning domains (M1–M4) are underlined and the predicted signal peptide cleavage site is indicated by (H). Shading indicates identity. (B) Alignment of second transmembrane region of various LGIC protein subunits indicating that Hco-LGC-55 is an anion selective channel. (C) Phylogenetic analysis of Hco-LGC-55 with various other LGCCs shows that Hco-LGC-55 is an ortholog of Cel- LGC-55. Bootstrap values are indicated. The GenBank accession numbers of the sequences included in the analysis are as follows: Cel-LGC-37 (NP 499662), Hco-LGC- 37 (CAA51991.1), Cel-ACC-1 (NP 501715), Cel-MOD-1a (AAF98227.2), Cel-LGC-55 (NP 507870.2), Hco-LGC-55 (FJ817373), Cel-LGC-54 (NP 504741), Cel-LGC-53a (NP 741945.3), Hco-LGC-53 (ACJ65067.1), Cel-GGR-3 (NP 494951.2), Hco-GGR-3 (ABP04038.1), Cel-LGC-52 (NP 502839.2) and Cel-lgc-51 (NP 490946.3).

3.3 Hco-lgc-55 expression in different life-stages of H. contortus

Using semi-quantitative RT-PCR we examined the expression levels of Hco-lgc-55 in different life-stages of H. contortus. The Hco-lgc-55 expression was detected in all the stages (Fig. 3-2); the highest band intensity was detected in the L3 larval stage and the lowest in adult male worms. The eggs interestingly showed considerable expression. Replicate experiments showed the same trend. No PCR products were obtained in negative controls that lacked reverse transcriptase.

Fig. 3-2 Hco-lgc-55 is expressed in all life-cycle stages of H. contortus. Reverse transcription-PCR analysis of Hco-lgc-55 in different stages of H. contortus compared to α-tubulin, which was used as a housekeeping gene. Replicate experiments showed the same trend.

3.4 Pharmacological characterization of Hco-LGC-55

Heterologous expression of Hco-lgc-55 in X. laevis oocytes resulted in the formation of a homomeric amine-gated chloride channel. Many ligands including biogenic amines were tested on the oocytes expressing Hco-LGC-55. Of all the ligands tested, TA elicited the most robust currents. Other amines such as dopamine and octopamine, at the same concentration used for TA (10 μM), elicited relatively smaller currents. Serotonin and acetylcholine did not produce any response at 10 μM (Fig. 3-3A). The EC50 for TA, DA and OA activation of Hco-LGC-55 was 5.8 ± 1.0 μM (n = 5), 25.2 ± 1.8 μM (n = 10) and 134.0 ± 30.0 μM (n = 7), respectively (Fig. 3-3B and 3-C). The Hill coefficients with standard error of mean of different agonists were 1.014 ± 0.1, 1.260 ± 0.06 and 1.13 ± 0.09 for TA, DA and OA, respectively. These results clearly indicate that the Hco-LGC- 55 subunit forms a homomeric channel gated by TA.

The presence of the PAR motif indicated that Hco-LGC-55 was anion selective. In order 65 to ascertain if this channel was chloride selective, we analyzed the current–voltage relationship for Hco-LGC-55 in standard (100.8 mM) and reduced (67.3 mM) chloride concentrations. Under standard chloride concentration condition, the reversal potential was -15.6 mV. For reduced chloride condition, chloride ion was partially replaced by another anion, gluconate which caused a shift in the reverse potential to −4.3 mV (Fig. 3- 3D). This shift in the reversal potential is in close agreement with the quantum of shift as calculated using the Nernst equation and demonstrates that Hco-LGC-55 is a chloride selective channel.

Fig. 3-3 (A) Electrophysiological trace depicting the response of Hco-LGC-55 expressed in X. laevis oocytes to the application of different neurotransmitters (10 μM). Order of application of ligands is TA (tyramine), OA (octopamine), 5-HT (5-hydroxy tryptamine), Ach (acetylcholine) and DA (dopamine). (B) Representative traces depicting the electrophysiological dose–response relationship of Hco-LGC-55 to increasing concentrations of TA (0.5–500 μM) (n = 5). (C) Hco-LGC-55 dose–response curves for TA, OA and DA performed in X. laevis oocytes. TA EC50 = 5.8 ± 1 μM; DA EC50 = 25.2 ± 1.8 μM, and OA EC50 = 133 ± 30 μM. Each data point represents the mean current value normalized to the mean maximum current observed for individual ligands. Error bars represent standard error of mean (SEM). (D) Current–voltage relationship plot for Hco- LGC-55. Graph depicts the electrophysiological response of Hco-LGC-55, clamped at various voltages at two different chloride concentrations (normal, 100.8 mM and reduced, 67.3 mM). Rightward shift under reduced chloride conditions indicated that Hco-LGC-55 channel is chloride selective. Error bars represent the standard error of the mean (SEM). 66

4. Discussion

Biogenic amine neurotransmitters such as serotonin and dopamine are known to mediate several physiological roles in vertebrates such as learning and memory and have been implicated in several psychological disorders in humans [28]. Another biogenic amine, TA, has previously been classified as only an intermediate or by-product of other biogenic amines [11]. However, the recent identification of a new family of G-protein-coupled receptors (GPCRs), the trace amine-associated receptors (TAARs) in mammals, which have a high affinity for TA, indicates that TA may possess a unique function entirely independent of classical biogenic amines [29, 30].

In invertebrates, TA has long been labeled as an intermediate for the synthesis of OA. However, more recently TA has gained attention as a neurotransmitter which acts on GPCRs in several invertebrate species including D. melanogaster (Tyr-dro) [31], the silk worm (BmTAR2) [32], and recently the American cockroach [33]. In C. elegans, SER-2, TYRA-2 and TYRA-3 have also been shown to be TA-receptors [14–17]. Additionally, a tyramine receptor in the parasitic nematode B. malayi was recently isolated and found to exhibit a high identity and similar pharmacological characteristics as the C. elegans TYRA-2 [20]. Perhaps more intriguing was the very recent discovery of a novel C. elegans TA-receptor from the cys-loop family of ligand-gated chloride channels (Cel- LGC-55) which plays an important role in the regulation of locomotion and head movement [11].

In the current study, we have shown that H. contortus possesses an ortholog of Cel- LGC-55, which is also an ionotropic TA-gated receptor subunit. Hco-LGC-55 responds most potently to TA with an EC50 that falls well within the range reported for the C. elegans counterpart [10]. However, we did observe some characteristics that were different from those reported for the C. elegans receptor. Most notably, the DA EC50 for Hco-LGC-55 is 6 times lower relative to that of the C. elegans channel [11]. This could be an indication that Hco-LGC-55 also functions as a DA-gated chloride channel in vivo. Interestingly, we also found that the dopamine receptor antagonist clozapine [34] causes a 67 small inhibition of Hco-LGC-55 (data not shown). We have previously identified a novel DA-gated chloride channel (Hco-GGR-3) in H. contortus [9]. It appears therefore that, as in C. elegans, amine-gated chloride channels play key roles in the biology of H. contortus.

The in vivo function of Hco-lgc-55 will be the focus of future investigations. In C. elegans, the Cel-LGC-55 subunit was found to be expressed postsynaptically to RIM neurons in the head including the nerve ring, a few neck muscles, and uterine cells as well as in the tail muscle cells. This subunit appears to play a mechanosensory role in C. elegans, controlling the head movement (suppression of oscillation) during the response to an anterior touch [11]. Interestingly, we have found that when H. contortus adult female worms are exposed to exogenous TA (20 mM) in vitro, they exhibit altered movement in the anterior region (1/4th of the total body length) where as the remaining posterior region (3/4th of the body length) was paralyzed (supplemental data: video file). However, it is unclear whether this observation is the result of the binding of TA to Hco-LGC-55 or some other receptor or other targets. From the sqRT-PCR results, it is clear that the Hco- lgc-55 gene is expressed in all the life-cycle stages of H. contortus with the highest expression in the L3 larval stage. The importance of Hco-lgc-55 in the L3 is unknown, but may be relevant to their unique locomotive requirements. In addition, the expression of this subunit in eggs raises questions on the possible involvement of this channel subunit in development. Further research is necessary to determine whether Hco-LGC-55 shares similarities in function to its C. elegans counterpart.

A very recent study has shown the interaction of two potential nematicidal agents, thymol and carvacrol, with the C. elegans TA-receptor, SER-2 in a heterologous expression system [35]. This highlights the relevance of TA-receptors as potential drug targets. Our study has provided further evidence for the importance of TA as a neurotransmitter in parasitic nematodes and has unveiled another receptor that could serve as a possible anthelmintic target.

Acknowledgments Financial support for this study was from NSERC, the FQRNT Centre for Host-Parasite Interactions, Fort Dodge Animal Health (now Pfizer Animal Health), and UOIT. We wish to thank Ms. Kathy Keller for providing the worms and Dr. Joseph Nabhan for cloning a portion of Hco-lgc-55. We are also grateful to Dr. Joseph Dent for valuable discussions.

References

[1] Nikolaou S and Gasser RB. Prospects for exploring molecular developmental processes in Haemonchus contortus. Int J Parasitol 2006;36:859-868.

[2] Blaxter ML, De Ley P, Garey JR, Liu LX, Scheldeman P, Vierstraete A, Vanfleteren JR, Mackey LY, Dorris M, Frisse LM, Vida JT, Thomas WK A molecular evolutionary framework for the phylum Nematoda. Nature 1998;5:71-5

[3] Sine SM, Engel AG. Recent advances in Cys-loop receptor structure and function. Nature 2006;440:448-55.

[4] Cully DF, Vassilatis DK, Liu KK, Paress PS, Van der Ploeg LH, Schaeffer JM, Arena JP. Cloning of an avermectin-sensitive glutamate-gated chloride channel from Caenorhabditis elegans. Nature 1994;20:707-11.

[5] Dent JA. avr-15 encodes a chloride channel subunit that mediates inhibitory glutamatergic neurotransmission and ivermectin sensitivity in Caenorhabditis elegans. EMBO J 1997;1:5867-879.

[6] Siddiqui SZ, Brown DR, Rao VTS, Forrester SG. An UNC-49 GABA receptor subunit from the parasitic nematode Haemonchus contortus is associated with enhanced GABA sensitivity in nematode heteromeric channels. J Neurochem 2010; In press.

[7] Putrenko I, Zakikhani M, Dent JA. A family of acetylcholine-gated chloride channel subunits in Caenorhabditis elegans. J Biol Chem 2005;280:6392–398.

[8] Ranganathan R, Cannon SC, Horvitz HR. MOD-1 is a serotonin-gated chloride channel that modulates locomotory behaviour in C. elegans. Nature 2000;23:470- 75. 70

[9] Rao VTS, Siddiqui SZ, Prichard RK, Forrester SG. A dopamine-gated ion channel (HcGGR3*) from Haemonchus contortus is expressed in the cervical papillae and is associated with macrocyclic lactone resistance. Mol Biochem Parasitol 2009;166:54-61.

[10] Ringstad N, Abe N, Horvitz HR. Ligand-gated chloride channels are receptors for biogenic amines in C. elegans. Science 2009;325(5936):96-100.

[11] Pirri JK, McPherson AD, Donnelly JL, Francis MM, Alkema MJ. A tyramine- gated chloride channel coordinates distinct motor programs of a Caenorhabditis elegans escape response. Neuron 2009;62(4):526-38.

[12] Lange AB. Tyramine: From octopamine precursor to neuroactive chemical in insects. Gen Comp Endocrinol 2008;162(1):18-26.

[13] Alkema MJ, Hunter-Ensor M, Ringstad N, Horvitz HR. Tyramine functions independently of octopamine in the Caenorhabditis elegans nervous system. Neuron 2005;46(2):247-60.

[14] Rex E, Komuniecki RW. Characterization of a tyramine receptor from Caenorhabditis elegans. J Neurochem 2002;82(6):1352-59.

[15] Rex E, Hapiak V, Hobson R, Smith K, Xiao H, Komuniecki R. TYRA-2 (F01E11.5): a Caenorhabditis elegans tyramine receptor expressed in the MC and NSM pharyngeal neurons. J Neurochem 2005;94(1):181-91.

[16] Tsalik EL, Niacaris T, Wenick AS, Pau K, Avery L, Hobert O. LIM homeobox gene-dependent expression of biogenic amine receptors in restricted regions of the C. elegans nervous system. Dev. Biol 2003;263:81-102.

[17] Wragg RT, Hapiak V, Miller SB, Harris GP, Gray J, Komuniecki PR, Komuniecki RW. Tyramine and octopamine independently inhibit serotonin-stimulated aversive behaviors in Caenorhabditis elegans through two novel amine receptors. J Neurosci 2007;27(49):13402-12. 71

[18] Goudey-Perrière F, Grosclaude JM, Nembo B, Barreteau H, Jacquot C, Gayral P. Levels of biogenic amines in larvae and adults of the rat hookworm, Nippostrongylus brasiliensis (Nematoda). Comp Biochem Physiol A Physiol 1997;118(3):615-23.

[19] Frandsen JC, Bone LW. Biogenic amines and their metabolites in Trichostrongylus colubriformis, a nematode parasite of ruminants. Comp Biochem Physiol C 1987;87(1):75-7.

[20] Smith KA, Rex EB, Komuniecki RW. Are Caenorhabditis elegans receptors useful targets for drug discovery: Pharmacological comparison of tyramine receptors with high identity from C. elegans (TYRA-2) and Brugia malayi (Bm4)? Mol Biochem Parasitol 2007;154:52-61.

[21] Ranjan S, Wang GT, Hirschlein C, Simkins KL. Selection for resistance to macrocyclic lactones by Haemonchus contortus in sheep. Vet Parasitol 2002;103: 109-17.

[22] Weston D, Patel B, Van Voorhis WC. Virulence in Trypanosoma cruzi infection correlates with the expression of a distinct family of sialicase superfamily genes. Parasitol 1999;98:105-16.

[23] Frohman M, Dush MK, Martin GR. Rapid production of full-length cDNAs from rare transcripts: amplification using a single gene-specific oligonucleotide primer. Proc Natl Acad Sci 1988;85:8998-9002.

[24] Guindon S, Delsuc F, Dufayard JF, Gascuel O. Estimating maximum likelihood phylogenies with PhyML. Methods Mol Biol 2009;537:113-37.

[25] Pei J, Kim BH, Grishin NV. PROMALS3D: a tool for multiple protein sequence and structure alignments. Nucleic Acids Res 2008;36(7):2295-300.

[26] Galzi JL, Devillers-Thiéry A, Hussy N, Bertrand S, Changeux JP, Bertrand D. Mutations in the channel domain of a neuronal nicotinic receptor convert ion selectivity from cationic to anionic. Nature 1992;359(6395):500-505. 72

[27] Beech R, Wolstenholme AJ, Neveu C, Dent JA. Nematode Parasite Genes, What's in a Name? Trends in Parasitol 2010; (in press)

[28] Olvera-Cortés ME, Anguiano-Rodríguez P, López-Vázquez MA, Alfaro JMC. Serotonin/dopamine interaction in learning. Prog Brain Res 2008;172: 567-602.

[29] Branicky R, Schafer WR. Tyramine: A New Receptor and a New Role at the Synapse. Neuron 2009;62:458-60.

[30] Zucchi R, Chiellini G, Scanlan TS, Grandy DK. Trace amine-associated receptors and their ligands. Br. J. Pharmacol 2006;149:967-78.

[31] Saudou F, Amlaiky N, Plassat JL, Borrelli E, Hen R. Cloning and characterization of a Drosophila tyramine receptor. EMBO J 1990;9:3611–617.

[32] Huang J, Ohta H, Inoue N, Takao H, Kita T, Ozoe F, Ozoe Y. Molecular cloning and pharmacological characterization of a Bombyx mori tyramine receptor selectively coupled to intracellular calcium mobilization. Insect Biochem Mol Biol 2009;39(11):842-49.

[33] Rottea C, Kracha C, Balfanzb S, Baumannb A, Walza B, Blenau W. Molecular characterization and localization of the first tyramine receptor of the American cockroach (Periplaneta americana) Neurosci 2009;162(4):1120-33.

[34] Naheed M, Green B. Focus on Clozapine. Curr Med Res and Opinion 2001;17(3):223-9.

[35] Leia J, Lesera M, Enan M. Nematicidal activity of two monoterpenoids and SER-2 tyramine receptor of Caenorhabditis elegans. Biochem Pharmacol 2009;79(7):1062-71.

Supplementary data

Supplementary data associated with this article can be found, in the online version, at doi:10.1016/j.molbiopara.2010.05.005. 73

Connecting statement II

To further understand the role of biogenic amines in the function of the inhibitory nervous system, the final component this project was to localize and determine the affects (on adult H. contortus) of neurotransmitters that have been shown to activate LGCCs. The localization consisted of dopamine, which was demonstrated in Chapter II to activate the LGCC, Hco-GGR-3 and serotonin which activates a C. elegans, LGCC called MOD-1. Although, chapter III describes a novel tyramine-gated chloride channel, there are currently no tyramine-specific antibodies available commercially. The overall affects of dopamine and serotonin on adult H. contortus were also examined. Overall, this final chapter provides the first examination of the function of biogenic amine neurotransmitters in H. contortus and complements the previous chapters on biogenic amine-gated chloride channels.

Chapter IV

Manuscript III

Localization of serotonin and dopamine in Haemonchus contortus

Vijayaraghava T. S. Rao, Sean G. Forrester, Kathy Keller and Roger K. Prichard

International Journal for Parasitology (DOI information: 10.1016/j.ijpara.2010.09.002) (2010)

Abstract Serotonin and dopamine play important roles in the biology of nematodes where they exert their effect on feeding, locomotion and reproductive behavior. Haemonchus contortus, a parasitic nematode which infects small ruminants, is responsible for considerable economic losses in agriculture. In the current study we have mapped the localization of these two neurotransmitters in this parasite using immuno-staining. Serotonin localized in amphidial and pharyngeal neurons in both adult female and male worms. Serotonin was also found in ray sensory neurons as well as in a few ventral cord motor neurons exclusively in adult males. Surprisingly, dopamine was only detected in the neuronal commissures linking the lateral and sub-lateral nerve cords in both sexes. We also studied the effect of these two molecules on female adult worms in vitro. Serotonin mainly inhibited movement whereas dopamine had a profound paralytic effect on the mid- body of the worms.

1. Introduction Nematoda is an animal phylum known for its abundance and richness in species. These animals have a wide variety of signaling molecules including the biogenic amine neurotransmitters, serotonin and dopamine. The overall function of dopamine and serotonin as well as the serotonergic and dopaminergic neuronal anatomy has been extensively characterized in the model free living nematode, Caenorhabditis elegans (Chase and Koelle, 2007). In C. elegans, serotonin is found in at least nine neurons (in the hermaphrodite) that are responsible for controlling many functions such as feeding (Rogers et al., 2001), egg laying (Weinshenker et al., 1995) and locomotion (Horvitz et al., 1982). Dopamine, on the other hand, is present in eight distinct neurons that appear to play a primary role in mechanosensation (Sulston et al., 1975; Sawin et al., 2000). The overall function of these amine neurotransmitters in nematodes involves two classes of receptors, the G-protein coupled receptor class (Smith et al., 2004) and a divergent group of cys-loop receptors called ligand-gated chloride channels (LGCC), the latter of which includes a class of amine receptors that have only been described in nematodes (Ranganathan et al., 2000; Rao et al., 2009; Ringstad et al., 2009). The presence of these unique amine-gated chloride channels clearly illustrates that nematodes possess a divergent inhibitory neurotransmission system as well as unique functions for both serotonin and dopamine. In addition to studies with C. elegans, distribution and function of serotonin has been investigated in a few other nematodes. The human parasite Ascaris lumbricoides and the chicken parasite Ascaris galli have been shown to possess serotonin (Mishra et al., 1984). The pig parasite, Ascaris suum, has been well mapped for serotonin localization (Martin and Donahue, 1989; Johnson et al., 1996; Fellowes et al., 1999, 2000) where it has been found in pharyngeal neurons in both sexes and in the ventral cord near the tail in males. Catecholamine localization has also been studied in various nematodes such as Phocanema decipiens (Goh and Davey, 1976), Goodeyus ulmi (Leach et al., 1987), A. galli (Smart, 1988), Setaria cervi (Agarwal et al., 1990), Trichinella spiralis (Lec and Ko, 1991), Romanomermis culicivorax (Jagdale and Gordon, 1994), Nippostrongylus 77 brasiliensis (Goudey-Perrière etal., 1997), Panagrellus redivivus and Meloidogyne incognita (Stewart et al., 2001) and more recently in seven free living rhabditid nematodes (Rivard et al., 2010), using both HPLC and immuno-cytochemical staining techniques. Haemonchus contortus infection is economically important, affecting small ruminant production worldwide. Relative to other strongylid parasites, this organism is perhaps the most pathogenic parasite of small ruminants (Peter and Chandrawathani, 2005). There exists very little information regarding the role of serotonin and dopamine in the neurobiology of this parasite. However, we have previously localized a novel dopamine- gated chloride channel in this parasite (Rao et al., 2009), suggesting a unique role for dopamine in parasitic nematodes. In this context, we believe that it is important to expand our knowledge of the serotonergic and the dopaminergic nervous system in economically important parasitic nematodes such as H. contortus. Such information will greatly assist our understanding of the nervous system of this parasite and specifically the relevant receptors for these molecules that may have potential as future drug targets. The current study investigates the immuno-staining of H. contortus adult worms in order to visualize the localization of serotonin and dopamine. 2. Materials and Methods 2.1 Immunolocalization of serotonin and dopamine 2.1.1 Nematodes and fixation Haemonchus contortus adult female and male worms of the PF23 strain were used in this study (Ranjan et al., 2002). Worms were fixed, permeabilized and collagenase digested as described elsewhere (Delany et al., 1998). Nematodes were subsequently washed and stored in PBS at 4°C before use. 2.1.2 Primary antibody incubation Worms were incubated for 72 h at 4°C with appropriate dilutions of the primary antibody in antibody diluent (0.1% (w/v) BSA, 0.5% (v/v) Triton X-100, 0.05% (w/v) sodium azide) in PBS. Anti-serotonin antibody, raised in rabbits (Sigma S5545, Lot – 097K4856) and anti-dopamine antibody raised in mice (Chemicon International - Millipore, USA, MAB5300, Lot – LV1462092) were used in dilutions of 1:300 and 1:200, respectively. The anti-serotonin antibody is a well established product which has been successfully used for serotonin staining in 14 different species of free living nematodes 78

(Loer and Rivard, 2007; Rivard et al., 2010). The anti-dopamine antibody has been used to stain dopamine in cultured neurons from Drosophila melanagaster (Park et al., 2007). Unbound antibodies were removed by a wash in PBS/0.1% (v/v) Triton X-100 at 4°C for 15 min. 2.1.3 Secondary antibody incubation Worms were incubated overnight at 4°C in the dark with appropriate secondary antibodies at optimal dilutions. Alexa Fluor 488 goat anti-rabbit IgG (Invitrogen, Molecular probes A11070) was always used at a dilution range of 1:1000 – 1:1500. Alexa Fluor 635 goat anti-mouse IgG (Invitrogen, Molecular probes A31575) was used at a dilution of 1:750. Worms were finally washed several times (minimum of five times) with PBS/0.1% (v/v) Triton X-100 at 4°C before being mounted on glass slides in mounting medium (Sigma M1289). The slides were examined using either a Nikon Eclipse E800 microscope fitted with Bio-Rad Radiance 2100 for confocal imaging or a Nikon Eclipse TE2000-U microscope for epifluorescence imaging. Captured images were processed using ImageJ (Rasband, W.S., 1997-2009. ImageJ, National Institutes of Health, Bethesda, Maryland, USA, http://rsb.info.nih.gov/ij/) to render optimal quality. Negative controls (NCs) consisted of non-immune (non-specific) sera, derived from the respective host species in which the primary antibodies were raised, as well as a second series of NCs in which the primary antibody was omitted. Worms cultured from a minimum of three different passages (i.e. three different isolates) were used. Each experiment was performed with at least 12 worms as test samples and six each for the panel of NCs. The whole experiment was repeated at least three times. 2.2 Effect of exogenously supplied serotonin and dopamine on H. contortus female worms Female worms were exposed to 10 mM – 40 mM serotonin (Sigma H8502 – 25G) and 0.5 mM – 10 mM dopamine (Sigma H9523 – 1G) in a final volume of 1 - 2 ml of RPMI medium. Movement of the worm was recorded by video camera for 1 min using a QICAM (FAST1394) camera fitted to a Nikon (SMZ1500) microscope, before the addition of the drug and 10 min after drug addition. The experiment was performed in duplicate. Worms from three different passages were utilized. Untreated (NC) worms were monitored for normal movement for the entire duration of the experiment. 79

Variability in the movement of individual untreated worms in RPMI medium made it difficult to quantify the effect of individual neurotransmitters on the worms.

3. Results 3.1 Immuno-localization 3.1.1 Immuno-localization of serotonin Serotonin-specific immuno-reactivity (IR) was found in the anterior region (amphids and pharynx) in both sexes (Figs. 4-1A-D and 4-2A). Although there was some variability in the details visualized between individual worms, cell bodies of four neurons (two pairs) could be consistently identified in most of the worms tested. Of these four neurons, cell bodies of two neurons (a pair) were located slightly anterior to the nerve ring. Towards the anterior, each of these two cell bodies has an axonal ending that reaches the animal’s lips (Figs. 4-1D, 4-2A and Supplementary Fig. 4-S1). The same cell bodies show axonal outgrowths running towards the posterior of the pharynx reaching out to meet two other cell bodies located posterior of the nerve ring (Supplementary Fig. 4-S2). These two other cell bodies, putative neurosecretory motor neurons (pNSM), are located at approximately the mid-region of the pharynx (Fig. 4-1B) and these send out processes in both anterior and posterior directions. These cell bodies send out branches in the direction of the nerve ring towards the anterior (Fig. 4-1B, C and Supplementary Fig. 4-S2). These branches show varicosities as they approach the nerve ring region (Supplementary Fig. 4-S2). Towards the posterior, the same two cell bodies send out processes which meet each other, forming a plexus (Fig. 4-1B and C). This plexus forks posteriorly, forming axonal outgrowths towards both the dorsal and ventral sides of the pharynx (Fig. 4-1B and C). These axonal outgrowths are ornate with varicosities, reaching the far end of the pharynx (Fig. 4-1B). In addition, serotonin was seen in abundance in some axonal processes that are part of the nerve ring (neuropile) (Figs. 4-1A, B and 4-2A). This has been ascertained by co-staining with DAPI to visualize the nerve ring region (Supplementary Fig. 4-S1A). The circumpharyngeal nerve ring processes were seen connected to extrapharyngeal axons which have their ends reaching the anterior tip of the worm (Supplementary Figs. 4-S1A and 4-S3). It remains unclear from all of our images whether these axons that are connected to nerve ring are a pair belonging to two different neurons or if they belong to 80 one common neuron. A schematic diagram depicting serotonin-IR in the head region (common for both female and male worms) has been included as Supplementary Fig. 4- S4. Only male worms showed serotonin-IR in the posterior end (Fig. 4-2B and Supplementary Fig. 4-S5A). Male worms are smaller and slender relative to females and are far more susceptible to damage during the permeabilization process. Only half of the number of worms tested showed discernable serotonin-IR in their bursa. Neuronal endings reaching the bursal sensory rays, axons rimming the stem that separates the bursal region from the rest of the body (Fig. 4-2B) and ventral cord motor neurons connecting to the rimming axons (Fig. 4-2B) all clearly possessed serotonin. Cell bodies of neurons that can be seen closer to the tail region belong to the ventral cord (Fig. 4-2B and Supplementary Fig. 4-S5A and B). In females, the mid-body and posterior region were both negative for any signal for serotonin. Male worms were also negative for serotonin-IR in the mid-body. None of the NC worms showed any serotonin-IR (Supplementary Fig. 4-S6A-D).

Fig. 4-1. Serotonin-immuno-reactivity (IR) in the anterior region of a Haemonchus contortus female worm (scale bar = 100 μm). A, B and D) Flattened stack - confocal micrographs; C) epifluorescent micrograph. Ant = anterior. A) Axonal processes of amphidial neurons (AN) directly connected to the axonal processes that are part of the nerve ring (NR). B) A pair of cell bodies is located posterior to the NR. Axonal branches arising from these putative neurosecretory motor neuronal cell bodies (pNSM) intersect, forming a plexus (P), which sends out varicose axonal processes (VA) in dorsal and ventral directions, towards the posterior of the pharynx. C) The pair of pNSM is indicated with black arrow heads. A plexus (P) formed by the axonal processes arising from these cell bodies is shown. D) The pair of cell bodies located anterior (ACB) to the NR are indicated with white arrowheads.

Fig. 4-2. Confocal micrographs showing serotonin-immuno-reactivity (IR) in the anterior and posterior of a Haemonchus contortus male worm, respectively (scale bar = 100 μm). Ant = anterior. A) Axonal endings in the amphids (AN), axons which are part of the nerve ring (NR) are depicted. B) Montage comprising of three individual micrographs, depicts bursal ray sensory neurons (RSN) and the axonal processes rimming the region that separates the bursa from the rest of the body (rim). Cell bodies of the neurons that make up the ventral nerve cord (VNC) are indicated with white arrowheads.

3.1.2 Immuno-localization of dopamine The majority of the worms tested showed clear dopamine-IR in the commissures. In nematode neuroanatomy, the ventral nerve cord (VNC) and dorsal nerve cord (DNC) are joined by individual neurites traversing the body wall. These dorsal-ventral extending neurites are called “commissures” (Loer and Rivard, 2007). In our study, both male and female worms displayed the presence of dopamine in neuronal commissures that link the lateral and sub-lateral nerve cords (Fig. 4-3A-D). Dopamine localization was restricted to such commissures located only in the mid-body region. The anterior quarter of the length of the worm, which includes the head and the pharynx, did not show any dopamine-IR (Fig. 4-3A) as was the case with the posterior part, including the tail region. The right side of the body appeared to have more dopamine-stained commissures than the left. In addition, worms treated with the appropriate dilution of anti-dopamine antibody which was pre-incubated with an excess of dopamine-BSA conjugate, showed significantly reduced dopamine-IR (data not shown). None of the NC worms showed any dopamine-IR (Supplementary Fig. 4-S6E and F).

Fig. 4-3. Confocal micrographs of Haemonchus contortus worms depicting dopamine- immuno-reactivity (IR). A) Confocal micrograph of a female worm (scale bar = 100 μm). Ant = anterior. Dopamine is localized in the neuronal commissures linking the lateral and sub-lateral nerve cords in the anterior mid-body region. The head region does not show any dopamine-IR. B) Flattened stack - confocal micrograph of a male worm (scale bar = 100 μm). This image depicts a lateral view (LV) of the neuronal commissures linking the lateral and sub-lateral nerve cords in the anterior mid-body region. C) Flattened stack - confocal micrograph of a female worm (scale bar = 100 μm). Top view of the neuronal commissures in the anterior mid-body. Lateral sides are indicated as LS. D) Flattened stack - confocal micrograph showing dopamine-IR in a female worm (scale bar = 100 μm). Close-up view of a commissure connecting lateral (L) and sub-lateral (SL) nerve cords.

3.2 Effect of exogenously supplied neurotransmitters on adult worms 3.2.1 Effect of serotonin Serotonin mainly inhibited worm movement. We tested the effect of different concentrations of this molecule on worms (10 – 40 mM). Any concentration above 10 mM showed inhibition of movement. Serotonin-treated worms appeared paralyzed in the posterior region compared with the normal wriggling movement of the same worms before exposure to amine as well as other untreated worms. Representative movie files depicting the effect of exogenous serotonin are available which depict the movement of the control worm before the addition of neurotransmitter (Supplementary Movie S1A) and the movement of the same worm 10 min after the addition of addition of 10 mM serotonin (Supplementary Movie S1B). 3.2.2 Effect of dopamine Dopamine shows a clear paralytic effect on the mid-body of the worms. A concentration of 1 mM of the amine was able to completely paralyze the worms in the midbody within 10 min. This effect was reversible when the treated worms were washed and placed in fresh medium devoid of dopamine (data not shown). Representative movie files depicting the effect of exogenous dopamine are available which depict the movement of the control worm before the addition of neurotransmitter (Supplementary Movie S2A); and the movement of the same worm 10 min after the addition of addition of 1 mM dopamine (Supplementary Movie S2B). Supplemental video files The video files can be found on the website of International Journal of Parasitology (DOI information: 10.1016/j.ijpara.2010.09.002)

4. Discussion Nervous systems of many economically important parasitic nematodes remain poorly described. Here, we have mapped two key neurotransmitters, serotonin and dopamine, in the nervous system of H. contortus which has proved to be a convenient and useful approach for exploring their neuronal anatomy. It is important to note that in all of our experiments, female worms appeared to stain better than male worms as has been observed in an earlier study (Portillo et al., 2003). The immuno-staining of serotonin that was visualized in this study is quite distinct and elaborate (see schematic cartoon representation in Supplementary Fig. 4-S4). In the head region, four neurons whose cell bodies could be identified are all situated within the pharynx. The pair of cell bodies seen posterior to the nerve ring are probably homologous to the neurosecretory motor neurons (NSM) in C. elegans (Albertson and Thomson, 1976) and A. suum (Johnson et al., 1996) and were often most brightly stained (pNSM in Fig. 4- 1B and C) in all of our specimens. The location of these cell bodies posterior to the nerve ring assumes significance in comparison to the location of NSM cell bodies in C. elegans, in which they are situated anterior to the nerve ring. Unlike C. elegans, the H. contortus putative NSM neurons appear to be bipolar. The axonal arms of the cell bodies extend in both anterior and posterior directions (Fig. 4-1B and C). Axon from both cell bodies reaches the nerve ring region in the anterior direction. Axons from the same cell bodies reach the far end of the pharynx in the posterior direction. Comparing the location of these cell bodies in the pharynx of different species reveals interesting differences. NSM cell bodies are located in the anterior mid-region of the pharynx in H. contortus. The same have been shown to be located at the very posterior end of the pharynx in A. suum (Johnson et al., 1996). The other two cell bodies which are located anterior to the nerve ring are most likely amphidial (Fig. 4-1D). However, there are no reported serotonergic neurons that are comparable with these neurons in either C. elegans or in other nematodes examined to date. Nevertheless, there are a few reports which define all of the amphidial neurons in L1s and L3s of H. contortus (Li et al., 2000a, 2000b, 2001). In one study the cell bodies of all the amphidial neurons in L1s have been shown to be located posterior to the nerve ring (Li et al., 2000a). This could perhaps be a stage-specific developmentally related 87 difference. In addition, the extra-pharyngeal axons which are directly connected with the nerve ring can be compared with the pair of ADF (amphidial) neurons in C. elegans (Sze et al., 2000). However, this comparison is inconclusive on two grounds. Firstly, this comparison can only be made on the basis of the fact that ADF neurons are the only extrapharyngeal serotonergic neurons in C. elegans which have ciliated endings in the amphids. Second, each ADF neuron, as described in H. contortus L1s (Li et al., 2000a), is branched and possesses two ciliated endings in the amphids unlike the single axonal ending that we see in the case of adults. The staining detected exclusively in male worms was restricted to the region close to the tail (bursa). Axonal endings detected in the bursal rays are comparable with ray sensory neurons in C. elegans and other nematodes (Loer and Kenyon, 1993; Lints and Emmons, 1999; Loer and Rivard, 2007). From the images that we recorded, it remains unclear how many rays in the bursa possess serotonergic neurons. Interestingly, we detected two axonal processes rimming the region that separates the bursa from the rest of the body. These processes appear to be connected to ventral cord motor neurons. However, the identities of these processes remain unknown. Approximately four cell bodies in the ventral cord are clearly visible (Fig. 4-2B and Supplementary Fig. 4-S5A). These are putatively homologous to CP (male specific neuron in ventral cord) neurons in C. elegans (Loer and Kenyon, 1993). The staining for the ventral cord becomes faint as one scans, in a posterior to anterior orientation (Fig. 4-2B and Supplementary Fig. 4-S5A). Formaldehyde-induced fluorescence, glyoxylic acid-induced fluorescence and dopamine-like immuno-staining have been used to visualize catecholamines in different nematodes (Sulston et al., 1975; Jagdale and Gordon, 1994; Stewart et al., 2001). Moreover, dopamine has been detected in the infective larval stage of H. contortus using HPLC methodology (Fleming, 1993). Dopaminergic neurons in C. elegans are ADE (anterior deirid), PDE (postdeirid sensillum) and CEP (cephalic) neurons, which are common in both sexes and a few ray sensory neurons in males (Sulston et al., 1975; Rand and Nonet, 1997). Comparable neurons have been shown to possess catecholamine in the head region of A. lumbricoides (Sulston et al., 1975). The localization of dopamine in the neuronal commissures that we have detected in H. contortus is novel for nematodes. Intriguingly, our experiments do not show any dopamine-IR in any neuronal cell body in 88 any of the worms tested. In a similar immuno-localization study involving H. contortus adult worms, γ-amino butyric acid (GABA)-IR was detected in the motor neuronal commissures, but no GABA-IR was reported in any of the cell bodies in this parasite (Portillo et al., 2003). To our knowledge, there exist no reports of any neuronal commissures (connecting the dorsal and the ventral nerve cords) which are dopaminergic in C. elegans. Non-detection of dopamine in the head and tail regions in H. contortus could perhaps be attributed to the sensitivity of the methodology adopted. Exogenous dopamine has been shown to have a complete paralytic effect in C. elegans. Maximum effect was seen at 16 mM drug concentration. However, animals were able to recover from this effect after prolonged exposure. Serotonin has also been shown to be an inhibitor of locomotion. However, the worms have been reported to move in a twisting, ‘kinking’ manner (Schafer and Kenyon, 1995). In A. suum, exogenous serotonin seems to exert a clear dose-dependent paralytic effect on the anterior region compared with just a ‘discordinated, irregular waveform locomotion’ experienced by the worms upon injection with dopamine (Stretton and Reinitz, 1996). The experimental set up that we have adopted in H. contortus is different from the previously mentioned studies in C. elegans and A. suum. Unlike those studies, swimming movements of worms in RPMI medium were monitored in our study. Notwithstanding this, we can conclude that the effect of dopamine and serotonin on H. contortus is similar to what has been reported in C. elegans. The effect of dopamine can clearly be characterized as paralytic; whereas serotonin inhibited the rapid wriggling movement of the worm, but the worms were not completely immotile. In addition, we detected dopamine in the lateral neuronal commissures, only in the mid- body. The paralytic effect of exogenous dopamine was found to be pronounced in the same extended mid-body region. Although there is a great deal of conservation of neuronal anatomy among different nematode species, there exist some crucial variations between them. To date, there exists only one report each on the characterization of a serotonin receptor (Smith et al., 2004) and a dopamine receptor (Rao et al., 2009) in H. contortus. Description of aminergic neurons that has been provided in this study should be beneficial for future studies involving characterization of aminergic receptors in H. contortus.

Acknowledgments Financial support for this study was provided by Natural Sciences and Engineering Research Council of Canada (NSERC), the Fonds de recherche sur la nature et les technologies (FQRNT), Québec, Centre for Host-Parasite Interactions, Québec, Fort Dodge Animal Health (now Pfizer Animal Health), and University of Ontario Institute of Technology (UOIT), Canada. We are also grateful to Dr. Joseph Dent for valuable discussions.

References: Agarwal, A., Shukla, O.P., Ghatak, S., Tekwani, B.L., 1990. Biogenic amines, metabolites and monoamine oxidase in the filarial worm Setaria cervi. Int. J. Parasitol. 20, 873-881. Albertson, D.G., Thomson, J.N., 1976. The pharynx of Caenorhabditis elegans. Philos. Trans. R. Soc. Lond. B. Biol. Sci. 275, 299-325. Chase, D.L., Koelle, M.R., 2007. Biogenic amine neurotransmitters in C. elegans. The C. elegans Research Community, Wormbook doi/10.1895/wormbook.1.132.1. Delany, N.S., Laughton, D.L., Wolstenholme, A.J., 1998. Cloning and localisation of an avermectin receptor-related subunit from Haemonchus contortus. Mol. Biochem. Parasitol. 97, 177-187. Fellowes, R.A., Dougan, P.M., Maule, A.G., Marks, N.J., Halton, D.W., 1999. Neuromusculature of the ovijector of Ascaris suum (Ascaroidea, Nematoda): An ultrastructural and immunocytochemical study. J. Comp. Neurol. 415, 518-528. Fellowes, R.A., Maule, A.G., Martin, R.J, Geary, T.G., Thompson, D.P., Kimber, M.J., Marks, N.J., Halton, D.W., 2000. Classical neurotransmitters in the ovijector of Ascaris suum: localization and modulation of muscle activity. Parasitol. 121, 325- 336. Fleming, M.W., 1993. Catecholamines during development of the parasitic nematode Haemonchus contortus. Camp. Biochem. Physiol. 104C, 333-334. Goh, S.L., Davey, K. G., 1976. Selective uptake of noradrenaline, DOPA and 5- hydroxytryptamine by the nervous system of Phaconema decipiens (Nematoda): A light autoradiograpghic and ultrastructural study. Tissue and Cell. 8, 421-435. 90

Goudey-Perrière F, G.J., Nembo, B., Barreteau, H., Jacquot, C., Gayral, P., 1997. Levels of biogenic amines in larvae and adults of the rat hookworm, Nippostrongylus brasiliensis (Nematoda). Comp. Biochem. Physiol. A. Physiol. 118, 615-623. Horvitz, H.R., Chalfie, M., Trent, C., Sulston, J.E., Evans, P.D., 1982. Serotonin and octopamine in the nematode Caenorhabditis elegans. Science. 116, 1012-1014. Jagdale, G.B., Gordon, R., 1994. Distribution of catecholamine(s) in the nervous system of a mermithid nematode, Romanomermis culicivorax. Parasitol. 80, 459-466. Johnson, C.D., Reinitz, C.A., Sithigorngul, P., Stretton, A.O.W., 1996. Neuronal localization of serotonin in the nematode Ascaris suum. J. Comp. Neurol. 367, 352-360. Leach, L., Trudgill, D.L., Gahan, P.B., 1987. Immunocytochemical localization of neurosecretory amines and peptides in the free-living nematode, Goodeyus ulmi. Histochem. J. 19, 471-475. Lec, D.L., Ko, R.C., 1991. Cateeholaminergic neurons in Trichinella spirlis (Nematoda). Parasitol. Res. 77, 269-270. Li, J., Ashton, F.T., Gamble, H.R., Schad, G.A., 2000a. Sensory neuroanatomy of a passively ingested nematode parasite, Haemonchus contortus: Amphidial neurons of the first stage larva. J. Comp. Neurol. 417, 299-314. Li, J., Zhu, X., Ashton, F.T., Gamble, H.R., Schad, G.A. , 2001. Sensory neuroanatomy of a passively ingested nematode parasite, Haemonchus contortus: Amphidial neurons of the third-stage larva. J. Parasitol. 87, 65-72. Li, J., Zhu, X., Boston, R., Ashton, F.T., Gamble, H.R., Schad, G.A., 2000b. Thermotaxis and thermosensory neurons in infective larvae of Haemonchus contortus, a passively ingested nematode parasite. J. Comp. Neurol. 424, 58-73. Lints, R., Emmons, S.W., 1999. Patterning of dopaminergic neurotransmitter identity among Caenorhabditis elegans ray sensory neurons by a TGFbeta family signaling pathway and a Hox gene. Development. 16, 5819-5831. Loer, C.M., Kenyon, C.J., 1993. Serotonin-deficient mutants and male mating behavior in the nematode Caenorhabditis elegans. J. Neurosci. 13, 5407-5417. 91

Loer, C.M., Rivard, L., 2007. Evolution of neuronal patterning in free-living rhabditid nematodes I: Sex-specific serotonin-containing neurons. J. Comp. Neurol. 502, 736-767. Martin, R.E., Donahue, M.J., 1989. Tissue and ultrastructural localization of 5- hydroxytryptamine (serotonin) in the tissues of Ascaris suum with energy dispersive X-ray photometry of immunoreactive structures. Int. J. Parasitol. 19, 585-596. Mishra, S.K., Sen, R., Ghatak, S., 1984. Ascaris lumbricoides and Ascaridia galli: Biogenic amines in adults and developmental stages. Exp. Parasitol. 57, 34-39. Park, S.S., Schulz, E.M., Lee, D., 2007. Disruption of dopamine homeostasis underlies selective neurodegeneration mediated by alpha-synuclein. Eur. J. Neurosci. 26, 3104-3112. Peter, J.W., Chandrawathani, P., 2005. Haemonchus contortus: parasite problem No. 1 from tropics - Polar Circle. Problems and prospects for control based on epidemiology. Trop. Biomed. 22, 131-137. Portillo, V., Jagannathan, S., Wolstenholme, A. J., 2003. Distribution of Glutamate-Gated Chloride Channel Subunits in the Parasitic Nematode Haemonchus contortus. J. Comp. Neurol. 462, 213-222. Rand, J.B., Nonet, M.L., 1997. Neurotransmitter assignments for specific neurons. In: Riddle, D.L., Blumenthal, T., Meyer, B.J., Priess, J.R. (2nd Ed.) C. elegans II. Cold Spring Harbor Laboratory Press, New York, pp 1049–1052. Ranganathan, R., Cannon, S.C., Horvitz, H.R., 2000. MOD-1 is a serotonin-gated chloride channel that modulates locomotory behaviour in C. elegans. Nature 23, 470-475. Ranjan, S., Wang, G.T., Hirschlein, C., Simkins, K.L., 2002. Selection for resistance to macrocyclic lactones by Haemonchus contortus in sheep. Vet. Parasitol. 103, 109- 117. Rao, V.T.S., Prichard, R.K., Forrester, S.G., 2009. A dopamine-gated ion channel (HcGGR3*) from Haemonchus contortus is expressed in the cervical papillae and is associated with macrocyclic lactone resistance. Mol. Biochem. Parasitol. 166, 54-61. 92

Ringstad, N., Abe, N., Horvitz, H.R., 2009. Ligand-gated chloride channels are receptors for biogenic amines in C. elegans. Science 325, 96-100. Rivard, L., Srinivasan, J., Stone, A., Ochoa, S., Sternberg, P.W., Loer, C.M., 2010. A comparison of experience-dependent locomotory behaviors and biogenic amine neurons in nematode relatives of Caenorhabditis elegans. BMC. Neurosci. 11:22 doi:10.1186/1471-2202-11-22. Rogers, C.M., Franks, C.J., Walker, R.J., Burke, J.F., Holden-Dye, L. , 2001. Regulation of the pharynx of Caenorhabditis elegans by 5-HT, octopamine, and FMRFamide- like neuropeptides. J. Neurobiol. 49, 239-244. Sawin, E.R., Ranganathan, R., Horvitz, H.R., 2000. C. elegans locomotory rate is modulated by the environment through a dopaminergic pathway and by experience through a serotonergic pathway. Neuron. 26, 619-631. Schafer, W.R., Kenyon, C.J., 1995. A calcium-channel homologue required for adaptation to dopamine and serotonin in Caenorhabditis elegans. Nature 375, 73-78. Smart, D., 1988. Catecholamine synthesis in Ascaridia Galli. Int. J. Parasitol. 18, 485- 492. Smith, M.W., Borts, T.L., Emkey, R., Cook, C.A., Wiggins, C.J., Gutierrez, J.A., 2004. Characterization of a novel G-protein coupled receptor from the parasitic nematode H. contortus with high affinity for serotonin. J. Neurochem. 86, 255- 266. Stewart, G.R., Perry, R.N., Wright, D.J., 2001. Occurrence of dopamine in Panagrellus redivivus and Meloidogyne incognita. Nematol. 3, 843-848. Stretton, A.O.W., Reinitz, C. A. , 1996. Behavioral and cellular effects of serotonin on locomotion and male mating posture in Ascaris suum (Nematoda). J. Comp. Physiol. 178, 655-667. Sulston, J., Dew, M., Brenner, S., 1975. Dopaminergic neurons in the nematode Caenorhabditis elegans. J. Comp. Neurol. 163, 215-226. Sze, J.Y., Victor, M., Loer, C., Shi, Y., Ruvkun, G., 2000. Food and metabolic signalling defects in a Caenorhabditis elegans serotonin-synthesis mutant. Nature 403, 560- 564. 93

Weinshenker, D., Garriga, G., Thomas, J.H., 1995. Genetic and pharmacological analysis of neurotransmitters controlling egg laying in C. elegans. J. Neurosci. 15, 6975- 6985.

Supplemental Images

Supplementary Fig. 4-S1. Confocal micrographs showing the anterior region of a single Haemonchus contortus male worm. A) Micrograph depicting the co-staining of serotonin (in green) and nuclei (using DAPI - in blue). The axonal processes that are part of the nerve ring (NR) can be clearly seen located in an area devoid of cell bodies. B) Merge image depicting the staining of serotonin (in green) and the phase-contrast version (grey). Intrapharyngeal and extrapharyngeal axons arising from the NR are clearly depicted.

Supplementary Fig. 4-S2. Confocal micrograph showing serotonin distribution in the head region of a Haemonchus contortus female worm. Ant = anterior. Axon from the putative neurosecretory motor neuronal (NSM) cell bodies reaches the nerve ring (NR). Axonal process from the cell bodies present slightly anterior to the NR (not visible in this image) reaches the NSM cell body.

Supplementary Fig. 4-S3. Confocal micrograph showing the anterior region of a Haemonchus contortus female worm. Ant = anterior. Merge image showing the staining of serotonin (in green) and the phase-contrast version. Putative intrapharyngeal neurosecretory motor neuronal (NSM) cell bodies are clearly visible. Axonal ending in amphid connected to the circumpharyngeal nerve ring (NR) is depicted.

Supplementary Fig. 4-S4. A schematic representation of serotonin-immuno-reactivity (IR) in the anterior (head) region of Haemonchus contortus adult worms (common for both sexes). Outline of the outer body of the worm is indicated with a thick continuous line. Outline of the twisted pharynx is indicated with a relatively thinner continuous line. Non-varicose axonal processes are depicted using lines with dashes. Varicose axonal processes are shown using dotted lines. Diagram is not drawn to scale. ACB, pair of cell bodies anterior to nerve ring; pNSM, putative neurosecretory motor neuronal cell bodies.

Supplementary Fig. 4-S5. Confocal micrographs showing the posterior of a single Haemonchus contortus male worm as well as the cell bodies of the ventral nerve cord. A) Montage comprising of three confocal flattened stacks depicting merge images of co- staining of serotonin (in green) and nuclei (using DAPI - in blue). Serotonin is present in the bursal ray sensory neurons (RSNs) and the ventral nerve cord (VNC). Some cell bodies of the VNC are indicated using a parenthesis. B) Merge image depicting the co- staining of serotonin (in red) and nuclei (using DAPI in blue). One of the cell bodies of the VNC is indicated using a black arrowhead.

Supplementary Fig. 4-S6. Panel of images of negative control (NC) worms (scale bar = 100 μm). Ant = anterior. A) Confocal micrograph depicting the anterior region of a NC female worm which was not incubated with serotonin-specific primary antibody. B) Flattened stack - confocal micrograph depicting the anterior region of a NC female worm which was incubated with non-immune serum from the host animal species in which antibody against serotonin was raised. C) Flattened stack - confocal micrograph depicting the anterior region of a NC male worm which was not incubated with serotonin-specific primary antibody. D) Flattened stack - confocal micrograph depicting the posterior region (bursa) of a NC male worm which was incubated with non-immune serum from the host animal species in which antibody against serotonin was raised. E) Flattened stack - confocal micrograph depicting the mid-body region of a NC female worm which was not incubated with dopamine-specific primary antibody. F) Flattened stack - confocal micrograph depicting the mid body region of a NC female worm which was incubated with non-immune serum from the host animal species in which antibody against dopamine was raised. 100

Chapter V

General Discussion LGCCs form basic receptors that conduct inhibitory neurotransmission. Invertebrate chloride channels appear to be gated by a variety of ligands unlike their mammalian counterparts. Nematoda appears to be a phylum which exemplifies this feature. In this study, we have deorphanized two new LGCCs providing more evidence to support the divergent evolution of LGCCs in these organisms. Hco-GGR-3 is a DA-gated chloride channel. This was revealed by the electrophysiological analyses of Hco-GGR-3 in X. laevis oocytes. Clearly this subunit assembled into homomeric channels and responded to DA. However there were some problems faced while conducting full dose response experiments to quantify the effect of DA on Hco-GGR-3 activation. The main problem was that the channel became less sensitive to the ligand at higher concentrations (above 200μM). A similar phenomenon was reported for the C. elegans MOD-1 channel (Ranganathan et al., 2000). However, there was clearly a dose-dependent response of Hco-GGR-3 to DA, which was sensitive to concentrations as low as 25µM. DA is conventionally known to be a ligand of GPCRs in both vertebrates and invertebrates. Emerging evidence has suggested that peripheral hormones can act on the midbrain dopaminergic systems to control food intake in vertebrates (Narayanan et al., 2010). In C. elegans, DA signaling allows animals to search efficiently for new food sources (Chase and Koelle, 2007). The presence of food is not only smelt but can also be mechanically felt by worms. Therefore, mechanosensation plays an important role in food hunting which is DA mediated. I have localized Hco-GGR-3 in adult H. contortus. This subunit was detected around cervical papillae which are thought to be mechanosensory organs. This suggests that DA is a possible mediator of mechanosensation in this parasite as well. Hence the mechanosensory function of DA seems to be conserved across different species. However, further research is required to determine how DA and Hco-GGR-3 are contributing to the functioning of the cervical papillae and to overall mechanosensation. The genetic basis for resistance to MLs appears to be polygenic (Prichard, 2007). Drug resistance mechanisms typically involve: i) the up regulation of cellular efflux 101 mechanisms in resistant organisms/cells; ii) an increase in drug metabolism in the resistant organism/cells; iii) an alteration in drug receptor site, which reduce drug binding or the functional consequences of drug binding; or iv) a decrease or regulation in abundance of functional drug receptors. In this study, I observed a down regulation in Hco-ggr-3 expression in ML-selected laboratory strains of H. contortus. I also found a SNP in the 3’UTR associated with selection of the same strains. There is no evidence to indicate if these two changes are related to each other. In this scenario, it is difficult to quantify the importance of these two changes, vis-à-vis ML selection. Since there is no information on the gene locus of Hco-ggr-3, it is not possible to link the down regulation of Hco-ggr-3 to some possible changes in its promoter activity. It is also unclear if down regulation of Hco-ggr-3 was only an artifact of a global effect experienced by the parasite during the selection process which is commonly referred to as a ‘neutral drift’. However, there is ample evidence that IVM can either modulate or gate several different LGICs namely

GluCls and GABAA receptor subunits (Cully et al., 1994; Feng et al., 2002), which suggests that the macrocyclic lactones may have multiple receptor targets. I have tested various concentrations of MLs on X. laevis oocytes expressing Hco-GGR-3 and found that the application of MLs did not produce any change in currents. However, this could simply be due to the inability of the drug to act on homomeric channels. Therefore, it is possible that Hco-GGR-3 is yet another IVM target that has reduced expression in ML- selected worms. Hco-LGC-55 is a TA-gated chloride channel. Exogenous TA inhibits the movement of the H. contortus worms in vitro. One of the interesting aspects of Hco-LGC-55 is its lower

EC50 value for DA as compared to what has been reported for Cel-LGC-55. This clearly accentuates the differences in the pharmacological features of Hco-LGC-55 and Cel-LGC- 55 and suggests that H. contortus, for some reason, requires LGC-55 channels to be more sensitive to DA activation compared to C. elegans receptors. Indeed, this is not a new phenomenon, as other H. contortus LGCCs have been shown to be more sensitive to ligands compared to their C. elegans orthologs (Siddiqui et al., 2010; McCavera et al., 2009). Cel-LGC-55 may have differences in binding site that affects either the binding affinity to TA and DA or the gating mechanisms of the two drugs. Interestingly, clozapine 102 which blocks both mammalian dopamine D2 and serotonergic receptors inhibited Hco- LGC-55. However, this inhibition was weak (see Appendix 1). Based on TA’s role in C. elegans, it could be hypothesized that in H. contortus, TA may also be involved in the control of locomotion. In addition, bioinformatic scanning of the incomplete H. contortus genome has revealed the presence of genes presumably encoding tyrosine decarboxylase (tdc) and tyrosine beta hydroxylase (tbh), enzymes responsible for the synthesis of TA and OA respectively (V Rao, personal observation). All these indicators provide clear evidence for fast tyraminergic neurotransmission in this parasite. Mapping nervous systems can be achieved through many approaches. These include, antibody staining of neurotransmitters, reporter analysis of genes encoding either the enzyme involved in the synthesis of neurotransmitters or the neurotransmitter receptor and neuronal staining using specific dyes. However, since H. contortus is highly refractory to genetic manipulation, the reporter analysis of H. contortus genes has only been performed in C. elegans. In this thesis, I have attempted to map the 5-HT and DA-nervous system in adult worms using antibodies. 5-HT was detected mainly in the amphidial and pharyngeal neurons. However, fixing an identity to the neurons in H. contortus is a challenging process. Detailed anatomical description of the nervous system of the adult stages of this parasite is not available. The amphidial neurons have been thoroughly studied as described in the literature review. However these descriptions are restricted to the L1 and L3 stages only. Therefore, all descriptions presented in chapter 4 are based on general comparisons with other nematodes, especially C. elegans. The most surprising part of the DA localization results was the fact that, unlike reports for C. elegans, no DA was detected in any cell bodies (even in the head region). DA does seem to have a profound paralytic affect on adult worms in the mid body, which is consistent with the DA localization results. Therefore, in H. contortus, DA may play more of a role in worm movement. At the outset, this PhD project has successfully characterized the first DA-gated chloride channel subunit (Hco-GGR-3) in any organism. Hco-LGC-55 has become the first trace amine-gated chloride channel to be studied in parasitic nematodes. Finally, I believe this project has produced some of the best resolution and characterization of many structures of the H. contortus nervous system, such as the nerve ring, deirid bodies, etc. This project 103 has attempted to map the neuroanatomy of this organism for both receptor distribution and the distribution of two biologically relevant neurotransmitters. This thesis has also generated and facilitated important future research avenues to explore. First, during this project, I also isolated an ortholog of a second DA-gated chloride channel, Hco-LGC-53 (Appendix 2) which appears to share a phylogenetic branch with Hco-GGR-3. Future co-expression and localization studies could investigate heteromeric assembly in vivo. This can be done using various combinations of subunits comprising of Hco-GGR-3, Hco-LGC-53 and Hco-LGC-55. Second, the genetic selection observed in the Hco-ggr-3 gene associated with selection by MLs can be further expanded by quantifying the expression levels of closely related subunit genes in the same strains of H. contortus, genotyping other genes from the same clade; to search for more SNPs and to determine whether MLs modulate the function of Hco-GGR-3 and related subunits. The effect of MLs can be tested on heteromeric expression of Hco-GGR-3 in combination with Hco-LGC-53 and or Hco-LGC-55. Since the SNP identified is located in the 3’ UTR of Hco-GGR-3 gene, the secondary structure of 3’UTR can be modeled with and without the SNP to check the overall effect of the SNP on mRNA stability. In addition, the SNP has been detected very close to a putative microRNA interaction site (K-box). Hence the microRNA that interacts with the K-box could be identified and the gene encoding for the same can be typed in the three strains. Third, the location of expression of Hco-LGC-55 would also provide important information on the function of these amine-gated channels in parasitic nematodes. Fourth, the mechanosensory role of the anterior deirids in nematode parasites has never been studied. A possible DA role in the functioning of the deirids can be studied by developing an assay that would involve prodding the anterior deirid using a fine platinum wire or hair in the presence and absence of DA as well as with DA antagonists. And finally, the mapping of serotonin and DA neurons will now allow for better interpretation of the function of future serotonin and DA gated ion channels as they are investigated in this parasite.

104

References: Chase, D. L. and Koelle, M.R. (2007). "Biogenic amine neurotransmitters in C. elegans." WormBook, ed. The C. elegans Research Community. Cully, D.F., Vassilatis, D.K., Liu, K.K., Paress, P.S., Van der Ploeg, L.H., Schaeffer, J.M., Arena, J.P. (1994). "Cloning of an avermectin-sensitive glutamate-gated chloride channel from Caenorhabditis elegans." Nature 20: 707-711. Feng, X.P., Hayashi, J., Beech, R.N., Prichard, R.K. (2002). "Study of the nematode putative GABA type-A receptor subunits: evidence for modulation by ivermectin. ." J Neurochem 83: 870–878. McCavera, S., Rogers, A.T, Yates, D.M., Woods, D.J, Wolstenholme, A.J. (2009). "An ivermectin-sensitive glutamate-gated chloride channel from the parasitic nematode Haemonchus contortus." Mol Pharmacol 75: 1347-1355. Narayanan, N. S., Guarnieri, D.J, DiLeone, R.J. (2010). "Metabolic hormones, dopamine circuits, and feeding." Front Neuroendocrinol 104(12): In press. Prichard, R. K. (2007). "Ivermectin resistance and overview of the consortium for anthelmintic resistance SNPs." Expert Opin. Drug Discov 2: S41–S52. Ranganathan, R., Cannon, S.C., Horvitz, H.R. (2000). "MOD-1 is a serotonin-gated chloride channel that modulates locomotory behaviour in C. elegans." Nature 23: 470-475. Siddiqui, S.Z., Brown, D.R., Rao, V.T.S., Forrester, S.G. (2010). "An UNC-49 GABA receptor subunit from the parasitic nematode Haemonchus contortus is associated with enhanced GABA sensitivity in nematode heteromeric channels." J Neuro Chem 113:1113-1122.

105

Appendix

1. Clozapine is a weak inhibitor of Hco-LGC-55

Materials and methods Electrophysiological analyses of Hco-LGC-55 were carried out in X. laevis oocytes as described in chapter 3. Dose response trials were performed using 10uM Tyramine (TA) with increasing concentrations of clozapine (1, 10, 100 and 500uM Clozapine).

Results:

Fig. A Fig. B Appendix 1-Fig. A: Clozapine inhibition dose response for TA activation of Hco-LGC-55 Appendix 1-Fig. B: Graph depicting the quantum of inhibition at maximal clozapine concentration.

Results:

An IC50 of 238uM +/- 50uM for clozapine was calculated for the inhibition of Hco-LGC- 55 (Figure A). Clozapine at 500μM concentration along with 10μM of TA was able to knock almost 70% of the response as compared to the response that was produced with the application of 10μM of TA alone (Figure B).

106

Appendix

2. Cloning full length cDNA of Hco-lgc-53 I have cloned the full length cDNA for Hco-lgc-53 and it has been submitted to Gen Bank. The details of submission are as follows:

ACCESSION EU879912 AUTHORS Beech, RN., Rao,VTS., Lian, J., Nabhan, J., Prichard, RK. and Forrester, SG. >cDNA 1 tcataaggaa gcaacaacga cggcatacac cacgacaagc tgcagcatca aacaacaaca 61 atgattatat cgtatctggc acggattgta ctacttctac ctgatctttc cgcatctgat 121 aatgatcgtc taatcaatat tgcccggaca tcacatgccc ggttagggca cgtaaatgaa 181 gttggtgctg atggacgtct taactacacg gcttcacaac gtgcacatga accaaggacc 241 ctctccaaag ccacatccac tgccgacctt tctgatgacg gatatgaacc agcacgatcg 301 tatgaccgtg accgatcgtg gagctcacgt aagcccaggg acgatgagga atgtatcccc 361 atcaatgata ctctacgaaa acatcttcta caggagctgt tctccgatgc ctacgacaag 421 aacaaccttc ccagttccaa ttcgactgag gttattgtcg aactcaccgt tcagtcgata 481 acggaaatca gtgaattctc gagtagtttc aaagctgatg tgtggtttcc acaaatatgg 541 agagatccac ggctcgattt cactgatcga aattattgta taaagaatat ttcgctagct 601 gctcacaaat taccacaatt atggtctccg aatgtatgct ttgtaaatag caaaaaagtt 661 gaaattcatt catctccatc tcaaaatatt ctactgctag tatttcctaa tggaactatc 721 tggctgaact ttcgtgtttc acttattgga ccgtgtaaac tcgatcttac atattttcca 781 atggatcgac aatcttgtaa cttgatcttt gagagttatt catataatac tgccgaagtt 841 cgtatagtat ggagggactg ggagccagtt tcgattcctg atcctaattc aaaaaatcta 901 cctgattttg aacttgtaca gtacgagcat cgtaatgcta ctttggtgta taccgcagga 961 ctgtgggatc aattagaagt ggaattcaca ttcagaagac tatatgggta ctatgttctt 1021 caggcctata tgccaactta tctttcagtt tttatttcat ggtcagtttt tatttcatgg 1081 atagcatttt ggattgacac caaggcgtta ccagcgagga taacgctggg cgtttcatca 1141 ctgatggctt tgacgtttca atttggtaat atcgttaaaa atcttccaag agtcagctat 1201 gtcaaggctc tcgacatttg gatgtttggt tgcgtaggat ttatattcct ttcacttgtt 1261 gagttagccg tggttggttt tgcggacaaa cttgacgcga aacggaaacg atacggaagg 1321 tccattgaac atgccgttat gcgaagtgat tctgagcaac agtggctttc cagacttcaa 1381 cggagtcatt tcactgaagt tgtggataat cgaagtccac taactactgg tggtgttccg 1441 ttactggtag cacccgaagg caacggaaac acccaaagaa agcgttccga agaaaaaact 1501 cggcaaatgt acgtacacgt ggaacatcct attcatgtaa atggagagag gatagatgaa 1561 atttctgcga agctgttccc attgatgttc acagctttca atatattcta ctggttctac 1621 tatattggaa tgtcaggagg aatattttaa attcgatggc cttttatttg ttgaacttgc 1681 ctatttcttt gcctacatga tgacgtgatt cctatcaaat atatcaaata tctatacatt 1741 gttattatca ttaaacaagc tgagtaaata ctagtctgtg taaaaaaaaa aaaaa

107

Appendix

3. Manuscript IV

An UNC-49 GABA receptor subunit from the parasitic nematode Haemonchus contortus is associated with enhanced GABA sensitivity in nematode heteromeric channels

Salma Z. Siddiqui, David D. R. Brown, Vijayaraghava T. S. Rao, and Sean G. Forrester

Journal of Neurochemistry 113: 1113-1122 (2010)

108

Abstract We have identified two genes from the parasitic nematode, Haemonchus contortus, Hco- unc-49B and Hco-unc-49C that encode two GABA-gated chloride channel subunits. Electro physiological analysis revealed that this channel has proper-ties similar to those of the UNC-49 channel from the free-living nematode Caenorhabditis elegans. For example, the Hco-UNC-49B subunit forms a functional homomeric channel that responds to GABA and is highly sensitive to picrotoxin. Hco-UNC-49C alone does not respond to GABA but can assemble with Hco-UNC-49B to form a heteromeric channel with a lower sensitivity to picrotoxin. However, we did find that the Hco-UNC-49B/C heteromeric channel is significantly more responsive to agonists compared to the Hco-UNC-49B homomeric channel, which is the opposite trend to what has been found previously for the C. elegans channel. To investigate the subunit requirements for high agonist sensitivity, we generated cross-assembled channels by co-expressing the H. contortus subunits with UNC-49 subunits from C. elegans (Cel-UNC-49). Co-expressing Cel-UNC-49B with Hco- UNC-49C produced a heteromeric channel with a reduced sensitivity to GABA compared to that of the Cel-UNC-49B homomeric channel. In contrast, co-expressing Hco-UNC- 49B with Cel-UNC-49C produced a heteromeric channel that, like the Hco-UNC-49B/C heteromeric channel, exhibits an increased sensitivity to GABA. These results suggest that the Hco-UNC-49B subunit is the key determinant for the high agonist sensitivity of heteromeric channels.

109

1.0 Introduction Haemonchus contortus is a gastrointestinal parasitic nematode, which resides in the abomasum of sheep and goats where it causes anemia and other complications (Mehlhorn 2008) resulting in great losses in productivity within the agricultural sector. Infection with H. contortus is commonly controlled using different classes of anthelmintics that target various proteins including b-tubulin (targets for benzimidazoles) as well as receptors called cys-loop ligand-gated chloride channels (LGCCs). Currently used drugs that target LGCCs include the macrocyclic lactones which activate glutamate-gated chloride channels (GluCls) and piperazine which is thought to target GABA-gated chloride channels (Ko¨hler 2001). However, increased drug resistance has rendered several currently available anthelmintics, including the macrocyclic lactones, less effective (Prichard 1994) and thus, there is an ongoing need to discover novel protein targets for future anti-parasitic drugs. GABA-gated chloride channels play an important role in the function of the inhibitory nervous system in both vertebrates (Sieghart et al. 1999) and invertebrates (Schuske et al.

2004). In invertebrates, one particular class of GABAA receptor subunits, the RDLs

(Resistance to Dieldrin), appear to be in many ways divergent from mammalian GABAA receptors and thus may be unique to invertebrates (Dent 2006). In the model free-living nematode, Caenorhabditis elegans, three RDL-like subunits (UNC-49A, UNC-49B and UNC-49C) have been characterized and are encoded by a single gene that is differentially spliced (Bamber et al. 1999). When expressed in Xenopus laevis oocytes, the UNC-49B subunit from C. elegans (Cel-UNC-49B) alone is able to form a functional homomeric channel and can assemble with Cel-UNC-49C to form a functional heteromeric channel that exhibits a reduced sensitivity to GABA (Bamber et al. 1999) and differing responses to various channel modulators and inhibitors (Bamber et al. 2003). The Cel-UNC-49B/C heteromeric channel appears to be the native channel which is expressed at neuromuscular junctions (Bamber et al. 1999, 2005) and plays a key role in GABA-mediated control of locomotion (Richmond and Jorgensen 1999). In contrast to C. elegans, the role of GABA in parasitic nematodes is less understood. Evidence for GABA neuro-transmission has been demonstrated in the parasitic nematodes Ascaris suum (Martin 1980, 1985; Guastella et al. 1991; Martin et al. 1991), H. 110 contortus (Laughton et al. 1994; Portillo et al. 2003) and Trichinella spiralis (Ros-Moreno et al. 1999). In A. suum, GABA receptors, which are associated with somatic muscle, have been shown to be neither bicuculline- nor picrotoxin-sensitive (Holden-Dye et al. 1988), which is a pharmacological profile distinct from mammalian GABAA receptors. The A. suum receptor is also partially sensitive to the GABAA receptor agonist, muscimol (Holden-Dye 1989). In addition, previous studies on H. contortus have identified a putative GABA receptor subunit gene called Hco-HG1, which encodes a protein orthologous to the uncharacterized C. elegans subunit LGC-37 (Laughton et al. 1994) and is expressed in ring motor- and inter-neurons (Skinner et al. 1998). Although Hco-HG1 does not appear to form a functional homomeric channel in Xenopus oocytes, it can co- assemble with the C. elegans subunit GAB-1 to form a functional GABA-sensitive channel (Feng et al. 2002). While these reports provide evidence that GABA is utilized by parasitic nematodes, we still do not know the full extent of the repertoire of GABA receptors in these organisms, nor do we fully understand the potential differences in GABA neurotransmission between free-living and parasitic nematodes. To better understand inhibitory GABA neurotransmission in parasitic nematodes, we have isolated two GABA receptor subunit genes from H. contortus, Hco-unc-49B and C, which are orthologous to the unc-49 genes from the free-living nematode C. elegans (Cel- unc-49). Interestingly, functional analysis has revealed that the H. contortus channel shares several of the characteristics previously reported for the orthologous channel in C. elegans (Bamber et al. 1999). However, we observed some key functional differences that appear to be linked to the Hco-UNC-49B subunit.

2.0 Experimental procedures

2.1 Cloning and sequencing of Hco-unc-49B and Hco-unc-49C

RNA was isolated using Trizol (Invitrogen, Carlsbad, CA, USA) from adult H. contortus worms supplied by Dr. Roger Prichard (Institute of Parasitology, McGill University). Copy DNA (cDNA) was synthesized using the RevertAidTM minus first strand cDNA synthesis kit (Fermentas, Burlington, ON, Canada.). A modified oligo-dT 111 anchor primer (5’CCTCTGAAGGTTCACGGATCCACATCTAGATTTTTTTTTTTTTTTTTTVN3’); [where V is either A, C, or G and N is either A, C, G, or T (Weston et al. 1999)] was used to create the cDNA template for the isolation of Hco-unc-49C and Hco-unc-49B. Partial H. contortus gene sequences were identified by searching a H. contortus specific online sequence database (Sanger Institute, Cambridge, UK). Partial sequences predicted to encode GABAA-receptor subunits were chosen for further molecular cloning and functional analysis. These sequences were used to design gene specific primers for the 5’ and 3’ rapid amplification of cDNA ends procedure (Frohman et al. 1988).

2.2 Isolation of Hco-unc-49C

The 5’ region of Hco-unc-49C was isolated using a sense primer specific to the splice leader 1 sequence (splice leader 1- 5’GGTTTAATTACCCAAGTTTGAG3’) [a sequence commonly found spliced onto the 5’ end of nematode mRNA (Van Doren and Hirsh 1988)] along with two antisense gene-specific primers in a nested PCR (nested primer 5’ATAGCAGAAGCCCAGATAGAC3’) using a PTC-100 Programmable Thermal Controller (MJ Research, Inc., Waltham, MA, USA). Resultant amplicons of the predicted size were sub-cloned into pGEM-T easy (Promega, Madison, WI, USA) and sequenced (Genome Quebec, Montréal, QC, Canada). The 3’ sequence was amplified using two sense gene-specific primers in a nested PCR (nested primer 5’TCACAGAGACGCATTTGATG3’) with two antisense primers specific to the modified oligo-dT anchor added to the cDNA. Amplicons of the expected size were sub- cloned and sequenced, yielding the predicted full length Hco-unc-49C gene. The full length sequence was verified using primers (named Hco-unc-49 5’ and Hco-unc-49C 3’), which flank the 5’ and 3’ coding sequence, in a nested PCR.

2.3 Isolation of Hco-unc-49B

To isolate the 3’ region of Hco-unc-49B, a nested PCR was performed using two sense gene specific primers (nested primer 5’CGATTCCGCTTATTCAACATCCTC3’) along 112 with primers specific to the modified oligo-dT anchor at the 3’ end as previously mentioned. PCR amplicons were cloned and sequenced as above. As it is predicted that, like the unc-49B transcripts in C. elegans, the Hco-unc-49B transcript shares the same 5’ end with Hco-unc-49C, the full length Hco-unc-49B coding sequence was amplified using the same sense Hco-unc-49 5’ primer as above, along with an antisense primer specific to the 3’ coding sequence of Hco-unc-49B.

2.4 Sequence analysis

The predicted full-length genes of Hco-unc-49B and Hco-unc-49C were translated and the resulting amino acid sequences were aligned with their C. elegans counterparts using the program MacVector (MacVector Inc., Cary, NC, USA).

2.5 Expression of unc-49B and unc-49C in Xenopus laevis oocytes

The coding sequence of Hco-unc-49B and Hco-unc-49C were sub-cloned into the oocyte expression vector, pT7Ts. The vector was then linearized and used as template in an in vitro transcription reaction (T7 mMessage mMachine kit, Ambion, Austin, TX, USA) producing the corresponding copy RNA (cRNA). The cRNA was subsequently precipitated using lithium chloride and diluted to the appropriate concentration. Cel-unc- 49B and Cel-unc-49C full-length cDNA clones (provided by Dr. B. Bamber, University of Toledo) were linearized using Asp-718I (Roche Molecular Biochemicals, Indianapolis, IN, USA) and used as template in an in vitro transcription reaction (T3 mMessage mMachine kit, Ambion). Xenopus laevis oocytes were injected with 50 nL of Hco-unc-49B and/or Hco-unc-49C cRNA (0.3–0.5 ng/nL) using a Drummond Nanoject microinjector and incubated at 20LC in ND96 (96 mM NaCl, 2 mM KCl, 1 mM MgCl2, 1.8 mM CaCl2, 5 mM HEPES pH 7.5) supplemented with 0.275 μg/mL pyruvate and 100 μg/mL gentamycin (Sigma-Aldrich Canada Ltd., Oakville, ON, Canada). For the co-expression of multiple subunits, mRNA for each subunit was mixed together in equal proportions and injected into the oocytes. Recordings were routinely made 2–5 days post-cRNA injection. 113

2.6 Electrophysiological recordings

Two-electrode voltage clamp electrophysiology was performed using the Axoclamp 900A voltage clamp (Molecular Devices, Sunnyvale, CA, USA). Glass electrodes containing Ag|AgCl wire were filled with 3 M KCl and had a resistance between 1 and 5 MW. Oocytes were clamped at -60 mV for the duration of the experiments. The drugs GABA and muscimol (both from Sigma) were dissolved in ND96. Picrotoxin (Sigma) was dissolved in dimethylsulfoxide. Drugs were washed over the oocytes using an RC-1Z recording chamber (Warner Instrument Inc., Hamdan, CT, USA). Data were obtained and analyzed using the Clampex software (Molecular Devices) and graphs were produced using Graphpad Prism Software 5.0 (San Diego, CA, USA). GABA and muscimol EC50 values were determined by generating dose response curves fitted to the equation:

Imax = 1 ______h {1 + (EC50/[D]) }

where Imax is the maximal response, [D] is the concentration of drug, EC50 is the concentration of drug that is required to produce half-maximal current, and h is the Hill coefficient. Imax, EC50 and h are free parameters. The curves were then normalized to the estimated Imax. The equation generating the dose response curves was used to fit a sigmoidal curve of variable slope to the normalized data (GraphPad). Significant differences between EC50 values were determined using either a one way ANOVA with Tukey’s multiple comparison test or a Student’s t-test and a p-value of ≤ 0.05 was considered significant. Current voltage relationships were performed by changing the holding potential in 20 mV steps from) 60 mV to +40 mV, and at each step the oocyte was exposed to 1 mM GABA. For reduced chloride trials, NaCl was partially substituted with Na-gluconate (Sigma) in the ND96 for a final Cl- concentration of 62.5 mM.

114

3.0 Results

3.1 Cloning of the Hco-unc-49 genes

PCR isolation of the Hco-unc-49C gene yielded a 1767 bp cDNA sequence. This full- length sequence included a 276 bp 5’ untranslated region (UTR). The 3’ end contained 171 bp of UTR as well as a poly-A tail. When translated in the appropriate reading frame, the sequence encodes for a 440 amino acid polypeptide, containing the signature cys-loop. In addition, four hydrophobic trans-membrane domains were identified as well as a signal peptide cleavage site (SignalP 3.0 server – http://www.cbs.dtu.dk/services/ SignalP/). The Hco-UNC-49C protein sequence shares an 85% homology with its predicted C. elegans ortholog, Cel-UNC-49C (Genbank accession number AF151644.1), a GABAA receptor subunit. An amino acid alignment of Hco-UNC-49C and Cel-UNC-49C revealed a high degree of sequence homology, especially in the membrane spanning domains (Fig. 1). The Hco-unc-49B gene was found to have 1489 bp of coding sequence and 699 bp of unique 3’ UTR. The full predicted Hco-UNC-49B polypeptide consists of 496 amino acids and shares an 81% homology with the C. elegans subunit Cel-UNC-49B.1 (Genbank accession number AF151641). However, the H. contortus polypeptide has a longer M3– M4 intracellular domain and is, in that respect, more similar to Cel-UNC-49B.3 (Bamber et al. 1999). The Hco-UNC-49B and Hco-UNC-49C polypeptides share a common N- terminal domain and are identical until just after the cys-loop; at this point the sequences diverge and thus exhibit two different C-terminal ends (Fig. 1). RT-PCR analysis of Hco-unc-49B and Hco-unc-49C detected the presence of transcripts in four life-stages of H. contortus (eggs, L3 larvae, adult female and adult male). However, PCR amplicons of Hco-unc-49B and Hco-unc-49C were least intense in the egg stage compared to the other life stages when calibrated to a control 18S ribosomal RNA gene (data not shown). 115

Appendix 3 Fig. 1 Protein sequence alignment of H. contortus and C. elegans UNC-49B, UNC-49C and a Rat GABAA beta1 (Rn-GABA-beta) sub-unit (Genbank accession number NM_012956.1). Dark shaded areas indicate regions of amino acid identity or no alignment between the sequences, lightly shaded areas indicate similar amino acids and no shading indicates no similarity. Signal peptide cleavage site in Hco-UNC-49B and C is identified by (▼). The downward facing arrow indicates the region where Hco-UNC-49 is presumably spliced, generating Hco-UNC-49B and C. The methionine involved in the UNC-49C resistance to picrotoxin is identified by (●). The cys-loop, putative binding domains, BDI and BDII (Bamber et al. 1999) and four membrane spanning domains (M1– M4) are indicated. Protein kinase C phosphorylation sites are indicated by the appropriately circled amino acids found in the M3–M4 intracellular loop.

116

3.2 Pharmacological characterization of Hco-UNC-49B and Hco-UNC-49C

When expressed in X. laevis oocytes, Hco-UNC-49B alone was able to form a homomeric channel and produce a robust response (current) to 100 μM GABA (Fig. 2), which was observed in many oocytes from several different frogs. In contrast, Hco-UNC- 49C alone (Fig. 2) or oocytes injected with water did not respond to GABA. When both Hco-unc-49B and Hco-unc-49C (Hco-UNC-49B/C) were injected in equal amounts a strong response to 100 μM GABA was also observed. Neither Hco-UNC-49B nor Hco- UNC-49B/C responded to 1 mM glycine or glutamate (data not shown). The GABA response for both Hco-UNC-49B and Hco-UNC-49B/C was dose-dependent when tested with concentrations of GABA ranging from 1 μM to 5 mM. Oocytes expressing Hco- UNC-49B exhibited a slightly, but significantly, lower sensitivity to GABA compared to oocytes expressing both Hco-UNC-49B and C subunits (Fig. 3a and b). The GABA EC50 value for Hco-UNC-49B was 64.0 ± 4.4 μM (n = 6) with a Hill coefficient of 1.9 ± 0.2. Hco-UNC-49B/C exhibited an EC50 of 39.9 ± 5.7 μM (n = 10) with a Hill coefficient of 2.2 ± 0.4. Although a difference in GABA sensitivity is evident between homomeric and heteromeric channels, no consistent difference was observed in the activation or inactivation kinetics. Current-voltage analysis of the Hco-UNC-49B/C channel using full Cl- ND96 (final concentration 103.6 mM Cl-) indicated a reversal potential of -17.2 ± 4.0 mV (n = 5) (Fig. 3c) consistent with the calculated Nernst potential for Cl- (-18.5 mV), assuming 50 mM internal Cl- (Kusano et al. 1982). When NaCl was partially replaced with Na-gluconate in the ND96, the reversal potential shifted to -6.9 ± 4.2 mV (n = 4), consistent with the predicted Nernst potential of -5.7 mV. The Hco-UNC-49B homomeric channel was much more sensitive to the GABA-gated chloride channel blocker picrotoxin, compared to the Hco-UNC-49B/C heteromeric channel (Fig. 4a and b). In the presence of picrotoxin, the response of Hco-UNC-49B to GABA was reduced by 94.0 ± 0.9% (n = 4) compared to a 46.0 ± 5.9% (n = 4) reduction in the response of Hco-UNC-49B/C to GABA (Fig. 4c).

117

Appendix 3 Fig. 2 Hco-UNC-49 channel response to GABA. Hco-UNC-49B and Hco- UNC-49B/C expressed in Xenopus laevis oocytes respond to 100 μM GABA (left and right, respectively). Hco-unc-49C injected oocytes (middle) do not respond to 100 μM GABA.

Appendix 3 Fig. 3 (a) Dose response electrophysiological traces for Hco-UNC-49B and Hco-UNC-49B/C. The GABA concentrations (μM) used are indicated above each trace. (b) Dose response curves of Hco-UNC-49B and Hco-UNC-49B/C with the current normalized to the percentage of maximal response. (c) Current-voltage analysis using 103.6 mM Cl- and 62.5 mM Cl- in ND96 buffer solution. GABA responses were generated with 1 mM GABA.

118

Appendix 3 Fig. 4 Hco-UNC-49B/C is more resistant to the inhibiting effects of picrotoxin compared to Hco-UNC-49B. (a) Hco-UNC-49B and (b) Hco-UNC-49B/C channel response to 50 μM GABA alone followed by 50 μM GABA combined with 100 μM picrotoxin. (c) Graph indicating the percent picrotoxin-dependent inhibition of the GABA response for each Hco-UNC-49 channel.

3.3 The Hco-UNC-49B/C channel has a higher sensitivity to muscimol compared to the Hco-UNC-49B channel

Both Hco-UNC-49B and Hco-UNC-49B/C responded to 100 μM muscimol (Fig. 5a and b). However, the Hco-UNC-49B average current generated by muscimol was only 23.5 ± 3.5% (n = 3) of the current generated by the same concentration of GABA. In contrast, the average response of Hco-UNC-49B/C to muscimol was 48.1 ± 15.1% (n =

3) of the GABA response (Fig. 5c). The muscimol EC50 values for the Hco-UNC-49B and Hco-UNC-49B/C channels were 157.5 ± 13.2 μM (n = 8) (Hill coefficient of 2.8 ± 119

0.3), and 62.2 ± 4.0 μM (n = 8) (Hill coefficient of 2.0 ± 0.2), respectively (Fig. 5d).

3.4 The Hco-UNC-49B subunit is associated with increased GABA sensitivity in nematode heteromeric channels

Previous reports on the UNC-49 channel in C. elegans have found that the assembly of Cel-UNC-49C with Cel-UNC-49B produces a heteromeric channel with a lower sensitivity to GABA compared to the Cel-UNC-49B homomeric channel (Bamber et al. 1999). Our results from the H. contortus UNC-49 subunits demonstrate the opposite trend; the heteromeric channel has higher sensitivity to GABA compared to the homomeric channel. To determine which specific subunit (either B or C) is associated with high GABA sensitivity in the H. contortus heteromeric channels, we produced cross-assembled channels that contain both C. elegans and H. contortus UNC-49 subunits. The calculated

EC50 for Cel-UNC-49B was 41.7 ± 8.7 μM (n = 10) (Fig. 6b), which is similar to that previously reported (Bamber et al. 1999). When the Cel-UNC-49B subunit was co- expressed with Hco-UNC-49C, a significant decrease in GABA sensitivity was observed with an EC50 of 97.2 ± 10.2 μM (n = 14) (Fig. 6b). In contrast, when Hco-UNC-49B was co-expressed with Cel-UNC-49C the resultant channel was significantly more sensitive to

GABA with an EC50 of 24.5 ± 2.1 μM (n = 8), compared to the Hco-UNC-49B homomeric channel (Fig. 6c). A summary of EC50 values and hill coefficients is shown in Table 1.

120

Appendix 3 Fig. 5 Muscimol activates the Hco-UNC-49 channels. (a) Muscimol response for the Hco-UNC-49B and (b) Hco-UNC-49B/C channels. Oocytes were first washed in 100 μM GABA and then in 100 μM muscimol. (c) Bar graph representing the channel response of muscimol in comparison to GABA. Percentage indicates the difference in channel response between GABA and muscimol. (d) Dose response analysis of muscimol for the Hco-UNC-49B and Hco-UNC-49B/C channels.

121

Appendix 3 Fig. 6 Hco-UNC-49 and Cel-UNC-49 cross-assembled heteromeric channels have differing GABA sensitivities. (a) Electrophysiological traces of Cel-UNC-49B, Cel- UNC-49B/Hco-UNC-49C and Hco-UNC-49B/Cel-UNC-49C in response to various concentrations of GABA. Concentrations of GABA (in μM) are indicated above each trace. (b) Dose response curves generated for Cel-UNC-49B and Cel-UNC-49B/ Hco- UNC-49C showing a decrease in GABA sensitivity because of the introduction of Hco- UNC-49C. (c) Dose response curves showing the response of Hco-UNC-49B (from Fig. 3b) and Hco-UNC-49B/ Cel-UNC-49C to GABA.

4.0 Discussion

Here, we report the isolation and pharmacological characterization of two Hco-UNC-49 subunits, Hco-UNC-49B and Hco-UNC-49C, from the parasitic nematode, H. contortus. Like their C. elegans orthologs, Hco-UNC-49B and C share the same N-terminal sequence but differ in their C-terminal sequence, which includes the membrane spanning regions. It is assumed, therefore, that similar to the situation in C. elegans, these Hco-unc- 49B and C transcripts are generated by alternative splicing of the same Hco-unc-49 gene. However, further research is required to confirm this. A similar phenomenon has been reported for a GluCl gene called avr-14 which has been shown, in several nematode species, to be alternatively spliced to form two different transcripts and thus different 122

GluCl subunits (Laughton et al. 1997; Jagannathan et al. 1999; Yates and Wolstenholme 2004). It appears, therefore, that this type of transcript generation is conserved among nematodes.

Functional analysis of the Hco-UNC-49 channels revealed some properties that were similar to previously reported C. elegans UNC-49 channels. First, the H. contortus UNC- 49B subunit, like its C. elegans counterpart, forms a functional homomeric channel with a similar EC50 for GABA and is highly sensitive to the open channel blocker, picrotoxin. Second, similar to studies in C. elegans, Hco-UNC-49C does not form a functional channel alone but will associate with Hco-UNC-49B to produce a picrotoxin resistant heteromeric channel. The resistance of the H. contortus and C. elegans channels to picrotoxin can be attributed to the fact that the M2 region of the UNC-49C subunit from both species exhibits a methionine at a key position that is associated with picrotoxin resistance (Zhang et al. 1995; Bamber et al. 2003) (Fig. 1). Thus, incorporation of the nematode UNC-49C subunit causes heteromeric channels to become resistant to picrotoxin. It is interesting to note that the GABAA receptor characterized from Ascaris muscle is also picrotoxin resistant (Holden-Dye et al. 1988) suggesting that this receptor shares similar properties to the Hco-UNC-49B/C heteromeric channel.

Both H. contortus homomeric and heteromeric channels responded to the restricted structural analogue of GABA, muscimol. However, as was the case for GABA, the heteromeric channel had a higher sensitivity to muscimol compared to the homomeric channel, although overall, muscimol was a less potent agonist for these channels. This is different than what has been observed for mammalian, particularly rat, GABAA receptors, where muscimol appears to be a more potent agonist compared to GABA (Amin and

Weiss 1993; Vien et al. 2002). A similar trend was observed for GABAA receptors from the tobacco budworm (Wolff and Wingate 1998). Our results appear more similar to the

Ascaris GABAA receptor where muscimol was ~60% less potent compared to GABA (Holden-Dye 1989), which further supports the notion that the previously characterized Ascaris muscle receptor may be an Hco-UNC-49B/C-like channel. Further comparison of the H. contortus and C. elegans UNC-49 channels revealed an 123 important difference. Whereas in H. contortus the heteromeric channel (UNC-49B/C) has a higher sensitivity to GABA than does the homomeric channel (UNC-49B), in C. elegans, the opposite trend has been found. Bamber et al. (1999) showed that Cel-UNC- 49B/C is less sensitive to GABA compared to the Cel-UNC-49B homomeric channel. In an attempt to shed some light on the subunit determinants for either high or low GABA sensitivity of heteromeric channels, we co-expressed C. elegans UNC-49 subunits with H. contortus UNC-49 subunits. First, we observed the same sensitivity of the Cel-UNC-49B homomeric channel to GABA as reported by Bamber et al. (1999) (EC50 of 42 μM). However, co-expression of Cel-UNC-49B and Hco-UNC-49C resulted in a heteromeric channel with a decreased sensitivity to GABA (EC50 of 97 μM). This was, in fact, the same trend as observed for the Cel-UNC-49B/C channel, where incorporation of the C. elegans C subunit decreased the sensitivity of the channel to GABA (Bamber et al. 1999). In contrast, when the UNC-49B subunit from H. contortus was co-expressed with the Cel- UNC-49C subunit, the resulting channel was found to have a higher sensitivity to GABA than both the Hco-UNC-49B homomeric channel and the Hco-UNC-49B/C heteromeric channel. Therefore, it appears that when Hco-UNC-49B assembles with an UNC-49C subunit, the sensitivity of the channel to GABA increases, regardless of whether the co- injected unc-49C RNA is from H. contortus or C. elegans. The cause for the increased GABA sensitivity in Hco-UNC-49B-associated heteromeric channels is unknown. It should be noted that the only UNC-49B subunit that we detected from H. contortus exhibited a longer M3–M4 intracellular loop compared to the C. elegans UNC-49B subunit that we used in this study. Whether this difference is associated with the results of the current study is not known at this time. The M3–M4 intracellular loop is generally thought to contribute to subtype specificity as well as intracellular regulatory processes (Olsen and Tobin 1990) and not necessarily binding affinities. We believe that the more likely cause may be found in the amino acid differences in the BDs of Hco-UNC-49B and Cel-UNC-49B. In mammalian GABAA receptors, a mutation of a highly conserved threonine residue in BDI of the β subunit causes a decrease in the sensitivity of a1b2c2 channels to GABA (Amin and Weiss 1993). In the Hco-UNC-49B subunit, a threonine is present in the equivalent position while in the C. elegans UNC-49B subunit, a glutamic acid is present. Interestingly, however, when comparing the EC50 124 values of the UNC-49B homomeric channels from both species, there is only a slight difference (64 vs. 42 μM). Thus, if this unique threonine residue found on Hco-UNC-49B causes an enhancement of GABA binding, it may only become involved when Hco-UNC- 49B becomes associated with an UNC-49C subunit, suggesting that, like mammalian

GABAA receptors, the GABA binding site is on the interface of adjacent subunits (Deng et al. 1986; Bureau and Olsen 1988) (in our case on the interface of UNC-49B and UNC- 49C). Another amino acid variation between the UNC-49B subunits from both species resides in the BDII where a serine is found in the Hco-UNC-49B subunit and a lysine in found in the equivalent position in Cel-UNC-49B. The significance of this variation is not known and we are currently investigating residues in both BDs to verify their role in GABA binding. Our goal here was to better understand the role of GABA receptors in a parasite such as H. contortus and how they compare to homologous receptors found in a non-parasitic nematode. We have observed clear differences in channel properties between the H. contortus UNC-49B homomeric and UNC-49B/C heteromeric channels when compared to the free-living nematode C. elegans. How these different channel properties affect overall GABA neurotransmission in parasitic nematodes will be an important area of future research.

Acknowledgements

We thank Dr. Bruce Bamber for the C. elegans unc-49 clones and Dr. Roger Prichard for the H. contortus RNA used in this study. This research was funded by a postgraduate scholarship by the Natural Science and Engineering Research Council (NSERC) to SZS and grants from NSERC and the Canadian Foundation for Innovation to SGF.

125

References:

Amin, J. and Weiss, D.S. 1993. GABAA receptor needs two homologous domains of the & beta;-subunit for activation by GABA but not by pentobarbital. (366) 565-569.

Bamber, B.A., Beg, A.A., Twyman, R.E. and Jorgensen, E.M. 1999. The Caenorhabditis elegans unc-49 Locus Encodes Multiple Subunits of a Heteromultimeric GABA Receptor. The Journal of Neuroscience (19) 5348-5359.

Bamber, B.A., Twyman, R.E. and Jorgensen, E.M. 2003. Pharmacological characterization of the homomeric and heteromeric UNC-49 GABA receptors in C. elegans. Br.J.Pharmacol. (138) 883-893.

Bamber, B.A., Richmond, J.E., Otto, J.F. and Jorgensen, E.M. 2005. The composition of the GABA receptor at the Caenorhabditis elegans neuromuscular junction. Br.J.Pharmacol. (144) 502-509.

Bureau, M. and Olsen, R.W. 1988. GABA/benzodiazepine receptor protein carries binding sites for both ligands on two major peptide subunits. Biochem. Biophys. Res. Commun. (153) 1006-1011.

Deng, L., Ransom, R.W. and Olsen, R.W. 1986. [3H]Muscimol photolabels the GABA receptor site on a peptide subunit distinct from that labeled with benzodiazepine. Biochem. Biophys. Res. Commun. (138) 1308-1314.

Dent, J.A. 2006. Evidence for a diverse Cys-loop ligand-gated ion channel superfamily in early bilateria. J.Mol.Evol. (62) 523-535.

Feng, X.P., Hayashi, J., Beech, R.N. and Prichard, R.K. 2002. Study of the nematode putative GABA type-A receptor subunits: evidence for modulation by ivermectin. J.Neurochem. (83) 870-878. 126

Frohman, M.A., Dush, M.K. and Martin, G.R. 1988. Rapid production of full-length cDNAs from rare transcripts: amplification using a single gene-specific oligonucleotide primer. Proceedings of the National Academy of Sciences (85) 8998-9002.

Guastella, J., Johnson, C.D. and Stretton, A.O.W. 1991. GABA-immunoreactive neurons in the nematode Ascaris. J.Comp.Neurol. (307) 584-597.

Holden-Dye, L. 1989. GABA receptors on the somatic muscle cells of the parasitic nematode, Ascaris suum: stereoselectivity indicates similarity to a GABAA-type agonist. Br.J.Pharmacol. (98) 841-850.

Holden-Dye, L., Hewitt, G.M., Wann, K.T., Krogsgaard-Larsen, P. and Walker, R.J. 1988. Studies involving avermectin and the 4-aminobutyric acid (GABA) receptor of Ascaris suum muscle. Pestic.Sci. (24) 231-245.

Jagannathan, S., Laughton, D.L., Critten, C.L., Skinner, T.M., Horoszok, L. and Wolstenholme, A.J. 1999. Ligand-gated chloride channel subunits encoded by the Haemonchus contortus and Ascaris suum orthologs of the Caenorhabditis elegans gbr-2 (avr-14) gene. Molecular & Biochemical Parasitology (103) 129-140.

Köhler, P. 2001. The biochemical basis of anthelmintic action and resistance. Int.J.Parasitol. (31) 336-345.

Kusano, K., Miledi, R. and Stinnakre, J. 1982. Cholinergic and catecholaminergic receptors in the Xenopus oocyte membrane. J.Physiol.(Lond.) (328) 143-170.

Laughton, D.L., Amar, M., Thomas, P., Towner, P., Harris, P., Lunt, G.G. and Wolstenholme, A.J. 1994. Cloning of a putative inhibitory amino acid receptor subunit from the parasitic nematode Haemonchus contortus. Recept.Channels (2) 155-163.

Laughton, D.L., Lunt, G.G. and Wolstenholme, A.J. 1997. Alternative splicing of a Caenorhabditis elegans gene produces two novel inhibitory amino acid receptor subunits with identical ligand binding domains but different ion channels. Gene (201) 119-125. 127

Martin, R.J. 1985. γ-aminobutyric acid and Piperazine activated single channel currents from Ascaris suum body muscle. Br.J.Pharmacol. (84) 445-461.

Martin, R.J. 1980. The effect of γ-aminobutyric acid on the input conductance and membrane potential of Ascaris muscle. Br.J.Pharmacol. (71) 99-106.

Martin, R.J., Pennington, A.J., Duittoz, A.H., Robertson, S. and Kusel, J.R. 1991. The physiology and pharmacology of neuromuscular transmission in the nematode parasite, Ascaris suum. Parasitology (102 Suppl) S41-58.

Mehlhorn, H. (Ed.). (2008). Encyclopedia of parasitology (3rd ed.) Springer Berlin Heidelberg.

Olsen, RW, Tobin, AJ. 1990. Molecular biology of GABAA receptors. The FASEB Journal (4) 1469-1480.

Portillo, V., Jagannathan, S. and Wolstenholme, A.J. 2003. Distribution of Glutamate- Gated Chloride Channel Subunits in the Parasitic Nematode Haemonchus contortus. J.Comp.Neurol. (462) 213-222.

Prichard, R. 1994. Anthelmintic resistance. Vet.Parasitol. (54) 259-268.

Richmond, J.E., Jorgensen, E.M. 1999. One GABA and two acetylcholine receptors function at the C. elegans neuromuscular junction. Nat.Neurosci. (2) 791-797.

Ros-Moreno, R.M., Moreno-Guzman, M.J., Jimenez-Gonzalez, A. and Rodriguez- Caabeiro, F. 1999. Interaction of ivermectin with γ-aminobutyric acid receptors in Trichinella spiralis muscle larvae. Parasitol.Res. (85) 320-323.

Skinner, T.M., Bascal, Z.A., Holden-Dye, L., Lunt, G.G. and Wolstenholme, A.J. 1998. Immunocytochemical localization of a putative inhibitory amino acid receptor subunit in the parasitic nematodes Haemonchus contortus and Ascaris suum. Parasitology (117) 89- 96. 128

Van Doren, K. and Hirsh, D. 1988. Trans-spliced leader RNA exists as small nuclear ribonucleoprotein particles in Caenorhabditis elegans. Nature (335) 556-559.

Vien, J., Duke, R.K., Mewett, K.N., Johnston, G.A.R., Shingai, R. and Chebib, M. 2002. trans-4-Amino-2-methylbut-2-enoic acid (2-MeTACA) and (±)-trans-2- aminomethylcyclopropanecarboxylic acid ((±)-TAMP) can differentiate rat ρ3 from human ρ1 and ρ2 recombinant GABAC receptors. Br.J.Pharmacol. (135) 883-890.

Weston, D., Patel, B. and Van Voorhis, W.C. 1999. Virulence in Trypanosoma cruzi infection correlates with the expression of a distinct family of sialidase superfamily genes. Molecular & Biochemical Parasitology (98) 105-116.

Wolff, M.A. and Wingate, V.P.M. 1998. Characterization and comparative pharmacological studies of a functional γ-aminobutyric acid (GABA) receptor cloned from the tobacco budworm, Heliothis virescens (Noctuidae: Lepidoptera). Invertebr.Neurosci. (3) 305-315.

Yates, D.M. and Wolstenholme, A.J. 2004. An ivermectin-sensitive glutamate-gated chloride channel subunit from Dirofilaria immitis. Int.J.Parasitol. (34) 1075-1081.

Zhang, D., Pan, Z.H., Zhang, X., Brideau, A.D. and Lipton, S.A. 1995. Cloning of y- aminobutyric acid type C receptor subunit in rat retina with methionine residue critical for picrotoxinin channel block. Proc.Natl.Acad.Sci.USA (92) 11756-11760.