Oncogene (2010) 29, 1073–1084 & 2010 Macmillan Publishers Limited All rights reserved 0950-9232/10 $32.00 www.nature.com/onc ORIGINAL ARTICLE miR-145 induces caspase-dependent and -independent cell death in urothelial cancer cell lines with targeting of an expression signature present in Ta bladder tumors
MS Ostenfeld1, JB Bramsen2, P Lamy1,3, SB Villadsen2, N Fristrup1,KDS rensen1, B Ulh i4, M Borre5, J Kjems2, L Dyrskj t1 and TF Ørntoft1
1Department of Molecular Medicine, Aarhus University Hospital, Aarhus N, Denmark; 2Department of Molecular Biology, University of Aarhus, Aarhus C, Denmark; 3BiRC, Bioinformatics Research Center, University of Aarhus, Aarhus C, Denmark; 4Institute of Pathology NBG, Aarhus Hospital, Aarhus, Denmark and 5Department of Urology, Aarhus University Hospital, Skejby, Denmark
Downregulation of miR-145 in a variety of cancers suggests tionally in multi-cellular organisms by interaction with a possible tumor suppressor function for this microRNA. partially complementary target sites in mRNA mole- Here, we show that miR-145 expression is reduced in cules. In accordance, miRNAs have been shown to bladder cancer and urothelial carcinoma in situ,compared influence gene regulatory processes in, for example, with normal urothelium, using transcription profiling and in development, differentiation, and disease, such as cancer situ hybridization. Ectopic expression of miR-145 induced (Calin and Croce, 2006; Esquela-Kerscher and Slack, extensive apoptosis in urothelial carcinoma cell lines (T24 2006), in which specific miRNA signatures have been and SW780) as characterized by caspase activation, associated with different clinical outcomes (Nakajima nuclear condensation and fragmentation, cellular shrink- et al., 2006; Rajewsky, 2006; Yanaihara et al., 2006; age, and detachment. However, cell death also proceeded Sempere et al., 2007; Tavazoie et al., 2008; Dyrskjot upon caspase inhibition by the pharmacological inhibitor et al., 2009). Approximately 50% of the known zVAD-fmk and ectopic expression of anti-apoptotic Bcl-2, miRNAs are located within regions of genomic indicating the activation of an alternative caspase-indepen- instability that are amplified or deleted in cancer (Calin dent death pathway. Microarray analysis of transcript et al., 2004), which may in part explain the aberrant levels in T24 cells, before the onset of cell death, showed expression observed. MIR145 is located at chromosome destabilization of mRNAs enriched for miR-145 7mer 5q32 in a putative bicistronic cluster with MIR143 target sites. Among these, direct targeting of CBFB, (Cordes et al., 2009), a region commonly lost in PPP3CA, and CLINT1 was confirmed by a luciferase myelodysplastic syndromes (Horrigan et al., 1996). reporter assay. Notably, a 22-gene signature targeted on miRNAs are predominantly transcribed by polymer- enforced miR-145 expression in T24 cells was significantly ase II and processed by Drosha into B70–100 nt (Po0.00003) upregulated in 55 Ta bladder tumors with precursor molecules (Lee et al., 2003). Once exported concomitant reduction of miR-145. Our data indicate that out of the nucleus by Exportin-5, pre-miRNAs are reduction in miR-145 expression may provide bladder processed into B22 nt duplexes and on separation, cancer cells with a selective advantage by inhibition of cell single-stranded mature miRNAs interact with target death otherwise triggered in malignant cells. mRNAs. According to the current dogma, miRNAs Oncogene (2010) 29, 1073–1084; doi:10.1038/onc.2009.395; interact predominantly with sequences in the 30 published online 16 November 2009 untranslated region (UTR) of mRNAs that are com- plementary to nt 2–8 of the miRNA (termed the ‘seed’) Keywords: miRNA; bladder cancer; cell death; caspases; resulting in mRNA destabilization and/or translational microarray repression depending on the degree of complementarity, and under the influence of RNA-binding proteins, such as Dnd1 (Kedde et al., 2007; Baek et al., 2008). However, miRNAs may also enhance translation on 0 Introduction binding in the 5 UTR and oscillate between mediating translational repression or activation (Vasudevan et al., MicroRNAs (miRNAs) are small non-coding RNA 2007; Orom et al., 2008). molecules that regulate gene expression post-transcrip- Reduced expression of miR-145 has been observed in a variety of cancers, such as colon, lung, ovarian, prostate, and breast cancer (Michael et al., 2003; Iorio Correspondence: Professor TF Ørntoft, Department of Molecular et al., 2005; Yanaihara et al., 2006; Porkka et al., 2007; Medicine, Aarhus University Hospital, Brendstrupgaardsvej, Yang et al., 2008). The downregulation is evident Aarhus N, Denmark. E-mail: [email protected] already in precancerous stages of breast and colon Received 28 May 2009; revised 9 September 2009; accepted 13 October cancer (Michael et al., 2003; Sempere et al., 2007), 2009; published online 16 November 2009 suggesting loss of miR-145 as a common early Functional role of miR-145 in bladder cancer MS Ostenfeld et al 1074 neoplastic event. In situ hybridization (ISH) analysis has Results identified miR-145 expression in myoepithelial cells of the mammary lobules and ducts as well as in smooth Localization of miR-145 in clinical samples muscle cells (Sempere et al., 2007; Cordes et al., 2009). by ISH analysis Furthermore, studies have shown that miR-145 reduces The downregulation of miR-145 (Figure 1a) in bladder cell viability in colon and cervical cancer cell lines after cancer specimens and urothelial cell lines, as compared prolonged exposure (Shi et al., 2007; Schepeler et al., with normal biopsies (Figures 1b and c) (Dyrskjot et al., 2008; Wang et al., 2008). Finally, the expression of miR- 2009), prompted us to investigate whether the differ- 145 has been shown to be induced by p53 (Sachdeva ences in miRNA levels measured may reflect tissue et al., 2009) and regulated by an enhancer element heterogeneity and/or an altered ratio of different cell activated by SRF and Nkx-2 transcription factors types to the tumor mass, rather than tumor cell-specific (Cordes et al., 2009). expression changes. We performed ISH analysis to We recently identified miR-145 as the most signifi- identify which cell type(s) expressed miR-145 (Figure 2). cantly downregulated miRNA (P ¼ 2.1EÀ08) in an Detection of miRNAs by ISH is challenging because of miRNA profiling study on bladder cancer comprising their small size, we, therefore, applied an improved 106 clinical samples of bladder cancer and 11 normal method using locked nucleic acid (LNA)-modified bladder biopsies (Dyrskjot et al., 2009). Bladder cancer probes to ensure hybridization to single-stranded RNA is the fourth most common cancer among men and molecules (Nuovo, 2008). In normal tissue biopsies from can be pathologically classified into discrete stages; Ta bladder, the miR-145 probe gave a strong signal in the are benign papillary tumors, T1 are lamina propria- urothelium (Figure 2a, bottom panel). The uppermost invasive tumors, carcinoma in situ (CIS) are small in situ umbrella cell layer displayed less signal than the other lesions of high-grade atypia, and T2–T4 are muscle- layers of urothelium. Infiltrating lymphocytes in the invasive tumors. In this study, we used two different stroma, endothelial cells of blood vessels, and the approaches to examine the possible function of miR-145 muscularis mucosa also displayed miR-145 expression. in bladder cancer cells. First, we investigated the Papillary Ta tumors showed homogenous expression in localization of miR-145 in clinical samples and the carcinoma cells with reduced staining intensity com- phenotypic consequence of miR-145 expression in pared with normal urothelium, and muscle-invasive cell culture with identification of putative targets tumors showed heterogeneous expression among the involved in the cellular signaling. Second, a bioinfor- carcinoma cells (Figure 2b), usually with large carcino- matic analysis was conducted to clarify if the identified ma cell areas absent of signal (arrow) and occasional target genes could possibly be under the regulatory small ‘islets’ of intense signal (asterisks). In CIS lesions, influence of the miR-145 level in clinical specimens and the miR-145 signal was predominantly absent thereby increase the understanding for its reduction in (Figure 2b). The localization examined on a tissue bladder cancer. microarray containing core biopsies from 182 Ta, 101
miR-145 Stage Bladder tumor type Ta Papillary, superficial CIS Carcinoma in situ T1 Lamina propria invasive T2-T4 Muscle invasive
Bladder 5.00 N Ta T1 T2-T4 cell lines 4.00 3.00 2.00 1.00 0.00 1 5 9 13 17 21 25 29 33 37 41 45 49 53 57 61 65 69 73 77 81 85 89 93 97
(log2 scale) -1.00 101 105 109 113 -2.00
miR-145 expression, array -3.00 -4.00 Figure 1 miR-145 expression in clinical samples of normal bladder biopsies, bladder cancer, and in bladder cancer cell lines. (a) Secondary structure of premiR-145, the sequence of the mature miR-145 is shown in lower case, and the 7mer seed sequence is boxed. (b) Different stages of bladder cancer. (c) Expression pattern of miR-145 in 11 normal bladder biopsies (N), 27 superficial Ta tumors (Ta), 40 T1 tumors (T1), and 27 invasive T2–T4 tumors (T2–T4), and bladder cell lines: non-malignant epithelial cell lines HU609 and HCV29, transitional cell carcinoma cell lines T24, SW780, HT1376, J82, and transitional cell papilloma cell line RT4. Samples were analyzed by LNA-based oligonucleotide microarray (y axis, log2 scale).
Oncogene Functional role of miR-145 in bladder cancer MS Ostenfeld et al 1075 Normal bladder biopsy Urothelium Endothelial cells Muscle HE Umbr Stroma
Uro Endo M Stroma
miR145mm
miR145 Umbr Uro
Endo
CIS lesion Invasive tumor (T2)
HE M CIS M miR-145 ISH (T1 high grade) 1.00 Carc 0.75 Carc strong Stroma 0.50 miR145 0.25 weak/ none CIS p=0.057 Proportion progression-free 0.00 0 50 100 150 200 * * months post-resection *
Figure 2 miR-145 localization in clinical samples by ISH. (a) A representative normal bladder biopsy, (scalebar-100 mm). Upper panel: HE staining, middle panel: negative control ISH using a mismatch LNA-probe (miR-145 mm), no staining observed, bottom panel: ISH using a perfect match LNA-probe (miR-145). (b) A representative CIS lesion and T2 tumor (scale bar, 200 mm). (Arrow, area absent of signal; asterisks, small ‘islets’ of carcinoma cells of intense signal). (Uro, urothelium; Umbr, umbrella cells; Endo, endothelial cells; M, muscle tissue; Carc, carcinoma cells). (c) Kaplan–Meier plot of the probability of progression-free survival among 94 patients with T1 high-grade tumors based on the miR-145 ISH signal in carcinoma cells in core biopsies of tumors on a tissue microarray.
T1, and 34 T2–T4 tumors gave similar results. Here, HU609 is a non-malignant urothelial cell line (Litynska reduced expression of miR-145 in T1 high-grade tumors et al., 2000) that does not induce tumors in mice (data correlated with disease progression with borderline not shown). Efficient transfection was confirmed significance (P ¼ 0.057, Figure 2c). (Supplementary Figure S1) and exogenous mature miR-145 was detected already at 12 h post-transfection (Figure 3a). Exogenous expression of miR-145 has been Time- and dose-dependent cell death in bladder cancer cell shown to reduce the growth of HeLa cells by 30% and lines on exogenous miR-145 expression colon cancer cells 4 days post-transfection (Shi et al., To analyze the possible tumor suppressor function of 2007; Wang et al., 2008). In T24 and SW780, transfection miR-145, we transfected miR-145 or scrambled (scr) of 10 or 50 nM pre-miR-145 exerted an antiproliferative precursor molecules into the urothelial carcinoma cell effect that was time dependent with onset already at 24 h lines T24 and SW780, and as a control into HU609 cells. post-transfection, whereas immortalized HU609 cells
Oncogene Functional role of miR-145 in bladder cancer MS Ostenfeld et al 1076 70 12h 60 24h 48h 50
40
30
20 miR-145/RNU6B (RT-qPCR) 10
0 - Scr 145 - Scr 145 - Scr 145
HU609 T24 SW780
Scr premiR (50 nM) PremiR-145 (10 nM) HU609 120 T24 120 SW780 PremiR-145 (50 nM) 120 100 100
100 80 80 80 60 60 60 40 40 40 20 20 20
% Viability (MTT reduction) 0 0 0 04872960 24487296 0 24487296
80 120 HU609 T24 70 100 SW780 60
80 50
60 40 30 40 20
20 % LDH release (of total) 10 % Viability (MTT reduction) 0 0 lipo 50 0.01 0.1 1 10 50 nM pre-miR lipo 50 0.01 0.1 1 10 50 nM pre-miR
Scr miR-145 Scr miR-145 Figure 3 The effect of exogenous miR-145 introduction on cell viability and cell death. (a) HU609, T24, and SW780 cells were transfected with 10 nM scr pre-miRNA or pre-miR-145. The level of mature miR-145 was examined 12, 24, and 48 h by RT–qPCR (note: excessive cell death was, however, observed at 48 h in SW780 cells). (b) HU609, T24, and SW780 cells were transfected with the indicated pre-miRNA and the time-dependent viability was determined by the MTT reduction assay and expressed as the viability compared with untransfected cells. (c) Dose-dependent viability 96 h post-transfection was examined using the indicated concentrations of pre-miRNAs. (d) Dose-dependent cell death was determined by the LDH release assay, and expressed as percentage of released LDH out of total cellular LDH. Columns (a), averages of a triplicate experiment, points (b) and columns (c, d), averages of triplicate experiments; bars, s.d. (a–d). Data are representative of a minimum of three triplicate experiments.
were only slightly growth inhibited after 72 h (Figure 3b). increase in the number of cells positively stained with the Lower amounts of miR-145 (0.01–0.1 nM) did not cell-non-permeable dye SYTOX-Green (Supplementary significantly affect cell viability, whereas 1 nM moderately Figure S1c). reduced it (Figure 3c). To test whether miR-145-induced reduction in cell density was associated with cell death, we analyzed whether miR-145 expression resulted in Involvement of caspases during miR-145-induced cell plasma membrane permeabilization. A dose-dependent death and the effect of exogenous miR-145 knockdown release of the cytoplasmic enzyme, LDH, into the media Different programed cell death modes can be defined on was observed for the carcinoma cell lines using 10–50 nM the basis of cellular morphology (Kroemer et al., 2008). pre-miR-145, but not for HU609 cells (Figure 3d). The Necrosis-like programed cell death is characterized by cell death observed in T24 cells was confirmed by an swelling of the cell, early disruption of the plasma
Oncogene Functional role of miR-145 in bladder cancer MS Ostenfeld et al 1077 T24 SW780
scr-miR 50 nM
T24 14 24h 12 48h miR-145 10 nM 10 72h 8 6 ** - 4 miR-145 2 50 nM casp3/7 act. ((RFU/min)/ LDH) casp3/7 act. - Scr 10 50 - 10 (Eto) miR-145 (nM) - - - - 50 50 LNA (nM)
miR-145 10 nM + LNA
200 T24 T24 SW780 SW780 160 120 100 120 80 80 60 40 40 20
qPCR (miR-145/RNU6B) 0 0 % Viability (MTT reduction) Scr 10 50 - 10 miR-145 (nM) Scr + - + miR-145 (50 nM) - - - 50 50 LNA - + + LNA (50 nM) Figure 4 Cell morphology and caspase activation upon miR-145 expression. (a, c, d) T24 and SW780 cell lines were transfected with pre-miR-145 at the indicated concentration ±50 nM LNA antagonist, or treated with 50 mM etoposide (Eto) when indicated. (a) Cell morphology was examined by phase contrast microscopy 48 h post-transfection, (scale bar, 100 mm). (b) The effector caspase activity (DEVDase) in T24 cell lysates 24, 48, and 72 h post-transfection was examined by fluorometric kinetic analysis and normalized toward total cellular LDH. (c) The level of miR-145 was examined 48 h post-transfection by RT–qPCR. (d) Viability was examined in T24 and SW780 cells 48 h post-transfection. Columns (b–d), average of triplicate experiments; bars, s.d. Data are representative for a minimum of three triplicate experiments. **P-value o0.01, -P-value >0.05. membrane, and lack of chromatin condensation, We next performed a loss-of-function experiment by whereas hallmarks of apoptosis and apoptosis-like transfecting an LNA knockdown molecule against miR- programed cell death are shrinkage of the cell, blebbing 145. This reduced the level of exogenous mature miR-145 of the plasma membrane, and compact or loose (Figure 4c), restored cell morphology (Figure 4a), chromatin condensation before the rupture of the inhibited caspase activation (Figure 4b), and recovered plasma membrane, respectively. Autophagic cell death cell viability (Figure 4d). These results strongly indicate is characterized by massive accumulation of autophago- that effector caspases participate in the execution of cell somes (Levine and Yuan, 2005). T24 and SW780 cells death induced by miR-145, and, furthermore, indicate transfected with pre-miR-145 displayed cell rounding, activation of a classical apoptotic death mode. shrinkage, plasma membrane blebbing, and subsequent detachment of the cells (Figure 4). The kinetics of the death process was cell type dependent; SW780 cells Activation of an alternative cell death pathway being in late stages of cell death by 48 h, whereas T24 upon blockage of the caspases cells displayed a flattened/senescent morphology Rather surprisingly, we found that miR-145-induced cell (Figure 4a and data not shown). No phenotype change death proceeded when SW780 cells were incubated with was observed for HU609 cells (data not shown). The the broad caspase inhibitor zVAD-fmk, as determined morphological features of an apoptotic cell death were by the morphological changes observed (Figure 5a, preceded by activation of effector caspases 3 and 7 as rounding up and loss of membrane integrity, asterisks) measured by kinetic cleavage of the substrate DEVD- and the reduced viability 48 h post-transfection AFC (Figure 4b, similar results were observed for (Figure 5b). This indicates that caspase activation SW780 cells), indicating that miR-145 induces cell death is not essential for miR-145-induced cell death in through caspase activation. SW780 cells. Next, DNA staining with cell-permeable
Oncogene Functional role of miR-145 in bladder cancer MS Ostenfeld et al 1078 SW780 SW780 - + zVAD-fmk 120 Control 12 zVAD-fmk 100 10 48h 8 72h 80 Scr 6 60 4 40 2 0 20 casp 3/7 act (RFU/min/LDH) - Scr + - + miR-145 % Viability (MTT reduction) 0 + + zVAD-fmk - 10 50 Scr miR-145 (nM) * miR-145 * * *
Untreated miR-145 miR-145 80 70 60 50 40 30 Scr miR145 + zVAD-fmk miR-145 + zVAD-fmk 20 10 (of Hoechst condensed nuclei)
% SYTOX-Green positive nuclei 0 + + miR-145 (50 nM) - + zVAD-fmk (50 µM)
cl2 4 4-B EP EP pC pC kDa 120 pCEP4 pCEP4-Bcl2 100 50 - Beta-actin 80 37 - 60
25 - Bcl-2 40 20 - 20
% Viability (MTT reduction) 0 Scr miR-145 - Eto Vin Transfection Drugs
Figure 5 The function of caspase activation and Bcl-2 in miR-145 cell death signaling. SW780 cells were transfected with 50 nM scr pre-miRNA or 50 nM (a), 10 nM (b, left), or 10/50 nM pre-miR-145 (b, right), and, when indicated, subsequently treated with 50 mM zVAD-fmk (broad caspase inhibitor). (a) Morphology was examined by phase contrast microscopy 48 h post-transfection, (scale bar, 100 mm). (Asterisks, cells with lost membrane integrity). (b) Effector caspase activity in SW780 cell lysates at 48 and 72 h post- transfection and viability 48 h post-transfection. (c) Nuclear morphology 48 h post-transfection (50 nM). DNA was stained using cell- permeable Hoechst-33342 and non-permeable SYTOX-Green. Arrows, cells with condensed nuclei and intact plasma membrane (scale bar, 200 mm). High-resolution pictures of nuclei (scale bar, 20 mm). The percentage of SYTOX-Green positive condensed nuclei±zVAD-fmk is depicted in the graph. (d) T24 cells transfected with empty vector (pCEP4) or Bcl-2 (pCEP4-Bcl-2) were analyzed for expression of Bcl-2 by western blotting and the sensitivity was examined after transfection of 10 nM miR-145 (72 h post- transfection) or 10 mM etoposide (Eto) and 10 nM vincristine (Vin) (48 h) by MTT assay. Columns (b–d), averages of triplicate experiments; bars, s.d. Data are representative of three experiments (b, d) or average of three experiments (c).
Hoechst-33342 and non-permeable SYTOX-Green that without fragmentation (Figure 5c), and a higher fraction enables detection of nuclear changes and loss of plasma of these cells also displayed lost plasma membrane membrane integrity, respectively, was performed. The integrity (Figure 5c, graph) suggesting a shift from the presence of compact condensed and fragmented classical apoptosis mode toward an alternative death Hoechst-stained nuclei that were SYTOX-Green nega- pathway. Similar results were obtained for T24 cells tive indicated classical apoptotic nuclear changes (data not shown). occurring before plasma membrane disruption During classical apoptosis, pro-apoptotic proteins (Figure 5c, arrows and close up). In the presence of such as cytochrome c are released from the mitochon- zVAD-fmk, loose nuclear condensation was observed dria; a process that triggers downstream caspase
Oncogene Functional role of miR-145 in bladder cancer MS Ostenfeld et al 1079 activation. This translocation is effectively inhibited by (PPP3CA) was also observed by RT–qPCR anti-apoptotic proteins of the Bcl-2 family (Ow et al., (Figure 6d). Furthermore, reduced expression of a 2008). Stable expression of exogenous Bcl-2 in T24 cells luciferase reporter was detected in cells co-transfected was insufficient, however, to block the miR-145-induced with pre-miR-145 when the luciferase construct carried cytotoxicity, whereas it conferred significant protection 400–800 bp of the 30UTR of CLINT1, PPP3CA, and against etoposide and vincristine, two commonly CBFB containing the target site (Figure 6e). This effect used chemotherapeutics (Figure 5d). This indicates was not observed using an scr pre-miR or on mutation that miR-145-induced death signaling is independent of the target site. Finally, a 22-gene signature of miR- of the Bcl-2 status and of signaling through the 145 targets was generated, when loosening the selection mitochondrial pathway. criteria described above to contain mRNAs down- regulated >twofold in at least one sample (Figure 6c, all 22 genes listed). Downregulation of mRNAs with 7mer target site(s) before the onset of miR-145-induced cell death Investigation of the expression of miR-145-regulated To identify putative targets for miR-145, we transfected mRNAs in Ta tumors T24 cells with 10 nM scr or miR-145 precursor and We next speculated, if the 22-target gene signature analyzed mRNA levels 46 h post-transfection using gene identified in our cell culture model was also present in expression microarrays. The majority of mRNAs (85%) clinical bladder cancer samples. We, therefore, validated and miRNAs other than miR-145 (>95%) remained the expression of the 22-gene signature in 55 papillary unchanged (Figure 6a and data not shown). The Ta tumors (18 grade I, 12 grade II, 25 grade III) and reported miR-145 targets, insulin receptor substrate-1, compared it with nine normal bladder biopsies by gene and MYC that have been speculated to influence the expression microarray analysis (Figure 6c). CBFB, growth inhibitory effect of miR-145 (Shi et al., 2007; PPP3CA, and 11 additional mRNAs of the signature Sachdeva et al., 2009) were not expressed or in fact were all significantly upregulated consistent with the low induced rather than repressed, respectively, and, there- fore, unlikely to account for the phenotype observed in expression of miR-145 in these tumors (Figure 1). Using a cutoff of P 0.01 and fold change >2 for individual our model system. As individual miRNAs are estimated o mRNAs, the likelihood of extracting this expression to target hundreds of mRNAs, we hypothesized that the P phenotypic effects of miR-145 may be a consequence of pattern by chance is extremely low ( o0.00003, binomial statistical analysis). A direct negative correla- the combined alteration of numerous targets instead of a tion between the expression of miR-145 and the three- single target gene and that it may result from both target genes CBFB, PPP3CA, and CLINT1 was primary, secondary, and subsequent regulatory effects. observed in eight clinical samples (Supplementary Hence, we used a bioinformatic approach for our Figure S4). These data suggests that experimentally further analysis. identified targets for miR-145 are also upregulated in Ta mRNAs that were either unaffected or upregulated on tumors consistent with a low miR-145 expression. miR-145 expression contained a 7mer target site at a frequency of 25–30% (Figure 6a), in agreement with the background frequency reported by others (Selbach et al., 2008). In contrast, a three- to fourfold enrichment Discussion of the 7mer was found among downregulated mRNAs as almost all of these harbored a 7mer site (Po1E-06, In this study, we examined the function of miR-145, the Figures 6a and b) and, interestingly, was not exclusively most significantly downregulated miRNA in bladder found in the 30UTR, but also in protein coding regions cancer evident even in low stage disease. We showed (data not shown). We next asked if the 188 down- that reduced miR-145 expression approached signifi- regulated mRNAs (Supplementary Figure S2) in parti- cance as a predictor of disease progression supporting cular represented known biological pathways. Ingenuity the function as a tumor suppressor. In addition, we Pathway analysis software designated significant enrich- showed that miR-145 strongly induces cell death in two ment for mRNAs involved in gene networks annotated malignant urothelial cell lines, using more than one cell with ‘cancer’, ‘cell cycle’, and ‘cell death’. death pathway, but not in an immortalized non- Predicted miR-145 targets (according to TargetScan tumorigenic cell line. Furthermore, we identified a set and PicTar databases) and mRNAs harboring a 7mer of target genes harboring the 7-mer target site and site had a significantly higher propensity of being documented that this subset of transcripts is upregulated downregulated (Figure 6b). Bioinformatic analysis in clinical specimens with downregulated miR-145 hence identified nine mRNAs that were (1) expressed above establishing a correlation between the expression levels a background level in untreated cells, (2) downregulated of miR-145 and its targets in a cell line model and at 46 h, (3) containing a 7mer target site, and (4) human malignant urothelium. predicted targets (TargetScan/PicTar) (Figure 6c, gray The downregulation of miR-145 in bladder cancer shadow and S3). Consistent with the microarray data, biopsies led us to speculate, if this was caused by a mere the depletion of three of these, Clathrin Interactor 1 variation in cellular composition. However, ISH analy- (CLINT1), core-binding factor b subunit (CBFB), and sis showed staining of miR-145 in the normal urothe- protein phosphatase 3 catalytic subunit a isoform lium, and weak or heterogeneous expression in tumor
Oncogene Functional role of miR-145 in bladder cancer MS Ostenfeld et al 1080 Regulated mRNAs (array analysis): All expressed genes Exp 1 (6249 genes) Down (-) no change (=) Up (+) Exp 2 0.8 Down (-) 188 (0.93) 339 (1.06) 0 (-) Pictar targets 0.4 TargetScan targets 7mer
no change (=) 214 (0.59) 6156 (0.33) 4 (0.25) fraction Cumulative No 7mer 0.0
-1.0 -0.5 0.0 0.5 1.0 Up (+) 0 (-) 308 (0.23) 58 (0.31) mRNA fold change (log2)
Expression (log2)
miR-145 transfection, Clinical samples, scr miR, 46h post-transfection Gene # 7mer exon array U133A array 1.4 miR-145, 46h post-transfection Exp1 Exp2 Exp p-value 1.2 FBXO28 1 -1.2 -1.2 1.9 0.0018 1 IVNS1ABP 2 -0.9 -1.1 1.9 0.00000105 0.8 ACBD3 2 -1.1 -1.1 2.5 0.0000155 ACTR3 1 -0.6 -1.2 1.2 0.000135 0.6 SACM1L 2 -1.2 -0.8 1.2 0.0166 0.4 NAT13 1 -0.8 -1.2 1.1 0.0000118 0.2 USP46 1 -1.1 -1.3 0.4 0.12 0 UBE1L2 3 -1.2 -0.4 1.3 0.011 qPCR (normalized towards GAPDH) CLINT1 CBFB PPP3CA PPP3CA 1 -2.2 -1.6 1 0.007 PAPD4 1 -1.1 -0.5 absent RASA1 1 -1.7 -1.3 1.1 0.00032 miR-145 Scr miR CLINT1 1 -1.1 -1.3 0.4 0.96 1.2 SEMA3A 2 -1.05 -0.95 -0.2 0.0001 1
CDK6 2 -1.2 -0.2 -0.1 0.054 0.8 CCDC25 1 -1 -1.7 -0.1 0.41 0.6 RAB14 2 -0.6 -1.1 1.1 0.0004 0.4 C11orf58 2 -1.2 -1.4 1.5 0.007 0.2 CBFB 2 -1.2 -1.7 1.2 0.000017
NUFIP2 1 -1.1 -0.7 absent expression luciferase Relative 0 APPBP2 2 -0.8 -1.2 -0.9 0.0014 UTR UTR UTR Δ Δ CBFB Δ CBFB
YES1 1 -1.05 -0.6 1 0.0078 CLINT1 CLINT1 UTRmut UTRmut UTRmut PPP3CA PPP3CA ACSL4 1 -1.2 -0.4 -0.3 0.617 Δ Δ Δ
Figure 6 Gene expression changes induced by miR-145 and target gene identification. (a) RNA from scr- or pre-miR-145 transfected T24 cells was harvested at 46 h and subjected to exon array analysis. The table depicts the number of mRNAs either downregulated (‘À’), unchanged (‘ ¼ ’), or upregulated (‘ þ ’) in two independent samples (experiment 1 and 2) upon miR-145 transfection, as compared with the scr control. The average number of 7mer target sites (AACUGGA) for miR-145 in the mRNAs within each group is denoted in parenthesis. (Note the higher level of target sites in the downregulated genes, boxed). (b) Expression fold change of predicted miR-145 targets (TargetScan or PicTar), and of mRNAs±at least one 7mer site. (Note the higher level of downregulation among the predicted target genes). (c) Gene list of downregulated mRNAs identified on miR-145 overexpression and their expression in Ta bladder tumors compared with normal urothelium. The criteria for the identification of the 22-target gene signature: (1) only mRNA transcripts expressed above background level (above average signal intensity on the array) in untransfected cells were considered (10 786/22 433 entries). (2) Only genes present in the databases of the prediction algorithms Targetscan 4.2 and PicTar were considered (6249/10 786 entries). (3) Transcripts were classified as upregulated, non-differentially regulated or downregulated (up: >twofold and down : otwofold). Transcripts that were downregulated in at least one sample based on this criteria were selected (624/6249 entries). (4) The categories of mRNA transcripts were compared with the lists of predicted targets by Targetscan and PicTar. The categorized downregulated transcripts that were also predicted targets were identified (22/624 entries). The presence of 7mer target sites and the fold change in expression for the two experiments are listed. The right columns show the expression of these mRNAs, examined by U133A microarray analysis, in 55 Ta tumors (grade 1–3) compared with nine normal bladder biopsies (P-value, t-test, and fold change in expression) (note that as expected, there is an overall inverse relation between alterations in vitro and in vivo). (d) RT–qPCR validation of miR-145 predicted targets CLINT1, PPP3CA, and CBFB in T24 cells using GAPDH for normalization. Columns, averages of duplicate samples analyzed in triplicates; bars, s.d. (e) Luciferase-based target validation of CLINT1, PPP3CA, and CBFB. Luciferase constructs were fused to 400–800 bp of the 30UTR containing the 7mer target site of CLINT1, PPP3CA, or CBFB. In parallel, constructs with a mutated target site were analyzed. Columns, average of triplicate experiments; bars, s.d.
samples, suggesting actual differences in miR-145 compared with normal bladder biopsies (data not expression between normal and transformed urothelial shown). The mechanism of miR-145 downregulation in cells. Consistent with this, a >100-fold decrease in miR- cancer is unknown, although defective processing 145 expression was detected by RT–qPCR in Ta tumors of miR-145 has been suggested, as equal levels of the
Oncogene Functional role of miR-145 in bladder cancer MS Ostenfeld et al 1081 hairpin precursor, but not mature miR-145, has been associated with ‘cell cycle’, ‘cell death’, and ‘cancer’ observed in colon cancer (Michael et al., 2003). p53 signaling, for example CBFB, PPP3CA, Ras p21 protein response elements identified in the putative promoter activator 1 (RASA1), homeodomain-interacting protein region of mir145 suggest that upon p53 inactivation, the kinase 2 (HIPK2), X-linked Inhibitor of Apoptosis transcription of miR-145 may be reduced (Sachdeva (XIAP/BIRC4), and the Proliferation-related Ki67-anti- et al., 2009). However, p53 is seldomly inactivated in Ta gen (MKI67). Among these, CBFB is a subunit of the tumors (Mitra et al., 2007) and thus cannot account for heterodimeric transcription factor CBF. A chromosomal the early loss of miR-145. We instead investigated if abnormality, inv(16)(p13q22), found in 10% of acute DNA hypermethylation could have a function in the myeloid leukemia cases results in the fusion of CBFB reduction of miR-145 in Ta tumors. A significant overall with MYH11, which generates the fusion oncoprotein increase in DNA methylation in a CpG-rich region CBFB-MYH11 (reviewed in Hart and Foroni, 2002). In 250 bp upstream of MIR145 in five Ta tumors (grade 1 Caenorhabditis elegans, overexpression of the CBFB and 2) compared with four normal bladder biopsies homolog BRO-1 leads to massive hyperplasia (Kagoshi- (Po0.0005, w2-test, data not shown). Although few ma et al., 2007). These findings show that CBFB has a samples were analyzed, this suggests that DNA hyper- significant function in oncogenesis. We are currently methylation could contribute to the reduced expression, investigating if the depletion of this and other targets although other regulatory mechanisms are most likely may mimic the phenotype of miR-145 expression. also involved. Notably, we examined how these mRNAs were regulated Earlier studies have shown that miR-145 reduces the in Ta papillary tumors. Consistent with our functional viability of colon and cervical cancer cells 96 h post- analysis, reduced miR-145 expression in Ta tumors transfection (Shi et al., 2007; Schepeler et al., 2008; correlated with a highly significant upregulation of the Wang et al., 2008) and regulate a quiescent versus 22-target gene signature. proliferative state of smooth muscle cells (Cordes et al., The miRNA array profiling and ISH analysis showed 2009). In this study, we identified miR-145 as an inducer that miR-145 expression was decreased in low stage of time- and dose-dependent massive cell death with tumors and CIS lesions, whereas more heterogeneously classical apoptotic features, such as caspase activation, expressed in T1 and T2–T4 tumors. An explanation for fragmentation and compact condensation of the chro- this shift could be that reduction of miR-145 is necessary matin, and plasma membrane blebbing. However, cell to achieve a survival advantage during early oncogen- death was not inhibited by Bcl-2 or zVAD-fmk, esis, but not for later steps of carcinogenesis. miR-145 indicating that an alternative cell death independent of seems to be a tumor suppressor based on the induction the mitochondrial apoptosis pathway, and of the of cell death and reduced expression on disease caspases, was also activated. Whether these pathways progression; therefore, inactivation of this tumor are activated in parallel or function in redundancy is suppressor may be crucial for the initial triggering of unknown. The existence of an interplay between an oncogenic pathway. For late tumor stages (T2–T4), apoptotic and non-apoptotic cell death in cancer cells additional mutations are acquired that affect the cellular is well known (Kim et al., 2006). For example, TRAIL homeostasis, which could explain why the loss of induces apoptosis in lung carcinoma A549 cells at miR-145 not serves a selective advantage for tumor normoxic levels and non-apoptotic death at hypoxia at growth in these tumors. For example downstream which Bcl-2, Bcl-XL, and Inhibitor of apoptosis proteins effector molecules in miR-145-regulated pathways could are upregulated (Kim et al., 2004). In addition, cells are be affected in these tumors relieving the pressure for a sensitized to TNF-a-induced cell death in the presence miR-145 loss. of zVAD-fmk that arrest apoptosis and promote other One of the major challenges in the current treatment forms of cell death, such as autophagic cell death (Yu of bladder cancer is to identify and prevent recurrence et al., 2004). As genetic alterations in cell death and disease progression of patients with Ta tumors. Our pathways enable cancer cells to evade cell death data indicate that miR-145 is a potential candidate for eventually leading to tumor progression (Hanahan and future non-coding RNA medicine against this stage of Weinberg, 2000; Kim et al., 2006), effective induction of bladder cancer with loss of miR-145, for example as a multiple types of cell death may increase the therapeutic neoadjuvant therapy in combination with transurethral efficacy of anticancer agents. Thus, from a clinical resection using intravesical installation for the aim of therapeutic perspective, it is interesting that miR-145 eliminating any remaining tumor cells or foci of CIS. induces multiple death pathways. Although miRNAs target hundreds of transcripts, potentially leading to a cascade of secondary expression changes, our bioinformatic analysis identified the majority of mRNAs (85%) and other miRNAs (95%) Materials and methods as unchanged 46 h post-transfection. Our analysis also Patient material identified miR-145 as a predominantly negative regu- Biological material from bladder tumors was obtained directly lator of gene expression rather than an inducer, as was from surgery and processed as described earlier (Dyrskjot unexpectedly reported for miR-10a (Orom et al., 2008). et al., 2005). Informed written consent was obtained from all Among the downregulated mRNAs, Ingenuity Pathway patients, and research protocols were approved by the Analysis identified significant enrichment of genes scientific ethical committee of Aarhus County.
Oncogene Functional role of miR-145 in bladder cancer MS Ostenfeld et al 1082 ISH detection of miR-145 Real-time RT–qPCR miRNA and mRNA expression analysis Five mm sections FFPE-serial tissue sections were processed TaqMan miRNA assays (Applied Biosystems, Foster City, for ISH analysis essentially as described (Nuovo, 2008; CA, USA) were used for quantification of miRNA expression Schepeler et al., 2008). An LNA-modified probe (Exiqon, using ribosomal RNA RNU6B and RNU43 for normal- Vedbaek, Denmark) complementary to miR-145 (probe: ization. For validation of target gene expression, TaqMan agggattcctgggaaaactggac, ‘miR-145’) or with two mismatches Gene expression assays (Applied Biosystems) were used for to the seed sequence (probe: agggattcctgggaaaaGtCgac, ‘miR- CLINT1, PPP3CA, and CBFB using GAPDH for normal- 145 mm’) was used (For details see Supplementary informa- ization. miRNA and mRNA RT–qPCR was performed in tion). In total, four normal biopsies, four Ta grade 1, À2, and triplicates and as described by the manufacturer using an 3, respectively, four T2–T4, and three CIS lesions as well as a ABI7500 PCR system (Applied Biosystems) and 7500 Fast tissue microarray containing 0.6 mm core biopsies from 189 system software for data analysis. Ta, 101 T1, and 34 T2–T4 tumors were analyzed by ISH. The signal intensity on the tissue microarray was scored blinded to clinical outcome by two independent observers Detection of cell viability and death (a statistics ¼ 0.71). Viability and death of the cells were analyzed by MTT (Sigma- Aldrich, St Louis, MO, USA) reduction and lactate dehy- drogenase (LDH; cytotoxicity detection kit, Roche, Basel, Cell culture and transfections Switzerland) assays essentially as described (Ostenfeld et al., Human urinary bladder transitional cell carcinoma (T24, 2005). The cell death mode was assessed by the morphology, SW780, HT1376, J82, RT4) and immortalized human bladder nuclear condensation, and plasma membrane integrity of epithelium (HU609, HCV29) cells were propagated in DMEM dying cells by phase contrast microscopy, and by staining the (Invitrogen, Carlsbad, CA, USA) supplemented with 10% cells with 2.5 mg/ml Hoechst-33342 and 0.5 mmol/l SYTOX- heat-inactivated fetal calf serum and antibiotics at 37 1Cina Green (Molecular Probes, Eugene, OR, USA) using Zeiss humidified air atmosphere at 5% CO2. T24 pCEP4 and Axiovert 40 CFL and Zeiss Axiovert 200M fluorescence –pCEP4-Bcl-2 are stable cell lines transfected with an microscopes. SYTOX-Green positivity was also examined on empty pCEP4-hygro vector (Invitrogen) or pCEP4-hygro a FACSCalibur flow cytometer (Becton Dickinson, Heidel- encoding human Bcl-2 and propagated under selection berg, Germany) measuring the mean fluorescence intensity in (200 mg/ml hygromycin). HEK293 cells were propagated in the FL1-H channel of 10 000 cells/sample and using CellQuest- RPMI-1640 containing 10% fetal calf serum and antibiotics. Pro software. miRNAs (Ambion, Austin, TX, USA) and LNA knockdown molecules (Exiqon) were reverse transfected using Lipofecta- mine 2000 (Invitrogen) according to manufacturer’s guidelines. Caspase activity measurement The broad caspase inhibitor zVAD-fmk (Bachem, Bubendorf, B The analysis of caspase 3/7 activity (DEVDase activity) was Switzerland) was added 8 h after transfection. Transfection performed essentially as described (Ostenfeld et al., 2005). The efficiency was examined on transfection of a Cy3-conjugated kinetic cleavage of the substrate Ac-DEVD-AFC (Biomol, scr miR (Ambion) by fluorescence microscopy and flow Plymouth Meeting, PA, USA) as measured by the liberation of cytometry. AFC (excitation, 400 nm; emission, 489 nm) was measured in cell lysates using a Synergy HT multi-mode micro plate reader, miRNA target validation (Biotek Industries Inc., Winooski, VT, USA). A partial 30UTR (dUTR) sequence of 400–800 bp from PPP3CA, CLINT1, and CBFB containing the potential miR- 145 target was inserted to the XhoI/NotI site of the Immunodetection of proteins psiCHECK2 vector (Promega, Madison, WI, USA). In Immunodetection of proteins separated by SDS–PAGE and addition, two, one, and one putative, target sites were mutated transferred to nitrocellulose membranes was performed for PPP3CA, CLINT1, and CBFB, respectively (see Supple- with enhanced chemiluminescence western blotting agents mental information for primer sequences). HEK293 cells were (Amersham Biosciences, Fairfield, CT, USA). Primary anti- co-transfected with 0.08 mg psiCHECK-UTR DNA and 50 nM bodies against Bcl-2 (1:1000, clone 124, Dako, Glostrup, pre-miRNA using Lipofectamine 2000. The luciferase activity Denmark) and b-actin (1:10 000, Sigma-Aldrich) followed by was measured on a FLUOstar luminometer (BMG labtech, appropriate peroxidase-conjugated secondary antibodies from Offenburg, Germany) and normalized to the relative rluc/ Dako A/S. fluc value of the corresponding mutated UTR using Dual- luciferase reporter assay system (Promega). Bioinformatic and statistical analysis miR-145-regulated mRNAs were identified using scr-miR RNA extraction and microarray analysis transfection as reference. The 22-target gene signature was RNA was extracted using a standard Trizol RNA extraction deduced from the cell culture model in which miR-145 was method (Invitrogen) and quality controlled using 2100 overexpressed based on criteria listed in the Supplementary Bioanalyzer (Agilent Technologies, Santa Clara, CA, USA). information. Presence of the 7mer AACUGGA miR-145 Microarrays for miRNA expression analysis were produced target site was examined in all mRNAs and analysis of target using an LNA-based oligonucleotide probe library (mercury site enrichment was performed by both a binomial test using LNA array ready to spot v.7.1, Exiqon), processed, and R (http://www.cran.r-project.org) and by performing 107 analyzed as described earlier (Schepeler et al., 2008) using permutations of the data to estimate the false discovery rate. TIGR spotfinder 2.23, TIGR MIDAS 2.19, and TIGR MEV For analysis of gene networks affected by miR-145, Ingenuity 3.1 software. For gene expression microarray analysis, the Pathways analysis (IPA) was used (http://www.ingenuity. RNA was labeled, hybridized to Human Exon 1.0 ST Arrays com). The ‘Global Functional Analysis’ identified the (Affymetrix, Santa Clara, CA, USA), and analyzed as biological function significantly associated with the express- described earlier (Thorsen et al., 2008). ion pattern.
Oncogene Functional role of miR-145 in bladder cancer MS Ostenfeld et al 1083 Conflict of interest assistance. We are grateful to M Ja¨ a¨ ttela¨ for providing the pCEP4 Bcl-2 vector construct and to Thomas B Hansen for The authors declare no conflict of interest. methylation analysis software. We thank the staff at the Departments of Urology, Clinical Biochemistry, and Pathol- ogy at Aarhus University Hospital. This work was supported by the Ministry of Technology and Science, The John and Acknowledgements Birthe Meyer Foundation, the Lundbeck Foundation, and the Danish Cancer Society, and the European Community’s We thank Gitte H j, Pamela Celis, Hanne Steen, Inge-Lis Seventh framework program (FP7/2007–2013) under grant Thorsen, Gitte Stouga˚rd, and Conni S rensen for technical agreement no 201663.
References
Baek D, Villen J, Shin C, Camargo FD, Gygi SP, Bartel DP. (2008). Litynska A, Przybylo M, Ksiazek D, Laidler P. (2000). Differences of The impact of microRNAs on protein output. Nature 455: 64–71. alpha3beta1 integrin glycans from different human bladder cell Calin GA, Croce CM. (2006). MicroRNA signatures in human lines. Acta Biochim Pol 47: 427–434. cancers. Nat Rev Cancer 6: 857–866. Michael MZ, SM OC, van Holst Pellekaan NG, Young GP, James RJ. Calin GA, Sevignani C, Dumitru CD, Hyslop T, Noch E, Yendamuri (2003). Reduced accumulation of specific microRNAs in colorectal S et al. (2004). Human microRNA genes are frequently located at neoplasia. Mol Cancer Res 1: 882–891. fragile sites and genomic regions involved in cancers. Proc Natl Mitra AP, Birkhahn M, Cote RJ. (2007). p53 and retinoblastoma Acad Sci USA 101: 2999–3004. pathways in bladder cancer. World J Urol 25: 563–571. Cordes KR, Sheehy NT, White MP, Berry EC, Morton SU, Muth AN Nakajima G, Hayashi K, Xi Y, Kudo K, Uchida K, Takasaki K et al. et al. (2009). miR-145 and miR-143 regulate smooth muscle cell fate (2006). Non-coding MicroRNAs hsa-let-7g and hsa-miR-181b are and plasticity. Nature 460: 705–710. associated with chemoresponse to S-1 in colon cancer. Cancer Dyrskjot L, Ostenfeld MS, Bramsen JB, Silahtaroglu AN, Lamy P, Genomics Proteomics 3: 317–324. Ramanathan R et al. (2009). Genomic profiling of microRNAs in Nuovo GJ. (2008). In situ detection of precursor and mature bladder cancer: miR-129 is associated with poor outcome and microRNAs in paraffin embedded, formalin fixed tissues and cell promotes cell death in vitro. Cancer Res 69: 4851–4860. preparations. Methods 44: 39–46. Dyrskjot L, Zieger K, Kruhoffer M, Thykjaer T, Jensen JL, Primdahl H Orom UA, Nielsen FC, Lund AH. (2008). MicroRNA-10a binds the et al. (2005). A molecular signature in superficial bladder carcinoma 5’UTR of ribosomal protein mRNAs and enhances their transla- predicts clinical outcome. Clin Cancer Res 11: 4029–4036. tion. Mol Cell 30: 460–471. Esquela-Kerscher A, Slack FJ. (2006). Oncomirs—microRNAs with a Ostenfeld MS, Fehrenbacher N, Hoyer-Hansen M, Thomsen C, role in cancer. Nat Rev Cancer 6: 259–269. Farkas T, Jaattela M. (2005). Effective tumor cell death by sigma- Hanahan D, Weinberg RA. (2000). The hallmarks of cancer. Cell 100: 2 receptor ligand siramesine involves lysosomal leakage and 57–70. oxidative stress. Cancer Res 65: 8975–8983. Hart SM, Foroni L. (2002). Core binding factor genes and human Ow YL, Green DR, Hao Z, Mak TW. (2008). Cytochrome c: functions leukemia. Haematologica 87: 1307–1323. beyond respiration. Nat Rev Mol Cell Biol 9: 532–542. Horrigan SK, Westbrook CA, Kim AH, Banerjee M, Stock W, Larson Porkka KP, Pfeiffer MJ, Waltering KK, Vessella RL, Tammela TL, RA. (1996). Polymerase chain reaction-based diagnosis of del (5q) in Visakorpi T. (2007). MicroRNA expression profiling in prostate acute myeloid leukemia and myelodysplastic syndrome identifies a cancer. Cancer Res 67: 6130–6135. minimal deletion interval. Blood 88: 2665–2670. Rajewsky N. (2006). microRNA target predictions in animals. Nat Iorio MV, Ferracin M, Liu CG, Veronese A, Spizzo R, Sabbioni S Genet 38(Suppl): S8–S13. et al. (2005). MicroRNA gene expression deregulation in human Sachdeva M, Zhu S, Wu F, Wu H, Walia V, Kumar S et al. (2009). p53 breast cancer. Cancer Res 65: 7065–7070. represses c-Myc through induction of the tumor suppressor miR- Kagoshima H, Nimmo R, Saad N, Tanaka J, Miwa Y, Mitani S et al. 145. Proc Natl Acad Sci USA 106: 3207–3212. (2007). The C. elegans CBFbeta homologue BRO-1 interacts with Schepeler T, Reinert JT, Ostenfeld MS, Christensen LL, the Runx factor, RNT-1, to promote stem cell proliferation and self- Silahtaroglu AN, Dyrskjot L et al. (2008). Diagnostic and renewal. Development 134: 3905–3915. prognostic microRNAs in stage II colon cancer. Cancer Res 68: Kedde M, Strasser MJ, Boldajipour B, Oude Vrielink JA, Slanchev K, 6416–6424. le Sage C et al. (2007). RNA-binding protein Dnd1 inhibits Selbach M, Schwanhausser B, Thierfelder N, Fang Z, Khanin R, microRNA access to target mRNA. Cell 131: 1273–1286. Rajewsky N. (2008). Widespread changes in protein synthesis Kim M, Park SY, Pai HS, Kim TH, Billiar TR, Seol DW. (2004). induced by microRNAs. Nature 455: 58–63. Hypoxia inhibits tumor necrosis factor-related apoptosis-inducing Sempere LF, Christensen M, Silahtaroglu A, Bak M, Heath CV, ligand-induced apoptosis by blocking Bax translocation. Cancer Res Schwartz G et al. (2007). Altered MicroRNA expression confined to 64: 4078–4081. specific epithelial cell subpopulations in breast cancer. Cancer Res Kim R, Emi M, Tanabe K, Murakami S, Uchida Y, Arihiro K. (2006). 67: 11612–11620. Regulation and interplay of apoptotic and non-apoptotic cell death. Shi B, Sepp-Lorenzino L, Prisco M, Linsley P, deAngelis T, Baserga R. J Pathol 208: 319–326. (2007). Micro RNA 145 targets the insulin receptor substrate-1 Kroemer G, Galluzzi L, Vandenabeele P, Abrams J, Alnemri ES, and inhibits the growth of colon cancer cells. J Biol Chem 282: Baehrecke EH et al. (2008). Classification of cell death: recommen- 32582–32590. dations of the Nomenclature Committee on Cell Death 2009. Cell Tavazoie SF, Alarcon C, Oskarsson T, Padua D, Wang Q, Bos PD Death Differ 16: 3–11. et al. (2008). Endogenous human microRNAs that suppress breast Lee Y, Ahn C, Han J, Choi H, Kim J, Yim J et al. (2003). The nuclear cancer metastasis. Nature 451: 147–152. RNase III Drosha initiates microRNA processing. Nature 425: Thorsen K, Sorensen KD, Brems-Eskildsen AS, Modin C, Gaustadnes 415–419. M, Hein AM et al. (2008). Alternative splicing in colon, bladder, Levine B, Yuan J. (2005). Autophagy in cell death: an innocent and prostate cancer identified by exon array analysis. Mol Cell convict? J Clin Invest 115: 2679–2688. Proteomics 7: 1214–1224.
Oncogene Functional role of miR-145 in bladder cancer MS Ostenfeld et al 1084 Vasudevan S, Tong Y, Steitz JA. (2007). Switching from repression to in lung cancer diagnosis and prognosis. Cancer Cell 9: activation: microRNAs can up-regulate translation. Science 318: 189–198. 1931–1934. Yang H, Kong W, He L, Zhao JJ, O’Donnell JD, Wang J et al. (2008). Wang X, Tang S, Le SY, Lu R, Rader JS, Meyers C et al. (2008). MicroRNA expression profiling in human ovarian cancer: miR-214 Aberrant expression of oncogenic and tumor-suppressive micro- induces cell survival and cisplatin resistance by targeting PTEN. RNAs in cervical cancer is required for cancer cell growth. PLoS Cancer Res 68: 425–433. ONE 3: e2557. Yu L, Alva A, Su H, Dutt P, Freundt E, Welsh S et al. (2004). Yanaihara N, Caplen N, Bowman E, Seike M, Kumamoto K, Regulation of an ATG7-beclin 1 program of autophagic cell death Yi M et al. (2006). Unique microRNA molecular profiles by caspase-8. Science 304: 1500–1502.
Supplementary Information accompanies the paper on the Oncogene website (http://www.nature.com/onc)
Oncogene