DOCSLIB.ORG

ARC Computing Element System Administrator Guide

Total Page：16

File Type：pdf, Size：1020Kb

Download full-text PDF Read full-text
ARC Computing Element System Administrator Guide NORDUGRID NORDUGRID-MANUAL-20 1/2/2019 ARC Computing Element System Administrator Guide F. Paganelli, Zs. Nagy, O. Smirnova, and various contributions from all ARC developers Contents 1 Overview 9 1.1 The grid . .9 1.2 The ARC services . .9 1.3 The functionality of the ARC Computing Element . 10 1.4 The A-REX, the execution service . 11 1.4.1 The pre-web service interfaces . 11 1.4.2 The web service interfaces . 12 1.5 Security on the Grid . 12 1.6 Handling jobs . 13 1.6.1 A sample job processing flow . 13 1.7 Application software in ARC: The RunTime Environments . 15 1.8 The local information . 17 1.8.1 Overview of ARC LDAP Infosys schemas . 17 1.9 LRMS, Queues and execution targets . 18 2 Requirements 19 2.1 Software Requirements . 19 2.2 Hardware Requirements . 19 2.3 Certificates . 20 3 Installation 21 3.1 Installation for commom GNU/Linux Distributions . 21 3.1.1 Setting up the repositories . 21 3.1.2 Performing the installation . 21 3.2 Installation for other systems and distributions . 23 3.3 Installation of certificates . 23 3.3.1 Installing host certificates . 23 3.3.2 Installing custom CA certificates . 24 3.3.3 Authentication Policy . 24 3.3.4 Revocation lists . 24 3.3.5 Authorization policy . 24 3 4 CONTENTS 4 Configuration 25 4.1 Preparing the system . 25 4.1.1 Users and groups . 25 4.1.2 Disk, partitioning, directories . 25 4.1.3 Permissions . 27 4.1.4 Networking . 27 4.1.5 Security considerations . 28 4.2 Configuration file formats . 29 4.2.1 Structure of the arc.conf configuration file . 29 4.2.2 Description of configuration items . 30 4.3 Setting up a basic CE . 31 4.3.1 Creating the arc.conf file . 31 4.3.2 The [common] section . 32 4.3.3 The [grid-manager] section: setting up the A-REX and the arched . 33 4.3.4 The [gridftpd] section: the job submission interface . 33 4.3.5 The [infosys] section: the local information system . 34 4.3.5.1 The [cluster] section: information about the host machine . 34 4.3.5.2 The [queue/fork] section: configuring the fork queue . 35 4.3.6 A basic CE is configured. What's next? . 35 4.4 Production CE setup . 36 4.4.1 Access control: users, groups, VOs . 36 4.4.1.1 [vo] configuration commands . 37 4.4.1.2 Automatic update of the mappings . 37 4.4.1.3 [group] configuration commands . 38 4.4.2 Connecting to the LRMS . 38 4.4.2.1 PBS . 39 4.4.2.2 Condor . 40 4.4.2.3 LoadLeveler . 41 4.4.2.4 Fork . 41 4.4.2.5 LSF . 42 4.4.2.6 SGE . 42 4.4.2.7 SLURM . 43 4.4.2.8 BOINC . 44 4.4.3 Enabling the cache . 44 4.4.3.1 The Cache Service . 45 4.4.3.2 Exposing the Cache . 46 4.4.3.3 The ARC Cache Index (ACIX) . 46 4.4.4 Configuring Data Staging . 47 4.4.5 Registering to an ARC EGIIS . 48 4.4.6 ARC CE to gLite Site and Top BDII integration . 50 4.4.7 Accounting with JURA . 50 CONTENTS 5 4.4.8 Monitoring the ARC CE: Nagios probes . 52 4.5 Enhancing CE capabilities . 53 4.5.1 Enabling or disabling LDAP schemas . 53 4.5.1.1 Applying changes . 54 4.5.2 Runtime Environments . 54 4.5.3 Enabling the Web Services interface . 55 4.5.4 Virtual Organization Membership Service (VOMS) . 55 4.5.4.1 Configuring trusted VOMS AC issuers . 57 4.5.4.2 Configuring VOMS AC signing servers to contact . 58 4.5.4.3 Configuring ARC to use VOMS extensions . 58 4.5.5 Dynamic vs static mapping . 59 4.5.5.1 Static mapping . 59 4.5.5.2 Dynamic mapping . 59 4.5.6 Using Argus authorization service . 60 4.5.7 Using LCAS/LCMAPS . 61 4.5.7.1 Enabling LCAS/LCMAPS . 61 4.5.7.2 LCAS/LCMAPS policy configuration . 62 4.5.7.3 Example LCAS configuration . 65 4.5.7.4 Example LCMAPS configuration . 65 4.5.8 Enabling the Arex ganglia implementation . 66 5 Operations 69 5.1 Starting and stopping CE services . 69 5.1.1 Overview . 69 5.1.2 Validating CE setup . 69 5.1.3 Starting the CE . 70 5.1.4 Stopping the CE . 70 5.1.5 Verifying the status of a service . 71 5.2 Testing a configuration . 72 5.2.1 Testing the information system . ..
Load more

Recommended publications
  • Full Document
    R&D Centre for Mobile Applications (RDC) FEE, Dept of Telecommunications Engineering Czech Technical University in Prague RDC Technical Report TR-13-4 Internship report Evaluation of Compressibility of the Output of the Information-Concealing Algorithm Julien Mamelli, [email protected] 2nd year student at the Ecole´ des Mines d'Al`es (N^ımes,France) Internship supervisor: Luk´aˇsKencl, [email protected] August 2013 Abstract Compression is a key element to exchange files over the Internet. By generating re- dundancies, the concealing algorithm proposed by Kencl and Loebl [?], appears at first glance to be particularly designed to be combined with a compression scheme [?]. Is the output of the concealing algorithm actually compressible? We have tried 16 compression techniques on 1 120 files, and the result is that we have not found a solution which could advantageously use repetitions of the concealing method. Acknowledgments I would like to express my gratitude to my supervisor, Dr Luk´aˇsKencl, for his guidance and expertise throughout the course of this work. I would like to thank Prof. Robert Beˇst´akand Mr Pierre Runtz, for giving me the opportunity to carry out my internship at the Czech Technical University in Prague. I would also like to thank all the members of the Research and Development Center for Mobile Applications as well as my colleagues for the assistance they have given me during this period. 1 Contents 1 Introduction 3 2 Related Work 4 2.1 Information concealing method . 4 2.2 Archive formats . 5 2.3 Compression algorithms . 5 2.3.1 Lempel-Ziv algorithm .
    [Show full text]
  • Genetic Databases
    Stefano Lonardi March, 2000 Compression of Biological Sequences by Greedy Off-line Textual Substitution Alberto Apostolico Stefano Lonardi Purdue University Università di Padova Genetic Databases § Massive § Growing exponentially Example: GenBank contains approximately 4,654,000,000 bases in 5,355,000 sequence records as of December 1999 Data Compression Conference 2000 1 Stefano Lonardi March, 2000 DNA Sequence Records Composed by annotations (in English) and DNA bases (on the alphabet {A,C,G,T,U,M,R,W,S,Y,K,V,H,D,B,X,N}) >RTS2 RTS2 upstream sequence, from -200 to -1 TCTGTTATAGTACATATTATAGTACACCAATGTAAATCTGGTCCGGGTTACACAACACTT TGTCCTGTACTTTGAAAACTGGAAAAACTCCGCTAGTTGAAATTAATATCAAATGGAAAA GTCAGTATCATCATTCTTTTCTTGACAAGTCCTAAAAAGAGCGAAAACACAGGGTTGTTT GATTGTAGAAAATCACAGCG >MEK1 MEK1 upstream sequence, from -200 to -1 TTCCAATCATAAAGCATACCGTGGTYATTTAGCCGGGGAAAAGAAGAATGATGGCGGCTA AATTTCGGCGGCTATTTCATTCATTCAAGTATAAAAGGGAGAGGTTTGACTAATTTTTTA CTTGAGCTCCTTCTGGAGTGCTCTTGTACGTTTCAAATTTTATTAAGGACCAAATATACA ACAGAAAGAAGAAGAGCGGA >NDJ1 NDJ1 upstream sequence, from -200 to -1 ATAAAATCACTAAGACTAGCAACCACGTTTTGTTTTGTAGTTGAGAGTAATAGTTACAAA TGGAAGATATATATCCGTTTCGTACTCAGTGACGTACCGGGCGTAGAAGTTGGGCGGCTA TTTGACAGATATATCAAAAATATTGTCATGAACTATACCATATACAACTTAGGATAAAA ATACAGGTAGAAAAACTATA Problem Textual compression of DNA data is difficult, i.e., “standard” methods do not seem to exploit the redundancies (if any) inherent to DNA sequences cfr. C.Nevill-Manning, I.H.Witten, “Protein is incompressible”, DCC99 Data Compression Conference 2000 2 Stefano Lonardi March, 2000
    [Show full text]
  • ARC-LEAP User Instructions for The
    ARC-LEAP User Instructions Appalachian Regional Commission Local Economic Assessment Package prepared for the Appalachian Regional Commission prepared by Economic Development Research Group, Inc. Glen Weisbrod Teresa Lynch Margaret Collins January, 2004 ARC-LEAP User Instructions Appalachian Regional Commission Local Economic Assessment Package prepared for the Appalachian Regional Commission prepared by Economic Development Research Group, Inc. 2 Oliver Street, 9th Floor, Boston, MA 02109 Telephone 617.338.6775 Fax 617.338.1174 e-mail [email protected] Website www.edrgroup.com January, 2004 ARC-LEAP User Instructions PREFACE LEAP is a software tool that was designed and developed by Economic Development Research Group, Inc. (www.edrgroup.com) to assist practitioners in evaluating local economic development needs and opportunities. ARC-LEAP is a version of this tool developed specifically for the Appalachian Regional Commission (ARC) and it’s Local Development Districts (LDDs). Development of this user guide was funded by ARC as a companion to the ARC-LEAP analysis system. This document presents user instructions and technical documentation for ARC-LEAP. It is organized into three parts: I. overview of the ARC-LEAP tool II. instructions for users to obtain input information and run the analysis model III. interpretation of output tables . A separate Handbook document provides more detailed discussion of the economic development assessment process, including analysis of local economic performance, diagnosis of local strengths and weaknesses, and application of business opportunity information for developing an economic development strategy. Economic Development Research Group i ARC-LEAP User Instructions I. OVERVIEW The ARC-LEAP model serves to three related purposes, each aimed at helping practitioners identify target industries for economic development.
    [Show full text]
  • ARC File Revision 3.0 Proposal
    ARC file Revision 3.0 Proposal Steen Christensen, Det Kongelige Bibliotek <ssc at kb dot dk> Michael Stack, Internet Archive <stack at archive dot org> Edited by Michael Stack Revision History Revision 1 09/09/2004 Initial conversion of wiki working doc. [http://crawler.archive.org/cgi-bin/wiki.pl?ArcRevisionProposal] to docbook. Added suggested edits suggested by Gordon Mohr (Others made are still up for consideration). This revision is what is being submitted to the IIPC Framework Group for review at their London, 09/20/2004 meeting. Table of Contents 1. Introduction ............................................................................................................................2 1.1. IIPC Archival Data Format Requirements .......................................................................... 2 1.2. Input ...........................................................................................................................2 1.3. Scope ..........................................................................................................................3 1.4. Acronyms, Abbreviations and Definitions .......................................................................... 3 2. ARC Record Addressing ........................................................................................................... 4 2.1. Reference ....................................................................................................................4 2.2. The ari Scheme ............................................................................................................
    [Show full text]
  • Steganography and Vulnerabilities in Popular Archives Formats.| Nyxengine Nyx.Reversinglabs.Com
    Hiding in the Familiar: Steganography and Vulnerabilities in Popular Archives Formats.| NyxEngine nyx.reversinglabs.com Contents Introduction to NyxEngine ............................................................................................................................ 3 Introduction to ZIP file format ...................................................................................................................... 4 Introduction to steganography in ZIP archives ............................................................................................. 5 Steganography and file malformation security impacts ............................................................................... 8 References and tools .................................................................................................................................... 9 2 Introduction to NyxEngine Steganography1 is the art and science of writing hidden messages in such a way that no one, apart from the sender and intended recipient, suspects the existence of the message, a form of security through obscurity. When it comes to digital steganography no stone should be left unturned in the search for viable hidden data. Although digital steganography is commonly used to hide data inside multimedia files, a similar approach can be used to hide data in archives as well. Steganography imposes the following data hiding rule: Data must be hidden in such a fashion that the user has no clue about the hidden message or file's existence. This can be achieved by
    [Show full text]
  • Sequence Alignment/Map Format Specification
    Sequence Alignment/Map Format Specification The SAM/BAM Format Specification Working Group 3 Jun 2021 The master version of this document can be found at https://github.com/samtools/hts-specs. This printing is version 53752fa from that repository, last modified on the date shown above. 1 The SAM Format Specification SAM stands for Sequence Alignment/Map format. It is a TAB-delimited text format consisting of a header section, which is optional, and an alignment section. If present, the header must be prior to the alignments. Header lines start with `@', while alignment lines do not. Each alignment line has 11 mandatory fields for essential alignment information such as mapping position, and variable number of optional fields for flexible or aligner specific information. This specification is for version 1.6 of the SAM and BAM formats. Each SAM and BAMfilemay optionally specify the version being used via the @HD VN tag. For full version history see Appendix B. Unless explicitly specified elsewhere, all fields are encoded using 7-bit US-ASCII 1 in using the POSIX / C locale. Regular expressions listed use the POSIX / IEEE Std 1003.1 extended syntax. 1.1 An example Suppose we have the following alignment with bases in lowercase clipped from the alignment. Read r001/1 and r001/2 constitute a read pair; r003 is a chimeric read; r004 represents a split alignment. Coor 12345678901234 5678901234567890123456789012345 ref AGCATGTTAGATAA**GATAGCTGTGCTAGTAGGCAGTCAGCGCCAT +r001/1 TTAGATAAAGGATA*CTG +r002 aaaAGATAA*GGATA +r003 gcctaAGCTAA +r004 ATAGCT..............TCAGC -r003 ttagctTAGGC -r001/2 CAGCGGCAT The corresponding SAM format is:2 1Charset ANSI X3.4-1968 as defined in RFC1345.
    [Show full text]
  • Usage Statistics and Usage Patterns on the Nordugrid: Analyzing the Logging Information Collected on One of the Largest Production Grids of the World
    CHEP04 Contribution ID: 102 Type: poster Usage statistics and usage patterns on the NorduGrid: Analyzing the logging information collected on one of the largest production Grids of the world. Wednesday, 29 September 2004 10:00 (0 minutes) The Nordic Grid facility (NorduGrid) came into production operation during the summer of 2002 when the Scandinavian Atlas HEP group started to use the Grid for the Atlas Data Challenges and was thus the first Grid ever contributing to an Atlas production. Since then, the Grid facility has been in continuous 24/7 operation offering an increasing number of resources to a growing set of active users coming from various scientific areas including chemistry, biology, informatics. As of today the Grid has grown into one of the largest production Grids of the world continuously running Grid jobs on the more than 30 Grid-connected sites which offer over 2000 CPUs. This article will start with a short overview of the design and implementation of the Advanced Resource Connector (ARC), the NorduGrid middleware, which delivers reliable Grid services to the NorduGrid production facility. This will be followed by a presentation of the logging facility of NorduGrid, describing the logging service and the collected information. The main part of the talk will focus onthe analysis of the collected logging information: usage statistics, usage patterns (what is a typical grid job on the NorduGrid looks like?). Use cases from different application domains will also be discussed. References: -NorduGrid live: www.nordugrid.org -> Grid Monitor -Atlas Data-Challenge 1 on NorduGrid: http://arxiv.org/abs/physics/0306013 Primary authors: KONSTANTINOV, A.
    [Show full text]
  • How to 'Zip and Unzip' Files
    How to 'zip and unzip' files The Windows 10 operating system provides a very easy way to zip-up any file (or folder) you want by using a utility program called 7-zip (Seven Zip). The program is integrated in the context menu which you get when you right-click on anything selected. Here are the basic steps you need to take in order to: Zip a file and create an archive 1. Open a folder in your machine and select any file (by clicking on it once). I selected a single file called 'how-to send an email.docx' 2. Now right click the mouse to have the context menu appear 3. In the context menu you should be able to see some commands like the capture below 4. Since we want to zip up the file you need to select one of the bottom two options a. 'Add to archive' will actually open up a dialog of the 7-zip application and will give you the opportunity to customise the archive. b. 'Add to how-to send an email.zip' is actually the quickest way possible to create an archive. The software uses the name of the file and selects a default compression scheme (.zip) so that you can, with two clicks, create a zip archive containing the original file. 5. Now you can use the 'how-to send an email.zip' file and send it as a 'smaller' email attachment. Now consider that you have just received (via email) the 'how-to send an email.zip' file and you need to get (the correct phrase is extract) the file it contains.
    [Show full text]
  • Performance of the Nordugrid ARC and the Dulcinea Executor in ATLAS Data Challenge 2
    Performance of the NorduGrid ARC and the Dulcinea Executor in ATLAS Data Challenge 2 Sturrock, R.; Eerola, Paula; Konya, Balazs; Smirnova, Oxana; Lindemann, Jonas; et, al. Published in: CERN-2005-002 2005 Link to publication Citation for published version (APA): Sturrock, R., Eerola, P., Konya, B., Smirnova, O., Lindemann, J., & et, A. (2005). Performance of the NorduGrid ARC and the Dulcinea Executor in ATLAS Data Challenge 2. In A. Aimar, J. Harvey, & N. Knoors (Eds.), CERN- 2005-002 (Vol. 2, pp. 1095-1098). CERN. Total number of authors: 6 General rights Unless other specific re-use rights are stated the following general rights apply: Copyright and moral rights for the publications made accessible in the public portal are retained by the authors and/or other copyright owners and it is a condition of accessing publications that users recognise and abide by the legal requirements associated with these rights. • Users may download and print one copy of any publication from the public portal for the purpose of private study or research. • You may not further distribute the material or use it for any profit-making activity or commercial gain • You may freely distribute the URL identifying the publication in the public portal Read more about Creative commons licenses: https://creativecommons.org/licenses/ Take down policy If you believe that this document breaches copyright please contact us providing details, and we will remove access to the work immediately and investigate your claim. LUND UNIVERSITY PO Box 117 221 00 Lund +46 46-222 00
    [Show full text]
  • Official Service Contractor for The2018 International Bluegrass Music Association
    International Bluegrass Musical Association OFFICIAL SERVICE September 26 - 29, 2018 CONTRACTOR Raleigh Convention Center Hall C Raleigh, NC Information and Order Forms Table of Contents General Information General Information................................................................2, 3 Payment Policy & Credit Card Authorization.........................4 Third Party Billing & Credit Card Charge Authorization..5,6 Color Chart for Drape, Table Skirts and Carpet...................7 Decorating Services Custom Booth Packages...........................................................8 Furnishing Rentals.......................................................................9 Mailing Address: Custom Signs and Graphics...................................................10 P. O. Box 49837 Greensboro, NC 27419 Labor Cleaning Service.........................................................................11 Street Address: Installation and Dismantle Labor............................................12 121 North Chimney Rock Road Exhibitor Appointed Contractor.........................................13,14 Greensboro, NC 27409 Material Handling Phone: (336) 315-5225 Material Handling General Information............................15,16 Fax: (336) 315-5220 Material Handling Rate Schedule and Order Form.......17,18 Shipping Labels........................................................................19 2 General 2 Information HOLLINS Exposition Services is pleased to have been selected as the Official Service Contractor for the2018 International
    [Show full text]
  • Galileo Formats
    Galileo Formats October 1998 edition Chapters INDEX Introduction Booking File Air Transportation Fares Cars Hotels LeisureShopper Document Production Queues Client File/TravelScreen Travel Information Miscellaneous SECURITY Sign On H/SON SON/Z217 or Sign on at own office SON/ followed by Z and a 1 to 3 character I.D.; the I.D. can be SON/ZHA initials, a number or a combination of both SON/ZGL4HA Sign on at branch agency SON/ followed by Z, own pseudo city code and a 1 to 3 character I.D. SON/Z7XX1/UMP Sign on at 4 character PCC branch agency SON/ followed by Z, own pseudo city code, second delimiter and 1 to 3 character I.D. SB Change to work area B SA/TA Change to work area A; different duty code TA (Training) SAI/ZHA Sign back into all work areas at own office SAI/ZGL4HA Sign back into all work areas at branch agency; SAI/ followed by Z, own pseudo city code and a 1 to 3 character I.D. Sign Off SAO Temporary sign out; incomplete Booking Files must be ignored or completed SOF Sign off; incomplete Booking Files must be ignored or completed SOF/ZHA Sign off override (at own office); incomplete transactions are not protected SOF/ZGL4HA Sign off override (at branch agency); incomplete transactions are not protected; SOF/ followed by Z, own pseudo city code and a 1 to 3 character I.D. SECURITY Security Profile STD/ZHA Display security profile, for sign on HA; once displayed, password may be changed SDA List security profiles created by user (second level authoriser and above) SDA/ZXXØ List security profiles associated with agency XXØ (second level authoriser and above) STD/ZXX1UMP or Display profile STD/ followed by Z, own pseudo city code, second delimiter if pseudo STD/Z7XX1/UMP city code is 4 characters and 1 to 3 character I.D.
    [Show full text]
  • Status Report
    Nordic Testbed for Wide Area Computing and Data Handling 9/01/01 NORDIC TESTBED FOR WIDE AREA COMPUTING AND DATA HANDLING (NORDUGRID) Status Report Introduction The purpose of the project is to create the grid computing infrastructure in Nordic countries. Project participants include universities and research centers in Denmark, Sweden, Finland and Norway. The active phase of the project started in May 2001, and involves the Niels Bohr Institute (Denmark), Lund and Uppsala Universities (Sweden), University of Oslo (Norway) and Helsinki Institute of Physics (Finland). From the very beginning, the NorduGrid testbed became an integral part of the EU DataGrid project, initiated at CERN and aimed at creation of the computing infrastructure for the future high−energy physics experiments. This report overviews the status of the NorduGrid project as of September 1, 2001. 1. Organization Due to the considerable geographical spread of the project member sites, the organization and management heavily relies on the Internet and teleconferences. The project Web site (http://www.quark.lu.se/grid) opened in December 2000, and is regularly updated with the most detailed information. 1.1. Responsibilities 1.1.1. Steering Panel Prior to the project’s start, the steering panel was appointed to provide adequate management. It consists of the coordinator, John Renner Hansen, representing Niels Bohr Institute, Denmark; Tord Ekelöf, Paula Eerola and Sten Hellman, representing Uppsala, Lund and Stockholm Universities of Sweden; Farid Ould−Saada from the University of Oslo, Norway, and Matti Heikkurinen, representing Helsinki Institute of Physics, Finland. The group holds regular phone meetings. 1.1.2. New positions Three new postdoctoral positions, funded by the project, were created.
    [Show full text]