Identification of Neurogenic Differentiation Factor and Neurogenin Homologs In

Home , Consensus sequence, NeuroD, Neurogenins

IDENTIFICATION OF NEUROGENIC

DIFFERENTIATION FACTOR AND NEUROGENIN

HOMOLOGS IN Schistosoma mansoni

SHIKHA TANDON

Submitted in partial fulfillment of the requirements for the degree of Master of Science

Thesis advisor: Dr. Emmitt R. Jolly

Department of Biology CASE WESTERN RESERVE UNIVERSITY

May 2012

CASE WESTERN RESERVE UNIVERSITY

SCHOOL OF GRADUATE STUDIES

We hereby approve the thesis/dissertation of SHIKHA TANDON candidate for the MS BIOLOGY degree*.

(signed) Dr. Roy Ritzmann (chair of the committee)

Dr. Emmitt R. Jolly

Dr. Christopher Cullis

Dr. Claudia Mizutani

January 18, 2012

*We also certify that written approval has been obtained for any proprietary material contained therein.

TABLE OF CONTENTS

1. INTRODUCTION 1 1.1 Schistosomiasis 1 1.2 bHLH Transcription factors 2 1.3 NeuroD and Neurogenin 3 1.4 Evolution of NeuroD and Neurogenin 5 1.5 NeuroD and Neurogenin in different organisms 6 1.5.1 Caenorhabditis elegans 6 1.5.2 Xenopus laevis 7 1.5.3 Homo sapiens 7 1.6 NeuroD and Diabetes Mellitus in Humans and Mice 9 1.7 NeuroD in the Mammalian Retina 11 1.8 NeuroD and Neurogenin in Schistosomes 12 2. MATERIALS AND METHODS 13 2.1 Identification and Cloning of NeuroD/Neurogenin homolog 13 2.2 Sequencing of NeuroD/Neurogenin homolog 15 2.3 cDNA synthesis and Real-Time Polymerase Chain Reaction (Absolute qPCR) 16 2.4 Yeast One Hybrid system to test for transcriptional activation 16 2.5 Protein expression, purification and quantification 18 2.6 Electrophoretic Mobility Shift Assay (EMSA) to test DNA-Protein binding 20 2.7 Cloning, protein expression, protein purification and EMSA of Smp_125400 DNA Binding Domain 22 3. RESULTS 24 4. DISCUSSION 30 5. FIGURES 35 6. BIBLIOGRAPHY 47

LIST OF FIGURES

Figure 1: Life cycle of Schistosoma mansoni

Figure 2: BLASTp search using Smp_125400 full transcript

Figure 3: Multiple sequence alignment of HLH domain of Smp_125400 with a)

Human neurogenic differentiation factors and neurogenins and b) HLH domain of multiple organisms

Figure 4: Expression of Smp_125400 during different stages of S.mansoni life cycle via RT-PCR

Figure 5: Nucleotide and protein sequence of Smp_125400 splice variant

Figure 6: Expression of Smp_125400 during different stages of S.mansoni life cycle via qPCR

Figure 7: Modified Yeast-One-Hybrid system to test whether Smp_125400 can activate transcription

Figure 8: Results of modified Yeast-One-Hybrid system reporter assays

Figure 9: Growth assay to test for Smp_125400 reporter activity by Spot Test

Figure 10: Electrophoretic Mobility Shift Assay to test for the DNA binding ability of a) Smp_125400 full transcript and b) Smp_125400 DNA Binding Domain protein

Figure 11: Orthogonal type of nervous system in S. mansoni

Identification of Neurogenic Differentiation Factor and Neurogenin Homologs in

Schistosoma mansoni

Abstract

SHIKHA TANDON

Schistosomiasis is a parasitic disease that is caused due to an infection by the parasitic worm, Schistosoma mansoni. S. mansoni has a complex life cycle transitioning from free swimming larval forms to an intermediate snail host or to a human definitive host. However, little is known about neural development in this parasite, nor how gene function and expression is regulated within the life cycle of S. mansoni. Neurogenic differentiation factor (neuroD) and neurogenin are basic helix- loop-helix transcription factors that play a role in the development and maintenance of the peripheral and sensory nervous system. They also have the ability to bind to and induce expression of the Insulin gene in beta cells of the pancreatic islet. Here we describe the identification of a neuroD/neurogenin homolog in S. mansoni and demonstrate that it functions as a transcriptional activator. We also test its ability to bind to DNA.

1. INTRODUCTION

1.1 Schistosomiasis

Schistosomiasis is a parasitic disease that infects 200 million people worldwide with an estimated 779 million at risk of infection [1] [3]. It infects people of all ages from

76 countries within Asia, Africa, South America and the Middle East [2].

Schistosomiasis is caused by the helminth parasite of the genus Schistosoma, namely

Schistosoma mansoni, Schistosoma japonicum and Schistosoma haematobium [4].

These three species can infect humans. Infection due to S. mansoni and S. japonicum causes intestinal schistosomiasis whereas urinary schistosomiasis is caused by S. haematobium [5]. Symptoms of an acute infection include fever, headache, diarrhoea and respiratory symptoms. Chronic infection is due to host immune responses to the eggs of the parasite [6].

The life cycle of S. mansoni involves a series of morphological and biochemical transitions from two free swimming larval forms, an intermediate snail host and a human definitive host [2] [Figure 1]. Cercariae, infect the human host by penetrating through the skin. Upon infection, they shed their tail and transform into schistosumula. These schistosomula travel to the liver via the lungs and develop into adult worms. The mature adult worms pair and females produce almost 300 eggs per day [7]. These eggs are excreted into fresh water through the feces. Upon contact with fresh water, the eggs hatch into free swimming miracidia which in turn infect the snail intermediate host. Inside the snail, miracidia transform into mother and daughter sporocysts. The daughter sporocysts produce cercariae, which is a larval form capable of infecting humans [2].

Praziquantel is the drug of choice to treat schistosomiasis, but it does not prevent reinfection. There are concerns that schistosomes may become resistant to praziquantel as some reports have shown selection of resistance in a laboratory setting [1]. Thus, it is paramount that ongoing research be aimed at understanding gene expression and regulatory function within the life cycle of S. mansoni.

Transcription factors are proteins that are capable of binding to certain DNA sequences and thereby regulating expression of genes by controlling transcription of

DNA to mRNA [22]. They play key roles in developmental processes in all organisms.

In this regard, understanding schistosome basic biology, particularly the function of regulators of gene expression during development, will elucidate how development is controlled in parasites and may help to identify potential therapeutic targets.

1.2 bHLH transcription factors

Basic helix-loop-helix (bHLH) proteins are a family of transcription factors. The bHLH structural motif contains two α- helices that are amphipathic and are connected by a loop of variable length [8]. Of the two α- helices, one is smaller than the other and the larger helix usually contains the DNA binding region. DNA binding is facilitated by the presence of basic amino acid residues in the larger helix [9]. Overall, the HLH regions of these transcriptional factors are hydrophobic and are composed of approximately 50 amino acid residues. Proteins containing bHLH structural motifs form functional dimers and are capable of binding to other bHLH proteins [8]. There are currently over 400 proteins that are known to contain the bHLH domain [8].

These complex structures are functionally heterogeneous and play a role in essential

2 developmental processes including neurogenesis, myogenesis, cell proliferation and tissue differentiation [8].

Evolutionarily, sequencing of the non bHLH domains between clades, revealed very little sequence similarity [8]. Between clades, although a high degree of similarity is seen in the bHLH domain, the location of this domain within the overall structure varies. The dissimilarity between non bHLH domains, suggests that these clades must have diverged a long time ago [8]. It is hypothesized that, the bHLH and non bHLH domains, which we now appreciate as the bHLH group of transcriptional factors, were shuffled around during evolution [8]. bHLH transcription factors are known to bind to a specific consensus DNA sequence

(CANNTG), known as E-box. These E-box sequences are present in the promoter region of the target genes and binding occurs via the DNA binding domain of the transcription factor [10].

1.3 Neurogenin and neuroD

Neurogenins are a subfamily of bHLH transcriptional factors that are involved in neuronal differentiation [11]. They are related to the Drosophila atonal gene family.

They play an essential role in the development of the dorsal root ganglia as part of the sensory lineage in the neural crest cells of Drosophila [11]. There are three types of neurogenins; neurogenin 1 (encoded by the NEUROG1 gene), neurogenin 2

(encoded by the NEUROG2 gene) and neurogenin 3 (encoded by the NEUROG3 gene)

[11].

In humans, neurogenin 1 interacts with cAMP response element binding protein or

CREB [12]. CREB protein is encoded by the CBP gene which acts as a coactivator for many transcriptional factors and is involved in embryonic development, growth control, and homeostasis [13] [14]. Neurogenin 2 is expressed in neural progenitor cells and is involved in the development of the central and peripheral nervous systems [15]. Neurogenin 3 is expressed in the pancreas and intestine and is essential for endocrine cell development [16].

Neurogenic differentiation factor or neuroD is a bHLH transcription factor that plays an important role in neuronal differentiation [10]. It is also known as beta2 (β-cell E- box transactivator 2) and is also involved in development of the pancreas [10].

NeuroD is expressed in the brain, pancreatic beta cells, enteroendocrine cells and neuroendocrine cells [10]. NeuroD is capable of forming heterodimers with ubiquitous bHLH factors such as E47 and E12 [31]. This NeuroD/E47 complex is capable of binding to the E-box sequence within the promoter region of the insulin gene [31].

There are five major members of the neuroD family, not all of which are seen in all species. NeuroD1 (encoded by the NEUROD1 gene) is capable of forming heterodimers with other bHLH proteins and is also responsible for activating transcription of the Insulin gene in humans. Mutations in this gene cause Type II

Diabetes Mellitus in humans [33]. NeuroD2 is encoded by the NEUROD2 gene and is involved in the determination and maintenance of neural cells [35]. It is capable of inducing transcription in genes with neuron specific promoters [35]. NeuroD3 is also known as neurogenin 1 and mediates neuronal differentiation in embryonic

4 development [35]. NeuroD4 is expressed in the developing nervous system, and its expression plays a role in the development of the retina [37]. NeuroD6 expression is seen in the human brain and is involved in the development and maintenance of the nervous system [40].

1.4 Evolution of neuroD and neurogenin

In Xenopus, formation of neuronal precursors was found to be preceded by the localized expression of neurogenin in the neural plate [19]. Further, injection of neurogenin mRNA in to two-cell stage embryos of Xenopus was capable of inducing ectopic neurogenesis [19]. This suggests that Neurogenin could function as a proneural gene. NeuroD is structurally related to neurogenin and was also found to be locally expressed in similar cells [19] [20]. However, neuroD expression, in comparison to neurogenin, occurred at a later stage. Its expression was noticed during the onset of neuronal differentiation and also in mature neurons [19] [20].

Thus, these bHLH genes were found to act both at the early and late stages of neurogenesis. They were observed in similar tissues and NeuroD expression was preceded by neurogenin expression in the same region [19] [21].

Evolution of these sequentially acting genes could be from a single bHLH gene that was initially responsible for controlling all the different stages of neurogenesis [21].

It is possible that, due to mutations and duplications, this single gene gave rise to a defective gene that discontinued the neurogenesis process just shy of actual neuronal differentiation. This would administer the proneural character to these cells and allow them to undergo proliferation. However, complete differentiation of

5 these cells would not have been possible and thus could have led to the expression of the late acting bHLH genes [21].

1.5 NeuroD/neurogenin in different organisms

1.5.1 Caenorhabditis elegans

Several bHLH factors have been implicated in the development of the C.elegans nervous system. The C.elegans homolog of neuroD is called C.elegans neuroD or cnd-

1 [23]. Cnd-1 homozygous mutants (Ju29) showed an uncoordinated phenotype when moving backwards. Cnd-1 is composed of 3 exons and encodes a 192 amino acid protein. The bHLH domain shares 68% identity and 81% similarity to vertebrate neuroD, and 60% identity and 71% similarity to neurogenin [23]. Additionally, cnd-1 mutants also have multiple defects in the ventral cord motor neurons.

Maintenance of neuroblast identity and specification of neuronal fates are the primary functions of cnd-1. This neuronal fate determination is mainly by regulation of three neuronal transcription factors; unc-30, unc-4 and unc-3 [23]. The promoters of these three genes contain consensus sequences that can be recognised by cnd-1.

This evidence seems to suggest that these three genes are downstream targets of cnd-1 [23]. Cnd-1 regulates axonal outgrowth and synaptic connectivity in a group of postmitotic motor neurons. Cnd-1 shares sequences homology to proteins of vertebrate neuroD while the bHLH domain is closely related to vertebrate neurogenin protein [23].

1.5.2 Xenopus laevis

Similar to other organisms, neuroD and neurogenin play a critical role in neuronal differentiation in Xenopus laevis. Ectopic injections of Xenopus neuroD and neurogenin1 RNA in Xenopus embryos resulted in significant increase in neuronal cell differentiation [19] [20]. This effect was observed in the neurogenic epithelium of the neural plate as well as the non neural ectoderm, where neurons normally do not form. Neural bHLH proteins induce neuronal differentiation in a unidirectional and sequential manner [24]. In Xenopus embryos, Xenopus neuroD expression in the neural plate is preceded by that of neurogenin1 and this leads to formation of primary neurons [24]. In line with this observation, Xenopus neurogenin1 acts as an upstream activator of neuroD [24].

In Xenopus, both neurogenin 3 and neuroD are expressed in the developing pancreas

[32]. It was observed that expression domains of neurogenin 3 and neuroD overlapped, especially during the early stages of pancreas development. The overexpression of neurogenin 3 in endocrine cell lines, lead to up regulation of endogenous neuroD RNA levels [32]. Thus, data suggests that neurogenin 3 functions as one of the transcription factors involved in the regulation of neuroD, during differentiation of the early islet cells [32].

1.5.3 Homo sapiens

There are five members in the human neuroD family. NeuroD1 (RefSeq.

NM_002500.3), in humans has been localized to chromosome 2q31.3. It is approximately 1Kb in length and contains one coding exon. The cerebellum has a

7 very high level of neuroD1 expression, followed by several other regions of the brain

[10] [26]. Due to its association with a diabetic phenotype, it comes as no surprise that neuroD1 is highly expressed in the pancreatic islets [33]. A significant amount of data has been compiled delineating the role of neuroD1 in the development of the pancreatic islets. It has been shown to be one of the key transcription activators required early on in pancreatic cell lineage determination [34]. There have been repeated associations of Type I Diabetes and variations in neuroD1. The common polymorphisms seen in neuroD1 associated with diabetes are invariably in the DNA binding domain of the bHLH domain, reiterating the function of neuroD1 in being a transcriptional activator [33].

NeuroD2 (RefSeq. NM_006160.3), in humans, maps to chromosome 17q12, contains one coding exon and is approximately 1Kb in length. NeuroD2 contains a single bHLH domain. NeuroD2 is known to induce transcription through neuron specific promoters and is essential in neuronal fate determination [35]. The functional domains of this protein are well conserved.

NeuroD3 (RefSeq. NM_006161.2) is also known as neurogenin1 and maps to chromosome 5q23-q31. It is 1.6Kb in length and contains one coding exon. NeuroD3 appears to mediate neuronal differentiation and its expression is limited to embryonic nervous system [35]. Mutations in neuroD3 have been identified in schizophrenic individuals [36]. NeuroD3, therefore, is a candidate gene for increased susceptibility to schizophrenia [36].

NeuroD4 (RefSeq. NM_021191.2) is 996bp in length, contains one coding exon, and maps to chromosome 12q13. Expression of this gene plays a role in the development

8 of the adult retina [38]. NeuroD protein expression was localized to the outer layer that contains the photoreceptors [38].

NeuroD6 (RefSeq. NM_022728.2) maps to chromosome 7p14-p15. It contains one coding exon and a single bHLH domain. It has moderate to high levels of expression in the brain and may be involved in the development and maintenance of the nervous system [40].

1.6 NeuroD and Diabetes Mellitus in human and mice

NeuroD mutations in humans and mice have been linked to their increased susceptibility to diabetes [26]. Type I Diabetes Mellitus or Insulin Dependent

Diabetes Mellitus (IDDM) has been linked to an Ala45Thr mutation in a region on human chromosome 2q32, where the neuroD gene is also located [26]. Type II diabetes mellitus occurs due to insulin resistance or failure to utilize the produced insulin. Maturity onset diabetes of the young (MODY) is a form of Type II diabetes mellitus and is classified into MODY1 to MODY6. The different types of MODY are a consequence of mutations in genes that encode different transcription factors. They are Hnf-4α (MODY1), glucokinase (MODY2), Hnf-1α (MODY3), Pdx-1 (MODY4), Hnf-

1β (MODY5) and NeuroD1 (MODY6) [27]. Two mutations in the neuroD gene are linked to increased susceptibility to MODY6 in humans. A heterozygous Arg111 missense mutation voids the DNA binding ability of neuroD when it occurs within the

DNA binding domain. The transcriptional activating domain of neuroD is located at its C-terminal and a mutation in this region leads to an increased susceptibility to a more severe clinical phenotype of Type 2 Diabetes Mellitus [33].

NeuroD1 is capable of forming a heterodimer with E47, a ubiquitously expressed bHLH protein [31]. Proper orientation of the neuroD-E47 heterodimer is important for recruiting other transcriptional factors, in order to form an active preinitiation complex [31]. This heterodimer binds strongly to the E box sequence of the insulin gene, thus activating transcription of the gene in β cells [28]. NeuroD1 alone is unable to form the DNA contact to the E-box [31]. The NeuroD1-E47 is capable of activating transcription, and regulating the expression of the glucagon gene in the islet cells. When E47 is over-expressed, the glucagon gene expression is inhibited but insulin expression is activated [27]. This suggests that the ratio of neuroD1/E47 plays a role in expression of these two genes [45]. A co-activator of neuroD1, p300, was found to be important in the activation of the E box directed transcription of the insulin gene in β cells. A mutated p300 no longer had the ability to bind to neuroD1, thus hampering insulin production [27]. Small heterodimer partner (SHP), a member of the orphan nuclear receptor superfamily is a co-regulator of neuroD1 activity. It competes with p300 for binding to neuroD1 and by doing this, represses the activity of neuroD1 [29].

NeuroD null mice were found to be hyperglycemic and it was observed in neuroD null mice that Islet cells failed to form the pancreas [26] [28]. Although all endocrine hormones were expressed, the total insulin level was only 5% of the normal. NeuroD activates the insulin promoter and also the sulfonylurea receptor (SUR1) [26] [30].

The SUR1 forms a potassium channel that responds to glucose. In the presence of glucose, this potassium channel closes and activates the calcium channel which results in increased levels of intracellular calcium. This calcium is required by mature

β cells to activate transcription factors that in turn stimulate insulin secretion [26].

NeuroD expression in mature β cells suggests its role in the function of these cells

[34].

1.7 NeuroD in the Mammalian Retina

NeuroD1 plays a role in the development of the mammalian sensory nervous system, in particular, the retina [37]. The expression of NeuroD1 is first seen in the central area of the retina at the E10.5 day of mouse embryogenesis and is also later observed at the lateral ends of the retina [10]. The differentiating photoreceptor cells are located in the outer nuclear layer and by E18.5 of embryogenesis, NeuroD1 expression is at its maximum in this region [10]. NeuroD1 expression is stable in the adult retina. In the inner nuclear layer, expression of NeuroD1 was not found to be significant in comparison to that in the outer nuclear layer [10]. This suggests that

NeuroD1 is expressed mainly in the differentiating or differentiated cells, and not the proliferating cells, in the retina [37] [10].

NeuroD also plays a role in the differentiation and maintenance of photoreceptors

[26]. NeuroD1 knockout mice have a decreased number of photoreceptor cells in the outer nuclear layer within the first 3 months. After 18 months, this layer is completely degenerated suggesting that NeuroD1 plays an important role in photoreceptor cell specification, differentiation and survival [10]. Apoptosis of these photoreceptor cells in the outer nuclear layer of the retina leads to blindness [10].

1.8 NeuroD and Neurogenin in Schistosomes

Schistosomes are parasitic worms that belong to the class Trematoda. They follow a typical trematode life cycle that consists of a definitive human host as well as an intermediate snail host. As discussed earlier, the different stages of the schistosome life cycle consists of the egg, miracidiae, sporocyst, cercariae, schistosomulum and adult stages. The body covering of schistosomes, known as tegument, bears sensory papillae on its surface. The tegument also contains cytoplasmic projections in the form of excretory pores and nerve endings. Schistosomes can absorb small molecules, such as glucose, through its tegument. The main source of energy is by the degradation of carbohydrates such as glucose and glycogen. Glucose absorption occurs in schistosomes by diffusion as well as by a carrier mediated system [39].

The nervous system of schistosomes is orthogon (ladder like) type that consists of longitudinal nerve cords that are connected at intervals by transverse nerve tissue

[Figure 11]. Several nerves stem from the anteriorly located cerebral ganglion while pairs of dorsal, ventral and lateral nerves are located at the posterior end. Sensory ending are found on the nerve branches as well as on the oral sucker. Cercariae and miracidia have a larger variety of sense organs than adult worms. This falls in line with the need for cercariae and miracidia to adapt quickly to their environment in order to find a suitable host [39].

Eyespots are present in miracidia and cercariae of schistosomes. These eyespots consist of cup-shaped pigment cells that surround the rhabdomeric microvilli of retinular cells. These rhabdomeres are the photoreceptors and the pigment cells enable the organism to differentiate between light and dark [39].

NeuroD and neurogenin have the potential to play important roles in the regulation of the schistosome life cycle. Based on their function in other organisms, they may be involved in the development of the nervous system as well as in the regulation of update of nutrients from host. Little is known about neuroD or neurogenin in helminths. Characterization of neuroD and neurogenin homologs in the helminth, S. mansoni, may provide us with an insight into developmental and neural pathways in parasitic worms.

2. MATERIALS AND METHODS

2.1 Identification and cloning of neuroD/neurogenin homolog

A genome wide search for ‘Transcription’ using the S.mansoni subsection of the

GeneDB database (www.genedb.org) was performed. Among the ninety six items displayed, the products of three genes (Smp_125400, Smp_072470 and

Smp_082290) were found to be bHLH transcription factors and similar to neurogenic differentiation factor and neurogenin. The protein and nucleotide sequence of

Smp_125400 was acquired using the above database. The protein sequence was used for a Basic Local Alignment Search Tool for proteins (BLASTp). Homology determination using the protein sequence of Smp_125400 was performed using

NCBI BLASTp (http://blast.ncbi.nlm.nih.gov) against the genomes of all organisms.

BLASTp analysis showed homology to neuroD and neurogenin genes across multiple organisms. Expected value (E-value) was used to statistically determine the probability of occurrence of this homology due to chance. The lower the E-value, the more significant the match is. Due to its high homology to other neuroD and neurogenin genes, Smp_125400 was selected for further experimental studies.

Using the Smp_125400 cDNA sequence as per the GeneDB database, gene specific forward (5’ – GAATTCCCGGGGATCCGTCGACCTATGAATTCAAAACTTCCAACTCAT - 3’) and reverse (5’ – TGCTAGTTATGCGGCCGCTTAAAATTGAGATTTATTCATCATTTGTAAAA

- 3’) primers were designed to be used in Reverse Transcriptase-Polymerase Chain

Reaction (RT-PCR). They were ordered from Integrated DNA Technologies, Coralville,

Iowa (IDT). As per the In-fusion Advantage Cloning Kit (Clontech, Mountainview, CA) protocol, both primers were designed to have a homology region to the yeast expression pGBKT7 vector (KanR, Trp) and contained restriction sites for Sal1 and

Not1, respectively. Reverse Transcriptase PCR (RT-PCR) to amplify Smp_125400 cDNA was carried out using S.mansoni mixed and 4 hour schistosomula mRNA and the above mentioned gene specific primers. Mixed mRNA consisted of mRNA from sporocyst, cercariae and adult stages of the life cycle. The SuperScript III One-Step

RT-PCR with Platinum Taq (Invitrogen, Carlsbad, CA) was carried out under the following conditions; cDNA synthesis at 45°C for 30 minutes, Initial denaturation at

94°C for 2 minutes, [Denaturation at 94°C for 30 seconds, Annealing at 49.5°C for 30 seconds, Extension at 68°C for 2 minutes] for 35 cycles, Final Extension at 68°C for 5 minutes. A 0.8% agarose gel stained with Ethidium Bromide was used to visualize the product bands. These bands were cut out and purified by following the Wizard SV

Gel and PCR Clean-Up system (Promega, Madison, WI) quick protocol. The pGBKT7 vector was digested using Sal1 and Not1 restriction enzymes and RT-PCR product was cloned in to it following the In-fusion Advantage Cloning Kit (Clontech,

Mountainview, CA) protocol. The resultant plasmid (pGBKT7-125400) was used to transform Chemically Competent One Shot TOP10 cells (Invitrogen, Carlsbad, CA) via the heat shock transformation method. Transformants were selected on Luria

Bertani media containing the antibiotic Kanamycin (LB+Kan). Single colonies were grown up in LB+Kan liquid media and plasmid DNA was purified using the Nucleospin

Plasmid Miniprep kit (Clontech, Mountainview, CA). Verification of the above plasmid DNA was carried out by restriction digestion analysis and DNA sequencing

(Elim Biopharm, Hayward, CA).

In order to determine if Smp_125400 is expressed at different stages of the S. mansoni life cycle, RT-PCR was performed using mRNA from sporocyst, cercariae, schistosomula and adults. Gene specific primers and reaction parameters were the same as for the above mentioned RT-PCR to amplify Smp_125400. Visualization of

DNA product via an agarose gel was performed, as above.

2.2 Sequencing of neuroD/neurogenin homolog

Plasmid DNA was sequenced at Elim Biopharm, Hayward, California, using T7 forward primer (5’ – TAATACGACTCACTATAGGG – 3’) specific to the pGBKT7 vector.

Reverse primer (5’ -

TGCTAGTTATGCGGCCGCTTAAAATTGAGATTTATTCATCATTTGTAAAA - 3’) specific to 3’ region of the Smp_125400 gene was used.

2.3 cDNA synthesis and Real-Time Polymerase Chain Reaction (Absolute qPCR)

Using the Smp_125400 transcript sequence, gene specific forward (5’ –

AGAAACCCTTAACAAAAGAACGTG - 3’) and reverse (5’ –

TGTTGAAAATGTTGGTATATGTCGT - 3’) primers were designed for Real

Time/quantitative Polymerase Chain Reaction (qPCR). They were ordered from

Integrated DNA Technologies, Coralville, IA (IDT) and designed to amplify a region of

137bp spanning exon 2 of Smp_125400. cDNA synthesis from 750ng mRNA of different stages; sporocyst, cercariae, schistosomulum (4 hour) and adult, was carried out by following the Superscript III Reverse Transcriptase (Invitrogen,

Carlsbad, CA) First-Strand cDNA Synthesis protocol. The qPCR reaction was carried out using above gene specific primers and the SYBR Green mix (Applied Biosystems,

Carlsbad, CA) under the following conditions; Holding stage at 95°C for 10 minutes,

Cycling stage [95°C for 15 seconds, 60°C for 1 minute] for 40 cycles, Melt curve stage

[95°C for 15 seconds, 60°C for 1 minute] for 1 cycle. Reactions were carried out in triplicate for each stage and an endogenous gene, Cyclophilin, was used as a reference gene. 2ul of cDNA was used per test reaction while negative controls contained 2ul double distilled water. The StepOnePlus Real-Time PCR System with

StepOne version 2.0 software (Applied Biosystems, Carlsbad, CA) was used to process reactions and analyze results via the comparative CT method.

2.4 Yeast One Hybrid system to test for transcriptional activation

The Yeast strain AH109 (genotype MATa, trp1-901, leu2-3, 112, ura3-52, his3-200, gal4∆, gal80∆, LYS2::GAL1UAS-GAL1TATA-HIS3, GAL2UASGAL2TATA-ADE2,URA3::MEL1UAS-

MEL1TATA-LacZ, MEL1) (Clontech, Mountainview, CA) [46] and pGBKT7 (Clontech,

Mountainview, CA), a yeast expression plasmid, were used to test for transcriptional activation activity of the Smp_125400 gene. pGBKT7-125400 plasmid was cloned in to AH109 by the No Fault Yeast Transformation protocol. Transformants were selected on a synthetic minimal medium (SD) that lacked the amino acid, Tryptophan

(SD-Trp). The Yeast strain AH109 contains the Galactose4 (GAL4) promoter upstream of four reporter genes; HIS3, ADE2, LacZ and MEL1. A modified Yeast One Hybrid

16 system was set up where the fusion protein of pGBKT7-125400 binds to the GAL4 promoter. In this fusion protein, the GAL4 DNA Binding Domain serves as the DNA binding domain while the Smp_125400 serves as the activating domain.

Negative control consisted of yeast strain AH109 transformed with pGBKT7 and thus contained only the GAL4 DNA binding domain. Positive control consisted of yeast strain AH109 transformed with pEJ780 vector that was designed to contain the full

GAL4 transcript. If test samples were able to induce expression of the reporter genes downstream of the GAL4 promoter, they were marked positive. If they were unable to induce reporter gene expression, they were marked negative for transcriptional activation activity.

ADE2 and HIS3 are nutritional markers and expression of these reporter genes was determined by growth on synthetic minimal media lacking the amino acid Adenine

(SD-Ade) and Histidine (SD-His), respectively. LacZ reporter gene expression was determined by the β-galactosidase assay and development of blue color was indicated positive. Similarly, the α-galactosidase assay was utilized for determining expression of the MEL1 reporter gene and development of blue color was termed as positive.

Spot test to determine extent of growth was carried out. Test samples (yeast AH109 transformed with pGBKT7-125400 plasmid), positive and negative controls were grown up to log phase then diluted to equal cell counts measured at optical density of 600nm (O.D.600) in synthetic minimal liquid media lacking Tryptophan (SD-Trp).

These cells were serial diluted by a factor of 10 up to 1: 104 and incubated at 30°C on

SD-Ade and SD-His plates for 72 hours. Growth of single colonies on our test samples were compared to the control reactions.

2.5 Protein expression, purification and quantification cDNA sequence of Smp_125400 was used to design gene specific primers that also had a homology region to the pMALc5x protein expression vector (New England

Biolabs, Ipswitch, MA). These primers were designed following the In-Fusion

Advantage Cloning Kit (Clontech, Mountainview, CA) protocol and were ordered from Integrated DNA Technologies, Coralville, Iowa (IDT). Forward primer (5’ –

TCACATATGTCCATGGGCGGCCGCATGAATTCAAAACTTCCAACTCATCAT – 3’) and reverse primer (5’ –

AGGGAATTCGGATCCGTCGACTTAAAATTGAGATTTATTCATCATTTGTAAAAATGT – 3’) contained a Not1 and Sal1 restriction site, respectively. These primers were used to amplify Smp_125400 from pGBKT7-125400 plasmid DNA by PCR using Phusion High-

Fidelity DNA Polymerase (Finnzymes). The PCR was carried out under the following conditions; Initial denaturation at 98°C for 30 seconds, [Denaturation at 98°C for 8 seconds, Annealing at 68°C for 30 seconds, Extension at 72°C for 12 seconds] for 35 cycles, Final extension at 72°C for 5 minutes. A 0.8% agarose gel stained with

Ethidium Bromide was used to visualize the product DNA bands. These bands were cut out and purified by following the Wizard SV Gel and PCR Clean-Up system

(Promega) quick protocol. The pMALc5x vector was digested using Sal1 and Not1 restriction enzymes and PCR product was cloned in to it following the In-fusion

Advantage Cloning Kit (Clontech, Mountainview, CA) protocol. The resultant plasmid

(pMALc5x-125400) was used to transform Chemically Competent One Shot TOP10

18 cells (Invitrogen, Carlsbad, CA) via the heat shock transformation method.

Transformants were selected on Luria Bertani media containing the antibiotic

Carbenicillin (LB+Carb). Single colonies were grown up in similar liquid media and plasmid DNA was purified using the Nucleospin Plasmid Miniprep kit (Clontech,

Mountainview, CA). Verification of the above plasmid DNA was carried out by restriction digestion analysis and DNA sequencing (Elim Biopharm, Hayward, CA).

Protein expression was carried out using Chemically Competent One Shot BL21 pLysS

(Invitrogen, Carlsbad, CA). These cells were transformed with the above plasmid DNA via the heat shock transformation method. Transformants were selected on Luria

Bertani media containing Carbenicillin (LB+Carb). A single colony was picked and used to inoculate 5ml of LB+Carb liquid media. This liquid culture was used to run a pilot protein expression test as per the pMAL Protein Fusion and Purification System

Instruction Manual (New England Biolabs, Ipswitch, MA) protocol. Protein expression was induced by addition of Isopropyl β-D-1-thiogalactopyranoside (IPTG). Optimum protein expression, based on the pilot protein expression, was found to be upon induction with a final concentration of 0.4mM IPTG and incubated overnight (10 hours) at 20°C in the incubator shaker. Cells were grown up to an O.D.600 of 0.6 prior to induction. A 100ml liquid culture (containing 0.2% dextrose and 60µg/ml

Carbenicillin) was harvested following the above conditions. Cells were pelleted and resuspended in 2.5ml of column buffer prior to being lysed by the freeze-thaw method followed by sonication. The crude extract was purified by running it through an Amylose High Flow Resin column (New England Biolabs, Ipswitch, MA). The eluted purified fusion protein consisted of Maltose Binding Protein (MBP)-Smp_125400.

This fusion protein was visualized on a 4-12% Novex Bis-Tris Polyacrylamide gel

(Invitrogen, Carlsbad, CA) using SimplyBlue Safe Stain (Invitrogen, Carlsbad, CA). The pure fractions were stored in Phusion storage buffer after running through a 30K

MW Amicon Ultra-4 Centrifugal Filter Device (Millipore). A standard protein concentration curve using Bovine Serum Albumin (BSA) was generated on a

NanoDrop 8000 (Thermo Scientific, Waltham, MA). Quantification of the fusion protein concentration was carried out by following the Bradford Protein Assay

(Thermo Scientific, Waltham, MA) protocol.

2.6 Electrophoretic Mobility Shift Assay to test DNA-Protein Binding

Primers to be used in the Electrophoretic Mobility Shift Assay (EMSA) were designed using the S.mansoni homolog of Xenopus laevis Early B-cell factor 3 (Ebf3). Ebf3 was found to be a downstream target of both neuroD and neurogenin in X. laevis. The

S.mansoni homolog, Smp_194670, was determined by performing an NCBI BLASTp against the S. mansoni genome using the protein sequence of X. laevis Ebf3.

Smp_194670 promoter region has one variation (CAAATG) of the E box sequence

(CANNTG) 250bp upstream of the transcription start site. Forward primer oST016 (5’

– CAATTATCTTCAAATGAAATCTGATC – 3’) and reverse complimentary primer oST017

(5’ – GATCAGATTTCATTTGAAGATAATTG - 3’) were designed to include the CAAATG E box sequence and 10bp homology to the promoter on each side of the E box.

Subsequent primers were designed to include other variations of the E box sequence while maintaining the 20bp (10bp on each side of E box) homology to the promoter region. Forward primer oST019 (5’ – CAATTATCTTCAGCTGAAATCTGATC – 3’) and reverse complimentary primer oST020 (5’ – GATCAGATTTCAGCTGAAGATAATTG – 3’)

20 were designed for the E box sequence CAGCTG while forward primer oST022 (5’ –

CAATTATCTTCAGATGAAATCTGATC – 3’) and reverse complimentary primer oST023

(5’ – GATCAGATTTCATCTGAAGATAATTG - 3’) were designed for the E box sequence

CAGATG. A set of forward primers containing CAAATG, CAGCTG and CAGATG E box sequences (oST015, oST018 and oST021, respectively) were designed that were

Biotin labeled at the 5’ end. All the above primers were ordered from Integrated

DNA Technologies, Coralville, Iowa (IDT). Equimolar amounts of forward and reverse primers (for each set of E box sequences) were annealed using a Multigene Thermal

Cycler (Labnet Technologies, Inc.) under the following conditions; 99°C for 2 minutes, cool by 1°C per minute up to 25°C and stored at 4°C. The double stranded oligos that contained the Biotin labeled forward primer, were termed as ‘hot’ while those containing the unlabeled forward primer, were termed as ‘cold’.

Electrophoretic Mobility Shift Assay was performed using the LightShift

Chemiluminescent EMSA Kit (Thermo Scientific, Waltham, MA). DNA-Protein binding of experimental samples was carried out in sets of three reactions as per the manufacturer’s protocol. Minimal reaction components; 1X Binding buffer, 50ng/µl

Poly (dI.dC) non specific inhibitor DNA, 20pmol unlabeled ‘cold’ double stranded

DNA (where applicable), 200fmol labeled ‘hot’ double stranded DNA and MBP-

125400 fusion protein extract, were used since specific binding conditions were unknown. Control reactions were also carried out in sets of three and components;

1X Binding buffer, 2.5% glycerol, 5mM MgCl2, 50ng/µl Poly (dI.dC) non specific inhibitor DNA, 0.05% NP-40, 4pmol unlabeled ‘cold’ double stranded DNA (where applicable), 20fmol labeled ‘hot’ double stranded DNA and protein extract were as

21 per the manufacturer’s protocol. Binding reactions were incubated at room temperature for 20 minutes, mixed with 5x loading buffer and loaded on a pre run

5% Polyacrylamide gel. This gel was run in 0.5X Tris-Borate-EDTA (TBE) buffer for 70 minutes at 150V. DNA was transferred to a 0.45µm Biodyne Precut Nylon Membrane

(Thermo Scientific, Waltham, MA) at 380mA for 60 minutes via a standard tank transfer apparatus. Transferred DNA was cross linked to the membrane at

120mJ/cm3 using the auto crosslink function on the CL-1000 Ultraviolet Cross linker

(UVP, Upland, CA). The membrane was developed by following the LightShift

Chemiluminescent EMSA Kit (Thermo Scientific, Waltham, MA) protocol and the

Biotin labeled DNA was viewed after exposing to a Charged Coupled Device (CCD) camera for 4 minutes.

2.7 Cloning, protein expression, protein purification and EMSA of Smp_125400 DNA

Binding Domain

The bHLH region of the transcription factor, Smp_125400, is responsible for its DNA binding property. The mouse neuroD1 has a DNA Binding Domain (DBD) of 66 amino acids. Based on this, the DBD of Smp_125400 was determined to be 198bp (66 amino acids) in length. Gene specific forward (5’ -

CACCATCACCATCACGGATCCAATCGTCGTATCCGTGCAAATGCT- 3’) and reverse (5’ –

TAAGCTTGGCTGCAGGTCGACTAATGGTGTAGGAGTTTTATTCATTAATAATAATTCGGA -

3’) primers were designed to be used in PCR. They were ordered from Integrated

DNA Technologies, Coralville, Iowa (IDT). As per the In-fusion Advantage Cloning Kit

(Clontech, Mountainview, CA) protocol, both primers were designed to have a homology region to the pQE30 protein expression vector (contains 6x His tag

22 sequence) and restriction sites for BamH1 and Sal1, respectively. Phusion High-

Fidelity DNA Polymerase (Finnzymes) was used to amplify the DBD from the

Smp_125400 plasmid DNA by PCR. The reaction conditions and DNA purification technique were similar to those mentioned above for Smp_125400 full transcript amplification. The pQE30 vector was digested using BamH1 and Sal1 restriction enzymes and above PCR product was cloned in to it following the In-fusion HD

Cloning Kit (Clontech, Mountainview, CA) protocol. The resultant plasmid (pQE30-

125400DBD) was used to transform Chemically Competent One Shot TOP10 cells

(Invitrogen, Carlsbad, CA) via the heat shock transformation method. Transformants were selected on LB+Carb media. Single colonies were grown up in similar liquid media and plasmid DNA was purified using the Nucleospin Plasmid Miniprep kit

(Clontech, Mountainview, CA). Verification of the above plasmid DNA was carried out by restriction digestion analysis.

Protein expression was carried out using Chemically Competent M15 cells (Qiagen,

Germantown, MD). These cells were transformed with the above plasmid DNA via the heat shock transformation method. Transformants were selected on

LB+Carb+Kan media. A single colony was picked and used to inoculate 5ml of

LB+Carb+Kan liquid media. This liquid culture was used to run a pilot protein expression test as afore mentioned during full Smp_125400 protein expression.

Optimum protein expression was found to be upon induction with a final concentration of 1.0mM IPTG and incubated for 4 hours at 37°C in the incubator shaker. Cells were grown up to an O.D.600 of 0.6 prior to induction. A 50ml

LB+Carb+Kan liquid culture was harvested following the above conditions. The

23 expressed DBD protein has a 6xHis tag at the 5’ end. The crude extract was purified under native conditions by running it through a Ni-NTA spin column as per the kit protocol (Qiagen, Germantown, MD). The eluted purified protein was visualized on a

15% Tris glycine SDS Page gel using SimplyBlue Safe Stain (Invitrogen, Carlsbad, CA).

Quantification of the DBD protein concentration was carried out by following the

Bradford Protein Assay (Thermo Scientific, Waltham, MA) protocol.

EMSA was performed to test binding of Smp_125400 DBD to the oligos that were designed for MBP-125400 fusion protein EMSA. Experimental conditions and reactions were as mentioned earlier while testing DNA binding capability of the full

Smp_125400 transcript. The nylon membrane was developed by following the

LightShift Chemiluminescent EMSA Kit (Thermo Scientific, Waltham, MA) protocol.

The membrane was placed in a film cassette and the Biotin labeled DNA was viewed on an X-ray film after exposure for 3 minutes.

3. RESULTS

Using the S. mansoni subsection of the GeneDB database, the products of three S. mansoni genes, Smp_125400 (NCBI gene ID 8352300), Smp_072470 (NCBI gene ID

8352127) and Smp_082290 (NCBI gene ID 8352996), were identified as bHLH transcription factors related to neurogenic differentiation factor and neurogenin. As per the S. mansoni subsection of the GeneDB database, Smp_072470 contains two exons, Smp_125400 contains three exons while Smp_082290 contains two exons.

Smp_072470 and Smp_125400 are located on chromosome 1 while Smp_082290 is located on chromosome 6 in S.mansoni.

BLASTp of Smp_125400 against the genomes of different organisms revealed homology to bHLH neurogenic differentiation factors and neurogenin [Figure 2]. This homology was seen in the HLH domain, which was conserved across species [Figure

3b]. BLASTp of Smp_125400 against the human genome revealed homology, at the

HLH domain, to neuroD1, neuroD2, neuroD4, neuroD6, neurogenin1, neuogenin2 and neurogenin3 [Figure 3a].

We were able to clone Smp_125400 from mixed (cercariae, sporocysts and adults) and 4 hour schistosomulum mRNA and Smp_082290 from mixed mRNA. However,

Smp_072470 could not be cloned using our designed primers. Smp_125400 was larger than predicted in the schistosome database and sequencing of Smp_125400 revealed a new splice variant of the gene [Figure 5a]. This splice form was longer in length, at 1287 base pairs, when compared to the 792 base pairs sequence as per the S. mansoni subsection of the GeneDB data base. This new sequence consists of two exons as compared to the three as per the data base. The extra 495bp encompass the second intron of the gene which in our sequence belongs to the functional full transcript. Since Smp_125400 was cloned from both mixed as well as 4 hour schistosomulum mRNA, it was used for all our further experiments.

To test when Smp_125400 is expressed during the schistosome life cycle, we performed Reverse Transcriptase PCR. We found that Smp_125400 expression was highly represented during the sporocyst and schistosomulum (4 hour) stages of the

S. mansoni life cycle [Figure 4]. We were unable to clone Smp_125400 from cercariae and adult mRNA and hence lack of gene expression during these stages could not be confirmed based solely on RT-PCR analysis. To address this

25 quantitatively, we analyzed Smp_125400 transcript levels by qPCR using cDNA from different stages: sporocyst, cercariae, 4 hour schistosomulum and adult [Figure 6].

The replicates were manually screened and those with bad passive reference signals were omitted prior to analysis. The comparative CT method was utilized to compare the Ct values of Smp_125400 gene expression to that of our endogenous reference gene, Cyclophilin. The formula used for this comparison is 2-ΔΔCt where ΔΔCt =

ΔCttarget – ΔCtreference. Our analysis showed that Smp_125400 expression, when compared to the sporocyst stage (expression set at 1 and used as an internal reference) of the life cycle, is more highly represented in cercariae and 4 hour schistosomulum stages by 19.15 and 6.02 fold, respectively. Smp_125400 expression is less represented during the adult stage, when compared to expression during sporocyst, and is at 0.27 fold. Results were analyzed and graphed based on the experimental data from the StepOne version 2.0 software (Applied Biosystems,

Carlsbad, CA). NeuroD1 has been shown to be involved in photoreceptor cell development in the mammalian retina. S. mansoni has photoreceptor cells surrounding its eye spots. These photoreceptors are used by the free swimming cercariae to swim towards the human definitive host and this explains up regulation during the cercarial stage. However, the photoreceptors must be fully developed before the cercariae exit the snail which might explain expression of Smp_125400 during the sporocyst stage. Once the cercariae penetrate the human skin, they shed their tail and become schistosomula that eventually grow in to the adult worm.

During the schistosomulum stage, the parasite utilizes host nutrients for its growth and survival. The development of the adult nervous system also takes place during this stage which could explain the up regulation of a neuroD homolog at this stage.

NeuroD and neurogenin are also involved in maintenance of the nervous system and this could explain expression, although much lower when compared to other stages, of Smp_125400 in the adult stage.

A modified Yeast-one-hybrid system was utilized to test whether Smp_125400 can activate transcription. Four reporter genes; LacZ, MEL1, HIS3 and ADE2, that were located downstream of the Gal4 promoter of Yeast strain AH109 were assayed for this purpose. LacZ gene was activated by Smp_125400 and this was determined by the β-galactosidase assay as presence of blue color in our test samples was comparable to the positive control. The α-galactosidase assay determined activation of the MEL1 gene. Here we demonstrated that Smp_125400 is capable of transcriptional activation due to the presence of blue color in our test samples that was comparable to the positive control. In both LacZ and MEL1 assays, the negative control remained white showing that it does not activate transcription. The HIS3 reporter gene also demonstrated expression as growth of single colonies on SD-His plates was comparable to the positive control. Growth of single colonies was also observed on SD-Ade plates and this determined expression of the ADE2 reporter gene. The negative control in both HIS3 and ADE2 assays did not show any growth.

Based on the above expression patterns of the reporter genes, we show that

Smp_125400 is capable of activating transcription.

Spot tests using serial dilutions of test and control samples were carried out as an extension of the HIS3 and ADE2 reporter assays. The GAL4 full protein is a strong transcriptional activator in the yeast system [42] and thus this spot test serves as a semi-quantitative assay for transcriptional activation. Extent of growth of single

27 colonies on the serial dilutions is an indication of strength as increased copy number of reporter genes would increase growth ability. Growth of the test samples was comparable to the positive control and single colonies were observed up to 1:104 dilutions and 1:105 dilutions on SD-His and SD-Ade plates, respectively. The negative control contains only the GAL4 DBD and is not capable of transcription activation and hence showed no growth on SD-His and SD-Ade plates, as expected. The sizes of the single colonies of the test sample were smaller than the positive control suggesting that Smp_125400 is a weaker transcriptional activator than the GAL4 protein.

The protein sequence of the new Smp_125400 splice form was predicted to be 428 amino acids according to the translate tool software on the ExPASy bioinformatics resource portal (operated by the Swiss Institute of Bioinformatics) [Figure 5b].

Molecular weight was predicted to be 48.9KDa by utilizing the protein parameters prediction tool, ProtParam, on the ExPASy bioinformatics resource portal.

In order to test whether Smp_125400 is capable of binding to E box consensus sequences, Electrophoretic Mobility Shift Assay was carried out. For this purpose,

Smp_125400 protein was expressed using a protein expression vector pMALc5x. This vector encodes for Maltose Binding Protein (MBP) and hence a fusion protein of

MBP-125400 was expressed upon induction with IPTG. The molecular weight of

Maltose Binding Protein is 42.5KDa. Fusion protein of MBP-125400 was purified by running the crude extract through an Amylose High Flow Resin column. The size of this fusion protein was as per our estimations at approximately 92KDa and was viewed on a 4-12% Novex Bis-Tris Polyacrylamide gel.

The above fusion protein of MBP-125400 was used to test for DNA binding ability using an Electrophoretic Mobility Shift Assay (EMSA) [Figure 10a]. All test and control reactions were carried out in sets of three. The purpose of these three reactions was to establish the position of unshifted DNA, shifted DNA and unshifted

DNA due to competitive binding by Poly (dI.dC) non specific inhibitor DNA. The EMSA data produces 3 bands. The single stranded biotin labeled oligos travel furthest on the gel and form the lowest band, which is consistent across all the samples. A middle band corresponds to double stranded biotin labeled DNA. An upper band corresponds to double stranded biotin labeled DNA that has shifted due to protein binding. If a shift occurs, there will be a slight reduction in intensity of the middle band as some of the DNA has shifted to form the upper band upon protein binding.

Results of EMSA showed that the MBP-125400 fusion protein failed to induce a shift in the double stranded DNA oligos containing the E box sequence. Control reactions to test the ability of MBP only to bind the E box sequences, returned negative (not shown). A possible explanation for this lack of a shift could be due to the inability of the fusion protein to bind to the double stranded DNA oligos. Previous studies to determine neuroD1 binding ability to E box sequences of other organisms have been carried out using a fusion protein of neuroD1 and E47. E47 is a ubiquitous class 1 basic-helix-loop-helix factor capable of forming a heterodimer with neuroD1 protein.

It has been hypothesized that neuroD1 requires interaction with E47 protein to facilitate DNA binding and thus initiate transcription [31]. If this hypothesis holds true in S. mansoni, it could explain why MBP-Smp_125400 failed to elicit a shift in the EMSA.

EMSA to test for DNA binding ability of Smp_125400 DBD alone was carried out following the experimental conditions used for the full transcript. However, all the three double stranded DNA oligos (containing CAGATG, CAGCTG and CAAATG E box sequence) were combined in to one tube and a single run of three reactions was performed. A set of control reactions were performed as per the LightShift

Chemiluminescent EMSA Kit (Thermo Scientific, Waltham, MA) directions.

Unfortunately, the Smp_125400 DBD also did not elicit a shift in the DNA oligos.

4. DISCUSSION

Neurogenin and neuroD belong to the basic helix-loop-helix family of transcriptional factors. They heterodimerize with ubiquitously expressed proteins such as E12 and

E47, to form complexes, that are capable of binding to consensus sequences in the promoter of their downstream targets. The consensus sequence, CANNTG, is identified as the E-box sequences. Neurogenin and neuroD function to regulate developmental pathways such as neurogenesis and they play a role in the differentiation of endocrine cells in the pancreas and intestine. NeuroD is a neuronal transcription factor that has been shown to influence endocrine cell development in the pancreas.

Our studies focused on characterizing Smp_125400, a putative transcription factor in

Schistosoma mansoni. Smp_125400 shares high homology with bHLH transcription factors neuroD and neurogenins of multiple organisms. We identified and characterized a new splice variant of Smp_125400. This splice variant had a coding sequence of 1287bp. The full transcript of this splice variant is 428 amino acids and molecular weight is predicted to be 48.9KDa. Temporal gene expression of

Smp_125400, via RT-PCR and qPCR analysis, revealed expression in sporocyst, cercariae, schistosomulum and adult stages of the S. mansoni. Increased representation of the gene, when referenced to the sporocyst stage, was seen in cercariae and schistosomulum while decreased representation was seen in adults.

Expression fold change was noted at 19.15, 6.02 and 0.27 in cercariae, schistosomulum and adults, respectively, when expression in sporocysts was set at

1.0. Sporocyst was used as an internal reference as we were able to clone

Smp_125400 from sporocyst mRNA via RT-PCR and thus were able to show expression of this gene during this stage. Another advantage of using sporocyst as a reference to measure expression fold change of Smp_125400 was that it preceeds the cercariae, schistosomulum and adult stages during the natural course of development of S. mansoni. S. mansoni have photoreceptor cells surrounding its eye spots. These photoreceptors are used by the free swimming cercariae to swim towards the human definitive host and this explains up regulation during the cercarial stage. These photoreceptors, however, need to be fully developed before the cercariae exit the snail and this explains expression during the sporocyst stage.

Once the cercariae penetrate the human skin, they shed their tail and become schistosomula that eventually grow in to the adult worm. During the schistosomulum stage, the parasite utilizes host nutrients for its growth and survival.

The development of the adult nervous system also takes place during the schistosomulum stage and put together explains the up regulation of a neuroD homolog at this stage. NeuroD and neurogenin are also involved in maintenance of the nervous system and this explains expression of Smp_125400 in the adult stage.

Using a modified Yeast One Hybrid system, we demonstrated that Smp_125400 is capable of activating transcription of downstream reporter genes. However, we also showed that the transcriptional activation ability of Smp_125400 was not as strong as that of a full GAL4 transcript.

NeuroD and neurogenins are a well studied group of transcriptional activators that interact with a variety of proteins to induce gene expression. Proteins such as E47 heterodimerize with neuroD and this functional complex induces transcription by binding to the E-box in the promoter of target genes. In an effort to characterize the downstream targets of this S.mansoni neuroD and neurogenin protein, downstream target genes of Xenopus neuroD and neurogenin homologs were noted. BLASTp analysis against the S. mansoni genome was carried out to identify homologs of these target genes. Early B-cell factor 3 (Ebf3) is a downstream target of both neuroD and neurogenin in Xenopus. BLASTp analysis against the S.mansoni genome, identified Smp_194670 as a homolog to Xenopus Ebf3. Electromobility Shift Assay to test DNA binding ability of the Smp_125400 full transcript was carried out. Double stranded DNA oligos containing consensus E-box sequences were designed. The three E-box sequences (CAAATG, CAGCTG, and CAGATG) were selected as they were present in abundance in studied target loci of Xenopus neuroD and neurogenin.

These E-box sequences were also present in the promoter region of S. mansoni homolog of Ebf3, Smp_194670. EMSA performed with full length Smp_125400 failed to elicit a shift in any of the DNA oligos tested. The Smp_125400 DBD was cloned and this protein was used in an EMSA along with the above mentioned DNA oligos.

Unfortunately, the DBD alone also failed to elicit a shift. A possible explanation for this is the absence of an E47/E12 ubiquitously expressed protein, its

32 heterodimerizing partner. This heterodimer is known to bind strongly to the E box sequence and neuroD1 alone is unable to form the DNA contact to the E-box [28]

[31]. Proper orientation of the neuroD-E47 heterodimer is important for recruiting other transcriptional factors, in order to form an active preinitiation complex [31].

Future studies will be aimed at performing an EMSA in the presence of this protein or its S. mansoni homolog. Since only three of the possible sixteen E-box consensus sequences were tested, another explanation could be that Smp_125400 binds to a sequence that was not tested for in our study.

The nervous system of S. mansoni is well organized and consists of several nerve cords that connect the entire body of the parasite [39]. The tegument and oral sucker contain sensory nerve endings that aid in the motility of the parasite. Upon exiting the snail host, cercariae need to adapt quickly to their environment as they have 24 hours to find and infect a human host. Eyespots are present in the two free swimming stages; cercariae and miracidea [2] [39]. These eyespots are surrounded by pigment cells and photoreceptors that aid cercariae in finding their host, by enabling them to differentiate between light and dark. Thus, targeting the S. mansoni neuroD and neurogenin homolog, with the aim of reducing its ability to find a host, could prevent the worm from completion of its life cycle. Disruption of the function of neuroD and neurogenin in S. mansoni could also prevent the development and maintenance of the adult worm nervous system.

Mammalian neuroD is capable of activating insulin gene expression. Schistosoma mansoni do not produce their own insulin but have been shown to express insulin like receptors. It has been suggested that these parasites employ their insulin receptors to utilize the host insulin for their own growth and development [44].

Armed with this knowledge, attractive therapeutic targets therefore could be either to block these insulin receptors or to inhibit tyrosine kinases that function downstream of these receptors. Since mammalian neuroD functions to increase insulin production, one could speculate that S. mansoni, via Smp_125400, can increases host insulin production. This insulin, upon binding to the insulin like receptors in S. mansoni, could promote growth and proliferation of the parasite. If this is true, a therapeutic intervention could aim to block host insulin production via neuroD repressors or antagonists.

This study has enabled the identification of Smp_125400 as a neuroD and neurogenin homolog in S. mansoni. We showed its expression varies in the sporocyst, cercariae, schistosomulum and adult stages of the life cycle. High representation of this gene upon penetration of the human host, leads us to believe that it plays an important role in development in to the adult worm upon infection.

Delineating the function of neuroD and neurogenin transcription factors may be important to further understanding the basic biology of schistosome development.

Due to its implications in human disease, one hopes that answering the above questions will result in practical and efficient therapeutic strategies towards control of Schistosomiasis.

5. FIGURES

Figure 1: Lifecycle of Schistosoma mansoni

A schematic representation of the S. mansoni lifecycle.

(a) Cercariae, infect the human host by penetrating through the skin. Upon infection, they shed their tail and transform into schistosumula. (b) Schistosomula migrate to the liver via the lungs and develop into adult worms. (c) Mature adult worms pair and females produce eggs. (d) Eggs are excreted into fresh water through the feces. Upon contact with fresh water, the eggs hatch into free swimming miracidia. (e) Miracidia infect the snail intermediate host. Inside the snail, miracidia transform in to mother and daughter sporocysts. (f) Daughter sporocysts produce cercariae, the larval form capable of infecting humans.

Figure 2: BLASTp search using Smp_125400 full transcript

Using NCBI, BLASTp was carried out for Smp_125400 protein sequence. Homology to the HLH region of neuroD and neurogenin was consistent among multiple organisms.

Figure 3: Multiple sequence alignment of HLH domain of Smp_125400 a) With human neurogenic differentiation factors and neurogenins

b) With HLH domain of multiple organisms

Figure 4: Expression of Smp_125400 during different stages of S.mansoni life cycle via RT-PCR

RT-PCR using S. mansoni mRNA from different stages of the life cycle. Smp_125400 specific primers were used to amplify the gene. RT-PCR products were run on a 0.8% Agarose gel. cDNA levels vary during the life cycle and is higher in schistosomula (4 hour) and sporocyst stages. The size of Smp_125400 is ~1200bp, larger than the expected 792bp described in the S.mansoni subsection of the GeneDB database [www.genedb.org].

Figure 5: Smp_125400 splice variant a) Nucleotide sequence (full transcript)

ATGAATTCAAAACTTCCAACTCATCATGAAGTTAATAATGATGGTAATATTATGAATCCCATTGATATCCATGAG GATAGTGTAAATAAATGTAATCAAAGTTCAAACATTGTTCATTCTAGTATCAATAATACAACTGGGAAGAAAAC AAAGAGCTCTGTTAAAACTGCTAAACAATCCACTACTGTCCAGAACAAAATGAAAAACTCAACAATATCTAAAA ATCAATTAATCAATAAAGAAATCAATGAAAATATTGATTCACTAAATACCATAGAAACAAAAAATCATTTAAACC ATCCTTTTCCTTATGATTCCCCATTAACACCAGTTAAACAACCTAAAAAACGTGGACCTAAAAAGAAACCCTTAA CAAAAGAACGTGAAACACGTTTAAAAAATCGTCGTATCCGTGCAAATGCTCGTGAACGTAGTCGTATGCATGGA TTAAATCATGCATTAGAATTACTACGACGACATATACCAACATTTTCAACAACTCAACGTTTAAGTAAAATAGAA ACATTACGTTTAGCTAAAAATTATATTAAAACATTATCCGAATTATTATTAATGAATAAAACTCCTACACCATTAG AGATGGCTATCAATTTAACTGAAGGTCTTTCACAGAATACATCAAATTTAATAGCAAATACATTACAAATTAATC CTAGAATATTAATTCAATTACAACGTCAACAACAATCGTCTTCATTCCTTCAACATCATCATGAACAACAACAACA ACATCAGCAACAACAACAATCAATCAATGAATCAAGTAATCATGATCAATCAGATCATAATCAATCATTATCTTC ATCATCGTCATCATCGTCATCATCTTTATCAGACGAGTTAAAATGTCCAGTTGTTACATCAAATGAACAAATGAA ATTATTTAGTCCTACTGATATTGCTACTTATAATAATAAAAGTAGTACAAATTGTTATGATAAAATATTACAACCT ACCTTATTGAATCACCAAAATTCACTCATTCCACATTCATGCAATATAGATTTCAATCCTGTTTTAATGAATTTTCA AAATTATAACAGTAATAGTTCATTATTAAATCCATCAACAATCTTTTATCCAAATTCTATTACAGATTGGAATCAA TCTAATTTGTTAATTTCACCAATCACTTCATATCATTCTGATAATGTACATGATAAAAATAATAATCCATCTATGC ATAATACTAATGTTAATATAAATGAAAATATTCATAATTATGAACAGACATTTTTACAAATGATGAATAAATCTC AATTTTAA Sequence of the 1287 base pair RT-PCR product of Smp_125400.

b) Protein sequence

M N S K L P T H H E V N N D G N I M N P I D I H E D S V N K C N Q S S N I V H S S I N N T T G K K T K S S V K T A K Q S T T V Q N K M K N S T I S K N Q L I N K E I N E N I D S L N T I E T K N H L N H P F P Y D S P L T P V K Q P K K R G P K K K P L T K E R E T R L K N R R I R A N A R E R S R M H G L N H A L E L L R R H I P T F S T T Q R L S K I E T L R L A K N Y I K T L S E L L L M N K T P T P L E M A I N L T E G L S Q N T S N L I A N T L Q I N P R I L I Q L Q R Q Q Q S S S F L Q H H H E Q Q Q Q H Q Q Q Q Q S I N E S S N H D Q S D H N Q S L S S S S S S S S S S L S D E L K C P V V T S N E Q M K L F S P T D I A T Y N N K S S T N C Y D K I L Q P T L L N H Q N S L I P H S C N I D F N P V L M N F Q N Y N S N S S L L N P S T I F Y P N S I T D W N Q S N L L I S P I T S Y H S D N V H D K N N N P S M H N T N V N I N E N I H N Y E Q T F L Q M M N K S Q F Stop

The protein sequence of the new Smp_125400 splice form was predicted by utilizing the translate tool software on the ExPASy bioinformatics resource portal (operated by the Swiss Institute of Bioinformatics). It is 428 amino acids. The underlined section is the HLH region that contains the DNA binding domain.

Figure 6: Expression of Smp_125400 during different stages of S.mansoni life cycle via qPCR

Relative expression of Smp_125400 by Comparative qPCR

5 Relative expression Relative level

0 Sporocyst Cercariae Schistosomulum Adult Developmental stages

The comparative CT method was used to determine expression of Smp_125400 during different stages of the S. mansoni life cycle. Endogenous gene, Cyclophilin, was used as a control. The formula used to calculate fold change is 2-ΔΔCt where ΔΔCt is ΔCttarget – ΔCtreference. Expression fold change at different stages of life cycle was compared to sporocyst (expression set at 1.0) as an internal reference. Smp_125400 is up regulated in cercariae and schistosomulum (4 hour) by 19.15 and 6.02 fold, respectively. Expression of Smp_125400 in adult stage was 0.27 fold when compared to that of sporocyst.

Figure 7: Modified Yeast-One-Hybrid system to test whether Smp_125400 can activate transcription

A modified yeast-one-hybrid system was used to test whether Smp_125400 could function as a transcriptional activator. The DNA binding domain (DBD) of GAL4 protein was N-terminally fused to Smp_125400, which acts as the activating domain (AD), to form a fusion protein. This fusion protein binds to the upstream activation sequence (UAS), of the GAL4 promoter, and its ability to induce expression of downstream reporter genes (MEL1, ADE2, HIS3 and LacZ) was tested. If Smp_125400 is a transcriptional activator, downstream reporter gene expression occurs. However, if Smp_125400 is unable to activate transcription, expression of downstream reporter gene is absent.

The negative control is the GAL4 DBD only, whereas the positive control is the full GAL4 protein.

Figure 8: Results of modified Yeast-One-Hybrid system reporter assays

For all reporter assays, the positive control (+ve control) is the full GAL4 protein (pEJ780) whereas negative control (-ve control) is the GAL4 DBD only (pGBKT7). a) MEL1 Mel1 gene expression is determined by the α-galactosidase assay on SD-Trp plates. The positive control turns blue while negative control remains white. Smp_125400 test assay can be compared to the positive control.

b) ADE2 Ade2 gene expression is determined by growth of single colonies on SD-Ade plates. Smp_125400 test assay can be compared to the positive control.

42 c) HIS3 His3 gene expression is determined by growth of single colonies on SD-His plates. Smp_125400 test assay can be compared to the positive control.

Figure 9: Growth assay to test for Smp_125400 reporter activity by Spot Test a) SD-His

b) SD-Ade

Positive control consists of full GAL4 transcript (pEJ780) while negative control consists of the DBD only (pGBKT7). Serial dilutions of test and control samples were made and growth of single colonies was tested on (a) SD-His and (b) SD-Ade plates. Smp_125400 was comparable to the positive sample in terms of growth of single colonies at various dilutions. However, the size of the colonies was smaller when compared to the positive control.

Figure 10: Electrophoretic Mobility Shift Assay to test for DNA binding ability of a) Smp_125400 full transcript

Double stranded labeled (Hot) DNA oligos with consensus E box sequence were designed and MBP-125400 fusion protein was used to determine binding ability of Smp_125400. Double stranded unlabeled (Cold) DNA oligos with consensus E box sequence compete for binding against the labeled oligos. Purified MBP protein alone does not bind the double stranded DNA oligos (not shown). Lane 1-3: Testing binding to E box sequence CAGATG. Lane 4-6: Testing binding to E box sequence CAGCTG. Lane 7-9: Testing binding to E box sequence CAAATG. Lane 10-12: Controls as per manufacturer’s kit.

45 b) Smp_125400 DNA Binding Domain protein

Double stranded ‘Hot’ DNA oligos with consensus E box sequence were designed and purified Smp_125400 DBD protein was used to determine DNA binding ability of Smp_125400 DBD. Double stranded unlabeled (Cold) DNA oligos with consensus E box sequence compete for binding against the labeled oligos. Lane 1-3: Controls as per manufacturer’s kit. Lane 4-6: Experimental reactions to test for binding to E box CAGCTG, CAGATG and CAAATG (performed in a single reaction).

Figure 11: Orthogonal type of nervous system in S. mansoni

Generalized schematic representation of the orthogonal type of nervous system in Schistosoma mansoni (trematode) [39].

6. BIBLIOGRAPHY

1. M. Berriman et al., The genome of the blood fluke Schistosoma mansoni., Nature

460, 352-8 (2009).

2. E. R. Jolly et al., Gene expression patterns during adaptation of a helminth parasite to different environmental niches., Genome biology 8, R65 (2007).

3. P. Steinmann, J. Keiser, R. Bos, M. Tanner, J. Utzinger, Schistosomiasis and water resources development: systematic review, meta-analysis, and estimates of people at risk., The Lancet infectious diseases 6, 411-25 (2006).

4. S. Montgomery, Chapter 3: Infectious diseases related to travel – Schistosomiasis.,

Center for Disease Control and Prevention, (2012).

5. A. Ross et al., Schistosomiasis, N Engl J Med 346, 1212-1220 (2002).

6. D. O. V. L. Boros, Immunopathology of Schistosoma mansoni Infection,

Microbiology 2 (1989), doi:10.1128/CMR.2.3.250.Updated.

7. K. Kloetzel, Some Quantitative Aspects Of Diagnosis And Epidemiology In

Schistosomiasis Mansoni, Am J Trop Med Hyg 12, 334-337 (1963).

8. B. Morgenstern, W. R. Atchley, Evolution of bHLH transcription factors: modular evolution by domain shuffling?, Molecular biology and evolution 16, 1654-63 (1999).

9. J. E. Lodish, Molecular Cell Biology., Fifth Edition.W. H. Freeman, (2003).

10. J.-H. Cho, M.-J. Tsai, The role of BETA2/NeuroD1 in the development of the nervous system., Molecular neurobiology 30, 35-47 (2004).

11. M. Rao, Developmental Neurobiology IV, Kluwer (2005).

12. Y. Sun et al., Neurogenin promotes neurogenesis and inhibits glial differentiation by independent mechanisms., Cell 104, 365-76 (2001).

13. J. Chrivia et al., Phosphorylated CREB binds specifically to the nuclear protein

CBP, Group (1993).

14. K.L.Wydner, Localization of human CREB-binding protein gene (CREBBP) to

16p13.2-p13.3 by fluorescence in situ hybridization. Genomics 30, 395–6 (1995).

15. A. Simmons, Neurogenin2 Expression in Ventral and Dorsal Spinal Neural Tube

Progenitor Cells Is Regulated by Distinct Enhancers, Developmental Biology 229, 327-

339 (2001).

16. J. N. Jensen, L. C. Rosenberg, J. Hecksher-Sørensen, P. Serup, Mutant neurogenin-

3 in congenital malabsorptive diarrhea., The New England journal of medicine 356,

1781-2; author reply 1782 (2007).

17. M. Appavoo, B. Tuch, Effect of upregulation of NeuroD in insulin-producing liver cells., Islets 1, 55-61 (2009).

18. T. Miyachi, H. Maruyama, T. Kitamura, S. Nakamura, H. Kawakami, Structure and regulation of the human NeuroD (BETA2/BHF1) gene., Brain research. Molecular brain research 69, 223-31 (1999).

19. Q. Ma, C. Kintner, D. J. Anderson, Identification of neurogenin, a vertebrate neuronal determination gene., Cell 87, 43-52 (1996).

20. J.E.Lee, Conversion of Xenopus ectoderm into neurons by NeuroD, a basic helix- loop-helix protein., Science 268, 836-844 (1995).

21. C. Dambly-Chaudière, M. Vervoort, The bHLH genes in neural development., The

International journal of developmental biology 42, 269-73 (1998).

22. S. Latchman, Transcription Factors : An Overview, Int. J. Biochem. Cell Biol. 2725,

1305-1312 (1997).

23. S. Hallam, E. Singer, D. Waring, Y. Jin, The C. elegans NeuroD homolog cnd-1 functions in multiple aspects of motor neuron fate specification., Development

(Cambridge, England) 127, 4239-52 (2000).

24. N. Koyano-Nakagawa, D. Wettstein, C. Kintner, Activation of Xenopus genes required for lateral inhibition and neuronal differentiation during primary neurogenesis., Molecular and cellular neurosciences 14, 327-39 (1999).

25. O. G. Kelly, D. a Melton, Development of the pancreas in Xenopus laevis.,

Developmental dynamics : an official publication of the American Association of

Anatomists 218, 615-27 (2000).

26. J. H. Chae, G. H. Stein, J. E. Lee, Molecules and NeuroD : The Predicted and the

Surprising, Molecules and Cells 18, 271-288 (2004).

27. M. E. Cerf, Transcription factors regulating beta-cell function., European journal of endocrinology / European Federation of Endocrine Societies 155, 671-9 (2006).

28. F. J. Naya, C. M. Stellrecht, M. J. Tsai, Tissue-specific regulation of the insulin gene by a novel basic helix-loop-helix transcription factor., Genes & Development 9,

1009-1019 (1995).

29. J.-Y. Kim et al., Orphan nuclear receptor small heterodimer partner, a novel corepressor for a basic helix-loop-helix transcription factor BETA2/neuroD.,

Molecular endocrinology (Baltimore, Md.) 18, 776-90 (2004).

30. J.-W. Kim et al., Transactivation of the mouse sulfonylurea receptor I gene by

BETA2/NeuroD., Molecular endocrinology (Baltimore, Md.) 16, 1097-107 (2002).

31. A. Longo, G. P. Guanga, R. B. Rose, Crystal structure of E47-NeuroD1/beta2 bHLH domain-DNA complex: heterodimer selectivity and DNA recognition., Biochemistry

47, 218-29 (2008).

32. H. P. Huang et al., Regulation of the pancreatic islet-specific gene BETA2 (neuroD) by neurogenin 3., Molecular and cellular biology 20, 3292-307 (2000).

33. M. T. Malecki et al., Mutations in NEUROD1 are associated with the development of type 2 diabetes mellitus., Nature genetics 23, 323-8 (1999).

34. S. K. Chakrabarti, R. G. Mirmira, Transcription factors direct the development and function of pancreatic beta cells., Trends in endocrinology and metabolism: TEM 14,

78-84 (2003).

35. M. B. McCormick et al., NeuroD2 and neuroD3: distinct expression patterns and transcriptional activation potentials within the neuroD gene family., Molecular and cellular biology 16, 5792-800 (1996).

36. B.-choon Ho et al., Basic Heli-loop-Helix Transcription Factor NEUROG1 and

Schizophrenia: Effects on Illness Susceptibility, MRI Brain Morphometry and

Cognitive Abilities, Schizophrenia Research 106, 192-199 (2008).

37. I. Ahmad et al., The role of NeuroD as a differentiation factor in the mammalian retina. Journal of molecular neuroscience : MN 11, 165-78 (1998).

38. H. R. Acharya, C. M. Dooley, W. B. Thoreson, I. Ahmad, cDNA cloning and expression analysis of NeuroD mRNA in human retina., Biochemical and biophysical research communications 233, 459-63 (1997).

39. G.D. Schmidt, L.S. Roberts, J. Janovy, Jr., Foundations of Parasitology. Eighth

Edition. McGraw-Hill, Chapter 15: 219-245 (2009).

40. M. Uittenbogaard, D.L. Martinka, P.F. Johnson, C. Vinson, A. Chiaramello, 5'UTR of the Neurogenic bHLH Nex1/MATH-22/NeuroD6 Gene Is Regulated by Two Distinct

Promoters Through CRE and C/EBP Binding Sites., Journal of Neuroscience Research

85, 1–18 (2007).

41. B. Titz et al., Transcriptional activators in yeast., Nucleic acids research 34, 955-67

(2006).

42. D. Lohr, P. Venkov, J. Zlatanova, B. Program, B. Academy, Transcriptional regulation in the yeast GAL gene family: a complex genetic network, The FASEB

Journal 9, 777-787 (1995).

43. M. G. Drummond et al., Molecular characterization of the Schistosoma mansoni zinc finger protein SmZF1 as a transcription factor., PLoS neglected tropical diseases

3, e547 (2009).

44. H. You et al., Cloning and characterisation of Schistosoma japonicum insulin receptors., PloS one 5, e9868 (2010).

45. E. Dumonteil, B. Laser, I. Constant, J. Philippe, Differential regulation of the glucagon and insulin I gene promoters by the basic helix-loop-helix transcription factors E47 and BETA2., The Journal of biological chemistry 273, 19945-54 (1998).

46. M. Gal, MATCHMAKER GAL4 Two-Hybrid System 3 & Libraries User Manual,

System 1, 1-38 (1999).