DOCSLIB.ORG

T Cell Activation Following Infection of Primary Follicle Center Lymphoma B

Total Page：16

File Type：pdf, Size：1020Kb

Download full-text PDF Read full-text
T Cell Activation Following Infection of Primary Follicle Center Lymphoma B Leukemia (2001) 15, 1451–1457 2001 Nature Publishing Group All rights reserved 0887-6924/01 $15.00 www.nature.com/leu T cell activation following infection of primary follicle center lymphoma B cells with adenovirus encoding CD154 MJ Cantwell, WG Wierda, IS Lossos, R Levy and TJ Kipps Immunogenex, Inc., La Jolla, CA; Division of Oncology, Stanford University Medical School, Stanford, CA; and Division of Hematology/Oncology, UCSD School of Medicine, La Jolla, CA, USA Purified, high-titer adenovirus encoding murine CD154 (Ad- cell cytotoxicity towards nonmodified CLL B cells.13 More- CD154) or human CD154 (Ad-hCD154) was used to infect lymph over, a phase I clinical study using Ad-CD154 modified CLL node cells isolated from patients with follicle center lymphoma. 14 Infection of lymphoma B cells with Ad-CD154 at a multiplicity B cells has shown promising therapeutic results. Similarly, of infection (MOI) ratio of 100 or higher resulted in high-level other groups have shown that modification of various tumor transgene expression. Additionally, upon infection of lym- types to express CD154 can induce effective anti-tumor phoma B cells, only Ad-CD154 resulted in surface expression immune responses in animal tumor models.15–17 of CD154, despite similar, high-level expression of either These encouraging results stimulated us to examine the human or mouse CD154 by HeLa cells infected with Ad-hCD154 feasibility of Ad-CD154 immunotherapy for other B cell or Ad-CD154, respectively. Moreover, infection of lymphoma B cells with Ad-CD154, but not Ad-hCD154 or adenovirus enco- malignancies. B cell lymphoma appears to be an excellent ding Eschericheria coli beta-galactosidase (Ad-LacZ), induced candidate disease for this approach because, similar to CLL, the neoplastic B cells to express higher levels of immune co- lymphoma B cells express CD40 and can be induced to stimulatory molecules that are required for proficient presen- express multiple immune co-stimulatory molecules upon tation of antigen to T cells. Consistent with this, we found that CD40 ligation.18,19 Moreover, since lymphoma cells express Ad-CD154 infected lymphoma B cells could stimulate T cells to clonally restricted immunoglobulins and generally harbor proliferate or produce interferon-gamma in allogeneic or auto- logous mixed lymphocyte interactions. We conclude that cytogenetic abnormalities, these cells should express somati- lymphoma B cells can be infected with Ad-CD154 and that this cally generated antigens that potentially could be targeted by significantly enhances their recognition by allogeneic or auto- the host immune system.20 As such, we examined whether logous T cells. As such, Ad-CD154-transduced lymphoma B lymphoma B cells could be infected with recombinant aden- cells may have potential for the active immune therapy of ovirus vectors. Furthermore, we studied the phenotype and patients with follicle center lymphoma. Leukemia (2001) 15, immune function of such cells following infection with adeno- 1451–1457. Keywords: follicle center lymphoma; CD154; adenovirus virus encoding CD154. Materials and methods Introduction Patient samples CD40–CD154 (CD40-ligand) interactions are critical for immune recognition.1,2 CD154 is transiently expressed on + After obtaining informed consent, lymph node biopsies were CD4 T cells following T cell receptor (TCR) engagement by performed on patients with B cell follicle center lymphoma antigen-presenting cells through major histocompatibility and prepared into single cell suspensions, as described.21 The complex (MHC) class II molecules.3–6 This, in turn, can cause cells then were subjected to density-gradient centrifugation activation of CD40-expressing antigen presenting cells (APCs), over cushions of Ficoll–Paque PLUS (Amersham Pharmacia including B cells, dendritic cells, monocytes, and macro- Biotech, Uppsala, Sweden) to isolate mononuclear cells, as phages.7,8 Such CD40-activated cells can set off a cascade of per the manufacturer’s instructions. The cells were suspended immune-activating events that lead to a specific and effective in fetal calf serum containing 10% dimethylsulfoxide (Sigma, immune response against foreign antigens, such as viruses or St Louis, MO, USA) for storage in liquid nitrogen until use. tumors.9,10 The importance of CD40–CD154 interactions is Blood mononuclear cells were similarly prepared from either underscored by the finding that individuals who have normal donors or follicle center lymphoma patients as indi- inherited defects in the ligand for CD40 have a profound cated. Cell cultures were maintained in serum free AIM-V immune deficiency.11,12 Such patients have an immune media (Gibco-BRL, Grand Island, NY, USA). deficiency syndrome associated with impaired germinal center formation, defective isotype switching, and marked susceptibility to various bacterial and viral pathogens. Adenovirus vector constructs In light of the role that this receptor–ligand pair plays in immune regulation, the potential for using CD154 for immun- Replication-incompetent adenovirus vectors encoding murine otherapy is under active investigation. For example, chronic CD154 (Ad-CD154), human CD154 (Ad-hCD154), or ␤- lymphocytic leukemia (CLL) B cells modified to express galactosidase (Ad-LacZ) cDNA were made as described.13,22 CD154 using a replication defective adenovirus vector can Each cDNA was flanked by the cytomegalovirus (CMV) enhance CLL antigen presentation and induce autologous T promoter/enhancer on the 5Ј end and the bovine growth hor- mone polyadenylation signal sequence on the 3Ј end, allowing for high-level expression of the transgene mRNA in Correspondence: TJ Kipps, Division of Hematology/Oncology, Ј Department of Medicine, University of Californai-San Diego, 9500 eukaryotic cells without 3 non-translated regulatory 10 Gilman Dr., La Jolla, CA 92093-0663, USA; Fax: 858 534 5620 sequences. Purified, high-titer (eg 0.8–2 × 10 p.f.u./ml), Received 27 March 2001; accepted 13 May 2001 recombinant adenovirus was produced by Molecular Medi- T cell activation following infection of lymphoma B cells with Ad-CD154 MJ Cantwell et al 1452 cine, LLC (San Diego, CA, USA; www.molecularmed.com) by each well of a 96-well U-bottom plate. Subsequently, 105 pur- anion-exchange chromatography, as described.23–25 Adeno- ified blood T cells from allogeneic normal donors or 105 auto- virus purity and titers were determined by high performance logous blood T cells were added to each well. In each case, liquid chromatography (Figure 1) and by a plaque forming the CD3+ T cells were isolated to Ͼ93% purity using the T assay using 293 cells, as described.26 Cell Negative Isolation Kit from Dynal, Inc (Lake Success, NY, USA), by which CD19, CD14, CD16, CD56, and HLA-DR- positive cells were depleted. For autologous MLR reactions, Flow cytometry we added recombinant human interleukin-2 (IL-2; Biosource International, Cambridge, MA, USA) to each well to a final Cells were washed and suspended in staining buffer, com- concentration of 25ng/ml. For some samples, blocking-mAb posed of phosphate buffered saline (PBS, pH = 7.4) containing specific for MHC-class I (clone W6/32) was added at 3 ␮g/ml 3% fetal calf serum, 0.05% sodium azide, and 10 ␮g/ml pro- final concentration. Following 2 days’ incubation, aliquots of pidium iodide. Cells then were incubated with saturating the media were collected to measure IFN-␥ production by amounts of fluorochrome-conjugated monoclonal antibody enzyme-linked immunosorbent assay (ELISA) using two IFN- (mAb) for 30 min at 4°C. Stained cells were washed twice ␥-specific mAbs (Pharmingen) and the manufacturer’s proto- with staining buffer and analyzed using a FACSCaliber flow col. To assess cell proliferation, we added 3H-thymidine to a cytometer (Becton Dickinson, San Jose, CA, USA). Dead cells final concentration of 0.5 ␮Ci/well 5days after the initiation and debris were excluded from the analysis by light scatter of the MLR and then harvested the cells 12 to 16 h later to and by gating out cells that failed to exclude propidium iod- measure incorporated 3H-thymidine using a cell harvester ide. We determined the percentages of cells that expressed (Tomtec, Hamden, CT, USA) and a beta-scintillation counter the transgene product and the mean fluorescence intensity (Wallac, Turku, Finland). ratio (MFIR) of transgene-expressing cells to assess the relative expression levels of the transgene. The MFIR is calculated by dividing the mean fluorescence intensity (MFI) of cells that Results were stained with the fluorochrome-conjugated antigen-spe- cific mAb by the MFI of cells that were stained with a control Adenovirus infection of lymphoma cells fluorochrome-conjugated mAb of the same isotype, but of irrelevant specificity. All antibodies were obtained from We initially determined if replication-incompetent adenovirus Pharmingen, Inc. (La Jolla, CA, USA). These included fluor- encoding either murine CD154 (Ad-CD154) or human CD154 escein-conjugated mAb specific for CD3, CD27, CD70, and (Ad-hCD154) could infect lymphoma B cells and result in sur- CD80, and PE-conjugated mAbs specific for mouse CD154, face expression of CD154. Each vector was prepared to high- human CD154, CD86, CD95, and CD71. In addition, we used titer and purity, as assessed via anion-exchange chromato- CyChrome-conjugated mAb specific for HLA-DR and APC- graphy (Figure 1). Following infection with Ad-CD154 or Ad- conjugated mAb specific for CD19. hCD154 at increasing MOI ratios, HeLa cells expressed sur- face mouse or human CD154, respectively (Figure 2). More- over, the levels of surface CD154 expression on HeLa cells Mixed lymphocyte reactions were similar for either vector at the same relative MOI ratio (Figure 2). Likewise, infection of lymphoma cells with Ad- Two days after the initial infection with adenovirus, the CD154 also resulted in high expression levels of murine infected lymphoma stimulator cells were treated with 100 CD154 provided MOI ratios were у100 (Figure 2). However, ng/ml mitomycin C for 1 h at 37°C to block proliferation. infection of lymphoma cells with Ad-hCD154 did not result These cells then were washed three times to remove the mito- in significant expression of human CD154, even at MOI ratios mycin C.
Load more

Recommended publications
  • Induction of a TRAIL Mediated Suicide Program by Interferon Alpha in Primary E€Usion Lymphoma
    Oncogene (2001) 20, 7029 ± 7040 ã 2001 Nature Publishing Group All rights reserved 0950 ± 9232/01 $15.00 www.nature.com/onc Induction of a TRAIL mediated suicide program by interferon alpha in primary eusion lymphoma Ngoc L Toomey1,4, Vadim V Deyev2,4, Charles Wood3, Lawrence H Boise2, Duncan Scott1, Lei Hua Liu1, Lisa Cabral1, Eckhard R Podack2, Glen N Barber2 and William J Harrington Jr*,1 1Department of Medicine University of Miami School of Medicine, Miami, Florida, FL 33136, USA; 2Department of Microbiology and Immunology, University of Miami School of Medicine, Miami, Florida, FL 33136, USA; 3School of Biological Sciences, University of Nebraska, Lincoln, Nebraska, NE 68588, USA Gammaherpes viruses are often detected in lymphomas Virus (EBV) or Human Herpes Virus Type 8 (HHV-8) arising in immunocompromised patients. We have found have been isolated from lymphomas found in im- that Azidothymidine (AZT) alone induces apoptosis in munosuppressed organ transplant recipients, children Epstein Barr Virus (EBV) positive Burkitt's lymphoma with hereditary immunode®ciencies and patients with (BL) cells but requires interferon alpha (IFN-a) to induce acquired immunode®ciency (AIDS) (Swinnen, 1999; apoptosis in Human Herpes Virus Type 8 (HHV-8) Goldsby and Carroll, 1998; Knowles, 1999). Many of positive Primary Eusion Lymphomas (PEL). Our these tumors can be categorized into distinct subtypes analysis of a series of AIDS lymphomas revealed that based on a variety of morphologic and molecular IFN-a selectively induced very high levels of the Death criteria. For example, AIDS associated large cell Receptor (DR) tumor necrosis factor-related apoptosis- diuse or immunoblastic lymphomas (DLCL, IBL) inducing ligand (TRAIL) in HHV-8 positive PEL lines are often EBV positive while AIDS associated Burkitt's and primary tumor cells whereas little or no induction lymphomas (BL) less frequently contain EBV (Gaidano was observed in primary EBV+ AIDS lymphomas and et al., 1994).
    [Show full text]
  • PAX5 Expression in Acute Leukemias: Higher B-Lineage Specificity Than Cd79a and Selective Association with T(8;21)-Acute Myelogenous Leukemia
    [CANCER RESEARCH 64, 7399–7404, October 15, 2004] PAX5 Expression in Acute Leukemias: Higher B-Lineage Specificity Than CD79a and Selective Association with t(8;21)-Acute Myelogenous Leukemia Enrico Tiacci,1 Stefano Pileri,2 Annette Orleth,1 Roberta Pacini,1 Alessia Tabarrini,1 Federica Frenguelli,1 Arcangelo Liso,3 Daniela Diverio,4 Francesco Lo-Coco,5 and Brunangelo Falini1 1Institutes of Hematology and Internal Medicine, University of Perugia, Perugia, Italy; 2Unit of Hematopathology, University of Bologne, Bologne, Italy; 3Section of Hematology, University of Foggia, Foggia, Italy; 4Department of Cellular Biotechnologies and Hematology, University La Sapienza of Rome, Rome, Italy; and 5Department of Biopathology, University Tor Vergata of Rome, Rome, Italy ABSTRACT (13, 16). PAX5 expression also occurs in the adult testis and in the mesencephalon and spinal cord during embryogenesis (17), suggesting an The transcription factor PAX5 plays a key role in the commitment of important role in the development of these tissues. hematopoietic precursors to the B-cell lineage, but its expression in acute Rearrangement of the PAX5 gene through reciprocal chromosomal leukemias has not been thoroughly investigated. Hereby, we analyzed routine biopsies from 360 acute leukemias of lymphoid (ALLs) and mye- translocations has been described in different types of B-cell malig- loid (AMLs) origin with a specific anti-PAX5 monoclonal antibody. Blasts nancies (18–23), and, more recently, PAX5 has also been shown to be from 150 B-cell ALLs showed strong PAX5 nuclear expression, paralleling targeted by aberrant hypermutation in Ͼ50% of diffuse large B-cell that of CD79a in the cytoplasm. Conversely, PAX5 was not detected in 50 lymphomas (24).
    [Show full text]
  • Human and Mouse CD Marker Handbook Human and Mouse CD Marker Key Markers - Human Key Markers - Mouse
    Welcome to More Choice CD Marker Handbook For more information, please visit: Human bdbiosciences.com/eu/go/humancdmarkers Mouse bdbiosciences.com/eu/go/mousecdmarkers Human and Mouse CD Marker Handbook Human and Mouse CD Marker Key Markers - Human Key Markers - Mouse CD3 CD3 CD (cluster of differentiation) molecules are cell surface markers T Cell CD4 CD4 useful for the identification and characterization of leukocytes. The CD CD8 CD8 nomenclature was developed and is maintained through the HLDA (Human Leukocyte Differentiation Antigens) workshop started in 1982. CD45R/B220 CD19 CD19 The goal is to provide standardization of monoclonal antibodies to B Cell CD20 CD22 (B cell activation marker) human antigens across laboratories. To characterize or “workshop” the antibodies, multiple laboratories carry out blind analyses of antibodies. These results independently validate antibody specificity. CD11c CD11c Dendritic Cell CD123 CD123 While the CD nomenclature has been developed for use with human antigens, it is applied to corresponding mouse antigens as well as antigens from other species. However, the mouse and other species NK Cell CD56 CD335 (NKp46) antibodies are not tested by HLDA. Human CD markers were reviewed by the HLDA. New CD markers Stem Cell/ CD34 CD34 were established at the HLDA9 meeting held in Barcelona in 2010. For Precursor hematopoetic stem cell only hematopoetic stem cell only additional information and CD markers please visit www.hcdm.org. Macrophage/ CD14 CD11b/ Mac-1 Monocyte CD33 Ly-71 (F4/80) CD66b Granulocyte CD66b Gr-1/Ly6G Ly6C CD41 CD41 CD61 (Integrin b3) CD61 Platelet CD9 CD62 CD62P (activated platelets) CD235a CD235a Erythrocyte Ter-119 CD146 MECA-32 CD106 CD146 Endothelial Cell CD31 CD62E (activated endothelial cells) Epithelial Cell CD236 CD326 (EPCAM1) For Research Use Only.
    [Show full text]
  • Bispecific CAR-T Cells Targeting Both CD19 and CD22 for Therapy Of
    Dai et al. Journal of Hematology & Oncology (2020) 13:30 https://doi.org/10.1186/s13045-020-00856-8 RAPID COMMUNICATION Open Access Bispecific CAR-T cells targeting both CD19 and CD22 for therapy of adults with relapsed or refractory B cell acute lymphoblastic leukemia Hanren Dai1,2,3†, Zhiqiang Wu1†, Hejin Jia2†, Chuan Tong1, Yelei Guo1, Dongdong Ti1, Xiao Han1, Yang Liu4, Wenying Zhang2, Chunmeng Wang2, Yajing Zhang2, Meixia Chen2, Qingming Yang2, Yao Wang1* and Weidong Han1,2* Abstract Background: Despite the impressive complete remission (CR) induced by CD19 CAR-T cell therapy in B-ALL, the high rate of complete responses is sometimes limited by the emergence of CD19-negative leukemia. Bispecific CAR-modified T cells targeting both CD19 and CD22 may overcome the limitation of CD19-negative relapse. Methods: We here report the design of a bispecific CAR simultaneous targeting of CD19 and CD22. We performed a phase 1 trial of bispecific CAR T cell therapy in patients with relapsed/refractory precursor B-ALL at a dose that ranged from 1.7 × 106 to 3 × 106 CAR T cells per kilogram of body weight. Results: We demonstrate bispecific CD19/CD22 CAR T cells could trigger robust cytolytic activity against target cells. MRD-negative CR was achieved in 6 out of 6 enrolled patients. Autologous CD19/CD22 CAR T cells proliferated in vivo and were detected in the blood, bone marrow, and cerebrospinal fluid. No neurotoxicity occurred in any of the 6 patients treated. Of note, one patient had a relapse with blast cells that no longer expressed CD19 and exhibited diminished CD22 site density approximately 5 months after treatment.
    [Show full text]
  • A Fratricide-Resistant Allogeneic CAR T
    Investigation of ALLO-316: A Fratricide- Resistant Allogeneic CAR T Targeting CD70 As a Potential Therapy for the Treatment of AML Surabhi Srinivasan, Nguyen Tan, Hsin-Yuan Cheng, Yi Zhang, Silvia Tacheva-Grigorova, Tom Van Blarcom, Cesar Sommer, Duy Nguyen , Barbra Sasu, and Siler Panowski 1 Disclosures • Full-time employee of Allogene Therapeutics • Equity interest in Allogene Therapeutics ALLO-316 (CD70) utilizes TALEN® gene-editing technology pioneered and owned by Cellectis. Allogene has an exclusive license to the Cellectis technology for allogeneic products directed at this target and holds all global development and commercial rights for this investigational candidate. 22 CONFIDENTIAL Disclaimers This presentation is not intended for product promotion. All information is related to investigational therapies not available for commercial use. The safety and efficacy of the therapies have not been established for FDA approval. Forward-Looking Statements To the extent statements contained in this Presentation are not descriptions of historical facts regarding Allogene Therapeutics, Inc. (“Allogene,” “we,” “us,” or “our”), they are forward-looking statements reflecting management’s current beliefs and expectations. Forward-looking statements are subject to known and unknown risks, uncertainties, and other factors that may cause our or our industry’s actual results, levels or activity, performance, or achievements to be materially different from those anticipated by such statements. You can identify forward-looking statements by words such as “anticipate,” “believe,” “could,” “estimate,” “expect,” “intend,” “may,” “plan,” “potential,” “predict,” “project,” “should,” “will,” “would” or the negative of those terms, and similar expressions that convey uncertainty of future events or outcomes. Forward-looking statements contained in this Presentation include, but are not limited to, statements regarding: the ability to progress the clinical development of allogeneic CAR T (AlloCAR T™) therapies and the potential benefits of AlloCAR T™ therapy, including ALLO-316.
    [Show full text]
  • CD81 Is Required for CD19-Complex Formation and Terminal Human B
    Supplemental Table 1. Primer sequences for PCR amplification and sequencing of CD81 coding regions from genomic DNA. Exon Forward primer Forward primer sequence Reverse primer Reverse primer sequence 1 CD81exon1F GGGGCGGGGCCTATGGAG CD81exon1R GGACCTGCCCAACGTGGA 2 CD81exon2F TGTGGGGTGGGCGCACTC CD81exon2R CACGCCATGCCCGACTGT 3 CD81exon3F ATCCCTGGCAGTCAGCAACC CD81exon3R TCCGCCCTGAGCACCAGC 4 CD81exon4F GTCAGGTCGTGGGCTGGT CD81exon4R CTGGAGATCCTCCTGGCAAGT 5 CD81exon5F TCTGGGGTCTAGCCTCGAAGC CD81exon5R CTGGGCGTAGGCAGGATT 6 CD81exon6F GGCCCCTGGATGCATTCT CD81exon6R AGTGTGGTCGCTCCCTGTGG 7+8 CD81exon7+8F CTGCGTGACAACGGGAAG CD81exon7+8R TATACACAGGCGGTGATGG Supplemental Table 2. Primer sequences for PCR amplification and sequencing of CD81 and CD225 transcripts. Gene Forward primer Forward primer sequence Reverse primer Reverse primer sequence CD81 CD81_mRNA_F1 GACCCCACCGCGCATCCT CD81_mRNA_R1 GGATGGCCCCGTAGCAGC CD81_mRNA_F2 CGCCCAACACCTTCTATGTA CD81_mRNA_R2 TGCCCGAGGGACACAAAT CD81_mRNA_F3 TTCCACGAGACGCTTGACTGCT CD81_mRNA_R3 AGGCCCGTCTCCACTCAT IFITM1 IFITM1_mRNA_F1 TCATTGGTCCCTGGCTAATTCAC IFITM1_mRNA_R1 GGTCACGTCGCCAACCAT IFITM1_mRNA_F2 ACAGCGAGACCTCCGTGC IFITM1_mRNA_R2 TCTAGGGGCAGGACCAAG Supplemental Table 3. PCR primers and TaqMan probes for CD81 transcript level quantification. Target Forward primer Forward primer sequence Reverse primer Reverse primer sequence TaqMan probe TaqMan probe Sequence total CD81 CD81_RQ_F CGCCAAGGCTGTGGTGAA CD81_RQ_R AGAGGTTGCTGATGATGTTGCTG T-CD81 ACTGACTGCTTTGACCACCTCAGTGCTCA wild type CD81 CD81_RQ_F CGCCAAGGCTGTGGTGAA
    [Show full text]
  • Porvac® Subunit Vaccine E2-CD154 Induces Remarkable Rapid Protection Against Classical Swine Fever Virus
    Article Porvac® Subunit Vaccine E2-CD154 Induces Remarkable Rapid Protection against Classical Swine Fever Virus Yusmel Sordo-Puga 1, Marisela Suárez-Pedroso 1 , Paula Naranjo-Valdéz 2, Danny Pérez-Pérez 1, Elaine Santana-Rodríguez 1, Talia Sardinas-Gonzalez 1, Mary Karla Mendez-Orta 1, Carlos A. Duarte-Cano 1, Mario Pablo Estrada-Garcia 1 and María Pilar Rodríguez-Moltó 1,* 1 Animal Biotechnology Department, Center for Genetic Engineering and Biotechnology, P.O. Box 6162, Havana 10600, Cuba; [email protected] (Y.S.-P.); [email protected] (M.S.-P.); [email protected] (D.P.-P.); [email protected] (E.S.-R.); [email protected] (T.S.-G.); [email protected] (M.K.M.O.); [email protected] (C.A.D.); [email protected] (M.P.E.) 2 Central Laboratory Unit for Animal Health (ULCSA), Havana 11400, Cuba; [email protected] * Correspondence: [email protected]; Tel.: +53-7-2504419 Abstract: Live attenuated C-strain classical swine fever vaccines provide early onset protection. These vaccines confer effective protection against the disease at 5–7 days post-vaccination. It was previously reported that intramuscular administration of the Porvac® vaccine protects against highly virulent Citation: Sordo-Puga, Y.; classical swine fever virus (CSFV) “Margarita” strain as early as seven days post-vaccination. In Suárez-Pedroso, M.; Naranjo-Valdéz, order to identify how rapidly protection against CSFV is conferred after a single dose of the Porvac® P.; Pérez-Pérez, D.; subunit vaccine E2-CD154, 15 swine, vaccinated with a single dose of Porvac®, were challenged Santana-Rodríguez, E.; 3 intranasally at five, three, and one day post-vaccination with 2 × 10 LD50 of the highly pathogenic Sardinas-Gonzalez, T.; Mendez-Orta, Cuban “Margarita” strain of the classical swine fever virus.
    [Show full text]
  • Age- and Gender-Specific Modulation of Serum Osteopontin and Interferon-Α by Osteopontin Genotype in Systemic Lupus Er
    Genes and Immunity (2009) 10, 487–494 & 2009 Macmillan Publishers Limited All rights reserved 1466-4879/09 $32.00 www.nature.com/gene ORIGINAL ARTICLE Age- and gender-specific modulation of serum osteopontin and interferon-a by osteopontin genotype in systemic lupus erythematosus SN Kariuki1, JG Moore1, KA Kirou2,MKCrow2, TO Utset1 and TB Niewold1 1Section of Rheumatology, University of Chicago, Chicago, IL, USA and 2Mary Kirkland Center for Lupus Research, Hospital for Special Surgery, New York, NY, USA Osteopontin (OPN) is a multifunctional cytokine involved in long bone remodeling and immune system signaling. Additionally, OPN is critical for interferon-a (IFN-a) production in murine plasmacytoid dendritic cells. We have previously shown that IFN-a is a heritable risk factor for systemic lupus erythematosus (SLE). Genetic variants of OPN have been associated with SLE susceptibility, and one study suggests that this association is particular to men. In this study, the 3 0 UTR SLE-risk variant of OPN (rs9138C) was associated with higher serum OPN and IFN-a in men (P ¼ 0.0062 and P ¼ 0.0087, respectively). In women, the association between rs9138 C and higher serum OPN and IFN-a was restricted to younger subjects, and risk allele carriers showed a strong age-related genetic effect of rs9138 genotype on both serum OPN and IFN-a (Po0.0001). In African- American subjects, the 5 0 region single nucleotide polymorphisms, rs11730582 and rs28357094, were associated with anti- RNP antibodies (odds ratio (OR) ¼ 2.9, P ¼ 0.0038 and OR ¼ 3.9, P ¼ 0.021, respectively). Thus, we demonstrate two distinct genetic influences of OPN on serum protein traits in SLE patients, which correspond to previously reported SLE-risk variants.
    [Show full text]
  • 1 ICAM3-Fc Outperforms Receptor-Specific Antibodies
    Preprints (www.preprints.org) | NOT PEER-REVIEWED | Posted: 10 April 2019 doi:10.20944/preprints201904.0118.v1 Peer-reviewed version available at Molecules 2019, 24, 1825; doi:10.3390/molecules24091825 ICAM3-Fc outperforms receptor-specific antibodies targeted nanoparticles to dendritic cells for cross-presentation Luis J. Cruz,1* Paul J. Tacken,2 Johan S. van der Schoot,2 Felix Rueda,3 Ruurd Torensma,2 Carl G. Figdor2* 1Translational Nanobiomaterials and Imaging, Department of Radiology, Leiden University Medical Center, Albinusdreef 2, 2333 ZA Leiden, The Netherlands. 2Department of Tumor Immunology, Radboud Insititute for Molecular Life Sciences, Radboud University Medical Center, Postbox 9101, 6500 HB Nijmegen, The Netherlands. 3Department of Biochemistry and Molecular Biology, University of Barcelona, Diagonal 643, 08028 Barcelona, Spain. Running title: ICAM3-Fc- versus antibody-targeted NP vaccines to human DCs Keywords: Delivery system; nanoparticle; targeting. AUTHOR INFORMATION Corresponding Author *Dr. Luis J. Cruz Translational Nanobiomaterials and Imaging, Department of Radiology, Bldg.1, C5-60. Leiden University Medical Center, Albinusdreef 2 2333 ZA Leiden, The Netherlands Tel: +31 71 5263025 Email: [email protected] *Prof. Dr. Carl G. Figdor Department of Tumor Immunology, Nijmegen Centre for Molecular Life Sciences, Radboud University Nijmegen Medical Centre, Postbox 9101, 6500 HB Nijmegen, The Netherlands. Fax: +31-24-3540339; Tel.: +31-24-3617600; E-mail: [email protected] 1 © 2019 by the author(s). Distributed
    [Show full text]
  • Uva-DARE (Digital Academic Repository)
    UvA-DARE (Digital Academic Repository) Balancing effector lymphocyte formation via CD27-CD70 interactions Arens, R. Publication date 2003 Link to publication Citation for published version (APA): Arens, R. (2003). Balancing effector lymphocyte formation via CD27-CD70 interactions. General rights It is not permitted to download or to forward/distribute the text or part of it without the consent of the author(s) and/or copyright holder(s), other than for strictly personal, individual use, unless the work is under an open content license (like Creative Commons). Disclaimer/Complaints regulations If you believe that digital publication of certain material infringes any of your rights or (privacy) interests, please let the Library know, stating your reasons. In case of a legitimate complaint, the Library will make the material inaccessible and/or remove it from the website. Please Ask the Library: https://uba.uva.nl/en/contact, or a letter to: Library of the University of Amsterdam, Secretariat, Singel 425, 1012 WP Amsterdam, The Netherlands. You will be contacted as soon as possible. UvA-DARE is a service provided by the library of the University of Amsterdam (https://dare.uva.nl) Download date:27 Sep 2021 Chapter 3 Constitutive CD27/CD70 interaction induces expansion of effector-type T cells and results in IFNy-mediated B cell depletion Ramon Arens*, Kiki Tesselaar*, Paul A. Baars, Gijs M.W. van Schijndel, Jenny Hendriks, Steven T. Pals, Paul Krimpenfort, Jannie Borst, Marinus H.J. van Oers, and René A.W. van Lier 'These authors contributed equally to this work Immunity 15, 801-812 (2001) Chapter 3 Constitutive CD27/CD70 interaction induces expansion of effector-type T cells and results in IFNy-mediated B cell depletion Ramon Arens123#, Kiki Tesselaar23", Paul A.
    [Show full text]
  • Increased Expression of CD154 and FAS in SLE Patients’ Lymphocytes Maria Elena Manea, Ruediger B
    Increased expression of CD154 and FAS in SLE patients’ lymphocytes Maria Elena Manea, Ruediger B. Mueller, Doru Dejica, Ahmed Sheriff, Georg Schett, Martin Herrmann, Peter Kern To cite this version: Maria Elena Manea, Ruediger B. Mueller, Doru Dejica, Ahmed Sheriff, Georg Schett, et al.. Increased expression of CD154 and FAS in SLE patients’ lymphocytes. Rheumatology International, Springer Verlag, 2009, 30 (2), pp.181-185. 10.1007/s00296-009-0933-4. hal-00568285 HAL Id: hal-00568285 https://hal.archives-ouvertes.fr/hal-00568285 Submitted on 23 Feb 2011 HAL is a multi-disciplinary open access L’archive ouverte pluridisciplinaire HAL, est archive for the deposit and dissemination of sci- destinée au dépôt et à la diffusion de documents entific research documents, whether they are pub- scientifiques de niveau recherche, publiés ou non, lished or not. The documents may come from émanant des établissements d’enseignement et de teaching and research institutions in France or recherche français ou étrangers, des laboratoires abroad, or from public or private research centers. publics ou privés. Increased expression of CD154 and FAS in SLE patients’ lymphocytes Maria Elena Manea1‡, MD, Ruediger B. Mueller2,3‡, MD, Doru Dejica1, PhD, Ahmed Sheriff2, PhD, Georg Schett2, MD, Martin Herrmann2, PhD, Peter Kern4, MD 1 Department of Immunopathology. “Iuliu Hatieganu" University of Medicine and Pharmacy, Str Croitorilor no 19-21, 3400 Cluj-Napoca, Romania. 2 Department for Internal Medicine 3 and Institute for Clinical Immunology, University of Erlangen-Nürnberg, Germany 3 Departement of Rheumatologie, Kantonsspital St. Gallen, Switzerland 4 Franz von Prümmer Klinik, Bahnhofstraße 16, 97769 Bad Brückenau, Germany ‡ both authors equally contributed to the work Address correspondence and reprint requests to: Ruediger B.
    [Show full text]
  • Cell-Expressed CD154 in Germinal Centers Expression, Regulation
    Expression, Regulation, and Function of B Cell-Expressed CD154 in Germinal Centers Amrie C. Grammer, Richard D. McFarland, Jonathan Heaney, Bonnie F. Darnell and Peter E. Lipsky This information is current as of September 25, 2021. J Immunol 1999; 163:4150-4159; ; http://www.jimmunol.org/content/163/8/4150 Downloaded from References This article cites 74 articles, 33 of which you can access for free at: http://www.jimmunol.org/content/163/8/4150.full#ref-list-1 Why The JI? Submit online. http://www.jimmunol.org/ • Rapid Reviews! 30 days* from submission to initial decision • No Triage! Every submission reviewed by practicing scientists • Fast Publication! 4 weeks from acceptance to publication *average by guest on September 25, 2021 Subscription Information about subscribing to The Journal of Immunology is online at: http://jimmunol.org/subscription Permissions Submit copyright permission requests at: http://www.aai.org/About/Publications/JI/copyright.html Email Alerts Receive free email-alerts when new articles cite this article. Sign up at: http://jimmunol.org/alerts The Journal of Immunology is published twice each month by The American Association of Immunologists, Inc., 1451 Rockville Pike, Suite 650, Rockville, MD 20852 Copyright © 1999 by The American Association of Immunologists All rights reserved. Print ISSN: 0022-1767 Online ISSN: 1550-6606. Expression, Regulation, and Function of B Cell-Expressed CD154 in Germinal Centers1 Amrie C. Grammer,* Richard D. McFarland,† Jonathan Heaney,* Bonnie F. Darnell,† and Peter E. Lipsky2* Activated B cells and T cells express CD154/CD40 ligand in vitro. The in vivo expression and function of B cell CD154 remain unclear and therefore were examined.
    [Show full text]