Mitochondrial Dysfunction Influences Apoptosis and Autophagy in Porcine Parthenotes Developing in Vitro

Journal of Reproduction and Development, Vol. 57, No. 1, 2011, 10-110H —Original Article— Mitochondrial Dysfunction Influences Apoptosis and Autophagy in Porcine Parthenotes Developing In Vitro Yong-Nan XU1), Xiang-Shun CUI1), Shao-Chen SUN1), Seung-Eun LEE1), Ying-Hua LI1), Jung-Suk KWON1), Sung-Hyun LEE1), Kyu-Chan HWANG1) and Nam-Hyung KIM1) 1)Department of Animal Sciences, Chungbuk National University, Chungbuk 361-763, Korea Abstract. Mitochondria are important regulators of both apoptosis and autophagy. One of the triggers for mitochondrial-mediated apoptosis is the production of reactive oxygen species (ROS), which include hydrogen peroxide, superoxide, hydroxyl radical, nitric oxide and peroxynitrite. Recently, several studies have indicated that ROS may also be involved in the induction of autophagy. In the present study, we used H2O2 to induce mitochondrial stress, examined apoptotic- and autophagic-related gene expression and observed LC3 protein (autophagosome presence marker) expression in porcine parthenotes developing in vitro. In porcine four-cell parthenotes cultured for 5 days in NCSU37 medium containing 0.4% BSA, the developmental rate and mitochondrial distribution did not differ from that of the group supplemented with 100 μM H2O2 but was significantly decreased in the group supplemented with 500 μM H2O2 (P<0.05). Transmission electron microscopy (TEM) indicated that whereas normal shaped mitochondria were observed in blastocysts from the control group, abnormal mitochondria (mitophagy) and autophagic vacuoles were observed in blastocysts from the group that received 500 μM H2O2. Furthermore, addition of H2O2 (100 μM and 500 μM) decreased cell numbers (P<0.05) and increased both apoptosis (P<0.05) and LC3 protein expression in the blastocysts. Real-time RT-PCR showed that H2O2 significantly decreased mRNA expression of anti- apoptotic gene Bcl-xL but increased pro-apoptotic genes, Caspase 3 (Casp3) and Bak, and autophagy-related genes, microtubule-associated protein 1 light chain 3 (Map1lc3b) and lysosomal-associated membrane protein 2 (Lamp2). However, the addition of H2O2 had no effect on mRNA expression levels in nuclear DNA-encoded mitochondrial- related genes, cytochrome oxidase (Cox) 5a, Cox5b and Cox6b1, in blastocysts. These results suggest that H2O2 leads to mitochondrial dysfunction that results in apoptosis and autophagy, which is possibly related to porcine early embryo development. Key words: Apoptosis, Autophagy, Mitochondria, Pig embryo (J. Reprod. Dev. 57: 143–150, 2011)

itochondria were first characterized as intracellular are at least two major protein families involved in the regulation of organelles responsible for energy production through the apoptosis, namely Bcl-2 and Bax. The Bcl-2 family members, coupling of oxidative phosphorylation to respiration. Oocyte mito- including Bcl-2, Bcl-xL, Bcl-x and Bcl-w, protect cells from apopto- chondria produce the energy required for resumption of meiosis, sis, whereas the Bax family members, Bad, Bax and Bak, induce fertilization and development of the embryo [1]. The mitochondria apoptosis in somatic cells. Similarly, apoptosis is more prevalent are the cellular power plants, providing ATP for most processes in poor quality bovine embryos, which express more Bax and less that require energy, and also have a decisive role in the regulation Bcl-2 as compared with good quality embryos [7]. Nutt et al. [8] of apoptosis by controlling the release of some mitochondrial pro- reported that apoptosis results from changes in mitochondrial integ- teins such as cytochrome c and other pro-apoptotic factors. rity caused by various effectors, such as Ca2+, ROS or the Accumulation of reactive oxygen species (ROS) such as hydro- production of Bak, which lead to the release of cytochrome c and gen peroxide (H2O2) is an oxidative stress response, which induces activation of the caspase cascade. various defense mechanisms or programmed cell death (PCD). Type II cell death or autophagic cell death is characterized by

Zhang et al. [2] reported that H2O2 induced apoptosis and autoph- the presence of abundant autophagic vacuoles that engulf bulk agy in U251 cells. Programmed cell death (type I cell death) or cytoplasm and cytosolic organelles, such as mitochondria and the apoptosis is crucially involved in the development and differentia- endoplasmic reticulum, with subsequent degradation by the cells’ tion of embryos [3]. Cory and Adams [4] reported that members of own lysosomal system [9]. The proteins encoded by the autoph- the Bcl-2 gene family play key roles in regulating apoptosis. agy-related genes (ATG) are required for formation of autophagic Among the Bcl-2 family, Bcl-xL and Bak are known as anti-apop- vesicles [10–13]. ATG5｠is associated with the ATG12–ATG16 totic and pro-apoptotic genes, respectively, in the pig [5, 6]. There complex through an ubiquitin-like system. ATG6/Beclin-1 functions in cooperation with the class III PI3-kinase signaling complex Received: July 26, 2010 to positively control formation of the autophagic vacuole [14, 15]. Accepted: October 5, 2010 Published online in J-STAGE: November 6, 2010 Microtubule-associated protein light chain 3 (LC3/ATG8) is con- ©2011 by the Society for Reproduction and Development verted to a membrane-conjugated form by ATG4, while ATG9 is Correspondence: N-H Kim (e-mail: [email protected]) an integral membrane protein required for the formation of the dou- 144 XU et al. ble membrane vesicle [16–18]. Lysosomal-associated membrane and washed three times in NCSU37 medium with 0.4% (w/v) BSA protein 2 (LAMP2) is a ubiquitous lysosomal membrane protein and then allocated (about 40–50 per group) and cultured with the that is highly expressed in normal human pancreatic tissue and is same medium containing H2O2 (0, 50, 100 or 500 μM) for 5 days required for proper fusion of lysosomes with autophagosomes in (day 7 from parthenogenic activation) at 39 C and 5% CO2 in air; the late stage of the autophagic process [19]. However, the role of the embryos that developed to the blastocyst stage were analyzed. autophagy in embryos is still poorly understood. During oocyte maturation and early embryo development, vari- Immunofluorescence staining ous microenvironmental stresses, such as Ca2+, ROS and ceramide, To determine the expression of autophagy (LC3) protein, can induce distribution of mitochondrial integrity that results in the approximate 10 blastocysts were washed in Dulbecco’s phosphate- release of cytochrome c and the activation of caspase 9 (Casp9) buffered saline (dPBS) containing polyvinyl alcohol (PVA, 1 mg/ [20], followed by apoptosis and abnormal embryonic development. ml), fixed for 20 min in 3.7% paraformaldehyde in dPBS and per-

Interestingly, H2O2 induces mitochondrial depolarization and cell meabilized with 0.2% Triton X-100 in dPBS for 30 min at room death [21]. In cows, generation of endogenous H2O2 results in temperature. The fixed embryos were then incubated with rabbit damage to the embryonic DNA [22] and/or apoptosis [23]. polyclonal LC3 (Abcam, Cambridge, UK) antibody for 1 h and Recently, several studies have indicated that ROS may also be then with FITC-labeled secondary antibody (Sigma). Hoechst involved in the induction of autophagy. Despite these observa- 33342 was used to stain the nuclei. Slides were examined using tions, it is not known whether mitochondrial stress induced by laser-scanning confocal microscopy, which was performed using a

H2O2 affects apoptosis and autophagy in porcine preimplantation Leica DM IRB equipped with a krypton–argon ion laser for the embryos developing in vitro. simultaneous excitation of fluorescence for protein and DNA.

In the present study, we induced mitochondrial stress with H2O2, Intensity of LC3 was measured with the ZEN software from Carl examined the apoptotic-, autophagic- and mitochondrial-related Zeiss. At least 10 embryos were examined, and at least 10 points genes and observed LC3 protein (marker for the presence of were examined in each embryo. autophagosomes) expression in porcine parthenotes developing in vitro. Terminal deoxynucleotidyl transferase-mediated dUTP nick- end labeling (TUNEL) assay Materials and Methods Approximate 10 blastocysts were washed three times in dPBS (pH 7.4) containing 1 mg/ml PVA (dPBS/PVA) and then fixed in In vitro porcine oocyte maturation and parthenogenetic 3.7% paraformaldehyde in dPBS/PVA for 1 h at room temperature. activation After fixation, embryos were washed in dPBS/PVA and permeabi- Prepubertal porcine ovaries were collected from a local slaugh- lized by incubation in 0.5% Triton X-100 for 1 h at room terhouse and transported to the laboratory at 25 C in Dulbecco’s temperature. They were then washed twice in dPBS/PVA and phosphate-buffered saline (dPBS) supplemented with 75 μg/l peni- incubated with fluorescein-conjugated dUTP and the terminal cillin G and 50 μg/l streptomycin sulfate. Cumulus–oocyte deoxynucleotidyl transferase enzyme (In Situ Cell Death Detection complexes (COCs) were aspirated from follicles of 2–8 mm in Kit, Roche; Mannheim, Germany) in the dark for 1 h at 37 C. After diameter with an 18-gauge needle and a disposable 10-ml syringe. being counterstained with 50 μg/ml RNase A in 40 μg/ml propid- The COCs were washed three times with Hepes-buffered Tyrode’s ium iodide (PI) for 1 h at 37 C to label all nuclei, embryos were medium containing 0.1% (w/v) polyvinyl alcohol (Hepes-TL- washed in PBS/PVA, mounted with slight coverslip compression PVA). Each group of 50 COCs was matured in 500 μl tissue cul- and examined under a confocal microscope. ture medium (TCM)-199 (with Earle’s salts; Gibco; Grand Island, For the other experiments, embryos were fixed in 3.7% NY, USA) supplemented with 0.57 mM cysteine (Sigma, St. paraformaldehyde in PBS for 1 h at RT and stained with 40 μg/ml Louis, MO, USA), 10 ng/ml EGF (Sigma), 10 IU/ml PMSG PI for 1 h at 37 C to label all nuclei, and total cell numbers were (Sigma) and 10 IU/ml hCG (Sigma) under paraffin oil at 39 C for counted under a fluorescence microscope (Olympus, Tokyo, 44 h. Following maturation, cumulus cells were removed by pipet- Japan). ting in the presence of 1 mg/ml hyaluronidase for 2–3 min. Oocytes were activated for parthenogenesis with 5 μM Ca2+ iono- Mitochondrial staining and image analysis phore (Sigma) for 5 min. After 3 h of culture in North Carolina To localize mitochondria, porcine blastocysts were fixed with State University 37 (NCSU37) medium containing 7.5 μg/ml 3.7% formaldehyde in dPBS/PVA for 1 h, washed two times with cytochalasin B (Sigma), embryos were washed three times in dPBS/PVA and incubated with MitoTracker Green FM (M-7514, NCSU37 medium containing 0.4% (w/v) BSA and cultured in the Molecular Probes, Inc.) for 20 min to stain the mitochondria. The same medium for 48 h at 39 C in an atmosphere of 5% CO2 and nuclei were stained with Hoechst 33342. The phase-contrast 95% air. images of individual samples were digitized using laser scanning confocal microscopy (Leica Laser Technik GmbH). Intensity of Embryo culture MitoTracker Green FM was measured with the ZEN software from After 48 h of culture in NCSU37 medium containing 0.4% BSA, Carl Zeiss. At least 10 embryos were examined, and at least 10 presumptive diploid four-cell parthenote embryos were collected points were examined in each embryo. MITOCHONDRIAL DYSFUNCTION INFLUENCES PORCINE PARTHENOTE DEVELOPMENT 145

Table 1. List of primers used for quantitative real-time RT-PCR Genes GenBank accession no. Primer sequence Annealing temperature (C) Product size H2a BF703857 F: TTTCCGCGGTCAGGTACTCC R: GTGGCAAACAGGGAGGCAAG 60 177 Bcl-xL AF216205 F: GGAGCTGGTGGTTGACTTTC R: CTAGGTGGTCATTCAGGTAAGG 60 518 Bak AJ001204 F: CTAGAACCTAGCAGCACCAT R: CGATCTTGGTGAAGTACTC 60 151 Casp3 NM_214131 F: GAGGCAGACTTCTTGTATGC R: CATGGACACAATACATGGAA 55 236 Cox5a XM_001926181 F: GGAATTGCGTAAAGGGATGA R: CATTTTGTCAAGGCCCAGTT 55 247 Cox5b NM_001007517 F: CTATGGCATCTGGAGGTGGT R: ACAGATGCAGCCCACTATCC 55 191 Cox6b1 NM_001097497 F: CTGAGAGCCCTACCAGCATC R: GTCACCCCCTTTAGCAGTCA 55 199 Map1lc3b NM_001190290 F: CCGAACCTTCGAACAGAGAG R: AGGCTTGGTTAGCATTGAGC 60 206 Lamp2 XM_001926458 F: CACCCACTCCAAAGGAAAAA R: GGTTGTCGTTTTTCACAGCA 60 246 F: forward. R: reverse.

Real-time reverse transcription polymerase chain reaction (RT- are sequence-specific, nonspecific PCR products could be distin- PCR) guished from specific ones. The crossing point (CP) must be Approximate 10 blastocysts were washed in Ca2+- and Mg2+-free determined for each transcript to generate the mathematical model. PBS, snap-frozen in liquid nitrogen and stored at –70 C. Messen- CP is defined as the point at which the fluorescence rises apprecia- ger RNA was extracted using the Dynabeads mRNA Direct Kit bly above the background fluorescence. The relative quantification (Dynal Asa, Oslo, Norway) according to the manufacturer’s of gene expression was analyzed by the 2-ddCt method [24]. In all instructions. Synthesis of cDNA was achieved by reverse tran- experiments, H2a mRNA was used as an internal standard. scription of the RNA using the Oligo (dT)12–18 primer and the superscript reverse transcriptase enzyme (Invitrogen, Grand Island, Transmission electron microscopy NY, USA). The mRNA of Bcl-xL , Bak, Caspase3 (Casp3), cyto- Blastocysts developed from H2O2-treated four-cell embryos chrome oxidase (Cox) 5a, Cox5b, Cox6b1, microtubule-associated were fixed in 2% glutaraldehyde in dPBS. The specimens were protein 1 light chain 3 beta (Map1lc3b), lysosomal-associated then postfixed in 2% OsO4 for 1 h, dehydrated in a graded ethanol membrane protein 2 (Lamp2) and histone H2a (H2a) species was series (50, 70, 80, 95 and 100%) and embedded in epoxy resin. then detected by real-time RT-PCR with specific primer pairs Ultrathin sections were cut with a diamond knife and poststained (Table 1). The PCR reactions were performed according to the first with 1% uranyl acetate in 30% ethanol and then with Reynolds instructions of the real-time PCR machine manufacturer (DNA lead citrate. Engine Opticon 3 fluorescence detection system, MJ Research, Waltham, MA, USA). The threshold cycle (Ct) value represents Statistical analysis the cycle number at which sample fluorescence rises statistically The general linear models (GLM) procedure in the statistical significantly above the background. The reactions were conducted analysis system [25] was used to analyze data from all experiments. according to the protocol of the DyNAmo SYBR green qPCR kit Significant differences were determined using Tukey’s Multiple containing modified Tbr DNA polymerase, SYBR Green, opti- Range Test [26] with P<0.05 considered significant. A paired Stu- mized PCR buffer, 5 mM MgCl2 and dNTP mix including dUTP dent’s t-test was used to compare relative gene expression. (Finnzymes). PCR was performed as follows: the denaturation program was performed at 95 C for 10 min; the amplification and Results quantification program was performed 40 times at 95 C for 10 sec,

55 or 60 C for 30 sec and 72 C for 30 sec with a single fluorescence Effect of H2O2 on parthenote development and number of cells measurement; the melting curve program was performed at 65–95 in the blastocyst C, with a heating rate of 0.2 C/sec and continuous fluorescence H2O2 of different concentrations was added in NCSU37 medium measurement; and finally a cooling step to 12 C was perfomed. containing 0.4% BSA, and the effect of H2O2 on embryo develop- Fluorescence data were acquired after the extension step during ment was studied. The development rates of porcine four-cell PCR reactions containing SYBR Green. Thereafter, PCR products parthenotes cultured for 5 days in NCSU37 medium containing were analyzed by generating a melting curve. Since melting curves 0.4% BSA were not significantly different from those in cultures 146 XU et al.

Fig. 1. The effect of H2O2 treatment on development to the blastocyst stage (A) and on total cell numbers in blastocysts (B). H2O2 treatments: 0 (control), 50 μM, 100 μM and 500 μM H2O2. Statistically significant differences are indicated by asterisks (P<0.05). Values are means ± SEM of four separate experiments.

supplemented with 50 μM and 100 μM H2O2 (56.5 ± 5.3 and 57.5 ± copy (Fig. 3A). The apoptotic index (fragmented cell number/total 2.9%) but significantly were decreased in cultures supplemented cell number) in blastocysts derived from cultures supplemented with 500 μM H2O2 (23.1 ± 4.5%) compared with parthenotes cul- with 100 μM and 500 μM H2O2 (10.3 ± 1.1 and 10.8 ± 0.8%) was tured without H2O2 (58.3 ± 5.2%, control, P<0.05, Fig. 1A). higher than in the in vitro-derived control group (5.8 ± 0.9%, Blastocysts were stained with PI to label all nuclei and counted P<0.05, Fig. 3B). under a fluorescence microscope (Olympus, Tokyo, Japan). At day To determine whether H2O2 induced autophagy, we examined 7 (after activation), the mean cell number in blastocysts derived the localization of LC3 expression in the porcine blastocysts from treatment with 100 μM and 500 μM H2O2 (38.3 ± 4.3 and 33.0 derived from the control and treatment group. Following addition ± 2.3) was significantly lower than in the control group (50.9 ± 4.3, of 100 μM and 500 μM H2O2 to the culture medium, the amount of P<0.05; Fig. 1B). LC3 protein was significantly increased compared with that of the control group (Fig. 4A and 4B; 43.1 ± 18.2 vs. 95.3 ± 20.7 and

Effect of H2O2 on mitochondria at the blastocyst stage 118.2 ± 20.8, respectively, P<0.05). To investigate the effect of H2O2 on mitochondrial distribution, the blastocysts were stained with Hoechst 33342 to label all nuclei Effect of H2O2 on apoptotic-, autophagic- and mitochondrial- and by MitoTracker to label mitochondria and were analyzed by related gene expression epifluorescent and confocal microscopy. Treatment with 100 μM To investigate whether 100 μM and 500 μM H2O2 modulates H2O2 for 5 days resulted in no difference in MitoTracker Green flu- mRNA expression of apoptotic-related genes in porcine par- orescence at the blastocyst stage (data not shown). However, thenotes developing in vitro, the relative amounts of Casp3, Bak embryos that were exposed to 500 μM H2O2 showed a significant and Bcl-xL mRNA expression in blastocysts cultured in NCSU37 decrease in MitoTracker Green fluorescence at the blastocyst stage medium containing 0.4% BSA supplemented with (100 μM and compared with that of the control (Fig. 2A and 2B; 198 ± 36.0 vs. 500 μM) or without H2O2 were measured by real-time RT-PCR. 71.3 ± 18.7, P<0.05). Mitochondria of blastocysts from the control Supplementation with 100 μM and 500 μM H2O2 increased the and treatment group are shown by representative transmission elec- mRNA expression level of Casp3 and Bak (P<0.05) and decreased tron microscopy photomicrographs. As shown in Fig. 2C, more the mRNA expression level of Bcl-xL (P<0.05, Fig. 5A). mitophagy (abnormal mitochondria) and autophagic vacuoles were To investigate whether 100 μM and 500 μM H2O2 modulates formed in the cytoplasm of the H2O2-treated group (Fig. 2Cb) com- mRNA expression of autophagic- related genes in porcine par- pared with the control group (Fig. 2Ca), but there was no difference thenotes developing in vitro, the relative amounts of Map1lc3b and in the nucleus and other organelles. This result indicates that H2O2 Lamp2 mRNA expression in blastocysts cultured in NCSU37 con- treatment decreased the mitochondrial mass as well as the number taining 0.4% BSA medium supplemented with (0, 100 and 500 of mitochondrial structures in the blastocysts. μM) or without H2O2 were measured by real time RT-PCR. Treat- ment with 100 μM or 500 μM H2O2 significantly increased the

Effect of H2O2 on apoptosis and autophagy in the blastocysts mRNA expression levels of Map1lc3b and Lamp2 in the blasto- To determine whether H2O2 induces apoptosis, blastocysts were cysts (P<0.05, Fig. 5B). stained with PI to label all nuclei and by TUNEL to label apoptotic To investigate the effect of H2O2 on mitochondrial-related gene nuclei and were analyzed by epifluorescent and confocal micros- expression, we detected the mRNA expression level of mitochon- MITOCHONDRIAL DYSFUNCTION INFLUENCES PORCINE PARTHENOTE DEVELOPMENT 147

Fig. 2. Laser scanning confocal microscopy images (A, 400×) of mitochondria in blastocyst stage embryos. Blue, chromatin (Aa and Aa’); green, mitochondria stained by MitoTracker (Ab and Ab’); merge (Ac and Ac’). Intensity of MitoTracker Green FM was measured with the ZEN software from Carl Zeiss (B). Representative transmission electron microscopy photomicrographs of mitochondria derived from blastocysts (C, 5000×). Formation of autophagic vacuoles and mitophagy by H2O2 treatment. Ca: control; Cb: treatment with 500 μM H2O2. White arrowheads: normal mitochondria. Black arrowheads: autophagic vacuoles. Arrows: mitophagy. Statistically significant differences are indicated by asterisks (P<0.05). drial-related genes, Cox5a, Cox5b and Cox6b1, which are encoded thenotes at the four-cell stage 48 h after activation. Our results by nuclear DNA, in blastocysts by real-time RT-PCR. No signifi- show that the developmental rate did not change in the group sup- cant difference was detected in the mRNA expression levels of plemented with 100 μM H2O2 but was significantly decreased in Cox5a, Cox5b and Cox6b1 between the control and H2O2-supple- the group supplemented with 500 μM H2O2 (P<0.05). Similar mented groups (Fig. 5C). effects of H2O2 on embryo development have been previously reported in bovine [31] and mouse [32] studies. Discussion In our study, treatment with 100 μM or 500 μM H2O2 decreased the cell number and increased apoptosis in the blastocyst stage. We

Hydrogen peroxide (H2O2) has been implicated as a key mole- found that addition of H2O2 significantly increased the percentage cule in arresting embryonic development [27]. ROS such as H2O2, of apoptotic TUNEL-labeled nuclei in the blastocysts. Similarly, superoxide anions and hydroxyl radicals can damage cell mem- Yang et al. [30] have also shown that H2O2 production directly cor- branes [28] and DNA [29] and might play a role in apoptosis [30]. relates with the increased fragmentation rate of human embryos

In this study, we demonstrated that H2O2 affected rates of develop- and cell death by apoptosis, and H2O2 has also been shown to medi- ment of four-cell parthenotes to the blastocyst stage and cell ate apoptosis in blastocysts [33]. The enhancement of the TUNEL numbers, mitochondrial distribution, apoptosis and autophagy in index might be explained partially by the increase in the number of the blastocyst stage. apoptotic cells per embryo and partially by the decrease in the total The experiments presented here were performed with embryos cell number in the blastocysts. The propensity of the cell to of homogenous quality by selecting good quality porcine par- undergo apoptosis is continuously counterbalanced by genes that 148 XU et al.

Fig. 3. Laser scanning confocal microscopic images of total nuclei (red) and fragmented DNA (green) in porcine blastocysts (400×). a and c: control. b and d: 100 μM and 500 μM H2O2 treatment (A). The effect of H2O2 treatment on the apoptotic rate (number of apoptotic cells/number of total cells) in blastocysts (B). H2O2 treatment: 0 (control), 50 μM, 100 μM and 500 μM H2O2. Statistically significant differences are indicated by asterisks (P<0.05), respectively. Values are means ± SEM of four separate experiments.

Fig. 4. Laser scanning confocal microscopic images of total nuclei (blue) and autophagy (LC3; green) in porcine blastocysts obtained after in vitro culture of four-cell parthenotes for 5 days (A, 400×). Embryos were stained with Hoechst 33342 (a, a’ and a’’) and FITC-conjugated secondary antibody for anti-LC3 (b, b’ and b’’). The merged images are presented in green and blue for FITC-conjugated and Hoechst 33342 (c, c’ and c’’), respectively. Intensity of LC3 was measured with the ZEN software from Carl Zeiss (B). Statistically significant differences are indicated by asterisks (P<0.05). MITOCHONDRIAL DYSFUNCTION INFLUENCES PORCINE PARTHENOTE DEVELOPMENT 149

xl, A1 and Mcl-l) and pro-apoptotic (Bax, Bak, Box, Bik, Blk, HrK, Bnip3, Bim, Bad, Bid and Bcl-xs) genes. During embryogenesis, the Bcl-2 gene family controls developmental programmed cell death. In contrast, another group of highly conserved genes are positive regulators of apoptosis; these genes translate into proteins, such as Bak, that are involved in the caspase cascade in the pig. In

the present study, treatment with H2O2 decreased the Bcl-xL mRNA expression and increased the Casp3 and Bak mRNA expression,

indicating that H2O2 induced apoptotic-related gene expression. Apoptosis results from changes in mitochondrial integrity caused by various effectors, such as Ca2+, ROS or production of Bak, that lead to the release of cytochrome c and activation of the

caspase cascade [8]. As a mechanism of H2O2-induced apoptosis, H2O2 has been suggested to activate mitochondrial permeability transition pores and release mitochondrial cytochrome c [34]. It has also been reported that Bcl-2, a mitochondrial regulatory pro-

tein of apoptosis, regulates H2O2-induced apoptosis in HL-60 cells [34]. In the presence of cytochrome c and dATP, Apaf1 interacts with pro-Casp9, thereby activating Casp9, which in turn activates

Casp3 [35]. In the present study, treatment with H2O2 enhanced Casp3 and Bak gene expression and decreased Bcl-xl gene expression. Cytochrome c oxidase is an important energy-generating enzyme critical for the proper functioning of most cells. In mammalian tissues, Cox5a, Cox5b and Cox6b1 are encoded in the nucleus and synthesized in the cytoplasm [36]. In the present study, no significant difference was detected in the mRNA expression levels of Cox5a, Cox5b and Cox6b1 between the control and

H2O2-supplemented groups. However, we showed that embryos treated with a high concentration of H2O2 exhibited a significant decrease of mitochondrial mass and show was a significant decrease of the number of mitochondrial structures in the blastocysts. Similar results have also been observed in mouse embryos;

treatment of mouse zygotes with H2O2 causes a decline in mitochondrial membrane potential and mitochondrial malfunction [32].

This observation supports the hypotheses that H2O2 induces mitochondrial stress, a rapid decrease in the mitochondrial transmembrane potential and the release of cytochrome c. Treat-

ment with H2O2 may also lead to the release of cytochrome c and changes in the mitochondrial transmembrane potential, which then lead to apoptosis. Autophagy, a process by which eukaryotic cells degrade and recycle macromolecules and organelles, has an important role in Fig. 5. Relative abundance of apoptotic- (A), autophagic- (B) and the cellular response to oxidative stress [37]. Recently, several mitochondrial-related (C) gene expression analyzed by real- studies have indicated that ROS are also involved in the induction time RT-PCR. H2a was used as the internal reference. Open of autophagy in many cell types [2, 38, 39]. In the present study, μ bars: control. Black bars: 100 M H2O2 added. Gray bars: 500 we first found the autophagy in porcine embryos subjected to oxi- μM H2O2 added. Statistically significant differences are indicated by asterisks (P<0.05). Values are means ± SEM of dative stress conditions. Our results showed that embryos that four separate experiments. were cultured in the presence of H2O2 in NCSU37 medium had significantly enhanced expression of LC3 protein, which is a marker

for the presence of autophagosomes. The addition of H2O2 also enhanced the expression of autophagic-related genes Map1lc3b stimulate cell survival and proliferation. Cory and Adams [4] orig- and Lamp2. Transmission electron microscopy images clearly inally reported that members of the Bcl-2 gene family play key showed that more mitophagy and autophagic vacuoles exist in the roles in regulating apoptosis, and to date, at least 15 mammalian cytoplasm from the group supplemented with H2O2 compared with Bcl-2 gene family members have been identified. They have been that from the control group. Previous observations and the present categorized into two subgroups: anti-apoptotic (Bcl-2, Bcl-w, Bcl- study suggest that H2O2 may also lead to autophagy in porcine pre- 150 XU et al. implantation embryos. kinase complexes function in autophagy and carboxypeptidase Y sorting in Saccharo- In summary, we found increased expression levels of the pro- myces cerevisiae. J Cell Biol 2001; 152: 519–530. 16. Baehrecke EH. Autophagy: dual roles in life and death? Nat Rev Mol Cell Biol 2005; 6: apoptotic–related genes Casp3 and Bak, a decreased expression 505–510. level of the anti-apoptotic–related gene Bcl-xL and increased 17. Kirisako T, Ichimura Y, Okada H, Kabeya Y, Mizushima N, Yoshimori T, Ohsumi expression levels of the autophagic-related genes Map1lc3b and M, Takao T, Noda T, Ohsumi Y. The reversible modification regulates the membrane- Lamp2 in porcine preimplantation stage embryos. Overall, our binding state of Apg8/Aut7 essential for autophagy and the cytoplasm to vacuole tar- geting pathway. J Cell Biol 2000; 151: 263–276. study demonstrated that mitochondrial stress induced mitochon- 18. Noda T, Kim J, Huang WP, Baba M, Tokunaga C, Ohsumi Y, Klionsky DJ. Apg9p/ drial dysfunction that resulted in apoptosis and autophagy, which Cvt7p is an integral membrane protein required for transport vesicle formation in the are possibly related to porcine early embryo development. Cvt and autophagy pathways. J Cell Biol 2000; 148: 465–480. 19. Fortunato F, Bürgers H, Bergmann F, Rieger P, Büchler MW, Kroemer G, Werner J. Impaired autolysosome formation correlates with Lamp-2 depletion: role of apopto- Acknowledgments sis, autophagy, and necrosis in pancreatitis. Gastroenterology 2009; 137: 350–360. 20. Kadenbach B, Arnold S, Lee I, Huttemann M. The possible role of cytochrome c oxi- This study was supported financially by a grant from the dase in stress-induced apoptosis and degenerative diseases. Biochim Biophys Acta 2004; 1655: 400–408. BioGreen 21 program (201003010612110010400 and 21. Lee CS, Kim YJ, Ko HH, Han ES. Synergistic effects of hydrogen peroxide and etha- 201003010612110010500), Rural Development Administration nol on cell viability loss in PC12 cells by increase in mitochondrial permeability transi- (RDA), Republic of Korea. tion. Biochem Pharmacol 2005; 70: 317–325. 22. Takahashi M, Keicho K, Takahashi H, Ogawa H, Schultz RM, Okano A. Effect of oxidative stress on development and DNA damage in in-vitro cultured bovine References embryos by comet assay. Theriogenology 2000; 54: 137–145. 23. Yuan YQ, Van Soom A, Coopman FO, Mintiens K, Boerjan ML, Van Zeveren A, de Kruif A, Peelman LJ. Influence of oxygen tension on apoptosis and hatching in bovine 1. Piko L, Taylor KD. Amounts of mitochondrial DNA and abundance of some mito- embryos cultured in vitro. Theriogenology 2003; 59: 1585–1596. chondrial gene transcripts in early mouse embryos. Dev Biol 1987; 123: 364–374. 24. Livak KJ, Schmittgen TD. Analysis of relative gene expression data using real-time 2. Zhang H, Kong X, Kang J, Su J, Li Y, Zhong J, Sun L. Oxidative stress induces paral- quantitative PCR and the 2(Delta Delta C (T)) method. Methods 2001; 25: 402–408. lel autophagy and mitochondria dysfunction in human glioma U251 cells. Toxicol Sci 25. Cary NC. SAS User’s Guide: Statistics. Version 5, USA. 1985. 2009; 110: 376–388. 26. Steel RGD, Torrie JH. Principles and Procedures of Statistics. New York: McGraw 3. Shen XH, Jin YX, Ko YG, Chung HJ, Cui XS, Kim NH. High mobility group box 1 Hill Book Co., 1980. (HMGB1) enhances porcine parthenotes developing in vitro in the absence of BSA. 27. Velez-Pardo C, Morales AT, Del Rio MJ, Olivera-Angel M. Endogenously generated Theriogenology 2006; 66: 2077–2083. hydrogen peroxide induces apoptosis via mitochondrial damage independent of NF- 4. Cory S, Adams JM. Matters of life and death: programmed cell death at cold spring kappaB and p53 activation in bovine embryos. Theriogenology 2007; 67: 1285–1296. harbor. Biochim Biophys Acta 1998; 1377: 25–44. 28. Aitken RJ, Clarkson JS, Fishel S. Generation of reactive oxygen species, lipid peroxi- 5. Boise LH, González-García M, Postema CE, Ding LA, Lindsten T, Turka LA, Mao X, dation, and human sperm function. Biol Reprod 1989; 41: 183–197. Nuñez G, Thompson CB. Bcl-x, a Bcl-2 related gene that functions as a dominant reg- 29. Halliwell B, Aruoma OI. DNA damage by oxygen derived species. Its mechanism ulator of apoptotic cell death. Cell 1993; 74: 597–608. and measurement in mammalian systems. FEBS Lett 1991; 281: 9–19. 6. Jurisicova A, Latham KE, Casper RF, Casper RF, Varmuza SL. Expression and regu- 30. Yang HW, Hwang KJ, Kwon HC, Kim HS, Choi KW, Oh KS. Detection of reactive lation of genes associated with cell death during murine preimplantation embryo oxygen species (ROS) and apoptosis in human fragmented embryos. Hum Reprod 1998; development. Mol Reprod Devel 1998; 51: 243–253. 13: 998–1002. 7. Yang MY, Rajamahendran R. Expression of Bcl-2 and Bax proteins in relation to qual- 31. Kimura K, Spate LD, Green MP, Roberts RM. Effects of oxidative stress and inhibi- ity of bovine oocytes and embryos produced in vitro. Anim Reprod Sci 2002; 70: 159– tors of the pentose phosphate pathway on sexually dimorphic production of IFN-tau 169. by bovine blastocysts. Mol Reprod Dev 2004; 68: 88–95. 8. Nutt LK, Gogvadze V, Uthaisang W, Mirnikjoo B, McConkey DJ, Orrenius S. Indi- 32. Liu L, Trimarchi JR, Keefe DL. Involvement of mitochondria in oxidative stress- rect effects of Bax and Bak initiate the mitochondrial alterations that lead to cyto- induced cell death in mouse zygotes. Biol Reprod 2000; 62: 1745–1753. chrome c release during arsenic trioxideinduced apoptosis. Cancer Biol Ther 2005; 4: 33. Pierce GB, Parchment RE, Lewellyn AL. Hydrogen peroxide as a mediator of pro- 459–467. grammed cell death in the blastocyst. Differentiation 1991; 46: 181–186. 9. Gozuacik D, Kimchi A. Autophagy as a cell death and tumor suppressor mechanism. 34. Lee JE, Sohn J, Lee JH, Lee KC, Son CS, Tockgo YC. Regulation of bcl-2 family in Oncogene 2004; 23: 2891–2906. hydrogen peroxide-induced apoptosis in human leukemia HL-60 cells. Exp Mol Med 10. Yu L, Alva A, Su H, Dutt P, Freundt E, Welsh S, Baehrecke EH, Lenardo MJ. Regula- 2000; 32: 42–46. tion of an ATG7-beclin 1 program of autophagic cell death by caspase-8. Science 2004; 35. Li P, Nijhawan D, Budihardjo I, Srinivasula SM, Ahmad M, Alnemri ES, Wang X. 304: 1500–1502. Cytochrome c and dATP-dependent formation of Apaf-1/caspase-9 complex initiates 11. Pattingre S, Tassa A, Qu X, Garuti R, Liang XH, Mizushima N, Packer M, Schneider an apoptotic protease cascade. Cell 1997; 91: 479–489. MD, Levine B. Bcl-2 antiapoptotic proteins inhibit Beclin 1-dependent autophagy. Cell 36. Cui XS, Li XY, Jeong YJ, Jun JH, Kim NH. Gene expression of cox5a, 5b, or 6b1 and 2005; 122: 927–939. their roles in preimplantation mouse embryos. Biol Reprod 2006; 74: 601–610. 12. Suzuki K, Ohsumi Y. Molecular machinery of autophagosome formation in yeast, 37. Scherz-Shouval R, Elazar Z. ROS, mitochondria and the regulation of autophagy. Saccharomyces cerevisiae. FEBS Lett 2007; 581: 2156–2161. Trends Cell Biol 2007; 17: 422–427. 13. Xie Z, Klionsky DJ. Autophagosome formation: core machinery and adaptations. Nat 38. Lee SJ, Cho KS, Koh JY. Oxidative injury triggers autophagy in astrocytes: the role of Cell Biol 2007; 9: 1102–1109. endogenous zinc. Glia 2009; 57: 1351–1361. 14. Petiot A, Ogier-Denis E, Blommaart EF, Meijer AJ, Codogno P. Distinct classes of 39. Chen Y, Gibson SB. Is mitochondrial generation of reactive oxygen species a trigger phosphatidylinositol 3’-kinases are involved in signaling pathways that control mac- for autophagy? Autophagy 2008; 4: 246–248. roautophagy in HT-29 cells. J Biol Chem 2000; 275: 992–998. 15. Kihara A, Noda T, Ishihara N, Ohsumi Y. Two distinct Vps34 phosphatidylinositol 3-