J. Microbiol. Biotechnol. (2016), 26(3), 511–520 http://dx.doi.org/10.4014/jmb.1510.10102 Research Article Review jmb

Genomic Barcode-Based Analysis of Exoelectrogens in Wastewater Biofilms Grown on Anode Surfaces S Kerstin Dolch1, Jessica Wuske1, and Johannes Gescher1,2*

1Institute for Applied Biosciences, Department of Applied Biology, Karlsruhe Institute of Technology, Fritz-Haber-Weg 2, D-76131 Karlsruhe, Germany 2Institute for Biological Interfaces, Karlsruhe Institute of Technology, D-76344 Eggenstein-Leopoldshafen, Germany

Received: November 2, 2015 Revised: December 4, 2015 The most energy-demanding step of wastewater treatment is the aeration-dependent Accepted: December 10, 2015 elimination of organic carbon. Microbial fuel cells (MFCs) offer an alternative strategy in which carbon elimination is conducted by anaerobic microorganisms that transport respiratory electrons originating from carbon oxidation to an anode. Hence, chemical energy is

First published online directly transformed into electrical energy. In this study, the use and stability of barcode- December 23, 2015 containing exoelectrogenic model biofilms under non-axenic wastewater treatment conditions

*Corresponding author are described. Genomic barcodes were integrated in Shewanella oneidensis, Geobacter Phone: +49-721-608-41940; sulfurreducens, and G. metallireducens. These barcodes are unique for each strain and allow Fax: +49 721 608 41941; distinction between those cells and naturally occurring wild types as well as quantification of E-mail: [email protected] the amount of cells in a biofilm via multiplex qPCR. MFCs were pre-incubated with these three strains, and after 6 days the anodes were transferred into MFCs containing synthetic wastewater with 1% wastewater sludge. Over time, the system stabilized and the coulomb efficiency was constant. Overall, the initial synthetic biofilm community represented half of the anodic population at the end of the experimental timeline. The part of the community that contained a barcode was dominated by G. sulfurreducens cells (61.5%), while S. oneidensis and S upplementary data for this G. metallireducens cells comprised 10.5% and 17.9%, respectively. To the best of our knowledge, paper are available on-line only at this is the first study to describe the stability of a synthetic exoelectrogenic consortium under http://jmb.or.kr. non-axenic conditions. The observed stability offers new possibilities for the application of pISSN 1017-7825, eISSN 1738-8872 synthetic biofilms and synthetically engineered organisms fed with non-sterile waste streams. Copyright© 2016 by The Korean Society for Microbiology Keywords: Wastewater treatment, microbial fuel cell, Shewanella, Geobacter, barcoding, qPCR and Biotechnology

Introduction These organisms catalyze the efficient conversion of chemical energy stored in the organic carbon sources to The application of microbial fuel cells (MFCs) in a electrical energy if the anode is connected to an electrical wastewater treatment plant is one of many relevant techniques load and a cathode. that can be applied to advance the already 100-year-old Previously, it was shown that MFCs used with wastewater wastewater treatment process [23]. Carbon elimination in can produce energy while reducing the amount of organic wastewater treatment plants is conducted via aerobic carbon [4]. The anodic community was analyzed in a few organisms that oxidize the organic carbon sources in a studies. Of the detected organisms, some were closely respiratory step. The wastewater aeration is the most related to microorganisms that were shown to transfer energy-consuming step during the treatment process. To respiratory electrons onto an anode [13]. Deltaproteobacteria reduce costs, an MFC could be implemented in place of the comprising the genus Geobacter seem to play a particularly aerobic oxidation step. Here, microorganisms use a solid key role in many communities, while other reports describe anode as an electron acceptor for anaerobic respiration. wastewater-fed communities on anodes that were dominated

A 2016 ⎪ Vol. 26⎪ No. 0 512 Dolch et al.

by members of the Bacteroidetes, Betaproteobacteria, and with 1% wastewater sludge. The current density, total Gammaproteobacteria [14]. It is largely unknown how amount of organic carbon (TOC), and coulomb efficiency these organisms contribute to the electron transfer process were measured over time. at the anode. Moreover, the anode serves as a nonspecific surface for biofilm growth that can be occupied by Materials and Methods microorganisms that do not contribute to the transfer of electrons. To improve the performance of an MFC, the Strain Preparations anodic microbial community must be selected and The barcodes were integrated into a non-coding region of the monitored [10]. This will be a major challenge for future genomes of S. oneidensis, G. sulfurreducens, G. metallireducens, and fuel cell research because tools have not been established to E. coli, with a space of at least 100 bp to adjacent coding regions. assemble tailored biofilms under non-axenic conditions or The synthetic sequences were designed with GeneDesign software to exclude the formation of secondary structures and ensure even to understand the functional role of all major binding of qPCR primers to the designated sequences only [25]. contributors of anode biofilm communities [22]. An overview of all strains and plasmids used in this study is Models for extracellular respiratory organisms, also called shown in Tables S1 and S2, and the primers are shown in Table 1. exoelectrogens, are Shewanella spp. and Geobacter spp. Barcoded strains are referred to with a subscript bc on each strain Whereas Shewanella oneidensis is a facultative anaerobic name. An overview of the insertion site of the barcoded strains is microorganism that can use a wide variety of electron shown in Fig. S1. acceptors [31], not all strains of Geobacter can grow in the Integration of the barcode into the S. oneidensis genome was presence of oxygen. Geobacter sulfurreducens can tolerate up conducted using the suicide vector pMQ150. The plasmid was to 10% oxygen [16], whereas Geobacter metallireducens is linearized with BamHI and SalI (New England Biolabs, Frankfurt strongly inhibited by oxygen. However, G. metallireducens am Main, Germany). Primers 1 and 4 were designed with a is extremely versatile in terms of the electron donors it can homology of 35 nt to the ends of the linearized plasmid. Primer use [1]. Many studies have analyzed the abilities of sets 1-2 and 3-4 were used to amplify a region of 500 bp upstream and downstream, respectively, of the insertion site. The two S. oneidensis and G. sulfurreducens in terms of biofilm growth fragments were assembled using a subsequent PCR step with on anodes. Whereas S. oneidensis seems to form rather thin primers 1 and 4. This was possible because primers 2 and 3 films, G. sulfurreducens can form several-micrometer-thick overlapped with 25 nt. These primers further contained the biofilms that are conductive [20]. barcode sequence. The entire fragment was cloned into the linear Hence, the three organisms have characteristics that plasmid according to the isothermal assembly method described would, in combination, form an organism that is extremely by Gibson et al. [8]. Afterwards, the plasmid was transformed in robust and can use a multitude of electron donors and Escherichia coli WM3064 and subsequently transferred into S. oneidensis acceptors. Instead of combining the characteristics in one MR-1 using conjugation; integration was described elsewhere [27]. organism, the combination of their abilities in a synthetic Integration of the barcode into G. sulfurreducens was performed three-organism biofilm would potentially be almost as using 602- and 601-bp-long fragments upstream and downstream efficient. Moreover, all three strains are genetically tractable. of the insertion site, amplified using primer sets 5-6 and 7-8. The Hence, the stable cultivation of synthetically engineered primers 9 and 10 were used for the amplification of a kanamycin resistance cassette from the plasmid pSCVAM. Primers 6 and 9 as Geobacter and Shewanella strains under non-axenic conditions well as 7 and 10 had a 25 bp overlap for assembly in a consecutive makes it possible to use available waste streams for PCR. The overlapping region of primers 7 and 10 was part of the biotechnological processes without prior costly deactivation. barcode sequence. The three PCR fragments were assembled via It was the aim of this study to analyze how stable a PCR and cloned in the plasmid pJET 1.2 using the CloneJET PCR community of model organisms would be under wastewater Cloning Kit according to the manufacturer`s instructions (Fermentas, treatment conditions. To monitor the three exoelectrogens St. Leon-Rot, Germany). The 2.2 kbp insert was amplified with and distinguish them from naturally occurring wild types primers 5 and 8 and transformed into G. sulfurreducens as described in wastewater sludge, barcodes were integrated into their by Coppi et al. [5]. As a minor modification, agar plates containing genomes. A barcode is a synthetic and unique DNA 35 µg/ml instead of 25 µg/ml kanamycin were used. sequence that is integrated in a non-coding region so that Integration into G. metallireducens was similar, but an upstream the phenotype does not change. Microbial electrochemical fragment of 598 nt (primers 11 and 12), the kanamycin resistance systems were started with all three strains at the same time. sequence (primers 13 and 14), and the 599 nt downstream sequence (primers 15 and 16) were amplified via PCR. The entire construct After the current density was stabilized, the anodes were was ligated via isothermal assembly into the HindIII (New England transferred into new setups containing synthetic wastewater

J. Microbiol. Biotechnol. Synthetic Biofilms on Anodes 513

Table 1. List of all primers that were used in this study. Number Sequence 1 AACGACGGCCAGTGCCAAGCTTGCATGCCTGCAGGTCTCGCCAAACGGCTGGTT 2 GCTCACACGGAGAGCAAGGAGAACGCACACCAATGCCAAGTACAGTCAAGATAAAAACTTGTTACCCAGT 3 CGTTCTCCTTGCTCTCCGTGTGAGCCTACAGCGGCATCCGAGCCGTGTTTACTGCTCTATGCCTTGAG 4 TGACCATGATTACGAATTCGAGCTCGGTACCCGGGAGCAGAGACGAGTAATAGGG 5 GTAGGCAAGGGAGAACAGC 6 ATTTTGAGACACAACGTGGCCCCCCACCTCCACCAGG 7 ACTTCTCCTGTCCTTCACCTCGGTGTCCTTCCTGCCAAGTGTTCTGTTCATGTTCTTCTCTCCTCCTCCTATCCGGCCGATCGTATCG GGAGTTTCTCCTGCTCG 8 AGGCTGGATCGCCTGGGT 9 CTGGTCCTGGTGGAGGTGGGGGGCCACGTTGTGTCTCAAAAT 10 CACTTGGCAGGAAGGACACCGAGGTGAAGGACAGGAGAAGTGAGGTGAGATGCAAGGAGGA- GACGGAGAGGTAGGTCGATAGAACCGTTAGAAAAACTCATCGAGCATC 11 TAACGCCAGGGTTTTCCCAGTCACGACGTTGTAAAACGACGGCCAGTGCCCATACCCTTCCTTCTCCAG 12 CAGAGATTTTGAGACACAACGTGGCGAAAGAGTGGCGCTACGGA 13 CCCAGCTCCGTAGCGCCACTCTTTCGCCACGTTGTGTCTCAAAAT 14 CGTAGAGGAACCAGCAAGGCTTGTCGGCAAGTC GGTATCATACAGAGCACGGCTTAGAAAAACTCATCGAGCATC 15 GTGCTCTGTATGATACCGACTTGCCGACAAGCCTTGCTGGTTCCTCTACGATGGCGGGATGGGCTTTGGAGA 16 AATTCGAGCTCGGTACCCGGGGATCCTCTAGAGTCGACCTGCAGGCATGCCTGATTGCGACCAGTTCAC 17 GACGGATGGCCTTTTTGCGTGGCCAGTGCCAAGCTTGCATGCCTGCAGGTCCAAGCTTGCATGCCTGCCTGCAG 18 TCAGTGATAAGCTGTCAAACATGAGAATTCGAGCTCGGTACCCGGGGATCTTCGAGCTCGGTACCCGG The primer numbers are used in the Materials and Methods section to indicate for which experiments the individual oligonucleotides were used.

Biolabs) linearized plasmid pk18mob_amp. The transformation of nitrate was used for G. metallireducens. No electron acceptors in G. metallireducens was performed according to Oberender et al. addition to the anode were added to the medium in the MEC [21]. As a minor modification, anoxic aqua bidest was used for experiments. The minimal medium contained 12.5 mM sodium resuspension of the cells. lactate and 5 mM sodium propionate as electron donors. E. coli Insertion of the barcode into E. coli was conducted using the strains were cultured in lysogeny broth medium at 37°C. vector system described by Haldimann and Wanner [9]. The synthetic sequence was synthesized by GenScript (Piscataway, NJ, MEC Setup and Electrochemical Measurements USA) and amplified with primers 17 and 18. The primers also MECs were operated in a two-chamber setup as described contained homologous regions to the vector pAH162 that was elsewhere [30]. The working electrode material was graphite felt cleaved with BamHI and SalI (New England Biolabs). The amplicon GFD2 EA (2 mm thick) from SGL Group, Carbon Company was ligated into the linearized plasmid pAH162 via isothermal in (Meitingen, Germany) [15]. Prior to use, the electrodes were first vitro ligation [8]. The plasmid was inserted into the E. coli genome rinsed with isopropanol and thereafter installed in the MEC as described previously [9]. A schematic overview of the strain before filling it with deionized water and autoclaving. The preparations is depicted in Fig. S2. electrodes were connected via platinum wires (0.1 mm; Chempur, Karlsruhe, Germany) to a potentiostat (Pine Instruments, Grove Bacterial Strains and Growth Conditions City, PA, USA). A saturated calomel electrode (Sensortechnik Prior to microbial electrochemical cell (MEC) experiments, Meinsberg GmbH, Ziegra-Knobelsdorf, Germany) was used as the microbial strains were pre-grown in the minimal medium adapted reference. from Dolch et al. [6] with minor changes. The final concentrations The anode chamber was filled with 2 L of minimal medium that of yeast extract, cysteine, and CaCl2 were 0.2% (w/v), 2.5 mM, and did not contain any electron acceptor. It was continuously flushed

0.4 mM, respectively; 0.02% peptone was added. The medium was with 80/20 N2/CO2 to maintain a constant anoxic environment supplemented with 20 mM sodium lactate and 40 mM disodium with a stable pH. The optical densities of the bacterial cultures fumarate for S. oneidensis and with 20 mM sodium lactate, 10 mM were measured at 655 nm, and the starting cell density of each acetate, and 40 mM disodium fumarate for G. sulfurreducens; strain in the anodic chamber was 0.04. All MEC experiments were whereas. 10 mM acetate, 4.4 mM propionate, and 10 mM sodium started in independent sextets at a constant temperature of 30°C.

March 2016 ⎪ Vol. 26⎪ No. 3 514 Dolch et al.

The anodes were poised to a constant potential of 0.241 V vs. the from Leica (Wetzlar, Germany). The filter sets L5 (excitation filter normal hydrogen electrode (NHE). 480/40 and suppression filter 527/30), Y3 (545/30 and 610/75), Measurements were stopped after 6 days. Three anodes were and A4 (360/40 and 470/40) were used for FITC, Cy3, and DAPI, immediately transferred to new setups containing anoxic synthetic respectively. Picture stacks were assembled using ImageJ [24]. wastewater according to ISO 11733 [11] (0.02% (w/v) peptone, 0.01% (w/v) meat extract, 0.1 mM glucose-monohydrate, 0.4 mM Extraction of DNA

NH4Cl, 0.1 mM KH2PO4, 0.2 mM Na2HPO4·2H2O, 3.5 mM NaHCO3, After completion of the MEC program, DNA was extracted

1.0 mM NaCl, and 0.148 mM FeCl3·6H2O). As a minor medium using the innuPREP Stool DNA Kit from Analytic Jena (Jena, modification, deionized water was used instead of potable water Germany) according to the manufacturer’s instructions. Whole

because of the high amount of carbonate in potable water from anodes were used for the lysis step after addition of E. colibc Karlsruhe. At the same time, the constant gas flow through the cultures as an internal standard. Standard curves were compiled system was stopped, and the fuel cells were slowly stirred instead. using serial dilutions of pure cultures after counting in an As an additional inoculum, 1% of a mixture of aerobic and improved Neubauer counting chamber (Marienfeld, Lauda- anaerobic wastewater sludge from the wastewater treatment plant Königshofen, Germany). The individual dilution steps from all in Karlsruhe, Germany was added. The standard measurement three strains were pooled in one vial prior to DNA extraction. protocol consisted of measuring the current at 0.241 V vs. NHE for From each of the six dilution steps, DNA was extracted in 14 days. The three remaining MFCs were used for cell quantification triplicate according to the manufacturer’s instructions. It was also and fluorescent in situ hybridization (FISH) analysis (Fig. 1). isolated from the wastewater sludge as a negative control for the qPCR experiment. Fluorescent in situ Hybridization An additional goal was to estimate the percentage of the starter Fluorescent in situ hybridization analysis was conducted community consisting of the three barcode strains within the according to Dolch et al. [6]. All fluorescent probes that were anode consortium after further inoculation with wastewater employed for the analysis are listed in Table 2. sludge. Therefore, the amount of DNA resulting from the addition

Images were taken with a Leica DM 5500 B microscope using a of E. colibc cells was subtracted from the amount of total isolated 63× water immersion lens and a DFC 300 FX digital color camera DNA. By comparing the DNA concentrations prior to and after

Fig. 1. Work flow. In phase I, the three strains were incubated at 241 mV vs. NHE in a bicarbonate-buffered medium for 6 days. Afterwards, one MEC was used for FISH, two for qPCR, and three for transferring the anodes into new MECs and starting the second phase. In phase II, the MECs were run with synthetic wastewater and 1% wastewater sludge. After 14 days, one MEC was used for FISH and two for qPCR.

J. Microbiol. Biotechnol. Synthetic Biofilms on Anodes 515

Table 2. Fluorescently labeled oligonucleotide probes and helper oligonucleotides used for fluorescent in situ hybridization experiments. Probe Target Sequence (5‘ → 3‘) Specificity Reference FA [%] ARCH915 16S rRNA GTGCTCCCCCGCCAATTCCT Archaea [2] 20 EUB388-I 16S rRNA GCTGCCTCCCGTAGGAGT Bacteria [2] 0−50 GEO3-A 16S rRNA CCGCAACACCTAGTACTCATC Geobacter cluster [26] 30 GEO3-B 16S rRNA CCGCAACACCTAGTTCTCATC Geobacter cluster [26] 30 HGEO3-3 Helper probes for GEO3 GTTTACGGCGGGTACTACC [26] HGEO3-4 Helper probes for GEO3 CACTGCAGGGGTCAATAC [26] addition of wastewater sludge, we could calculate the percentage pairing or primer-dimer formation was not detectable. All of residual barcode-containing cells. The DNA concentration was experiments were accompanied with no-template controls, and measured using a NanoDrop 2000 Spectrophotometer (ThermoScientific, the isolated DNA from the wastewater sludge was used as a Schwerte, Germany). negative control. Standard curves were established using biological triplicates Quantitative PCR and applied on each qPCR plate. On the basis of standard curves, Strain-specific primers and hydrolysis probes were designed cell counts of each isolated DNA sample were determined. Cell with the software tool Beacon Designer (Premier Biosoft, Palo quantifications of the anode samples were based on three separate

Alto, CA, USA) to quantify the abundance of S. oneidensisbc, DNA samples from two independent MFCs. Quantitative PCR

G. sulfurreducensbc, and G. metallireducensbc in the MFCs via qPCR experiments with these samples were conducted in technical (Table 3). All qPCRs were conducted in a CFX96 Cycler (Bio-Rad, triplicates. The cell count per anode was calculated by multiplying Munich, Germany) using white polypropylene thin-walled plates the mean of the samples by the amount of lysis solution. (4titude, Wotton, UK) and adhesive qPCR seal (Sarstedt, Nümbrecht, Germany). A reaction volume of 20 µl was chosen as Electrical Conductivity suggested by the DyNAmo Flash qPCR Kit manual (Biozym, The conductivities of the anode media and the synthetic Hessisch Oldendorf, Germany). The primer (Sigma-Aldrich, wastewater were measured using an HI 99300 EC/TDS meter Steinheim, Germany) concentration was 0.5 µM, the hydrolysis (HANNA Instruments, Kehl am Rhein, Germany). probe (Biomers, Ulm, Germany) concentration was 0.25 µM, and 1 µl of template-DNA was added. The optimal annealing temperatures Analytical Measurements and Statistical Analysis as well as the efficiencies were determined using isolated DNA of Samples were taken daily for quantification of TOC using a the pure strains and temperature gradient qPCR with the DyNAmo multi N/C 2100S and TOC-Gas-Generator TG 600 from Analytik Flash SYBR Green qPCR Kit (Biozym, Hessisch Oldendorf, Jena (Jena, Germany). It was assumed that each consumed molecule Germany). The efficiencies at 60°C are shown in Table 3. Primer of organic carbon would have a redox state of 0 (following the

Table 3. Sequences of primers and probes used for real-time PCR experiments. Probe Sequence (5’ → 3’) Usage Efficiency R2

S.o. for GACTGTACTTGGCATTGG Quantification of S. oneidensisbc cells 94.8% 0.997 S.o. rev GATCCATTAGCACAGACTTA S.o. hydrolysis probe CGTTCTCCTTGCTCTCCGTGT

G.s. for CGGTTCTATCGACCTACC Quantification of G. sulfurreducensbc cells 93.1% 0.997 G.s. rev CTGCTTGATGAACGAGAG G.s. hydrolysis probe CTCACCTCACTTCTCCTGTCCTTC

G.m. for CCGTGCTCTGTATGATAC Quantification of G. metallireducensbc cells 99.7% 0.989 G.m. rev CAGGATTTCTCGAATTTCTC G.m. hydrolysis probe TGCTGGTTCCTCTACGATGGC

E.c. for GAAGGATAGTATGGGTGTCA Quantification of E. colibc cells 85% 0.998 E.c. rev GATCCTCCGCTTTCTCTC E.c. hydrolysis probe TCCCTGAATCCCAACTCGCTC

March 2016 ⎪ Vol. 26⎪ No. 3 516 Dolch et al.

simplified formula of organic carbon as (CH2O)n). Therefore, the period, this took almost 5 days. After subsequent additions, oxidation of one molecule of organic carbon to CO2 would lead to the carbon consumption stabilized to approximately 50 mg the release of four electrons. The coulomb efficiency was calculated organic carbon per day. by dividing the number of electrons transferred to the anode by To evaluate the efficiency of the bioelectrical systems the theoretical value. Statistical analysis was conducted by with respect to reducing the organic carbon load in calculating the median and the normalized median of absolute wastewater and thereby producing electricity, the coulomb deviation (MADN) [3] for the MFC data. The average and efficiency was used as a nominal value. In Fig. 2C, the standard deviation were calculated for cell number analysis. coulomb efficiency is shown over time. In the first 5 days, it increased steadily until a new carbon source was added. Results Thereafter, it stabilized and did not change after feeding. After 14 days, the coulomb efficiency was 7.3% ± 1.2%. Establishing a Biofilm on the Anodes The electrical conductivity of the medium was 8.1 mS/cm. Microbial Population Analysis During the 6-day initial monitoring period (phase I, Fig. 1), It was shown that the biofilm on the pre-incubated there was a steep increase in the current during the initial anodes together with wastewater sludge could produce hours followed by a plateau. After 6 days, the current current by oxidizing organic carbon in artificial wastewater. density was stable and reached 392.39 ± 209.73 µA/cm2 To analyze how the biofilm developed between the end of (Fig. S3). phases I and II, anodes were fixed and used for FISH analyses. At the end of phase I, all graphite felt fibers were Current Production of the Pre-Incubated Anodes in covered with a uniform and dense biofilm of bacteria Wastewater except between fiber crossings where more biomass The electrical conductivity after phase II was 0.6 mS/cm. production could be observed (Fig. 3A). The anode had The same potential, 241 mV vs. NHE, was applied, and the thicker biofilms around the fibers (almost 50 µm radius) current density was measured. There was immediate after 14 days in wastewater (Fig. 3B). Surprisingly, the current production without a detectable lag phase. When biofilm consisted only of bacteria. Therefore, the supernatant the current density dropped below the starting value, an of phase II was also stained for bacteria and archaea. Most identical dose of organic carbon was added. This procedure of the cells were grouped into flocks. In those flocks, some was repeated twice. Each time, an immediate increase in archaea (green) were detected (Figs. 3C and 3D). Additionally, current density occurred; however, the measured current the planktonic organisms in phase II were further stained was always lower than in phase I (Fig. 2A). with probe GEO3 to quantify the amount of Geobacteraceae in the planktonic phase. However, no fluorescence signal Reduction of Organic Carbon and Coulomb Efficiency was detectable, suggesting that Geobacteraceae were Before each addition of carbon, the TOC dropped to a localized to the anode surface only (Fig. 3D). level similar to the original value (Fig. 2B). In the first

Fig. 2. Analysis of current density, TOC concentration, and Coulomb efficiency in phase II of the experiment. The solid lines show the median of three independent MECs and the dashed lines the MADN. The dashed vertical lines indicate the addition of the synthetic wastewater. (A) Current density of three independent MECs in phase II. Anodes with exoelectrogens were transferred into anoxic synthetic media containing 1% wastewater sludge. (B) Amount of total organic carbon (TOC) in the MECs in phase II. (C) Coulomb efficiency of the MECs in phase II.

J. Microbiol. Biotechnol. Synthetic Biofilms on Anodes 517

Fig. 3. Fluorescent in situ hybridization images of the two phases. DNA was stained nonspecifically with DAPI (blue). Biofilm on the anode after (A) phase I and (B) phase II. Bacteria (EUB388-I) were stained in red and archaea (ARCH915) in green. Planktonic cells after phase II (C) stained with EUB388-I (red) and ARCH915 (green) and (D) GEO3 (red) and ARCH915 (green).

Survival of the Three Exoelectrogenic Strains dominant after 6 days of incubation both in the planktonic First, the limit of detection (LOD) was determined for each and in the sessile phase. We found 40.2 ± 7.1% of the strain separately and was 144 ≥ LOD ≥ 14.4 cells per reaction planktonic cells were S. oneidensisbc in phase I, whereas only for S. oneidensisbc, 154 ≥ LOD ≥ 30.8 for G. sulfurreducensbc, 6.7 ± 2.5% of the sessile cells accounted for this organism. and 404 ≥ LOD ≥ 40.4 for G. metallireducensbc. The Cq values The quantities of G. metallireducensbc cells in both fractions were used as internal controls and did not differ in the were smaller (Fig. 4). The total number of sessile cells was qPCR experiments by more than 1.7%. This assured that 8.81 × 1010 ± 4.79 × 1010. Hence, the average DNA content the solution was homogenous and that the quantification per cell was 10.8 ± 0.7 fg. procedure allowed comparison of values between different After transferring the anodes into synthetic wastewater bioelectrochemical setups. Prior to all fuel cell experiments, containing 1% sludge and further incubation for 14 days, the barcoded strains were characterized in growth 1.1 ± 0.1 mg DNA was isolated from the anodes. Using the experiments using nitrate or fumarate as electron acceptor above-quantified DNA content per cell and estimating that as described in the Materials and Methods section. During this value can be, to some extent, expanded to all bacterial these tests, no differences in growth characteristics could cells, 1.04 × 1011 ± 9.66 × 109 cells were expected to be part be observed, indicating that the integration of the barcode of the anodic biofilm. The amount of sessile barcode cells did not change the cell physiology (data not shown). decreased to 5.02 × 1010 ± 1.18 × 1010. Therefore, half (48.8 ± Even though pre-incubation was started with cell 11.3%) of the cells on the anode contained a barcode. Among suspensions of equal OD values, the cell numbers differed. the barcoded strains, the dominance of G. sulfurreducensbc This is most probably due to a difference in cell size. Hence was even more pronounced because it constituted 97.9 ± 2.6% the starting inoculum was composed of 28.9 ± 0.4% of all barcoded cells. Versus the initial biofilm composition

G. sulfurreducensbc cells, 45.5 ± 2.7% G. metallireducensbc cells, at the end of phase I, 61.5% of all G. sulfurreducensbc, 10.5% and 25.6 ± 3.2% S. oneidensisbc cells. G. sulfurreducensbc was of all S. oneidensisbc, and 17.9% of all G. metallireducensbc cells

March 2016 ⎪ Vol. 26⎪ No. 3 518 Dolch et al.

related strains. Hence, this barcode system can be used to analyze the influence of synthetic biofilms on the performance of an MFC or to monitor the prevalence of synthetically introduced production strains on anodes in waste streams. Because we lack an understanding of the ecology of microbial communities on anodes [22], this system further is a platform for studying microbial communities by monitoring their development under different applied potentials or process conditions. Of note, using this method, it is not possible to distinguish between live and dead cells. Moreover, it could be possible that extracellular DNA could influence the measurement, which would lead to an overestimation of the cell number. Still, DNA is a very good carbon source that can be used by a variety of organisms. Therefore, an accumulation of extracellular DNA in a non-axenic system will most likely not occur. Fig. 4. Distribution of the three barcoded strains at the end of phases I and II. Performance of the MFCs

The amount of cells of S. oneidensisbc (green), G. sulfurreducensbc (red), We have shown that the three exoelectrogenic strains and G. metallireducens (purple) was quantified by applying multiplex bc could establish a stable current-producing biofilm on the qPCR. A, Distribution of barcoded strains in the inoculum. B, anode in a bicarbonate-buffered medium in phase I. In Distribution of barcoded strains in the planktonic phase at the end of phase II, these anodes were transferred to a new setup phase I. C, Distribution of barcoded strains on the working electrode containing anoxic synthetic wastewater with 1% wastewater at the end of phase I. D, Distribution of barcoded strains on the working electrode at the end of phase II. In the planktonic samples sludge. Here, the current densities were always lower than from phase II, the amounts of cells were below the LOD value for each in phase I. One reasonable explanation could be the lower strain. The error bar indicates the deviation of two independent MECs electrical conductivity of the synthetic wastewater. The from each phase. current density dropped over time, although the TOC values showed that residual carbon was present. This potentially indicates that only a certain fraction of the TOC were retained on the anode surface. However, none of the was consumed by the community in the bioelectrochemical three strains was detected in the planktonic part of the cells. After approximately 8 days, the coulomb efficiency bioelectrochemical systems. stabilized. The lower efficiency compared with phase I is most probably due to the formation of gaseous end- Discussion products like hydrogen or methane by fermentative bacteria and methanogens, respectively. This is also in line Establishing Traceable Microorganisms with the detection of archaea in the planktonic phase after In this work, we developed four strains with synthetic phase II. The pre-incubated anodes could degrade 50 mg/l and unique DNA sequences (barcodes) inserted in their TOC per day, while anodes with only wastewater sludge genomes. Instead of deleting a gene with the barcode accumulated organic carbon (data not shown). This shows sequence [7], the barcode was integrated in a non-coding that although pre-incubated anodes might not be quite region of the genome. Therefore, the phenotypes of the sufficient to produce energy from wastewater, they reduced organisms remained unchanged. The barcode sequences more organic carbon. were used for cell quantification. By applying a standard Our focus on the established biofilm and how it curve of known cell counts for each strain, a multiplex developed led us to determine that pre-incubation resulted qPCR protocol was developed. This was a faster approach in a uniform and thin biofilm covering the graphite felt fibers. than staining with FISH probes and performing This biofilm became thicker in wastewater. Geobacteraceae fluorescence-activated cell sorting. However the most are known to be enriched in MFCs [13]. Therefore, the prominent advantage was that these barcodes distinguished planktonic cells were stained with GEO3 – a probe for the these strains from naturally occurring phylogenetically Geobacter cluster. Quite surprisingly, cells belonging to this

J. Microbiol. Biotechnol. Synthetic Biofilms on Anodes 519

cluster were absent in the planktonic phase nor were they Stahl DA. 1990. Combination of 16S rRNA-targeted detectable in the wastewater sludge. The amount of sessile oligonucleotide probes with flow cytometry for analyzing exoelectrogens declined in phase II relative to that found at mixed microbial populations. Appl. Environ. Microbiol. 56: the end of phase I. However, the barcoded organisms 1919-1925. represented half of the anodic population. It is known that 3. Babanova S, Bretschger O, Roy J, Cheung A, Artyushkova K, Atanassov P. 2014. Innovative statistical interpretation of G. sulfurreducens needs bicarbonate to grow [19]. Here, we Shewanella oneidensis microbial fuel cells data. Phys. Chem. showed that if Geobacter was pre-grown in a bicarbonate- Chem. Phys. 16: 8956-8969. buffered condition as part of a biofilm, it can survive and 4.Cha J, Choi S, Yu H, Kim H, Kim C. 2010. Directly most probably produce electricity in an anodic biofilm in applicable microbial fuel cells in aeration tank for wastewater without CO2 as a buffer. This agrees with the wastewater treatment. Bioelectrochemistry 78: 72-79. results of Jung and Regan [12], who found Geobacter spp. 5. Coppi MV, Leang C, Sandler SJ, Lovley DR. 2001. Development on an anode in a non-bicarbonate-buffered system. of a genetic system for Geobacter sulfurreducens. Appl. Environ.

The highest stability was that of G. sulfurreducensbc. Roughly Microbiol. 67: 3180-3187. 60% of the initial community size could be detected at the 6. Dolch K, Danzer J, Kabbeck T, Bierer B, Erben J, Forster AH, et al. 2014. Characterization of microbial current production end of phase II, while 20% of G. metallireducensbc and 10% of as a function of microbe-electrode-interaction. Bioresour. S. oneidensisbc cell counts after phase I could be quantified after phase II. The high stability of G. sulfurreducens cells Technol. 157: 284-292. 7. Gao H, Barua S, Liang Y, Wu L, Dong Y, Reed S, et al. 2010. can likely be explained by its ability to build dense Impacts of Shewanella oneidensis c-type cytochromes on multilayer biofilms [20]. aerobic and anaerobic respiration. Microb. Biotechnol. 3: 455- This study showed that it is possible to dictate the 466. microbial community of biofilms in non-axenic systems to 8. Gibson DG, Young L, Chuang RY, Venter JC, Hutchison a surprisingly high degree. Certainly, the amount of cells CA, Smith HO. 2009. Enzymatic assembly of DNA that can be retained will depend on the operating molecules up to several hundred kilobases. Nat. Methods 6: conditions of the MEC. This will be the basis of further 343-345. studies to analyze factors that positively influence this 9. Haldimann A, Wanner BL. 2001. Conditional-replication, process. Nevertheless, the integration of synthetic biofilms integration, excision, and retrieval plasmid-host systems for with certain abilities into waste streams not only offers the gene structure-function studies of bacteria. J. Bacteriol. 183: possibility to improve a carbon elimination process but 6384-6393. also enables the biotechnological use of waste streams 10. Ishii S, Suzuki S, Norden-Krichmar TM, Wu A, Yamanaka Y, Nealson KH, Bretschger O. 2013. Identifying the microbial without prior deactivation of the natural community. communities and operational conditions for optimized wastewater treatment in microbial fuel cells. Water Res. 47: Acknowledgments 7120-7130. 11. ISO. 2004. Water quality - determination of the elimination We gratefully acknowledge financial support received and biodegradability of organic compounds in an aqueous from Baden-Württemberg Stiftung under the program medium - activated sludge simulation test. ISO 11733:2004. “Umwelttechnologieforschung.” Furthermore, we thank 12. Jung S, Regan JM. 2011. Influence of external resistance on Frederik Golitsch for designing the MFC setup and Prof. electrogenesis, methanogenesis, and anode prokaryotic Boll from the University of Freiburg for providing the communities in microbial fuel cells. Appl. Environ. Microbiol. wild-type strain of G. metallireducens and the plasmid 77: 564-571. pK18mob. 13. Ki D, Park J, Lee J, Yoo K. 2008. Microbial diversity and population dynamics of activated sludge microbial communities participating in electricity generation in microbial fuel cells. References Water Sci. Technol. 58: 2195-2201. 14. Kim GT, Webster G, Wimpenny JW, Kim BH, Kim HJ, 1. Aklujkar M, Krushkal J, DiBartolo G, Lapidus A, Land ML, Weightman AJ. 2006. Bacterial community structure, Lovley DR. 2009. The genome sequence of Geobacter compartmentalization and activity in a microbial fuel cell. J. metallireducens: features of metabolism, physiology and Appl. Microbiol. 101: 698-710. regulation common and dissimilar to Geobacter sulfurreducens. 15. Kipf E, Koch J, Geiger B, Erben J, Richter K, Gescher J, BMC Microbiol. 9: 109. Zengerle R, Kerzenmacher S. 2013. Systematic screening of 2. Amann RI, Binder BJ, Olson RJ, Chisholm SW, Devereux R, carbon-based anode materials for microbial fuel cells with

March 2016 ⎪ Vol. 26⎪ No. 3 520 Dolch et al.

Shewanella oneidensis MR-1. Bioresour. Technol. 146: 386-392. 24.Rasband WS. 1997-2004. ImageJ. National Institutes of 16. Lin WC, Coppi MV, Lovley DR. 2004. Geobacter sulfurreducens Health, Bethesda, Maryland, USA. can grow with oxygen as a terminal electron acceptor. Appl. 25. Richardson SM, Nunley PW, Yarrington RM, Boeke JD, Environ. Microbiol. 70: 2525-2528. Bader JS. 2010. GeneDesign 3.0 is an updated synthetic 17. Lovley DR, Giovannoni SJ, White DC, Champine JE, Phillips biology toolkit. Nucleic Acids Res. 38: 2603-2606. EJ, Gorby YA, Goodwin S. 1993. Geobacter metallireducens 26. Richter H, Lanthier M, Nevin KP, Lovley DR. 2007. Lack of gen. nov. sp. nov., a microorganism capable of coupling the electricity production by Pelobacter carbinolicus indicates that complete oxidation of organic compounds to the reduction the capacity for Fe(III) oxide reduction does not necessarily of iron and other metals. Arch. Microbiol. 159: 336-344. confer electron transfer ability to fuel cell anodes. Appl. 18. Lutz R, Bujard H. 1997. Independent and tight regulation of Environ. Microbiol. 73: 5347-5353. transcriptional units in Escherichia coli via the LacR/O, the 27. Saltikov CW, Newman DK. 2003. Genetic identification of a TetR/O and AraC/I1-I2 regulatory elements. Nucleic Acids respiratory arsenate reductase. Proc. Natl. Acad. Sci. USA Res. 25: 1203-1210. 100: 10983-10988. 19. Mahadevan R, Bond DR, Butler JE, Esteve-Nunez A, Coppi 28. Shanks RM, Caiazza NC, Hinsa SM, Toutain CM, O'Toole MV, Palsson BO, et al. 2006. Characterization of metabolism GA. 2006. Saccharomyces cerevisiae-based molecular tool kit in the Fe(III)-reducing organism Geobacter sulfurreducens by for manipulation of genes from gram-negative bacteria. constraint-based modeling. Appl. Environ. Microbiol. 72: Appl. Environ. Microbiol. 72: 5027-5036. 1558-1568. 29. Simon R, Priefer U, Pühler A. 1983. A broad host range 20. Malvankar NS, Lau J, Nevin KP, Franks AE, Tuominen MT, mobilization system for in vivo genetic engineering: transposon Lovley DR. 2012. Electrical conductivity in a mixed-species mutagenesis in gram negative bacteria. Nat. Biotechnol. 1: biofilm. Appl. Environ. Microbiol. 78: 5967-5971. 784-791. 21. Oberender J, Kung JW, Seifert J, von Bergen M, Boll M. 2012. 30. Sturm-Richter K, Golitsch F, Sturm G, Kipf E, Dittrich A, Identification and characterization of a succinyl-coenzyme A Beblawy S, et al. 2015. Unbalanced fermentation of glycerol (CoA): benzoate CoA transferase in Geobacter metallireducens. in Escherichia coli via heterologous production of an electron J. Bacteriol. 194: 2501-2508. transport chain and electrode interaction in microbial 22.Oh ST, Kim JR, Premier GC, Lee TH, Kim C, Sloan WT. electrochemical cells. Bioresour. Technol. 186: 89-96. 2010. Sustainable wastewater treatment: how might microbial 31. Venkateswaran K, Moser DP, Dollhopf ME, Lies DP, fuel cells contribute. Biotechnol. Adv. 28: 871-881. Saffarini DA, MacGregor BJ, et al. 1999. Polyphasic taxonomy 23. Rabaey K, Rodriguez J, Blackall LL, Keller J, Gross P, of the genus Shewanella and description of Shewanella Batstone D, et al. 2007. Microbial ecology meets electrochemistry: oneidensis sp. nov. Int. J. Syst. Bacteriol. 49: 705-724. electricity-driven and driving communities. ISME J. 1: 9-18.

J. Microbiol. Biotechnol.