(MFSV) Gene Expression and Protein Interaction

Home , Drosophila melanogaster, Early 35 kDa protein

Maize fine streak virus (MFSV) Gene Expression and Protein Interaction

DISSERTATION

Presented in Partial Fulfillment of the Requirements for the Degree Doctor of Philosophy in the Graduate School of The Ohio State University

Fiorella Melina Cisneros Delgadillo

Graduate Program in Plant Pathology

The Ohio State University

2013

Dissertation Committee:

Professor Feng Qu, Adviser

Professor Margaret Redinbaugh, Co-adviser

Professor Omprakash Mittapalli

Professor Christopher Taylor

Copyrighted by

Fiorella Melina Cisneros Delgadillo

2013

Abstract

Maize fine streak virus (MFSV) belongs to the family Rhabdoviridae, and is transmitted by the leafhopper Graminella nigrifrons. The MFSV genome is a 13,782 nucleotide, nonsegmented, negative-sense RNA that encodes five core structural proteins: the nucleocapsid protein (N), the phosphoprotein (P), the polymerase (L), the matrix protein

(M) and the glycoprotein (G) and two non-structural proteins, MFSV 3 and 4. The genes follow the order 3´-N-P-3-4-M-G-L-5’. Functions for the MFSV N, P, M, G, and L genes have been assigned based on sequence homologies to other Rhabdoviridae, but functions for the non-structural MFSV 3 and 4 genes remain unknown. To begin to define the roles of the genes and proteins encoded by the MFSV 3 and 4 in replication and systemic infection, we analyzed the accumulation of their corresponding transcripts in maize and

G. nigrifrons using RT-qPCR assays. We hypothesized that the expression pattern for the

MFSV 3 and 4 would provide an indication of their relative importance in virus replication and movement in animal and plant host. To determine whether the MFSV 3 and 4 protein function requires interaction with other MFSV proteins (e.g., for virus movement in plants), a protein-protein interaction map was generated by means of yeast two-hybrid (YTH) and bimolecular fluorescence complementation (BiFC).

To determine the potential of MFSV to be engineered as gene expression system, we examined the expression of viral and reporter components required to produce infectious ii

MFSV in Drosophila S2 cells. The reporter, driven by a T7 promoter, was designed to contain MFSV sequences important for replication. Expression of the MFSV N and P genes, and the T7 DdRp was detected by western blot in S2 cells over a period of 4 days and only under inducible conditions, indicating that these proteins were produced in S2 cells. Also, co-transfection experiments indicated than more than one protein could be produced in S2 cells at the same time. However, the epression of the MFSV L gene, the other protein component required for replication of rhabdoviruses, could not be detected in S2 cells.

We developed a robust and reproducible RT-qPCR assay for the specific quantification of each of the seven MFSV genes using oligo(dT) primers for cDNA synthesis and primers designed to have high amplification efficiency and specificity for each of the seven

MFSV genes. We used the RT-qPCR assay to determine the abundance of MFSV P, 3, 4,

M, G and L transcripts relative to the MFSV N transcripts in infected maize and G. nigrifrons. CT values for each gene were normalized to the reference 18S RNA in maize plants and to the Ribosomal protein S13 gene RPS13 in insects and the accumulation of transcripts was analyzed by the comparative CT method. Higher levels of the MFSV P and 3 transcripts were found relative to N transcripts at each week, whereas temporal changes in the accumulation of the MFSV M, G and L transcripts were found from week two to week four of infection. Interestingly, the accumulation of MFSV 4 transcripts remained similar to the N transcripts from week two to four. In insects, the accumulation of MFSV P, 3, M and G transcript levels were significantly higher than those for N

iii transcripts, whereas MFSV 4 and L transcripts accumulated at lower levels. Our results indicate that the regulation of MFSV gene transcription is different from that of animal- infecting rhabdoviruses and that MFSV has alternative means for regulating gene expression in insects and plants.

To shed lights into the associations between MFSV proteins, a protein-protein interaction map for MFSV 3 and 4 proteins was generated by means YTH and BiFC assays. The

MFSV 3 and 4 proteins strongly interacted with each other in both assays, suggesting that this interaction is likely to occur in nature. No interaction of the MFSV 3 or 4 proteins was detected with the MFSV N, P, M or G proteins in either assay, suggesting that these interactions are not important during infection. Based on the location of MFSV 4 in the genome, the size of the encoded protein and higher accumulation of transcripts in the plant compared to the insect host, MFSV 4 may be a movement protein, and its strong interaction with MFSV 3 may be important during infection of the plant host. In addition, the interaction of the MFSV N and P proteins was detected by BiFC, but not by YTH assays. Because N-P interaction is conserved across the Mononegavirales, we expect that the MFSV N – MFSV P interaction occurs in nature.

To my parents, Guillermo and Mercedes, and my husband, Jeffrey, for their

unconditional love and support

Acknowledgments

I would like to thank to the Department of Plant Pathology for giving me the opportunity to pursue my academic goals.

I would also like to thank to my adviser, Dr. Margaret Redinbaugh, for her intellectual guidance and constant support on my path to become a scientist. I am very grateful for her encouragement and assistance on every step of my graduate studies.

I am also grateful to my co-adviser, Dr. Feng Qu, and my advisory committee members,

Dr. Omprakash Mittapalli and Christopher Taylor for their advice and support.

Finally, I would like to thank to the current and past members of my lab Kristen Willie,

Jane Todd, Chris Nacci, Braden Conn, Jose Luis Zambrano, Dr. Valdir Correa, Dr. Chi

Wei Tsai, Dr. Lucy Stewart and Dr. Bryan Cassone for their help and friendship.

Vita

2003...... B.S. Biology, San Marcos Major National

University, Peru

2011...... M.A. Science, The Ohio State University

2008 to present ...... Graduate Research Associate, Department

of Plant Pathology, The Ohio State

University

Fields of Study

Major Field: Plant Pathology

vii

Table of Contents

Abstract ...... ii Acknowledgments...... vi Vita ...... vii List of Tables ...... x List of Figures ...... xi Chapter 1: Literature Review ...... 1 1.1. Introduction ...... 1 1.2. Classification ...... 2 1.3. MFSV transmission ...... 2 1.4. Virion morphology ...... 3 1.5. MFSV genome organization ...... 4 1.6. MFSV transcription and replication ...... 5 1.7. MFSV structural proteins ...... 6 1.7.1. The nucleocapsid protein (N)...... 6 1.7.2. The phosphoprotein (P)...... 8 1.7.3. The matrix protein (M) ...... 9 1.7.4. The glycoprotein (G)...... 10 1.7.5. The polymerase protein (L) ...... 10 1.7.6. MFSV non-structural proteins ...... 11 1.8. MFSV-insect-plant interaction ...... 14 1.9. Plant viruses as gene expression systems ...... 17 1.10. References ...... 19 Chapter 2: Development of a reverse genetics system for Maize fine streak virus (MFSV)…………………………………………………………………………………..26 2.1. Abstract ...... 26 2.2. Introduction ...... 26 2.3. Material and Methods...... 30 2.4. Results ...... 33

viii

2.5. Discussion ...... 34 2.6. Roles and Acknowledgements ...... 38 2.7. References ...... 39 Chapter 3: Quantification of Maize fine streak virus transcripts in maize by reverse transcription quantitative PCR (RT-qPCR) ...... 45 3.1. Abstract ...... 45 3.2. Introduction ...... 46 3.3. Material and Methods...... 48 3.4. Results ...... 54 3.5. Discussion ...... 57 3.6. References ...... 63 Chapter 4: Analysis of Maize fine streak virus gene expression in its plant host and insect vectors ...... 71 4.1. Abstract ...... 71 4.2. Introduction ...... 72 4.3. Material and methods ...... 75 4.4. Results ...... 79 4.5. Discussion ...... 83 4.6. References ...... 88 Chapter 5: Interaction map for the Maize fine streak virus non-structural proteins ...... 95 5.2. Introduction ...... 95 5.3. Material and methods ...... 99 5.4. Results ...... 104 5.5. Discussion ...... 107 5.6. References ...... 113 Chapter 6: Summary………………………………………………………………...... 122

Comprehensive bibliography…………………………………………………………...128

List of Tables

Table 3.1. Primer names, sequences and product size...... 67

Table 3.2. Assay performance...... 68

Table 5.1. Summary of interactions tested in YTH...... 120

Table 5.2. Summary of interactions tested in BiFC...... 121

List of Figures

Figure 1.1. MFSV virus particle structure...... 25

Figure 2.1. MFSV replicon construct...... 43

Figure 2.2. Expression of foreign genes in transfected S2 cells ...... 43

Figure 2.3.Expression of foreign genes in co-transfected S2 cells...... 44

Figure 3.1.Plasmid constructs containing the MFSV target genes……………………...69

Figure3.2. MFSV gene transcript copy number...... 69

Figure 3.3.MFSV gene expression using CT values ...... 70

Figure 4.1. MFSV gene transcript accumulation relative to the MFSV N transcript in infected maize ...... 92

Figure 4.2. Analysis of MFSV transcripts accumulation relative to the MFSV N gene in infected plants during four weeks...... 93

Figure 4.3. MFSV transcripts accumulation relative to the MFSV N gene in infected G. nigrifrons...... 93

Figure 5.1. Plates and filter-lift assay of MFSV interactions determined by YTH...... 117

Figure 5.2. Epifluorescent micrographs of MFSV interactions determined by BiFC. .. 118

Figure 5.3. Confocal micrographs of MFSV interactions determined by BiFC ...... 119

Chapter 1: Literature Review

1.1. Introduction

Rhabdoviruses cause significant damage to several major crop plant families (Jackson et al., 2005), and the insect vector plays an essential role in virus transmission and disease epidemiology (Ammar el et al., 2009). The ability of the virus to spread from the original site of infection to adjacent cells is a crucial stage during the infection cycle inside the plant host. Inside the insect vector, rhabdoviruses must overcome physical, molecular and genetic barriers in order to be transmitted to other hosts (Hogenhout et al., 2003).

In agricultural systems, genetic resistance to pathogens is usually the best method for controlling disease (Gomez et al., 2009; Kang et al., 2005). Characterization of genetic resistance and deployment of resistance genes are aided when the mode of action of the pathogen is well understood. Understanding how viruses are transmitted and move inside the plant host will provide ways to develop strategies for control of plant viral disease. In addition, understanding the mechanism of infection of plant rhabdoviruses will expand the opportunities for basic and applied research. In basic research, it will allow the development of a reverse genetics system for negative-strand plant viruses, which is currently unavailable for monocots. In applied research, it will allow the exploitation of plant rhabdoviruses as tools for expression of pharmacologically important molecules 1

(e.g. drugs) in plants.

1.2. Classification

Maize fine streak virus (MFSV) belongs to the order Mononegavirales (ICTV, 2011).

Members in this order contain non-segmented, negative-strand RNA genomes that are organized inside a large envelope (Conzelmann, 1998; Jackson et al., 2005). This order consists of four families, Bornaviridae, Filoviridae, Paramyxoviridae, and

Rhabdoviridae, and MFSV has been placed in the latter (ICTV, 2011).

The family Rhabdoviridae includes important pathogens that infect humans, animals and plants, and are perhaps the most widely distributed virus family in nature (Kuzmin et al.,

2009). Six genera have been designated within this family based on host range, presence of non-structural genes, and the site of replication inside the host cell; and only two of the six genera infect plants. The Cytorhabdoviruses replicate in the cytoplasm of infected plant cells while the Nucleorhabdovirus replicate in the nuclei. MFSV is a member of the genus Nucleorhabdovirus, Most rhabdoviruses are transmitted in nature by arthropod vectors, which also become infected (Conzelmann, 1998; Hogenhout et al., 2003).

1.3. MFSV transmission

MFSV was first reported in Georgia (Redinbaugh et al., 2002). MFSV is transmitted in a persistent manner by the black-faced leafhopper, Graminella nigrifons (Todd et al.,

2010). The virus can be mechanically transmitted by vascular puncture inoculation (VPI),

2 but not by leaf-rub inoculation (Redinbaugh et al., 2002). G. nigrifrons is also capable to transmit MFSV to wheat, oat, rye, barley, foxtail, annual ryegrass, and quackgrass (Todd et al., 2010). MFSV transmission by G. nigrifrons is affected by the viral titer and, most importantly, by the length of the post-first access to diseased periods (PADPs) (the sum of the intervals form the beginning of the acquisition to the end of the inoculation access period). No transmission of MFSV occurs earlier than 4-week PADP, which coincides with the time at which the MFSV viral particles are detected in the salivary glands of the insect for the first time (Todd et al., 2010).

1.4. Virion morphology

Rhabdovirus virions have a distinctive bullet-shaped particle morphology that consists of a nucleocapsid core surrounded by an envelope (Fig 1.A). The core consists of the genomic RNA bound to complexes of at least three structural proteins (Fig 1.B). The envelope is formed by associations of viral glycoprotein and host-derived lipid membrane, and is attached to the core by matrix protein associations. The genomic RNA of rhabdoviruses encodes five core structural proteins: the nucleocapsid protein (N), the phosphoprotein (P), the polymerase (L), the matrix protein (M) and the glycoprotein (G)

(Redinbaugh and Hogenhout, 2005). The N, P and L proteins form the core and their presence is necessary for viral replication (Goodin et al., 2001). The M protein is thought to play roles in the condensation of the nucleocapsid and the G protein play roles in the formation of the outer membrane layer of the virions (Jackson et al., 2005). In addition to the five structural proteins, all plant rhabdovirus genomes carry one to four additional

3 genes for which functions are poorly understood (Dietzgen et al., 2006; Huang et al.,

2005; Scholthof et al., 1994; Tanno et al., 2000; Tsai et al., 2005).

1.5. MFSV genome organization

The MFSV genome encodes seven open reading frames (ORFs) flanked by the non- coding leader (l) and trailer (t) regions. The ORFs follow the order of the prototype

Vesicular stomatitis virus (VSV) (Jackson et al., 2005) with two extra non-structural genes positioned between the P and M genes, designated gene 3 and 4. Thus, the genome organization of MFSV is 3’-l-N-P-3-4-M-G-L-t- 5’. Functions for the five ORFs encoding the structural genes were deduced based on protein localization in plant cells and sequence similarity with other rhabdovirus genes (Tsai et al., 2005). The MFSV

ORFs 3 and 4 have no significant similarity with the nucleotide or deduced protein sequences of other rhabdovirus genes or with sequences in the Genbank, and their functions remain to be elucidated (Tsai et al. 2005).

The intergenic regions of MFSV are similar to these regions of other rhabdoviruses (Tsai et al., 2005). Important features of the intergenic regions include: an AT-rich region at the 3’end of each gene (element I); a short, variable non-transcribed region that separates each gene (element II); and, a highly conserved region at the 5’end of each gene (element

III) (Jackson et al., 2005). These regions are thought to play important roles in regulating transcription and replication.

The leader and trailer regions are short non-translated sequences, ranging from 84 to 389 nucleotides, present in all rhabdoviruses that carry important signals for transcription and replication (Conzelmann, 1998; Whelan et al., 2004). Nonetheless, the leader and trailer sequences of plant rhabdoviruses are much longer than in VSV, and have little sequence in common (Jackson et al., 2005).

1.6. MFSV transcription and replication

In animal-infecting rhabdoviruses, gene expression is primarily regulated by gene order, with decreasing levels of viral transcripts along the 3’ to 5’ genome (Conzelmann, 1998;

Jackson et al., 2005). According to this model, the synthesis of the transcripts follows the order of the genes in the genome and downstream genes are transcribed at a lower rate than upstream genes. In the animal-infecting rhabdovirus VSV, the leader RNA and the

N mRNA are the first to be transcribed and the L mRNA is the last, and this is consistent with the amount of transcripts produced (Abraham and Banerjee, 1976). It was proposed that this gradient is due to dissociation of polymerase complexes at each gene border, resulting in a progressive loss of transcripts encoded by the 5’end of the genome

(Banerjee, 1987; Iverson and Rose, 1981). Critical to this process are transcription initiation and termination/polyadenylation sequences flanking each gene (Barr et al.,

2002). Similar sequential order and gradients in the synthesis of transcripts have been observed for other animal-infecting, non-segmented, negative strand RNA viruses confirming that this is a common strategy for this group (Ruigrok et al., 2011; Whelan et al., 2004).

It is not known whether plant-infecting rhabdoviruses are similarly regulated. In particular, the regulation of non-structural genes (e.g., MFSV ORF 3 and ORF 4) has not been defined. The fact that the intergenic regions containing the transcription termination and initiation sequences are conserved across the different taxa of the family suggests that the regulation of gene expression is common to all rhabdoviruses. One way to define the regulation of transcription of plant-infecting rhabdoviruses is by measuring the expression levels of the viral genes. We hypothesize that the expression levels of MFSV genes will reflect their relative importance during infection of their two biologically dissimilar hosts.

1.7. MFSV structural proteins

As mentioned above, functions for the five major structural proteins of rhabdoviruses have been assigned based on their homology to the intensely studied animal-infecting rhabdoviruses, VSV and Rabies virus (RABV). Although there are variations in sequence of the plant-infecting rhabdoviruses, the primary functions and structural characteristics are thought to be conserved across all rhabdoviruses (Assenberg et al., 2010).

1.7.1. The nucleocapsid protein (N)

The principal function of the N protein is the encapsidation of the genomic RNA

(Wagner and Rose, 1996). In Sonchus yellow net virus (SYNV), a closely related plant- infecting rhabdovirus, the N protein is a component of the polymerase complex (Wagner and Jackson, 1997). Comparison of the deduced amino acid sequences of the N proteins

6 of all the plant rhabdovirus genomes available showed virtually no sequence homology, although their general structures appear to be similar. (Ghosh et al., 2008; Jackson et al.,

2005).

The MFSV N protein contains a putative nuclear localization signal (NLS) which may be required to facilitate its nuclear localization (Makkerh et al., 1996; Tsai et al., 2005). As expected from the presence of a NLS, GFP fusions of the MFSV N protein localized to the nuclei of plant cells. Putative NLS have also been identified in the nucleorhabdoviruses SYNV, Rice yellows stunt virus (RYSV) and Orchid fleck virus

(OFV). Similarly, the SYNV N protein localizes to the nuclei of plant cells(Goodin et al.,

2001). Functions for the NLSs present in the N proteins of RYSV and OFV have not been demonstrated experimentally to make further comparisons (Huang et al., 2003). In contrast no NLSs could be predicted for any of the proteins encoded by the genomes of

Potato yellow dwarf virus (PYDV) and Taro vein chlorosis virus (TaVCV), the other two sequenced nucleorhabdoviruses (Bandyopadhyay et al., 2010; Revill et al., 2005).

Intriguingly, PYDV N protein interacts with the importin- protein and localizes to the nuclei of plant cells, suggesting that nucleorhabdoviruses employ different mechanisms to direct their proteins to the nucleus. No predictable NLS has been found for any of the cytorhabdoviruses sequenced to date (Ghosh et al., 2008).

1.7.2. The phosphoprotein (P)

The P protein is thought to a play key role in RNA synthesis in rhabdoviruses. In VSV, it forms a complex together with the L protein that has polymerase activity (Banerjee,

1987). Phosphorylation of the P protein has been observed in vivo for the animal- infecting VSV and for the plant-infecting SYNV, providing biochemical evidence that supports the function of the P protein of rhabdoviruses (Chen et al., 1997; Wagner and

Jackson, 1997). Although comparisons of the deduced amino acid sequences of the P proteins of plant rhabdoviruses show little similarity, putative P proteins in this group have been assigned based on their location in the genome next to the N protein gene and based on size and predictions of the protein structure (Jackson et al., 2005). Despite the relatedness among rhabdoviral P proteins, similar functions to that of VSV are expected based on their genome location (Wagner and Jackson, 1997).

For MFSV, the P protein was assigned based on its localization next to the N gene in the viral genome, its predicted similar size to other rhabdoviral P proteins, and its localization to the cytoplasm and nucleus in planta (Tsai et al., 2005). Co-infiltration experiments in Nicotiana benthamiana showed that the MFSV N and P proteins co- localized to the nucleolus, whereas the MFSV N protein accumulated in the whole nucleus and the MFSV P protein spread throughout the cell when infiltrated alone.

1.7.3. The matrix protein (M)

The M protein of rhabdoviruses is one of the most abundant proteins in the virion and is thought to play a role in the condensation of the nucleocapsid during virion morphogenesis. In VSV, evidence supports that the M protein interacts with membranes in which the viral glycoproteins are integrated and is also associated with the core of the virus (Chong and Rose, 1993). The association of the M protein with the core shuts down virus transcription and prepares the newly formed structure for budding in animal- infecting rhabdoviruses (Finke et al., 2003). Similar functions are hypothesized for the M protein of plant rhabdoviruses based on short stretches of amino acid similarities to the

M proteins of other rhabdoviruses (Bandyopadhyay et al., 2010; Dietzgen et al., 2006;

Tanno et al., 2000; Tsai et al., 2005).

Analysis of the deduced amino acid sequence of the MFSV M protein revealed a putative

NLS (Tsai et al., 2005), but its function has not been demonstrated experimentally.

However, GFP fusions of the MFSV M protein localized to the nucleus of plant cells.

Similarly, a putative NLS and nuclear localization were observed for SYNV M protein

(Goodin et al., 2001). NLS motifs have also been predicted for members of the other genus of the rhabdoviruses but not for cytorhabdoviruses (Redinbaugh and Hogenhout,

2005).

1.7.4. The glycoprotein (G)

In rhabdoviruses, the G protein forms the virion spikes (Jackson et al., 2005). In plant rhabdoviruses the G protein is glycosylated, and the type of glycosylation seems to be influenced by the host (Dietzgen et al., 2006; Goldberg et al., 1991). In addition, glycosylation of the G protein is thought to play a role in virion morphogenesis (Jones and Jackson, 1990).

Plant rhabdovirus G proteins have no significant homology to G proteins of other rhabdoviruses (Redinbaugh and Hogenhout, 2005). Nevertheless, some similarities can be established. MFSV, SYNV, and Northern cereal mosaic virus (NCMV) G proteins are predicted to have one transmembrane anchor domain, whereas RYSV, Lettuce necrotic yellows virus (LNYV) and Potato yellow dwarf virus (PYDV) G proteins are predicted to have two transmembrane domains. The G proteins of all rhabdoviruses sequenced to date also share N-terminal signal peptides, and 3 to 10 potential glycosylation signals

(Bandyopadhyay et al., 2010; Dietzgen et al., 2006; Goldberg et al., 1991; Tanno et al.,

2000; Tsai et al., 2005).

1.7.5. The polymerase protein (L)

The L proteins of rhabdoviruses are positively charged, large proteins that contain conserved motifs characteristic of RNA-dependent RNA polymerases and RNA binding domains (Jackson et al., 2005; Redinbaugh and Hogenhout, 2005). The L protein, together with the N and P proteins, forms a complex that is important for virus replication

10 and protein synthesis (Banerjee, 1987; Wagner and Jackson, 1997). RNA polymerase activity has been demonstrated for the SYNV L protein (Wagner and Jackson, 1997), but not for other plant rhabdovirus L proteins.

Alignment of deduced L protein sequences for plant rhabdovirus shows the highest conservation at 20-25% identity. Furthermore, this conservation has been observed for other members of the Mononegavirales (Ruigrok et al., 2011). The MFSV L protein has a putative NLS and is predicted to localize to the nucleus (Tsai et al., 2005). Likewise, putative NLS have been predicted for other nucleorhabdoviruses (Redinbaugh and

Hogenhout, 2005).

1.7.6. MFSV non-structural proteins

Unlike the structural proteins, the additional genes reported for rhabdoviruses have not been extensively characterized. The number and position of these genes in their genome vary between rhabdovirus genera, including those that infect vertebrates. In addition, the deduced amino acid sequences of rhabdoviral non-structural genes reveal no significant homology and their functions do not appear to be conserved across the family (Walker et al., 2011). The main characteristic of the non-structural proteins of all the rhabdoviruses characterized to date is that they are not found in association with the virions. However, recent studies show that the P3 protein of Rice transitory yellowing virus (RTYV) is present in association with the nucleocapsid core inside the virus particles (Hiraguri et al.,

2012).

Plant rhabdoviruses are thought to spread from cell-to-cell as nucleocapsids (Jackson et al., 2005). The fact that the ORFs of unknown function identified in plant rhabdoviruses are not present in all animal rhabdoviruses, particularly in the vesiculoviruses, led to the hypothesis that the proteins encoded by these ORFs play roles unique to the plant segment of the life cycle, such as systemic spread in the plant host (Huang et al., 2005).

Nearly all plant viruses have at least one specialized viral-encoded movement protein

(MPs) that facilitates the cell-to-cell and/or systemic movement of the virus in their plant hosts (Lucas, 2006; Redinbaugh and Hogenhout, 2005).

At least four types of MPs have been described for plant viruses: the products of a triple gene block, the tymoviral MPs, a series of small polypeptides (less than 10 kDa) characteristic of carmo-like viruses and some geminiviruses, and the 30K superfamily of

MPs, named after the 30 kDa Tobacco mosaic virus (TMV) MP (Lucas, 2006; Melcher,

2000). Two plant rhabdovirus proteins, the sc4 of SYNV and the P3 of RYSV have been implicated in cell-to-cell movement (Huang et al., 2005; Scholthof et al., 1994). The genes encoding these two proteins are located in between the P and M genes, have similar mass of 30kDa and both have significant similarity with the consensus core structure of the 30K superfamily of viral MPs (Goodin et al., 2007; Melcher, 2000). Further, RYSV

P3 was able to restore the movement of a movement-deficient Potato virus X (PVX) and the interaction of RYSV N and P3 was demonstrated by glutathione S-transferase (GST) pull down assays (Huang et al., 2005). Given that plant rhabdoviruses spread from cell-

12 to-cell in the form of nucleocapsids and N is the primary protein component of the nucleocapsid, this data supports the premise that P3 is a movement protein and may be essential for intercellular movement of the nucleocapsid.

In the case of MFSV, the functions of the additional genes are not understood. These genes, or more properly MFSV ORFs 3 and 4, have no significant similarity with the nucleotide and deduced protein sequences of other rhabdoviruses or with sequences in the

Genbank (Tsai et al., 2005). Yet, transcripts corresponding to the two ORFs are detected in MFSV-infected maize leaves. In addition, the MFSV ORF 3 fused to yellow fluorescent protein (YFP) accumulated in punctate loci in the cytoplasm of N. benthamiana cells, whereas the MFSV 4 fused to green fluorescent protein (GFP) localized to the nuclei (Tsai et al., 2005).

Based on the MFSV ORF 3 and ORF 4 location in the genome, we can hypothesize that one or both of these genes are involved in cell-to-cell movement in the plant host.

Although the MFSV ORF 4 has a molecular mass of 37.2 kDa (Tsai et al., 2005), similar to that of the SYNV sc4, the nuclear localization of the MFSV ORF 4 is different from that of sc4, which is associated with cytoplasmic membranes (Goodin et al., 2007).

However, analysis of the secondary structures of the putative MFSV P4, RYSV P3,

Maize mosaic virus (MMV) P3 and LNYV 4b predicts that all of these proteins share similarity to the 30K superfamily of viral MPs (Huang et al., 2005). The localization of the MFSV P3 in punctuate cytoplasmic loci is similar to that of sc4, but the molecular

13 mass of this deduced protein is much smaller at 10.7 kDa (Tsai et al., 2005). Therefore, more work is needed to understand the roles of the MFSV P3 and P4 in the cell-to-cell and systemic movement of the virus during infection of the plant host. Understanding viral movement mechanisms will not only shed light on the molecular mechanisms of infection but will also provide ways to develop strategies for the control of plant viral diseases.

1.8. MFSV-insect-plant interaction

Critical aspects of virus-plant-insect vector interactions are not well understood. One important aspect that needs to be considered when studying these interactions in plant rhabdoviruses is that they replicate in and systemically invade their plants host as well as the insect vector; therefore the vector is also a host (Hogenhout et al., 2003). As a consequence, rhabdoviruses must overcome defense mechanisms in their two biologically dissimilar hosts in order to ensure their perpetuation.

Plant rhabdoviruses are horizontally transmitted to their plant hosts by their insect vector in a persistent propagative manner (Hogenhout et al., 2008). The first step towards a successful transmission is the acquisition of the virus from the plant host and subsequent infection of the insect host (Ammar el et al., 2009). Once inside the insect, rhabdoviruses must cross several barriers prior to their transmission to their non-insect host (Hogenhout et al., 2003). After ingestion, rhabdoviruses first invade epithelial cells of the insect gut most likely by a pH-dependent receptor mediated endocytosis; and rhabdovirus G protein

14 is involved in this process (Coll, 1995). Putative receptors have been identified for vertebrate-infecting rhabdoviruses and for other plant-infecting viruses, but not for plant- infecting rhabdoviruses (Lafon, 2005; Li et al., 2002). After invasion of the insect gut cells, the virus disseminates to other insect tissues before reaching the salivary glands

(Ammar el and Hogenhout, 2008). The movement of the virus to the salivary glands is considered a key step for virus transmission and survival. Several routes have been proposed for the dissemination of infectious virus through the insect body and these include the hemolymph, neural, tracheal and muscle tissues (Ammar el et al., 2009).

Immunolocalization studies of MMV-infected planthoppers and MFSV-infected leafhoppers showed that the virus is extensively detected in the nervous system, suggesting that plant rhabdoviruses might use the neurotropic routes for dissemination

(Ammar el and Hogenhout, 2008; Todd et al., 2010). After invading the salivary glands, the virus must enter into the insect saliva for dissemination into plants during insect feeding. The dispersion of the virus from the salivary gland to the saliva is not known.

Insects in the order hemipterans, such as aphids, planthoppers and leafhoppers, obtain their nutrients mainly from the plant phloem sieve elements using their pierce-sucking mouthparts (Powell et al., 2006). While feeding, the insects are able to secrete the virus along with their saliva (Fereres and Moreno, 2009). Thus, insect saliva may play key roles during insect transmission. One possible role is that saliva has the ability to prevent clogging of the plant sieve tubes during insect feeding, which is likely to result in a more efficient acquisition and inoculation of phloem-limited viruses by insect vectors (Will et

15 al., 2007). Studies on saliva content and its role on the induction or suppression of plant defense responses have become available in the last years, shedding lights on the mechanisms of insect transmission of plant viruses (Bos et al., 2010; De Vos and Jander,

2009; Mutti et al., 2008). It is not known whether saliva plays a role during transmission of rhabdoviruses by their insect vector.

Transmission of rhabdoviruses by their vector exhibits high species specificity, as reflected by the number, efficiency, and relatedness of vector species for each virus

(Ammar and Nault, 2002; Creamer et al., 1997). In this context, G. nigrifrons was the only vector able to transmit MFSV identified among several insect species that use maize as a feeding and/or developmental host (Redinbaugh et al., 2002). In addition to the vector specificity, viral titer within the vector and the length of the post-first access to diseased periods (PADPs) are important during transmission of rhabdoviruses (Creamer et al., 1997). For MFSV, a threshold viral titer and a PADP of >4 weeks are necessary for transmission by G. nigrifrons (Todd et al., 2010).

Finally, once inside the plant host, the last barrier that rhabdoviruses must overcome is the mechanisms of defense response in the plant cells. All plants have innate immune responses that assist in protection against pathogens (Jones and Dangl, 2006; Tarchevsky,

2001), and there is evidence that this system is important in response to rhabdovirus infection (Ming et al., 1997).

1.9. Plant viruses as gene expression systems

In the last years, a number of virus-based gene expression systems have been developed.

The ease of manipulation, high level of amplification and strong infectivity are some of the unique characteristics that most plant viruses exhibit that enable their broad application as expression systems, from basic research to product development(Lico et al., 2008). Negative-sense RNA viruses have a number of additional features, such as a very low frequency of recombination events (Spann et al., 2003; Steinhauer et al., 1992) and the relatively simple genomes encoding only 5 to 11 proteins, that make their use attractive. Besides these features, the wide plant host range observed for viruses in the family Rhabdoviridae make them appealing candidates to be engineered as expression vectors. However, in spite of the great potential of plant rhabdoviruses to be employed as expression systems, there are still some limitations that make the development of vectors more difficult such as the lack of infectivity of their genomic RNA in plants or plant cell culture and the absence of a mechanism for recombinational insertion of foreign genes

(Bukreyev et al., 2006). Moreover, he fact that rhabdoviruses need at least three proteins

(N, P and L) in addition to the genome to start replication (Goodin et al., 2001) has limited the development of reverse genetics systems suitable to study the genetics and biology of plant rhabdoviruses (Bukreyev et al., 2006; Conzelmann, 1998). Nevertheless, examples of reverse genetics systems have been described for negative-sense RNA animal viruses (Lico et al., 2008), but are lacking for plant viruses. The development of a reverse genetics system for plant rhabdoviruses will not only enable the production of

17 virus-based expression systems, but it will also extend its utility to basic research in monocots, for which no reverse genetics system is available.

The selection of an appropriate system for the expression of heterologous proteins is key to the successful development of a reverse genetics system. In the last years, several systems such as bacterial, yeast, insect and mammalian cells have become available for the expression of recombinant proteins. Insect cells systems offer the advantage to overcome limitations such as post-translational modification deficiencies found in prokaryotic systems and low expression levels observed in mammalian cells (Cha et al.,

2005; Moraes et al., 2012). High levels of protein expression can be achieved using the

Drosophila expression system (DES), for which expression plasmids under the control of

Drosophila promoters are commercially available. Drosophila melanogaster Schneider 2

(S2) cells is the cell line employed by this system and it has been used for the successful expression of several heterologous proteins, including some of viral origin (Batista et al.,

2009; Culp et al., 1991; Hill et al., 2001; Jorge et al., 2008; Perret et al., 2003). Based on this evidence and the wide host range observed for rhabdoviruses, we hypothesize that S2 cells might be useful for the development of gene expression vectors based on MFSV.

1.10. References

Abraham, G., Banerjee, A.K., 1976. Sequential transcription of the genes of vesicular stomatitis virus. Proceedings of the National Academy of Sciences of the United States of America 73, 1504-1508.

Ammar, E.D., Nault, L.R., 2002. Virus transmission by leafhoppers, planthoppers and treehoppers (Auchenorrhyncha, Homoptera). Advances in Botanical Research, Vol 36 36, 141-167.

Ammar el, D., Hogenhout, S.A., 2008. A neurotropic route for Maize mosaic virus (Rhabdoviridae) in its planthopper vector Peregrinus maidis. Virus research 131, 77- 85.

Ammar el, D., Tsai, C.W., Whitfield, A.E., Redinbaugh, M.G., Hogenhout, S.A., 2009. Cellular and molecular aspects of rhabdovirus interactions with insect and plant hosts. Annual review of entomology 54, 447-468.

Assenberg, R., Delmas, O., Morin, B., Graham, S.C., De Lamballerie, X., Laubert, C., Coutard, B., Grimes, J.M., Neyts, J., Owens, R.J., Brandt, B.W., Gorbalenya, A., Tucker, P., Stuart, D.I., Canard, B., Bourhy, H., 2010. Genomics and structure/function studies of Rhabdoviridae proteins involved in replication and transcription. Antiviral Research 87, 149-161.

Bandyopadhyay, A., Kopperud, K., Anderson, G., Martin, K., Goodin, M., 2010. An integrated protein localization and interaction map for Potato yellow dwarf virus, type species of the genus Nucleorhabdovirus. Virology 402, 61-71.

Banerjee, A.K., 1987. Transcription and replication of rhabdoviruses. Microbiol Rev 51, 66-87.

Barr, J.N., Whelan, S.P.J., Wertz, G.W., 2002. Transcriptional control of the RNA- dependent RNA polymerase of vesicular stomatitis virus. Biochimica Et Biophysica Acta-Gene Structure and Expression 1577, 337-353.

Batista, F.R., Moraes, A.M., Buntemeyer, H., Noll, T., 2009. Influence of culture conditions on recombinant Drosophila melanogaster S2 cells producing rabies virus glycoprotein cultivated in serum-free medium. Biologicals : journal of the International Association of Biological Standardization 37, 108-118.

Bos, J.I., Prince, D., Pitino, M., Maffei, M.E., Win, J., Hogenhout, S.A., 2010. A functional genomics approach identifies candidate effectors from the aphid species Myzus persicae (green peach aphid). PLoS genetics 6, e1001216.

Bukreyev, A., Skiadopoulos, M.H., Murphy, B.R., Collins, P.L., 2006. Nonsegmented negative-strand viruses as vaccine vectors. Journal of virology 80, 10293-10306.

Cha, H.J., Shin, H.S., Lim, H.J., Cho, H.S., Dalal, N.N., Pham, M.Q., Bentley, W.E., 2005. Comparative production of human interleukin-2 fused with green fluorescent protein in several recombinant expression systems. Biochemical Engineering Journal 24, 225-233.

Chen, J.L., Das, T., Banerjee, A.K., 1997. Phosphorylated states of vesicular stomatitis virus P protein in vitro and in vivo. Virology 228, 200-212.

Chong, L.D., Rose, J.K., 1993. Membrane association of functional vesicular stomatitis virus matrix protein in vivo. Journal of virology 67, 407-414.

Coll, J.M., 1995. The glycoprotein-G of rhabdoviruses. Archives of virology 140, 827- 851.

Conzelmann, K.K., 1998. Nonsegmented negative-strand RNA viruses: genetics and manipulation of viral genomes. Annual review of genetics 32, 123-162.

Creamer, R., He, X., Styer, W.E., 1997. Transmission of sorghum stunt mosaic rhabdovirus by the leafhopper vector, Graminella sonora (Homoptera: Cicadellidae). Plant Disease 81, 63-65.

Culp, J.S., Johansen, H., Hellmig, B., Beck, J., Matthews, T.J., Delers, A., Rosenberg, M., 1991. Regulated expression allows high level production and secretion of HIV-1 gp120 envelope glycoprotein in Drosophila Schneider cells. Bio/technology 9, 173- 177.

De Vos, M., Jander, G., 2009. Myzus persicae (green peach aphid) salivary components induce defence responses in Arabidopsis thaliana. Plant, cell & environment 32, 1548-1560.

Dietzgen, R.G., Callaghan, B., Wetzel, T., Dale, J.L., 2006. Completion of the genome sequence of Lettuce necrotic yellows virus, type species of the genus Cytorhabdovirus. Virus research 118, 16-22.

Fereres, A., Moreno, A., 2009. Behavioural aspects influencing plant virus transmission by homopteran insects. Virus research 141, 158-168.

Finke, S., Mueller-Waldeck, R., Conzelmann, K.K., 2003. Rabies virus matrix protein regulates the balance of virus transcription and replication. Journal of General Virology 84, 1613-1621.

Ghosh, D., Brooks, R.E., Wang, R.Y., Lesnaw, J., Goodin, M.M., 2008. Cloning and subcellular localization of the phosphoprotein and nucleocapsid proteins of Potato 20

yellow dwarf virus, type species of the genus Nucleorhabdovirus. Virus research 135, 26-35.

Goldberg, K.B., Modrell, B., Hillman, B.I., Heaton, L.A., Choi, T.J., Jackson, A.O., 1991. Structure of the glycoprotein gene of sonchus yellow net virus, a plant rhabdovirus. Virology 185, 32-38.

Gomez, P., Rodriguez-Hernandez, A.M., Moury, B., Aranda, M.A., 2009. Genetic resistance for the sustainable control of plant virus diseases: breeding, mechanisms and durability. European Journal of Plant Pathology 125, 1-22.

Goodin, M.M., Austin, J., Tobias, R., Fujita, M., Morales, C., Jackson, A.O., 2001. Interactions and nuclear import of the N and P proteins of sonchus yellow net virus, a plant nucleorhabdovirus. Journal of virology 75, 9393-9406.

Goodin, M.M., Chakrabarty, R., Yelton, S., Martin, K., Clark, A., Brooks, R., 2007. Membrane and protein dynamics in live plant nuclei infected with Sonchus yellow net virus, a plant-adapted rhabdovirus. The Journal of general virology 88, 1810-1820.

Hill, R.M., Brennan, S.O., Birch, N.P., 2001. Expression, purification, and functional characterization of the serine protease inhibitor neuroserpin expressed in Drosophila S2 cells. Protein expression and purification 22, 406-413.

Hiraguri, A., Hibino, H., Hayashi, T., Netsu, O., Shimizu, T., Uehara-Ichiki, T., Omura, T., Sasaki, N., Nyunoya, H., Sasaya, T., 2012. The movement protein encoded by gene 3 of rice transitory yellowing virus is associated with virus particles. Journal of General Virology 93, 2290-2298.

Hogenhout, S.A., Ammar el, D., Whitfield, A.E., Redinbaugh, M.G., 2008. Insect vector interactions with persistently transmitted viruses. Annual review of phytopathology 46, 327-359.

Hogenhout, S.A., Redinbaugh, M.G., Ammar, E.-D., 2003. Plant and animal rhabdovirus host range: a bug's view. Trends in Microbiology 11, 264-271.

Huang, Y., Zhao, H., Luo, Z., Chen, X., Fang, R.X., 2003. Novel structure of the genome of Rice yellow stunt virus: identification of the gene 6-encoded virion protein. The Journal of general virology 84, 2259-2264.

Huang, Y.W., Geng, Y.F., Ying, X.B., Chen, X.Y., Fang, R.X., 2005. Identification of a movement protein of rice yellow stunt rhabdovirus. Journal of virology 79, 2108- 2114.

Iverson, L.E., Rose, J.K., 1981. Localized attenuation and discontinuous synthesis during vesicular stomatitis-virus transcription. Cell 23, 477-484.

Jackson, A.O., Dietzgen, R.G., Goodin, M.M., Bragg, J.N., Deng, M., 2005. Biology of plant rhabdoviruses. Annual review of phytopathology 43, 623-660.

Jones, J.D., Dangl, J.L., 2006. The plant immune system. Nature 444, 323-329.

Jones, R.W., Jackson, A.O., 1990. Replication of sonchus yellow net virus in infected protoplasts. Virology 179, 815-820.

Jorge, S.A., Santos, A.S., Spina, A., Pereira, C.A., 2008. Expression of the hepatitis B virus surface antigen in Drosophila S2 cells. Cytotechnology 57, 51-59.

Kang, B.C., Yeam, I., Jahn, M.M., 2005. Genetics of plant virus resistance, Annual review of phytopathology. Annual Reviews, Palo Alto, pp. 581-621.

Kuzmin, I.V., Novella, I.S., Dietzgen, R.G., Padhi, A., Rupprecht, C.E., 2009. The rhabdoviruses: Biodiversity, phylogenetics, and evolution. Infection Genetics and Evolution 9, 541-553.

Lafon, M., 2005. Rabies virus receptors. Journal of Neurovirology 11, 82-87.

Li, C., Gildow, F.E., Cox-Foster, D., 2002. Luteovirus-binding proteins associated with aphid transmission specificity. Phytopathology 92, S47.

Lico, C., Chen, Q., Santi, L., 2008. Viral vectors for production of recombinant proteins in plants. Journal of cellular physiology 216, 366-377.

Lucas, W.J., 2006. Plant viral movement proteins: agents for cell-to-cell trafficking of viral genomes. Virology 344, 169-184.

Makkerh, J.P., Dingwall, C., Laskey, R.A., 1996. Comparative mutagenesis of nuclear localization signals reveals the importance of neutral and acidic amino acids. Current biology : CB 6, 1025-1027.

Melcher, U., 2000. The '30K' superfamily of viral movement proteins. The Journal of general virology 81, 257-266.

Ming, R., Brewbaker, J.L., Pratt, R.C., Musket, T.A., McMullen, M.D., 1997. Molecular mapping of a major gene conferring resistance to maize mosaic virus. TAG Theoretical and Applied Genetics 95, 271-275.

Moraes, A.M., Jorge, S.A., Astray, R.M., Suazo, C.A., Calderon Riquelme, C.E., Augusto, E.F., Tonso, A., Pamboukian, M.M., Piccoli, R.A., Barral, M.F., Pereira, C.A., 2012. Drosophila melanogaster S2 cells for expression of heterologous genes: From gene cloning to bioprocess development. Biotechnol Adv 30, 613-628.

Mutti, N.S., Louis, J., Pappan, L.K., Pappan, K., Begum, K., Chen, M.S., Park, Y., Dittmer, N., Marshall, J., Reese, J.C., Reeck, G.R., 2008. A protein from the salivary glands of the pea aphid, Acyrthosiphon pisum, is essential in feeding on a host plant. Proceedings of the National Academy of Sciences of the United States of America 105, 9965-9969.

Perret, B.G., Wagner, R., Lecat, S., Brillet, K., Rabut, G., Bucher, B., Pattus, F., 2003. Expression of EGFP-amino-tagged human mu opioid receptor in Drosophila Schneider 2 cells: a potential expression system for large-scale production of G- protein coupled receptors. Protein expression and purification 31, 123-132.

Powell, G., Tosh, C.R., Hardie, J., 2006. Host plant selection by aphids: behavioral, evolutionary, and applied perspectives. Annual review of entomology 51, 309-330.

Redinbaugh, M.G., Hogenhout, S.A., 2005. Plant rhabdoviruses. Current topics in microbiology and immunology 292, 143-163.

Redinbaugh, M.G., Seifers, D.L., Meulia, T., Abt, J.J., Anderson, R.J., Styer, W.E., Ackerman, J., Salomon, R., Houghton, W., Creamer, R., Gordon, D.T., Hogenhout, S.A., 2002. Maize fine streak virus, a new leafhopper-transmitted rhabdovirus. Phytopathology 92, 1167-1174.

Revill, P., Trinh, X., Dale, J., Harding, R., 2005. Taro vein chlorosis virus: characterization and variability of a new nucleorhabdovirus. The Journal of general virology 86, 491-499.

Ruigrok, R.W., Crepin, T., Kolakofsky, D., 2011. Nucleoproteins and nucleocapsids of negative-strand RNA viruses. Current opinion in microbiology 14, 504-510.

Scholthof, K.B., Hillman, B.I., Modrell, B., Heaton, L.A., Jackson, A.O., 1994. Characterization and detection of sc4: a sixth gene encoded by sonchus yellow net virus. Virology 204, 279-288.

Spann, K.M., Collins, P.L., Teng, M.N., 2003. Genetic recombination during coinfection of two mutants of human respiratory syncytial virus. Journal of virology 77, 11201- 11211.

Steinhauer, D.A., Domingo, E., Holland, J.J., 1992. Lack of evidence for proofreading mechanisms associated with an RNA virus polymerase. Gene 122, 281-288.

Tanno, F., Nakatsu, A., Toriyama, S., Kojima, M., 2000. Complete nucleotide sequence of Northern cereal mosaic virus and its genome organization. Archives of virology 145, 1373-1384.

Tarchevsky, I.A., 2001. Pathogen-induced plant proteins (Review). Appl Biochem Micro+ 37, 441-455.

Todd, J.C., Ammar el, D., Redinbaugh, M.G., Hoy, C., Hogenhout, S.A., 2010. Plant host range and leafhopper transmission of maize fine streak virus. Phytopathology 100, 1138-1145.

Wagner, J.D., Jackson, A.O., 1997. Characterization of the components and activity of Sonchus yellow net rhabdovirus polymerase. Journal of virology 71, 2371-2382.

Wagner, R.R., Rose, J.K., 1996. Rhabdoviridae: The viruses and their replication. Lippincott-Raven Publishers {a}, 227 East Washington Square, Philadelphia, Pennsylvania 19106, USA.

Walker, P.J., Dietzgen, R.G., Joubert, D.A., Blasdell, K.R., 2011. Rhabdovirus accessory genes. Virus research 162, 110-125.

Whelan, S.P., Barr, J.N., Wertz, G.W., 2004. Transcription and replication of nonsegmented negative-strand RNA viruses. Current topics in microbiology and immunology 283, 61-119.

Will, T., Tjallingii, W.F., Thonnessen, A., van Bel, A.J., 2007. Molecular sabotage of plant defense by aphid saliva. Proceedings of the National Academy of Sciences of the United States of America 104, 10536-10541.

Figure 1.1. A) Electron micrograph of the MFSV virus particle detected in infected maize. B) Schematic overview of the structure of MFSV and genome organization. The corresponding proteins encoded by the genes are indicated by the same color in schematic particle.

Chapter 2: Development of a reverse genetics system for Maize fine streak virus (MFSV)

2.1. Abstract

The development of virus-based gene expression systems has been described for negative-sense RNA animal viruses, but is lacking for plant viruses. To gain insight into the potential of MFSV to be engineered as expression system, we examined the expression of viral and reporter components required for development of a reverse genetics approach to produce infectious MFSV in Drosophila S2 cells. Expression of the

MFSV N and P genes, and the T7 DdRp was detected by western blot in S2 cells over a period of 4 days and only under inducible conditions, indicating that these proteins were produced in S2 cells. Also, co-transfection experiments indicated than more than one protein could be produced in S2 cells at the same time. Expression of the MFSV L gene, the other protein component required for replication of rhabdoviruses, could not be detected in S2 cells.

2.2. Introduction

Maize fine streak virus (MFSV) is a plant-infecting rhabdovirus (Redinbaugh et al., 2002) that is transmitted by the black-faced leafhopper Graminella nigrifrons in a persistent circulative manner (Todd et al., 2010). Viruses in this family have bacilliform virions containing non-segmented negative-sense RNA genomes and are significant pathogens of humans, animals and plants (Conzelmann, 1998; Jackson et al., 2005; Redinbaugh and 26

Hogenhout, 2005). The MFSV genome is a 13,782 nucleotide, non-segmented, negative- sense RNA that encodes five core structural proteins: the nucleocapsid protein (N), the phosphoprotein (P), the polymerase (L), the matrix protein (M) and the glycoprotein (G) and two non-structural proteins, MFSV 3 and 4.

The genes follow the order 3´-N-P-3-4-M-G-L-5´, flanked by the non-coding leader (l) and trailer (t) regions. Functions for the MFSV N, P, M, G, and L genes have been assigned based on sequence homologies to other Rhabdoviridae (Tsai et al., 2005), but functions for the non-structural MFSV 3 and 4 genes remain unknown. The leader and trailer regions are short non-translated sequences, ranging from 84 to 389 nucleotides. In animal-infecting rhabdoviruses, the leader and trailer sequences were found to carry important signals for transcription and replication that are recognized by the polymerase complex formed by L, P and N proteins (Conzelmann, 1998; Jackson et al., 2005;

Whelan et al., 2004). During replication, the N protein of rhabdoviruses encapsidates the viral genomic RNA, and no genomic replication occur in absence of the N protein

(Banerjee, 1987; Wagner and Jackson, 1997). Genomic replication is carried out by the polymerase L, which in turn use the P protein as a co-factor for function (Bourhis et al.,

2006; Whelan et al., 2004).

In the past three decades, a number of virus-based gene expression systems have been developed for transient expression of proteins in plants and animals. The relatively simple genomes of rhabdoviruses, encoding only 5 to 9 proteins, as well as their wide host ranges, make them appealing candidates to be engineered as expression systems.

However, the lack of direct infectivity of their negative-sense genomic RNA in plants or plant cell culture and the absence of a mechanism for recombinational insertion of foreign genes has hampered the progress in developing rhabdovirus-based vectors for plants (Bukreyev et al., 2006). Moreover, the fact that rhabdoviruses need at least three proteins (N, P and L) in addition to the genome to initiate virus replication (Goodin et al.,

2001) has limited the development of reverse genetics systems suitable to study the genetics and biology of plant rhabdoviruses (Bukreyev et al., 2006; Conzelmann, 1998).

Although examples of reverse genetics systems have been described for negative-sense

RNA animal viruses (Lico et al., 2008), they are lacking for plant viruses.

The development of a reverse genetics system for plant rhabdoviruses will not only enable the production of virus-based expression systems, but it will also extend its utility to basic research in monocots, for which no reverse genetics system is available. A crucial step in the development of a successful reverse genetics system is the selection of an appropriate system for the expression of heterologous proteins. In the last years, several systems such as bacterial, yeast, insect and mammalian cells have become available for the expression of recombinant proteins. Several expression systems were developed using mammalian cell lines mainly because of their capability to perform complex post-translational modifications in proteins (i.e. glycosylation), which could not be obtained with yeast cells (Sunley and Butler, 2010). However, the low expression level is the main limitation for their use of mammalian cells as expression systems.

Insect cells offer the advantage to overcome the limitations observed in yeast and

28 mammalian cells in addition to the low-cost associated to their maintenance. (Cha et al.,

2005; Ivey-Hoyle, 1991; Moraes et al., 2012). Several lines derived from Drosophila melanogaster have been tested for expression of recombinant proteins and the Schneider

2 (S2) cell line, which derives from late embryonic stages, has proven to be the most efficient (Schneider, 1972). To date, well-developed commercial systems for heterologous gene expression in S2 cells are available.

There are a number of examples of successful expression of heterologous proteins in S2 cells, including some of viral origin, in (Batista et al., 2009; Culp et al., 1991; Hill et al.,

2001; Jorge et al., 2008; Perret et al., 2003). Based on this evidence and the wide host range observed for rhabdoviruses, we hypothesized that MFSV components could be expressed in S2 cells, and that S2 cells might be useful for the development of a reverse genetics system for MFSV. As a first step to verifying the utility of the S2 system for expressing infectious MFSV, we examined the expression of the MFSV components required for virus replication, alone and in combinations.

2.3. Material and methods

2.3.1. Maintenance of S2 cell line

Drosophila melanogaster Schneider 2 (S2) cells is a line derived from a primary culture of late stage Drosophila melanogaster embryos (Life Technologies). The cells were maintained at 25oC as a semi-adherent layer in Schneider’s Drosophila medium (Life

29 technologies) enriched with 10% heat inactivated fetal bovine serum (FBS) (Gibco) according to the manufacturer’s recommendations.

2.3.2. Recombinant plasmid construction

The pMT/V5/His-TOPO vector, which contains a heavy metal-inducible metallothionein promoter, was used in this study (Life Technologies). Full-length ORFs corresponding to the MFSV N, P and L genes were amplified from RNA extracted from MFSV-infected maize plants by RT-PCR using the ThermoScriptTM Reverse Transcriptase System (Life

TechnologiesTM) for cDNA synthesis and the Platinum® Taq DNA Polymerase High

Fidelity System (Life TechnologiesTM) for the PCR step, according to the manufacturer’s recommendations.

The amplification products were inserted into the pMT/V5/His-TOPO vector using T4

DNA ligase-mediated ligation (Promega). Forward primers for each fragment were designed to contain a Kozak translation initiation sequence ((G/A)NNATGG) containing the ATG start codon in a proper context for initiation of translation. Similarly, the reverse primers were designed to remove the native stop codon of each gene and allow fusion with a C-terminal peptide present in the vector that allowed the detection of expressed proteins with either V5 or His antibodies. In a similar manner, the bacteriophage T7 DNA dependent RNA polymerase (DdRp) with and without a SV40 nuclear localization signal was cloned into the same plasmid vector. Recombinant plasmids were sequenced and only validated clones were used for expression experiments.

2.3.3. MFSV replicon and GFP construct

The MFSV replicon construct was assembled by Overlap Extension PCR (OE-PCR), and was a gift from Dr. T. German (Univ. Wisconsin). The construct consists of the MFSV antisense transcriptional initiation and termination sequences flanking the anti-sense GFP gene sequence, and driven by a T7 promoter modified to allow the transcription product to have the exact viral nucleotide sequence at the 5’end. In order to ensure the production of an exact 3’end of the viral genome, an HDV ribozyme and a T7 transcriptional terminator were incorporated in the construct as well (Fig. 2.1). The replicon construct was inserted into the pMT/V5/His-TOPO vector for expression in S2 cells. This construct was not fused to the V5-His tag present in the plasmid in order to have the exact sequences needed. Similarly, the GFP gene from the replicon construct was amplified and inserted in-frame into the pMT/V5/His-TOPO vector with its stop codon. The GFP construct was expected to be expressed under inducible conditions with no other requirements and it serves as a control of expression. The replicon was expected to be expressed only under the control of T7 DdRp. In order to be expressed, the replicon would need to be expressed in the presence of the MFSV N, P and L proteins. In this context, the GFP protein was expected to be produced after co-transfection of S2 cells with the entire assortment of plasmids containing the MFSV N, P and L gene sequences and the T7DdRp.

2.3.4. Expression of foreign genes in S2 cells

Plasmids were introduced into S2 cells using calcium phosphate-mediated transfection procedures of the Drosophila Expression System (DES) (Life Technologies). Cells were transfected with 5, 10 or 25 µg of each construct independently or in combinations.

Protein expression for plasmid constructs was induced with 500 M copper sulfate 48 h after transfection and monitored for 1, 2, 3 and 4 days after induction. Protein extracts from transfected S2 cells were analyzed on western blot using either anti-V5 (Life

Technologies) or specific antibodies (Redinbaugh et al., 2002).

2.3.5. Western blot assays

Western blot assays were carried out using protein extracts of transfected S2 cells.

Proteins were extracted from S2 cells using lysis buffer and extractions were resuspended in loading buffer (4% SDS, 10% 2-mercaptoethanol, 20% glycerol, 0.004% bromophenol blue, 0.125 M Tris-HCl, pH 6.8). Electrophoresis of protein samples was performed using Sodium dodecyl sulfate (SDS) acrylamide gels (4-12% gradient) (Bio-Rad).

Polyacrylamide gels were transferred to nitrocellulose membrane using a trans-blot system (Bio-Rad). Nitrocellulose membranes were blocked with 5% (w/v) dry milk in

PBS, and then incubated with antibodies specific to the V5 epitope or GFP (Life

Technologies).

2.4. Results

2.4.1. Expression of foreign genes in S2 cells

Full-length sequences for the MFSV N, P, and L as well as the T7DdRp were inserted into the inducible pMT/V5/His-TOPO vector. The expression of the MFSV N and P genes was detected in transfected S2 cells over a period of 4 day after induction of gene expression with CuSO4, but not in non-induced cells (Fig. 2.2). Antibodies to the V5 epitope clearly reacted with proteins of ~55 and 43 kDa in cells transfected with plasmids carrying the N and P genes, respectively, the sizes expected for the full-length fusion proteins. No bands were detected in non-transfected or non-induced samples. Similar results were observed when cells were co-transfected with constructs carrying the N and

P genes indicating that both proteins can be produced in S2 cells at the same time (data not shown). In the same way, the expression of the T7 polymerase fused to nuclear localization signal (NLS) sequence was detected in transfected S2 cells for at least 4 days only under inducible conditions, but did not accumulate when lacking the NLS (Fig. 2.2).

We were also able to detect the expression of the MFSV N, P and T7 polymerase proteins for up to 3 days in cells simultaneously transfected with constructs carrying the corresponding genes, indicating that these three proteins can be produced at the same time in S2 cells (Fig. 2.3). GFP expression was detected in S2 cells transfected with the construct containing the GFP gene in the sense orientation, but not in cells transfected with the replicon constructs (data not shown). Bands corresponding to GFP protein were detected for at least 4 days with specific GFP antibodies only under inducible conditions, indicating that this protein can be produced in S2 cells (Fig. 2.2). In contrast, we were not

33 able to detect the expression of the MFSV L protein in transfected S2 cells under the same conditions. Transfection experiments were conducted with 5, 10 and 20 µg of the L construct plasmid, but no detection of the corresponding fusion protein was possible using antibodies directed to the V5 epitope. The expression of the MFSV N and P, T7 polymerase and GFP genes was detected at all three levels of plasmid.

2.5. Discussion

In the last years, bacterial, yeast, insect, plant and mammalian cells have been widely used for the expression of heterologous viral proteins. Among these, the Drosophila S2 cell line offers many advantages such as proper eukaryotic post-translational modification and high level of protein expression (Cha et al., 2005; Moraes et al., 2012). However, it was not known whether S2 cells would support the replication of the MFSV genes and replicons required for development of an expression vector. Production of animal- infecting rhabdovirus particles in cells requires the simultaneous expression of the viral

N, P, and L together with the full-length negative-sense genome (Banerjee, 1987; Whelan et al., 2004). Therefore, we tested expression of MFSV N, P, and L, along with a replicon carrying viral elements important for MFSV replication fused to a GFP reporter gene and driven by a T7 promoter and the T7 polymerase.

We were able to detect the expression of the MFSV N and P and the T7 polymerase genes fused to V5 epitope sequences in S2 cells over a period of 4 days using anti-V5 specific antibodies (Fig. 2.2). The fact that we observed bands corresponding to the

34 expected sizes of the fusion proteins only under inducible conditions suggests that we detected the specific proteins corresponding to the genes inserted into the plasmid vector.

In addition, we were able to detect the simultaneous expression of the MFSV N, P and T7 polymerase genes in S2 cells, indicating that this cell line supports the production of more than two proteins at the same time.

Simultaneous expression of proteins in S2 cells have been observed for proteins of mammalian origin but not for proteins of viral origin (Dobrosotskaya et al., 2003; Kim et al., 2008). As expected, we did not detect GFP expression in S2 cells after transfection with the MFSV replicon construct alone, as this protein is expected to be produced from the replicon construct only in the presence of active MFSV N, P and L and T7DdRp proteins. To determine whether GFP expression could be detected in S2 cells, we inserted the GFP sequence in a sense direction into the same vector used for viral gene expression.

Similar to the MFSV N and P proteins, we were able to detect the GFP protein over a period of 4 days post-induction in S2 cells using GFP specific antibodies. No specific bands were detected under non-inducible conditions or in non-transfected S2 cells.

We were not able to detect the expression of the MFSV L in S2 cells under the same conditions for the other constructs. After overcoming problems with induction of mutations during growth of L protein expressing plasmids in E. coli, we were able to insert and validate the full-length sequence of the MFSV L gene into the pMT/V5/His-

TOPO plasmid, suggesting that the expression of the corresponding protein in S2 cells at levels high enough for detection with the V5 antibodies might be the problem. However,

35 growth of E. coli cells transformed with this plasmid was always much slower than that of E. coli transformed with the other constructs. Therefore, it is possible that changes in the sequence of the MFSV L insert have occurred during its propagation in E. coli, interfering with the expression of this protein in S2 cells. Alternatively, due to their large sizes, the MFSV L transcripts and/or proteins may have been targeted for degradation in

S2 cells. It is also possible that the MFSV L transcripts are targeted for degradation by

RNAi, a highly conserved gene silencing process that is essential for virus defense in plants and insects (Elbashir et al., 2001; Hamilton and Baulcombe, 1999; Hannon, 2002).

RNAi is triggered by in insect cells during infection by the animal rhabdovirus Vesicular stomatitis virus, as demonstrated by the high susceptibility of RNAi-defective mutant cells to this virus (Mueller et al., 2010).

To date, reverse genetic systems are available for two animal-infecting rhabdoviruses,

Vesicular stomatitis virus (VSV) and Rabies virus (RV) (Lawson et al., 1995; Matthias

J.Schnell, 1994; Pattnaik et al., 1992). Virus-like particles of VSV and RV were formed using similar reverse genetics approaches in non-heterologous cell systems in which the wild-type virus was able to replicate at high titers. In these systems, expression of the viral proteins necessary for encapsidation of the virus particles were achieved using anti- genomic full-length cDNA clones. However, it is not known whether S2 cells support the replication of MFSV. Preliminary experiments indicated that MFSV proteins can be detected using MFSV specific antibodies for at least six days after incubation of S2 cells in presence of DEAE-dextran but not in absence of DEAE-dextran (data not shown).

However, we were not able to discern transcripts corresponding to the anti-genomic RNA

(replicative form) from the genomic RNA (non-replicative form) of MFSV when using conventional RT-PCR. Thus, we have not yet been able to determine if the MFSV proteins detected in S2 cells corresponded to newly formed products or to stabilization of virions in the presence of DEAE-dextran. Nevertheless, the development of a virus transcript-specific RT-qPCR assay (Chapter 3) should allow us to discern the replicative form of MFSV from the non-replicative form (i.e. viral particles used as inoculum).

The main limitation of our approach was the lack of detection and/or expression of the L protein in the S2 cell system. Heterologous expression of proteins is often limited by the size of the protein to be expressed regardless of the system used (Batista et al., 2009;

Gleba et al., 2007; Moraes et al., 2012). The L gene encodes a ~250 kDa multi-enzymatic protein, which catalyzes RNA synthesis as well as mRNA capping, methylation and polyadenylation in animal-infecting rhabdoviruses (Ivanov et al., 2011). Previous analyses of the sequence of the L gene from different members of the Mononegavirales indicated a high degree of conservation and revealed the existence of six conserved domains (I – VI) (Poch et al., 1990). Among these, domain III contains motifs involved in the RNA-dependent RNA polymerase activity and polyadenylation (Whelan and

Wertz, 2002). Based on these results, it might be interesting to examine if the conserved region III and/or other regions of the MFSV L gene will be sufficient for our reverse genetics system. However, we should take into account that we do not have as yet an in- vitro system suitable for MFSV replication.

Additional efforts for developing expression system based on a dicot-infecting rhabdovirus are also underway by another group (Ganesan et al., 2009). The possibility of manipulating the MFSV genome by recombinant DNA techniques using the described procedure will greatly facilitate the investigation of MFSV genetics, virus-host interactions and plant virus pathogenesis. Additionally, it will provide a tool for the design of new generation of plant viral vectors for monocots, for which no expression systems are available.

2.6. References

Banerjee, A.K., 1987. Transcription and replication of rhabdoviruses. Microbiol Rev 51, 66-87.

Bourhis, J.M., Canard, B., Longhi, S., 2006. Structural disorder within the replicative complex of measles virus: Functional implications. Virology 344, 94-110.

Bukreyev, A., Skiadopoulos, M.H., Murphy, B.R., Collins, P.L., 2006. Nonsegmented negative-strand viruses as vaccine vectors. Journal of virology 80, 10293-10306.

Conzelmann, K.K., 1998. Nonsegmented negative-strand RNA viruses: genetics and manipulation of viral genomes. Annual review of genetics 32, 123-162.

Dobrosotskaya, I.Y., Goldstein, J.L., Brown, M.S., Rawson, R.B., 2003. Reconstitution of sterol-regulated endoplasmic reticulum-to-Golgi transport of SREBP-2 in insect cells by co-expression of mammalian SCAP and Insigs. Journal of Biological Chemistry 278, 35837-35843.

Elbashir, S.M., Martinez, J., Patkaniowska, A., Lendeckel, W., Tuschl, T., 2001. Functional anatomy of siRNAs for mediating efficient RNAi in Drosophila melanogaster embryo lysate. Embo Journal 20, 6877-6888.

Ganesan, U., Bragg, J.N., Deng, M., Marr, S., Jackson, A.O., 2009. GFP expression from a biologically active minireplicon of Sonchus yellow net virus. Phytopathology 99, S39-S39.

Gleba, Y., Klimyuk, V., Marillonnet, S., 2007. Viral vectors for the expression of proteins in plants. Current opinion in biotechnology 18, 134-141.

Hamilton, A.J., Baulcombe, D.C., 1999. A species of small antisense RNA in posttranscriptional gene silencing in plants. Science 286, 950-952.

Hannon, G.J., 2002. RNA interference. Nature 418, 244-251.

Ivanov, I., Yabukarski, F., Ruigrok, R.W.H., Jamin, M., 2011. Structural insights into the rhabdovirus transcription/replication complex. Virus research 162, 126-137.

Ivey-Hoyle, M., 1991. Recombinant gene expression in cultured Drosophila melanogaster cells. Current opinion in biotechnology 2.

Jackson, A.O., Dietzgen, R.G., Goodin, M.M., Bragg, J.N., Deng, M., 2005. Biology of plant rhabdoviruses. Annual review of phytopathology 43, 623-660.

Jorge, S.A., Santos, A.S., Spina, A., Pereira, C.A., 2008. Expression of the hepatitis B virus surface antigen in Drosophila S2 cells. Cytotechnology 57, 51-59.

Kim, K.R., Kim, Y.K., Cha, H.J., 2008. Recombinant baculovirus-based multiple protein expression platform for Drosophila S2 cell culture. J Biotechnol 133, 116-122.

Lawson, N.D., Stillman, E.A., Whitt, M.A., Rose, J.K., 1995. Recombinant vesicular stomatitis viruses from DNA. Proceedings of the National Academy of Sciences of the United States of America 92, 4477-4481.

Lico, C., Chen, Q., Santi, L., 2008. Viral vectors for production of recombinant proteins in plants. Journal of cellular physiology 216, 366-377.

Matthias J.Schnell, T.M.a.K.-K.C., 1994. Infectious rabies viruses from cloned cDNA. The EMBO journal.

Mueller, S., Gausson, V., Vodovar, N., Deddouche, S., Troxler, L., Perot, J., Pfeffer, S., Hoffmann, J.A., Saleh, M.C., Imler, J.L., 2010. RNAi-mediated immunity provides strong protection against the negative-strand RNA vesicular stomatitis virus in 40

Drosophila. Proceedings of the National Academy of Sciences of the United States of America 107, 19390-19395.

Pattnaik, A.K., Ball, L.A., LeGrone, A.W., Wertz, G.W., 1992. Infectious defective interfering particles of VSV from transcripts of a cDNA clone. Cell 69, 1011-1020.

Poch, O., Blumberg, B.M., Bougueleret, L., Tordo, N., 1990. Sequence comparison of five polymerases (L proteins) of unsegmented negative-strand RNA viruses: theoretical assignment of functional domains. The Journal of general virology 71 ( Pt 5), 1153-1162.

Redinbaugh, M.G., Hogenhout, S.A., 2005. Plant rhabdoviruses. Current topics in microbiology and immunology 292, 143-163.

Schneider, I., 1972. Cell lines derived from late embryonic stages of Drosophila melanogaster. J Embryol Exp Morphol 27, 353-365.

Sunley, K., Butler, M., 2010. Strategies for the enhancement of recombinant protein production from mammalian cells by growth arrest. Biotechnol Adv 28, 385-394.

Todd, J.C., Ammar el, D., Redinbaugh, M.G., Hoy, C., Hogenhout, S.A., 2010. Plant host range and leafhopper transmission of maize fine streak virus. Phytopathology 100, 1138-1145.

Wagner, J.D., Jackson, A.O., 1997. Characterization of the components and activity of Sonchus yellow net rhabdovirus polymerase. Journal of virology 71, 2371-2382.

Whelan, S.P., Barr, J.N., Wertz, G.W., 2004. Transcription and replication of nonsegmented negative-strand RNA viruses. Current topics in microbiology and immunology 283, 61-119.

Whelan, S.P., Wertz, G.W., 2002. Transcription and replication initiate at separate sites on the vesicular stomatitis virus genome. Proceedings of the National Academy of Sciences of the United States of America 99, 9178-9183.

T7 T7* TTTATTTTGTAGTTG TTTATTTTGTAGTT HDV t GFP geneG ℓ Term 5’ 3’

Figure 2.1. MFSV Replicon construct showing the sequences assembled by overlap extension PCR (OE-PCR). The orange line indicates the negative-sense RNA of MFSV containing the transcriptional initiation or leader (l) and termination or trailer (t) sequences flanking the GFP gene sequence. Red boxes indicate the T7 promoter (T7*) and transcriptional terminator (T7) sequences recognized by the T7DdRp. The HDV ribozyme sequence is indicated by the purple box.

Figure 2.2. Expression of foreign genes in transfected S2 cells. MFSV N and P, and T7DdRp fusion proteins were detected in S2 cells by western blot using anti-V5 antibodies and GFP protein was detected using anti-GFP specific antibodies. Expression of proteins was induced with CuSO4, and cell extracts were analyzed at 1, 2, 3, and 4 days post-induction (dpi). Controls are represented by cells that were not transfected with any construct (empty cells), or transfected but not induced (non-induced cells).

Figure 2.3. Expression of foreign genes in co-transfected S2 cells. Arrows indicate the detection of MFSV N, P and T7DdRp fusion proteins in S2 cells by western blot using anti-V5 antibodies. Expression of proteins was induced with CuSO4, and cell extracts were analyzed at 1, 2, and 3 days post-induction (dpi). Controls are represented by cells that were not transfected with any construct (empty cells), or transfected but not induced (non-induced cells).

Chapter 3: Quantification of Maize fine streak virus transcripts in maize by

reverse transcription quantitative PCR (RT-qPCR)

3.1. Abstract

Two-step RT-qPCR assays were developed to quantify the Maize fine streak virus

(MFSV) gene expression in infected maize tissue. We used oligo (dT) primers for cDNA synthesis, and primers designed to have high amplification efficiency and specificity for each of the seven MFSV genes for the qPCR step. Two analyses were used to determine the abundance of MFSV P, 3, 4, M, G and L transcripts relative to MFSV N transcripts.

In the first analysis, transcript copy number was calculated for each gene based on standard curves. For the second analysis, CT values for each gene were normalized to the

18S reference gene using the 2-Ct algorithm. In contrast to animal-infecting rhabdoviruses, MFSV gene expression did not exhibit sequential transcriptional attenuation in maize. Interestingly, transcripts corresponding to the non-structural MFSV

3 gene accumulated to higher levels than those of the MFSV N gene, suggesting differential regulation of transcription for these two genes or exhibit increased stability relative the remaining MFSV transcripts.

3.2. Introduction

Maize fine streak virus (MFSV) is an emerging pathogen of maize that belongs to the family Rhabdoviridae (Redinbaugh et al., 2002). Viruses in this family have bacilliform virions containing non-segmented negative-sense RNA genomes and are significant pathogens of humans, animals and plants (Conzelmann, 1998; Jackson et al., 2005;

Redinbaugh and Hogenhout, 2005). The symptoms caused by MFSV include dwarfing and fine chlorotic streaks along intermediate and small veins. MFSV is transmitted by the black-faced leafhopper Graminella nigrifrons (Forbes) in a persistent circulative manner, indicating virus replication in the insect vector (Todd et al., 2010). Mechanical transmission of MFSV is difficult as rub-inoculation is ineffective and successful inoculation requires inoculation of seeds through vascular puncture inoculation (VPI)

(Redinbaugh et al., 2002). The MFSV genome is a 13,782 nucleotide non-segmented negative-sense RNA that encodes seven distinct genes in the 3´-N-P-3-4-M-G-L-5´ order.

Proteins corresponding to MFSV N, P, M, G, and L have been detected in infected maize leaves, with their functions being assigned based on gene order and sequence similarity to other Rhabdoviridae (Tsai et al., 2005). However, functions for the non-structural MFSV

3 and 4 genes remain unknown.

Based on similarity to Vesticular stomatitis virus (VSV) and other Rhabdoviridae, transcription and replication in MFSV are thought to initiate at sites located on the 3´ end of the genomic RNA (Jackson et al., 2005; Tsai et al., 2005). During VSV transcription, the viral polymerase uses a stop–start mechanism with a single entry point at the 3’ end

46 of the genome. The polymerase (L protein) first produces the short leader RNA, which is not capped or polyadenylated. It then restarts with transcription of the 3’ gene on the genome (i.e. the N gene). This transcript is capped and polyadenylated by the viral polymerase, as are all the other viral transcripts. At the end of the N gene the viral polymerase starts transcription of the P gene, and so on until the end of the last gene

(Assenberg et al., 2010; Iverson and Rose, 1981; Whelan and Wertz, 2002). An attenuation of transcription of 29-33% across each intergenic region has been observed using the VSV RdRP in vitro (Iverson and Rose, 1981). This transcription strategy results in transcripts for the downstream genes being produced at lower amounts than those for the upstream genes. It has been suggested that this transcription strategy accounts for the observed conservation in gene order within the Mononegavirales, with genes whose products are required in large amounts located promoter proximally, whereas those needed in catalytic amounts being more distal (Whelan et al., 2004).

Real-time RT-qPCR is a very sensitive method for the quantification of DNA and RNA

(Bustin, 2000; Kubista et al., 2006). This technology has been shown to be efficient for analysis of virus gene expression (Pan et al., 2005; Tombacz et al., 2009). Analysis of viral replication requires detection of strand-specific cDNA synthesis during reverse transcription of viral RNA that can then be quantified using real-time RT-qPCR viral gene transcripts (Komurian-Pradel et al., 2004). While conceptually simple, the production of strand-specific cDNAs is technically difficult due to the tendency of viral

RNA molecules to auto-prime (i.e. produce cDNA without addition of primers) (Ruigrok

47 et al., 2011). Alternatively, the specific detection of gene transcripts in organisms that produce polyadenylated mRNAs can be achieved by priming reverse transcription with oligo(dT)s. RT-qPCR data can be analyzed using absolute or relative quantification

(Kubista et al., 2006). In absolute quantification, the quantity (e.g., transcript copy number) of the unknown sample is interpolated from a range of standards of known quantity. In relative quantification, the result obtained is the fold increase (or decrease) of the target gene in the test sample relative to the calibrator sample and is normalized to the expression of a reference gene (Huggett et al., 2005; Livak and Schmittgen, 2001).

In this study, we developed RT-qPCR assays for the quantification of each of the seven

MFSV transcripts. We used this method to establish the relative accumulation for each of the seven MFSV transcripts in leaves of infected maize plants.

3.3. Material and Methods

3.3.1. Plant inoculations and growth conditions

Maize (Zea mays L.) seeds (cv Spirit) were infected with MFSV by vascular puncture inoculation (VPI) as previously described (Redinbaugh et al., 2002). Mock inoculations using virus-extraction buffer (0.1 M potassium phosphate, pH 7.0) as inoculum were used as controls. Infection experiments were conducted in three independent replicates. Of the

50 seeds inoculated in each replicate, 66.5±2.2% germinated after incubation at 30oC in the dark for two days. Seeds were subsequently planted in potting soil and moved a growth chamber with a 28˚C/16 h day, 22˚C/8 h night cycle. Approximately 35% of the

48 germinated seeds were infected as assessed by symptom development. After four weeks of growth, symptomatic leaves were harvested and used immediately for RNA isolation.

3.3.2. RNA isolation

Total RNA was isolated from 50 mg of maize leaves using the Direct-zol™ RNA

MiniPrep System (Zymo Research) following the manufacturer’s protocol. DNA was removed with Turbo DNAfree (Ambion, Inc.) using the rigorous protocol before RNA quantification. Removal of DNA from plant RNA samples was confirmed by performing conventional PCR on 100 ng of total RNA using a maize actin (GeneBank accession No

NM001155179) primer set (Table 1). DNA-free total RNA was quantified by micro- spectrophotometry (NanoDrop 2000C, NanoDrop Technologies). RNA quality was assessed using the Experion Automated Electrophoresis System (Bio-Rad Laboratories,

Inc) and only those RNAs with RQ (RNA Quality) values of seven or higher were used for further analysis.

3.3.2. Primer design

Primers were designed based on MFSV sequences obtained from GenBank (accession No

NC_005974) (Table 1). Sequences were imported into Beacon Designer software

(Premier Biosoft) and primers were designed using the SYBR Green protocol. The program setting ‘avoid template structure’ was chosen to restrict primer sequences and products to regions of the genomic RNA that have little secondary structure. Primer specificity was verified by BLAST searches of the GenBank non-redundant database

(National Center for Biotechnology Information (NCBI) website http://www.ncbi.nlm.nih.gov/BLAST/), and primers were purchased from IDT

(Integrated DNA Technologies). Primer efficiencies on a target template were calculated using the formula: % efficiency = (E – 1) x 100%, where E=10(-1/slope), and slope corresponds to the slope of the standard curve generated for each pair of primers using

Pearson’s Correlation Coefficient in the Bio-Rad CFX96 system software (Bio-Rad

Laboratories, Inc.) (Pfaffl, 2001; Rasmussen, 2001) (Table 2).

3.3.3. RT-qPCR assays

A two-step quantitative RT-PCR was carried out for transcriptional analysis. For each gene, a minimum of 3 independent biological replicates using RNA from each of the three MFSV inoculation experiments were performed.

Reverse transcription. cDNA was generated from 1 µg of DNA-free total RNA using

ThermoScriptTM Reverse Transcriptase system (Life TechnologiesTM) following the manufacturer’s protocol. Briefly, oligo(dT)20 (2.5 µM final concentration) and template were mixed in a total of 12 µl; the mixture was incubated at 65˚C for 5 min and quenched on ice; then 8 µl of a mixture of 5X reaction buffer (1X final concentration) and 1 unit of reverse transcriptase were added to each sample. No reverse transcriptase was added to the negative control (NRT). Reactions were incubated at 60˚C for 60 min, and then terminated by heating to 85˚C for 5 min. Reactions were stored at -20˚C until needed.

Samples were diluted 10-fold for subsequent qPCR.

Quantitative PCR. All reactions were performed in triplicate using SsoFastTM

EvaGreen® Supermix (Bio-Rad Laboratories, Inc.) in a total volume of 15 µl. Similar to

SYBR Green, this kit uses a DNA-intercalating dye (EvaGreen®) that emits fluorescence when complexed with double-stranded DNA. Reactions were prepared for each primer pair containing 1X EvaGreen supermix, 300 nM of each primer and 1 µl of the 1/10 dilution of the cDNA as a template. No template was added to the negative control

(NTC). Reactions were amplified using the Bio-Rad CFX96 TouchTM Real-Time PCR

Detection System (Bio-Rad Laboratories, Inc.) using a 2-step amplification protocol. The reaction conditions were: enzyme activation and well factor determination at 98˚C for two minutes followed by 40 cycles of 98˚C for 2 sec (denaturation) and 55 ºC for 5 sec

(annealing and elongation). After the cycling protocol, a melting curve protocol was performed at 70 - 90˚C with increments of 0.2˚C every 10 sec.

3.3.5. Assay validation and optimization

A powerful way to determine whether a qPCR assay is optimized is to run serial dilutions of a template and use the results to generate a standard curve (Bustin et al., 2009). Two types of templates were independently used to generate standard curves for our experiments. First, RT-PCR products containing each of the MFSV target genes were synthesized from RNA isolated from MFSV-infected maize plants, purified, quantified, and then combined in equimolar amounts to generate standard curves. In the second, target sequences for qPCR were sequentially cloned into plasmids, and then used for generating the standard curve. To generate these constructs, cDNA fragments

51 corresponding to each of the MFSV targets were produced by RT-PCR using RNA extracted from MFSV-infected plants as a template, and cloned into the pGAD-T7 plasmid (Life Technologies) by multiple ligations (Fig. 3.1). We were not able to introduce all the targets into one plasmid, thus two different constructs were generated.

The first construct (std 5) contains targets for the MFSV N, P, 3 and 4 primers, while the second construct (std 6) contains targets for the MFSV N, P, M, G, and L primers.

Common targets were included on each standard to allow for independent use of each standard. DNA concentrations of the RT-PCR products and plasmid constructs were determined using the nanodrop 2000C software (NanoDrop Technologies) and recalculated into number of molecules/µl. Both constructs were sequenced and tested using conventional PCR to verify the presence of target sequences. Standard curves were individually generated using 10-fold serial dilutions (from 10-1 to 10-8) of each type of template (RT-PCR products or plasmid constructs). Each dilution was tested in triplicate and independent RT-qPCR runs were analyzed for each primer set. The standard curve, correlation coefficient (R2) and the amplification efficiency (E) were calculated as previously described (Bustin et al., 2009; Pfaffl, 2001) (Table 2).

3.3.6. Relative quantification of MFSV gene expression

3.3.6.1. Relative quantification of MFSV gene expression using transcript copy

number

The relative quantification of MFSV gene expression was expressed as a ratio (r) of each

MFSV gene transcript copy number to the MFSV N gene transcript copy number (Eq.1).

Expression of a reference gene was not used in this case, because absolute values of transcript numbers were used for each gene. To correct for the background caused by self-priming of the RNA, the copy number obtained for each no primer control was subtracted from the copy number detected with the gene-specific primers.

Equation 1. Relative expression ratio (r) r = ratio = MFSV test gene transcript copy number (sample – no primer control)

MFSV N gene transcript copy number (sample – no primer control)

The resulting ratios for each MFSV gene were used for statistical analysis and the means of the values were plotted in a histogram (Fig 3.2).

3.3.6.2. Relative quantification of MFSV gene expression by the 2-Ct method

-Ct The comparative CT or 2 method (Livak and Schmittgen, 2001) was also used to analyze relative MFSV gene expression (Huggett et al., 2005). The quantification cycle

(Cq) or threshold cycle (CT) value for each gene was determined by automated threshold analysis on the Bio-Rad CFX96 system (Bio-Rad Laboratories, Inc.), then normalized to the CT value of the reference gene to obtain CT(MFSV gene) = (CT(MFSV gene) – CT(reference gene)). Then expression relative to the MFSV N gene was determined using CT =

-Ct (CT(MFSV gene) - CT(MFSV N)) according to the to the 2 algorithm (Eq.2).

Equation 2. Normalized expression ratio

2-Ct = 2 -(CT(MFSV gene) - CT(MFSV N))

The resulting 2-Ct values for each MFSV gene were used for statistical analyses. In order to identify a reference gene suitable for normalization, we analyzed the stability expression of the maize actin and 18S rRNA genes (GeneBank accession No

NM001155179) using the genormPLUS algorithm (Table1) (Vandesompele et al., 2002).

The genormPLUS software package defines the gene stability measure (M) as the average pairwise variation between all the genes analyzed, in a given set of samples; and M values lower than 0.5 reflect stable expression.

3.3.7. Data analysis

Means separations for the ratios of relative quantification were determined with the generalized linear model (GLM) and Fisher’s less significant difference (LSD) tests

(PROC GLM, LSD) using SAS Enterprise Guide 4 (Statistical Analysis Systems, Cary

NC).

3.4. Results

3.4.1. RT-qPCR Assays

To detect MFSV transcripts, we used oligo(dT)20 primers for the cDNA synthesis and primer sets specific to all seven genes of MFSV (Table 1). Polyadenylation of viral transcripts by the viral polymerase has been observed for animal-infecting rhabdoviruses, and has been hypothesized for plant-infecting rhabdoviruses (Assenberg et al., 2010;

Jackson et al., 2005). In addition, preliminary studies by K. Willis (USDA, ARS, personal communication) indicated that MFSV transcripts could be detected when

54 oligo(dT) was used to prime cDNA synthesis for RNA extracted from MFSV-infected plants but not from virions, suggesting that the synthesis of cDNA occur only from

MFSV transcripts but not from genomic viral RNA (vRNA) (data not shown).

The amplification efficiency (E) for all primer pairs tested in this study ranged from 1.94 to 2.03, as calculated from the slope of the standard curves (Table 2). This indicated high amplification efficiencies, ranging from 94 to 103%. E values of 100% are the best indicator of a robust, reproducible assay, and indicate that the entire template was amplified in every cycle (Huggett et al., 2005). In practice, E values between 90 and

105% are considered good (Bustin et al., 2009). The primer pairs were specific, as indicated by the absence of non-specific products and primer dimers based on the observation of a single peak in the melting curve analysis after 40 cycles of amplification.

In addition, the standard curves produced linear regression curves with correlation coefficient (R2) values between 0.988 and 0.997 (Table 2). R2 values greater than 0.980 indicate optimized qPCR assays (Bustin et al., 2009). E and R2 values were similar when using either PCR products or the plasmid constructs containing the targets for the MFSV genes as standards. The ten-fold serial dilutions of templates (PCR products or plasmid constructs) used for generating the standard curves produced slopes ranging from 3.423 to 3.464, close to the theoretical slope of 3.32 obtained at 100% amplification efficiency

(Huggett et al., 2005).

3.4.2. Relative quantification of MFSV gene expression

Two approaches were used to determine the relative levels of MFSV gene expression.

Both approaches are based on the ratio of gene expression for each MFSV gene relative to the MFSV N gene. The first approach used the transcript copy number corresponding to each MFSV gene to calculate the ratios. Transcript copy numbers were determined by including standard curves on each PCR plate. To determine relative MFSV transcript copy number in leaf tissue, RT-qPCR was carried out using 10-fold dilutions of cDNA synthesized from 12 independent 1 µg samples of total RNA from MFSV-infected leaves.

Transcript copy number values ranged from 1.5 x 105 to 2 x 107. Background, as defined by the no oligo(dT) primer controls, yielded transcript copy numbers ranging from 2 x

103 to 1 x 105, which represented between 10 to 30%. To correct for this background, the values in the no primer controls were subtracted from values for each test sample. The no-reverse transcriptase (NRT) and the no-template (NTC) controls did not yield detectable RT-qPCR products. Using this approach to calculate relative transcript levels, the mean number of transcripts was similar for the MFSV N, 4 and M genes (P<0.05)

(Fig. 3.2). Also, MFSV N and P, and G and L transcripts accumulated to similar levels.

Surprisingly, MFSV 3 transcripts were 4.5 higher than those of MFSV N. Similar mean separations were observed when using either RT-PCR products or plasmid constructs to generate the standard curves (data not shown).

The second approach used the CT values of each sample normalized to a reference gene.

The expression stability for two potential reference genes, the maize 18S and actin genes,

56 was compared using the genormPLUS software, and an M value of 0.460 was obtained.

The low M value (M<0.5) indicated high correlation and stability for both genes

(Hellemans et al., 2007; Vandesompele et al., 2002) making either suitable as a reference for MFSV transcript quantification. The means of the CT values were 20.65±0.31 and

30.69±0.75 for the 18S and actin RNAs, respectively, when using the 10-fold cDNA dilutions as templates for amplification. We detected MFSV gene transcripts in each of the 10-fold cDNA dilutions of all the samples tested, with CT values ranging from 22.05 to 27.96 for the MFSV genes. Therefore, given the range of detection for the MFSV genes, we decided to use 18S as reference gene for our analysis. The relative quantification of the MFSV gene expression was calculated according to 2-Ct algorithm to give fold-differences in accumulation of MFSV gene transcripts relative to the MFSV

N transcript (Fig 3.3). Using this approach we found that MFSV N, 4 and M transcripts accumulated at comparable levels (P<0.05), similar to the relative levels observed when using the transcript copy number to calculate gene expression. Likewise, MFSV G and L were not significantly different using the same parameters. In contrast, the accumulation of the MFSV P and 3 transcripts were 3 and 6-fold higher than MFSV N transcripts, respectively. Similar patterns of transcript accumulation were found when using other genes (i.e. MFSV 3 and MFSV L) as calibrators.

3.5. Discussion

Sequential transcriptional attenuation has been observed for animal-infecting, nonsegmented, negative strand RNA viruses (Mononegavirales), including the extensively

57 studied rhabdovirus VSV (Ruigrok et al., 2011; Whelan et al., 2004). Attenuation of

~30% across genes has been observed for different members of the Mononegavirales and is thought to be regulated at each intergenic region (Whelan and Wertz, 2002). However, it was not known whether other plant-infecting rhabdoviruses are similarly regulated. To address this question, we first developed a sensitive and reproducible assay for determining the relative expression of MFSV genes. A robust RT-qPCR assay was developed, as determined by E, R2 and slope values close to the theoretical values obtained with 100% of amplification efficiency. For calculating relative gene expression, two approaches using external and internal standards were used. External standards were purified and quantified RT-PCR products corresponding to each MFSV gene, or plasmids encoding target sequences for multiple MFSV genes. The internal standard used was the maize 18S RNA. Both approaches were used to analyze the transcription patterns of the

MFSV genes, and both resulted in similar patterns of transcription (Fig 3.2 and 3.3).

However, a defined, sequential gradient of gene transcription from the 3’ to 5’ end of the

MFSV genome was not observed, suggesting that MFSV does not have polar, discontinuous transcription in its plant host.

The expression of the MFSV 4 and M genes was not significantly different from that of the MFSV N gene, indicating that there was no attenuation in expression of these genes.

The matrix (M) proteins of animal-infecting rhabdoviruses are multifunctional proteins involved in virus maturation and budding (Harty et al., 1999) that have been implicated in the modulation of viral gene transcription and translation (Komarova et al., 2007; von

Kobbe et al., 2000). Relatively higher transcription of the MFSV M gene in maize, comparable to MFSV N, may indicate that the M protein plays more than one role during viral infection of the plant host. Although no function has yet been assigned to MFSV 4, the fact that MFSV 4 transcripts accumulate to levels similar to MFSV N may also indicate an active role during plant infection. MFSV 4 is one of the two additional, non- structural genes encoded by the MFSV genome, that are thought to play important roles during infection of the plant host (Jackson et al., 2005). Additional, non-structural genes located between the P and M genes have been observed in other plant-infecting rhabdoviruses but not in animal-infecting rhabdoviruses (Walker et al., 2011). Among these, the sc4 of Sonchus yellow net virus (SYNV) and the P3 of Rice yellow stunt virus

(RYSV) have been implicated in cell-to-cell movement (Huang et al., 2005; Melcher,

2000; Scholthof et al., 1994).

Secondary structure predictions of this protein share similarity to the consensus core of the 30K superfamily of viral movement proteins (Melcher, 2000).

Lower relative levels of transcripts were observed for the MFSV G and L genes relative to MFSV N, suggesting that the expression of these two genes is attenuated during viral replication. However, means separation tests indicate that this attenuation was not significantly different for the G gene (Figure 3.2 and 3.3). Attenuation of L gene expression was significant when the transcript copy number was used for quantification, but not when the CT values were used. This might be explained by the fact that the CT values for the MFSV L gene were not uniform across samples and replicates. Taking into

59 account the number of genes encoded by the MFSV genome, if the relative rates of

MFSV transcription were similar to those described for VSV, then we would have expected MFSV N gene transcript levels to be about 6-fold higher than those the L gene

(Iverson and Rose, 1981), and this is consistent with the approximately 8-fold higher accumulation of MFSV N vs. L gene transcripts. The L protein of rhabdoviruses, together with N and P, form a complex that is important for virus replication and transcription

(Banerjee, 1987). Low accumulation of the MFSV L transcripts may indicate a regulation of the transcription/replication complex during viral infection. Alternatively, due to its large size, the MFSV L mRNA may be a target for degradation by the host cell machinery.

In contrast, the relative transcription ratios for MFSV 3 were at least 4.5-fold higher than

MFSV N (Figs.3. 2 and 3.3), indicating increased transcription and/or reduced degradation. The MFSV 3 is the other, non-structural gene encoded by the MFSV genome. To date, few studies have been conducted to determine the relative gene expression of plant-infecting members of the Mononegavirales. In Rice stripe virus

(RSV), dominant expression of the suppressor of gene silencing (NS3) gene was observed in infected rice plants (Li S, 2012). The elevated levels of MFSV 3 suggest that the accumulation of these transcripts is regulated differently than the other genes during infection of maize. Alternatively, transcripts corresponding to the MFSV 3 gene may be more stable or less susceptible to degradation during infection of maize.

The relative levels of MFSV P transcripts were at least 3-fold higher than MFSV N when analyzed by the 2-Ct method (Fig 3.3). However, when the transcript copy number was used to analyze our data, MFSV P transcript levels were not significantly different to those for MFSV N (Fig 3.2). It is possible that the higher transcript copy number observed for the no primer control for MFSV P interfered with our ability to quantify expression using the transcript copy number approach. The P proteins of animal-infecting rhabdoviruses have been implicated in the inhibition of the immune response of host cells, particularly the IFN/STAT signaling pathway (Oksayan et al., 2012). Higher levels of MFSV P transcripts relative to MFSV N transcripts, could suggest a role during viral infection, perhaps by blocking the plant immune response. Other studies on transcriptional regulation of VSV gene expression indicated that a precise balance in the relative amounts of the N to the P proteins (N:P) was critical for replication (Harouaka and Wertz, 2012). We do not as yet know if specific ratios of MFSV transcripts and/or proteins are important for virus replication and movement in plants.

For animal-infecting rhabdoviruses, particularly VSV and Rabies virus (RV), the attenuation of gene transcription has been associated with the length of the intergenic regions (Finke et al., 2000; Iverson and Rose, 1981). In contrast, the length of individual intergenic regions did not play a role in the accumulation gradients of gene transcripts for other members of the Mononegavirales (Kuo et al., 1996; Schneemann et al., 1994; Yan and Samal, 2008). In the case of MFSV, the intergenic regions are identical not only in

size, but also in sequence, suggesting that additional unknown factors may be involved in

the regulation of transcription.

3.6. Roles and Acknowledgements

Kyle Willis (USDA, ARS, Madison, WI) designed the MFSV primer pairs used for and

performed preliminary experiments for this study. Support for this research was provided

by a grant to Fiorella Cisneros from the OARDC Research enhancement competitive

grants program (SEEDS) and by USDA, ARS.

3.7. References

Banerjee, A.K., 1987. Transcription and replication of rhabdoviruses. Microbiol Rev 51, 66-87.

Bustin, S.A., 2000. Absolute quantification of mRNA using real-time reverse transcription polymerase chain reaction assays. Journal of Molecular Endocrinology 25, 169-193.

Bustin, S.A., Benes, V., Garson, J.A., Hellemans, J., Huggett, J., Kubista, M., Mueller, R., Nolan, T., Pfaffl, M.W., Shipley, G.L., Vandesompele, J., Wittwer, C.T., 2009. The MIQE guidelines: minimum information for publication of quantitative real-time PCR experiments. Clinical chemistry 55, 611-622.

Conzelmann, K.K., 1998. Nonsegmented negative-strand RNA viruses: genetics and manipulation of viral genomes. Annual review of genetics 32, 123-162.

Finke, S., Cox, J.H., Conzelmann, K.K., 2000. Differential transcription attenuation of rabies virus genes by intergenic regions: generation of recombinant viruses overexpressing the polymerase gene. Journal of virology 74, 7261-7269.

Harouaka, D., Wertz, G.W., 2012. Second-Site Mutations Selected in Transcriptional Regulatory Sequences Compensate for Engineered Mutations in the Vesicular Stomatitis Virus Nucleocapsid Protein. Journal of virology 86, 11266-11275.

Harty, R.N., Paragas, J., Sudol, M., Palese, P., 1999. A proline-rich motif within the matrix protein of vesicular stomatitis virus and rabies virus interacts with WW domains of cellular proteins: Implications for viral budding. Journal of virology 73, 2921-2929.

Hellemans, J., Mortier, G., De Paepe, A., Speleman, F., Vandesompele, J., 2007. qBase relative quantification framework and software for management and automated analysis of real-time quantitative PCR data. Genome biology 8.

Huang, Y.W., Geng, Y.F., Ying, X.B., Chen, X.Y., Fang, R.X., 2005. Identification of a movement protein of rice yellow stunt rhabdovirus. Journal of virology 79, 2108- 2114.

Huggett, J., Dheda, K., Bustin, S., Zumla, A., 2005. Real-time RT-PCR normalisation; strategies and considerations. Genes and Immunity 6, 279-284.

Iverson, L.E., Rose, J.K., 1981. Localized attenuation and discontinuous synthesis during vesicular stomatitis-virus transcription. Cell 23, 477-484.

Jackson, A.O., Dietzgen, R.G., Goodin, M.M., Bragg, J.N., Deng, M., 2005. Biology of plant rhabdoviruses. Annual review of phytopathology 43, 623-660.

Komarova, A.V., Rea, E., Borman, A.M., Brocard, M., England, P., Tordo, N., Hershey, J.W.B., Kean, K.M., Jacob, Y., 2007. Rabies virus matrix protein interplay with elF3, new insights into rabies virus pathogenesis. Nucleic Acids Research 35, 1522-1532.

Komurian-Pradel, F., Perret, M., Deiman, B., Sodoyer, M., Lotteau, V., Paranhos- Baccala, G., Andre, P., 2004. Strand specific quantitative real-time PCR to study replication of hepatitis C virus genome. Journal of virological methods 116, 103-106.

Kubista, M., Andrade, J.M., Bengtsson, M., Forootan, A., Jonak, J., Lind, K., Sindelka, R., Sjoback, R., Sjogreen, B., Strombom, L., Stahlberg, A., ZoriC, N., 2006. The real- time polymerase chain reaction. Molecular Aspects of Medicine 27, 95-125.

Kuo, L.L., Fearns, R., Collins, P.L., 1996. The structurally diverse intergenic regions of respiratory syncytial virus do not modulate sequential transcription by a dicistronic minigenome. Journal of virology 70, 6143-6150.

Li S, e.a., 2012. Analysis of RSV whole gene expression in rice and planthopper by qPCR. acta Virologica.

Livak, K.J., Schmittgen, T.D., 2001. Analysis of relative gene expression data using real- time quantitative PCR and the 2(-Delta Delta C(T)) Method. Methods 25, 402-408.

Melcher, U., 2000. The '30K' superfamily of viral movement proteins. The Journal of general virology 81, 257-266.

Oksayan, S., Ito, N., Moseley, G., Blondel, D., 2012. Subcellular trafficking in rhabdovirus infection and immune evasion: a novel target for therapeutics. Infectious disorders drug targets 12, 38-58.

Pan, Y.R., Fang, C.Y., Chang, Y.S., Chang, H.Y., 2005. Analysis of Epstein-Barr virus gene expression upon phorbol ester and hydroxyurea treatment by real-time quantitative PCR. Archives of virology 150, 755-770.

Pfaffl, M.W., 2001. A new mathematical model for relative quantification in real-time RT-PCR. Nucleic Acids Res 29, e45.

Rasmussen, R., 2001. Quantification on the LightCycler instrument, in: Meurer, S., Wittwer, C., Nakagawara, K. (Eds.), Rapid Cycle Real-Time PCR: Methods and Applications. Springer-Verlag Press, Heidelberg, pp. 21-34.

Redinbaugh, M.G., Hogenhout, S.A., 2005. Plant rhabdoviruses. Current topics in microbiology and immunology 292, 143-163.

Ruigrok, R.W., Crepin, T., Kolakofsky, D., 2011. Nucleoproteins and nucleocapsids of negative-strand RNA viruses. Current opinion in microbiology 14, 504-510.

Schneemann, A., Schneider, P.A., Kim, S., Lipkin, W.I., 1994. Identification of Signal Sequences That Control Transcription of Borna-Disease Virus, a Nonsegmented, Negative-Strand Rna Virus. Journal of virology 68, 6514-6522.

Scholthof, K.B., Hillman, B.I., Modrell, B., Heaton, L.A., Jackson, A.O., 1994. Characterization and detection of sc4: a sixth gene encoded by sonchus yellow net virus. Virology 204, 279-288.

Todd, J.C., Ammar el, D., Redinbaugh, M.G., Hoy, C., Hogenhout, S.A., 2010. Plant host range and leafhopper transmission of maize fine streak virus. Phytopathology 100, 1138-1145.

Tombacz, D., Toth, J.S., Petrovszki, P., Boldogkoi, Z., 2009. Whole-genome analysis of pseudorabies virus gene expression by real-time quantitative RT-PCR assay. BMC genomics 10, 491.

Vandesompele, J., De Preter, K., Pattyn, F., Poppe, B., Van Roy, N., De Paepe, A., Speleman, F., 2002. Accurate normalization of real-time quantitative RT-PCR data by geometric averaging of multiple internal control genes. Genome biology 3. von Kobbe, C., van Deursen, J.M., Rodrigues, J.P., Sitterlin, D., Bachi, A., Wu, X., Wilm, M., Carmo-Fonseca, M., Izaurralde, E., 2000. Vesicular stomatitis virus matrix protein inhibits host cell gene expression by targeting the nucleoporin Nup98. Mol Cell 6, 1243-1252.

Walker, P.J., Dietzgen, R.G., Joubert, D.A., Blasdell, K.R., 2011. Rhabdovirus accessory genes. Virus research 162, 110-125.

Whelan, S.P., Barr, J.N., Wertz, G.W., 2004. Transcription and replication of nonsegmented negative-strand RNA viruses. Current topics in microbiology and immunology 283, 61-119.

Yan, Y., Samal, S.K., 2008. Role of intergenic sequences in newcastle disease virus RNA transcription and pathogenesis. Journal of virology 82, 1323-1331.

Primer sequence (5' to 3', Product Name Gene product forward/reverse) size MFSV N nucleocapsid protein ACAGTCACCAGCAAGAGTTC 120 CAATCGTAAGAATGAGCAGAGG MFSV P phosphoprotein CAGTGACAGAAGCAGACC 160 GAGTTAGAATCGGAGCCATC MFSV 3 unknown ATTCAGGAGGAGAAATCAC 196 ATAGGGAGATGTTCATTACC MFSV 4 unknown CAGACATTATCAGAGGACAG 174 AACAAGAAGGAACATAGTGG MFSV M matrix protein GGCTGGTAGAACTAAAGAAAG 183 TGTGTATTGTATGGCTGATAAG MFSV G glycoprotein GCTCAACCCGAACAACTC 199 CGCTTCCTGAACTGTAACTC MFSV L polymerase GATATGCTCTCTGTGTCAATG 176 CGTTAAGAATCTGGTTGTATCC M_18S Maize 18S rRNA GATTCCGGTCCTATTGTGTTG 142 TTTCGCAGTTGTTCGTCTTT M_Actin Maize actin TGTCGAGAAGAGCTACGAGATG ATGCCAACAAGGGATGGT 201 Table 3.1. Primer names, sequences and product size. MFSV primers were derived from the genome sequence (GeneBank accession No NC_005974)

Primer set Efficiency ( E ) % efficiency R2 qPCR efficiency MFSV N 1.96 96.0 0.993 3.423 MFSV P 2.03 103.0 0.988 3.427 MFSV 3 2.03 103.0 0.990 3.428 MFSV 4 1.96 96.0 0.992 3.446 MFSV M 1.94 94.0 0.991 3.434 MFSV G 1.96 96.0 0.997 3.464 MFSV L 1.96 96.0 0.995 3.442

Table 3.2. Assay performance. Primer efficiencies (E ) were determined from a dilution curve of target DNA using the formula: E = 10(-1/slope) (Bustin et al., 2009) (Pfaffl, 2001). The correlation coefficient (R2) of the standard curve for each primer set was determined by the Bio-Rad CFX Manager software and the qPCR efficiency was determined from the slope of the curve.

Figure 3.1. Plasmid constructs containing the MFSV target genes.

6.00

5.00 a

4.00

3.00 transcript 2.00 b b,c,d b,c

Ratios relative MFSV to Ngene 1.00 c,d,e d,e e 0.00 MFSV N MFSV P MFSV 3 MFSV 4 MFSV M MFSV G MFSV L

Figure 3.2. MFSV gene transcript copy number relative to MFSV N gene transcript copy number. Bars with the same letter designations are not significantly different at 95% confidence interval determined using the generalized linear model (GLM) with a Fisher’s least significant difference (LSD) test.

7.00 a 6.00

5.00

4.00 b 3.00

genetranscript c 2.00 c

difference to relative the MFSV N c,d - 1.00 d

Fold d 0.00 MFSV N MFSV P MFSV 3 MFSV 4 MFSV M MFSV G MFSV L

Figure 3.3. MFSV gene expression relative to the MFSV N gene using the 2-Ct algorithm. Bars with the same letter designations are not significantly different at 95% confidence interval determined using the generalized linear model (GLM) with a Fisher’s least significant difference (LSD) test

Chapter 4: Analysis of Maize fine streak virus gene expression in its plant host and insect vectors

4.1. Abstract

Maize fine streak virus (MFSV) is a nucleorhabdovirus transmitted by the black-faced leafhopper, Graminella nigrifrons. Parameters affecting the efficiency of MFSV acquisition by G. nigrifrons and its transmission to maize include viral titer and the length of the acquisition and inoculation access periods. It is not known whether MFSV gene expression plays a role during acquisition and transmission by G. nigrifrons. To address this question, quantification of MFSV gene expression in its maize host for four weeks post-inoculation and in its insect vector at six weeks post exposure to infected maize were examined using a quantitative RT-PCR (RT-qPCR) assay. Accumulation of

MFSV P, 3, 4, M, G and L transcripts relative to the N transcripts and normalized to the reference 18S RNA in maize plants and to the Ribosomal protein S13 gene RPS13 in insects were determined using the comparative CT method. Transcript accumulation for the MFSV genes was different in the two hosts. In plants, higher levels the MFSV P and

3 transcripts were found relative to N transcripts, while MFSV L transcripts were present at lower levels. In G. nigrifrons, MFSV P, 3, M and G transcripts accumulated at higher levels than N transcripts, whereas MFSV 4 and L transcripts accumulated at lower levels.

In G. nigrifrons, insect transmitters or acquirers, as differentiated by their ability to acquire and transmit MFSV, exhibited similar patterns of transcript accumulation. These results indicate that the regulation of virus gene transcription for this plant-infecting 71 nucleorhabdovirus is different from that of animal-infecting rhabdoviruses, for which transcript accumulation decreases sequentially from the 3’ to the 5’ end of the genome.

4.2. Introduction

Viruses in the family Rhabdoviridae include important pathogens that infect humans, animals and plants, and many rhabdoviruses are transmitted by arthropods (Hogenhout et al., 2003; Jackson et al., 2005). Viruses in two of the six Rhabdoviridae genera infect plants. Viruses in the genus Cytorhabdovirus replicate in the cytoplasm of infected plant cells, while those in the genus Nucleorhabdovirus replicate in the nuclei. Plant-infecting rhabdoviruses are transmitted by hemipteran insects, and one particular characteristic of plant rhabdoviruses is that they replicate in both their insect vector and the plant host

(Ammar el et al., 2009; Todd et al., 2010).

Maize fine streak virus (MFSV) is a member of the genus Nucleorhabdovirus, and was first reported in Georgia (Redinbaugh et al., 2002). MFSV is transmitted in a persistent propagative manner by the black-faced leafhopper Graminella nigrifons (Redinbaugh et al., 2002; Todd et al., 2010). Transmission of rhabdoviruses by their vector exhibits high species specificity, as reflected by the number, efficiency, and relatedness of vector species for each virus (Ammar and Nault, 2002; Creamer et al., 1997). In this context, G. nigrifrons was the only vector able to transmit MFSV identified among several insect species tested that use maize as a feeding and/or developmental host (Redinbaugh et al.,

2002). In addition to vector specificity, viral titer and the length of the post-first access to

72 diseased plants periods (PADPs) (time from the beginning of the acquisition access period to the beginning of the inoculation access period) are important during transmission of rhabdoviruses (Creamer et al., 1997). No transmission of MFSV occurs earlier than 4-week PADP, which coincides with the time at which the MFSV viral particles are detected in the salivary glands of the insect for the first time (Todd et al.,

2010).

Based on their ability to transmit MFSV, G. nigrifrons insects can be divided into three groups: transmitters, which become infected and are able to transmit the virus to a new plant host; acquirers, which become infected but are not able to transmit the virus; and non-acquirers, which do not become infected after exposure to virus-infected plants.

Although MFSV is transmitted by G. nigrifrons at a lower efficiency (<10% of transmitters) when compared to other rhabdovirus–vector systems (16-50% transmission)

(Ammar el and Hogenhout, 2008; Conti, 1980; Falk, 1985; Massah et al., 2005; Todd et al., 2010), the consistent proportions of transmitters, acquirers and non-acquirers observed in the G. nigrifrons population, suggested qualitative or quantitative genetic differences among individuals (Todd et al., 2010).

The MFSV encodes seven genes with a proposed genome organization of 3’-N-P-3-4-M-

G-L-5’ (Tsai et al., 2005). The fact that additional non-structural genes of unknown function have been identified in all plant rhabdoviruses, but not in all animal rhabdoviruses, particularly in the vesiculoviruses, led to the hypothesis that the proteins

73 encoded by these non-structural genes play roles unique to the plant segment of the life cycle, such as systemic spread in the plant host (Huang et al., 2005). Two plant rhabdovirus proteins, the sc4 of Sonchus yellow net virus (SYNV) and the P3 of Rice yellow stunt virus (RYSV) have been implicated in cell-to-cell movement (Goodin et al.,

2007; Huang et al., 2005; Melcher, 2000). Further, RNAi is a highly conserved gene silencing process that is essential for virus defense in plants and insects (Elbashir et al.,

2001; Hamilton and Baulcombe, 1999; Hannon, 2002). To counteract defense responses, viruses encode silencing suppressors that inhibit this process at different levels (Pallas and Garcia, 2011; Song et al., 2011). RNAi responses are activated in insect cells upon infection with the rhabdovirus Vesicular stomatitis virus (VSV) (Mueller et al., 2010), and homologs of the genes implicated in RNAi/PTGS pathways in Drosophila melanogaster have been found in G. nigrifrons exposed to MFSV (Chen et al., 2012). It is not known whether any of the MFSV genes encode movement or suppressor activities.

In animal rhabdoviruses, gene expression is primarily regulated by gene order, with decreasing levels of viral transcripts for genes from the 3’ end to 5’ end of the genome

(Abraham and Banerjee, 1976; Banerjee, 1987). However, it is not known whether gene expression in plant rhabdoviruses is similarly regulated, or if the regulation of gene expression plays a role during acquisition and transmission of the virus. In addition, the regulation of expression of non-structural genes has not been defined. We hypothesize that temporal changes in the expression levels of the MFSV genes in the plants and vectors will reflect their relative importance during infection of its two biologically

74 dissimilar hosts. Therefore, we have examined the relative accumulation for each of the seven MFSV transcripts in leaves of infected maize plants and its insect vector.

4.3. Material and Methods

4.3.1. Plant inoculations and growth conditions

Maize seeds (Zea mays L. cv Spirit) were infected with MFSV by vascular puncture inoculation (VPI) as previously described (Redinbaugh et al., 2002). Mock inoculation with grinding buffer (0.1 M potassium phosphate, pH 7.0) was used as the negative control. At two days post-inoculation (dpi), seeds were planted in greenhouse soil and moved a growth chamber with a 28˚C/16 h day, 22˚C/8 h night cycle. Plants were evaluated for the presence of symptoms at 7, 14, 21 and 28 dpi, and 50 mg of leaf tissue from the newest leaf was collected from each plant at each time point. Leaf tissue was frozen in liquid nitrogen, then immediately stored at -80˚C until RNA isolation. The efficiency of MFSV transmission was assessed from development of symptoms on inoculated plants. Three independent biological experiments in which 50 seeds were inoculated per treatment (MFSV or mock inoculated) and samples were collected from total of 40 plants.

4.3.2. Insect rearing and transmission assays

G. nigrifrons were maintained on maize cv Early Sunglow as previously described

(Gingery et al., 2004; Todd et al., 2010). Virus acquisition and transmission assays were carried out in a growth chamber with a 27˚C/15 h day, 22˚C/9 h night cycle. For virus 75 acquisition, gravid females were transferred to symptomatic MFSV-infected maize plants for oviposition. After 2 days, adults were removed and offspring were allowed to feed on the infected plants for 4 to 6 weeks for virus acquisition. Source plants were replaced every 2 weeks with fresh symptomatic plants during the acquisition period. Subsequently, approximately 300 adults were individually transferred to 4-day old healthy maize seedlings for 7 days to allow for virus transmission. Harvested leafhoppers were individually and stored in RNase-free tubes at -80oC until RNA isolation. After the inoculation period, plants were moved to a greenhouse for four weeks for symptom development. G. nigrifrons capable of transmitting MFSV (transmitters) were identified based on symptom development in maize after the inoculation period. Non-transmitting

G. nigrifrons were further separated based on the presence or absence of MFSV in insect

RNA as detected by RT-PCR (see below). Thus, an insect was designated as an acquirer if it was positive by RT-PCR, but was not able to transmit the virus; and as a non- acquirer if it was negative by both assays (RT-PCR and transmission). The presence of

MFSV in transmitters was corroborated by RT-PCR assays. Three independent experiments consisting of 300 insects were conducted.

4.3.3. RNA isolation

Total RNA was isolated from maize leaves using the Direct-zol™ RNA MiniPrep system

(Zymo Research) following the manufacturer’s protocol. Total RNA was isolated from

G. nigrifrons using Trizol (Life TechnologiesTM) following the manufacturer’s protocol.

DNA was removed before RNA quantification with Turbo DNAfree (Ambion, Inc.) using the rigorous protocol. DNA-free RNA was quantified by micro-spectrophotometry

(NanoDrop Technologies), and quality was evaluated using the Experion Automated

Electrophoresis System (Bio-Rad Laboratories, Inc.). Only those RNAs with RQ (RNA

Quality) numbers of 7 or higher were used in further analyses. Six 400 ng RNA samples isolated from plants collected at the same time points (7, 14, 21 or 28 days) were pooled for subsequent RT-qPCR. Similarly, 200 ng RNA isolated from ten individual insects and corresponding to the same type (transmitter, acquirer or non-acquirer) were pooled (2 µg

RNA total) for subsequent RT-qPCR assay.

4.3.4.Primers and one step RT-PCR assays

One-step RT-PCR assays used to detect the presence of MFSV were conducted using 100 ng of total RNA isolated from individual insects for the differentiation of transmitters, acquirers and non-acquirers. The AccessQuickTM RT-PCR system (Promega

Corporation) was used following the manufacturer’s protocol. The primer pair 514F (5’-

GTGCAGAATTGCCCTATCC-3’)/1631R (5’-TCGAGGCAATTCCTGTATC -3’) was used to amplify an 1117 bp fragment corresponding to the MFSV N gene (GenBank accession No NC_005974). Reverse transcription was carried out at 45oC for 45 min.

PCR included an initial denaturation at 94oC for 3 min, 35 cycles of 94oC for 30 sec

(denaturation), 55oC for 30 sec (annealing) and 72oC for 1 min (extension) followed by a final extension step at 72oC for 10 min.

4.3.5. RT-qPCR assays

Two-step RT-qPCR assays were carried out as previously described (Chapter 2). The cDNA was generated from 1 µg of DNA-free total RNA using the ThermoScriptTM

Reverse Transcriptase system (Life TechnologiesTM) following the manufacturer’s protocol. Oligo(dT)20 (2.5µM final concentration) and template were incubated at 65˚C for 5 min and quenched on ice; then a mixture of reaction buffer (1X final concentration) and reverse transcriptase (1 unit) was added and samples were incubated at 60˚C for 60 min. The reactions were terminated at 85˚C for 5 min, and cDNA was stored at -20˚C until needed. No reverse transcriptase was added to the negative control (NRT).

For qPCR, 15 µl reactions containing SsoFast EvaGreen supermix (1X) (Bio-Rad

Laboratories, Inc.), 300 nM of each primer and 1 µl of a 10-fold dilution of the cDNA were incubated at 98˚C for 2 minutes followed by 40 cycles of 98˚C for 2 sec.

(denaturation) and 55 ºC for 5 sec. (annealing and elongation). After the amplification, a melting curve protocol was performed at 70 - 90˚C with increments of 0.2˚C every 10 sec. No template was added to the negative control (NTC). All reactions were performed in 3 technical replicates using the Bio-Rad CFX96 TouchTM Real-Time PCR Detection

System (Bio-Rad Laboratories, Inc.).

4.3.6. Analysis of MFSV gene transcripts accumulation in maize and insects

Analysis of the relative MFSV gene expression was perform according to 2-Ct method

(Livak and Schmittgen, 2001). The quantification cycle (Cq) or threshold cycle (CT) 78 value of each gene was determined by automated threshold analysis on the Bio-Rad

CFX96 system (Bio-Rad Laboratories, Inc.). The CT value for each MFSV transcript was normalized to that of the reference RNA to obtain CT(MFSV gene) = (CT(MFSV gene) –

CT(reference gene)). The relative expression of MFSV genes was determined using CT =

-Ct (CT(MFSV gene) - CT(MFSV N)) according to the to the 2 algorithm. Maize 18S rRNA

(chapter 2) and G. nigrifrons ribosomal protein S13 (RPS13) (Chen et al., 2012) were used as reference genes, as previously described.

4.3.7. Data analysis

Means separations were performed using the generalized linear model (GLM) and

Fisher’s least significant difference (LSD) test (PROC GLM, LSD) using SAS

Enterprise Guide 4 (Statistical Analysis Systems, Cary NC).

4.4. Results

4.4.1. Infection and transmission assays

Approximately 35% of the forty seeds that germinated in each treatment were successfully infected as assessed by development of symptoms. No symptoms of infection were observed in any plant at 7 dpi. Symptoms corresponding to MFSV infection started to develop at 14 dpi, which coincided with the first detection of MFSV transcripts by RT-qPCR. Plants that show delayed symptoms or died (<10%) during infection experiments were not sampled for RT-qPCR analysis. Of the 900 individual

79 insects tested for transmission of MFSV, 24.3± 5% became infected, as assessed by one- step RT-PCR. As expected, transmission efficiencies were low at 16.7 ± 5.3% as assessed by development of symptoms of single plants exposed to individual insects and by the detection of MFSV N transcripts in the corresponding insects.

4.4.2. Analysis of temporal MFSV gene expression in maize

Amplification efficiencies (E) for the primers used for RT-qPCR assays ranged from 94 to 103%, as previously described (Chapter 2). The specificity of amplification (i.e. the absence of non-specific products) and the absence of primer dimers were indicated by the observation of a single melting peak in the melting curve analysis after 40 cycles of amplification. To analyze the MFSV gene expression, we used the CT values of each sample normalized to the maize 18S rRNA reference gene. Transcripts for all MFSV genes were detected in all the samples tested, with CT values ranging from 23.53 to

26.15. Fold-differences in the levels of the transcripts relative to the MFSV N transcript were calculated according to the 2-Ct algorithm. Similarly to what we observed previously (Chapter 2), the sequential transcriptional attenuation characteristic of the animal-infecting rhabdoviruses, was not observed for MFSV in this study (Fig. 4.1).

At week 1, transcripts could not be detected for any of the MFSV genes, and no symptoms were observed in any of the plants at this time (data not shown). Thus, we did not include this time point in further analyses. At two to four weeks post-inoculation, accumulation of MFSV L transcripts was reduced relative to the MFSV N transcripts 80

(Fig. 4.1), suggesting that the expression of this gene is attenuated during viral replication

(P<0.01). In contrast, levels for MFSV 4, M and G transcripts were not significantly different from those of N transcripts (GLM, LSD; P>0.05) (Fig. 4.1). On the other hand, accumulation of MFSV P and 3 transcripts was 1.5 and 2.1-fold higher, respectively, than

MFSV N transcripts (P<0.01).

Similar relative levels of MFSV gene transcript accumulation were found for maize at two and four weeks after inoculation. The MFSV P and 3 transcripts accumulation were always higher relative to the MFSV N transcripts. However, they both showed different patterns by week (Fig. 4.2). Accumulation of the MFSV P gene transcripts was highest at week two, decreased significantly at week three and remained at similar levels through week four. In the case of MFSV 3, levels increased significantly from week two to three, then decreased at week four. In contrast to MFSV P and 3, the accumulation of the

MFSV M, G and L transcripts were lower than N transcripts from week two to three.

Interestingly, the accumulation of the MFSV 4 gene transcripts was always similar to that of MFSV N transcripts and did not exhibit any significant changes from week two to four. Accumulation of the MFSV M transcripts was significantly attenuated during weeks two and three, and then reached levels similar to N transcripts in week four. MFSV G gene transcripts accumulated at levels similar to the N transcripts in weeks two and three, and experienced a significant increase in week four. Lastly, the accumulation of the

MFSV L gene transcripts follows the pattern of accumulation of MFSV M transcripts,

81 being significantly attenuated during weeks two and three, and reaching levels similar to the N transcripts by week four.

4.4.3. Analysis of MFSV gene expression in G. nigrifrons

To analyze the MFSV transcript accumulation in G. nigrifrons, CT values for each gene in each sample were normalized to the G. nigrifrons RPS13 reference gene. We were not able to detect MFSV transcripts from non-acquirers or insects reared on healthy plants, thus we did not include these individuals in our analysis. As expected, the NRT and NTC controls did not yield detectable product.

Fold-differences of the MFSV gene transcripts relative to the MFSV N transcript were calculated according to 2-Ct algorithm. Accumulation of MFSV 4 and L transcripts were significantly lower than MFSV N in both transmitters and acquirers (P<0.01) (Fig. 4.3).

In contrast, levels of the MFSV P, 3, M and G transcripts were higher than MFSV N in transmitters and acquirers (P<0.01), and the accumulation of MFSV 3 transcripts was significantly higher than P, M and G transcripts. Similar transcript levels were observed for transmitters and acquirers. Although the means of the fold-differences were higher in transmitters than in acquirers for all the genes, they were not significantly different by

GLM, LSD (P>0.05), indicating that the MFSV transcripts accumulated at the same levels in the two type of insects.

4.5. Discussion

We analyzed levels for transcripts for the MFSV genes relative to the MFSV N gene in maize plants for four weeks post-inoculation and in G. nigrifrons that could transmit or acquire MFSV. Our results indicate that transcription of MFSV genes does not undergo sequential transcriptional attenuation during infection of either of its two dissimilar hosts.

It has recently been proposed that Rabies virus (RV) may have other means of regulating relative mRNA levels that provides the virus with additional versatility in its gene expression in the variety of biological scenarios the virus encounters during natural infections (Palusa et al., 2012). For example, RV must successfully replicate not only at the site of infection, but also in different tissues as it moves towards the central nervous system, and in doing so the virus must also be able to avoid stimulating host immune responses. Thus careful regulation of protein expression may be particularly important for the successful progression of rabies virus infection. Taking into account the unexpected patterns of gene regulation observed for MFSV, it is also possible that MFSV uses alternative means to regulate its expression during the infection of its two biological unrelated hosts. To date, the mechanisms that regulate MFSV gene expression during the virus life cycle remain unknown.

In maize leaves, MFSV 4, M and G transcript levels were similar to those for MFSV N, suggesting that expression of these genes was not attenuated. However, when analyzed by week, the accumulation of the MFSV G transcripts increased by week four, suggesting an active function of the gene product at this point of infection. This is perhaps not 83 surprising given the intense replication that the virus undergoes during infection of the plant host as indicated by the development of symptoms. Interestingly, the accumulation of MFSV 4 transcripts remained similar to the N transcripts along the course of infection evaluated, suggesting an active role of the gene during infection of the plant host.

Additional, non-structural genes located between the P and M genes, that have been identified in many plant-infecting rhabdoviruses but not in animal-infecting rhabdoviruses (Walker et al., 2011). It has been speculated that genes located in this portion of the genome play roles unique to the plant segment of the virus life (Huang et al., 2005; Jackson et al., 2005). We hypothesized that the expression pattern for the

MFSV 3 and 4 would provide an indication of their relative importance in virus replication and movement in animal and plant hosts. Levels of the MFSV 4 gene were significantly reduced relative to MFSV N in leafhoppers. MFSV 4 is one of the two additional, non-structural genes encoded by the MFSV genome. The fact that MFSV 4 is attenuated during insect infection, but not in plants may indicate that the protein encoded by this gene may play a role only needed during viral infection of the plant (i.e. systemic movement). Interestingly, the protein encoded by the MFSV 4 has a molecular mass of

37.2 kDa (Tsai et al., 2005), similar to the movement protein of SYNV sc4 (Goodin et al.,

2007; Scholthof et al., 1994). In addition, based on secondary structure predictions, the

MFSV 4 protein shares similarity to the consensus core structure of 30K superfamily of viral MPs (Huang et al., 2005; Melcher, 2000). Additional studies are needed to demonstrate the roles of MFSV 4 in systemic movement.

Surprisingly, transcripts for the non-structural MFSV 3 gene accumulated to relatively high levels in both plant and insect hosts, at 2.13 and 2.72-fold respectively, compared to

N transcripts. Based on the MFSV 3 location on the genome, we hypothesized that the protein encoded by this gene might play a role(s) exclusive to the plant segment of the virus infection cycle. However, the fact that MFSV 3 levels are higher in its two unrelated hosts suggests that its expression is controlled by similar mechanisms in the two hosts. RNAi is a highly conserved gene silencing process that involves posttranscriptional gene silencing (PTGS) and is essential for virus defense in plants and insects (Elbashir et al., 2001; Hamilton and Baulcombe, 1999; Hannon, 2002). Homologs of the genes implicated in RNAi/PTGS pathways in Drosophila melanogaster have been found in G. nigrifrons (Chen et al., 2012). On the other hand, viruses encode suppressors of gene silencing to counteract the immune response of the host (Brigneti et al., 1998). In

Rice stripe virus (RSV), high expression of the suppressor of gene silencing (NS3) gene was observed in infected rice plants and in the small brown planthopper vector (Li S,

2012). It is not known if MFSV 3 is involved in counteracting the immune responses elicited in insects upon MFSV infection. Moreover, it is still unknown if similar responses are triggered in maize plants upon MFSV infection.

Levels of the MFSV P transcript were higher than MFSV N in both insects and plants. In addition, MFSV M and G transcripts accumulated to higher levels than MFSV N and were similar to those of MFSV P in insects. The fact that MFSV P accumulates to higher

85 levels in both hosts suggests an active role of the protein encoded by this gene during viral infection. The P proteins of animal-infecting rhabdoviruses have been involved in the inhibition of the immune response of the host cells, particularly the IFN/STAT signaling pathway (Oksayan et al., 2012). We do not yet know if the accumulation of

MFSV P transcripts is important for the suppression of immune responses in plants and/or insects. Likewise, the M proteins of animal-infecting rhabdoviruses have been implicated in the modulation of the transcription and translation in the host cell

(Komarova et al., 2007; von Kobbe et al., 2000). The high levels of accumulation of the

MFSV M gene transcripts in insects suggests an active function of its encoded protein during viral infection of the insect host. Also, it has recently been demonstrated that the

G gene of Rabies virus, a mammal-infecting rhabdovirus, is differentially overexpressed during infection of human 293T cell cultures (Palusa et al., 2012). Intriguingly, transcripts corresponding to this gene are selectively associated with the cellular poly(rC)-binding protein 2 (PCBP2), a multi-functional RNA-binding protein that regulates mRNA stability and translation (Du et al., 2008). Additional research is needed to determine the mechanisms behind the regulation of the expression of MFSV G gene during infection of its insect host. The development of in vitro systems to allow heterologous expression of the MFSV gene could facilitate this type of studies.

Lastly, a significant reduction in the expression of MFSV L gene is observed in plant and insect hosts, suggesting transcriptional attenuation during viral infection. Alternatively, transcripts corresponding to the MFSV L gene may be less stable during infection

Although the protein encoded by the L gene of rhabdoviruses is important for virus replication and transcription (Banerjee, 1987), the mechanisms by which the expression of this gene is regulated remains poorly understood.

4.6. References

Abraham, G., Banerjee, A.K., 1976. Sequential transcription of the genes of vesicular stomatitis virus. Proceedings of the National Academy of Sciences of the United States of America 73, 1504-1508.

Ammar, E.D., Nault, L.R., 2002. Virus transmission by leafhoppers, planthoppers and treehoppers (Auchenorrhyncha, Homoptera). Advances in Botanical Research, Vol 36 36, 141-167.

Ammar el, D., Hogenhout, S.A., 2008. A neurotropic route for Maize mosaic virus (Rhabdoviridae) in its planthopper vector Peregrinus maidis. Virus research 131, 77-85.

Banerjee, A.K., 1987. Transcription and replication of rhabdoviruses. Microbiol Rev 51, 66-87.

Brigneti, G., Voinnet, O., Li, W.X., Ji, L.H., Ding, S.W., Baulcombe, D.C., 1998. Viral pathogenicity determinants are suppressors of transgene silencing in Nicotiana benthamiana. Embo Journal 17, 6739-6746.

Chen, Y., Cassone, B.J., Bai, X., Redinbaugh, M.G., Michel, A.P., 2012. Transcriptome of the plant virus vector Graminella nigrifrons, and the molecular interactions of maize fine streak rhabdovirus transmission. PLoS One 7, e40613.

Conti, M., 1980. Vector relationships and other characteristics of Barley yellow striate mosaic virus (bysmv). Annals of Applied Biology 95, 83-&.

Creamer, R., He, X., Styer, W.E., 1997. Transmission of sorghum stunt mosaic rhabdovirus by the leafhopper vector, Graminella sonora (Homoptera: Cicadellidae). Plant Disease 81, 63-65.

Du, Z.H., Fenn, S., Tjhen, R., James, T.L., 2008. Structure of a construct of a human poly(C)-binding protein containing the first and second KH domains reveals insights into its regulatory mechanisms. Journal of Biological Chemistry 283, 28757-28766.

Falk, B.W., 1985. Serological Detection and Evidence for Multiplication of Maize Mosaic Virus in the Planthopper,Peregrinus maidis. Phytopathology 75, 852.

Gingery, R.E., Anderson, R.J., Redinbaugh, M.G., 2004. Effect of environmental conditions and leafhopper gender on Maize chlorotic dwarf virus transmission by Graminella nigrifrons (Homoptera: Cicadellidae). Journal of economic entomology 97, 768-773.

Hamilton, A.J., Baulcombe, D.C., 1999. A species of small antisense RNA in posttranscriptional gene silencing in plants. Science 286, 950-952.

Hannon, G.J., 2002. RNA interference. Nature 418, 244-251.

Hogenhout, S.A., Redinbaugh, M.G., Ammar, E.-D., 2003. Plant and animal rhabdovirus host range: a bug's view. Trends in Microbiology 11, 264-271.

Huang, Y.W., Geng, Y.F., Ying, X.B., Chen, X.Y., Fang, R.X., 2005. Identification of a movement protein of rice yellow stunt rhabdovirus. Journal of virology 79, 2108- 2114.

Jackson, A.O., Dietzgen, R.G., Goodin, M.M., Bragg, J.N., Deng, M., 2005. Biology of plant rhabdoviruses. Annual review of phytopathology 43, 623-660.

Li S, e.a., 2012. Analysis of RSV whole gene expression in rice and planthopper by qPCR. acta Virologica.

Livak, K.J., Schmittgen, T.D., 2001. Analysis of relative gene expression data using real- time quantitative PCR and the 2(-Delta Delta C(T)) Method. Methods 25, 402- 408.

Massah, A., Izadpanah, K., Lesemann, D.E., 2005. Relationship of Iranian maize mosaic virus with insect vector and plant cells. Iranian Journal of Plant Pathology 41, 151-159.

Melcher, U., 2000. The '30K' superfamily of viral movement proteins. The Journal of general virology 81, 257-266. 89

Pallas, V., Garcia, J.A., 2011. How do plant viruses induce disease? Interactions and interference with host components. The Journal of general virology 92, 2691- 2705.

Palusa, S., Ndaluka, C., Bowen, R.A., Wilusz, C.J., Wilusz, J., 2012. The 3' untranslated region of the rabies virus glycoprotein mRNA specifically interacts with cellular PCBP2 protein and promotes transcript stability. PLoS One 7, e33561.

Scholthof, K.B., Hillman, B.I., Modrell, B., Heaton, L.A., Jackson, A.O., 1994. Characterization and detection of sc4: a sixth gene encoded by sonchus yellow net virus. Virology 204, 279-288.

Song, L., Gao, S., Jiang, W., Chen, S., Liu, Y., Zhou, L., Huang, W., 2011. Silencing suppressors: viral weapons for countering host cell defenses. Protein Cell 2, 273- 281.

Todd, J.C., Ammar el, D., Redinbaugh, M.G., Hoy, C., Hogenhout, S.A., 2010. Plant host range and leafhopper transmission of maize fine streak virus. Phytopathology 100, 1138-1145.

Tsai, C.W., Redinbaugh, M.G., Willie, K.J., Reed, S., Goodin, M., Hogenhout, S.A., 2005. Complete genome sequence and in planta subcellular localization of maize fine streak virus proteins. Journal of virology 79, 5304-5314. von Kobbe, C., van Deursen, J.M., Rodrigues, J.P., Sitterlin, D., Bachi, A., Wu, X., Wilm, M., Carmo-Fonseca, M., Izaurralde, E., 2000. Vesicular stomatitis virus matrix protein inhibits host cell gene expression by targeting the nucleoporin Nup98. Mol Cell 6, 1243-1252.

Walker, P.J., Dietzgen, R.G., Joubert, D.A., Blasdell, K.R., 2011. Rhabdovirus accessory genes. Virus research 162, 110-125.

3.00

2.50 a 2.00

b 1.50

c, d c,d 1.00

c,d,e

difference relative to the the to relative difference -

MFSV N gene transcript gene N MFSV d,e e

0.50 Fold

0.00 MFSV N MFSV P MFSV 3 MFSV 4 MFSV MMFSV G MFSV L

Figure 4.1. MFSV gene transcript accumulation relative to the MFSV N transcript in infected maize. Data was normalized to the maize 18 rRNA gene expression and the relative transcript accumulation was calculated according to the 2-Ct algorithm. Means for the accumulation of each gene across the time points are shown. Bars with the same letter are not significantly different at 95% confidence interval by generalized linear model (GLM) with a Fisher’s least significant difference (LSD) test.

3.00 *

2.50 week 2

week 3 2.00 * * * * 1.50 *

1.00 N gene transcript gene N

* difference relative to the MFSV MFSV the to relative difference - 0.50 *

* * Fold 0.00 MFSV N MFSV P MFSV 3 MFSV 4 MFSV M MFSV G MFSV L

Figure 4.2. Analysis of MFSV transcripts accumulation relative to the MFSV N gene in infected plants during four weeks. Data was normalized to the maize 18 rRNA gene expression and the relative transcript accumulation was calculated according to the 2-Ct algorithm. Means for the accumulation of each gene at each week are shown. Asterisks indicate values significantly different at 95% confidence interval by two-tailed paired T- test.

3.00

2.50

b 2.00 b b

1.50

1.00

difference relative to the the to relative difference

- MFSV N gene transcript gene N MFSV d Fold 0.50 d

0.00 MFSV N MFSV P MFSV 3 MFSV 4 MFSV MMFSV G MFSV L

Figure 4.3. MFSV transcripts accumulation relative to the MFSV N gene in infected G. nigrifrons. Data was normalized to the ribosomal protein S13 (RPS13) gene expression and the relative transcript accumulation was calculated according to the 2-Ct algorithm. Means for the accumulation of each gene are shown. Bars with the same letters are not significantly different at 95% confidence interval by generalized linear model (GLM) with a Fisher’s least significant difference (LSD) test.

Chapter 5: Interaction map for the Maize fine streak virus non-structural proteins

5.1. Abstract

Little is known about the roles of the non-structural genes of Maize fine streak virus

(MFSV) during viral infection. For many viruses, interactions among viral proteins are critical for viral infection and transmission processes. To gain insight into the associations between MFSV proteins, a protein-protein interaction map for MFSV 3 and

4 proteins was generated. Protein interactions were examined in vitro using yeast two- hybrid (YTH) assays and in planta using bimolecular fluorescence complementation

(BiFC) assays. The MFSV 3 and 4 proteins interacted with each other in both assays, suggesting that this interaction is likely to occur in nature. Interaction of the MFSV N and

MFSV P proteins was detected by BiFC, but not by YTH assays. No interaction of the

MFSV 3 or 4 protein was detected with the MFSV N, P, M or G proteins in either assay.

Based on the location of MFSV 4 in the genome, the size of the encoded protein and higher accumulation of transcripts in the plant compared to the insect host, we hypothesize that MFSV 4 is a movement protein, and that its strong interaction with

MFSV 3 may be important during infection of the plant host. Because N-P interaction has been observed for other rhabdoviruses, and is conserved across the Mononegavirales, we expect that the MFSV N – MFSV P interaction occurs in nature.

5.2. Introduction

The family Rhabdoviridae includes important pathogens that infect human, animals and plants, and are perhaps the most widely distributed virus family in nature (Kuzmin et al.,

2009). Among the plant-infecting rhabdoviruses, viruses in the genus the

Cytorhabdovirus replicate in the cytoplasm of infected plant cells and viruses in the genus Nucleorhabdovirus replicate in the nuclei (Jackson et al., 2005). Maize fine streak virus (MFSV) is a member of the genus Nucleorhabdovirus (Redinbaugh et al., 2002).

Similar to animal-infecting rhabdoviruses, the negative-stranded RNA genomes of plant- infecting rhabdoviruses encode five structural proteins: the nucleocapsid protein (N), the phosphoprotein (P), the polymerase (L), the matrix protein (M) and the glycoprotein (G)

(Jackson et al., 2005; Redinbaugh and Hogenhout, 2005). In addition, all plant rhabdovirus genomes carry one to four non-structural genes for which functions are poorly understood (Huang et al., 2005; Scholthof et al., 1994; Tanno et al., 2000; Tsai et al., 2005). The MFSV genome encodes two non-structural genes, MFSV 3 and MFSV 4, located between the P and M genes, the same genomic context where other non-structural plant rhabdovirus genes have been found.

The minimal infectious unit of the rhabdoviruses is the nucleocapsid, which is composed of the genomic RNA plus the N, P and L proteins (Goodin et al., 2001; Jackson et al.,

2005; Wagner and Jackson, 1997; Whelan et al., 2004). During viral morphogenesis, the nucleocapsid is condensed by the M protein, producing virion-like particles that bud through the inner nuclear membrane and acquire a host-derived lipid envelope and viral

G protein in the process (Jackson et al., 2005). Currently, molecular details of how plant- infecting rhabdoviruses move from their sites of replication into adjacent cells and long- distance within the plant are lacking. However, most plant viruses use host factors or specialized viral-encoded movement protein (MPs) to facilitate cell-to-cell and/or long- distance (systemic) movement of the virus in their plant hosts (Citovsky et al., 2006;

Harries and Ding, 2011; Krichevsky et al., 2006; Lucas, 2006). Despite the abundance of information for the movement of several genetically diverse plant viruses, the mechanisms by which plant rhabdoviruses move remains poorly understood.

At least four types of MPs have been described for plant viruses: the products of a triple gene block; the tymoviral MPs; a series of small polypeptides (less than 10 kDa) characteristic of carmo-like viruses and some geminiviruses; and, a large number of members of the 30K superfamily of MPs, named after the 30 kDa Tobacco mosaic virus

(TMV) MP (Lucas, 2006; Melcher, 2000). Two plant rhabdovirus proteins, the sc4 of

Sonchus yellow net virus (SYNV) and the P3 of Rice yellows stunt virus (RYSV) have been implicated in cell-to-cell movement (Huang et al., 2005; Scholthof et al., 1994). The genes encoding these two proteins are located in between the P and M genes, have similar mass of 30kDa and both have significant similarity with the consensus core structure of the 30K superfamily of viral MPs (Goodin et al., 2007; Melcher, 2000). RYSV P3 was able to restore the movement of a movement-deficient Potato virus X (PVX) and interacted with RYSV N, the main component of the rhabdoviruses nucleocapsid, in

GST-pull down assays (Huang et al., 2005). In contrast, the SYNV sc4 protein interacted

97 with the G protein, but not with the N protein in bimolecular fluorescence complementation (BiFC) experiments among all pairwise interactions of SYNV-encoded proteins and it has been proposed that the sc4-G interaction permits the formation of a movement complex for SYNV (Min et al., 2010). Similarly, PYDV Y, the putative MP of

Potato yellow dwarf virus (PYDV), another member of the genus Nucleorhabdovirus, interacted with the M protein, but not the N protein of PYDV in BiFC (Bandyopadhyay et al., 2010). Taken together, this data suggests that strategies for cell-to-cell movement may differ even among closely related viruses in the genus Nucleorhabdovirus.

The study of protein interactions is critical for understanding molecular mechanisms that underlie viral infection and transmission processes (DaPalma et al., 2010). Several methodologies have been developed for studying protein interactions including yeast two-hybrid (YTH), pull down, and imaging based fluorescence resonance energy transfer

(FRET) and bimolecular fluorescence complementation (BiFC) assays (Jin-Jun Meng,

2005). Among these, YTH and BiFC are advanced and powerful tools for identifying protein interactions (Citovsky et al., 2006; Goodin, 2008; Guo et al., 2008; Nagy, 2008).

The yeast two-hybrid is an in vitro assay that uses the interaction between tested proteins to reconstitute a functionally active molecule, most often a transcriptional activator that stimulates the expression of a reporter gene, whose product can be readily measured.

Activity of the reporter gene product is then taken as indication that the protein interaction has occurred (Jin-Jun Meng, 2005). The BiFC is an in planta assay that takes advantage of the observation that the yellow fluorescent protein (YFP), can be split into

98 two non-fluorescent fragments that, when recombined with the interacting proteins, reconstitutes a fluorescent molecule.

In this study, an interaction map among the structural and non-structural proteins of

MFSV was generated in order to provide clues as to their roles in MFSV infection process. Interaction of the MFSV N and P proteins was hypothesized based on the subcellular re-localization pattern observed when both proteins were co-expressed in

Nicotiana benthamiana leaves (Tsai et al., 2005), and, therefore, was included in the present study. Interactions of the non-structural MFSV 3 and 4 with each other and the

MFSV N, P, M and G proteins were tested by YTH and BiFC assays.

5.3.Material and methods

5.3.1. Plant material, bacterial and yeast strains, and growth conditions

Wild-type N. benthamiana plants were maintained under greenhouse conditions with a

28˚C/16 h day and 22˚C/8 h night cycle. Infiltrations were performed on 4-week old plants using Agrobacterium tumefaciens C58C1 and infiltrated plants were maintained under the same conditions. Saccharomyces cerevisiae AH109 cells were grown at 30oC for 4 days in YPD agar medium (Clontech) before each transformation experiment.

Bacterial and yeast strains were kindly provided by Dr. Lucy Stewart (USDA, ARS and

Ohio State Univ.).

5.3.2. RNA isolation and RT-PCR

Total RNA was isolated from MFSV-infected leaf tissue using the SV total RNA

Isolation System (Promega) following the manufacturer’s protocol. Primers specific to each MFSV gene were designed to amplify full-length open reading frames (ORF) for each gene. Unless otherwise stated, first-strand cDNA synthesis was performed using the

ThermoScriptTM Reverse Transcriptase System (Life TechnologiesTM), and PCR reactions were carried out using the Platinum® Taq DNA Polymerase High Fidelity

System (Life TechnologiesTM), following the manufacturer’s instructions.

5.3.3. Cloning of MFSV genes into binary vectors for BiFC

BiFC expression cassettes containing full-length sequences of the MFSV N, P, 3, 4, M and G genes were generated using gateway-mediated recombination into pSITE vectors

(Citovsky et al., 2006). Genes of interest containing att recombination sites were generated by a two-step PCR approach as previously described (Chakrabarty et al.,

2007). First, the genes-of-interest were amplified using gene-specific forward and reverse primers containing 5′ extensions corresponding to half of the att site. Second, the PCR products were then re-amplified using primers that incorporated the remainder of the att site at both ends of the amplicons. The PCR products containing entire att sites were then purified and recombined into pDONR221 vector using the Gateway BP clonase (Life

TechnologiesTM) according to the manufacturer’s recommendations. Sequences of the entry clones were verified prior to subsequent use. In this way, entry clones containing each of the MFSV genes and suitable for LR recombination were generated. Entry clones

100 were then incubated with the appropriate BiFC binary destination vector in presence of

LR clonase (Life TechnologiesTM) to allow for transfer of MFSV genes from the entry clone into the destination vector. Destination vectors used in this study included the pSITE-BiFC-nEYFP and pSITE-BiFC-cEYFP, which contain the amino- and carboxy- terminal half of the YFP sequence, respectively. Interaction between the MFSV 3 and 4 proteins with the MFSV N, P, 3, 4, M and G proteins was tested in a pairwise manner, using each gene fused to the N- and C-terminal halves of the YFP. The pENTR™-gus

(Life Technologies), which contains the ß-glucuronidase gene, was also recombined into the BiFC destination vectors, and used as a negative control for interaction. Recombinant pSITE vectors were then transformed into A. tumefaciens C58C1 by electroporation.

Electroporated cells were grown in LB medium at 28oC for approximately 72 h. Glycerol

(Glycerin 1,2,3-Propanetriol) (Fischer Scientific) stocks were prepared for each transformation and stored at -80oC until use.

5.3.4. Expression of proteins in plant tissues and interaction assays

Fresh cultures of A. tumefaciens transformed with the genes of interest were prepared for testing for interactions. Equal volumes (10 ml) of bacterial suspension were infiltrated into at least three leaves of N. benthamiana as previously described (Tsai et al., 2005).

Briefly, bacterial suspensions grown overnight in LB medium were adjusted to an optical density at 600 nm of 0.6 in agroinfiltration buffer containing 10 mM MgCl2, 10 mM

MES (morpholine-ethanesulfonic acid) and 100 µM acetosyringone (glycerin 1,2,3- propanetriol) (Sigma-Aldrich®). Water-mounted sections of infiltrated leaves were

101 examined using epifluorescence and confocal microscopy (see below) at 1, 2, 3, 4 and 5 days post-infiltration. At least 36 sections corresponding to three separate biological replicates were examined for each interaction. Interactions of the MFSV 3 and 4 proteins with the MFSV N, P, 3, 4, M and G proteins were examined in a pair-wise manner, as well as the MFSV N-P interaction. Interaction of GUS with MFSV 3 and 4 were included as negative controls.

5.3.5. Eplifuorescence and confocal microscopy

Epifluorescence and confocal micrographs were acquired as previously described (Tsai et al., 2005). Briefly, eplifuorescence micrographs were acquired using an Axiocam MR monochromatic digital camera mounted on a motorized Axioplan2 microscope (Carl

Zeiss Microimaging Inc., Thornwood, NY). Camera and microscope settings were controlled using Axiovision software v. 4.1. Confocal micrographs were taken using the

Leica TCS SP8 confocal imaging system (Leica Microsystems). EYFP was excited using the 488-nm laser line and fluorescence was examined using the filter set that consisted of a D470 excitation (Ex) filter, a 505 DCLP dichroic, and a D540 emission (Em) filter.

Micrographs were exported as TIFF files and all subsequent cropping and image manipulations were carried out using Adobe Photoshop CS6 (Adobe Systems Inc.)

5.3.6. Cloning of MFSV genes into expression vectors for yeast two-hybrid

The pGAD-T7 and pGBK7 (Matchmaker Yeast Two-Hybrid System, Clontech), which contain the activation domain (AD) and binding domain (DB) of the yeast GAL4,

102 respectively were used in this study according to the manufacturer’s recommendations.

MFSV genes were inserted into these plasmids using T4 DNA ligase-mediated ligation

(Bioline). Recombinant plasmids were sequenced and only validated clones were used for yeast transformation experiments. MFSV N, P, 3, 4, M and G gene sequences were inserted into both the AD and BD vectors. The human genes P53 (tumor protein 53), T (T lymphocyte) and Lam (laminin) were also cloned into both vectors and used as controls.

5.3.7. Yeast-two hybrid interaction assays

Recombinant YTH plasmids containing the MFSV genes were transformed into

Saccharomyces cerevisiae AH109 cells by lithium acetate (LiAc)-mediated transformation, according to the manufacturer’s instructions (Matchmaker Yeast Two-

Hybrid System, Clontech). Co-transformations were performed using 0.25 µg of each recombinant plasmid in presence of 0.1 mg of denatured carrier DNA (Clontech).

Protein-protein interactions were screened at low (-Leu/-Trp), medium (-His/-Leu/ -Trp), and high (-Ade/-His/ -Leu/ -Trp) stringency minimal SD agar. Medium and high stringency plates were supplemented with 3-amino-1,2,4-triazole (3-AT) (Sigma) in order to inhibit the expression of the yeast HIS3 protein reported for some yeast strains.

Interactions of the MFSV 3 and 4 proteins were examined in a pair-wise manner as mentioned above for BiFC for at least three independent biological replicates. Interaction of the MFSV N and P was also examined. Interaction of T with P53 and T with Lam were included as positive and negative controls, respectively. Production of recombinant proteins was indicated by the formation of colonies on low stringency medium. Positive

103 interactions were indicated by the formation of colonies on medium and high stringency media, but only those that grew on both were considered to be strong interactions and were further evaluated for the production of ß-galactosidase.

5.3.8. ß-galactosidase assay

Positive interactions were examined for production of ß-galactosidase using 5-bromo-4- chloro-3-indolyl-ß-D-galactopyranoside (X-gal; Sigma) as a substrate on colony-lift filter assays, according to the manufacturer’s protocol (Clontech). Briefly, colonies corresponding to the positive interactions above were grown on fresh high-stringency medium for approximately two days. Colonies were then transferred onto sterile

Whatman No5 filter paper (VWR International, LLC), permeabilized by freeze/thaw treatment, and incubated in Z buffer (0.06 M Na2HPO4, 0.04 M NaH2PO4, 0.01 M KCl,

o 0.01 M MgSO4, 0.05 M -mercaptoethanol, pH 7.0) containing 20 µg/ml X-gal at 30 C for 60 min. -galactosidase producing colonies were identified by the development of blue color by the colonies lifted on the paper filter.

5.4. Results

5.4.1. Screening of MFSV protein-protein interactions by YTH

Full-length sequences for the MFSV N, P, 3, 4, M and G genes were inserted into YTH plasmids containing the activation domain (AD) and binding domain (BD). Protein- protein interactions were examined in a reciprocal pair-wise manner, screening each gene for interaction with the non-structural MFSV 3 and 4 proteins. A phenotypic screening on

104 low stringency medium was used to ensure the corresponding proteins were produced in yeast cells. Growth of yeast cells on this medium confirmed the presence of both the AD and BD plasmid derivatives, without selective pressure for the interaction of the fusion proteins. Yeast colonies grew under low stringency conditions for every interaction examined (Fig. 5.1.C). As expected, colonies corresponding to the positive control T-P53 also grew under high stringency conditions, whereas the negative control T-Lam did not

(Fig. 5.1.A. and 5.1.C). Formation of yeast colonies on high stringency medium, was also observed for the MFSV 3 – MFSV 4 pair (Fig. 5.1.A, 3+4), starting at 3 days post- transformation, suggesting interaction of these proteins. To corroborate our results, we examined the reciprocal interaction and found the same results (Fig. 5.1.A, 4+3). In contrast, no formation of colonies under high stringency was observed for 3-N, 3-P, 3-3,

3-M, 3-G, 4-N, 4-P, 4-4, 4-M, 4-G, indicating that these protein pairs did not interact in yeast (Table 5.1). The same protein pairs were tested in a reciprocal manner and no interactions were observed (Table 1. In addition, the MFSV N-P interaction was also examined in this study, and no colonies were observed under stringent conditions, indicating that these two proteins did not interact in yeast (Fig. 5.1A). When different amounts of plasmid (0.10, 0.25 and 0.50 ug) were used in our co-transformation experiments, the same positive and negative interactions were observed, corroborating our results (data not shown).

To confirm the interaction between MFSV 3 and 4, colonies grown in high stringency medium were examined for ß-galactosidase activity. We used the qualitative colony-lift

105 filter assay with freeze-thaw cycles to detect -galactosidase activity because of its sensitivity and ease of use (Schneider et al., 1996). Because yeast cells co-transformed with 3-4 and 4-3 grew faster than the positive T-P53 control under high stringency conditions, we were not able to measure for ß-galactosidase activity at the same time for all the interactions. Nevertheless, enzymatic activity, as indicated by the development of blue color on the filter paper containing the yeast colonies, was observed for the T-P53 positive control after 5 days of growth, as expected (data not shown). Development of blue color was also observed for the 3-4 and 4-3 pairs after two days of growth, indicating that these proteins interacted or were in close proximity to restore the enzymatic activity (Fig. 5.1.B).

5.4.2. Interaction matrix for MFSV 3 and 4 proteins by BiFC

BiFC assays were also used to define the interaction of MFSV 3 and 4 proteins with other

MFSV proteins. Full-length sequences of the MFSV N, P, 3, 4, M, and G genes were inserted into both pSITE-BiFC-nEYFP and pSITE-BiFC-cEYFP (Citovsky et al., 2006).

In addition, the full-length sequence of the GUS (-glucoronidase) protein was inserted into the same vectors to be used as controls. Proper function of the pSITE-BiFC plasmids in N. benthamiana was tested using the pSITE-GUS-nEYFP and pSITE-GUS-cEYFP independently. GUS activity in leaves infiltrated with either construct was observed for up to 5 days post-infiltration, indicating that heterologous protein expression from the vectors occurred in N. benthamiana. Positive interactions, as indicated by the development of green fluorescence produced from the re-constituted EYFP protein fused

106 to interacting proteins, were observed for 3-4 and N-P interactions (Fig. 5.2 and 5.3), starting at one day post-infiltration and continuing for up to three days post-infiltration.

Fluorescence was similarly observed using the reciprocal plasmids. To discard false positives that may be created by auto-fluorescence of non-interacting proteins, interaction of MFSV 3, 4, N and P against GUS was examined for the same period of time (1-3 days post-infiltration) and no fluorescence was observed, indicating that we did not see fluorescence corresponding to false positive interactions (Table 5.2). No interactions were observed for 3-N, 3-P, 3-3, 3-M, 3-G, 4-N, 4-P, 4-4, 4-M, and 4-G pairs (Table 5.2).

The same protein pairs were tested in a reciprocal manner and no interactions were observed.

5.5.Discussion

In this study, we defined the pair-wise interactions of the MFSV 3 and 4 proteins with the

MFSV N, P, 3, 4, M, and G proteins. The L protein was not included in this study because of difficulties expressing the ~250 kDa protein in in vitro and in planta systems.

The MFSV 3 and 4 proteins interacted in both the YTH and BiFC assays. In both assays, reciprocal interactions (3-4 and 4-3) were also observed, suggesting that the interaction is likely to occur and that may be important in the viral disease cycle. The fact that yeast carrying the MFSV 3 and 4 plasmids grew faster than the positive control (T-P53) and had -galactosidase activity indicated a strong interaction occurred between these two proteins in this assay. In YTH, the interacting proteins reconstitute GAL4 activity resulting in transcriptional regulation of ß-galactosidase activity (Jin-Jun Meng, 2005).

107

The lack of detectable interactions of MFSV 3 and 4 with other MFSV proteins in the same assay suggests that the MFSV 3 and 4 interactions in yeast were not spurious. In addition, the fact that the YFP fluorescence was observed after co-expression of the

MFSV 3 and 4 in N. benthamiana cells, but not after co-expression of 3-GUS and 4-GUS suggest that the fluorescence was indeed reconstituted due to true interactions. Although

YTH and BiFC are ‘artificial’ assays relative to maize and G. nigrifons, the fact that the same interaction was found using these two biologically different assays, indicates that this interaction is expected to occur in nature.

MFSV 3 and 4 are non-structural genes encoded by the MFSV genome (Tsai et al.,

2005). The deduced amino acid sequences of these genes have no significant homology to the non-structural gene products of other plant rhabdoviruses. To get insights into the structure and functions of P3 and P4, the iterative threading assembly refinement (I-

TASSER) and protein homology/analog Y recognition engine (PHYRE2) software were used to predict protein structure and function (Kelley and Sternberg, 2009; Roy et al.,

2010). The secondary structure prediction of P3 revealed that this protein shares homology with members of the FK506-binding protein (FKBPs) family. FKBPs comprise a large family of proteins that are found in bacteria, fungi, animals and plants that are grouped primarily according to their molecular weights, ranging from ~12 to 58 kDa (Gollan et al., 2012; Wang and Heitman, 2005; Wang et al., 2012). FKBPs have peptidyl-prolyl cis-trans isomerase (PPIase) activity, which is the ability to catalyze the cis to trans configuration of the N-terminal peptide bond of proline residues in peptide or

108 protein substrates, and function in protein folding processes (Fischer et al., 1984).

Interestingly, human cyclophilin A and B (CyPA and CyPB), both FKBPs, are functional regulators of Hepatitis C virus (HCV) replication (Watashi et al., 2005; Yang et al.,

2008). The exact mechanism by which these CyPs assist in HCV replication is unknown, but it has been suggested that HCV uses this host protein to properly expose the RNA binding domain(s) of the viral proteins that participate in the replication process (Heck et al., 2009). Homologous PPIases with low molecular weight (~12kDa) that are essential for efficient pathogen replication are also found in the human pathogens Legionella pneumophila, Chlamydia spp. and Trypanosoma cruzi (Riboldi-Tunnicliffe et al., 2001).

In addition to their functions in protein folding processes, FKBPs have been have been implicated in a diversity of cellular processes including development, stress and immune responses (Breiman and Camus, 2002; Gollan et al., 2012). In order to ensure their perpetuation, viruses need to attain different molecular functions either directly or indirectly by using their host’s components. Based on the high abundance of MFSV 3 transcripts during infection of both plant and insect hosts (shown in Chapter 4), it is possible that p3 may play more than one role during infection. One function could be the functional regulation of MFSV replication. In addition, by emulating the PPIase host proteins, p3 may interfere with the pathways involved in the activation of immune responses.

109

Secondary structure predictions of P4 suggest that the C-terminus of this protein shares homology to several RNA-binding proteins and may contain an oligonucleotide binding

(OB)-fold domain. It has been previously demonstrated that p4 shares similarity to the consensus core the MFSV 4 protein shares similarity to the consensus core structure of

30K superfamily of viral MPs (Melcher, 2000). One particular characteristic of these

MPs is that their C-terminus is a flexible tail that facilitates its binding to nucleic acids

(Lucas, 2006). Additional characterization of the 30K MPs indicated that they form a binding cavity that exhibits either an hsp70-peptide-binding fold or an OB fold domain

(Melcher, 2000; Waigmann et al., 2004). Moreover, transcripts corresponding to the

MFSV 4 gene accumulate at higher levels than those for the N gene during infection of the plant host but not in the insect vector, suggesting a role inherent to the plant portion of the virus life cycle (Chapter 4). Taken altogether, these results suggest that MFSV 4 is a movement protein. On the other hand, analysis of the predicted secondary structure of p4 also showed homology to members of the aldehyde dehydrogenase family of proteins.

Aldehyde dehydrogenases have been involved in detoxification processes of the host cell elicited by the accumulation of immune response products after viral infection (Ogier et al., 1989). Thus, it is possible that p4 may be also playing roles of detoxification of the plant host cells after viral infection.

Interaction of MFSV N-P proteins was also observed, but only in the BiFC assay, suggesting that the in planta BiFC assay is more sensitive than the YTH assay for detecting this interaction. The observed N-P interaction is consistent with previous

110 studies that showed co-localization of the MFSV N and P proteins to the nucleolus when expressed together in N. benthamiana cells, in contrast to their nuclear and cytoplasmic localizations, respectively, when expressed singly (Tsai et al., 2005). Moreover, interaction of N-P proteins is common in the Mononegavirales (Assenberg et al., 2010;

Ruigrok et al., 2011). In addition to their roles in the encapsidation of the genomic RNA of rhabdoviruses, the N-P interaction has been involved in associations with plant host factors (Min et al., 2010). The P proteins of animal-infecting rhabdoviruses undergo a conformational change when interacting with the N protein (Assenberg et al., 2010), and it is possible that yeast cells do not support a similar proper conformational change of the

MFSV P protein, but N.benthamiana does.

Finally, the fact that no positive interactions were observed for 3-N and 4-N on both assays, suggest that strong associations of these proteins are not necessary for viral replication. Similarly, the interaction of the N with the putative movement proteins has not been observed for other rhabdoviruses including the nucleorhabdoviruses SYNV and

PYDV (Bandyopadhyay et al., 2010; Min et al., 2010). In contrast, the association of the putative movement protein of RYSV, P3, with the N protein was proposed to be required for cell-to-cell movement (Huang et al., 2005). It is also possible that host proteins play a critical role in these viral protein interactions, and that these interactions do not occur in non-hosts.

111

Taken together, the interactions demonstrated by YTH and BiFC assays provide insights into the role of the non-structural proteins of MFSV and the possible mechanisms that

MFSV may employ to move to new cells during infection of its plant hosts. However, the completion of the interaction map for all the MFSV genes and its expansion to include host proteins is necessary to gain an in-depth understanding of viral infection processes.

YTH library screenings may be useful for the latter. In addition, mutants of MFSV 3, 4,

N and P can be used to validate the MFSV interactions found in this study. Such studies could also allow the identification of sites important for the interaction.

112

5.6. References

Breiman, A., Camus, I., 2002. The involvement of mammalian and plant FK506-binding proteins (FKBPs) in development. Transgenic research 11, 321-335.

Chakrabarty, R., Banerjee, R., Chung, S.M., Farman, M., Citovsky, V., Hogenhout, S.A., Tzfira, T., Goodin, M., 2007. PSITE vectors for stable integration or transient expression of autofluorescent protein fusions in plants: probing Nicotiana benthamiana-virus interactions. Molecular plant-microbe interactions : MPMI 20, 740-750.

Citovsky, V., Lee, L.Y., Vyas, S., Glick, E., Chen, M.H., Vainstein, A., Gafni, Y., Gelvin, S.B., Tzfira, T., 2006. Subcellular localization of interacting proteins by bimolecular fluorescence complementation in planta. Journal of molecular biology 362, 1120-1131.

DaPalma, T., Doonan, B.P., Trager, N.M., Kasman, L.M., 2010. A systematic approach to virus-virus interactions. Virus research 149, 1-9.

Fischer, G., Bang, H., Mech, C., 1984. Detection of Enzyme Catalysis for Cis-Trans- Isomerization of Peptide-Bonds Using Proline-Containing Peptides as Substrates. Biomedica Biochimica Acta 43, 1101-1111.

Gollan, P.J., Bhave, M., Aro, E.M., 2012. The FKBP families of higher plants: Exploring the structures and functions of protein interaction specialists. FEBS Lett 586, 3539- 3547.

Goodin, M.M., 2008. Membrane and Protein Dynamics in Virus-Infected Plant Cells, Methods in Molecular Biology.

113

Guo, D., Rajamaki, M.-L., Valkonen, J., 2008. Protein-protein interactions: The yeast two-hybrid system, in: Foster, G.D., Johansen, I.E., Hong, Y., Nagy, P.D. (Eds.), Methods in Molecular Biology. Humana Press Inc, 999 Riverview Dr, Ste 208, Totowa, Nj 07512-1165 USA, pp. 421-439.

Harries, P., Ding, B., 2011. Cellular factors in plant virus movement: at the leading edge of macromolecular trafficking in plants. Virology 411, 237-243.

Heck, J.A., Meng, X., Frick, D.N., 2009. Cyclophilin B stimulates RNA synthesis by the HCV RNA dependent RNA polymerase. Biochem Pharmacol 77, 1173-1180.

Huang, Y.W., Geng, Y.F., Ying, X.B., Chen, X.Y., Fang, R.X., 2005. Identification of a movement protein of rice yellow stunt rhabdovirus. Journal of virology 79, 2108- 2114.

Jackson, A.O., Dietzgen, R.G., Goodin, M.M., Bragg, J.N., Deng, M., 2005. Biology of plant rhabdoviruses. Annual review of phytopathology 43, 623-660.

Jin-Jun Meng, M.R., Willis Bacon, John T. Stickney, and Wallace Ip, 2005. Methods to Study Protein–Protein Interactions, Methods in Molecular Biology.

Kelley, L.A., Sternberg, M.J., 2009. Protein structure prediction on the Web: a case study using the Phyre server. Nat Protoc 4, 363-371.

Krichevsky, A., Kozlovsky, S.V., Gafni, Y., Citovsky, V., 2006. Nuclear import and export of plant virus proteins and genomes. Molecular plant pathology 7, 131-146.

Kuzmin, I.V., Novella, I.S., Dietzgen, R.G., Padhi, A., Rupprecht, C.E., 2009. The rhabdoviruses: Biodiversity, phylogenetics, and evolution. Infection Genetics and Evolution 9, 541-553.

Lucas, W.J., 2006. Plant viral movement proteins: agents for cell-to-cell trafficking of viral genomes. Virology 344, 169-184.

Melcher, U., 2000. The '30K' superfamily of viral movement proteins. The Journal of general virology 81, 257-266.

Min, B.E., Martin, K., Wang, R., Tafelmeyer, P., Bridges, M., Goodin, M., 2010. A host- factor interaction and localization map for a plant-adapted rhabdovirus implicates cytoplasm-tethered transcription activators in cell-to-cell movement. Molecular plant- microbe interactions : MPMI 23, 1420-1432.

114

Nagy, P.D., 2008. Yeast as a model host to explore plant virus-host interactions. Annual review of phytopathology 46, 217-242.

Ogier, G., Chantepie, J., Quash, G., Doutheau, A., Gore, J., Marion, C., 1989. The effect of a novel inhibitor of aldehyde dehydrogenase on viral replication. Biochem Pharmacol 38, 1335-1343.

Redinbaugh, M.G., Hogenhout, S.A., 2005. Plant rhabdoviruses. Current topics in microbiology and immunology 292, 143-163.

Riboldi-Tunnicliffe, A., Konig, B., Jessen, S., Weiss, M.S., Rahfeld, J., Hacker, J., Fischer, G., Hilgenfeld, R., 2001. Crystal structure of Mip, a prolylisomerase from Legionella pneumophila. Nature structural biology 8, 779-783.

Roy, A., Kucukural, A., Zhang, Y., 2010. I-TASSER: a unified platform for automated protein structure and function prediction. Nat Protoc 5, 725-738.

Ruigrok, R.W., Crepin, T., Kolakofsky, D., 2011. Nucleoproteins and nucleocapsids of negative-strand RNA viruses. Current opinion in microbiology 14, 504-510.

Schneider, S., Buchert, M., Hovens, C.M., 1996. An in vitro assay of beta-galactosidase from yeast. Biotechniques 20, 960-962.

Scholthof, K.B., Hillman, B.I., Modrell, B., Heaton, L.A., Jackson, A.O., 1994. Characterization and detection of sc4: a sixth gene encoded by sonchus yellow net virus. Virology 204, 279-288.

Tanno, F., Nakatsu, A., Toriyama, S., Kojima, M., 2000. Complete nucleotide sequence of Northern cereal mosaic virus and its genome organization. Archives of virology 145, 1373-1384.

Wagner, J.D., Jackson, A.O., 1997. Characterization of the components and activity of Sonchus yellow net rhabdovirus polymerase. Journal of virology 71, 2371-2382.

Waigmann, E., Ueki, S., Trutnyeva, K., Citovsky, V., 2004. The ins and outs of nondestructive cell-to-cell and systemic movement of plant viruses. Critical Reviews in Plant Sciences 23, 195-250. 115

Wang, P., Heitman, J., 2005. The cyclophilins. Genome biology 6, 226.

Wang, W.W., Ma, Q., Xiang, Y., Zhu, S.W., Cheng, B.J., 2012. Genome-wide analysis of immunophilin FKBP genes and expression patterns in Zea mays. Genetics and molecular research : GMR 11, 1690-1700.

Watashi, K., Ishii, N., Hijikata, M., Inoue, D., Murata, T., Miyanari, Y., Shimotohno, K., 2005. Cyclophilin B is a functional regulator of hepatitis C virus RNA polymerase. Mol Cell 19, 111-122.

Whelan, S.P., Barr, J.N., Wertz, G.W., 2004. Transcription and replication of nonsegmented negative-strand RNA viruses. Current topics in microbiology and immunology 283, 61-119.

Yang, F., Robotham, J.M., Nelson, H.B., Irsigler, A., Kenworthy, R., Tang, H., 2008. Cyclophilin A is an essential cofactor for hepatitis C virus infection and the principal mediator of cyclosporine resistance in vitro. Journal of virology 82, 5269-5278.

116

7 Figure 5.1. Plates and filter-lift assay of MFSV interactions determined by YTH. Interaction assays were conducted in AH109 yeast cells co-transformed with MFSV protein fusions to the activation domain (AD) and the binding domain (BD) of the GAL4 system. For each interaction, fusions to the AD are listed first, and fusions to the BD are listed second. MFSV 3 and 4 protein fusions to each domain were tested in pair-wise interactions with all the MFSV proteins. Panels A and C show the co-transformed yeast cells grown in high and low stringency medium, respectively; and panel B shows the filter- lift assay corresponding to the cells grown in high stringency medium. Positive interactions were observed for MFSV 3-4 and 4-3, as indicated by the growth of yeast cells in high stringency medium (A) and by the development of blue color that identify the -galactosidase-producing colonies (B). No interactions were observed for MFSV N-P and P-N, and for the negative control (T-Lam) (A and B). The binding control (T-P53) grew slower than our positive interactions (A), thus we were not able to detect -galactosidase activity at the same time on our filter-lift assays. Co-transformation efficiencies are indicated by the growth of yeast cells in low stringency medium (C).

Figure 5.2. Epifluorescent micrographs of MFSV interactions determined by BiFC. Interaction assays were conducted in N. benthamiana leaves co-infiltrated with MFSV protein fusions to the amino- and carboxy-terminal half of the YFP protein, n-YFP and cYFP respectively. For each interaction, fusions to the n-YFP are listed first, and fusions to the c-YFP are listed second. MFSV 3 and 4 protein fusions to each half of YFP were tested in pair-wise interactions with all the MFSV proteins and only positive interaction are shown in this figure including MFSV 3-4, N-P and the reciprocal 4-3 and P-N interactions. Non-binding controls were indicated by the negative interaction of MFSV 3 and 4 to GUS, tested in pair-wise interactions.

118

Fig 5.3. Confocal micrographs of MFSV interactions determined by BiFC. P3 and P4 were tested in pair-wise interactions with all the MFSV proteins and only positive interaction are shown in this figure. Panels on the left are micrographs of the YFP fluorescence resulting from the BiFC assays, and panels on the right are the corresponding overlays. BiFC positive interactions were observed for MFSV 3-4, 4-3 N-P and P-N. Non-binding controls were represented by the negative interaction of MFSV 3 and 4 to GUS, tested in pair-wise interactions. 119

growth at low growth at high stringency stringency B - total rep. total rep. Interaction # total reps total rep galactosidase positive negative activity 3-N 3 0 3 3 N 3-P 3 0 3 3 N 3-3 4 0 4 4 N 3-4 6 6 0 6 Y 3-M 3 0 3 3 N 3-G 3 0 3 3 N N-3 3 0 3 3 N P-3 3 0 3 3 N 4-3 6 6 6 6 Y M-3 3 0 3 3 N G-3 3 0 3 3 N 4-N 3 0 3 3 N 4-P 3 0 3 3 N 4-4 4 0 4 4 N 4-M 3 0 3 3 N 4-G 3 0 3 3 N N-4 3 0 3 3 N P-4 3 0 3 3 N M-4 3 0 3 3 N G-4 3 0 3 3 N N-P 4 0 4 4 N P-N 3 0 3 3 N T-P53 6 6 0 6 Y T-Lam 6 0 6 6 N Table 5.1. Summary of interactions tested in YTH. Pair-wise interactions of MFSV 3 and 4 with MFSV N, P, M, and G were tested in at least 3 independent replicates (rep). The numbers of reps for each interaction are indicated in the second column. Positive interactions were indicated by the formation of yeast colonies at high stringency conditions (SD -Ade/-His/ -Leu/ -Trp agar) and by the restoration of the -galactosidase activity. Growth of yeast colonies at low stringency (SD -Leu/-Trp agar) indicated that the proteins tested were produced in yeast cells, Y=yes, N=no.

120

Length of # sections # sections # sections Interaction fluorescence examined positive negative (days) 3-N 36 0 36 0 3-P 36 0 36 0 3-3 36 0 36 0 3-4 36 30 6 3 3-M 36 0 36 0 3-G 36 1 35 0 N-3 36 0 36 0 P-3 36 0 36 0 4-3 36 32 4 3 M-3 36 0 36 0 G-3 36 0 36 0 4-N 36 0 36 0 4-P 36 0 36 0 4-4 36 0 36 0 4-M 36 0 36 0 4-G 36 0 36 0 N-4 36 0 36 0 P-4 36 0 36 0 M-4 36 0 36 0 G-4 36 0 36 0 N-P 36 36 0 4 P-N 36 36 0 4 3-GUS 27 0 36 0 4-GUS 27 0 36 0 N-GUS 27 0 36 0 P-GUS 27 0 36 0 Table 5.2. Summary of interactions tested in BiFC. Pair-wise interactions of MFSV 3 and 4 with MFSV N, P, M, and G were tested in 3 independent replicates (reps). The # of sections examined corresponded to the total reps. # sections positive corresponded to the number of sections in which at least one cell showed YFP fluorescence. The length of fluorescence indicates the number of days for which the YFP fluorescence was observed for a particular interaction.

121

Chapter 6: Summary

Maize fine streak virus (MFSV) belongs to the family Rhabdoviridae, order

Mononegavirales. Viruses in this family have bacilliform virions containing nonsegmented negative-sense RNA genomes and are significant pathogens of humans, animals and plants. The MFSV genome is a 13,782 nucleotide, non-segmented, negative- sense RNA that encodes five core structural proteins: the nucleocapsid protein (N), the phosphoprotein (P), the polymerase (L), the matrix protein (M) and the glycoprotein (G) and two non-structural proteins, MFSV 3 and 4. The genes follow the order 3´-N-P-3-4-

M-G-L-5´, flanked by the non-coding leader (l) and trailer (t) regions. Functions for the

MFSV N, P, M, G, and L genes have been assigned based on sequence homologies to other Rhabdoviridae, but functions for the non-structural MFSV 3 and 4 genes remain unknown. The fact that the ORFs of unknown function identified in all plant rhabdoviruses are not present in all animal rhabdoviruses led to the hypothesis that the proteins encoded by these ORFs play roles unique to the plant segment of the life cycle, such as systemic spread in the plant host.

The development of virus-based gene expression systems has been described for negative-sense RNA animal viruses, including VSV, but is lacking for plant viruses. The fact that rhabdoviruses need at least three proteins (N, P and L) in addition to specific sequences in the genome to initiate virus replication has limited the development of 122 reverse genetics systems that will allow the exploitation of plant rhabdoviruses as tools for expression of pharmacologically important molecules (e.g. drugs) in plants. To gain insight into the potential of MFSV to be engineered as expression system, we examined the expression of viral and reporter components required for development of a reverse genetics approach to produce infectious MFSV in Drosophila S2 cells. The green fluorescent protein (GFP) reporter, driven by a T7 promoter, was designed to contain

MFSV sequences important for replication. Expression of the MFSV N and P genes, and the T7 DNA-dependent RNA polymerase (DdRp) was detected by western blot in S2 cells over a period of 4 days post-transfection and only under inducible conditions, indicating that these proteins were produced in S2 cells. Also, co-transfection experiments indicated than more than one protein could be produced in S2 cells at the same time. Expression of the MFSV L gene, the third viral protein component required for replication of rhabdoviruses, could not be detected in S2 cells.

In animal-infecting rhabdoviruses, especially Vesicular stomatitis virus (VSV), gene expression is primarily regulated by gene order, with decreasing levels of viral transcripts along the 3’ to 5’ genome. Sequential transcriptional attenuation of ~30% has been observed and is thought to be regulated at each intergenic region. However, it was not known whether plant-infecting rhabdoviruses are similarly regulated. In particular, the regulation of non-structural genes (e.g., MFSV 3 and 4) has not been defined. To address this question, we first developed a robust RT-qPCR assay for the specific quantification of each of the seven Maize fine streak virus (MFSV) genes using oligo(dT) primers for

123 cDNA synthesis and primers designed to have high amplification efficiency and specificity for each of the seven MFSV genes. We used the RT-qPCR assay to determine the abundance of MFSV P, 3, 4, M, G and L transcripts relative to the MFSV N transcripts in infected maize plants. Two approaches were used for this purpose. In the first approach, transcript copy numbers were calculated for each gene based on standard curves. For the second approach, CT values for each gene were normalized to the 18S reference gene using the comparative CT method. Both approaches indicated in similar patterns of transcription. No sequential gradient of gene transcription from the 3’ to 5’ end of the MFSV genome was observed, suggesting that gene expression in MFSV is regulated by an alternate processes. Interestingly, transcripts corresponding to the MFSV

P and the non-structural MFSV 3 genes accumulated to higher levels than the 3’ MFSV

N gene, suggesting an increased transcription of these genes during infection of maize or increased stability relative to the remaining MFSV transcripts.

MFSV is transmitted in a persistent, propagative manner by the black-faced leafhopper,

Graminella nigrifrons. Parameters affecting the efficiency of its acquisition from and transmission to maize by G. nigrifrons include viral titer and the length of the acquisition and inoculation access periods. However, it is not known whether MFSV gene expression plays a role during acquisition and transmission by G. nigrifrons. To gain insights, quantification of MFSV gene expression in its maize host for four weeks post-inoculation and in its insect vector at six weeks post exposure to infected maize was examined using

RT-qPCR assays. CT values for each gene were normalized to the reference 18S RNA in

124 maize plants and to the Ribosomal protein S13 gene (RPS13) in insects and the accumulation of transcripts was analyzed by the comparative CT method. One week after inoculation with MFSV, no symptoms were observed and no transcripts could be detected for any of the MFSV genes in maize. Temporal changes in the accumulation of

MFSV P and 3 were observed from week two to week four, whereas no changes in the accumulation of the MFSV M, G and L transcripts were found during the same period.

Interestingly, the relative levels of MFSV 4 and N transcripts were similar over this time period. In insects, the accumulation of MFSV P, 3, M and G transcripts was significantly higher than N transcripts, whereas MFSV 4 and L transcripts levels were lower than those for N transcripts. This pattern was similar for insects capable of transmitting the virus and those that could acquire, but not transmit the virus. Our results indicate that the accumulation of MFSV gene transcripts is different from that of animal-infecting rhabdoviruses and that MFSV may have alternative means for regulating gene expression in insects and plants.

The roles of the MFSV non-structural proteins during viral infection are poorly understood. Interactions among viral proteins are critical for viral infection and transmission processes. To shed light on the associations between MFSV proteins, a protein-protein interaction map for MFSV 3 and 4 proteins was generated by means of yeast two-hybrid (YTH) and bimolecular fluorescence complementation (BiFC) assays.

The MFSV 3 and 4 proteins strongly interacted with each other in both assays, suggesting that this interaction is likely to occur in nature. No interaction of the MFSV 3 or 4

125 proteins was detected with the MFSV N, P, M or G proteins in either assay, suggesting that these interactions are not important during infection. Based on the location of MFSV

4 in the genome, the size of the encoded protein and higher accumulation of transcripts in the plant compared to the insect host, MFSV 4 may be a movement protein, and its strong interaction with MFSV 3 may be important during infection of the plant host. In addition, the interaction of the MFSV N and P proteins was detected by BiFC, but not by YTH assays. Because N-P interaction is conserved across the Mononegavirales, we expect that the MFSV N – MFSV P interaction occurs in nature.

The analysis of the relative accumulation of MFSV transcripts provides insights into the mechanism of regulation of transcription of plant-infecting rhabdoviruses. MFSV may have different mechanisms for regulating gene expression, as suggested by the temporal changes in accumulation in infected maize and the different patterns of accumulation of transcripts in its insect and plant hosts. MFSV must overcome several physical, molecular and genetic barriers inside the plant host and insect vector for successful transmission to a new plant host. Thus, the analysis of transcripts accumulation in different plant and insect tissues are the first step to better understand the mechanisms of viral transcription and replication.

The interactions demonstrated by YTH and BiFC assays provide insights into the role of the non-structural proteins of MFSV and the possible mechanisms that MFSV may employ to move to new cells during infection of its plant hosts. However, like many other

126 viruses, is possible that MFSV uses host factor to favor its multiplication. Thus, the completion of the interaction map for all the MFSV genes and its expansion to include host proteins is necessary to gain an in-depth understanding of viral infection processes.

YTH library screenings may be useful for the latter. In addition, mutational studies can be used to validate the MFSV interactions found in this study and to identify sites that are important for the interaction. The identification of the specific interaction sites will allow the development of strategies to disrupt viral infection.

127

Comprehensive Bibliography