GENOMIC AND FUNCTIONAL ANALYSIS OF MOUSE LY49 NATURAL KILLER CELL RECEPTOR GENES
by
KARINA LEE McQUEEN
B.Sc, The University of Guelph, 1995
A THESIS SUBMITTED IN PARTIAL FULFILMENT OF THE REQUIREMENTS
FOR THE DEGREE OF
DOCTOR OF PHILOSOPHY
in
THE FACULTY OF GRADUATE STUDIES
(Department of Medical Genetics; Genetics: Graduate Program)
We accept this thesis as ccjiibH»ipg to the required standard
THE UNIVERSITY OF BRITISH COLUMBIA
March 2001
© Karina Lee McQueen, 2.00\ In presenting this thesis in partial fulfilment of the requirements for an advanced degree at the University of British Columbia, I agree that the Library shall make it freely available for reference and study. I further agree that permission for extensive copying of this thesis for scholarly purposes may be granted by the head of my department or by his or her representatives. It is understood that copying or publication of this thesis for financial gain shall not be allowed without my written permission.
Department of meci^QaX Gyg.ng.'KcS.
The University of British Columbia Vancouver, Canada
Date YAOLCCK Ql-, QLQOI Abstract
The overall objective of my research has been to better understand the genomic complexity of the mouse Ly49 multigene family, which encodes receptors for MHC class I molecules on natural killer (NK) cells. When I began my study, nine Ly49 genes, Ly49a-i, had been identified in the C57BL/6 (B6) mouse, though Southern blot analysis suggested the existence of additional Ly49 genes. To characterize and localize new Ly49 genes, we isolated and mapped PI genomic clones hybridizing to an Ly49c-related probe. The relative order of all Ly49 genes within the clones was determined, and five new Ly49 genes, Ly49j-n, were identified. Three of these new genes, Ly49j, k and n, belonged to the Ly49c-related subset of the Ly49 family. To determine whether the Ly49j, k and n genes were transcribed, RT-PCR was performed using gene-specific primers. A full- length cDNA for Ly49j was detected and shares 96% nucleotide identity with Ly49c and /. Many different sized Ly49k and n transcripts were observed, although they likely do not encode functional proteins due to severe truncations in the open reading frame. Interestingly, the most abundant Ly49j transcript detected lacked the transmembrane domain, yet maintained the reading frame. Further studies revealed the presence of Ly49i transmembrane-less transcripts, although at a much lower frequency than observed for Ly49j. Finally, we examined the 5' and 3' regions of the closely related Ly49c and j genes, to determine if they contained czs-acting elements involved in gene regulation. Luciferase reporter assays in EL-4 cells indicate that the 5' regions o£Ly49c and j contain promoter elements and repressor sequences, and that Ly49j contains an active promoter in the first intron. Finally, comparisons of the 3' non-coding regions of Ly49c and j revealed that the sequence of Ly49j diverges completely from Ly49c downstream of the termination codon, resulting in a longer 3' untranslated region (UTR). When the Ly49j 3' UTR was used to provide the polyadenylation signal for the GFP reporter gene, expression of GFP was reduced two-fold. These results suggest that both internal promoters and 3' regions play a role in regulating Ly49 gene expression. Ill
Table of Contents
GENOMIC AND FUNCTIONAL ANALYSIS OF MOUSE Ly49 NATURAL KILLER CELL RECEPTOR GENES i
Abstract ii
Table of Contents iii
List of Figures vii
List of Tables ix
Acknowledgements x
List of Abbreviations xi
Chapter 1 Introduction 1
1.1 Natural Killer Cells 2 1.1.1 Overview 2 1.1.2 Ontogeny 2 1.1.3 Roles of NK Cells in the Body 4 1.1.4 Mechanism of Cytotoxicity 6
1.2 Missing Self Hypothesis 7 1.2.1 A Historical Perspective 7
1.3 Major Histocompatibility Complex (MHC) 11 1.3.1 Roles and Structure 11 1.3.2 Genomic Organization 13
1.4 NK cell Receptor Families 16 iv
1.4.1 Overview 16 1.4.2 Ig Superfamily Members 19 1.4.3 C-type Lectin-like domain (CTLD) Superfamily 23
1.5 Mouse Ly49 Receptors 35 1.5.1 Overview 35 1.5.2 Functional role of Ly49 35 1.5.3 Polymorphisms and Evolution 38 1.5.4 Genomic Organization 40 1.5.5 Regulation of the Ly49 gene family 40
1.6 Thesis Objectives and Organization 49
Chapter 2 Localization of five new Ly49 genes, including three closely related to Ly49c 51
2.1 Introduction 52
2.2 Materials and Methods 53 2.2.1 PI Bacteriophage Library Screening and Isolation of PI DNA 53 2.2.2 Probes and hybridizations 53 2.2.3 PI clone Restriction Enzyme Mapping 54 2.2.4 Exon PCR, Subcloning, and Sequencing 56
2.3 Results 57 2.3.1 Complexity of Ly49c-related genes in C57BL/6 mice 57 2.3.2 Isolation and mapping of PI clone DNA 59 2.3.3 Gene Localization 61 2.3.4 Sequence Analysis 63
2.4 Discussion 69
Chapter 3 Expression analysis of the new Ly49c-related genes 75 V
3.1 Introduction 76
3.2 Materials and Methods 77 3.2.1 Preparation of NK cell cDNA 77 3.2.2 PCR reactions 77 3.2.3 Sequencing 78 3.2.4 Probes and hybridizations 79 3.2.5 Ly49J expression cloning constructs 79 3.2.6 Antibodies 79 3.2.7 Cell lines 80 3.2.8 Transfections and flow cytometry 80 3.2.9 Cell adhesion assay 80
3.3 Results and Discussion 82 3.3.1 Analysis of Ly49j, k and n cDNAs 82 3.3.2 Transcripts Lacking the Transmembrane Domain 85 3.3.3 Protein Expression of Ly49J 90 3.3.4 Alternative Splicing of C-type Lectin Family Members 90
Chapter 4 Functional analysis of 5' and 3' regions of the closely related Ly49c and j genes 95
4.1 Introduction 96
4.2 Materials and Methods 97 4.2.1 Cell lines 97 4.2.2 Sequencing of putative regulatory regions 97 4.2.3 Generation of luciferase reporter gene constructs 97 4.2.4 Determining intron/exon boundaries for Ly49c 98 4.2.5 Luciferase assays 100 4.2.6 RT-PCR analysis 100 4.2.7 Probes and hybridization 101 4.2.8 3' Race for Ly49j 101 vi
4.2.9 Generation of GFP reporter gene constructs 102 4.2.10 Transfections and Flow Cytometry 103
4.3 Results and Discussion 104 4.3.1 Intron/exon boundaries of Ly49c 104 4.3.2 Sequence and comparison of the 5' region ofLy49c and j 104 4.3.3 Promoter activity of the 5'region 107 4.3.4 Sequence comparison of a putative promoter region in intron 1 ofLy49a, candy 109 4.3.5 Intron 1 promoter analysis 110 4.3.6 Analysis of transcripts from the intron 1 promoter 113 4.3.7 Different 3' untranslated regions in Ly49c and j 115
Chapter 5 Summary 121
Bibliography 123 Vll
List of Figures
Figure 1-1 The missing self hypothesis 8 Figure 1-2 Schematic representation of the MHC class I molecule 12 Figure 1 -3 Schematic map of the human and mouse MHC 14 Figure 1-4 Schematic representation of KIR (Ig-SF) and Ly49 (CTLD-SF) inhibitory and activating receptors 17 Figure 1-5 Schematic map of the leukocyte receptor complex (LRC) on human chromosome 19ql3.1-ql3.3 20 Figure 1-6 Schematic map of the natural killer cell gene complex (NKC) in human and mouse 27 Figure 1-7 Ontogeny of expression of Ly49 receptors by splenic NK cells 42 Figure 1-8 Models of differential Ly49 expression 48 Figure 2-1 Southern blot analysis of genomic DNA derived from inbred mouse strains..58 Figure 2-2 Southern blot analysis of eight PI clones, digested with EcoRI or Hindlll, and hybridized to the Ly49c-related probe under stringent conditions 60 Figure 2-3 A physical map showing the relative location of some of the known and potentially new Ly49 genes in the B6 genome 62 Figure 2-4 Comparison of exon 2 sequences 64 Figure 2-5 Comparison of exon 4 sequences 67 Figure 2-6 Comparison of exon 7 sequences 68 Figure 2-7 The genomic organization of the Ly49 gene cluster in the B6 mouse 71 Figure 3-1 Amino acid sequence of the full-length Ly49J protein, compared to the closely related Ly49C and I proteins 84 Figure 3-2 Products from RT-PCR performed on total NK cell RNA using Ly49c, i- and y'-specific primers 86 Figure 3-3 Nucleotide sequence of the exon 3 splice donor (SD) and exon 3 and 4 splice acceptor (SA) sites for Ly49c, i and j 89 Figure 3-4 COS cell expression of the Ly49j cDNA 91 Figure 4-1 Genomic organization of the Ly49a and c genes 105 Vlll
Figure 4-2 Comparison of 5' sequence upstream (and including) exon 1 from Ly49j, c and a 106 Figure 4-3 Promoter activity of the 5' region measured by the firefly luciferase assay system 108 Figure 4-4 Comparison of partial intron 1 sequence from Ly49j, c and a Ill Figure 4-5 The promoter activity of intron 1 112 Figure 4-6 Semi-quantitative RT-PCR on approximately 5, 10, 50 and 100 ng of NK cell cDNA to identify transcripts produced from the putative intron 1 promoter in Ly49j 114 Figure 4-7 The 3' region of Ly49c and j 116 Figure 4-8 Expression of GFP constructs containing the 3' UTR of either Ly49c orj .. 118 ix
List of Tables
Table 1-1 NK cell receptors belonging to the immunoglobulin superfamily (Ig-SF) 24 Table 1-2 NK cell receptors of the C-type lectin (CTLD) superfamily 33 Table 1-3 MHC class I binding specificities of the known Ly49 receptors 37 Table 1-4 Nucleotide identity between known Ly49 gene coding regions in B6 mice....39 Table 2-1 Nucleotide sequences of Ly49 gene-specific oligonucleotide probes 55 Table 2-2 The presence or absence of an ITIM in the known and new Ly49 molecules .73 Table 3-1 Alternatively spliced products observed for the Ly49g, h,j, k and n genes 83 Table 3-2 Estimate of the frequency of full-length versus transmembrane-less transcripts of the Ly49c, i and j genes 88 Table 3-3 Members of the CTLD-SF for which exon-skipping creates both membrane- bound and putative cytoplasmic protein isoforms 94 Table 4-1 Primers used to amplify the putative regulatory regions of Ly49a, c and j 99 Acknowledgements
I would like to begin by thanking my whole family for their love, support and encouragement over the last few years. In particular, I would like to thank my parents, Don and Winnie, my sister Tanja, and my brother-in-law Mark Johannes for always believing in me and for teaching me what is truly important in life. I could not have done this without you. I would also like to thank my cousin and roommate Mark Ware for his continuing friendship, and Mike and Judy Peacock for their encouragement. And finally, Gary Peacock, my life-partner and best friend, I would never have completed this degree without your support. Thank you for always respecting my work, for taking me into the mountains, for teaching me about life, and for making my life a never-ending adventure.
Many thanks must also go to the people I have been lucky enough to work with: to my supervisor, Dixie Mager, for your support and guidance. You have been an excellent mentor, teacher and editor and I feel privileged to have been a part of your lab. I will miss our gruelling lab hikes through the snow and rain (and sometimes even sun!). To my co-supervisor, Fumio Takei, for your thoughtful discussions and for forcing me to listen to the opposing view. To Doug Freeman, for your never-ending patience, for teaching me almost everything I know, and for being a walking encyclopaedia. I never had to look anything up when you were around. To Brian Wilhelm, for your friendship, for helpful discussions, and for your willingness to share ideas and help others. Your zest for life and science is something to aspire to. To my other lab-mates past and present, Paul Kowalski, Josette-Renee Landry, Patrik and Lilly Medstrand, Holly Stamm, Corinna Baust, Louie van de Lemaat, Marie Louise Andersson and Greg Baillie for making our lab a great place to work. Each of you has helped me in so many ways I can't even begin to describe them all. I am eternally grateful for all your efforts. You are a great group of people. I would also like to thank Rebecca Lian for teaching me about cell culture, for her patience in answering my many questions, and for many interesting discussions about life and science. I would also like to acknowledge the support of my thesis supervisory committee, Ann Rose and Rob McMaster.
To my friends, Sharlene Faulkes, Nicolas Pineault, Suzanne Vercauteren, Jennifer Antonchuk, Karen McLoughlin, Lori Armstrong and Ian Christie. I would like to thank you for your friendship, help, support, encouragement, for listening, and for many good meals full of happiness and laughter over the years. I am lucky to have you all.
And finally, I would like to thank old friends who have helped shape my life: Allison Wallace, Simone Norman, Bruce Norman, Ceylan Goktalay, Heather Williams, Jeff Moore and Tom Schwarzer. You may be far away, but your continuing friendship and support are priceless. xi
List of Abbreviations
ADCC antibody dependent cell-mediated cytotoxicity AICL activation-induced C-type lectin AIRM adhesion inhibitory receptor molecule APC anitgen presenting cell BAC bacterial artificial chromosome bg beige bp base pair B6 C57BL/6 p2m beta-2-microglobulin CD clusters of differentiation cDNA complementary deoxyribonucleic acid cen centromere chr chromosome CLEC C-type lectin receptors cmv cytomegalovirus CRD carbohydrate recognition domain CTL cytotoxic T lymphocyte CTLD C-type lectin domain DAP 12 DNAX adaptor protein DMEM dulbecco's modified eagle's medium DNA deoxyribonucleic acid EST expressed sequence tag FACS fluorescence activated cell sorting FITC fluorescin isothiocyanate GFP green fluorescent protein HBSS Hank's balanced salt solution HLA human leukocyte antigen H2 histocompatibility complex 2 IFN interferon Ig immunoglobulin Ig-SF immunoglobulin superfamily IL interleukin ILT immunoglobulin-like transcript IRF interferon response factor ITAM immunoreceptor tyrosine-based activation motif ITIM immunoreceptor tyrosine-based inhibition motif KARAP killer activating receptor adaptor protein kb kilobase kDa kilo-dalton KIR killer-immunoglobulin-like receptor KLR killer cell lectin-like receptor LAIR leukocyte-associated immunoglobulin-like receptor LINE long interspersed elements LIR leukocyte immunoglobulin-like receptor LLT1 lectin-like transcript LT lymphotoxin
Ly lymphocyte antigen mAb monoclonal antibody MAFA mast cell function-associated antigen MAR mouse activating receptor Mb megabase MCMV murine cytomegalovirus MDL myeloid DAP12-associated lectin MHC major histocompatibility complex min minute MIR monocyte immunoglobulin-like receptor ml milolitre ng nanogram NILR neutrophil immunoglobulin-like receptor NK cell natural killer cell xiii
ORF open reading frame p short arm PAC PI artificial chromosome PCR polymerase chain reaction pg picograms PIR paired immunoglobulin-like receptor q long arm Race rapid amplification of cDNA ends RAR rat activating receptor RNA ribonucleic acid RT-PCR reverse transcriptase-polymerase chain reaction s seconds scid severe combined immuno-deficiency SDS sodium dodecyl sulphate SF superfamily SHP SH2-domain-containing phosphatase SH2 Src-homology 2 SSC standard sodium citrate TCR T cell receptor tel telomere UTR untranslated region YAC yeast artificial chromosome a alpha P beta s epsilon y gamma
[i micro
)u,g microgram
ul micorlitre
5 delta
S, zeta Chapter 1 Introduction 2
1.1 Natural Killer Cells
1.1.1 Overview
Natural killer (NK) cells represent a third population of lymphocytes, in addition to T and B cells, and account for ~15 percent of lymphoid cells found in the human peripheral blood. They were first described in the mid-1970's when it was noted that a population of lymphocytes from healthy individuals was able to spontaneously lyse various cell lines, as well as certain normal and tumour cells in a non-major histocompatibility complex (MHC) restricted manner, without prior sensitization (reviewed in Trinchieri 1989). NK cells were originally called "null" cells, as they do not express or rearrange T or B cell surface markers such as the T cell receptor (TCR)/CD3 (yds) complex or immunoglobulin (Ig) antigens (Biron et al. 1987). As a result, NK cells could only be identified by a negative definition (Moretta 1995). Intensive research into the various cell markers expressed on the surface of NK cells led to the first non• functional definition of an NK cell in 1988. NK cells were described as large granular lymphocytes that mediated cytolytic reactions in the absence of MHC class I expression on target cells, and expressed the cell surface antigens CD 16 and CD56 in humans, and NK1.1 in mice (Lanier et al. 1986; Perussia et al. 1984; Trinchieri 1989). CD 16, or the FcRylll, encodes the low-affinity receptor for the Fc fragment of IgG and plays a role in antibody-dependent cell-mediated cytotoxicity (ADCC) of target cells coated with IgG, while the CD56 molecule is a product of the NCAM gene (Lanier et al. 1991; Lanier et al. 1986). The NK1.1 antigen in mice encodes a surface protein belonging to the NKR- Pl family of C-type lectin-like molecules (Ryan et al. 1992).
1.1.2 Ontogeny
The ontogeny and lineage relationship of NK cells is somewhat controversial, although it is accepted that NK cells arise in the bone marrow (Haller and Wigzell 1977; Levy et al. 1981). Unlike T lymphocytes, NK cells do not require the thymus in order to differentiate and mature, as they are able to develop in athymic nude and scid mice (Dorshkind et al. 1985; Hackett et al. 1986). As NK and CD8+ cytotoxic T cells (CTLs) share cytolytic functions and surface markers, such as CD2 and CD7, it was suggested 3 that NK cells are related to, and share a common progenitor with T cells. In support of this hypothesis, studies using both mouse and human systems have shown that fetal thymocytes differentiated into either T cells or NK cells depending on the microenvironment in which the cells were cultured (Poggi et al. 1993; Rodewald et al. 1992; Sanchez et al. 1994). In addition, a recent study conclusively demonstrated that CD117+, NK1.1+, CD9010, CD25" fetal thymocytes are bi-potent NK and T progenitors (Michie et al. 2000). Furthermore, a population of primitive cells isolated from adult mouse and human bone marrow gave rise to B, T and NK cells in vivo, but could not generate cells of the myeloid lineage (Galy et al. 1995; Kondo et al. 1997), illustrating the existence of a common lymphoid progenitor for all three cell types. Recent studies have shed light into the transcriptional pathways and cytokine requirements for the development of the NK cell lineage in mice. Some of the trans• acting factors and cytokines that likely play a role in NK differentiation are briefly mentioned below, however, this list is by no means complete. The differentiation of NK cells is highly complex, and it is likely that many other factors are involved. Targeted mutations of the /raws-activating factor Ikaros, have suggested it is required for early lymphoid differentiation from the hematopoeitic stem cell, as Ikaros-deficient mice lack T, B and NK cells and lymphoid precursors (Georgopoulos et al. 1994). In addition, knock-out studies on the transcription factors Ets-1, Stat-1, and the cytokines IL-2, IL-7 and IL-12 resulted in a decrease in the number and/or functional capacity of NK cells, suggesting a role for these molecules in NK development (Barton et al. 1998; Kundig et al. 1993; Lee et al. 2000; Magram et al. 1996; Moore et al. 1996). Numerous studies also support an important role for IL-15 in NK cell development. For example, mice deficient in the common y chain (which is shared by the cytokines IL-2 and IL-15), the IL-2/IL- 15RP chain and the interferon-response factor (IRF-1) all had impaired NK cell development (DiSanto et al. 1995; Ogasawara et al. 1998; Ohteki et al. 1998; Suzuki et al. 1997). As IL-15 contains an IRF-1 response element in its promoter, and IRF-1-/- mice display impaired IL-15 production by the bone marrow stroma as well as impaired NK differentiation (Ogasawara et al. 1998; Williams et al. 1998), IL-15 is likely involved in NK development. Further evidence for the role of IL-15 in NK differentiation comes from IL-15 and IL-15Ra knock-out mice in which NK cells have been shown to be 4 absent (Kennedy et al. 2000; Lodolce et al. 1998). Transgenic and knock-out studies have greatly improved our knowledge regarding the factors involved in NK cell development, however, much remains to be learned.
1.1.3 Roles of NK Cells in the Body
NK cells are important effector cells in the innate immune system. Their primary roles are direct lysis of target cells, and the production of cytokines, which mediate other immune effects. NK cells are involved in killing virally infected cells, tumour cells, as well as cells coated in IgG antibody in ADCC. NK cells play an important role against intracellular pathogens, via ADCC. NK cells, as well as neutrophils, monocytes and macrophages, use the FcRylll, or CD 16, on the cell surface to interact with and lyse target cells that have been coated with the IgG antibody (reviewed in Trinchieri 1989). NK cells are also involved in the removal of intracellular pathogens through the production of cytokines, such as IFNy, which in turn activate other effector cells involved in non-adaptive resistance.
NK cells are an important first line of defence against certain viral infections. They act during the initial days of an infection to decrease viral titres to a level that is manageable for the adaptive T and B cell immune response, which ultimately eliminates the virus. Evidence to support this finding is abundant using experimental animal systems. For example, mutant beige (bg) mice, which are defective in NK cell cytotoxicity, but have normal T and B cell responses, were shown to be susceptible to murine cytomegalovirus (MCMV) infection (Bancroft et al. 1981; Shellam et al. 1981). In other experiments, the depletion of NK cells in scid mice, which are deficient in T and B cells, resulted in higher viral titres and a decreased survival rate in animals inoculated with MCMV (Welsh et al. 1991). Welsh and colleagues also showed that depletion of NK cells in normal mice increased viral titres of MCMV after inoculation, but not of other viruses, such as lymphocytic choriomeningitis virus (Welsh et al. 1990). The importance of NK cells in viral immunity is also supported by the fact that naturally occurring NK deficiencies in humans are rare. Isolated case reports have identified a few individuals with no detectable NK activity and/or NK precursor cells. These individuals are highly susceptible to life-threatening, recurrent viral infections, such as herpes viruses 5 or Epstein-Barr virus (Biron et al. 1989; Fleisher et al. 1982), confirming that NK cells play an important role in limiting viral titres before the adaptive immune system can respond. There are many studies suggesting that NK cells play a role in tumour surveillance and subsequent killing (reviewed in Trinchieri 1989). For example, it has been shown that nude mice, which lack T cell activity yet have functional NK cells, do not have particularly high incidences of spontaneous or carcinogen-induced tumours compared to immunologically normal control mice, suggesting that NK cells have anti- tumour activity (Herberman and Ortaldo 1981). Also, the depletion of NK cells using the monoclonal antibody (mAb) NK1.1, followed by inoculation of melanoma or colon carcinoma cells resulted in increased tumour localization and growth, leading to a reduced survival rate in the injected animals (Seaman et al. 1987). In addition, early studies in NK cell-deficient bg mice, reported increased tumour growth and metastasis of injected tumours compared to control littermates (Karre et al. 1980; Talmadge et al. 1980). More compelling evidence of a role for NK cells in tumour immunity comes from a recent study in which Ly49A transgenic mice, under the control of the granzyme A locus, were generated. Ly49 molecules are NK cell surface receptors and will be discussed further in section 1.5. This particular Ly49A transgenic line had a selective deficiency in NK1.1+CD3" cells, and displayed defective natural killing. The numbers and functions of T and B cells, as well as other hematopoetic cells in these mice were normal. Interestingly, this phenotype appears to be attributed to the site where the Ly49a construct integrated in the genome, rather than the over-expression of the Ly49A molecule itself. Transgenic animals were unable to reject injected tumour cells, and tumours metastasised to the lungs at a much higher rate as compared to control mice. Adoptive transfer of NK1.1+CD3" T and B cell-deficient cells from scid mice into the transgenic animals increased the ability of these mice to eliminate inoculated tumour cells. This process could then be abrogated by addition of the mAb anti-NKl.l, which depletes NK cells, providing direct evidence that NK1.1+CD3" cells play a significant role in tumour elimination in vivo, although it is likely that the related CD3+ T cell population, termed NK/T cells, also plays a redundant role (Kim et al. 2000). It remains to be seen, however, if these transgenic mice are more susceptible to naturally occurring tumours as 6 they age. Despite a wealth of experimental evidence derived from animal models, the exact role NK cells play in tumour immunity is complex and has yet to be fully elucidated.
1.1.4 Mechanism of Cytotoxicity
NK cells and CTLs lyse specific target cells in a multistep process. CTL and NK cells first recognize and come into close contact with specific target cells. They then deliver a lethal hit to the target cell via the exocytosis of cytotoxic granules, which injure the cell and initiate programmed cell death. This is followed by detachment from the dying target, allowing effector cells to seek out and destroy new targets. More specifically, CTL and NK cells come into close contact with specific target cells and release cytotoxic granules containing proteins such as perforin and granzymes. Perforin monomers insert into the cell membrane, and in the presence of calcium, polymerize to form pore-like channels that bore into the target cell membrane (reviewed in Young and Cohn 1987). Perforin-deficient mice are unable to lyse virally infected cells or NK cell targets, supporting a role for perforin as a key effector molecule in NK cell-mediated killing (Kagi et al. 1994). Additional proteins, including serine protease molecules called granzymes, are then released into the target cells, resulting in the rapid induction of target cell DNA fragmentation and apoptosis (Heusel et al. 1994). 7
1.2 Missing Self Hypothesis
1.2.1 A Historical Perspective
One of the most important features of the immune system is the ability to distinguish between self and non-self. The adaptive T and B-cell immune response performs this function by recognizing the presence of foreign antigens in the context of self-MHC. Despite the fact that NK cells were originally believed to be MHC unrestricted, it was observed that they were unable to lyse syngeneic cells, and thereby must have some mechanism to discriminate between normal and foreign cells. In 1986 it was noted that there was an inverse correlation between the expression of MHC class I molecules on the surface of a target cell and NK cell-mediated lysis of the targets (Karre et al. 1986). This discovery led to the formulation of the missing self hypothesis. The missing self hypothesis states that NK cells are effector cells in a defence system geared to detect the deleted or reduced expression of self-MHC (Ljunggren and Karre 1990) (Fig. 1-1). In an elegant set of experiments, Karre and coworkers repeatedly mutagenized lymphoma cell lines and selected for sublines that were deficient in MHC class I expression. When syngeneic mice were injected with MHC class I-expressing lymphoma cells, numerous tumours grew, whereas injection with the selected MHC I-deficient lymphoma cells prevented tumour growth (Karre et al. 1986). The increased lysis of MHC class I-deficient tumour cells was shown to be mediated by NK cells. Similar observations were seen using a transformed human B cell line (Harel-Bellan et al. 1986). In addition, many lung metastases were observed when B16 melanoma cells expressed MHC class I molecules, however MHC class I-deficient B16 melanoma cells failed to produce metastatic colonies after inoculation (reviewed in Ljunggren and Karre 1990). The metastatic capacity of these cells could be restored if MHC class I-deficient B16 melanoma cells were treated with IFNy, which upregulates MHC class I expression, or if NK cells were depleted (Taniguchi et al. 1987). Similarly, Ljunggren and colleagues showed that transfection of the beta-2-microglobulin (fbm) molecule into MHC class I- deficient YAC-1 target cells restored protection against lysis (Ljunggren et al. 1990). 8
*• No Lysis
*• Lysis
Figure 1-1. The missing self hypothesis. 9
These experiments clearly demonstrate a correlation between MHC class I expression and NK cell sensitivity. The existence of an NK cell repertoire was discovered when it was noted that different NK clones from the same individual recognized different target cells. This suggested the presence of distinct receptors on the surface of NK cells that recognized specific alloantigens (Moretta et al. 1992). Two models were proposed to explain how NK cells recognized allogeneic or MHC-deficient cells. The first, called the effector- inhibition model, suggested that NK cells expressed receptors that recognized MHC class I molecules on target cells, and that this interaction led to the generation of a negative signal which prevented NK cell-mediated lysis. Loss of an MHC class I molecule or an aberrant MHC class I molecule would result in target cell lysis due to the lack of a negative signal (Ljunggren and Karre 1990; Moretta et al. 1992). The target interference model, on the other hand, suggested that NK cell receptors recognized specific self- epitopes, and that appropriate MHC class I molecules would mask the self-epitopes and protect the cell from lysis. Expression of an inappropriate MHC class I molecule would not mask the epitope, allowing the NK cell to bind and lyse the target cell (Ljunggren and Karre 1990; Moretta et al. 1992). The effector inhibition model has stood the test of time. In support of this model, Moretta and colleagues showed that two NK cell specific mAbs, GL183 and EB6, reacted with a family of 58 kDa surface molecules on human NK cells, and that this family of molecules was involved in specific recognition of alloantigens (Moretta et al. 1992). This 58 kDa family of proteins was later defined as the killer Ig-like receptor family (KIR), which will be discussed further in section 1.4. In the murine system, Ohlen and coworkers showed that NK cells from B6 mice (H2b) transfected with the non-self MHC class I gene H2-Dd, rejected B6 bone marrow cell grafts that lacked H2-Dd but were otherwise syngeneic to the host (Ohlen et al. 1989). Karlhofer and coworkers extended this study and were the first to show that this allorecognition was mediated at the clonal level by a receptor family on murine NK cells called Ly49. NK cells from B6 mice expressing the Ly49A molecule could not lyse target cells expressing the MHC class I gene H2-Dd, whereas these same targets could be lysed by Ly49A" NK cells (Karlhofer et al. 1992). From these experiments, it was clear that NK cells expressed inhibitory 10 receptors that specifically recognized MHC class I molecules on target cells and mediated lysis. Therefore, in order to prevent self-reactivity, every NK cell must express at least one inhibitory receptor specific for self-MHC, and these observations have formed the basis for the missing self hypothesis. The human and mouse NK cell receptors that mediate this recognition will be described in more detail in sections 1.4 and 1.5. 11
1.3 Major Histocompatibility Complex (MHC)
1.3.1 Roles and Structure
As MHC class I molecules have been shown to act as ligands for receptors on cells involved in innate immunity, such as NK cells, they will be described briefly. The MHC was originally discovered as the major determinant of graft survival in transplantation experiments (and is hence called the Major Histocompatibilty Complex) (reviewed in Klein 1986). Despite its involvement in tissue rejection, the principle role of the MHC is the presentation of processed peptide antigens to T cells. The MHC consists of two distinct classes of molecules that act in this capacity, namely MHC class I and II. MHC class I molecules are located on the surface of all nucleated cells in the body and present endogenous antigens, such as virally-derived peptides, to CD8+ T lymphocytes, which then elicit a cytotoxic response. MHC class II molecules are located on specialized cells called antigen presenting cells (APC), such as dendritic cells, macrophages and B cells. MHC class II molecules present exogenously-derived peptides to CD4+ T helper cells, which in turn activate B cells to produce an antibody response against the antigen. In addition, MHC molecules play a role in thymic education of CD4+ and CD8+ T cells during development, which in turn prevents autoimmunity (reviewed in Trowsdale 1993). The role of MHC class I molecules as ligands for receptors on NK cells will be discussed further in sections 1.4 and 1.5. As MHC class I molecules play a role in NK cell-mediated cell lysis, the structure of these molecules will be described here briefly. MHC class I molecules are transmembrane proteins consisting of two separate polypeptide chains. The first is a MHC-encoded a or heavy chain, consisting of an al, a2 and a3 region. The al and a2 domains make up the peptide binding region of the molecule. The second chain is the. non-MHC encoded p2m chain which non-covalently associates with the heavy chain (reviewed in Robinson and Kindt 1989) (Fig 1-2). MHC molecules in humans and mice are highly polymorphic, whereby hundreds of different alleles for each individual MHC locus may exist. The al and a2 domains, encoding the peptide binding domain, or antigen recognition sequence, contain most of the polymorphic residues, while the a3 12
Figure 1-2. Schematic representation of the MHC class I molecule (adapted from Immunobiology-The Immune System in Health and Disease, 1st Ed). 13 and p^m regions remain relatively conserved. This polymorphism likely evolved, and is maintained, as a mechanism to increase the number of antigenic peptides that can be presented to T cells, in order to elicit a better immune response, as structural variability may confer a selective advantage in an individual (reviewed in Parham and Ohta 1996; Robinson and Kindt 1989).
1.3.2 Genomic Organization
The MHC is referred to as the HLA (Human Leukocyte Antigen) in humans, and the H2 (Histocompatibility 2) in mice. The HLA complex is located on human chromosome 6p21, while the H2 is found on mouse Chromosome 17. Both the HLA and the H2 regions span approximately four Mb of DNA and contain MHC class I, II and III genes as well as numerous other genes, many of which are associated with the immune response (Trowsdale 1996). The complete sequence and gene map of the human MHC has recently become available (MHC Consortium1999), and sequencing of the mouse H2 locus is currently in progress (http:/chroma.mbt.washington.edu/msg_www/) (Amadou et al. 1999). A generalized schematic representation of the human and mouse MHC is illustrated in Fig. 1-3. MHC class I molecules can be divided into 'classical' and 'non-classical' genes. In humans, the classical MHC class I genes are designated HLA-A, -B and -C, while their mouse counterparts are referred to as H2-D, -K and -L. Interestingly, human and mouse MHC class I genes are not orthologous. Different alleles of each human HLA class I gene are denoted by an asterix and a four digit number, such as HLA-B*0201, while different mouse alleles are denoted by a lower case superscript Arabic letter. For example, H-2Dk denotes the k allele of the D gene (nomenclature is reviewed in Parham 1996). The classical MHC class I genes are highly polymorphic and are involved in tissue rejection and peptide presentation to T cells. The non-classical MHC class I genes are HLA-E, -F, and -G, as well as MIC (MHC class I chain related) in humans, and Q, M and T in the mouse (reviewed in Stroynowski and Forman 1995). Non-classical MHC genes are typically less polymorphic, and perform other functions in the cell, some of which have yet to be determined. The MHC class II genes, HLA-DR, 14
on bO
O Cw 0) O CD G O O O e3 O O oS '3 c: o o CM g O c CM o _> g o CD CD DC m 13 on a. o a> CO H O O
CO GO
111 tz s g § CO u CC - O X = |
o 5 X 06 •Si §
4> c3 e o -i to !Z5 S o > on on o O Q. SD £ w TO E 15
-DQ and -DP in humans, and mouse H2-I (-A and -E), are similar to the classical MHC class I genes in that they also function in tissue rejection and peptide presentation. However, they differ from MHC class I genes in that they present antigenic peptides to CD4+ T helper cells. The MHC class III region is interspersed among the MHC class I and II genes and contains over 30 genes, including the heat shock protein 70, tumour necrosis factor, and numerous complement genes. The MHC also contains a number of genes related to antigen presentation, such as TAP, and LMP (MHC Consortiuml999; Hansen and Sachs 1989; Robinson and Kindt 1989; Trowsdale 1996). 16
1.4 NK cell Receptor Families
1.4.1 Overview
A number of gene families that encode receptors on the surface of human and mouse NK cells and interact with MHC class I molecules have now been discovered. Interestingly, these families can be divided into two structurally distinct classes of molecules: (1) those belonging to the Ig superfamily (Ig-SF), such as the KIRs, and (2) those with similarity to the C-type animal lectins, such as Ly49 receptors and CD94/NKG2 heterodimers (Lanier 1997) (Fig. 1-4). Members of the Ig-SF are type I transmembrane proteins and are characterized by varying numbers of Ig-like regions in the extracellular portion of the protein. In addition, they are expressed as monomers on the surface of the NK cell. In contrast, C-type lectin- like molecules are type II transmembrane proteins, are expressed on the cell surface as disulfide-linked homo- or heterodimers, and are characterized by an extracellular carbohydrate recognition-like domain (CRD) (reviewed in Lanier 1997). Despite the structural differences between the Ig-SF and C-type lectin-like molecules, NK cell receptors belonging to both families are functionally similar, in that they recognize MHC class I ligands on target cells. In addition, both the Ig-SF and C- type lectin-like NK cell receptor families contain some members that encode activating receptors, and others that encode inhibitory receptors specific for MHC class I. In contrast to T and B cells, individual NK cells can express multiple NK cell receptors, with activating and inhibitory isoforms being expressed on the same cell (Mason et al. 1996; Moretta et al. 1995; Vales-Gomez et al. 2000). Therefore, the ability of an NK cell to kill a target is regulated by a balance between inhibitory and activating receptors on the cell surface. Interestingly, the signalling machinery used by Ig-SF or C-type lectin- like inhibitory receptors is the same, and is distinct from the signalling pathways used by activating NK cell receptors (Fig. 1-4). For the remainder of this section, the terms 'inhibitory receptors' and 'activating receptors' will encompass molecules belonging to both the Ig-SF and C-type lectin-like families. 17
E o •E a Q. s- 3 W) G
re u E -a o c Q « o u ••*-< —I 0) faS3 Q. >» o i - H O U o\
S * .5 (SO CD » & s-i ftO o o c S ft s ~ E Q. O
a • y M-i
• D) t/2 ft
61) u fa H 18
The inhibitory NK cell receptors have been well studied. As predicted by the missing self hypothesis, NK cells survey target cells for expression of MHC class I molecules. Engagement of an inhibitory receptor with its appropriate MHC class I ligand results in a negative signal being sent to the NK cell, preventing NK cell-mediated lysis of the target. Inhibitory receptors have been shown to send the negative signal to the NK cell via immune tyrosine-based inhibitory motifs (ITIM) (V/IxYxxL/V) located in the cytoplasmic domain (Leibson 1997). Receptor-ligand interactions cause tyrosine residues within the ITIM to become phosphorylated, thereby recruiting Src-homology-2 (SH2) domain-containing phosphatases such as SHP-1 (Burshtyn et al. 1996; Fry et al. 1996; Mason et al. 1997; Olcese et al. 1996), resulting in dephosphorylation events that block NK activation (Fig. 1-4). Importantly, the negative signals sent via MHC I-specific inhibitory receptors dominate over triggering receptors, so that when both receptors are engaged, the inhibitory signal prevails (Moretta et al. 1995; Valiante et al. 1997b). Many inhibitory receptors have activating counterparts, although the role of these molecules is less well understood. Activating and inhibitory NK cell receptors have highly similar extracellular regions, but have markedly different transmembrane and cytoplasmic domains, leading to the generation of opposing signals (Biassoni et al. 1996). Activating NK cell receptors are typically characterized by short cytoplasmic tails that lack obvious signalling motifs, such as ITIMs or immune receptor tyrosine-based activation motifs (ITAMs), and are unable to inhibit the cytotoxic response (Leibson 1997). Importantly, many activating receptors involved in the immune response have been shown to be multi-subunit receptor complexes that transmit signals via membrane associated signalling proteins such as FceRly and CD3^. For example, the TCR signals via the CD3 molecule on T cells, while B cell surface Ig associates with FcR. Typically, associated signalling molecules have acidic or negatively charged amino acid residues in the transmembrane domain that are required for interaction with basic or positively charged residues in their ligand-binding receptors. The majority of the activating NK cell receptors identified to date contain a positively charged amino acid residue (arginine or lysine) in the transmembrane domain, which suggests these receptors transduce signals through associated proteins that contain signalling motifs (Leibson 1997). This has indeed proved to be the case. Activating NK cell receptors have been shown to associate 19 with a signalling molecule related to FcsRIy and CD3^, called DAP 12 (or KARAP, killer activating receptor adaptor protein) (Lanier et al. 1998b; Smith et al. 1998) (Fig. 1-4). DAP 12 is expressed on the cell surface as a disulfide-linked homodimer, with a short extracellular region and an IT AM (D/ExxYxxL/Ix6-gYxxL/I) in the cytoplasmic domain. The DAP 12 gene is located on human chromosome 19ql3.1, in close proximity to a number of Ig-like gene families, and has a negatively charged residue (aspartic acid) in the transmembrane domain, which binds to the positively charged amino acids found in the transmembrane region of the non-inhibitory NK cell receptors (Lanier et al. 1998b). DAP 12 was initially shown to non-covalently associate with the activating Ig-SF NK cell receptor KIR2DS2, resulting in phosphorylation of the IT AM in DAP 12 and recruitment of the protein tyrosine kinases ZAP70 and/or syk (Lanier et al. 1998b). This initiates a cascade of protein tyrosine phosphorylation events that is not well understood, but ultimately leads to activation of the NK cell. DAP 12 has also been shown to associate with the activating C-type lectin-like molecules, Ly49D and H (Gosselin et al. 1999; Smith et al. 1998), and CD94/NKG2C (Lanier et al. 1998a), leading to the activation of syk kinases (Mason et al. 1998). Interestingly, DAP 12 is expressed on NK cells, and cells of the myeloid lineage, suggesting it is involved in the signal transduction cascades of additional receptor families (Lanier et al. 1998b; Mason et al. 1998). Some of these families will be discussed further in sections 1.4.2 and 1.4.3.
1.4.2 lg Superfamily Members
Many new gene families containing Ig-like domains that encode receptors on the surface of hematopoietic cells, including NK cells, have been discovered in the last five years (see below). A number of these gene families, such as the KIRs, Ig-like transcripts (ILT), leukocyte associated Ig-like receptors (LAIR), and NKp46, localize to a 1 Mb region called the leukocyte receptor complex or cluster (LRC) on human chromosome 19ql3.4 (Wagtmann et al. 1997; Wende et al. 1999; Wilson et al. 2000) (Fig. 1-5). As the different gene families encoded in the LRC have conserved gene structures and sequences, and appear to be in the same centromeric to telomeric orientation on the chromosome, it is likely that the LRC has evolved via extensive duplication events (Wilson et al. 2000). 20
9>
On •c = o O vi c O £ !-. o
8 J d I
_ on a E o on © U c o o (50 8 ^ a o ?? e on o 0d a> 2 s -J o aT * .S 3 ^ •S ^ &
a«i o o s 5
C/5 o u
/i» ° M 2
The mouse and rat also have a LRC, located on syntenic regions of mouse chromosome 7 and rat chromosome 1, respectively. The rodent LRC contains such gene families as the mouse paired Ig-like receptors (PIRs) and mouse/rat NKp46 (MARs/RARs) (Biassoni et al. 1999; Dennis et al. 1999). The genomic organization of these regions has not been well defined.
KIR (Killer Ig-like receptors)
General characteristics
The best characterized NK cell receptors belonging to the Ig-SF, are the KIRs. KIR molecules were originally identified as NK cell surface glycoproteins that recognized MHC class I molecules and prevented NK cell-mediated lysis (Moretta et al. 1993). Numerous closely related KIR cDNAs were initially cloned (Colonna and Samaridis 1995; D'Andrea et al. 1995; Wagtmann et al. 1995), and found to be distributed on overlapping subsets of NK cells (Colonna and Samaridis 1995). Thirteen closely related KIR groups or subfamilies are known to exist, and the genomic organization of the KIR cluster, spanning approximately 150 kb of the LRC, has recently been determined (Martin et al. 2000; Torkar et al. 1998; Wende et al. 1999; Wilson et al. 2000) (Fig. 1-5). KIR molecules are expressed on human NK cells, and a subset of T lymphocytes (Mingari et al. 1996). Mouse KIRs have not yet been identified, although primate homologs have been shown to exist (Khakoo et al. 2000). KIR molecules can be classified according to the number of extracellular Ig-like domains they contain (2D or 3D), and on the length of their cytoplasmic tail (long, L or short, S). In addition, each KIR subfamily or group has been given a numerical designation. For example, the molecule KIR2DS1 contains two-Ig-like domains and a short cytoplasmic tail and belongs to the KIR group designated number one. KIR molecules that have a long cytoplasmic tail (L) contain two ITIMs and are believed to encode inhibitory receptors, while KIR molecules with shorter cytoplasmic tails (S) lack ITIMs (Long et al. 1996) (http://www.ncbi.nlm.nih.gov/PROW) and transduce activating signals via the adaptor protein DAP12 (Lanier et al. 1998b) (Fig. 1-4). Both inhibitory and activating KIRs can be expressed on the same NK cell. In general, three Ig-like KIRs 22
(KIR3D) recognize HLA-A and -B alleles, while KIRs with two Ig-like domains (KIR2D) bind HLA-C molecules (reviewed in Vales-Gomez et al. 2000).
Polymorphisms and evolution
KIR molecules are highly polymorphic. The KIR cDNAs so far identified can be divided into thirteen groups, each representing a distinct locus. cDNAs within a group differ by one to nine nucleotides, and sequences between groups differ by greater than 20 nucleotides. Each group contains up to six allelic variants (Uhrberg et al. 1997; Wilson et al. 2000), and new variants are still being discovered. For example, Martin and coworkers recently identified a KIR2DL4 allele that differed in length from the previously reported gene (Martin et al. 2000; Selvakumar et al. 1997). Mapping studies have also illustrated the polymorphic nature of this region, as two independent sets of PAC clones spanning the KIR/ITL gene clusters were found to have different restriction enzyme patterns (Martin et al. 2000). Interestingly, there is enormous KIR diversity within the human population, as analysis of over 50 donors identified 18 different KIR haplotypes (Uhrberg et al. 1997). Analysis of KIR molecules in 48 chimpanzees exhibited a similar degree of polymorphism (Khakoo et al. 2000), further emphasizing the variability of this region. As all KIR molecules share the same genomic organization and are closely related, they likely arose from a common ancestral gene and there is growing evidence in the literature to support this hypothesis. For example, the coding sequence, as well as the intron and intergenic regions between KIR genes are highly conserved, and contain only a limited number of unique sequence features that are greater than 100 bp in length. In addition, all KIR genes, except KIR2DL4, have a microsatellite repeat in intron 1, and contain a pseudo-exon 3, which is removed by alternative splicing (Wilson et al. 2000). Phylogenetic analysis of various regions of the KIR genes also revealed that the 2D and 3D KIR genes belong to distinct lineages and likely diverged prior to the diversification that is seen in each group (Martin et al. 2000; Valiante et al. 1997b).
The analysis of repetitive elements within the genomic DNA of the KIR gene cluster has provided additional evidence to support the existence of a common ancestral KIR gene. For example, four ancestral retroelements were identified in the same position 23 in all KIR genes, and the 3' intergenic space between each KIR was shown to contain a MER2 sequence. Also, two (TAGA)„ repeats were discovered in the fourth intron of each KIR (Martin et al. 2000). Another report looked at the insertion of different subfamilies of the repetitive element Alu into the KIR cluster and determined the Alu S/J ratio; The Alu S/J ratio can be used to measure the relative age of a sequence, where the Alu S and J subfamilies represent recent versus older Alu insertions, respectively. The Alu S/J ratio for most sequences in Genbank was found to be 3.0, whereas the ratio for the KIRs was shown to be over 70, indicating a recent origin for the KIR family (Wilson et al. 2000). Furthermore, the cloning of KIRs from chimpanzee, which is separated from humans by only 5 million years, identified only three chimpanzee KIR orthologs, KIR2DL4, KIR2DL5 and KIR2DS4, whereas the additional seven chimpanzee KIR groups identified had diverged significantly from their human counterparts (Khakoo et al. 2000). Taken together these results suggest that the KIR gene family evolved between the divergence of new and old world monkeys 30-45 million years ago (Martin et al. 2000). The presence of KIR orthologs in most primate species, and their absence in the mouse is consistent with this hypothesis (Valiante et al. 1997a).
Other Ig-Superfamily Receptors
A large number of other receptors belonging to the Ig-SF have been identified in recent years. However, the ligands for only a few of these molecules have been identified, and the functional significance of these receptors is not clear. As Ig-SF members were not the focus of my research project, only a brief description of each gene family is summarized in Table 1-1.
1.4.3 C-type Lectin-like domain (CTLD) Superfamily
A number of NK cell receptor gene families have structural similarity, and belong to the Ca2+-dependent (C-type) lectin domain (CTLD) superfamily. The CTLD superfamily includes the NKR-P1 genes, CD69, and the well characterized Ly49 multigene family (Takei et al. 1997). This superfamily has grown in recent years and a number of new NK cell gene families and molecules have been discovered (see below). CTLD NK cell receptor family members are similar to animal lectins in that they contain 24
c o CO co CO _w CT> CO O) a> — 0 a> CD co .. co a,c U 5o 0 _: TO co co CO .. o X3 co — c c CD o o i— ~ CD a> co co co 0 xs O CM co E c O o c 0 • - CO c CM COm ro — °>£: ^ as -5 a> 8 2 a> i "a* 2 a>£- ; c= o 2 co a> OWQr co a> - O O) « C! O5 ? < CD r- 0) (/) O Q?5?
CD .is CO CD O O ^"8 0 O CL o O •g w O ^ m z "55 « 8 Q. T3 o E ° 8"H co - o 05 "O : E CO o CD -52 sd c o cV E > CD * O Q >, ° 0 m y ac t ZCD-D Z E O £ OQ "O
05 05 05 03 c 05 05 c c •o O O ST c o o g od o o re o c O c X c X 3 O 51 3
•o X3 c c co •D co C c co 3s, 0 hi O -j= c? ^0) 05 a re o m 2 U5 o is.° B-^ 5 co 0 c?^0 »5 > 5 w OQ)- O> O! jQ CO ._ Jr 0 i! ^TO "- c5o ^ "F 8= £ » A 13) o D) (0 c ^ .= s o re E S u P CM CD CO
DC E to s 'E c wo re CO G O) js E
© C35 E QH o V CO r- O O E-2 0 C CO CO 05 .C 0 o re 3 O C "S t ° E O ~ •g o CT) (3) C CO 05 u O _J 3 OS
o Q. oo" m Q. Q. 0 <35 O •<* 0 * 8 Q. 0£ o> H 53 <3 CO NILR-1 rat chr. 1 rat inhibitory unknown neutrophils Berg et al. 1999
NKp46 human chr. 19, human, activating unknown predominantly NK cells Falco et al. (MAR-1 in mouse chr. 7, mouse, rat 1999b; Pessino mouse, RAR- rat chr. 1 et al. 1998; 1 in rat) (syntenic) Sivori et al. 1997 Z Q. human chr. 6 human activating unknown IL-2 activated NK cells Cantoni et al. 1999; Vitale et al. 1998 z£ co _ o ap human chr. 6 human activating unknown all NK cells Pende et al. 1999 Ovl 2B4 human chr. 1, human, activating and CD48 NK cells, CD8+T, Brown et al. mouse chr. 1 mouse inhibitory (?) monocytes, basophils 1998; Nakajima and Colonna 2000; Schatzle etal. 1999 CM r2B4 unknown rat activating? unknown NK cells Kumaresan et (part of rat al. 2000 2B4 family?) 26 a C-terminal carbohydrate recognition domain (CRD). However, the critical residues in the CRD of the CTLD NK cell receptors are only partially conserved. For example, cysteine residues that form disulfide bonds in the extracellular region of the molecule are conserved, while critical Ca binding residues have diverged. Nevertheless, sequence similarities between the CRDs of the CTLD superfamily suggest evolution from a common distant ancestral domain. Therefore, CTLD NK cell receptors are related yet evolutionarily divergent from other C-type lectins, and form a distinct lineage (Weis et al. 1998). The CTLD NK cell receptor families NKR-P1 and Ly49 were originally shown to localize to a region called the NK cell gene complex (NKC) on mouse chromosome 6 (Yokoyama et al. 1991). The NKC has grown to include other CTLD genes, such NKG2, CD94, and CD69. An NKC has also been detected on syntenic regions of human chromosome 12pl2-pl3 (Renedo et al. 1997; Suto et al. 1997), and rat chromosome 4 (Dissen et al. 1996). Linkage and sequence-ready physical maps of this region in humans and the mouse have been developed, and the order of the various CTLD genes determined (Brown et al. 1999; Depatie et al. 2000; Depatie et al. 1997; Forbes et al. 1997; Scalzo et al. 1995) (Chapter 2 of this thesis) (Fig. 1-6). The human region has been essentially sequenced. A comparison of ~225 kb of the NKC between humans and mouse revealed that the number, relative order, and orientation of the genes was similar, suggesting the NKC is conserved between species. The complete sequence of this region in humans and mouse will be necessary in order to confirm this finding. Interestingly, no correlation between the relative distribution of repetitive elements has yet been observed (Ansari-Lari et al. 1998).
Ly49
One of the best characterized CTLD NK cell receptor genes belong to the Ly49 multigene family, which was originally identified in rodents. The Ly49 gene family will be discussed in detail in section 1.5. 27
o o ON c ON CD "9 .52 ^ ON O & a a OS I ,2 l-l oi- CS pq u 16t^-|. 1 a x ;=!
CD94/NKG2
The CD94 and NKG2 molecules are well characterized members of the CTLD superfamily. The CD94 molecule is encoded by a single gene (Chang et al. 1995), while the NKG2 locus encodes a multigene family. CD94, NKG2A, C, E, and F have been identified in humans (Adamkiewicz et al. 1994; Houchins et al. 1991; Plougastel and Trowsdale 1997), while CD94, and NKG2a and c-like molecules have been cloned in the mouse (Lohwasser et al. 1999; Silver et al. 1999; Vance et al. 1998; Vance et al. 1997) and rat (Berg et al. 1998b; Dissen et al. 1997). It should be noted, however, that rodent and human NKG2A and C genes are not orthologous. As the CD94 molecule contains a short cytoplasmic tail, it was hypothesized that CD94 bound to another protein capable of inducing a signalling cascade (Phillips et al. 1996). Subsequent studies have shown that CD94 covalently associates with members of the NKG2 gene family, forming disulfide- bonded heterodimeric complexes on the cell surface (Brooks et al. 1997; Carretero et al. 1997; Lazetic et al. 1996). Like other NK cell receptor gene families, NKG2 has been shown to encode both inhibitory and activating molecules. NKG2A contains two ITIMs in the cytoplasmic domain and encodes an inhibitory receptor, while NKG2C and E lack an ITIM and likely encode activating receptors. Indeed, the phosphatase SHP-1 has been shown to associate with CD94/NKG2A heterodimers (Carretero et al. 1998; Houchins et al. 1997), while CD94/NKG2C has been shown to associate with the adaptor signalling molecule DAP 12 (Lanier et al. 1998a). Human CD94/NKG2A and C have recently been shown to recognize the non-classical MHC class I molecule HLA-E (Borrego et al. 1998; Braud et al. 1998; Lee et al. 1998b). Expression of HLA-E on the cell surface is regulated by the binding of peptides derived from the signal sequences of classical MHC class I molecules (Lee et al. 1998a). Similarly, mouse CD94/NKG2A and C have been shown to recognize the non-classical MHC class I gene Qa-lb, which also requires binding of peptides derived from the leader sequence of the classical H2-D and -L proteins (Salcedo et al. 1998; Vance et al. 1998). Since surface expression of HLA-E and Qa-lb molecules depends on the availability of class I-derived signal sequences, 29 recognition of these non-classical MHC class I molecules by CD94/NKG2 represents a mechanism for broadly assessing MHC class I expression (reviewed in Leibson 1998). The CD94 and NKG2 genes have been localized to the NKC, and the gene order (CD94-NKG2F-NKG2E-NKG2C-NKG2A) has been determined in humans and mice (Plougastel and Trowsdale 1998; Renedo et al. 2000; Sobanov et al. 1999; Vance et al., 1999). Genomic sequencing revealed that all NKG2 family members are oriented in the same direction on the chromosome, and that the intron/exon sequences of the various NKG2 genes are remarkable similar (Renedo et al. 2000; Sobanov et al. 1999). In addition, examination of the distribution of repetitive elements demonstrated that all NKG2 genes contained a number of long interspersed elements (LINE) at the same position (Plougastel and Trowsdale 1998). These finding suggest that the NKG2 gene cluster arose from a common ancestral gene via gene duplication events. Interestingly, CD94 and NKG2 genes appear to be more conserved or less variable than the KIRs (Khakoo et al. 2000). In addition, it is likely that CD94/NKG2 molecules are evolutionarily older than the KIRs, as they have found in both rodents and man, while the KIRs exist only in primates (Valiante et al. 1997a; Wilson et al. 2000).
Other CTLD Superfamily Receptors
A number of additional members of the CTLD superfamily have been identified. However, like the newly discovered Ig-SF members, the ligand specificities and the precise physiological role of many of these proteins is unknown at this time. Some of the genes that encode putative NK cell surface receptors will be described briefly below, and are summarized in Table 1-2.
A) NKR-P1:
NKR-P1 was originally defined as the NK1.1 antigen, which is present on all NK cells in B6 mice, and is used as the prototypic NK cell marker. The NKR-P1 gene family contains three genes, NKR-P1A, -B and -C, and was first cloned in the rat (Giorda et al. 1990), and later in the mouse (Giorda and Trucco 1991; Yokoyama et al. 1991) and human (Lanier et al. 1994). NKR-P1A and -C encode activating receptors (Ryan et al. 1991; Ryan et al. 1995; Ryan and Seaman 1997), and likely signal via p56lck tyrosine kinases (Campbell and Giorda 1997; Giorda and Trucco 1991). Recent studies have 30 shown that NKR-P1B contains an ITIM, associates with SHP-1, and encodes an inhibitory receptor (Carlyle et al. 1999; Kung et al. 1999). Therefore, like other NK cell receptors, the NKR-P1 gene family encodes both activating and inhibitory molecules. The NKR-P1 gene family is polymorphic in terms of its expression pattern in different mouse strains (Kung et al. 1999; Lanier et al. 1994). Interestingly, the NK1.1 antigen has been identified as the activating NKR-P1C molecule in B6 mice (Ryan et al. 1992), and as the inhibitory NKR-P1B gene in other mouse strains (Carlyle et al. 1999; Kung et al. 1999).
B) NKG2D:
NKG2D was originally identified as a member of the NKG2 family in humans (Houchins et al. 1991). Subsequent cloning in the mouse and rat, however, led to the determination that NKG2D belonged to a distinct gene family (Berg et al. 1998a; Ho et al. 1998; Vance et al. 1997). NKG2D contains a short cytoplasmic tail, and was recently shown to associate with the newly described associated signalling molecule DAP 10 (Wu et al. 1999). Ligands for NKG2D have been identified in humans and the mouse. Human NKG2D recognizes the stress-inducible MHC class I-related genes MICA and MICB (Bauer et al. 1999), while mouse NKG2D interacts with the minor histocompatibility antigen H60 and the retinoic acid early inducible gene Rae-1 (Cerwenka et al. 2000; Diefenbach et al. 2000). Interaction of NKG2D/DAP10 with its H60 or Rael ligands resulted in NK cytotoxicity, cytokine release, and nitric oxide production, supporting an activating role for NKG2D in innate immunity (Diefenbach et al. 2000).
C) CD69 (Early activation antigen):
CD69 molecules were first identified as the earliest inducible cell surface glycoproteins acquired during lymphoid activation. The gene has been cloned in mouse and human (Hamann et al. 1993; Lopez-Cabrera et al. 1993; Ziegler et al. 1993), and is expressed on activated T, B, NK cells, neutrophils, and platelets (Ziegler et al. 1993). CD69 is a triggering receptor as it contains a short cytoplasmic tail and lacks signalling motifs, although the cytoplasmic domain is necessary for signal transduction (Sancho et al. 2000). A recent study has shown that CD69 engagement leads to the activation of 31
ERK kinase, and that this interaction is suppressed by co-expression of CD94/NKG2A inhibitory receptors (Zingoni et al. 2000). However, the physiological role of this molecule in innate immunity is unknown.
D) AICL (Activation-induced C-type lectin):
AICL is a single type II transmembrane gene expressed on most human hematopoeitic cells. It contains a short cytoplasmic tail, lacks an ITIM, and likely encodes an activating receptor. No ligand or functional activity for this molecule has been reported (Hamann et al. 1997).
E) LLT1 (Lectin-like transcrtipt 1):
LLT1 is a recently discovered human C-type lectin molecule with high similarity to AICL and CD69. LLT1 is expressed on NK, T and B cells, and likely acts as an activating receptor, as it lacks an ITIM in the cytoplasmic domain. No signalling partners have yet been identified, and the function of this molecule is unknown (Boles et al. 1999).
F) MAFA (Mast cell function-associated antigen):
The MAFA gene was originally cloned in the rat (Guthmann et al. 1995), but has subsequently been identified in humans (Butcher et al. 1998) and the mouse (Blaser et al. 1998; Hanke et al. 1998). Rat MAFA is expressed primarily on mast cells, whereas human MAFA is also expressed on NK cells (Butcher et al. 1998; Guthmann et al. 1995). Interestingly, mouse MAFA is expressed on a subset of NK cells, and a small population of T cells, but is not expressed on mast cells (Blaser et al. 1998; Hanke et al. 1998). A recent study has suggested that mouse MAFA is regulated by MHC class I molecules, as cell surface expression of MAFA was downregulated in MHC I-deficient mice. Binding of MAFA to MHC class I molecules could not be demonstrated using cell adhesion assays, however it was proposed that MHC class I regulates MAFA via interactions with inhibitory Ly49 molecules (Corral et al. 2000). 32
G) KLR-F1:
The KLR-F1 molecule was recently discovered on human activated NK cells and monocytes. It has been localized to the NKC, and contains two ITIMs in the cytoplasmic domain, suggesting it acts as an inhibitory molecule (Roda-Navarro et al. 2000). 33
CO CO 1— v; oo CO co CM O0 0 c 00 co 52 co . . oo • - O) 0 DQ CD co 2 CD CO oo s CO ^_ -= -= o) oo CO CO m CO CO" r5 CO 0 CO CO ._ CO N- _: oo co r 0
—I >- o C co CO 0 0 ca CO CO CO CO -O _Q Q CO 3 0 = a 8 §• CO u 0 CO
"a T3 •a © c: C c co CO co t3 >, CO CO °> CO CO o s c re o = o = •J= £ CO •ti CO "co ^ JO > > -Q -9 > n > ^ o a .£ co .5= CO co .£ = < I U o •a 0 CO E Q. to WO 'E C CO U 2 o- CO 5-g" © 0 CO CD c CD E «o g to c « Q. O W « Q. O W o b. o « ° "— - E-2 c C\l 03 c 0 ^ |^ g g CO SJ O) ci^ CM co -^t o re co co CO =! t ° E a. -£ O 3 CM 2 j= E3 CQ.M g ^ 3 CM 2 JO O _l O 3 CM X ^ E ."»• x: T- E o ° ^ E o o 0 CM ^ s CM I a o. 0 * cn CM " 0 a ^ i "co o > o 34 .. CD O CD .. co CD o CO CD 00 a> o CD CD : CD CD T- co CD 0 CM o CO : ID CD "CD CO CD « CO C > 0 i_ CD CD CD c 0 CD i- CD 2 c o c CD o E c CD o IX o CD CO O X CM O _co in 0 aT co 0 0 o 0 ^ CO "co o o o jo 0 _ g 0 w !? II CO (1) CD 0 |= E I JO o 1 CD .3 8 2 o o co c c o 8 & c O CD ° o o 0 ^ x E O CD XJ E E 9= 0 C c <: o o c o 'I c c 3 3 3 CD CD C o o ^ o CD ±i CD > J5 JO > O CD CD c c CD 0 CD E CD CO 3 E 2 E 2 \2 CO CO CM cr CO " Q. " QL O O c 0 co ™ co 2 CD CO ^ CD E o. E a. E 3 3 CM 3 CM -c E o (0 o DC UJ Q < _J _i £ £ < o 35 1.5 Mouse Ly49 Receptors 1.5.1 Overview Ly49 molecules were originally identified in B6 mice as cell surface antigens expressed on a subset of T lymphocytes (reviewed in Takei et al. 1997). Two groups independently cloned the first Ly49 cDNA shortly after, and determined it encoded a type II membrane protein expressed as a homodimer on the surface of NK cells and a small population of T cells (Chan and Takei 1989; Yokoyama et al. 1989). Southern blot analysis on genomic DNA digested with different restriction enzymes revealed that the Ly49 gene was actually a member of a multigene family (Chan and Takei 1989; Yokoyama et al. 1989; Yokoyama et al. 1990). Subsequently, 14 closely related Ly49 genes have been identified in the inbred mouse strain B6 (Mason et al. 1995; Smith et al. 1994; Wong et al. 1991) (our contribution is discussed in Chapter 2), and additional distinct genes have been discovered in other mouse strains (Makrigiannis et al. 1999). The original Ly49 gene was named Ly49a, and additional genes have been named sequentially, Ly49b, c etc. To date, ten Ly49 genes in B6 have been shown to be expressed (Ly49A-J), some of which recognize MHC class I molecules on target cells and inhibit or activate NK cells (Brennan et al. 1994; Karlhofer et al. 1992; Mason et al. 1995; Nakamura et al. 1999; Yu et al. 1996) (Chapter 3). Ly49 molecules have been cloned in the rat, although the exact number of Ly49 genes is unknown (Dissen et al. 1996) . A single related Ly49 gene has been discovered in the human NKC, called human Ly49L, however this gene is not functional due to incorrect splicing in exon 5 (Barten and Trowsdale 1999; Westgaard et al. 1998). Therefore, humans do not use Ly49 molecules as NK receptors that interact with MHC class I on target cells and mediate NK cell cytotoxicity. Instead, they use KIRs, belonging to the Ig-SF, to carry out this function. 1.5.2 Functional role of Ly49 It was originally believed that all Ly49 genes encoded inhibitory receptors on the surface of NK cells. Indeed, the ITIM-containing Ly49A molecule was shown to recruit the phosphatase SHP-1 upon engagement with its MHC class I ligand (Nakamura et al. 1997) . However, it was noted a few years ago that the Ly49D and H molecules did not 36 contain an ITIM in the cytoplasmic domain, although this region is highly similar to other Ly49 molecules (Mason et al. 1996). It has subsequently been shown that Ly49D and H associate with the adaptor signalling molecule DAP 12, and likely encode activating receptors (Gosselin et al. 1999; Smith et al. 1998). Therefore, like most NK receptor families discovered to date, the Ly49 family encodes both activating and inhibitory proteins. The binding specificities of the various Ly49 family members have been well studied, but the analysis is by no means complete. This functional analysis has been hampered by a lack of suitable biological reagents such as mAb specific for each gene. As the Ly49 family contains numerous closely related genes, most available mAbs cross- react with more than one Ly49 molecule, making results difficult to interpret (reviewed in Takei et al. 1997). For example, the mAb 5E6, which was originally believed to be specific for Ly49C, was later found to also recognize the Ly49i gene product (Brennan et al. 1996a; Sundback et al. 1996). Despite these difficulties, the MHC class I specificities of some Ly49 proteins have been determined and are summarized in Table 1-3. Ly49A and C have been the best characterized, and both have been shown to have a broad specificity for MHC class I (Brennan et al. 1994; Hanke et al. 1999; Karlhofer et al. 1992). The specificities of Ly49D, G and F, however, appear to be more restricted (George et al. 1999a; Hanke et al. 1999; Mason et al. 1995), while the binding specificities of Ly49B, E, H and J are still unknown (Hanke et al. 1999) (Chapter 3). Interestingly, the activating receptors Ly49D in B6 and Ly49P in the mouse strain 129/J, have been shown to recognize the MHC class I molecule H2-Dd (George et al. 1999a; Nakamura et al. 1999; Silver et al. 2000). Therefore, both activating and inhibitory Ly49 molecules recognize MHC class I ligands, and in some cases they can recognize the same class I ligand. To test which signal would dominate if both types of receptors were engaged on an individual NK cell, George and coworkers examined the co-expression of self-MHC-specific inhibitory and activating receptors on NK cells from H2-Dd- expressing mice. They demonstrated that self tolerance of the Ly49D+ NK subset was achieved through co-expression of a sufficient level of self-specific inhibitory receptors (i.e., co-expression of Ly49A or G with Ly49D in H2d mice). This finding 37 Table 1-3. MHC class I binding specificities of the known Ly49 receptors. A '+' indicates binding, a '-' indicates no binding, and a space denotes binding specificities that have not been tested. MHC class I haplotype Ly49 b d k f q r s V p References A + + + + + + + + Brennan et al. 1994; Hanke et al. 1999; Karlhofer et al. 1992; Michaelsson et al. 2000; Olsson-Alheim et al. 1999 B Hanke etal. 1999 C + + + + + + + + Brennan et al. 1994; Hanke etal. 1999; Lian et al. 1999; Michaelsson et al. 2000; Yu etal. 1996 D - + + . - George etal. 1999a; Nakamura et al. 1999 E Hanke etal. 1999 F - + - - Hanke etal. 1999 G — + + - - + - — George et al. 1999; Hanke et al. 1999; Johansson et al. 1998; Mason etal. 1995 H I + + + - + + + + Hanke et al. 1999; Lian et al. 1999 J - - Chapter 3 O P + Silver et al. 2000 38 clearly illustrates that the inhibitory signal is dominant and is able to prevent NK cell- mediated lysis of target cells (George et al. 1999a; George et al. 1999b). 1.5.3 Polymorphisms and Evolution The Ly49 family is highly polymorphic. Southern blot analysis with Ly49 probes on genomic DNA from various mouse strains revealed marked inter-strain and species differences in the patterns of hybridization. This suggested that various mouse strains contained different numbers of Ly49 genes, and that the genomic organization of these genes differed between the strains (Takei et al. 1997; Yokoyama et al. 1990) (this will be discussed further in Chapter 2). In addition, it has been shown that different mouse strains express different alleles of the same gene. For example, Ly49C from B6 is highly similar (99.3%) to other strains, such as BALB/c, A/Sn and CBA/J, yet differs by four amino acids (Brennan et al. 1996a; Makrigiannis and Anderson 2000; Sundback et al. 1996). Finally, Ortaldo and colleagues examined the expression pattern of Ly49A, C, G and I by fluorescence activated cell sorting (FACS) in eleven different mouse strains and determined that there were inter-strain differences. For example, Ly49A was expressed at a high level on all the strains examined, except 129/J and SJL/J, while Ly49G was expressed at varying levels in the different mice (Ortaldo et al. 1999). As mentioned previously, the various Ly49 genes are highly related, sharing between 70-96% nucleotide identity (Table 1-4). The Ly49b gene is the most divergent, sharing only 70% identity with most family members, while Ly49c, i and j are the most closely related (Makrigiannis and Anderson 2000) (Chapters 2, 3 and 4). Therefore, it is likely that the Ly49 genes arose via gene duplication from a common ancestral gene. As all the Ly49 genes are so closely related, it can be difficult to determine if newly described Ly49 genes in other mouse strains are allelic or represent distinct genes. It has been suggested that distinct genes share less than 97% identity, while alleles are greater than 97% identical. As Ly49c, i and j share 96.5% nucleotide identity, they may represent the most recent gene duplication events that have occurred in the Ly49 family, assuming genetic drift is a function of time (Makrigiannis and Anderson 2000). That the Ly49 family arose via gene duplication events is also supported by the observation that 39 Table 1-4. Nucleotide identity (%) between known Ly49 gene coding regions in B6 mice (adapted from Makrigiannis et al 2000). A B C D E F G H I J A - 69.8 80.7 88.2 82.8 82.3 87.7 77.9 80.7 80.5 B - 70.9 68.9 69.9 70.9 70.8 69.7 70.9 69.8 C - - 76.8 89.1 90.9 80.0 90.5 95.9 96.3 D - - - 78.8 78.3 84.3 78.6 77.8 76.6 E - - - - 91.9 81.8 85.4 90.0 88.9 F - - - - - 82.5 86.5 91.8 91.3 G ------77.9 80.4 80.0 H ------91.9 91.1 I ------96.9 j ...... 40 all the Ly49 genes identified to date appear to be in the same transcriptional orientation on mouse chromosome six (Depatie et al. 2000) (Chapter 2). Recombination events between different Ly49 family members also appears to have contributed to the evolution of this family. For example, Ly49h is only 78% identical to Ly49c in the first two exons, but is 95% identical in the last four exons (Takei et al. 1997) (Chapter 2). A similar situation is observed with the newly described Ly49o and p genes identified in 129/J mice. Ly49o is 97% identical to Ly49a in the 5' end of the gene, and 97% identical to Ly49d in the 3' region of the gene. The opposite was seen with Ly49p, where the 5' end of the gene is Ly49d-like, while the 3' region closely resembles Ly49a (Makrigiannis et al. 1999). 1.5.4 Genomic Organization When I began my study in 1995, the genomic organization of the Ly49 gene cluster on mouse chromosome six was unknown. My thesis project has contributed to this area of research and will be discussed in detail in Chapter 2. A number of other groups have also examined the organization of this family over the last five years, and much is now known. Genetic maps of the NKC have been described (Depatie et al. 1997; Forbes et al. 1997; Scalzo et al. 1995), and physical maps of the Ly49 cluster have been published (Brown et al. 1997a; Depatie et al. 2000) (Chapter 2). Our group and others determined the relative order of 14 Ly49 genes in the strain B6 (Brown et al. 1997a) (Chapter 2), and this analysis has been confirmed by a sequence ready BAC contig spanning the Ly49 region (Depatie et al. 2000). The genomic organization in other mouse strains remains to be determined. This analysis will be necessary to fully understand how the Ly49 gene family evolved, how it is regulated, and to distinguish between genes and alleles. 1.5.5 Regulation of the Ly49 gene family Much of the research on the Ly49 gene family over the last ten years has focussed on trying to understand the function of the Ly49 molecules, however, very little is known about how these genes are regulated. This is currently an active area of research, and it is becoming increasingly clear that Ly49 genes are regulated at a number of different levels. NK cell receptors are distributed on overlapping subsets of NK cells, where the 41 expression of individual Ly49 receptors is observed on subsets of 20-50% of NK cells. This clonal heterogeneity may enable NK cells to react to subtle perturbations in the MHC class I make-up of a cell. Analysis of single mouse NK cells and human NK clones has shown that individual NK cells can express as many as six different receptors (Kubota et al. 1999; Valiante et al. 1997b). In addition, these studies illustrated that every NK cell expressed at least one inhibitory receptor specific for self-MHC, thereby meeting the criteria proposed by the missing self hypothesis. Interestingly, the expression of mouse Ly49 and human KIR NK cell receptors appear to be governed by similar rules, even though these genes are unrelated. It has been proposed that receptor acquisition and co-expression of inhibitory Ly49 molecules is stochastic, whereby the likelihood of a single NK cell expressing two or more receptors is the product of their individual probabilities (product rule) (Held et al. 1996; Raulet et al. 1997). The co- expression of the activating Ly49D and H molecules, however, does not appear to be stochastic, and occurs more frequently than expected by random acquisition (Smith et al. 2000). The molecular mechanisms by which this clonal distribution of NK receptors occurs remain poorly understood. Inhibitory receptors on fetal NK cells The expression of Ly49 molecules is low on fetal or neonatal NK1.1+CD3" (NK) cells, but gradually increases to adult levels during the first six to eight weeks of life. The appearance of Ly49 molecules coincides with the appearance of NK activity (Dorfman and Raulet 1998) (Fig. 1-7). Despite the absence of Ly49 molecules, fetal and neonatal'NK1.1+Ly49" cells were able to distinguish between MHC class Ihlgh and class Ilow targets cells (Manoussaka et al. 1998; Sivakumar et al. 1997; Toomey et al. 1998), suggesting the presence of additional class I-specific molecules on fetal cells that are able to mediate this interaction. Subsequent studies have shown that CD94/NKG2 hetero- dimers are expressed on fetal NK cells, and likely play a role in self-tolerance during early ontogeny (Kubota et al. 1999; Sivakumar et al. 1999; Toomey et al. 1999). The percentage of cells expressing CD94/NKG2 was shown to decrease slightly in adult mice compared to neonatal levels (Kubota et al. 1999), suggesting that there is a 42 age, days j age of mice that are competent to reject bone marrow grafts Figure 1-7. Ontogeny of expression of Ly49 receptors by splenic NK cells. Early NK cells do not express Ly49 molecules but gradually acquire them during post-natal life, until adult levels are reached at 6-8 weeks of age (adapted from Dorfman and Raulet 1998). 43 developmental switch from solely using CD94/NKG2 inhibitory receptors in fetal NK cells, to using a combination of Ly49 and CD94/NKG2 molecules in adult mice. Role of MHC class I on the Ly49 repertoire in NK development There is strong evidence that the expression of MHC class I molecules influences the NK cell receptor repertoire during ontogeny. The sequential expression model proposes that the successive stochastic accumulation of different Ly49 receptors by developing NK cells is terminated once the cell expresses receptors with sufficient avidity for self-MHC class I (Held et al. 1996; Held and Raulet 1997). This model implies that individual NK cells limit the number of receptors specific for self-MHC so as to be able to distinguish cells that have undergone slight alterations in their MHC class I expression. Evidence to support this model is abundant in the literature. For example, several groups reported there was an increased frequency of NK cells expressing two or more receptors in MHC I-deficient mice compared to normal mice (Held et al. 1996; Salcedo et al. 1997). In addition, the number of Ly49A+NK cells and cell surface level of Ly49A was shown to be decreased in H2d mice, which express the ligand for Ly49A, compared to H2b mice, which do not express the ligand (Olsson et al. 1995; Salcedo et al. 1997). Held and coworkers also showed that mice expressing multiple H2d-specific Ly49 receptors (i.e., co-expression of Ly49A and G) were less frequent in H2d mice than in H2b mice (Held et al. 1996). These results were expanded upon using Ly49A transgenic mice. The expression of the Ly49A transgene on all NK cells in H2d mice caused a decrease in the expression of Ly49G, whose ligand is also H2d (Held and Raulet 1997; Roth et al. 2000), and a decrease in the expression of endogenous Ly49A (Fahlen et al. 1997). Further support for these findings come from a report where uncommitted Ly49ATg c-kit+Sca+Lin" precursors were sorted and cloned onto irradiated bone marrow stromal cells derived from H2d, H2b and MHC I-deficient (p2m-/-) mice, and the percentage of Ly49G+ cells was determined. In agreement with previous reports, a higher percentage of Ly49G+ cells was present on P2m-/- stroma, an intermediate expression of Ly49G+ cells was present on H2b stroma, whereas a decreased proportion of Ly49G+ cells was observed on H2d-derived stromal cells which express the ligand for Ly49G (Roth et al. 2000). 44 Additional studies have demonstrated that the engagement of inhibitory MHC receptors during NK cell development provides crucial signals for further NK cell differentiation and/or maturation (Lowin-Kropf and Held 2000). In this report, the interaction between an Ly49A transgene and its MHC ligand accelerates and/or rescues the development of NK cells which would otherwise fail to acquire sufficient numbers of self-specific receptors. Clearly, these studies point to an MHC-dependent education process which limits the number of NK cells that co-express self-MHC specific Ly49 receptors. Such a process optimizes the capacity for NK cells to identify self cells that have lost the expression of some, but not all, MHC class I molecules. A number of reports have illustrated the importance of bone marrow stromal cells for the development of NK cells. For example, bone marrow progenitors cultured in a stroma-free system gave rise to lytic NK1.1+, but Ly49" cells (Williams et al. 1997), however, Ly49+ cells were induced when these same progenitors were cultured in the presence of bone marrow stroma (Williams et al. 1999). In addition, transfer of NK1.1+Ly49" cells into mice resulted in the acquisition of Ly49+ cells (Dorfman and Raulet 1998). These studies suggest the presence of the bone marrow microenvironment is necessary for proper development and expression of Ly49 molecules on NK cells. Interestingly, a recent report suggested that there may be a reciprocal interaction between NK precursor cells and their microenvironment. Studies on lymphotoxin-deficient mice (LTa-/-) suggested that cells in the developing NK lineage deliver a membrane LTa signal to bone marrow stromal cells which, in turn, encourages the stroma to provide an environment that supports the development of NK cells (Iizuka et al. 1999). Ly49 Receptor Acquisition In addition to being influenced by MHC class I molecules, several recent studies have placed a temporal restriction on Ly49 initiation, suggesting that the order of Ly49 gene expression during development may be non-random. In vivo transfer experiments using NKl.l+Ly49A+C"GT NK cells gave rise to a fraction of cells that expressed Ly49 C/I and G, whereas transfer of NKl.l+Ly49A"C"GT NK cells induced expression of Ly49C/I and G, but not Ly49A (Dorfman and Raulet 1998). These results suggested that Ly49A was initiated very early in development, before the expression of NK1.1, and that 45 Ly49 acquisition was ordered. This was confirmed by a recent report where NK cell clones were cultured from lymphoid-restricted bone marrow progenitors or bone marrow NK1.1+cells. Less restricted c-kit+Sca+Lin" progenitor cells had the ability to give rise to Ly49A-expressing cells, whereas more committed NKl.l+DX5+Ly49" progenitor cells could not (Roth et al. 2000). Thus, Ly49 receptors appear to be expressed successively, with the potential to initiate expression of certain Ly49 receptors being lost in an orderly fashion as development proceeds. There is some controversy in the literature regarding the order of Ly49 expression during development. Unlike other gene families, such as the beta-globin gene cluster, the order of Ly49 expression does not appear to follow the gene order along the chromosome. A clonal analysis of NK cell development from bone marrow progenitors in vitro suggested that expression of Ly49B, CD94, NKG2A and NKG2C preceded that of NK1.1 (Williams et al. 2000). In contrast to the previous study by Roth and coworkers (Roth et al. 2000), the expression of Ly49A in this system was not initiated until after the expression of Ly49G, C, and I. Interestingly, this study also supports the role for IL-15 in NK development. Expression of the IL-2/IL-15Rp chain was shown to precede that of Ly49, CD94, NKG2 and NK1.1 expression (Williams et al. 2000). In addition, one report has shown that NK cells cultured from the liver and thymus of day 14 fetal mice express high levels of Ly49E (Toomey et al. 1998), while another study illustrated that freshly isolated fetal NK cells only expressed transcripts for Ly49E and CD94 (Van Beneden et al. 1999). As the ligand for Ly49E is unknown at this time, the role of Ly49E in NK ontogeny is unclear. Although the results of these studies do not necessarily agree, they support the sequential expression model for a stochastic, but ordered acquisition of Ly49 molecules, which is influenced by MHC class I. Therefore, Ly49 receptor acquisition is likely a developmentally regulated process that requires direct contact with the bone marrow as well as the interaction with specialized factors produced by the marrow microenvironment. Mono-allelic expression of Ly49 molecules An additional level of regulation for receptor acquisition was suggested by studies illustrating that some Ly49 genes are expressed predominantly in a mono-allelic fashion. 46 Held et al. showed that most NK cells from (B6 x BALB/c) Fl hybrid mice expressed Ly49A from a single allele, inherited from either parental chromosome (Held et al. 1995). Further studies have shown that Ly49C and G are also expressed in a mono-allelic manner, and that expression of the respective alleles can occur from the same or the opposite chromosome (Held and Kunz 1998; Held et al. 1999a). Therefore, it is probable that the Ly49 receptor repertoire is generated by an allele-specific, stochastic process that acts on the entire gene cluster. Cis- and /raws-acting factors involved in NK receptor regulation It has been shown that Ly49 expression is normal in DNA recombination- deficient PvAG-1 mice, therefore, the regulation of Ly49 genes is, at least partly, transcriptionally controlled (Held et al. 1999a). However, little is known about the specific cis- and trans-acting factors involved in Ly49 gene regulation. To date, only the 5' promoter regions of Ly49a and / have been investigated (Gosselin et al. 2000; Kubo et al. 1993). Kubo and coworkers identified a 13 bp sequence in Ly49a called ELI3 (ATGACGAGGAGGA), which lies adjacent to the previously reported TATA-element (Kubo et al. 1999). Their analysis showed that the trans-acting factor ATF-2 binds to the ELI 3 motif and is likely responsible for Ly49a promoter activity in the T cell lymphoma line EL-4. The trans-acting factor TCF-1 has also been shown to play a role in Ly49a regulation. Held and colleagues have shown that TCF-1 binds to two consensus TCF- 1/LEF-l motifs upstream of the previously reported transcriptional start site of Ly49a, and is required for the acquisition of Ly49a by NK cells (Held et al. 1999b). As TCF-1 does not affect the expression of other Ly49 genes, such as Ly49c and i, it is likely that other trans-acting factors are involved in regulating the expression of individual or subsets of Ly49 genes. The promoter region of Ly49i has recently been published (Gosselin et al. 2000). A core TATA promoter was identified in Ly49i that is not conserved in the Ly49a gene, indicating that the transcriptional start sites for the two genes differ. In addition, a repressor element was identified upstream of the TATA box, and a 36 bp region of the core promoter was shown to form EL-4 and NK cell-specific DNA/protein complexes by 47 electrophoretic mobility shift assays. However the identity and function of these complexes in NK cells remains unknown (Gosselin et al. 2000). It is also possible that the Ly49 gene cluster is regulated at the chromosomal level by a locus control region, although there is no direct evidence to suggest that such a region exists. The complete sequence and functional analysis of the entire Ly49 gene complex will be required to answer this question. Clearly, much remains to be learned about how the Ly49 gene family is regulated at the DNA and protein level during NK cell development. Models for clonal heterogeneity in Ly49 expression A number of models have been put forth to explain the differential expression of Ly49 genes during development. One such model suggests that each Ly49 gene is controlled by a different trans-acting factor, each of which is limiting with respect to receptor acquisition (Fig. 1-8A). In this model, each trans-acting factor would be available at only certain times during development, which could account for the non- random sequential expression of different Ly49 genes. However, this model is probably not correct, as Ly49 genes are highly related and likely arose via gene duplication. A second model suggests that all Ly49 genes are controlled by a single set of collaborating trans-acting factors (Fig. 1-8B). The induction of distinct Ly49 genes during development would then be influenced by polymorphisms in the relevant cw-acting elements. A combination of the above models is more likely. In this final model, subsets of Ly49 genes are controlled by distinct ^raws-acting factors that are limiting (Fig. 1-8C) (Held et al. 1999a). Recent results showing that TCF-1 can regulate the acquisition of Ly49a, but not other Ly49 genes, is consistent with this possibility (Held et al. 1999b). Studies to identify additional cis- and trans-acting factors involved in the regulation of NK cell receptor genes will be necessary to distinguish between these possibilities. 48 maternal Chr. paternal Chr. maternal Chr. paternal Chr. maternal Chr. paternal Chr. Figure 1-8. Models of differential Ly49 expression. (A) Individual Ly49 genes are regulated by distinct trans-acting factors (diamonds and circles). (B) All Ly49 genes compete for a single trans-acting factor (circle) available at limiting concentrations. (C) Subsets of related Ly49 genes, such as Ly49a and g, axe regulated by the same trans-acting factor (squares) at limiting concentrations. Different Ly49 subsets are regulated by distinct factors (adapted from Held et al. 1999). 49 1.6 Thesis Objectives and Organization When I began my thesis project in 1995, cDNAs for only eight Ly49 genes, Ly49a-h, had been identified in B6 mice. Subsequently, a ninth Ly49 cDNA, Ly49i, was discovered (Brennan et al. 1996a; Sundback et al. 1996). Despite the availability of Ly49 cDNAs, genomic information regarding the organization of these Ly49 genes on mouse chromosome six was unknown. Therefore, the overall objective of my research was to better understand the genomic complexity of the Ly49 genes in the B6 mouse strain. More specifically, our goals were to determine the genomic organization of a subset of the Ly49 family, the Ly49c-related subfamily, as well as to identify and characterize new Ly49 genes. Chapter 2: The identification and localization of five new Ly49 genes, including three closely related to Ly49c The goal of this work was to determine the genomic organization of the Ly49c- related genes in B6 mice. We constructed a physical map consisting of two non- overlapping contigs spanning approximately 250 kb of the Ly49 cluster on mouse chromosome six. Using a combination of hybridization, PCR and sequencing techniques, we identified and localized five new Ly49 genes, Ly49j-n, in this region, including three genes that were closely related to Ly49c and belonged to the Ly49c-re\ated subfamily. This chapter has been published: K.L. McQueen, J.D. Freeman, F. Takei and D.L. Mager (1998) Localization of five new Ly49 genes, including three closely related to Ly49c. Immunogenetics 48: 174-183. Chapter 3: Expression analysis of the new Ly49c-related genes The primary focus of this chapter was to functionally characterize the newly described Ly49c-related genes, Ly49j, k and n. Full-length cDNAs were not identified for Ly49k and n, suggesting these genes encode non-functional molecules. Full-length cDNAs for Ly49j were detected, however, the majority of the transcripts identified lacked the transmembrane region. An analysis of the closely related Ly49c and i genes also revealed transmembrane-less transcripts for Ly49i, although the functional significance of this finding is still unknown. Finally, the functional characteristics of Ly49J are 50 described. This chapter has been published: K.L. McQueen, S. Lohwasser, F. Takei and D.L. Mager (1999) Expression analysis of new Ly49 genes: most transcripts of Ly49j lack the transmembrane domain. Immunogenetics 49(7-8): 685-691. Chapter 4: Functional analysis of 5' and 3' regions of the closely related Ly49c and j genes The aim of this final set of experiments was to investigate three regions of the closely related Ly49c and j genes to determine if they contained cw-acting elements involved in gene regulation. Luciferase reporter assays in the cell line EL-4 suggested that the 5' regions ofLy49c and j contained promoter and repressor elements. Interestingly, Ly49j also contained an active promoter in the first intron. Finally, comparisons of the 3' non-coding regions of Ly49c and j revealed that the sequence of Ly49j diverged completely from Ly49c in this region, resulting in a much longer 3' untranslated region. Therefore, internal promoters, repressors and 3' regions play a role in regulating Ly49 gene expression. This chapter has been published: K.L. McQueen, B.T. Wilhelm, F. Takei and D.L. Mager (2001) Functional analysis of 5' and 3' regions of the closely related Ly49c and j genes. Immunogenetics 52(3-4): 212-223. Chapter 5: Summary This chapter discusses how our results have contributed to the understanding of the complex nature of the Ly49 receptors, and suggests possible areas for future study. Chapter 2 Localization of five new Ly49 genes, including three closely related to Ly49c A paper of the same title by K.L. McQueen, J.D. Freeman, F. Takei and D.L. Mager has been published in Immunogenetics 48: 174-183 (1998). J. Douglas Freeman contributed to the restriction enzyme mapping and PI contig organization described in this chapter. This work is summarized in Figure 2-3. 52 2.1 Introduction Jack Brennan, a previous Ph.D. student in the Mager lab, performed hybridization analysis on B6 genomic DNA using a single exon probe derived from the cDNA encoding Ly49c and identified at least four hybridizing bands. Interestingly, this probe was known to cross-hybridize to the known Ly49h and i genes (Brennan et al. 1996a). This suggested that in addition to Ly49h and i, B6 mice contained a number of unidentified genes closely related to the Ly49c gene. This observation served as a starting point for my research. Preliminary research into this area also suggested that the genes closely related to Ly49c were highly polymorphic. Genomic southern blot analysis on various strains of mice using the Ly49c single exon probe revealed a complex hybridization pattern, where differences in the numbers as well as the sizes of hybridizing bands among various strains was observed (Takei et al. 1997) (discussed further in this chapter). Therefore, we undertook a study to isolate and localize the Ly49c-re\ated genes in B6 mice to clarify the organization of the Ly49 genes, and as a first step in understanding the genomic complexity of this family. For the purpose of my work, we have arbitrarily defined Ly49c-re\ated genes as a subset of the Ly49 gene family that share greater than 95% identity with Ly49c in the 3' region. 53 2.2 Materials and Methods 2.2.1 P1 Bacteriophage Library Screening and Isolation of P1 DNA PI genomic clones containing Ly49 genes were identified by screening a PI bacteriophage genomic library of B6 mouse DNA ligated into pAdlOSacBII (Resource Centre - Max Planck-Institute for Molecular Genetics, Berlin, Germany) using a combination of full-length cDNAs for Ly49A, Ly49B and Ly49G.4. The library filters were hybridized to 32P-labeled probes at 55°C and washed under low stringency conditions in 0.5 x standard sodium citrate (SSC), 1% sodium dodecyl sulfate (SDS) at 55°C. These conditions were designed to identify all the Ly49-containing genomic clones. Positive clones were grown and maxi-preparations of PI DNA were carried out using the Nucleobond AX500 kit (Clontech Laboratories Inc., Palo Alto, Calif.) as directed for low copy plasmids. Approximately 100 jag of DNA was obtained for each PI clone. 2.2.2 Probes and hybridizations A 118 base pair (bp) Xba I-Sst II fragment from the 3' end of the Ly49cBALB cDNA cloned into pBluescript-KS was used as the Ly49c-related probe. This region corresponds to exon seven of the Ly49c gene, which encodes for part of the CRD. An approximately 140 bp Kpn I-Sst I fragment derived from the 5' end of the Ly49aB6 cDNA cloned into pBluescript-KS was used as the Ly49a-specific probe. This region corresponds to exon 2 of the Ly49a gene, which codes for the cytoplasmic domain of the protein. The Ly49A exon 7 probe, used as part of the exon 7 combination probe, consisted of a 148 bp Ear I fragment of a 398 bp PCR fragment derived from the genomic clone U5 described previously (Wong et al. 1991), which is identical to the Ly49a gene. For genomic Southern analysis, 5 ug of DNA derived from various mouse strains (Jackson Laboratories, Bar Harbour, MA) was digested and electrophoresed on 0.8% agarose gels. DNA was transferred onto Zeta-probe GT nylon membrane (Bio Rad, Richmond, Calif.) using the alkaline blotting method (Reed and Mann 1985). Probes labelled with 32P were hybridized to Southern blots overnight at 65°C as described 54 previously (Mager and Goodchild 1989). Stringent washing was performed in 0.1 x SSC, l%SDSat65°C. For PI clone hybridizations, one ug of PI clone DNA was digested and electrophoresed on 0.8% agarose gels. DNA was transferred onto nylon membranes using 20 x SSC, and hybridized in standard conditions. Stringent washing in 0.5 x SSC, 1% SDS at 65°C was performed when the 32P-labeled Ly49c-related probe was used. Less stringent hybridization and washing at 55°C in 3 x SSC, 1% SDS was used when the combination Ly49a exon7/Ly49c-related probe was used to localize the position of exon 7 from all the Ly49 genes on the PI clones. This combination probe was also hybridized to a DNA panel of all known Ly49 cDNAs to confirm that it bound to every Ly49 gene (data not shown). Oligonucleotide probes specific for each known Ly49 cDNA were synthesized (PE Biosystems - model 391, Foster City, Calif.) so that each had a melting temperature of 68°C (Table 2-1). Probes were 32P-end labelled using terminal transferase as instructed (Life Technologies, Burlington, ON, Canada), and hybridized at 63°C to Southern blots of the PI clones (wash of 10 minutes at room temperature in 3 x' SSC, 1% SDS). Southern blots were stripped of probe between hybridizations by washing in boiling 0.1 x SSC, 0.1% SDS for five minutes, and autoradiography performed to ensure all radioactive probe had been removed. All oligonucleotide probes were also hybridized to a DNA panel of all known Ly49 cDNAs to confirm that each probe bound only to its corresponding cDNA (data not shown). 2.2.3 P1 clone Restriction Enzyme Mapping Individual PI genomic clones were initially digested with the restriction enzymes Not I and Sal I to isolate the DNA insert from the PI vector. The DNA inserts were then digested with a variety of restriction enzymes. Single and double digests of each useful enzyme were performed on DNA from each PI clone, and alkaline transfers were carried out onto Zeta-probe nylon membranes with 20 x SSC. 32P-end labelled Sp6 and TV- specific oligonucleotides were hybridized to the Southern blots to identify the vector ends for each genomic insert. The sizes of the bands for each digest were determined, and a restriction enzyme map for each PI clone was constructed. 55 Table 2-1. Nucleotide sequences of Ly49 gene-specific oligonucleotide probes. Gene Oligonucleotide Sequence Exon A 5 '-GATCAACAAAAAAAACTGCAGGAATTC-3' 4 B 5 '-CTCCGTCAAGAGTACCAGGTCA-3' 4 C 5' - AAGC AATGAAACTCTGG AATAT ATCA-3' 4 D 5' -CAAGGAGAC ACGGAAGCCCTGAA-3' 2 E 5' -GATTGC AGTCCAGGTGAGGAAC-3' 4 F 5' -TAGGTCTATAGACTCTAGGCC AGG-3' 4 G 5'-ACGATAACTGCAGCCCCACGC-3' 4 H 5' -TTGAACAGCC AGGTGAGACTTGA-3' 2 I 5%C AATGA AACTCTC AACCACTACCAT-3' 4 56 2.2.4 Exon PCR, Subcloning, and Sequencing Consensus PCR primers were designed corresponding to sequences located at the beginning and end of exons 2, 4 and 7. The sequence of Ly49b was not taken into consideration as hybridizations revealed that the Ly49b gene was not contained within our panel of PI clones (data not shown). The restriction enzyme Eco RI was added to the 5' end of each primer to aid in subcloning. The sequences (minus the added cloning site) of the oligonucleotides used are as follows: exon 2, 5' -CCRMRATGA VTGARCMRGA- 3' and 5'-TKWDGCVARCTTYTYYRG-3'; exon 4, 5'- agTTTTTCAGYATRRTCAACA-3' and 5' -acCTGTGTSYYGTRARKAATCT-3'; exon 7, 5'-cagTGMCWTGAAMAYAAVGAAA-3' and 5'- CTTTWACWCTVDYTGGARARTYAA-3', where R=A,G; M=A,C; V=A,C,G; K=G,T; W=A,T; D=A,G,T; Y=C,T; S=C,G. Lower case letters represent intron sequences. Approximately 100 ng of PI DNA was added to a 50 ul reaction mixture containing 75mM MgCb, 2.5mM each of four deoxyribonucleoside triphosphates, 30 pmol of each PCR primer, and 2.5 units of Taq polymerase (Life Technologies). 30 cycles in an Ericomp thermocycler were carried out as follows: 30 s denaturation at 94°C; 30 s annealing at 45°C for exon 2 primers, or 51°C for exon 4 and 7 primers; and 60 s extension at 72°C. This was followed by a seven min extension at 72°C. PCR products ranging in size from 100-240 bp were phenol/chloroform purified and ethanol precipitated, then digested with Eco RI, and subcloned into the Eco RI site of pBluescript-KS. Plasmid DNA to be used for 35S sequencing was prepared using a modified mini-alkaline-lysis procedure, and sequencing of each single exon was carried out using the Perkin Elmer Amplicycle kit as directed (PE Biosystems). All the PCR- derived sequences described in this paper were obtained in at least two independent PCR- subcloning experiments, or from two different overlapping PI clone DNA templates, unless otherwise stated. 57 2.3 Results 2.3.1 Complexity of Ly49c-related genes in C57BL/6 mice To begin our genomic analysis of genes related to Ly49c, Southern blot analysis was performed on Eco RI digested genomic DNA derived from different mouse strains using the Ly49c-related probe (Fig.2-1 A). The 3' region of the CRD (exon 7) of the Ly49cBALB gene was chosen as the probe since this region is least homologous to other members of the Ly49 family, and hybridization studies have shown that it recognizes Ly49c, h and i under the stringent hybridization conditions used, but does not detect any of the other known Ly49 cDNAs (data not shown). Results of this experiment reveal remarkable variation in the banding patterns observed (Fig. 2-1 A). It is likely that each band on the Southern blot represents at least one gene as there is no EcoRl site present within the region used as the probe. Therefore, differences in both the number and size of the hybridizing bands indicate that multiple genomic patterns of Ly49c-related genes exist in the mouse. This finding is in marked contrast to Southern blot analysis performed on the same genomic DNA panel using a probe specific for Ly49a under the same hybridization conditions. Only one hybridizing fragment is observed in each strain and there is much less variation in fragment size (Fig. 2-IB). This analysis indicates that the Ly49c-re\ated genes are a highly complex and polymorphic subset of the Ly49 gene family. Hybridization of B6 and BALB/c genomic DNA digested with various restriction enzymes using the Ly49c-related probe revealed the presence of four or five hybridizing bands in B6 (Fig. 2-1C). Again, it is likely that each band represents at least one gene, as sites for the restriction enzymes used to digest the DNA are not found within the probe. This analysis suggests that B6 mice contain at least five distinct loci related to the Ly49c gene. One or two hybridizing bands were observed when BALB/c genomic DNA was digested with various enzymes, indicating the presence of fewer Ly49c-related genes in this mouse strain. 58 •o 9/18ZSo/aivDa I ^ c B Hi n CO C *•> a/aiva fa o _ 9/iazso o o 8^ Q o a § o/aiva C o 9/18ZS3 "LB bo o a 38/AMS § J i 3 C C CD « C S73 5 -a 39/yDI = • S 4^ "S 1/1 oaeoD/aiva « 8 13 O snu JAB iLjosod 3 a a v a 1 ^ y, •* r/a/v\s -a 11 u o —' a ^4 4= > +» Hi 3 S r/dy it 3 1 O . N >iy/aiow i • fN Q snjajds ~w i Mi 1 i 4» .2 S 8 § !3/!l H03Z0 > S * I3/1SV3 I s, I ^ o c Tpo/yazsD 1 I • -5 o ac3 3/aiva ; I ' 9/13ZSD i-O o to 59 2.3.2 Isolation and mapping of P1 clone DNA Nineteen PI genomic clones were identified by screening a PI bacteriophage genomic library derived from B6 with a mixed Ly49 probe, however four clones would not grow and were not analyzed further in this study. The remaining fifteen clones were hybridized to the exon 7 Ly49c-related probe, and it was found that eight of the fifteen were positive under stringent conditions. (It was later determined that a ninth clone, E55, also contained the 5' portion of Ly49c. Please note that PI clone names in the text have been abbreviated - full clone names are present in the legend to Fig. 2-2). When Southern blot analysis was performed on the original eight PI clones digested with Eco RI or Hind III using the Ly49c-related probe, five or six hybridizing bands, respectively, were observed (Fig. 2-2). The sizes of the bands match those seen when genomic Southern blot analysis with this probe is performed on DNA derived from B6 mice (Fig. 2-1C). Therefore, these genomic clones appear to contain at least five Ly49c-related genes. When Southern blot analysis was performed on this same panel of PI clones using an exon 7-combination probe designed to identify all the known Ly49 cDNAs, additional hybridizing bands were observed (data not shown). This suggests that some of the PI clones contain more than one Ly49 gene. For example, PI clone C81 appears to contain one Ly49c-re\ated gene, and at least one gene more closely related to Ly49a. These results were confirmed as described below. Restriction enzyme maps of the ten PI clones believed to contain at least five of the Ly49c-re\ated genes were constructed by analyzing single and double digests of the enzymes Cla I, Kpn I, Nhe I, Sal I, Sma I and Xho I. In this manner it was determined that clones Ol 1, M83, A10 and F59 formed a contig approximately 140 kb in length, and K98, C81, K19 and E55 formed a 165 kb contig. These two contigs, labelled 1 and 2 respectively, are not joined together by any of the PI clones analyzed in detail in this study. Restriction site analysis indicated clone A27, which also contains an Ly49c- related gene, does not overlap with either contig 1 or 2. A27 is only 40 kb in length, while DNA inserts from the other mapped clones ranged from 60 to 80 kb, suggesting 60 EcoRI Hindi 11 I 1 i t- CD O CO 00 CD N- 00 «— O O rj) ootDr^-oo CO r- i— in 00 i— N kb Figure 2-2. Southern blot analysis of eight PI clones, digested with EcoRI or Hindlll, and hybridized to the Ly49c-related probe under stringent conditions. One day exposure. Sizes of the hybridizing bands match those seen when B6 genomic DNA is digested with these same enzymes and hybridized to the same probe (Fig. 2-1C). PI clone names have been abbreviated in this chapter. Full PI clone names are as follows: ICRFP703C07281 (C81), ICRFP703K12319, (K19) ICRFP703A23110 (A10), ICRFP703F0259 (F59), ICRFP703M13183 (M83), ICRFP703N0716 (N16), ICRFP703A23227 (A27), ICRFP703K12198 (K98), and ICRFP703E15255 (E55). 61 that A27 may have rearranged. However, it is unlikely that a rearrangement has occurred in the 3' region of the gene because the same size restriction fragment was detected when genomic DNA is hybridized to the Ly49c-related probe (Fig. 2-1C, 2-2). Although it is possible that a rearrangement could have occurred at the 5' end of this gene, the sequence obtained from this gene differs from any known Ly49 gene (see below), making this unlikely. Also, preliminary analysis suggested that N16, a small PI clone identified in the original screening process, had rearranged and so was not analyzed further. An end cloning strategy was carried out to attempt to identify overlaps between individual clones. However, most end fragments contained either highly repetitive DNA, or part of an Ly49 gene and so were not useful for mapping analysis. 2.3.3 Gene Localization Hybridization and mapping studies were performed to determine the location of each of the known and potentially new Ly49 gene sequences within the PI clones. Southern blot analysis was carried out on the PI clones using oligonucleotide probes specific for each previously known Ly49 gene (Table 2-1) to localize each gene to a restriction fragment. The genomic fragments containing the Ly49a, c, and / genes were identified in this manner, while probes for Ly49b, d, e,f,g and h did not hybridize to this set of PI clones. Ly49c exon 4 is located in a 22 kb Cla I-Sal I fragment of contig 2, and the Ly49a gene is found on E55. Exon 4 of Ly49i was found in the 16.4 kb Nhe I-Kpn I fragment of M83, F59 and A10. Figure 2-3 shows the approximate location of these genes with respect to the various restriction sites. The restriction enzyme fragments containing the exon 7 sequences derived from all the different genes present in the contigs were identified by hybridization of the PI clones to a combination exon 7 probe under conditions designed to identify all the Ly49 genes (Fig. 2-3 and data not shown). Four genomic fragments on contig 1 and four fragments on contig 2 hybridized to this probe indicating that each contig contains several distinct Ly49 genes, while clone A27 appears to contain only one gene. These hybridization and mapping results and the sequence data to be described below indicate the presence of ten distinct Ly49 genes within this set of PI clones (Fig. 2-3). Five of these sequences were identified as the Ly49a and g genes, as well as three of the known 62 in m LLI <0 l=§ 7= 03 CO — o cn Q. E To 5 « z co co X O oo 5 O 00 CM O <° O o CM CD C CN h=°f> CN o 2 < , 00 < 2 S31 o ^1 i .-i> c O O a> o MB g ta 0X1 w 63 Ly49c-re\ated genes c, h and i. Four new genes, termed Ly49j, I, m and n, have been localized to contigs 1 and 2, and one new gene, Ly49k, to clone A27. Interestingly, hybridization data suggest that the Ly49n and k genes are somewhat smaller (-15-16 kb) than the Ly49a gene, the only gene in this family for which the size has been determined (Kuboetal. 1993). 2.3.4 Sequence Analysis To help determine which Ly49 genes were located in each PI clone and to gain information concerning the putative new Ly49 genes, sequence analysis of selected regions was performed. To do this, consensus PCR primers were designed from exons 2, 4 and 7 so that all the Ly49 genes present within each PI clone would be amplified. PCR was performed on each PI clone, and products were subcloned into pBluescript-KS. Since most PI clones contained more than oneLy49 gene, multiple positive subclones were isolated and sequenced from each clone to ensure each gene segment was represented. The sequence information derived from each clone was compared to sequences from the Ly49 cDNAs known at that time (Ly49AB6, ABALB, B, CB6, CBALB, C129, CNZB, DB6, EB6, FB6, GB6, GBALB, H, and I86) using the FASTA search program. In this manner it was determined if the PCR-derived sequence corresponded to a known Ly49 gene or if it represented part of a new sequence. It should be noted however, that this PCR-based sequencing approach could miss some new genes if they did not amplify well, and could be the cause of the lack of exon 2 and exon 4 sequence information for the Ly49m and / genes, respectively (see below). Sequence obtained from each potentially new gene was confirmed by determining the sequence from more than one overlapping clone, or by performing independent PCR-subcloning experiments. Exon 2: Exon 2 PCR-derived sequences (Fig. 2-4) confirmed that contig 2 contained several distinct Ly49 genes. Sequence identical to the Ly49c gene was obtained from PI clones K19 and C81. A sequence that had two mismatches with Ly49cB6, derived from Ly49j, was identified in K98 and C81 (7 independent clones), and a sequence similar to the Ly49dB6 gene, from Ly49l, was also discovered in K98 (6 clones from two independent PCR-subcloning experiments). Exon 2 sequences identical to the Ly49h (derived from Ly49h and n) and i genes were obtained from contig 1. Also, the 64 u u u o o CJ u u u u § 2 § 3 3 OCD0UUUOO ~~ " u u o o o H EH ^ EH EH EH EH H EH H J2 £ 2 g g O -2 —i 8\g ^ S .2 1/3 oT> C/3 SS S5 o -n -H « .q J< i-i 'a O "r^ "H R JH ^ ^ rg 111!L 11T, N 1_ J 1 J 1_ "O .S C S3 2 § .§ a S CM « CN o X UJ (50 « 65 novel Ly49k gene in PI clone A27 contained a sequence highly similar, yet distinct from Ly49h. Additional genomic PCR-sequencing experiments on this clone using primers that spanned intron two determined the sequence corresponding to the entire second exon of this gene, including the 5' untranslated region (UTR), and the entire coding sequence (data not shown). Exon 4: Exon 4 PCR-derived sequences were obtained from seven distinct genes (Fig. 2-5). Sequences corresponding to the known Ly49c-related genes c, h and i were found in C81 and K19 from contig 2 (Ly49c), and in 011 (Ly49h) and F59 (Ly49i) from contig 1. A sequence similar to Ly49gB6, but with 12 mismatches and three extra base pairs, was discovered in C81, however this sequence, presumably from the Ly49m gene, was found only once and has not yet been verified. An exon 4 sequence from the Ly49j gene with two mismatches to Ly49cmB was found in 25 clones from multiple PCR- subcloning experiments in K98, C81 and K19. It should be noted that the published Ly49c gene from NZB (Stoneman et al. 1995) is actually more similar to Ly49i. In addition, three clones from the Ly49k gene in clone A27 contained a sequence with 10 mismatches to the previously published Ly49h gene, which was derived from a hybrid mouse strain (Wong et al. 1991). Three clones from F59 and M83 contained a sequence, from the gene we have assigned Ly49n, which is most similar to the Ly49h gene, but with five mismatches. Exon7: Exon 7 sequences (Fig. 2-6) corresponding to Ly49a, c, h and / were found in clones E55 (Ly49a), K98 and C81 (Ly49c), or Ol 1 (Ly49h), F59 and A10 (Ly49i). A sequence with one mismatch to the Ly49gBALB gene, from the Ly49m gene, was found in multiple clones derived from K98, C81 and K19, while three clones obtained from two separate PCR reactions from K98 identified a sequence, derived from Ly49j, with one mismatch to Ly49i. Multiple clones from different PCR reactions using K98 as a template also identified a sequence, from Ly49l, with eight mismatches to Ly49d, and an exon 7 sequence identical to Ly49i was isolated from the Ly49k gene in A27. Three clones from F59 and M83 identified a sequence, the putative Ly49n gene, with five mismatches to the previously published Ly49h (Wong et al. 1991). In addition, a sequence identical to Ly49g was found in AlO and M83, and is believed to be located at 66 the end of the clone so that only the 3' region of the gene is present. Taken together, the sequence data confirms the gene location and order shown in Figure 2-3. 67 HHBHEHHHHHEH UUUCJCJCJCJCJCJCJ CJUCJCJUCJCJCJCJCJ i/lCJCJCJCJCJCJCJCJCjO o • • n> • • o • • CDCDCDCDCDCDCDCDCDCD CDCDCDCDCDCDCDCDCDCD CDCDCDCDCDCDCDCDCDCD 6656666666 HHE J L &&&&&&&&&& J L j 13 CQ J2 m ^ o S5 Z o X 111 68 o ri3 rf3 rij rij ri3 oooooooooooo in O O O O O O o o o o o o oooooooooooo EHEHEHEHEHEHEHEHEHEHEHH i i i I i i UUUUUUUUUEHEHO ££££££ <<;<<<;< u o o o o o u u u u u u <<<<<< O O O B 8 D 3 3 3 3:' ' O (J O O B t) <<<<;<< U U U U I OOOUOUOOOOOO 3 3 3 « EH 3 o o u u u u o U o u o u EH EH EH O U 0 O33333333333 Cfl o QUO C3 O O O 3O B B u o o B EH EH EH 3 3 O o a o E-iE-^E-iE-iE-iE-iE-iE-iE-i EH EH H EH EH EH EH EH EH UUUCJUUUUU o a O O O O O U O EH EH EH EH EH EH a a o EH EH EH S3S3S3S3S3S3S3S3S3 " EH EH EH EH EH EH EH EH EH EH EH S3 S3 S3 EH EH EH S3 & &6! 6&! &S 3 S3 S3 <<<<<<<<< EH EH EH EH EH EH EHEHEHEHEHEHEHEHEEH EH EH EH H O O o o o o DODO EH EH H EH u o U H EH EH EH EH EH EH EH EH EH EH EH EH EH EH S3 S3 S3 S3 EH EH EH EH EH EH U O u u U U U U < < < < O O o a O O £ S3 & £ o o EH EH EH EH & S3 S3 S3 S3 S3 u u O O O -u E-i EH < EH EH EH EH EH EH EH ££££ O O O O O O o o o o u u S3 S3 & & S3 S3 & 61 & & U U U U U < < < < S3 S3 S3 S3 < < < < U U U EH og o ij 5 U U U U U U EH EH EH Q S3 S3 S3 B 3 <3 3< 3< 3< EH H 3 8 S H EH EH EH EH EH <<<<<< < < < EH EH EH EH U U QUO < o <<<<<< . 333 OOOBB*i 3 O O EH H EH H EH EH EH o 3 a a u S3 S3 S3 <<<<<< S3 S3 S3 & S3 3 3 3 3 3 3 8 m EH EH EH EH H H EH EH EH EH EH EH EH < < < < < < < < < < < U U U U U U < < < o o o u o H o O O O O O EH O O O U EH EH EH EH EH EH S S3 o u o u o o o EH EH EH EH EH EH EH EH EH EH EH EOH EH EH EH H EH S2 53 S3 EH EH EH EH EH EH EH O O O O O O < < < o o o u o < < < < u id EH EH EH EH EH U u U U U U u U U U U U 3 3 Si rfjo riio oS i rfi< i U u U U U U u U u U U U EH EH El EJ El EH EH EH U u U U u U u U EH U U u EH EH <<<<<< EH EH EH EH EH EH EH EH EH EH EH EH EH EH H H H H H H EH EH EH EH EH EH EH EH EH EH EH EH 33333333333 . . .33 . EH EH EH 4J U u u o o u o 3 3 3 3 3 3 < < < . < • 1 * « * « •H A! •r-> M T) IB •H J< •l-N 0 6 •H J< 5 tn bN H IB ON ON ON ON ON ON 0> o> ON ON 0\ B ON ON ON ON ON ON o> ON ON ON ON ON ON ON ON ON ON o> 0> ON ON ON ON ON ON >»i M" TJi TJi ^ 1" ^« ^" ^ 1> 1< V xji TJI ^ 1* X N is >, >N i>. X >N X X ^1 ^ ^ ^ ^ •4 1-H ^ >4 ^1 •*H •*H ^ ^ ^H ^ tH ^ l-H 1 II 1 1 1 1 1 1 1 1 1 11 1 1 IL _l 1 11 1 CQ z 0 X ON LU fN 'J-J 3 U 69 2.4 Discussion While this study was underway, Brown and coworkers (1997a) published a large- scale yeast artificial chromosome (YAC) physical map of the natural killer gene complex, including the localization of most known Ly49 genes. In this study, we have produced a refined smaller scale physical map that corroborates and extends their findings. The Ly49a, c, h and part of the g genes are found in the same order on our PI clones as that presented by Brown et al. (1997a) (Fig. 2-3). However, our work identified and localized five new gene sequences, Ly49j-n. Three of these sequences, Ly49j, k and n, represent the new Ly49c-re\ated genes identified by Southern blot analysis (Fig. 2-1C), while the other genes are new sequences more closely related to Ly49d and g that were identified as a consequence of our search for genes closely related to Ly49c. The nucleotide sequences of the five potentially new genes corresponding to exons 2, 4 and 7 [based on intron-exon boundaries described for Ly49a (Kubo et al. 1993)], were determined and found to lack premature stop codons or frame shifts, suggesting that they may encode functional proteins. However, the sequences of the entire genes were not determined in this analysis, and it was unknown if any of the genes were expressed. Studies to clarify the status of the new Ly49 genes will be described in Chapter 3. The Ly49n sequence is closely related to the Ly49h gene, being identical in exon 2 and differing by only five nucleotides in each of exons 4 and 7. The Ly49h cDNA was originally cloned from a (CBA x B6) Fl lung library (Wong et al. 1991), however, an identical cDNA from B6 NK cells was also reported by Silver et al. (1996). This indicates that the original Ly49h sequence is of B6 origin. Our Ly49n sequences were identified at least twice from independent PCR experiments, eliminating the possibility of sequencing or PCR-generated errors. These findings therefore indicate that Ly49n is distinct from Ly49h, and suggests that there are six Ly49c-re\ated genes in B6 mice, all of which have been localized in our study. The physical map published by Brown indicates that there is at least 60-100 kb between the Ly49c and Ly49g genes (Brown et al. 1997a). Information regarding Ly49 gene size has only been obtained for the Ly49a gene, and cloning studies revealed it was 18-20 kb in length (Kubo et al. 1993). cDNA sequence comparisons indicate that all the 70 known Ly49 genes have similar sized coding regions and limited comparisons of intron sequences reveal a high degree of similarity between genes (unpublished observations). Therefore, assuming that all the Ly49 genes are of a similar size, the -60-100 kb region on the previously published physical map could contain the three novel genes, Ly49j, I and m (Fig. 2-3). In addition, our study has placed the Ly49i gene, which was not localized by Brown et al. (1997a), next to the probable Ly49g gene. It is likely that we have now identified all Ly49 genes located in the region between Ly49h and Ly49a. A recent report has confirmed the relative order and transcriptional orientation of the Ly49 genes within the cluster. As mentioned in Chapter 1, Depatie and coworkers have recently published a sequence-ready BAC contig and physical map that spans the entire 1.2 Mb Ly49 gene cluster. In contrast to the previous mapping studies, the BAC contig localized all 14 Ly49 family members so far identified to the same physical map (Fig. 2-7). Exon amplification and direct BAC sequencing placed the newly described Ly49k gene on the map in close proximity to Ly49d and/(Depatie et al. 2000), whereas our efforts to link this member to the gene cluster were unsuccessful. In addition, the BAC contig has physically linked our PI clone contigs 1 and 2. This analysis also resolved the order of the Ly49d and/genes (Brown et al. 1997a), placing Ly49f centromeric to Ly49d (Depatie et al. 2000). Interestingly, the BAC contig indicates there is a greater gap between the Ly49h and n genes (-40 kb) than our results suggest. This difference has not yet been resolved. Finally, a consensus map for the Ly49 family has been proposed as follows: cen-Ly49e-Ly49f-Ly49d-Ly49k-new Ly49-Ly49h-Ly49n-Ly49i- Ly49g-Ly49l-Ly49j-Ly49m-Ly49c-Ly49a-Ly49b (Depatie et al. 2000). It is likely that there are several more unidentified Ly49 genes in B6 mice. For example, the -100 kb gap between Ly49e and f, or the -40 kb gap between Ly49k and n (Brown et al. 1997a; Depatie et al. 2000) may contain more Ly49 genes. Furthermore, Ly49b, which is divergent from the rest of the known Ly49 genes, has been mapped -750 kb distal to the rest of the Ly49 gene cluster (Brown et al. 1997a; Depatie et al. 2000). As the KIR genes have been shown to be very close together in the LRC (Martin et al. 2000; Wilson et al. 2000), it is likely that there will be no large gaps between the Ly49 EE KI to5*"1*?'' BE EZ «4 4SfM".-j GE IS tZ3 ^ 72 genes in the NKC. A search of the expressed sequence tag (EST) database for Ly49 genes identified several ESTs derived from B6 mouse cDNA that were not identical to any of the known Ly49 genes or to any of the new sequences described in this study. In addition, exon amplification studies performed by Depatie and colleagues (Depatie et al. 2000), and in the Mager lab (B.T. Wilhelm, unpublished observations) have indicated the presence of other Zy49-related sequences, likely in the gap between Ly49k and h, or Ly49e and/ However, these putative genes have not yet been localized, and it is unknown if they represent full-length sequences or gene fragments. Comparisons of different mouse strains revealed extensive variation in the numbers of Ly^Pc-related genes (Fig. 2-1 A). Such variation may also exist for other members of the Ly49 gene family, although Southern blot analysis suggests the presence of Ly49a is less variable (Fig. 2-IB). This variation in gene number and arrangement and the polymorphic nature of Ly49 makes it difficult in some cases to identify allelic forms of the same gene, and caution must be exercised in designating alleles versus distinct loci. Furthermore, the Southern analyses suggest that some of the genes arose by duplications or rearrangements that are specific to a particular strain, as may well be the case for the Ly49o and p genes recently described in the inbred strain 129/J (Makrigiannis et al. 1999). In such cases, true allelic forms will not exist in other strains. Results of this study also reveal that the Ly49c-related genes are not present in a homogenous cluster within the B6 genome, as has been speculated for such genes in the rat. Genes identified via hybridization with an Ly49c probe are located in a cluster at the telomeric end of the rat NK cell gene complex (Dissen et al. 1996), whereas the mouse Ly49c-re\ated genes in B6 are intermixed with other, more distantly related members of the Ly49 family (Fig. 2-3). As discussed in Chapter 1, the mechanism by which inhibitory receptors such as mouse Ly49A prevent NK cell cytotoxicity includes tyrosine phosphorylation of a conserved ITIM present in the cytoplasmic tail of the protein, followed by the association of the tyrosine phosphatase SHP-1 (Leibson 1997). In Ly49 proteins, the consensus sequence of the ITIM has been shown to be VxYxxV. The inhibitory receptors Ly49A, C and G all share this motif, whereas Ly49D, a proposed activating receptor, lacks this motif (Mason et al. 1996), as does Ly49H (Table 2-2). It has recently been determined 73 Table 2-2. The presence or absence of an ITIM in the known and new Ly49 molecules. Ly49s containing ITIMs Ly49s lacking ITIMs genes amino acid sequence genes amino acid sequence Ly49A VTYSMV Ly49D DTFSAV Ly49B VTYTTL Ly49H VTFPTM Ly49C VTYSTV Ly49K VAFPTM Ly49E VTYSTV Ly49L VTFSAV Ly49F VTYSTV Ly49N VTFPTM Ly49G VTYSTV Ly49I VTYSTV Ly49J VTYSTV Ly49M N/A consensus motif VxYxxV • 74 that these proteins act in an activating manner (Gosselin et al. 1999; Nakamura et al. 1999; Smith et al. 1998). Interestingly, amino acid translations of the new Ly49 sequences reported here revealed the absence of a tyrosine residue within the ITIM of the Ly49l, k and n genes (Table 2-2). Therefore, it is tempting to speculate that these genes encode potential activating receptors. The identification of full-length cDNA sequences of each gene, followed by functional studies will be needed to investigate this further. Indeed, a full-length cDNA sequence for the Ly49l gene has recently been described in CBA/J mice, and the gene appears to encode an activating receptor (Makrigiannis et al. 2000). This study has detected five possible novel Ly49 genes, three of which are closely related to Ly49c. The analysis of the protein products of these genes will reveal whether they function as inhibitory receptors specific for MHC molecules, or play a different role in target cell recognition. Therefore, our next objective was to identify full-length cDNAs and to functionally characterize the new Ly49c-related genes. These experiments will be described in Chapter 3. 75 Chapter 3 Expression analysis of the new Ly49c-re\ated genes A paper by K.L. McQueen, S. Lohwasser, F. Takei and D.L. Mager entitled 'Expression analysis of new Ly49 genes: most transcripts of Ly49j lack the transmembrane domain' has been published in Immunogenetics 49: 685-691 (1999). 76 3.11ntroduction As discussed in Chapter 1, NK cells are a subpopulation of lymphocytes that have been shown to kill certain tumor and virally infected cells, but not normal cells. Unlike T cells, NK cells do not require expression of MHC class I molecules on the surface of a target cell to initiate a cytotoxic response (Trinchieri 1989). In fact, it has been demonstrated that the expression of certain MHC class I molecules is protective against NK cell mediated lysis (Karre et al. 1986). It has now been shown that receptors on the surface of NK cells interact with specific MHC class I molecules on target cells and are responsible for inhibiting NK cell lytic function (Lanier 1997). To explain how NK cells are able to distinguish between self and non-self, it was proposed that every NK cell must express at least one inhibitory receptor able to recognize self-MHC class I molecules (Ljunggren and Karre 1990). However, the mouse inhibitory receptors known to date do not provide a sufficiently wide repertoire of ligand specificities or distribution among NK cell subsets to prevent NK cell self-reactivity. For example, Ly49A and G from B6 mice (H2b) have been shown to recognize foreign MHC (H2d) (Karlhofer et al. 1992; Mason et al. 1995), while only Ly49C (Brennan et al. 1994; Brennan et al. 1996b; Yu et al. 1996), and Ly49I (Hanke et al. 1999; Lian et al. 1999), interact with self-MHC. However, Ly49C and I are expressed on less than 50% of NK cell subsets (Brennan et al. 1994; Yu et al. 1996), therefore it is likely that additional molecules function as inhibitory receptors specific for self-MHC. Since Ly49C is known to prevent NK cells from becoming self- reactive, it is possible that other genes closely related to Ly49C may also mediate this interaction. Previous work described in Chapter 2 used PI bacteriophage genomic clones to identify exon 2, 4 and 7 sequences for five new Ly49 genes, three of which belonged to the Ly49c-re\ated subfamily, namely Ly49j, k and n. Of these newly identified genes, Ly49j is very similar to Ly49c, and the Ly49k and n genes are most closely related to Ly49h. However, that study did not examine the possible expression of these genes. In this chapter, our expression analysis of Ly49j, k and n will be described. We chose to focus on the Ly49c-re\ated genes in this study, however, other groups have investigated the possible expression of the new Ly49l and m genes, and their results will be discussed below. 77 3.2 Materials and Methods 3.2.1 Preparation of NK cell cDNA Total cellular RNA from B6 interleukin-2 activated NK cells (75% NK1.1+) was prepared using Trizol Reagent as directed (Life Technologies). Synthesis of first-strand cDNA was carried out using Ready-to-go You-Prime First-Strand beads (Amersham Pharmacia Biotech, Baie d'Urfe, PQ.) with random primers. 3.2.2 PCR reactions Ly49 transcripts were amplified using the following gene-specific primers: Ly49c sense primer 5'-TCCCACGATGAGTGAGCCA and the antisense primer 5'- TACCTTTAACTCTAGTTGGAAAA; Ly49i sense primer 5'- GTCTTCAGGGTTGCAGAAAT and the antisense primer 5'- AGACTTTGTTCTTTAACTCTG; Ly49j sense primer 5'- GGTCACTTACTCAACTGTGAAT and the antisense primer 5'- GGGAATTTATCCAGTTTCTTCCA; Ly49k sense primer 5'- GATGGGTGAGCAGGAAGTCG and the antisense primer 5'- CCACAAATACAGTAGTAGGGAA; Ly49n sense primer 5'- TTCCCAACTATGAGATTCCAC and the antisense primer 5'- GCTTTAGATAAAAATAAACATCCTA. Eco RI restriction sites were added to the 5' end of the Ly49c- and /-specific primer pairs, while Cla I restriction sites were added to the 5' end of the Ly49j-, k-, and «-specific primers to facilitate subcloning into pBluescript. The PCR amplifications were carried out in a 50 uL reaction volume containing 20 ng NK cDNA, 300mM Tris-S04 (pH 9.1 @25°C), 90mM (NH4)2S04, lOmM MgSC«4 (Buffer B - Life Technologies), 2.5mM each of four deoxyribonucleoside triphosphates, 20 pmol of each PCR primer, and 1.5 units of Elongase (Life Technologies). Thirty-five cycles in an Ericomp thermocycler were carried out as follows: 30 s denaturation at 94°C; 30 s annealing at 59°C (Ly49C), 56°C (Ly49I), 62°C (Ly49J and K), 61°C (Ly49N); and 60 s extension at 68°C. This was followed by a seven min extension at 68°C. In order to design primer-pairs specific for each gene, the primers differ in length and in their position within exons 2 and 7. However, PCR conditions 78 were tested using all known Ly49 cDNAs as templates to confirm that the primer-pairs were specific for each gene (data not shown). PCR products were prepared as described previously in Chapter 2, section 2.3.4 and subcloned into pBluescript-KS. A complete full-length cDNA for Ly49j was produced by performing PCR using primers that extended the initial PCR products by adding 5' and 3' Ly49j sequence obtained from two subclones of the PI bacteriophage genomic clone K12198 described in Chapter 2 (Resource Centre). These subclones are known to contain only the 5' and 3' regions of the Ly49j gene, respectively (data not shown). Full-length Ly49j PCR was carried out in a 50 uL reaction volume containing 100 ng of exon 2-7 Ly49j cDNA, cloned Pfu polymerase reaction buffer (Stratagene, La Jolla, Calif), 2.5mM each of four deoxyribonucleoside triphosphates, 30 pmol of each primer, and 2.5 units of cloned Pfu polymerase (Stratagene). The sense primer 5'- ACGATGAGTGAGCTGGAGGTCACTTACTCAACTGTGAAT and the antisense primer 5' -TTAATCAGGGAATTTATCCAGTTTCTTCCAACAA were used. Primers contained Eco RI sites at the 5' end to facilitate subcloning. Twenty-five cycles in an Ericomp thermocycler were carried out as follows: denaturation of 45 s at 95°C; annealing of 45 s at 60°C; extension of 75 s at 72°C; followed by a 10 min extension at 72°C. 3.2.3 Sequencing The pBluescript SK primer 5'-TCTAGAACTAGTGGATC and KS primer 5'- CGAGGTCGACGGTATCG were used to sequence theLy49c, hand n subcloned transcripts. Sequence from the 5' and 3' ends of the Ly49j gene were obtained from subclones of Kl 2198 known to contain only the Ly49j gene, using the sequencing primers 5' -TTCTGTTGCCAGCTTCTC, and 5' -ATGAACTTTAAGTCTAGAGG, respectively. Sequence of the exon 3 splice donor and acceptor sites of Ly49c, i and j was obtained from PI subclones C07281, Ml3183 and Kl2319 (Resource Centre, described in chapter 2), known to contain exon 3 from each gene, respectively. The following sequencing primers were used: Ly49c, i and j exon 3 splice donor 5'- CAACTCATTGTGAAAGCTCTT and Ly49c, i and j exon 3 splice acceptor 5'- AAGAGCTTTCACAATGAGTTG. All sequencing was carried out using the ABI Prism 79 Big Dye Cycle Sequence Ready Reaction Kit (PE Biosystems) in an ABI automated DNA sequence machine (model 310). 3.2.4 Probes and hybridizations Bacterial colonies representing each Ly49c and / subcloned transcript were transferred onto Zeta-probe GT nylon membrane (Bio Rad) using the alkaline blotting method (Reed and Mann 1985). Hybridization analysis was performed using the P- terminal transferase (Life Technologies) end labeled oligonucleotide probe 5'- TTGGAATCCTCTGTTTCCTT at 46°C in 6x SSC, 0.5% SDS, lx Denhardt's (0.02 % each Ficoll, polyvinylpyrrolidone, bovine serum albumin fraction V). The membrane was washed for 10 minutes at room temperature in 3 x SSC, 1% SDS, and autoradiography was performed for four hours. 3.2.5 Ly49J expression cloning constructs The Ly49J-GFP fusion construct was generated by replacing exon 2 of Ly49j with the enhanced green fluorescent protein (GFP). PCR was performed using primers based on nucleotide sequences at the beginning and end of exons 3 and 7 of the Ly49j gene, respectively. The resulting cDNA was subcloned into pBluescript, sequenced and subcloned in-frame into the Kpn I-Bam HI site of the pEGFP-Cl vector (Clontech). A full-length Ly49j cDNA, beginning three nucleotides before the ATG start site and ending at the TAA stop codon, was cloned into the Sma I site of the expression vector PAX142 (Kay and Humphries 1991). DNA from the Ly49J-GFP fusion construct and the Ly49J-PAX142 expression vector was prepared using the Nucleobond AX500 DNA purification kit (Clontech). 3.2.6 Antibodies The mAbs 5E6 and 4L03311 have been described previously (Brennan et al. 1996a; Lemieux et al. 1991). The 8H7 and 1F8 mAbs were obtained from Dr. Vinay Kumar and were generated by immunization of rats with a Ly49I peptide (V. Kumar, personal communication). 80 3.2.7 Cell lines COS cells were cultured in Dulbecco's Modified Eagle's Medium (DMEM) supplemented with 5% fetal bovine serum, 100 units/mL penicillin, and 100 ug/mL streptomycin (Stem Cell Technologies, Vancouver, Canada). MHC class I-transfected RBL-1 cells were cultured in DMEM supplemented with 5% fetal bovine serum and 0.7 mg/ml Geneticin (G418 Sulfate) (Life Technologies), except for H2-Kk-transfected cells which were not cultured in the presence of Geneticin. 3.2.8 Transfections and flow cytometry Two ug of plasmid DNA was transfected into COS cells via the liposome- mediated Lipofectamine Reagent and cells were cultured as directed (Life Technologies). COS cells transfected with the pEGFP-Cl vector alone, and with the J-GFP fusion construct were stained with 1 ug propidium iodide and dead cells were gated out. The cells were analyzed on a FACScan (Becton Dickinson, Mississauga, ON). COS cells transfected with PAX142 alone, J-PAX142 and I-PAX142 were stained with 0.3 ug of the mAb 5E6, and 0.3 ug of the mAb 4L03311, incubated on ice for 30 minutes, then stained with a 1:50 dilution of fluorescein isothiocyanate (FITC)-conjugated goat-anti- mouse secondary antibody (Jackson ImmunoResearch Laboratories, Bar Harbor, MA). Transfected COS cells were also stained with a 1:100 dilution of the FITC-conjugated 8H7 mAb. Dead cells were gated out, and live cells were analyzed by flow cytometry. 3.2.9 Cell adhesion assay The binding of class I MHC-transfected RBL-1 cells to COS cells transfected with PAX142 alone, J-PAX142 and C-PAX142 was carried out as follows. After 24 h, transfected COS cells were trypsinized and 4.75 x 104 cells were transferred to 6 well plates (Falcon Labware, Oxnard, Calif). 48 h later, one ml of Hank's Balanced Salt Solution (HBSS) (Stem Cell Technologies) supplemented with 0.5 mg/ml heat inactivated bovine serum albumin (Sigma-Aldrich, St. Louis, MO) was added to the adherent layer of COS cells and incubated for one hour at 37°C. The cells were then washed twice, followed by an overlay of 106-107 cells/ml MHC-transfected RBL-1 cells. Cells were incubated for 10-15 min at room temperature, followed by five washes with HBSS supplemented with 2% fetal bovine serum. The adhesion of MHC-transfected PvBL-1 cells to Ly49-transfected COS cells was determined by observing the presence absence of cell aggregates. 82 3.3 Results and Discussion 3.3.1 Analysis of Ly49j, k and n cDNAs To determine if the Ly49j, k and n genes were transcribed and encoded functional proteins, we designed PCR primers from the available gene-specific exon 2 and 7 sequence data, as these exons contain the start and stop codons, respectively. PCR was then used to amplify cDNA clones for each gene from B6 NK cell cDNA. PCR products were shotgun subcloned into pBluescript and the inserts of at least 50 subclones for each gene were sized by gel electrophoresis. Numerous different sized PCR products were obtained for all three genes, and at least one product of each size was sequenced. For Ly49j, a full-length cDNA containing an open reading frame (ORF) similar to those found in other Ly49 family members was observed, in addition to numerous altered transcripts (Table 3-1). The full-length Ly49j transcript would encode a protein of 267 amino acids and shares 96-97% nucleotide, and 92-93% amino acid identity with the Ly49c and / genes (Fig. 3-1). As Ly49J contains an ITIM in exon 2, it likely encodes a functional inhibitory receptor capable of recognizing MHC class I molecules and transmitting a negative signal to the NK cell via interaction with tyrosine phosphatases, as has been shown for other ITIM-containing Ly49 molecules (Nakamura et al. 1997; Olceseetal. 1996). Interestingly, PCR products corresponding to full-length transcripts for the Ly49k and n genes were not obtained. All forms of the Ly49k and n transcripts that were detected contained insertions or deletions of sequence, and in some cases resulted in loss of an entire exon (Table 3-1). One alternatively spliced product of Ly49k lacked the first nine bp of exon 3, resulting in the removal of the amino acids valine-cysteine-serine, as has been reported for the Ly49d and h genes (Silver et al. 1996). It is likely that the altered transcripts of the Ly49k and n genes we detected do not produce functional proteins since all transcripts would result in a major truncation. However, it is possible that full-length transcripts of the Ly49k and n genes exist but are transcribed at very low levels, and could have been missed by the shotgun-cloning strategy employed in this study. 83 Table 3-1. Alternative splicing products observed for the Ly49g, h,j, k and n genes. Gene Alternative Splicing Result Ly49g No exon 3 Maintains reading frame Ly49h No exon 3 Maintains reading frame Ly49j - Full-length -Maintains frame - No exon 3 -Maintains frame - And/or insertions in exon 5 -Altered forms due to frameshifts Ly49k All transcripts contained stop codon - end of exon 4 Altered forms due to Plus - no exon 5 frameshifts - no exon 5 and 6 - no exon 5 and 6 and 7 - minus 9 bp at beginning of exon 3 (valine-cysteine-serine deletion) Ly49n All transcripts lacked exon 3 + first 7 bp of exon 4 Altered forms due to Plus - insertions and/or deletion in exon 5 frameshifts - no exon 5 and 6 - no exon 6 84 exon 2 exon 3 Ly49J MSELEVTYST VNLHKSSGLQ KLVRHEETQG PREAGNRKCS IYWQLIVKAL GILCFLLLVI Ly49I MnEpEVTYST VrLHKSSGLQ KLVRHEETQG PREAGNRKCS vsWQLIVKAL GILCFLLLVI Ly49C MSEpEVTYST VrLHKSSGLQ KLVRHEETQG PREvGNRKCS apWQLIVKAL GILCFLLLVt ^ exon 4 Ly49J VAVLAVKIFQ YSQHKQEINE TLNHHHNCSN MQRDFNLKEE MLTNKSIDCR PSNELLEYIK Ly49I VAVLtiKIFQ YSQHKQEINE TLNHyHNCSN MQsDFNLKEE MLTNKSIDCR PSNELLdYIK Ly49C VAVLAVKIFQ YnQHKQEINE TLNHHHNCSN MQRaFNLKEE MLTNKSIDCR PSNEtLEYIK ^ exon 5 Ly49J REQDRWNSET NTILDSSRDT GGGVKYWFCY STKCYYFIMN KTTWSGCKAN CQHYSVPIVK Ly49I REQDRWNSET kTvLDSSRDT GrGVKhWFCY gTKCYYFIMN KTTWSGCKAN CQHYSVPIVK Ly49C REQDRWdSkT kTvLDSSRDT GrGVKYWFCY STKCYYFIMN KTTWSGCKAN CQHYSVPI1K ^ exon 6 y exon 7 Ly49J IEDEDELKFL QRHVIPESYW IGLSYDKKKK EWAWIDNGPS KLDMKIRKMN FKSRGCVFLS Ly49I IEDEDELKFL QRHVIPESYW IGLSYDKKKK EWAWIDNGqS KLDMKtRKMN FKSRGCVFLS Ly49C IEDEDELKFL QRHVIPEnYW IGLSYDKKKK EWAWIDNGPS KLDMKIRKMN FKSRGCVFLS Ly49J KARIEDTDCN IPYYCICWKK LDKFPD* Ly49I KARIEDTDCN IPYYCICgKK LDKFPD* Ly49C KARIEDiDCN IPYYCICgKK LDKFPD* Figure 3-1. Amino acid sequence of the full-length Ly49J protein, compared to the closely related Ly49C and I proteins (Brennan et al. 1996; Stoneman et al. 1995). Bold uppercase text represents Ly49j sequence, bold lowercase text represents amino acid differences. The ITIM is boxed, putative intron-exon boundaries, based on cDNA sequence similarity to other Ly49 genes, are represented by arrows, and the transmembrane domain is underlined. The Genbank accession number for the Ly49j cDNA sequence is AF110492. 85 A full-length cDNA for the Ly49l gene has recently been identified in the inbred mouse strain CBA/J (Makrigiannis et al. 2000). Interestingly, a full-length Ly49l was not identified in the inbred strain B6, despite the presence of exon 2 and 7 sequence for this gene (Chapter 2). Also, full-length transcripts for Ly49m have not been reported, indicating that not all \ ALy49 genes identified within the B6 gene cluster encode functional proteins. Therefore, it is likely that the Ly49k, I, m and n sequences identified in B6 mice in this study represent the remnants of genes, or gene fragments that could possibly encode full-length transcripts in other mouse strains, as has been shown to be the case for Ly49l (Makrigiannis et al. 2000). Analysis of the Ly49 cluster in other mouse strains will be necessary in order to extend this finding. 3.3.2 Transcripts Lacking the Transmembrane Domain It was expected that amplification from NK cell cDNA using the Ly49j-specific primers would produce a single PCR product of 779 bp, representing a full-length transcript. However, when the PCR products were run on a gel and the size of 50 individual subcloned products was determined, multiple different sizes were observed (Fig. 3-2; data not shown). The most abundant transcript was only 689 bp in length, and sequence analysis revealed that it lacked exon 3. Interestingly, this splicing variant retains a long ORF and would encode a protein that lacks the transmembrane domain. This raised the question of whether other known Ly49 family members showed a similar degree and pattern of alternative splicing. To investigate this possibility, PCR was performed on the same preparation of NK cell cDNA using Ly49c- and /'-specific primers. Ly49c and /' were chosen due to their high sequence similarity to the Ly49j gene. In contrast to Ly49j, the most abundant product resulting from the Ly49c and /'-specific amplification was the size expected for a full-length transcript (Fig.3-2). Between 145-180 bacterial colonies each representing Ly49c and /' subcloned transcripts were transferred onto nylon membranes. Hybridization analysis was then performed using an oligonucleotide probe derived from a Ly49C/I consensus region in exon 3, to identify transcripts containing the transmembrane region. A similar hybridization procedure was carried out on 80 individual Ly49j colonies. 86 Ly49 200- Figure 3-2. Products from RT-PCR performed on total NK cell RNA using Ly49c-, i- andy-specific primers. The intense bands in the Ly49c and i lanes represent full-length forms of each gene expected with the primer combinations used (831 and 786-bp, respectively). The less intense bands represent transmembrane-less forms of the Ly49i gene (697-bp), as well as other aberrant transcripts. The bottom intense band in the Ly49j lane corresponds to the 689-bp transmembrane-less form, while the much less intense larger bands represent full-length and other aberrant transcripts, as determined by sequence analysis. Other less abundant transcripts for each gene were detected by the subcloning-sequencing strategy but are not visible on the gel. 87 Plasmid DNA of transcripts that did not hybridize to the oligonucleotide probe, as well as a random sampling of transcripts that hybridized to the exon 3 probe and were believed to be full-length were prepared using a modified mini-alkaline lysis procedure. The size of each transcript was then determined, and an estimate of the percentage of full-length versus alternatively spliced transcripts was derived. Representative subclones were sequenced. As illustrated in Table 3-2, forms lacking exon 3 for the Ly49c gene were not discovered, and the majority of Ly49c transcripts appeared to be full-length. A number of aberrant transcripts were also detected, but all contained exon 3. Transmembrane-less transcripts for Ly49i were found, but they occurred at a much lower frequency than for Ly49j. Results from independent PCR-subcloning experiments revealed that only 5-10% of the Ly49j transcripts were full-length, whereas greater than 80% appeared to lack the transmembrane domain. The fact that a difference in the proportion of full-length versus aberrant Ly49c, i and j transcripts was still observed when PCR was performed without template limitation and to saturation (35 cycles), suggests that these differences are significant. Other alternatively spliced forms of each gene were observed but were not abundant and if translated, would encode truncated proteins due to frameshifts (data not shown). Additional expression studies also revealed the presence of in-frame transmembrane-less forms of the Ly49g and h genes (Table 3-1), but the relative frequency of these forms has not been determined. Nonetheless, these results suggest that this type of alternative splicing may occur for many different Ly49 genes. To determine if there were any obvious nucleotide differences that could account for the variability in the frequency of full-length versus transmembrane-less expressed transcripts observed in our study, we compared the relevant splice junctions from the Ly49c, i and j genes. There were no nucleotide differences unique to Ly49j at the exon 3 splice junctions or at the exon 4 splice acceptor site. We did detect a nucleotide difference unique to Ly49j 34 bp upstream of the exon 3 splice acceptor site (Fig. 3-3). This region may function as a branchpoint sequence, which plays an important role in the splicing process (Green 1991), therefore this difference could affect splicing. However, it has been reported that branchpoint mutations do not abolish splicing, but allow it to occur through cryptic branchpoint sequences (Green 1991). So it is unclear if this 88 Table 3-2. Estimate of the frequency of full-length versus transmembrane-less transcripts of the Ly49c, i and j genes. Transcripts Ly49c Ly49i Ly49j Full-length > 95% > 80% 5-10% No transmembrane domain 0 10-15% 80% Other aberrant forms <5% 5-10% 5-10% 89 I- 1- -i—> -1—< •4—> 5« a) (a C a„ r- h- h- c CD CD CD < < < Q C/3 Sr 3 CD CD CD co I- I- h- O c a CD CD CD o aco o 03 03 03 T3 o O) O) CJ) <±> c 2 < < < aMu £ £ co o e b wo TO CO x M 8 J-3 u a CD CD CD ° s 03 03 03 CO CD CD CD < < it 3 ^ u 03 03 03 CO CO « 3 o Q_ 03 03 03 " S .S 03 03 r— S co §1 o -5 _ O " 43 0)0 0) ^- ^- >» >» > fa .2 2 90 nucleotide change is significant. Therefore this analysis does not reveal why exon 3 is preferentially skipped in Ly49j. 3.3.3 Protein Expression of Ly49J Although the Ly49j gene contains an ORF, it is possible that this gene does not encode a functional protein. To determine if the full-length Ly49j gene can be expressed as a protein on the cell surface, the cytoplasmic domain of Ly49J was tagged with GFP and transfected into COS cells. Flow cytometry was performed, and fluorescence of the Ly49J-GFP construct was detected, suggesting that Ly49J is expressed as a protein (data not shown). Ly49j cDNA was then cloned into the expression vector PAX142, and tested against mAbs known to recognize other Zy^Pc-related genes. Ly49J was not recognized by the mAbs 5E6 and 4L03311, which recognize Ly49C/I and Ly49C, respectively (Brennan et al. 1996a; Sundback et al. 1996; data not shown). This was not unexpected in light of studies that have identified critical residues involved in recognition of these mAbs (Lian et al. 1999). As illustrated in Fig 3-4, Ly49J was recognized by the mAb 8H7. The 8H7 antibody was generated in rats by immunization with a Ly49I peptide (V. Kumar, personal communication), however, it appears to cross-react with the Ly49j gene. Ly49J was also recognized by the mAb 1F8, which cross-reacts with Ly49C, H and I (data not shown). This suggests that Ly49j is expressed as a protein on the surface of NK cells, and may play a functional role in the cell. Preliminary cell adhesion studies of Ly49J-transfected COS cells to MHC class I-transfected RBL-1 cells have not yet determined the binding specificity of Ly49J, although only MHC haplotypes H2d and k were investigated. A more thorough search for the ligand of Ly49J is necessary. 3.3.4 Alternative Splicing of C-type Lectin Family Members Alternative splicing of various Ly49 genes has been described previously. Smith et al. (1994) reported the presence of three distinct transcripts for the Ly49g gene, and Silver et al. (1996) described "long" and "short" forms of the Ly49d and h genes with and without a three amino acid (valine-cysteine-serine) sequence at the splice junction of intron 2/exon 3. To our knowledge, we were the first to report exon-skipping resulting in transmembrane-less forms of genes in the Ly49 family. 91 CO 01ld-ZH8 en CO 92 However, other members of the C-type lectin superfamily that lack the transmembrane domain have been reported in the literature (Table 3-3). Cloning of the mouse NKR-P1 gene family revealed the presence of numerous alternatively spliced transcripts, most of which resulted in altered proteins due to frameshifts. However, one transcript was found that lacked the transmembrane domain, yet maintained its reading frame (Giorda and Trucco 1991). These splicing results were not quantitative, but it was believed that some of the transcripts were generated in large amounts (Giorda and Trucco 1991), similar to our results. Potentially functional transmembrane-less forms of the human MAFA gene, which has been shown to inhibit the FcsRI stimulation-induced mast cell secretory response (Bocek et al. 1997), and the B cell surface protein CD72 (Lyb-2) (Robinson et al. 1992), have also been reported. Further studies on mouse CD 72 revealed that the distribution of alternatively spliced forms varies in an allele-specific manner (Ying et al. 1995), similar to results obtained in our study where the distribution appears to vary between different Ly49 genes. As these C-type lectin molecules are type II inverted membrane proteins that lack an amino-terminal signal peptide, it is possible that mRNA forms lacking the transmembrane regions that maintain their reading frame are translated into putative cytoplasmic molecules. However, the function of such molecules remains unclear. It is interesting to speculate that isoforms of the Ly49 proteins that lack the transmembrane domain, and yet preserve the cytoplasmic and CRD, could serve an intracellular regulatory function. Ly49I and J contain an ITIM, which has been shown in other Ly49s to prevent NK cell cytotoxicity via association with the tyrosine phosphatase SHP-1 (Leibson 1997). It is possible that such soluble proteins could inhibit the functions of membrane-bound Ly49s by competing for SHP phosphatases. Studies to determine if a putative soluble form of Ly49J is localized to the cytoplasm, and whether it associates with SHP phosphatases have not been performed. In this chapter we have analyzed the types of transcripts produced from three new Ly49 genes. For Ly49k and n, the only transcripts detected would, if translated, encode severely truncated proteins. In contrast, we found Ly49j mRNAs that could encode transmembrane-less as well as full-length molecules. COS cells transfected with the full- 93 length Ly49j cDNA were shown to react with the mAbs 8H7 and 1F8, suggesting that this gene may have a functional role in NK cells. 94 Table 3-3. Members of the C-type lectin superfamily for which exon-skipping has been shown to create both membrane-bound and putative cytoplasmic protein isoforms. Molecule Cell Type Function Alternative Splicing Ly49 NK cells Mediate NK cytotoxicity - Removes exon 3 (maintains reading frame) - Other forms — insertion/deletions (altered forms due to frameshifts) NKR-Pl8 NK cells May activate NK cells - Removes exon 2 (maintains reading frame) - Other forms - insertions/deletions (altered forms due to frameshifts) MAFA5 Mast cells Inhibit FcsRI stimulation- - No exon 2 induced mast cell (maintains reading frame) secretory - No exon 2/3 response (altered form due to frameshift) CD72C B cells B cell proliferation and - No exon 3 (maintains frame) (Lyb-2) differentiation - No exon 3 and 4 (maintains frame) - No exon 4 (maintains frame) - Other forms - insertion/deletions aGiorda and Trucco 1991 bBoceketal. 1997 'Robinson et al. 1992; Ying et al. 1995 Chapter 4 Functional analysis of 5' and 3' regions of the closely related Ly49c and j genes A paper of the same title by K.L. McQueen, B.T. Wilhelm, F. Takei and D.L. Mager has been published in the journal Immunogenetics 52(3-4): 212-223 (2001). Brian T. Wilhelm contributed to sequencing the 3' end of intron 1 from Ly49a, and to the construction of the Ly49A intron 1 luciferase constructs. This work is summarized in Figures 4-4 and 4-5. 96 4.1 Introduction The Ly49 multigene family is located in a 420 kb gene cluster, with the exception of Ly49b, which lies -750 kb telomeric to the region (Brown et al. 1997a; Depatie et al. 2000). Ten Ly49 genes, Ly49a-j, have been shown to encode functional proteins in B6 mice (Brennan et al. 1994; Karlhofer et al. 1992; Smith et al. 1994), while some other Z,>>49-related sequences likely represent pseudogenes or remnants of genes that may be functional in other mouse strains, such as mouse Ly49l (Chapter 3) (Makrigiannis and Anderson 2000). Although much is known about the function of the Ly49 molecules, the regulation of these genes has been poorly defined. More specifically, many of the specific cis- and /raws-acting factors involved in Ly49 gene regulation have not yet been identified. To date, only the 5' promoter regions of Ly49a and i have been described (Gosselin et al. 2000; Kubo et al. 1993). Although the promoter regions of Ly49a and i share 71% sequence identity, the position of their putative TATA elements and the reported transcriptional start sites are not conserved, suggesting that Ly49 genes or gene subfamilies are regulated differently. The regulatory regions of additional Ly49 genes must be examined to help clarify this issue. As described in chapters 2 and 3, we identified the previously unknown gene, Ly49j, which is very closely related to Ly49c and i. Interestingly, the well characterized Ly49c and i genes have been shown to be expressed on ~50% and 35% of NK cells, respectively (Brennan et al. 1994; Kubota et al. 1999; Yu et al. 1996). In contrast, single NK cell reverse transcriptase (RT)-PCR analysis has revealed that Ly49J is expressed on only -5-8% of NK cells (Kubota et al. 1999; unpublished data). Before it can be determined why Ly49C and J are expressed on a different proportion of NK cells, a better understanding of their cz's-acting control elements is required. In this study, we have compared and functionally tested three different regions of the Ly49c and j genes that could play a role in Ly49 gene regulation. 97 4.2 Materials and Methods 4.2.1 Cell lines EL-4, a mouse T cell lymphoma cell line, and COS cells were cultured in DMEM supplemented with 5% fetal bovine serum, 100 units/ml penicillin, and lOOug/ml streptomycin (Stem Cell Technologies). EL-4 cells were known to express Ly49A by FACS (data not shown). 4.2.2 Sequencing of putative regulatory regions The putative regulatory regions located upstream of exon 1, and in intron 1 for Ly49a, c and j were sequenced from subclones of the previously described PI bacteriophage genomic clones C07281, K12319 and El 5255 (Resource Centre) (described in chapter 2), known to contain only the 5' regions of Ly49c, j and a, respectively. The following oligonucleotides were used: Ly49c/j exon 1 antisense 5'- GATTCTGGTGGAGGGAAAA; Ly49c/j 5'region antisense 5'- TTTCTAGATCTTCAATCATA; Ly49j exon 2 antisense primer 5'- TTCTGTTGCCAGCTTCTC; the Ly49c exon 2 antisense 5'- CAACCCTGAAGACTTATGA; and Ly49a exon 2 antisense 5'- GGATTGATATATAAAGTATGT. The regions downstream of the coding portion of Ly49c and j were sequenced from subclones of PI genomic clones C07281 and K12319 (Resource Centre), respectively, known to contain only the 3' region of each gene, using the primers: Ly49j exon 7 sense 5'-ATGAACTTTAAGTCTAGAGG; Ly49j 3' UTR sense 5'- AGCATCCTACTAAGCCTCA; and Ly49c exon 7 sense 5'- CTAAAGCAAGAATAGAAGATA. All sequencing was carried out using the ABI Prism Big Dye Cycle Sequence Ready Reaction Kit (PE Biosystems) in an ABI automated DNA sequence machine (model 310). 4.2.3 Generation of luciferase reporter gene constructs Putative 5'upstream and intron 1 promoter regions from Ly49a, c and j were amplified from subclones of the PI genomic clones E15255, C07281 and K12319 98 (Resource Centre), respectively, using the primer pairs listed in Table 4-1. All primer pairs contained Kpn I sites to facilitate cloning into the promoterless pGL3 luciferase reporter vector (Promega, Madison, WI). For simplicity, the Kpn I sites are not shown on the primer sequences listed in the table. All constructs were amplified in a 50 ul reaction volume containing 10 ng PI genomic subclone DNA specific for Ly49a, c or j, cloned Pfu polymerase reaction buffer (Stratagene), 2.5mM each of four deoxyribonucleoside triphosphates, 30 pmol of each primer, and 2.5 units of cloned Pfu polymerase (Stratagene). Thirty cycles in a GeneAmp PCR System 9700 thermocycler (PE Applied Biosystems) were performed as follows: denaturation of 45 s at 95°C, annealing of 45 s at 47°C (Ly49c/j 310 and 800 bp), 49°C (Ly49a 310 and 800 bp), 44°C (Ly49c/j 360 bp, 1.7, 2.0 and 2.4 kb), 45°C (Ly49a 360 bp, 1.7, 2.0, and 2.4 kb); extension of 90 s at 72°C; followed by a 1 min extension at 72°C. DNA from the luciferase reporter gene constructs, and from the pGL3-Basic and -Promoter vectors (Promega) was prepared using the Qiagen Endotoxin-Free Plasmid Maxi DNA purification kit (Qiagen, Mississauga, ON, Canada). All luciferase reporter gene constructs were sequenced to confirm sequence integrity and orientation using the pGL3 vector primers RV3 and GL2 previously described (Promega). 4.2.4 Determining intron/exon boundaries for Ly49c The intron/exon boundaries for Ly49c were sequenced from subclones of the PI clones C07281 and K12319 known to contain only the 5' and 3' regions of the gene (Resource Centre, described in Chapter 2). The following primers were used: C exon 1 sense 5'-TAAACCAGAAAACGCCAC; C exon 2 boundaries 5'- TCATAAGTCTTCAGGGTTG and its antisense; C exon 4 sense 5'- AAGCAATGAAACTCTGGAAT and antisense 5' -TTCATTGCTTGGCCTACAATC; C exon 5 sense 5'-TGGAGTGGATGTAAAGCG and its antisense; C exon 6 5'- GGATTGGATTGTCTTATGAT and its antisense; and C exon 7 sense 5'- TATCTTCTAATTCTTGCTTTAG. The C exon 3 intron/exon boundaries were sequenced using the Ly49c, i and j primers described in chapter 3.3.3. 99 Table 4-1. Primers used to amplify the putative regulatory regions of Ly49a, c and Constructs Ly49 Sense Primer Antisense Primer 310 bp a 5' -CATCAGTGCCACATTTTTC 5' -AGTGGTTCTGGTGGAGG upstream c,j 5' -CTTCAGTCCCTCTTTTTC 5' -GATGCTGGTGGAGGGA 800 bp a 5' -GCGTATTATTTATTTATTAACC 5' -AGTGGTTCTGGTGGAGG upstream c,j 5' -AACCTGGAATACATTTGTG 5' -GATGCTGGTGGAGGGA 360 bp intron 1 a 5' -GAAATAAGTGGGTGGGTA 5' -GGATTGATATATAAAGTATGT cJ 5' •AATGATTTTTTTAGTGTTTTT 5' -ATCGTGGGAGTACAAGA 1.7 kb intron 1 a 5' -AACCACTTCTTGCTAGC 5' -GGATTGATATATAAAGTATGT c,j 5' -AATTTTCCCTCCACCAG 5' -ATCGTGGGAGTACAAGA 2.0 kb intron 1 a 5' •CATCAGTGCCACATTTTTC 5' -GGATTGATATATAAAGTATGT + upstream c,j 5' -CTTCAGTCCCTCTTTTTC 5' -ATCGTGGGAGTACAAGA 2.4 kb intron 1 a 5' -GCGTATTATTTATTTATTAACC 5' -GGATTGATATATAAAGTATGT + upstream c,j 5' -AACCTGGAATACATTTGTG 5' -ATCGTGGGAGTACAAGA 100 4.2.5 Luciferase assays EL-4 cells were plated at 2 x 106 cells per well in a six-well plate and transiently transfected with 4 ug of the individual expression constructs using 48 ug Superfect transfection reagent (Qiagen) according to the manufacturer's instructions. Luciferase assays were performed on EL-4 transfectants using the Firefly Luciferase Assay System (Promega) as per the manufacturer's instructions, with the following modifications: luciferase activity was measured for 10/150 ul cell extract using 50 ul Luciferase Assay Reagent (Promega). Five ul of cell lysate was assayed for protein content using the Bio- Rad protein assay kit (Bio Rad). Luciferase measurements were read using a Tropix luminometer (Bio/Can Scientific, Mississauga, ON, Canada) 24 hours after transfection. Eight replicates of each construct were performed independently, and all measurements were normalized for protein content. 4.2.6 RT-PCR analysis Total cellular RNA from B6 interleukin-2-activated NK cells (75% NK1.1+) was prepared using Trizol Reagent (Life Technologies). RNA was DNase I treated to remove any contaminating DNA as per the manufacturer's instructions (Life Technologies). Synthesis of first-strand cDNA was carried out as described previously (Medstrand et al. 1992) using random primers. Semi-quantitative PCR was performed on approximately 5, 10, 50 and 100 ng of NK cell cDNA using primers located upstream and downstream of the putative TATA box in intron 1 (Fig. 4-5A). The .Ly4P/'-outside-TATA sense primer 5'- TAATTGCTATTACCATTAGAAAT or the Ly49/-inside-TATA sense primer 5'- AATCAGTCCATGTCAGGGTA were used in combination with the Ly49j-exon 2-RT antisense primer 5'-CCCTGAAGACTTATGAAGAT. PCR was performed in a 50 ul reaction volume containing 75mM MgCh, 2.5 raM each of four deoxyribonucleoside triphosphates, 30 pmol of each PCR primer, and 2.5 units of Taq polymerase (Life Technologies). Twenty two cycles in a GeneAmp 9700 thermocycler (PE Applied Biosystems) were carried out as follows: denaturation of 30 s at 94°C; annealing of 30 s at 51°C; extension of 60 s at 72°C; followed by a 10 min extension at 72°C. PCR using 101 the inside and outside primer pairs was performed on a PI genomic subclone known to contain the 5' region of Ly49j and equal amplification of each product was observed (data not shown). Amplification of a no-RT template using both primer sets was included to control for DNA contamination (Fig. 4-5B). 4.2.7 Probes and hybridization RT-PCR products were transferred onto Zeta-probe GT nylon membrane (Bio Rad) using the alkaline blotting method (Reed and Mann 1985). Hybridization analysis was performed using a 32P-labeled 108 bp probe located downstream of the putative TATA box in intron 1 of Ly49j. Hybridization analysis was performed overnight at 65 °C in 6 x SSC, 0.5% SDS, 1 x Denhardt's. The membrane was washed for 2x30 min in 3 x SSC, 1% SDS, and for 1 x 30 min in 0.5 x SSC, 1% SDS, and autoradiography performed for 24 h. The 108 bp downstream TATA probe was amplified from the K12319 (Resource Centre) genomic subclone DNA known to contain the 5' end of Ly49j using the following primers: sense 5'-TGAGTTAGTCAGACTCTACC, and antisense 5'- TGGAGTTTCAGTGAATTTTAA. To generate this probe, 10 ng of DNA was added to a 50 ul reaction volume containing 75mM MgCb, 2.5 mM each of four deoxyribonucleoside triphosphates, 30 pmol of each PCR primer, and 2.5 units of Taq polymerase (Life Technologies). Thirty-five cycles in a GeneAmp 9700 thermocycler (PE Applied Biosystems) were carried out as follows: denaturation of 30 s at 94°C; annealing of 30 s at 51 °C; extension of 60 s at 72°C; followed by a 10 min extension at 72°C. The PCR product was run on a 2% agarose (Life Technologies) gel, and purified using the Qiaex II Gel Extraction kit (Qiagen). 4.2.8 3' Race for Ly49j The polyadenylation site for Ly49j was identified by 3' Rapid Amplification of cDNA Ends (Race) using the method described previously (Frohman 1993). Gene- specific primers included: Ly49j-exon 7 sense 5'-CTGTATTTGTTGGAAGAAACTG and the nested Ly49j-UTR sense primer 5' -AAGTGTATGAATTTGTGGGCA. All PCR amplifications were carried out in a 50 ul reaction volume containing either 0.5 ug NK 102 cDNA (initial PCR) or 100 pg of the initial PCR product (nested PCR), cloned Pfu polymerase reaction buffer (Stratagene), 2.5 mM each of four deoxyribonucleoside triphosphates, 30 pmol of each primer, and 2.5 units of cloned Pfu polymerase (Stratagene). Twenty eight cycles in a GeneAmp PCR System 9700 thermocycler were carried out as follows: denaturation of 45 s at 95°C; annealing of 45 s at 55°C (initial PCR) or 53°C (nested PCR); extension of 120 s at 72°C; followed by a 7 min extension at 72°C. PCR products were run on a 2 % agarose gel, purified using the Qiaex II Gel extraction kit (Qiagen) and cloned into the pGEM-T vector (Promega) for sequencing. 3' Race products were sequenced using the T7 and Sp6 oligonucleotides described in the pGEM-T vector user manual (Promega). 4.2.9 Generation of GFP reporter gene constructs The Ly49c and j 3'UTR-GFP fusion constructs were generated by replacing the stop codon sequence, and the polyadenylation signal of the pEGFP-Cl vector (Clontech) with the 3'UTR of Ly49c or j. The pEGFP-Cl vector was cleaved at the Bam HI site (position 1390 of the pEGFP-Cl sequence) and the Mlu I site (position 1641) (Clontech). Ly49c and j DNA containing a portion of exon 7, the 3 'UTR, and approximately 90 bp downstream of the polyadenylation site were amplified from subclones of the PI genomic clones C07281 and K12198 (Resource Centre) known to contain only the 3' regions of Ly49c and j, respectively. The following PCR primers pairs were used: Ly49c-UTR sense primer 5'-GGGAAGAAACTGGATAAATTC and the antisense primer 5'- CTCAGACAAACAAACAAGCAA; Ly49j-UTR sense primer 5'- TGGAAGAAACTGGATAAATTC and the antisense primer 5'- A ATGGTGCTG A A A AT ATGTGC. Bam HI cloning sites were added to the sense primers, and Mlu I cloning sites were added to the antisense primers to facilitate subcloning into the modified pEGFP-Cl vector. PCR amplifications were carried out in a 50 ul reaction volume containing 10 ng of the PI subclones, cloned Pfu polymerase reaction buffer (Stratagene), 2.5mM each of four deoxyribonucleoside triphosphates, 30 pmol of each primer, and 2.5 units of cloned Pfu polymerase (Stratagene). Twenty eight cycles in a GeneAmp PCR System 9700 thermocycler (PE Applied Biosystems) were carried out as follows: denaturation of 45 s at 95°C; annealing of 45 s at 51°C; extension 103 of 60 s at 72°C; followed by a 10 minute extension at 72°C. DNA from the 3'UTR-GFP fusion constructs, and from the pEGFP-Cl vector was prepared using the Qiagen Endotoxin-Free Plasmid Maxi DNA purification kit (Qiagen). The 3'UTR-GFP fusion constructs were sequenced using the following oligonucleotides: sense primer 5'- CACTCTCGGCATGGACG, from position 1302-1318 of the pEGFP-Cl sequence; and the antisense primer 5 '-AAAATGAGCTGATTTAACAAAA, from position 1687-1709 (Clontech). 4.2.10 Transfections and Flow Cytometry COS cells were plated at 2 x 105 cells per well in a six-well plate and transiently transfected as described in Chapter 3.2.8. The cells were analyzed on a FACScan (Becton Dickinson) and mean fluorescence intensity was measured. Results from three independent transfection experiments were averaged. 104 4.3 Results and Discussion 4.3.1 Intron/exon boundaries of Ly49c To complement our regulatory analysis of the Z,v49c-related genes Ly49c and j, we sequenced the intron/exon boundaries of the well characterized Ly49c gene. To date, only the genomic organization of the Ly49a gene has been published (Kubo et al. 1993). As Ly49a and c belong to different subsets of the Ly49 gene family, it is possible there could be differences in gene organization. Primers designed within each exon of Ly49c were used to sequence the intron/exon boundaries from PI genomic subclones known to contain either the 5' or 3' end of the gene. As illustrated in Figure 4-1, the sequence surrounding the intron/exon boundaries in the coding portion of Ly49a and c are well conserved. This was not surprising based on the functional similarity between the two molecules, as both Ly49A and C have a broad MHC class I specificity (Hanke et al. 1999). Interestingly, the intronl/exon 2 boundary differs between Ly49a and c. This difference will be examined further in section 4.3.4. 4.3.2 Sequence and comparison of the 5' region of Ly49c and j The first portion of the Ly49c and j genes to be investigated was the 5' region immediately upstream of exon 1, according to the transcriptional start site defined previously for Ly49a (Kubo et al. 1993). Approximately 900 bp upstream of (and including) exon 1 for Ly49c and j was sequenced from subclones of PI genomic clones. As observed for the coding portion of the genes, these regions are highly similar, sharing over 95% nucleotide identity (Fig. 4-2). Two regions ofLy49c and j contain simple repeats. A CA-rich region occurs -730 bp upstream of the exon 1/2 boundary (starting at position 204 in Fig. 4-2), although Ly49j contains a 14 bp deletion within this element. A shorter CA-rich region is also present in Ly49a (starting at position 235 in Fig. 4-2). In addition, Ly49c and j contain a (TA)n simple repeat located -920 bp upstream of the exon 1/2 boundary (starting at position 1 in Fig. 4-2), which is not present in the Ly49a gene. Overall, the Ly49a gene shares only 77% nucleotide identity with Ly49c and j in the 5' region. Ly49c and j contain a TATA element (TAT AAA) at the same position as has been recently described for the closely related Ly49i gene (Gosselin et al. 2000). In 105 CL .O *+-» O a a a a fi a 0 0 0 0 0 0 X X X X X X >H 0) CD oa i-l (N ei if) NO u c a a a a a d 4J 0 0 0 0 0 0 0 u u u u u rH u DC -H 4J 4J 4J 4J 4J 4-1 4J ^J 1 c G c c a a a ^ c/i Q H -rH -H •rH -H •H •H X rd rd rd rd 4J 4J a o co 80 J ATATATATATATATATATATATATATATATATATATATATATATATATATATATATATATATATATCGCTTGTTATTTGT c W/HBsSBM A GC C AG AT ATAC TATATG CT TA AT TG G CA C A ATG AGA AT G A A 160 J TTGTTAACCTGGAATACATTTGTGAAATGGTGTACAGCTATCATTCC-AGGACAGAAAGGAGTGAGAACTTAGGAATGTG C TC A T C G A A A GC T GC TC A A A TA ACA A TGT TGA A C CG A 240 ,Vi ••^jimammamm^^mMa,- J AGTGTAATGTGAGCCTATGCTAACATAGTAAGATAAAACATCTCAAACAACAACAA CAAACAAAAC C CAAACAAACAAAAC A T G G TA G T GTCT AC CA • • • • > > .320 J AAAACAGAAAAAAAAAAOU^C^CC&GAACAAAATAA C C A C G A CGCCACA C G GA 400 J AGCATGTTCATTGTCTTAGATTTGATTTCCCATCAC C A -T G T A T A G T T 480 J ATGTTC^TAGGAAATATTATCTATGATTG-AAGATCTAGAAAATGAAAAAGGAAGACTTCAGCAGTGCAAATGTGAGTGC C A AT T T T G A A TA A TGT C CACTTAGCTGCAA 560 J TTAAAAGC ATTCCTAATATATACTTAGCTCCAATTAGCATAATTCAAAATCAAGGAGTAACTAAAAAA TAGT C ATA G T A A C G A A T TTAGTAACA 640 J AACATAACAGTAAATTTCAAACAGTTTATGACAAAATTAGCCTATGAACTTCAGTCCCTC-TTTTTCCTATTTGTTTTGC C G C C A T ATAG C C T C GAGCATC G A A G a • • • • • •'720 J TAAAGA^CAAip-TTTTCCCCTCTCTGCAGGAGTGTGTGTCTTCTCTATCTT-CJiAArTATAA^TTATTCACATTTGTTTTG C CA A G GT T G T T TCA CT AA C G GG 800 J -TCCATCCAATACTATATGTTGTT TTAGATTGCAATAAGCAATTTCCTCTTTTTCJ C C A CAG TGGC A C TCTCTC CTTTGTT CTGAGGG C G T T G + . . 880 fiCAAGGAGGGGCAGAAAATCATGAGATTGAGTATCACTCGGTGGAAATTTAGCTCTGTCTTTCAATTTTGAAACTCA G G C TCA G G A | T | G TA TACGTTGGAT : ...... 958 J TAGGGGATATAGACCAGAAAACGCCAACTTTTCAGACAAATTTTCCCTCCACCAGAATCACTCC--GGTAGAGACACAG C A C A G C A CA A T C TTTCC Figure 4-2. Comparison of 5' sequence upstream (and including) exon 1 from Ly49j, c and a. The sequence is presented in blocks of ten nucleotides (dots) and ends at the exon 1/2 boundary (position 958). Nucleotide differences as compared to Ly49j are in bold text, and gaps in the sequence are represented by dashes. Repetitive CA and TA sequences are illustrated by boxed shaded text. TATA and CAAT regulatory elements are in open boxes, the transcriptional start site of Ly49a is in bold and denoted by a star, the HMG boxes are represented by dark shaded boxes with borders, and the ATF-2 binding site is underscored. The Genbank accession numbers for the Ly49c and j 5' region sequences are AF294732 and AF294733, respectively. The 5' sequence for Ly49a has been previously published (Kubo et al. 1993). 107 Ly49i, this region has been shown to have core promoter activity, and based on sequence similarity, it likely has a similar role in Ly49c and j. As noted previously, this region is not conserved in the Ly49a gene, and it is probable that the Ly49c, i and j subfamily contain different promoter elements. In support of this hypothesis, the TATA element for these three genes is located upstream of the first HMG box found in Ly49a. This HMG box, which has been shown to be a potential TCF-1 binding site involved in the regulation of the Ly49a gene (Held et al. 1999b), is absent in Ly49c and j (position 751 of Fig. 4-2). 4.3.3 Promoter activity of the 5'region To measure promoter activity of the 5'region upstream of exon 1 for Ly49c and j, ~310 or 800 bp of upstream sequence was cloned into the promoterless pGL3 luciferase vector (Promega). Comparable Ly49a constructs were generated, to act as a positive control for the luciferase experiments which were performed in EL-4 cells. Results of independent luciferase experiments are summarized in Fig. 4-3 B. Luciferase values are presented relative to the empty pGL3-promoterless vector (Promega). For unknown reasons, the empty pGL3 had significant background promoter activity in the EL-4 cells, therefore it was difficult to determine if constructs that had lower luciferase activity than vector alone were significant. It is possible that the constructs with activity below the background level contain repressor sequences. Alternatively, the decrease in luciferase activity could be due to the insertion of DNA into the vector, which effects the basal activity of the promoterless pGL3 vector in EL-4 cells. As reported previously (Held et al. 1999b), we confirmed that Ly49a has strong promoter activity in EL-4 cells (Fig. 4- 3B). The luciferase activity for the Ly49c and j constructs was not as high, although promoter activity is evident for the 310 bp constructs. Interestingly, the 310 bp luciferase constructs had significantly higher promoter activity compared to the 800 bp constructs for Ly49c and j, and to a lesser extent for Ly49a (Fig. 4-3B), which is consistent with results observed for Ly49i (Gosselin et al. 2000). This analysis indicates that the regions directly upstream of Ly49c and j contain promoter elements, as expected, but also contain repressor elements upstream of the core promoter that may play a role in the regulation of these genes in vivo. 108 A putative TATA 5' region I 310 bp 5' upstream sequence 800 bp 5' upstream sequence 2.5 3 3.5 fold increase Figure 4-3. Promoter activity of the 5' region measured by the firefly luciferase assay system. (A) Schematic representation of the luciferase constructs from the 5' region. Exon 1 is represented by a dark box, and the sequence upstream of exon 1 is illustrated by a horizontal line. Arrows represent the approximate location of the primers used to amplify the 310 or 800 bp of 5'sequence that was cloned into the promoterless pGL3 vector. The luciferase constructs are shown as open boxes. (B) Luciferase results as compared to the promoterless pGL3 luciferase vector. Promoter expression below the luciferase expression of the empty (promoterless) pGL3 (solid line) represents background. Eight independent replicates of each Ly49a, c or j luciferase construct were transiently transfected into EL-4 cells, and protein expression was measured using the firefly luciferase assay system (Promega). Representative results from two independent transfections are presented. Standard error bars are shown. 109 4.3.4 Sequence compariso n of a putative promoter region in intron 1 of Ly49a, c and j The use of multiple promoters as a means of differentially regulating gene expression is widespread in mammalian systems. For example, the FcyRIII-A gene encoding the CD 16 protein on NK cells has been shown to use different promoters to regulate tissue-specific expression (Gessner et al. 1996), and multiple promoter usage is common among members of the steroid/thyroid hormone family to achieve spatio- temporal expression (Flouriot et al. 1998). Interestingly, a recent study has suggested that NK cell receptor gene families may also use multiple promoters. Studies to identify the 5' regulatory region of the human NKG2A gene revealed the presence of TATA and CAAT-like regulatory elements, and multiple transcriptional start sites located in the first intron, as well as in the 5' region immediately upstream of exon 1 (Plougastel and Trowsdale 1998). Studies to determine the transcriptional start site of Ly49c also revealed heterogenous start sites in the 5' region, although none were discovered within the first intron (B.T. Wilhelm et al, in press). To examine whether any Ly49 genes contained regulatory regions within the first intron, we sequenced the 5' portion of intron 1 immediately upstream of exon 2 for Ly49a, c and j from PI genomic clones. The intron 1 sequence of Ly49c and j is highly similar (-94% nucleotide identity) (Fig. 4-4). This was not unexpected due to the high similarity in the coding sequence and in the 5' region of the genes. Ly49a is -80% identical to Ly49c and j for the first 240 bp immediately upstream of exon 2, then the similarity ends (position 112 in Fig. 4-4). Analysis of the sequence has revealed that this portion of Ly49a contains a LINE-1 element not present in Ly49c or j (Fig. 4-4). Intron 1 in Ly49a is only slightly larger (-1.8 kb) than in Ly49c and j (-1.7 kb) (data not shown), so it is likely that this partial LINE-1 insertion is quite small. Like human NKG2A, Ly49j contains putative TATA and CAAT-like elements within the first intron, whereas Ly49a contains only the TATA box, and Ly49c has neither. These sites are located -203 and -228 bp upstream of exon 2, respectively (position 140 and 114 in Fig. 4-4). The human Ly49L gene also contains putative TATA/CAAT elements in intron 1, although they occur at different nucleotide positions relative to the human NKG2A and Ly49j genes (Plougastel and Trowsdale 1998; data not 110 shown). Interestingly, Ly49a appears to differ from Ly49c and j at the intron 1/exon 2 boundary. The exon 2 splice acceptor site of Ly49c and j occurs 18 bp upstream of the ATG start codon in exon 2, whereas the acceptor site for Ly49a occurs 34 bp further upstream of this point (Fig. 4-4). A comparison of the intron/exon boundaries of the human Ly49L cDNA with genomic sequence and available through Genbank (Accession AC021049) has shown that the human Ly49L gene contains the same intron 1/ exon 2 junction as Ly49a (Barten and Trowsdale 1999; data not shown). This suggests that the Ly49a splice site is older than the one used by Ly49c and j. 4.3.5 Intron 1 promoter analysis Although the presence of a putative promoter region was described in intron 1 for the human NKG2A gene, functional analysis of these elements was not reported (Plougastel and Trowsdale 1998). To determine whether any Ly49 genes have intron 1 promoter activity, we tested various regions of Ly49a, c and j using luciferase assays in EL-4 cells (Fig. 4-5). As predicted from the sequence analysis, the Ly49c 360 bp and 1.7 kb intron 1 constructs, which do not contain TATA or CAAT elements, had insignificant promoter activity compared to empty pGL3. Similarly, no luciferase activity was seen with the equivalent Ly49a regions, which contain a TATA box but no CAAT elements (Fig. 4-4, 4-5B). The Ly49a and c 2.0 and 2.4 kb upstream/intron 1 constructs are both expressed at levels comparable to those observed for the 310 and 800 bp upstream constructs, respectively (Figs. 4-3B, 4-5B). This suggests that intron 1 from both Ly49a and c do not contain significant regulatory elements that are active in EL-4 cells, as their presence does not appear to affect the promoter activity of the upstream/intron 1 constructs. Ly49j, on the other hand, appears to have significant promoter activity in intron 1. The 360 bp intron 1 construct is expressed at a level comparable to that observed for the 310 bp upstream construct (Fig. 4-3B, 4-5B). The presence of promoter activity from this construct is not surprising, and likely results from the presence of TATA and CAAT boxes in Ly49j upstream of exon 2 (Fig. 4-4). The Ly49j 1.7 kb intron 1 construct is not expressed, suggesting the presence of repressor elements located upstream of the TATA/CAAT elements in intron 1. This is supported by the lack of promoter activity of the Ly49j 2.0 kb construct compared to the 310 bp upstream Ill 80 J AATGATTTTTTTAGTGTTTTTCTGTGCTGAATAGTTTGAAAAAATAGGCTTTATCAATGGTAGAGTGATTTAGTAAAGTT C A T GC C A AG A LINE 1 repeat . . . . 160 J TTAATC-TTTTTCATATTTTTTAqCAATKATTGCTATTACCATTAGAA^TATAAJ CTTAACAGAAATCTACAG C A G CTAA ATGA A A G G CTACT T A ATGA 240 J --TCTTACCTGTGATGGAAATTGGGATCAGTCCATGTCAGGGTATTTGGATTATTAAGTGAGTTAGTCAGACTCTACCCT C GT T G G A GCCTAT - TGTGC CCT 320 J TTTTAATCTCTCTGTATCATCATATCCAGTTATGTTCCCATAGGTGAACATTTTATCATTTTTCTTAAAATTCACTGAAA C T A G_ A CCGC GTCCT AT ' 366 J TCTCCATTTTACCAGAGAACAGACTTCTTGT ACTCCCACGATC C A A A ATC A i Figure 4-4. Comparison of partial intron 1 sequence from Ly49j, c and a. Nucleotide differences as compared to the Ly49j sequence are in bold text, gaps in the sequence are represented by dashes, the ATG start codon is underlined and in bold, and the LINE-1 repeat in Ly49a is shown by tildes. The TATA and CAAT regulatory elements present in Ly49j are in open boxes. The intron 1/exon 2 boundaries are represented by boxed shaded text. Note that Ly49a and c/j appear to have different splice junctions. The Genbank accession numbers for the 3' portion of the intron 1 sequences are as follows: Ly49a intron 1 AF294734, Ly49c intron 1 AF294735, and Ly49j intron 1 AF294736. 112 B putative exonl TATA exon 2 5' region " i intron 1 SV40 empty pGL3 A-360 360 bp intron 1 LUC C-360 J-360 A-1.7 1.7 kb intron 1 LUC C-1.7 L J-1.7 A-2.0 2.0 kb intron + 5' upstream seq LUC C-2.0 L J-2.0 A-2.4 2.4 kb intron + 5' upstream seq LUC C-2.4 ZH L J-2.4 T 0.5 1 1.5 2 2.5 3 3.5 fold increase Figure 4-5. The promoter activity of intron 1. (A) Schematic representation of the Ly49a, c and j luciferase constructs containing intron 1. Exons are represented by dark boxes, while the 5' and intron 1 sequence is illustrated by a horizontal line. Arrows represent the approximate location of the primers used to amplify the 360 bp, 1.7 kb, 2.0 kb and 2.4 kb portions of each gene that were cloned into the promoterless pGL3 vector. The luciferase constructs are shown as open boxes. (B) Luciferase results as compared to the promoterless pGL3 luciferase vector. Promoter expression below the luciferase expression of the empty (promoterless) pGL3 (solid line) represents background. Eight independent replicates of each Ly49a, c and j construct were transiently transfected into EL-4 cells, and promoter activity was measured using the firefly luciferase assay system. Representative results from two independent luciferase experiments are presented. Standard error bars are shown. 113 construct (Fig. 4-3B, 4-5B). The identity and functional significance of this repressor element is unknown at this time. 4.3.6 Analysis of transcripts from the intron 1 promoter To investigate the functional relevance of the alternative promoter for Ly49j, we performed semi-quantitative RT-PCR on NK cell cDNA. PCR primers were designed downstream of the putative TATA box (inside primers) that would amplify a 240 bp segment of transcripts being produced from the intron 1 promoter (Fig. 4-6A). A primer pair located upstream of the TATA box (outside primers) and in exon 2 (producing a 315 bp product) was used to identify any transcripts that were being produced from the 5' promoter but which had failed to remove intron 1 due to incorrect splicing. It should be noted that the inside-PCR primers would amplify transcripts being produced from both the 5' and intron 1 promoters. Four serial dilutions of NK cell cDNA were amplified with each primer set, and Southern blot analysis was performed using an intron 1 probe located downstream of the intron 1 TATA box. As illustrated in Fig. 4-6B, incorrectly- spliced transcripts produced from the 5' promoter can be detected using the outside-PCR primer pairs. However, a significantly higher proportion of transcripts being produced from the intron 1 promoter were detected by the inside-primer pair, as illustrated by the much stronger hybridization signal of the 240 bp product (Fig. 4-6B). Due to the high level of sequence identity between the different Ly49 family members, it should be noted that this hybridization analysis is likely not specific for the Ly49j gene. However, it supports the hypothesis that some Ly49 genes contain a functional promoter in intron 1. Northern blot analysis on NK RNA using the probe located downstream of the intron 1 TATA box identified a weak transcript of -390 bp which appears to be produced from the alternative promoter (data not shown). Full-length transcripts were not identified, and the functional relevance of this truncated transcript is unknown. A BLAST search using the probe sequence produced a significant match with the 5' non-coding region of a Ly49v cDNA from the inbred mouse strain 129 (Genbank Accession AF288381). This suggests that this cDNA was derived from an alternatively spliced product containing intron 1, or from a transcript produced from the intron 1 promoter. 114 exon 1 putative exon 2 TATA intron 1 240 bp inside _31_5_bp_ outside probe B ng of NK cell cDNA no RT P1 clone 5 10 50 100 control control <0 o • o as • -o CD •D CU 73 CU "55 T3 '(« T3 ' *J en "35 2 3 3 2 e | g o c 0 c o o .E o .E bp 315- A: 41 ftk -315 240 - -240 Figure 4-6. Semi-quantitative RT-PCR on approximately 5,10,50 and 100 ng of NK cell cDNA to identify transcripts produced from the putative intron 1 promoter in Ly49j. (A) Schematic representation illustrating the approximate location of the primers (arrows) used to amplify 240 bp transcripts (dashed line) produced from the intron 1 promoter, and the alternatively spliced 315 bp transcripts (dashed line) produced from the 5' promoter. Exons are shown as dark boxes, the intron sequence by the horizontal line, and the hatched box represents the approximate location of the probe used in the hybridization analysis. The putative TATA box is marked. Twenty-two cycles of PCR were carried out on serial dilutions of NK cell cDNA and on a no-RT control. (B) Southern blot analysis of the semi-quantitative RT-PCR products hybridized to a 108 bp intron 1 probe from Ly49j located downstream of the intron 1 TATA box. Inside primer pairs amplified 240 bp products representing transcripts produced from the intron 1 promoter, as well as incorrectly-spliced products produced from the 5' promoter. The outside primers amplified 315 bp products corresponding to incorrectly-spliced transcripts produced from the 5' promoter. A no-RT control was included to eliminate the possibility of DNA contamination. 115 4.3.7 Different 3' untranslated regions in Ly49c and j The 3' UTR of eukaryotic mRNA has been shown to play an important role in translational control of protein expression (Sonenberg 1994). We therefore examined the 3' UTR of Ly49c and j to determine if they were significantly different. We sequenced the 3' region of Ly49c and j from genomic clones and compared the sequence to the previously published 3' regions of Ly49a, b, e,f,g and i (Mason et al. 1995; Smith et al. 1994; Stoneman et al. 1995). Fig. 4-7 shows a sequence comparison of the 3'region of Ly49c and j. The 3' region of Ly49c is similar to the other known Ly49 genes, having a polyadenylation signal (AAUAAA) located 272 bp downstream of the termination codon (position 292 in Fig. 4-7), followed by a GU-rich region. These characteristics are typical of many eukaryotic genes (Gray and Wickens 1998). The 3' region of Ly49j, however, differs dramatically. Its similarity to Ly49c ends 130 bp downstream of the termination codon (position 134 in Fig. 4-7). We performed 3' Race on NK cDNA and determined that the polyadenylation signal used by Ly49j is located 521 bp downstream of the termination codon (position 524 in Fig. 4-7), and is not followed by a GU-rich region. Also, the likely polyadenylation signal for Ly49j has an A to U substitution at the second position (AUUAAA), although it is estimated that ten percent of polyadenylation signals in normal eukaryotic cells have this nucleotide change (Wahle and Ruegsegger 1999). It has been shown that the AAUAAA and GU-rich sequences in the 3'UTR specify the cleavage and poly(A) addition site, as well as the strength of the poly(A) signal (Colgan and Manley 1997). It is possible that the non-consensus polyadenylation signal in Ly49j coupled with the absence of a GU-rich region downstream contribute to inefficiency of polyadenylation, which could result in the decreased expression of Ly49J within NK cells. Interestingly, this novel Ly49j sequence does not appear to contain any AU-rich elements, which are the most common determinants of mRNA instability in mammalian cells (Ross 1996). However, it has been shown that canonical AU-rich elements are not required for a 3' UTR to have a destabilisation effect. Therefore it is possible that other unidentified elements in this novel region contribute to instability of the Ly49j mRNA message. 116 80 J TAACTTTCCAACCAGAGTTAAAGGTAAAAATGGAATGAGTTGATCCTTATTCGTTTCTTGTAATAATTCATGACACCAAC C TAATTTTCCAACTAGAGTTAAAGGTAAAAATGGAATGAGTTGATCCTTATTCGTTTCTTGTAATAATTCATGACTCCAAC . . . 160 J AATCAAGTATTTTGACTACAGAACAAAGTCTGCTGTGAAGAGAAACAAAGCTGCTTATGTAAGCTCAAGACTTACAATCA ii iiiMiiiiiii iiiiiiiii inn iiiiiiiiiiiiiiiiiiiii inn C AAACAAGTATTTTGATTACAGAACATAGTCTCCTGTGAAGAGAAACAAAGCTG CAAGAACATTGGGAC 240 J TACAAGTGTATGAATTTGTGGGCAGCCCAGGCTTCATAATATGTATGATGTCAACGTGTGCTACAGAGTTAGATTCTATG II I II I I III Ml MM III I I II I II I III C TGTACTCTCCTATCTATCTTGACAGAACAGAGGTCATTTTTTATCCTGTTGGAGAGAGGACGCATCTACTCGGGTGAATG 320 J TCTTAGGAAGCCTAATAATAATGGTGTTAATGATAATAATACTAAAGCTGTCTAGAACAGAAATACTTTCAAGGGTGAAG C GGCACGCTTTGCCCTAAAGCCTTCAGAATTGTGTTCTTTCTGATTTCTTAAACTCCCATAAAACTqAATAAApAG 400 J CAATATCTTGGGTAGCATCCTACTAAGCCTCAATTATTCAATATGTATCTAGTAATAAGTTTTAGTCCATAACCCACATT I LL II II III II I I II I I I I MM I c TCCTCCC TJU^TAAGAGCCTGAATTTCGATTAATGTTATGACAA^TTGTTTTTGTTTGTTTGTTTH * ...... 480 j ATTCGCAATGGTTAGTGTTCTGGATCGTATCACTATCAATATATCTTTAAATTCAGAATCATACAGTGGTTCACATGTAA c . . [*] . 560 J TGTCCTTAAGTTGTGAAATAGTTTGGCTCATTGTTTGTCTGAc4ftTTAAA|TTCAAAAATCCTAGCqTirGAAGTTGAGTCT C 640 J GCATATAAATGCATCCACTGGAAGTCATGAAAATATGAGTTTTTATAATTATGCACATATTTTCAGCACCATTCTACAAA C Figure 4-7. The 3' region of Ly49c and j. Nucleotide identity between Ly49c and / is illustrated by vertical lines, the termination codon is in bold and underlined, and gaps in the sequence are represented by dashes. The region of sequence similarity between Ly49c and j is denoted by the shaded boxed text. The polyadenylation signals for Ly49c and j are shown in open boxes, the GU-rich region of Ly49c is in a shaded box with a border, and the cleavage/poly(A) addition site for each gene is illustrated by a boxed star. The Genbank accession numbers for the Ly49c and j 3' region sequences are AF294737 and AF294738, respectively. 117 Hybridization to a PI genomic mapping panel previously described (Chapter 2) has shown that sequences related to this novel Ly49j 3' UTR are present in the 3' region of the Ly49m gene. Full-length transcripts of Ly49m have not been detected in B6 mice, and it is likely that this gene is not expressed (data not shown). This sequence also hybridized to a 15 kb genomic fragment known to contain the 3' end of the Ly49a gene, as well as the intergenic region between Ly49a and c (Chapter 2) (Brown et al. 1997b; Depatie et al. 2000; data not shown). As the 3'UTR of Ly49a does not contain this novel region (Smith et al. 1994), it likely occurs in a gene remnant located in the intergenic space between Ly49a and c. Complete sequencing of the B6 Ly49 gene cluster will be necessary to confirm this observation. We have not detected this novel sequence associated with any other Ly49 gene, and this region does not match any known sequences or repeats in the databases (data not shown). To determine whether the novel 3' UTR from Ly49j could affect protein expression of a reporter gene, we generated fusion constructs in which we replaced the polyadenylation signal of the pEGFP-Cl vector (Clontech) with the 3' region of either Ly49c or j (Fig. 4-8A). We then transfected these constructs into COS cells, and measured the mean fluorescence intensity by FACS analysis. The mean fluorescence intensity provides an indication of the level of gene expression. As shown in Fig. 4-8B, replacement of the polyadenylation signal of pEGFP-Cl with that of Ly49j resulted in a 50% decrease in the mean fluorescence intensity compared to the original vector. Use of the 3' UTR of Ly49c did not significantly alter the expression of the 3'UTR-GFP fusion construct as compared to the pEGFP-Cl control. It should be noted that the decrease in GFP expression observed in this experiment could also have been caused by amino acid residues contained within the exon 7 coding portion of the 3'UTR-GFP fusion constructs. This possibility was not investigated. However, these results suggest that the 3' UTR can contribute to Ly49 gene regulation. As this region appears to be associated with genes that are not expressed, such as Ly49m (data not shown), or are expressed on a small percentage of NK cells, such as Ly49j, it may act as one of the mechanisms involved in the deactivation of Ly49 genes, or as a means of differentially regulating Ly49j in different tissues. Studies of the Ly49 repertoire in NKT cells in different cellular compartments have shown that Ly49J is expressed on 20% of thymic NKT cells, a 118 A poIyA c exon 7 TAA 3' UTR GU, J exon 7 TAA 3' UTR poly A B 120 -i 110 - 100 - c 90 - o 80 - 'ess i I 70 - a. 60 - G F TO «*i 50 - 40 • © 0. 30 - h 4 20 - 10 - 0 - ••:.BS| GFP Vector C 3'UTR Figure 4-8. Expression of GFP constructs containing the 3' UTR of either Ly49c or j. (A) Schematic representation of the 3' UTR-GFP fusion constructs for Ly49c and j. The open boxes represent the regions of the 3' UTR that are similar between Ly49c and j, while the shaded and hatched boxes represent regions of the 3' UTR that differ. Ly49c has a GU-rich region, while Ly49j does not, and the 3' UTR of Ly49j is considerably longer than for Ly49c. (B) Protein expression of the Ly49c and j 3' UTR-GFP fusion constructs. Fusion constructs were transiently transfected into COS cells, and the mean fluorescence intensity was measured by FACS analysis. Protein expression from three independent experiments was averaged and graphed as a percent of the pEGFP-Cl vector. Standard error bars are shown. 119 frequency similar to that of Ly49A (S. Lohwasser et al., unpublished data). Perhaps there are binding sites in this region specific for proteins present in the different NKT cell subsets which allow Ly49J to be expressed at a higher level. While our results show that the Ly49j 3' UTR has the potential to affect gene expression in a test system, a more thorough study of this region in different subsets of NK and NKT cells will be necessary to determine the functional significance of this finding. As mentioned previously, it has been shown that Ly49C is expressed on a higher percentage of NK cells compared to Ly49J (Kubota et al. 1999; unpublished data). It is likely that this low expression of Ly49J within the NK cell population is controlled, at least in part, by the expression of MHC class I. The binding specificity of Ly49J has not yet been determined, but could have several implications regarding the NK receptor repertoire. For example, Lowin-Kropf and Held (2000) have demonstrated that the engagement of inhibitory MHC receptors during NK cell development provides signals that are important for further NK differentiation and maturation. If the ligand for Ly49J is not present in B6 mice, or is only present in certain cellular compartments, it is possible that developing NK cells which initiate the expression of Ly49J do not mature into functional adult cells. Recent studies have illustrated that the potential to initiate the expression of individual receptors changes with the developmental stage of the NK cell (Roth et al. 2000). Perhaps the window of opportunity when Ly49J can be initiated is small, resulting in low expression of this gene within the NK cell population. It has also been shown that cells expressing receptors for one self-MHC class I molecule are less likely to express another self-specific receptor (Held et al. 1996; Held and Raulet 1997; Roth et al. 2000). If the ligand for Ly49J is self-MHC class I, it might be expected that Ly49J would be expressed on a smaller proportion of individual NK cells. Elucidation of the binding specificity of Ly49J, as well as the levels of expression in mouse strains of other haplotypes which may contain an Ly49j allele will be required to resolve this issue. Clearly, the regulation of the Ly49 gene family is highly complex. We have identified three regions of the gene containing czs-acting elements that likely play a role in regulating different Ly49 genes. In addition to active promoter elements immediately upstream of the genes, we have identified putative promoter sequences in the first intron of some Ly49 genes, which appear to produce severely truncated transcripts. Our results 120 also suggest that repressor elements are involved in Ly49 regulation. Furthermore, we have shown that sequence elements within the 3' UTR of Ly49j can affect protein expression, possibly by decreasing mRNA stability. It is likely that sequences in these regions act in concert with as yet unidentified transcription factors, MHC class I molecules and other elements such as locus control regions, to regulate the expression of different Ly49 genes on NK cells. 121 Chapter 5 Summary My research project has contributed to our understanding of the complexity of the Ly49 gene family. Most importantly, we were able to localize ten Ly49 genes in the NKC on mouse chromosome six, and in the process we identified five new Ly49 gene sequences. This has contributed to our knowledge of how the gene cluster is organized at the genomic level. We were also able to show that not all Ly49 genes in B6 mice are functional, and that different Ly49 gene subfamilies are not clustered together in the genome. Our results have complemented studies conducted by other groups, and raise a number of important questions. Interestingly, our Southern blot analysis (Fig. 2-1) has revealed that the organization of the Ly49 gene cluster in different inbred mouse strains is diverse. It would therefore be of interest to determine the genomic organization of the Ly49 genes in other mouse strains, such as BALB/c and 129/J, which contain different numbers of Ly49 genes, some of which are not present in B6. This genomic information would help to determine if Ly49 sequences from other mouse strains are allelic or represent distinct loci, and could be used to determine if any Ly49 genes act as "anchor" loci that are present in the same genomic position in all strains, as has been shown for some KIR genes in humans (Wilson et al. 2000). An analysis of the Ly49 cluster in different wild mice would also enhance our understanding of the genomic complexity of this gene family. Such an analysis would provide insight into how the Ly49 family evolved and could help explain why humans use a different NK cell receptor system to perform the same function. Genomic information on the gene families within the NKC from different mouse strains would also be useful, as a number of phenotypic differences, such as disease susceptibility, can be attributed to genetic variation within this region. For example, B6 and BALB/c mice differ in their immune responses to pathogens, such as MCMV. The cmv-1 locus, which confers resistance to MCMV, has been mapped to the NKC, in a region distal to the Ly49 gene cluster (Brown et al. 1999; Depatie et al. 2000). B6 mice, which carry the cmv-f allele, are highly resistant to MCMV infection, while BALB/c 122 mice, carrying the cmv-ls allele, typically die post-infection (Scalzo et al. 1990). Sequence of the NKC in other mouse strains will enable a comprehensive analysis of the inter-strain genetic variation within this region. This work has also increased our understanding of how the Ly49 gene family is regulated. Specifically, we identified several regions of the Ly49 genes that contain potential regulatory elements and warrant further investigation. For example, we [and others (Gosselin et al. 2000)] were able to show that the Ly49c-re\ated genes appear to contain repressor sequences upstream of the regulatory TATA and CAAT-like elements. The exact nature of this repressor remains to be elucidated. In addition, we have shown that some Ly49 genes use an internal promoter located in the first intron, and that message instability factors within the 3' UTR can also affect gene expression. The significance of these findings is unknown at this time. Many questions regarding the regulation of the Ly49 gene family remain to be answered. One of the biggest questions is which transcription factors play a role in regulating different Ly49 genes. For example, are different Ly49 subfamilies regulated by distinct subsets of trans-acting factors, or are all Ly49 genes regulated by the same trans-acting factors at limiting concentrations (Fig. 1-8)? Biochemical and transgenic approaches may help address these issues. The relative order of gene expression to form the Ly49 repertoire during development is another area of study in need of further investigation. For example, does the order of Ly49 acquisition vary in different mouse strains, or is it universal? The generation of better clonal assay systems in different mouse strains will be necessary before these types of questions can be answered conclusively. Clearly the Ly49 receptor system is very complex, and much work remains to be done. A better understanding of the different levels of gene regulation, such as the effects of chromatin on opening up the cluster to various transcription factors, the role of cis- and trans-acting factors such as repressors and positive transcription factors, as well as the role of external factors like MHC class I molecules on the formation of the Ly49 repertoire will be necessary before the complexity of Ly49 gene regulation can be fully appreciated. 123 Bibliography Complete sequence and gene map of a human major histocompatibility complex. The MHC sequencing consortium. Nature 401: 921-923, 1999 Adamkiewicz, T. V., McSherry, C, Bach, F. H., and Houchins, J. P.: Natural killer lectin-like receptors have divergent carboxy-termini, distinct from C-type lectins. Immunogenetics 39: 218, 1994 Amadou, C, Kumanovics, A., Jones, E. P., Lambracht-Washington, D., Yoshino, M., and Lindahl, K. F.: The mouse major histocompatibility complex: some assembly required. Immunol Rev 167: 211-221, 1999 Ansari-Lari, M. A., Oeltjen, J. C, Schwartz, S., Zhang, Z., Muzny, D. M., Lu, J., Gorrell, J. H., Chinault, A. C, Belmont, J. W., Miller, W., and Gibbs, R. A.: Comparative sequence analysis of a gene-rich cluster at human chromosome 12pl3 and its syntenic region in mouse chromosome 6. Genome Res 8: 29-40, 1998 Arm, J. P., Nwankwo, C, and Austen, K. F.: Molecular identification of a novel family of human Ig superfamily members that possess immunoreceptor tyrosine-based inhibition motifs and homology to the mouse gp49Bl inhibitory receptor. J Immunol 159: 2342- 2349, 1997 Bakker, A. B., Baker, E., Sutherland, G. R., Phillips, J. H., and Lanier, L. L.: Myeloid DAP12-associating lectin (MDL)-l is a cell surface receptor involved in the activation of myeloid cells. Proc Natl Acad Sci USA 96: 9792-9796, 1999 Bancroft, G. J., Shellam, G. R., and Chalmer, J. E.: Genetic influences on the augmentation of natural killer (NK) cells during murine cytomegalovirus infection: correlation with patterns of resistance. J Immunol 126: 988-994, 1981 Barten, R. and Trowsdale, J.: The human Ly-49L gene. Immunogenetics 49: 731-734, 1999 Barton, K., Muthusamy, N., Fischer, C, Ting, C. N., Walunas, T. L., Lanier, L. L., and Leiden, J. M.: The Ets-1 transcription factor is required for the development of natural killer cells in mice. Immunity 9: 555-563, 1998 Bauer, S., Groh, V., Wu, J., Steinle, A., Phillips, J. H., Lanier, L. L., and Spies, T.: Activation of NK cells and T cells by NKG2D, a receptor for stress-inducible MICA. Science 285: 727-729, 1999 Berg, S. F., Dissen, E., Westgaard, I. H., and Fossum, S.: Molecular characterization of rat NKR-P2, a lectin-like receptor expressed by NK cells and resting T cells. Int Immunol 10: 379-385, 1998a 124 Berg, S. F., Dissen, E., Westgaard, I. H., and Fossum, S.: Two genes in the rat homologous to human NKG2. Eur J Immunol 28: 444-450, 1998b Berg, S. F., Fossum, S., and Dissen, E.: NILR-1, a novel immunoglobulin-like receptor expressed by neutrophilic granulocytes, is encoded by a leukocyte receptor gene complex on rat chromosome 1. Eur J Immunol 29: 2000-2006, 1999 Biassoni, R., Cantoni, C, Falco, M., Verdiani, S., Bottino, C, Vitale, M., Conte, R., Poggi, A., Moretta, A., and Moretta, L.: The human leukocyte antigen (HLA)-C-specific "activatory" or "inhibitory" natural killer cell receptors display highly homologous extracellular domains but differ in their transmembrane and intracytoplasmic portions. J Exp Med 183: 645-650, 1996 Biassoni, R., Pessino, A., Bottino, C, Pende, D., Moretta, L., and Moretta, A.: The murine homologue of the human NKp46, a triggering receptor involved in the induction of natural cytotoxicity. Eur J Immunol 29: 1014-1020, 1999 Biron, C. A., Byron, K. S., and Sullivan, J. L.: Severe herpesvirus infections in an adolescent without natural killer cells. NEnglJMed 320: 1731-1735, 1989 Biron, C. A., van den Elsen, P., Tutt, M. M., Medveczky, P., Kumar, V., and Terhorst, C: Murine natural killer cells stimulated in vivo do not express the T cell receptor alpha, beta, gamma, T3 delta, or T3 epsilon genes. J Immunol 139: 1704-1710, 1987 Blaser, C, Kaufmann, M., and Pircher, H.: Virus-activated CD8 T cells and lymphokine- activated NK cells express the mast cell function-associated antigen, an inhibitory C-type lectin. J Immunol 161: 6451-6454, 1998 Bocek, P., Guthmann, M. D., and Pecht, I.: Analysis of the genes encoding the mast cell function-associated antigen and its alternatively spliced transcripts. The Journal of Immunology 158: 3235-3243, 1997 Boles, K. S., Barten, R., Kumaresan, P. R., Trowsdale, J., and Mathew, P. A.: Cloning of a new lectin-like receptor expressed on human NK cells. Immunogenetics 50: 1-7, 1999 Borges, L., Hsu, M. L., Fanger, N., Kubin, M., and Cosman, D.: A family of human lymphoid and myeloid Ig-like receptors, some of which bind to MHC class I molecules. J Immunol 159: 5192-5196, 1997 Borrego, F., Ulbrecht, M., Weiss, E. H., Coligan, J. E., and Brooks, A. G.: Recognition of human histocompatibility leukocyte antigen (HLA)-E complexed with HLA class I signal sequence-derived peptides by CD94/NKG2 confers protection from natural killer cell- mediated lysis. J Exp Med 187: 813-818, 1998 Braud, V. M., Allan, D. S., O'Callaghan, C. A., Soderstrom, K., D'Andrea, A., Ogg, G. S., Lazetic, S., Young, N. T., Bell, J. I., Phillips, J. H., Lanier, L. L., and McMichael, A. J.: HLA-E binds to natural killer cell receptors CD94/NKG2A, B and C. Nature 391: 795-799, 1998 125 Brennan, J., Lemieux, S., Freeman, J. D., Mager, D. L., and Takei, F.: Heterogeneity among Ly-49C natural killer (NK) cells: characterization of highly related receptors with differing functions and expression patterns. J Exp Med 184: 2085-2090, 1996a Brennan, J., Mager, D., Jefferies, W., and Takei, F.: Expression of different members of the Ly-49 gene family defines distinct natural killer cell subsets and cell adhesion properties. J Exp Med 180: 2287-2295, 1994 Brennan, J., Mahon, G., Mager, D. L., Jefferies, W. A., and Takei, F.: Recognition of class I major histocompatibility complex molecules by Ly-49: specificities and domain interactions. J Exp Med 183: 1553-1559, 1996b Brooks, A. G., Posch, P. E., Scorzelli, C. J., Borrego, F., and Coligan, J. E.: NKG2A complexed with CD94 defines a novel inhibitory natural killer cell receptor. J Exp Med 185: 795-800, 1997 Brown, M. G., Fulmek, S., Matsumoto, K., Cho, R., Lyons, P. A., Levy, E. R., Scalzo, A. A., and Yokoyama, W. M.: A 2-Mb YAC contig and physical map of the natural killer gene complex on mouse chromosome 6. Genomics 42: 16-25, 1997a Brown, M. G., Scalzo, A. A., Matsumoto, K., and Yokoyama, W. M.: The natural killer gene complex: a genetic basis for understanding natural killer function and inate immunity. Immunol Rev 155: 53-65, 1997b Brown, M. G., Zhang, J., Du, Y., Stoll, J., Yokoyama, W. M., and Scalzo, A. A.: Localization on a physical map of the NKC-linked Cmvl locus between Ly49b and the Prp gene cluster on mouse chromosome 6. J Immunol 163: 1991-1999, 1999 Brown, M. H., Boles, K., van der Merwe, P. A., Kumar, V., Mathew, P. A., and Barclay, A. N.: 2B4, the natural killer and T cell immunoglobulin superfamily surface protein, is a ligand for CD48. J Exp Med 188: 2083-2090, 1998 Burshtyn, D. N., Scharenberg, A. M., Wagtmann, N., Rajagopalan, S., Berrada, K., Yi, T., Kinet, J. P., and Long, E. O.: Recruitment of tyrosine phosphatase HCP by the killer cell inhibitor receptor. Immunity 4: 77-85, 1996 Butcher, S., Arney, K. L., and Cook, G. P.: MAFA-L, an ITIM-containing receptor encoded by the human NK cell gene complex and expressed by basophils and NK cells. Eur J Immunol 28: 3755-3762, 1998 Campbell, K. S. and Giorda, R.: The cytoplasmic domain of rat NKR-P1 receptor interacts with the N-terminal domain of p56(lck) via cysteine residues. Eur J Immunol 27: 72-77, 1997 Cantoni, C, Bottino, C, Vitale, M., Pessino, A., Augugliaro, R., Malaspina, A., Parolini, S., Moretta, L., Moretta, A., and Biassoni, R.: NKp44, a triggering receptor involved in tumor cell lysis by activated human natural killer cells, is a novel member of the immunoglobulin superfamily. J Exp Med 189: 787-796, 1999 126 Carlyle, J. R., Martin, A., Mehra, A., Attisano, L., Tsui, F. W., and Zuniga-Pflucker, J. C: Mouse NKR-P1B, a novel NK1.1 antigen with inhibitory function. J Immunol 162: 5917-5923, 1999 Carretero, M., Cantoni, C, Bellon, T., Bottino, C, Biassoni, R., Rodriguez, A., Perez- Villar, J. J., Moretta, L., Moretta, A., and Lopez-Botet, M.: The CD94 and NKG2-A C- type lectins covalently assemble to form a natural killer cell inhibitory receptor for HLA class I molecules. Eur J Immunol 27: 563-567, 1997 Carretero, M., Palmieri, G., Llano, M., Tullio, V., Santoni, A., Geraghty, D. E., and Lopez-Botet, M.: Specific engagement of the CD94/NKG2-A killer inhibitory receptor by the HLA-E class lb molecule induces SHP-1 phosphatase recruitment to tyrosine- phosphorylated NKG2-A: evidence for receptor function in heterologous transfectants. Eur J Immunol 28: 1280-1291, 1998 Cerwenka, A., Bakker, A. B., McClanahan, T., Wagner, J., Wu, J., Phillips, J. H., and Lanier, L. L.: Retinoic acid early inducible genes define a ligand family for the activating NKG2D receptor in mice. Immunity 12: 721-727, 2000 Chan, P. Y. and Takei, F.: Molecular cloning and characterization of a novel murine T cell surface antigen, YE1/48. J Immunol 142: 1727-1736, 1989 Chang, C, Rodriguez, A., Carretero, M., Lopez-Botet, M., Phillips, J. H., and Lanier, L. L.: Molecular characterization of human CD94: a type II membrane glycoprotein related to the C-type lectin superfamily. Eur J Immunol 25: 2433-2437, 1995 Colgan, D. F. and Manley, J. L.: Mechanism and regulation of mRNA polyadenylation. Genes Dev 11: 2755-2766, 1997 Colonna, M., Navarro, F., Bellon, T., Llano, M., Garcia, P., Samaridis, J., Angman, L., Cella, M., and Lopez-Botet, M.: A common inhibitory receptor for major histocompatibility complex class I molecules on human lymphoid and myelomonocytic cells. J Exp Med 186: 1809-1818, 1997 Colonna, M. and Samaridis, J.: Cloning of immunoglobulin-superfamily members associated with HLA-C and HLA-B recognition by human natural killer cells. Science 268: 405-408, 1995 Colonna, M., Samaridis, J., and Angman, L.: Molecular characterization of two novel C- type lectin-like receptors, one of which is selectively expressed in human dendritic cells. Eur J Immunol 30: 697-704, 2000 Corral, L., Hanke, T., Vance, R. E., Cado, D., and Raulet, D. H.: NK cell expression of the killer cell lectin-like receptor Gl (KLRG1), the mouse homolog of MAFA, is modulated by MHC class I molecules. Eur J Immunol 30: 920-930, 2000 127 D'Andrea, A., Chang, C, Franz-Bacon, K., McClanahan, T., Phillips, J. H., and Lanier, L. L.: Molecular cloning of NKB1. A natural killer cell receptor for HLA-B allotypes. J Immunol 155: 2306-2310, 1995 Dennis, G., Jr., Stephan, R. P., Kubagawa, H., and Cooper, M. D.: Characterization of paired Ig-like receptors in rats. J Immunol 163: 6371-6377, 1999 Depatie, C, Lee, S. H., Stafford, A., Avner, P., Belouchi, A., Gros, P., and Vidal, S. M.: Sequence-ready BAC contig, physical, and transcriptional map of a 2-Mb region overlapping the mouse chromosome 6 host-resistance locus cmvl. Genomics 66: 161- 174, 2000 Depatie, C, Muise, E., Lepage, P., Gros, P., and Vidal, S. M.: High-resolution linkage map in the proximity of the host resistance locus Cmvl. Genomics 39: 154-163, 1997 Diefenbach, A., Jamieson, A. M., Liu, S. D., Shastri, N., and Raulet, D. H.: Ligands for the murine NKG2D receptor: expression by tumour cells and activation of NK cells and macrophages. Nature Immunol 1: 119-126, 2000 DiSanto, J. P., Muller, W., Guy-Grand, D., Fischer, A., and Rajewsky, K.: Lymphoid development in mice with a targeted deletion of the interleukin 2 receptor gamma chain. Proc Natl Acad Sci USA 92: 377-381, 1995 Dissen, E., Berg, S. F., Westgaard, I. H., and Fossum, S.: Molecular characterization of a gene in the rat homologous to human CD94. Eur J Immunol 27: 2080-2086, 1997 Dissen, E., Ryan, J. C, Seaman, W. E., and Fossum, S.: An autosomal dominant locus, Nka, mapping to the Ly-49 region of a rat natural killer (NK) gene complex, controls NK cell lysis of allogeneic lymphocytes. J Exp Med 183: 2197-2207, 1996 Dorfman, J. R. and Raulet, D. H.: Acquisition of Ly49 receptor expression by developing natural killer cells. J Exp Med 187: 609-618,1998 Dorshkind, K., Pollack, S. B., Bosma, M. J., and Phillips, R. A.: Natural killer (NK) cells are present in mice with severe combined immunodeficiency (scid). J Immunol 134: 3798-3801, 1985 Fahlen, L., Khoo, N. K., Daws, M. R., and Sentman, C. L.: Location-specific regulation of transgenic Ly49A receptors by major histocompatibility complex class I molecules. Eur J Immunol 27: 2057-2065, 1997 Falco, M., Biassoni, R., Bottino, C, Vitale, M., Sivori, S., Augugliaro, R., Moretta, L., and Moretta, A.: Identification and molecular cloning of p75/AIRMl, a novel member of the sialoadhesin family that functions as an inhibitory receptor in human natural killer cells. JExp Med 190: 793-802, 1999a Falco, M., Cantoni, C, Bottino, C, Moretta, A., and Biassoni, R.: Identification of the rat homologue of the human NKp46 triggering receptor. Immunol Lett 68: 411-414, 1999b 128 Fleisher, G., Starr, S., Koven, N., Kamiya, H., Douglas, S. D., and Henle, W.: A non-x- linked syndrome with susceptibility to severe Epstein-Barr virus infections. J Pediatr 100: 727-730, 1982 Flouriot, G., Griffin, C, Kenealy, M., Sonntag-Buck, V., and Gannon, F.: Differentially expressed messenger RNA isoforms of the human estrogen receptor-alpha gene are generated by alternative splicing and promoter usage. Mol Endocrinol 12: 1939-1954, 1998 Forbes, C. A., Brown, M. G., Cho, R., Shellman, G. R., Yokoyama, W. M., and Scalzo, A. A.: The Cmvl host resistance locus is closely linked to the Ly49 multigene family within the natural killer cell gene complex on mouse chromosome 6. Genomics 41: 406- 413,1997 Frohman, M. A.: Rapid amplification of complementary DNA ends for generation of full- length complementary DNAs: thermal RACE. Methods Enzymol 218: 340-356, 1993 Fry, A. M., Lanier, L. L., and Weiss, A.: Phosphotyrosines in the killer cell inhibitory receptor motif of NKB1 are required for negative signaling and for association with protein tyrosine phosphatase 1C. J Exp Med 184: 295-300, 1996 Galy, A., Travis, M., Cen, D., and Chen, B.: Human T, B, natural killer, and dendritic cells arise from a common bone marrow progenitor cell subset. Immunity 3: 459-473, 1995 George, T. C, Mason, L. H., Ortaldo, J. R., Kumar, V., and Bennett, M.: Positive recognition of MHC class I molecules by the Ly49D receptor of murine NK cells. J Immunol 162: 2035-2043, 1999a George, T. C, Ortaldo, J. R., Lemieux, S., Kumar, V., and Bennett, M.: Tolerance and alloreactivity of the Ly49D subset of murine NK cells. J Immunol 163: 1859-1867, 1999b Georgopoulos, K., Bigby, M., Wang, J. H., Molnar, A., Wu, P., Winandy, S., and Sharpe, A.: The Ikaros gene is required for the development of all lymphoid lineages. Cell 79: 143-156, 1994 Gessner, J. E., Grussenmeyer, T., Dumbsky, M., and Schmidt, R. E.: Separate promoters from proximal and medial control regions contribute to the natural killer cell-specific transcription of the human FcgammaRIII-A (CD 16-A) receptor gene. J Biol Chem 271: 30755-30764, 1996 Giorda, R., Rudert, W. A., Vavassori, C, Chambers, W. H., Hiserodt, J. C, and Trucco, M.: NKR-P1, a signal transduction molecule on natural killer cells. Science 249: 1298- 1300, 1990 Giorda, R. and Trucco, M.: Mouse NKR-P1. A family of genes selectively coexpressed in adherent lymphokine-activated killer cells. J Immunol 147: 1701-1708, 1991 129 Gosselin, P., Makrigiannis, A. P., Nalewaik, R., and Anderson, S. K.: Characterization of the Ly49I promoter. Immunogenetics 51: 326-331, 2000 Gosselin, P., Mason, L. H., Willette-Brown, J., Ortaldo, J. R., McVicar, D. W., and Anderson, S. K.: Induction of DAP 12 phosphorylation, calcium mobilization, and cytokine secretion by Ly49H. JLeukoc Biol 66: 165-171, 1999 Gray, N. K. and Wickens, M.: Control of translation initiation in animals. Annu Rev Cell DevBioll4: 399-458, 1998 Green, M. R.: Biochemical mechanisms of constitutive and regulated pre-mRNA splicing. Ann Rev Cell Biol 7: 559-599, 1991 Guthmann, M. D., Tal, M., and Pecht, I.: A secretion inhibitory signal transduction molecule on mast cells is another C-type lectin. Proc Natl Acad Sci USA 92: 9397-9401, 1995 Hackett, J., Jr., Bosma, G. C, Bosma, M. J., Bennett, M., and Kumar, V.: Transplantable progenitors of natural killer cells are distinct from those of T and B lymphocytes. Proc Natl Acad Sci USA 83: 3427-3431, 1986 Haller, O. and Wigzell, H.: Suppression of natural killer cell activity with radioactive strontium: effector cells are marrow dependent. J Immunol 118: 1503-1506, 1977 Hamann, J., Fiebig, H., and Strauss, M.: Expression cloning of the early activation antigen CD69, a type II integral membrane protein with a C-type lectin domain. J Immunol 150: 4920-4927, 1993 Hamann, J., Montgomery, K. T., Lau, S., Kucherlapati, R., and van Lier, R. A.: AICL: a new activation-induced antigen encoded by the human NK gene complex. Immunogenetics 45: 295-300, 1997 Hanke, T., Corral, L., Vance, R. E., and Raulet, D. H.: 2F1 antigen, the mouse homolog of the rat "mast cell function-associated antigen", is a lectin-like type II transmembrane receptor expressed by natural killer cells. Eur J Immunol 28: 4409-4417, 1998 Hanke, T., Takizawa, H., McMahon, C. W., Busch, D. H., Pamer, E. G., Miller, J. D., Airman, J. D., Liu, Y., Cado, D., Lemonnier, F. A., Bjorkman, P. J., and Raulet, D. H.: Direct assessment of MHC class I binding by seven Ly49 inhibitory NK cell receptors. Immunity 11: 67-77, 1999 Hansen, T. H. and Sachs, D. H.: The Major Histocompatibility Complex. In W. E. Paul (ed.): Fundamental Immunology, pp. 445-487, Raven Press Ltd., New York, 1989 Harel-Bellan, A., Quillet, A., Marchiol, C, DeMars, R., Tursz, T., and Fradelizi, D.: Natural killer susceptibility of human cells may be regulated by genes in the HLA region on chromosome 6. Proc Natl Acad Sci USA 83: 5688-5692, 1986 130 Held, W., Dorfman, J. R., Wu, M. F., and Raulet, D. H.: Major histocompatibility complex class I-dependent skewing of the natural killer cell Ly49 receptor repertoire. Eur J Immunol 26: 2286-2292, 1996 Held, W. and Kunz, B.: An allele-specific, stochastic gene expression process controls the expression of multiple Ly49 family genes and generates a diverse, MHC-specific NK cell receptor repertoire. Eur J Immunol 28: 2407-2416, 1998 Held, W., Kunz, B., Ioannidis, V., and Lowin-Kropf, B.: Mono-allelic Ly49 NK cell receptor expression. Semin Immunol 11: 349-355, 1999a Held, W., Kunz, B., Lowin-Kropf, B., van de Wetering, M., and Clevers, H.: Clonal acquisition of the Ly49A NK cell receptor is dependent on the trans-acting factor TCF-1. Immunity 11: 433-442, 1999b Held, W. and Raulet, D. H.: Ly49A transgenic mice provide evidence for a major histocompatibility complex-dependent education process in natural killer cell development. JExp Med 185: 2079-2088, 1997 Held, W., Roland, J., and Raulet, D. H.: Allelic exclusion of Ly49-family genes encoding class I MHC-specific receptors on NK cells. Nature 376: 355-358, 1995 Herberman, R. B. and Ortaldo, J. R.: Natural killer cells: their roles in defenses against disease. Science 214: 24-30, 1981 Heusel, J. W., Wesselschmidt, R. L., Shresta, S., Russell, J. H., and Ley, T. J.: Cytotoxic lymphocytes require granzyme B for the rapid induction of DNA fragmentation and apoptosis in allogeneic target cells. Cell 76: 977-987, 1994 Ho, E. L., Heusel, J. W., Brown, M. G., Matsumoto, K., Scalzo, A. A., and Yokoyama, W. M.: Murine Nkg2d and Cd94 are clustered within the natural killer complex and are expressed independently in natural killer cells. Proc Natl Acad Sci USA 95: 6320-6325, 1998 Houchins, J. P., Lanier, L. L., Niemi, E. C, Phillips, J. H., and Ryan, J. C: Natural killer cell cytolytic activity is inhibited by NKG2-A and activated by NKG2-C. J Immunol 158: 3603-3609, 1997 Houchins, J. P., Yabe, T., McSherry, C, and Bach, F. H.: DNA sequence analysis of NKG2, a family of related cDNA clones encoding type II integral membrane proteins on human natural killer cells. JExp Med 173: 1017-1020, 1991 Iizuka, K., Chaplin, D. D., Wang, Y., Wu, Q., Pegg, L. E., Yokoyama, W. M., and Fu, Y. X.: Requirement for membrane lymphotoxin in natural killer cell development. Proc Natl Acad Sci USA 96: 6336-6340, 1999 131 Johansson, M. H., Hoglund, E., Nakamura, M. C, Ryan, J. C, and Hoglund, P.: Alphal/alpha2 domains of H-2D(d), but not H-2L(d), induce "missing self reactivity in vivo—no effect of H-2L(d) on protection against NK cells expressing the inhibitory receptor Ly49G2. Eur J Immunol 28: 4198-4206, 1998 Kagi, D., Ledermann, B., Burki, K., Seiler, P., Odermatt, B., Olsen, K. J., Podack, E. R., Zinkernagel, R. M., and Hengartner, H.: Cytotoxicity mediated by T cells and natural killer cells is greatly impaired in perforin-deficient mice. Nature 369: 31-37, 1994 Karlhofer, F. M, Ribaudo, R. K., and Yokoyama, W. M.: MHC class I alloantigen specificity of Ly49 and IL-2-acitivated NK cells. Nature 358: 66-70, 1992 Karre, K., Klein, G. O., Kiessling, R., Klein, G., and Roder, J. C: Low natural in vivo resistance to syngeneic leukaemias in natural killer-deficient mice. Nature 284: 624-626, 1980 Karre, K., Ljunggren, H. G., Piontek, G., and Kiessling, R.: Selective rejection of H-2- deficient lymphoma variants suggest alternative immune defence strategy. Nature 319: 675-678, 1986 Kay, R. and Humphries, R., K.: New vectors and procedures for isolating cDNAs encoding cell surface proteins by expression cloning in COS cells. Methods Mol. Cell. Biol. 2: 254-265, 1991 Kennedy, M. K., Glaccum, M., Brown, S. N., Butz, E. A., Viney, J. L., Embers, M., Matsuki, N., Charrier, K., Sedger, L., Willis, C. R., Brasel, K., Morrissey, P. J., Stocking, K., Schuh, J. C, Joyce, S., and Peschon, J. J.: Reversible defects in natural killer and memory CD8 T cell lineages in interleukin 15-deficient mice. J Exp Med 191: 771-780, 2000 Khakoo, S. I., Rajalingam, R., Shum, B. P., Weidenbach, K., Flodin, L., Muir, D. G., Canavez, F., Cooper, S. L., Valiante, N. M., Lanier, L. L., and Parham, P.: Rapid evolution of NK cell receptor systems demonstrated by comparison of chimpanzees and humans. Immunity 12: 687-698, 2000 Kim, S., Iizuka, K., Aguila, H. L., Weissman, I. L., and Yokoyama, W. M.: In vivo natural killer cell activities revealed by natural killer cell-deficient mice. Proc Natl Acad Sci USA 97: 2731-2736, 2000 Klein, J.: Natural history of the major histocompatibility complex. Wiley, New York, 1986 Kondo, M., Weissman, I. L., and Akashi, K.: Identification of clonogenic common lymphoid progenitors in mouse bone marrow. Cell 91: 661-672, 1997 Kubagawa, H., Burrows, P. D., and Cooper, M. D.: A novel pair of immunoglobulin-like receptors expressed by B cells and myeloid cells. Proc Natl Acad Sci USA 94: 5261- 5266, 1997 132 Kubo, S., Itoh, Y., Ishikawa, N., Nagasawa, R., Mitarai, T., and Maruyama, N.: The gene encoding mouse lymphocyte antigen Ly-49: structural analysis and the 5'-flanking sequence. Gene 136: 329-331, 1993 Kubo, S., Nagasawa, R., Nishimura, H., Shigemoto, K., and Maruyama, N.: ATF-2- binding regulatory element is responsible for the Ly49A expression in murine T lymphoid line, EL-4. Biochim Biophys Acta 1444: 191-200, 1999 Kubota, A., Kubota, S., Lohwasser, S., Mager, D. L., and Takei, F.: Diversity of NK cell receptor repertoire in adult and neonatal mice. J Immunol 163: 212-216, 1999 Kumaresan, P. R., Stepp, S. E., Bennett, M., Kumar, V., and Mathew, P. A.: Molecular cloning of transmembrane and soluble forms of a novel rat natural killer cell receptor related to 2B4. Immunogenetics 51: 306-313, 2000 Kundig, T. M., Schorle, H., Bachmann, M. F., Hengartner, FL, Zinkernagel, R. M., and Horak, I.: Immune responses in interleukin-2-deficient mice. Science 262: 1059-1061, 1993 Kung, S. K., Su, R. C, Shannon, J., and Miller, R. G.: The NKR-P1B gene product is an inhibitory receptor on SJL/J NK cells. J Immunol 162: 5876-5887, 1999 Lanier, L. L.: NK cells: from no receptors to too many. Immunity 6: 371-378, 1997 Lanier, L. L., Chang, C, Azuma, M., Ruitenberg, J. J., Hemperly, J. J., and Phillips, J. H.: Molecular and functional analysis of human natural killer cell-associated neural cell adhesion molecule (N-CAM/CD56). J Immunol 146: 4421-4426, 1991 Lanier, L. L., Chang, C, and Phillips, J. H.: Human NKR-P1 A. A disulfide-linked homodimer of the C-type lectin superfamily expressed by a subset of NK and T lymphocytes. J Immunol 153: 2417-2428, 1994 Lanier, L. L., Corliss, B., Wu, J., and Phillips, J. H.: Association of DAP12 with activating CD94/NKG2C NK cell receptors. Immunity 8: 693-701, 1998a Lanier, L. L., Corliss, B. C, Wu, J., Leong, C, and Phillips, J. H.: Immunoreceptor DAP 12 bearing a tyrosine-based activation motif is involved in activating NK cells. Nature 391: 703-707, 1998b Lanier, L. L., Le, A. M., Civin, C. I., Loken, M. R., and Phillips, J. H.: The relationship of CD 16 (Leu-11) and Leu-19 (NKH-1) antigen expression on human peripheral blood NK cells and cytotoxic T lymphocytes. J Immunol 136: 4480-4486, 1986 Lazetic, S., Chang, C, Houchins, J. P., Lanier, L. L., and Phillips, J. H.: Human natural killer cell receptors involved in MHC class I recognition are disulfide-linked heterodimers of CD94 and NKG2 subunits. J Immunol 157: 4741-4745, 1996 133 Lee, C. K., Rao, D. T., Gertner, R., Gimeno, R., Frey, A. B., and Levy, D. E.: Distinct requirements for IFNs and STAT1 in NK cell function. J Immunol 165: 3571-3577, 2000 Lee, N., Goodlett, D. R., Ishitani, A., Marquardt, H., and Geraghty, D. E.: HLA-E surface expression depends on binding of TAP-dependent peptides derived from certain HLA class I signal sequences. J Immunol 160: 4951-4960, 1998a Lee, N., Llano, M., Carretero, M., Ishitani, A., Navarro, F., Lopez-Botet, M, and Geraghty, D. E.: HLA-E is a major ligand for the natural killer inhibitory receptor CD94/NKG2A. Proc Natl Acad Sci USA 95: 5199-5204, 1998b Leibson, P.: Signal transduction during natural killer cell activation: inside the mind of a killer. Immunity 6: 655-661, 1997 Leibson, P. J.: Cytotoxic lymphocyte recognition of HLA-E: utilizing a nonclassical window to peer into classical MHC. Immunity 9: 289-294, 1998 Lemieux, S., Ouellet-Talbot, F., Lusignan, Y., Morelli, L., Labreche, N., Gosselin, P., and Lecomte, J.: Identification of murine natural killer cell subsets with monoclonal antibodies derived from 129 anti-C57BL/6 immune spleen cells. Cell. Immunol. 134: 191-204, 1991 Levy, E. M., Kumar, V., and Bennett, M.: Natural killer activity and suppressor cells in irradiated mice repopulated with a mixture of cells from normal and 89Sr-treated donors. J Immunol 127: 1428-1432, 1981 Lian, R. H., Li, Y., Kubota, S., Mager, D. L., and Takei, F.: Recognition of class I MHC by NK receptor Ly-49C: identification of critical residues. J Immunol 162: 7271-7276, 1999 Ljunggren, H. G. and Karre, K.: In search of the 'missing self: MHC molecules and NK cell recognition. Immunol Today 11: 237-244, 1990 Ljunggren, H. G., Sturmhofel, K., Wolpert, E., Hammerling, G. J., and Karre, K.: Transfection of beta 2-microglobulin restores IFN-mediated protection from natural killer cell lysis in YAC-1 lymphoma variants. J Immunol 145: 380-386, 1990 Lodolce, J. P., Boone, D. L., Chai, S., Swain, R. E., Dassopoulos, T., Trettin, S., and Ma, A.: IL-15 receptor maintains lymphoid homeostasis by supporting lymphocyte homing and proliferation. Immunity 9: 669-676, 1998 Lohwasser, S., Hande, P., Mager, D. L., and Takei, F.: Cloning of murine NKG2A, B and C: second family of C-type lectin receptors on murine NK cells. Eur J Immunol 29: 755- 761,1999 Long, E. O., Colonna, M., and Lanier, L. L.: Inhibitory MHC class I receptors on NK and T cells: a standard nomenclature. Immunol Today 17: 100, 1996 134 Lopez-Cabrera, M., Santis, A. G., Fernandez-Ruiz, E., Blacher, R., Esch, F., Sanchez- Mateos, P., and Sanchez-Madrid, F.: Molecular cloning, expression, and chromosomal localization of the human earliest lymphocyte activation antigen AIM/CD69, a new member of the C-type animal lectin superfamily of signal-transmitting receptors. JExp Med 178: 537-547, 1993 Lowin-Kropf, B. and Held, W.: Positive impact of inhibitory Ly49 receptor-MHC class I interaction on NK cell development. J Immunol 165: 91-95, 2000 Mager, D. L. and Goodchild, N. L.: Homologous recombination between the LTRs of a human retro virus-like element causes a 5-kb deletion in two siblings. Am J Human Genet 45: 848-854, 1989 Magram, J., Connaughton, S. E., Warrier, R. R., Carvajal, D. M., Wu, C. Y., Ferrante, J., Stewart, C, Sarmiento, U., Faherty, D. A., and Gately, M. K.: IL-12-deficient mice are defective in IFN gamma production and type 1 cytokine responses. Immunity 4: 471-481, 1996 Makrigiannis, A. P. and Anderson, S. K.: Ly49 gene expression in different inbred mouse strains. Immunol Res 21: 39-47, 2000 Makrigiannis, A. P., Etzler, J., Winkler-Pickett, R., Mason, A., Ortaldo, J. R., and Anderson, S. K.: Identification of the Ly49L protein: evidence for activating counterparts to inhibitory Ly49 proteins. JLeukoc Biol 68: 765-771, 2000 Makrigiannis, A. P., Gosselin, P., Mason, L. H., Taylor, L. S., McVicar, D. W., Ortaldo, J. R., and Anderson, S. K.: Cloning and characterization of a novel activating Ly49 closely related to Ly49A. J Immunol 163: 4931-4938, 1999 Manoussaka, M. S., Smith, R. J., Conlin, V., Toomey, J. A., and Brooks, C. G.: Fetal mouse NK cell clones are deficient in Ly49 expression, share a common broad lytic specificity, and undergo continuous and extensive diversification in vitro. J Immunol 160: 2197-2206, 1998 Martin, A. M., Freitas, E. M., Witt, C. S., and Christiansen, F. T.: The genomic organization and evolution of the natural killer immunoglobulin-like receptor (KIR) gene cluster. Immunogenetics 51: 268-280, 2000 Mason, L. H., Anderson, S. K., Yokoyama, W. M., Smith, H. R., Winkler-Pickett, R., and Ortaldo, J. R.: The Ly-49D receptor activates murine natural killer cells. JExp Med 184: 2119-2128, 1996 Mason, L. H., Gosselin, P., Anderson, S. K., Fogler, W. E., Ortaldo, J. R., and McVicar, D. W.: Differential tyrosine phosphorylation of inhibitory versus activating Ly-49 receptor proteins and their recruitment of SHP-1 phosphatase. J Immunol 159: 4187- 4196,1997 135 Mason, L. H., Ortaldo, J. R., Young, H. A., Kumar, V., Bennett, M., and Anderson, S. K.: Cloning and functional characteristics of murine large granular lymphocyte-1: a member of the Ly-49 gene family (Ly-49G2). J Exp Med 182: 293-303, 1995 Mason, L. H., Willette-Brown, J., Anderson, S. K., Gosselin, P., Shores, E. W., Love, P. E., Ortaldo, J. R., and McVicar, D. W.: Characterization of an associated 16-kDa tyrosine phosphoprotein required for Ly-49D signal transduction. J Immunol 160: 4148-4152, 1998 Medstrand, P., Lindeskog, M., and Blomberg, J.: Expression of human endogenous retroviral sequences in peripheral blood mononuclear cells of healthy individuals. J Gen Virol 73: 2463-2466, 1992 Meyaard, L., Adema, G. J., Chang, C, Woollatt, E., Sutherland, G. R., Lanier, L. L., and Phillips, J. H.: LAIR-1, a novel inhibitory receptor expressed on human mononuclear leukocytes. Immunity 7: 283-290, 1997 Michaelsson, J., Achour, A., Salcedo, M., Kase-Sjostrom, A., Sundback, J., Harris, R. A., and Karre, K.: Visualization of inhibitory Ly49 receptor specificity with soluble major histocompatibility complex class I tetramers. Eur J Immunol 30: 300-307, 2000 Michie, A. M., Carlyle, J. R., Schmitt, T. M., Ljutic, B., Cho, S. K., Fong, Q., and Zuniga-Pflucker, J. C: Clonal characterization of a bipotent T cell and NK cell progenitor in the mouse fetal thymus. J Immunol 164: 1730-1733, 2000 Mingari, M. C, Schiavetti, F., Ponte, M., Vitale, C, Maggi, E., Romagnani, S., Demarest, J., Pantaleo, G., Fauci, A. S., and Moretta, L.: Human CD8+ T lymphocyte subsets that express HLA class I-specific inhibitory receptors represent oligoclonally or monoclonally expanded cell populations. Proc Natl Acad Sci USA 93: 12433-12438, 1996 Moore, T. A., von Freeden-Jeffry, U., Murray, R., and Zlotnik, A.: Inhibition of gamma delta T cell development and early thymocyte maturation in IL-7 -/- mice. J Immunol 157: 2366-2373, 1996 Moretta, A., Sivori, S., Vitale, M., Pende, D., Morelli, L., Augugliaro, R., Bottino, C, and Moretta, L.: Existence of both inhibitory (p58) and activatory (p50) receptors for HLA-C molecules in human natural killer cells. J Exp Med 182: 875-884, 1995 Moretta, A., Vitale, M., Bottino, C, Orengo, A. M., Morelli, L., Augugliaro, R., Barbaresi, M., Ciccone, E., and Moretta, L.: P58 molecules as putative receptors for major histocompatibility complex (MHC) class I molecules in human natural killer (NK) cells. Anti-p58 antibodies reconstitute lysis of MHC class I-protected cells in NK clones displaying different specificities. J Exp Med 178: 597-604, 1993 Moretta, L.: Introduction: NK cells: origin, receptors and specificity. Semin Immunol 7: 57-59, 1995 136 Moretta, L., Ciccone, E., Moretta, A., Hoglund, P., Ohlen, C, and Karre, K.: Allorecognition by NK cells: nonself or no self? Immunol Today 13: 300-306, 1992 Nakajima, H. and Colonna, M.: 2B4: an NK cell activating receptor with unique specificity and signal transduction mechanism. Hum Immunol 61: 39-43, 2000 Nakamura, M. C, Linnemeyer, P. A., Niemi, E. C, Mason, L. H., Ortaldo, J. R., Ryan, J. C, and Seaman, W. E.: Mouse Ly-49D recognizes H-2Dd and activates natural killer cell cytotoxicity. JExp Med 189: 493-500, 1999 Nakamura, M. C, Niemi, E. C, Fisher, M. J., Shultz, L. D., Seaman, W. E., and Ryan, J. C: Mouse Ly-49A interrupts early signaling events in natural killer cell cytotoxicity and functionally associates with the SHP-1 tyrosine phosphatase. J Exp Med 185: 673-684, 1997 Ogasawara, K., Hida, S., Azimi, N., Tagaya, Y., Sato, T., Yokochi-Fukuda, T., Waldmann, T: A., Taniguchi, T., and Taki, S.: Requirement for IRF-1 in the microenvironment supporting development of natural killer cells [published erratum appears in Nature 1998 Apr 23;392(6678):843]. Nature 391: 700-703, 1998 Ohlen, C, Kling, G., Hoglund, P., Hansson, M., Scangos, G., Bieberich, C, Jay, G., and Karre, K.: Prevention of allogeneic bone marrow graft rejection by H-2 transgene in donor mice. Science 246: 666-668, 1989 Ohteki, T., Yoshida, H., Matsuyama, T., Duncan, G. S., Mak, T. W., and Ohashi, P. S.: The transcription factor interferon regulatory factor 1 (IRF-1) is important during the maturation of natural killer 1.1+ T cell receptor-alpha/beta+ (NK1+ T) cells, natural killer cells, and intestinal intraepithelial T cells. J Exp Med 187: 967-972, 1998 Olcese, L., Lang, P., Vely, F., Cambiaggi, A., Marguet, D., Blery, M., Hippen, K. L., Biassoni, R., Moretta, A., Cambier, J. C, and Vivier, E.: Human and mouse killer-cell inhibitory receptors recruit PTP1C and PTP1D protein tyrosine phosphatases. J Immunol 755:4531-4534, 1996 Olsson, M. Y., Karre, K., and Sentman, C. L.: Altered phenotype and function of natural killer cells expressing the major histocompatibility complex receptor Ly-49 in mice transgenic for its ligand. Proc Natl Acad Sci USA 92: 1649-1653, 1995 Olsson-Alheim, M. Y., Sundback, J., Karre, K., and Sentman, C. L.: The MHC class I molecule H-2Dp inhibits murine NK cells via the inhibitory receptor Ly49A. J Immunol 162: 7010-7014, 1999 Ortaldo, J. R., Mason, A. T., Winkler-Pickett, R., Raziuddin, A., Murphy, W. J., and Mason, L. H.: Ly-49 receptor expression and functional analysis in multiple mouse strains. JLeukoc Biol 66: 512-520, 1999 Parham, P.: Functions for MHC class I carbohydrates inside and outside the cell. Trends Biochem Sci 21: 427-433, 1996 137 Parham, P. and Ohta, T.: Population biology of antigen presentation by MHC class I molecules. Science 272: 61-1A, 1996 Pende, D., Parolini, S., Pessino, A., Sivori, S., Augugliaro, R., Morelli, L., Marcenaro, E., Accame, L., Malaspina, A., Biassoni, R., Bottino, C, Moretta, L., and Moretta, A.: Identification and molecular characterization of NKp30, a novel triggering receptor involved in natural cytotoxicity mediated by human natural killer cells. JExp Med 190: 1505-1516, 1999 Perussia, B., Trinchieri, G., Jackson, A., Warner, N. L., Faust, J., Rumpold, H., Kraft, D., and Lanier, L. L.: The Fc receptor for IgG on human natural killer cells: phenotypic, functional, and comparative studies with monoclonal antibodies. J Immunol 133: 180- 189,1984 Pessino, A., Sivori, S., Bottino, C, Malaspina, A., Morelli, L., Moretta, L., Biassoni, R., and Moretta, A.: Molecular cloning of NKp46: a novel member of the immunoglobulin superfamily involved in triggering of natural cytotoxicity. JExp Med 188: 953-960, 1998 Phillips, J. H., Chang, C, Mattson, J., Gumperz, J. E., Parham, P., and Lanier, L. L.: CD94 and a novel associated protein (94AP) form a NK cell receptor involved in the recognition of HLA-A, HLA-B, and HLA-C allotypes. Immunity 5: 163-172, 1996 Plougastel, B. and Trowsdale, J.: Cloning of NKG2-F, a new member of the NKG2 family of human natural killer eel receptor genes. Eur J Immunol 27: 2835-2839, 1997 Plougastel, B. and Trowsdale, J.: Sequence analysis of a 62-kb region overlapping the human KLRC cluster of genes. Genomics 49: 193-199, 1998 Poggi, A., Rubartelli, A., Moretta, L., and Zocchi, M. R.: Expression and function of NKRP1A molecule on human monocytes and dendritic cells. Eur J Immunol 27: 2965- 2970, 1997 Poggi, A., Sargiacomo, M., Biassoni, R., Pella, N., Sivori, S., Revello, V., Costa, P., Valtieri, M., Russo, G., Mingari, M. C, and et al.: Extrathymic differentiation of T lymphocytes and natural killer cells from human embryonic liver precursors. Proc Natl Acad Sci USA 90: 4465-4469, 1993 Raulet, D. H., Held, W., Correa, I., Dorfman, J. R., Wu, M. F., and Corral, L.: Specificity, tolerance and developmental regulation of natural killer cells defined by expression of class I-specific Ly49 receptors. Immunol Rev 155: 41-52, 1997 Reed, K. and Mann, D. A.: Rapid transfer of DNA from agarose gels to nylon membranes. Nuc Acids Res 13: 7207-7221, 1985 Renedo, M., Arce, I., Montgomery, K., Roda-Navarro, P., Lee, E., Kucherlapati, R., and Fernandez-Ruiz, E.: A sequence-ready physical map of the region containing the human natural killer gene complex on chromosome 12pl2.3-pl3.2. Genomics 65: 129-136, 2000 138 Renedo, M., Arce, I., Rodriguez, A., Carretero, M., Lanier, L. L., Lopez-Botet, M., and Fernandez-Ruiz, E.: The human natural killer gene complex is located on chromosome 12pl2-pl3. Immunogenetics 46: 307-311, 1997 Robinson, M. A. and Kindt, T. J.: Major Histocompatibility Complex Antigens and Genes. In W. E. Paul (ed.): Fundamental Immunology, pp. 489-538, Raven Press Ltd., New York, 1989 Robinson, W. H., Ying, H., Miceli, M. C, and Parnes, J. R.: Extensive polymorphism in the extracellular domain of the mouse B cell differentiation antigen Lyb-2/CD72. The Journal of Immunology 149: 880-886, 1992 Roda-Navarro, P., Arce, I., Renedo, M., Montgomery, K., Kucherlapati, R., and Fernandez-Ruiz, E.: Human KLRF1, a novel member of the killer cell lectin-like receptor gene family: molecular characterization, genomic structure, physical mapping to the NK gene complex and expression analysis. Eur J Immunol 30: 568-576, 2000 Rodewald, H. R., Moingeon, P., Lucich, J. L., Dosiou, C, Lopez, P., and Reinherz, E. L.: A population of early fetal thymocytes expressing Fc gamma RII/III contains precursors of T lymphocytes and natural killer cells. Cell 69: 139-150, 1992 Rojo, S., Burshtyn, D. N., Long, E. O., and Wagtmann, N.: Type I transmembrane receptor with inhibitory function in mouse mast cells and NK cells. J Immunol 158: 9-12, 1997 Ross, J.: Control of messenger RNA stability in higher eukaryotes. Trends Genet 12: 171-175, 1996 Roth, C, Carlyle, J. R., Takizawa, H., and Raulet, D. H.: Clonal acquisition of inhibitory Ly49 receptors on developing NK cells is successively restricted and regulated by stromal class I MHC. Immunity 13: 143-153, 2000 Ryan, J. C, Niemi, E. C, Goldfien, R. D., Hiserodt, J. C, and Seaman, W. E.: NKR-P1, an activating molecule on rat natural killer cells, stimulates phosphoinositide turnover and a rise in intracellular calcium. J Immunol 147: 3244-3250, 1991 Ryan, J. C, Niemi, E. C, Nakamura, M. C, and Seaman, W. E.: NKR-P1A is a target- specific receptor that activates natural killer cell cytotoxicity. J Exp Med 181: 1911-1915, 1995 Ryan, J. C. and Seaman, W. E.: Divergent functions of lectin-like receptors on NK cells. Immunol Rev 155: 79-89, 1997 Ryan, J. C, Turck, J., Niemi, E. C, Yokoyama, W. M., and Seaman, W. E.: Molecular cloning of the NK1.1 antigen, a member of the NKR-P1 family of natural killer cell activation molecules. J Immunol 149: 1631-1635, 1992 139 Salcedo, M., Bousso, P., Ljunggren, H. G., Kourilsky, P., and Abastado, J. P.: The Qa-lb molecule binds to a large subpopulation of murine NK cells. Eur J Immunol 28: 4356- 4361, 1998 Salcedo, M., Diehl, A. D., Olsson-Alheim, M. Y., Sundback, J., Van Kaer, L., Karre, K., and Ljunggren, H. G.: Altered expression of Ly49 inhibitory receptors on natural killer cells from MHC class I-deficient mice. J Immunol 158: 3174-3180, 1997 Samaridis, J. and Colonna, M.: Cloning of novel immunoglobulin superfamily receptors expressed on human myeloid and lymphoid cells: structural evidence for new stimulatory and inhibitory pathways. Eur J Immunol 27: 660-665, 1997 Sanchez, M. J., Muench, M. O., Roncarolo, M. G., Lanier, L. L., and Phillips, J. H.: Identification of a common T/natural killer cell progenitor in human fetal thymus. J Exp Med 180: 569-576, 1994 Sancho, D., Santis, A. G., Alonso-Lebrero, J. L., Viedma, F., Tejedor, R., and Sanchez- Madrid, F.: Functional analysis of ligand-binding and signal transduction domains of CD69 and CD23 C-type lectin leukocyte receptors. J Immunol 165: 3868-3875, 2000 Scalze, A. A., Fitzgerald, N. A., Simmons, A., La Vista, A. B., and Shellam, G. R.: Cmv- 1, a genetic locus that controls murine cytomegalovirus replication in the spleen. JExp Med: 171(5): 1469-1483, 1990. Scalzo, A. A., Lyons, P. A., Fitzgerald, N. A., Forbes, C. A., Yokoyama, W. M., and Shellam, G. R.: Genetic mapping of Cmvl in the region of mouse chromosome 6 encoding the NK gene complex-associated loci Ly49 and musNKR-Pl. Genomics 27: 435-441, 1995 Schatzle, J. D., Sheu, S., Stepp, S. E., Mathew, P. A., Bennett, M., and Kumar, V.: Characterization of inhibitory and stimulatory forms of the murine natural killer cell receptor 2B4. Proc Natl Acad Sci USA 96: 3870-3875, 1999 Seaman, W. E., Sleisenger, M., Eriksson, E., and Koo, G. C: Depletion of natural killer cells in mice by monoclonal antibody to NK-1.1. Reduction in host defense against malignancy without loss of cellular or humoral immunity. J Immunol 138: 4539-4544, 1987 Selvakumar, A., Steffens, U., Palanisamy, N., Chaganti, R. S., and Dupont, B.: Genomic organization and allelic polymorphism of the human killer cell inhibitory receptor gene KIR103. Tissue Antigens 49: 564-573, 1997 Shellam, G. R., Allan, J. E., Papadimitriou, J. M., and Bancroft, G. J.: Increased susceptibility to cytomegalovirus infection in beige mutant mice. Proc Natl Acad Sci U S A 78: 5104-5108, 1981 Silver, E. T., Elliott, J. F., and Kane, K. P.: Alternatively spliced Ly-49D and H transcripts are found in IL-2-activated NK cells. Immunogenetics 44: 478-482, 1996 140 Silver, E. T., Gong, D. E., Chang, C. S., Amrani, A., Santamaria, P., and Kane, K. P.: Ly- 49P activates NK-mediated lysis by recognizing H-2Dd. J Immunol 165: 1771-1781, 2000 Silver, E. T., Lau, J. C, and Kane, K. P.: Molecular cloning of mouse NKG2A and C. Immunogenetics 49: 727-730, 1999 Sivakumar, P. V., Bennett, M., and Kumar, V.: Fetal and neonatal NK1.1+ Ly-49- cells can distinguish between major histocompatibility complex class I(hi) and class I(lo) target cells: evidence for a Ly-49-independent negative signaling receptor. Eur J Immunol 27: 3100-3104, 1997 Sivakumar, P. V., Gunturi, A., Salcedo, M., Schatzle, J. D., Lai, W. C, Kurepa, Z., Pitcher, L., Seaman, M. S., Lemonnier, F. A., Bennett, M., Forman, J., and Kumar, V.: Cutting edge: expression of functional CD94/NKG2A inhibitory receptors on fetal NK1 .l+Ly-49- cells: a possible mechanism of tolerance during NK cell development. J Immunol 162: 6976-6980, 1999 Sivori, S., Vitale, M., Morelli, L., Sanseverino, L., Augugliaro, R., Bottino, C, Moretta, L., and Moretta, A.: p46, a novel natural killer cell-specific surface molecule that mediates cell activation. JExp Med 186: 1129-1136, 1997 Smith, H. R., Chuang, H. H., Wang, L. L., Salcedo, M., Heusel, J. W., and Yokoyama, W. M.: Nonstochastic coexpression of activation receptors on murine natural killer cells. JExp Med 191: 1341-1354, 2000 Smith, H. R. C, Karlhofer, F. M., and Yokayama, W. M.: Ly-49 multigene family expressed by IL-2-activated NK cells. J Immunol 153: 1068-1079, 1994 Smith, K. M., Wu, J., Bakker, A. B., Phillips, J. H., and Lanier, L. L.: Ly-49D and Ly- 49H associate with mouse DAP12 and form activating receptors. J Immunol 161: 7-10, 1998 Sobanov, Y., Glienke, J., Brostjan, C, Lehrach, H., Francis, F., and Hofer, E.: Linkage of the NKG2 and CD94 receptor genes to D12S77 in the human natural killer gene complex. Immunogenetics 49: 99-105, 1999 Sonenberg, N.: mRNA translation: influence of the 5' and 3' untranslated regions. Curr Opin Genet Dev 4: 310-315,1994 Stoneman, E. R., Bennett, M., An, J., Chesnut, K. A., Wakeland, E. K., Scheerer, J. B., Siciliano, M. J., Kumar, V., and Mathew, P. A.: Cloning and characterization of 5E6 (Ly- 49C), a receptor molecule expressed on a subset of murine natural killer cells. JExp Med 182: 305-313, 1995 Stroynowski, I. and Forman, J.: Novel molecules related to MHC antigens. Curr Opin Immunol 7: 97-102, 1995 141 Sundback, J., Karre, K., and Sentman, C. L.: Cloning of minimally divergent allelic forms of the natural killer (NK) receptor Ly-49C, differentially controlled by host genes in the MHC and NK gene complexes. J Immunol 157: 3936-3942, 1996 Suto, Y., Yabe, T., Maenaka, K., Tokunaga, K., Tadakoro, K., and Juji, T.: The human natural killer gene complex (NKC) is located on chromosome 12pl3.1-pl3.2. Immunogenetics 46: 159-162, 1997 Suzuki, H., Duncan, G. S., Takimoto, H., and Mak, T. W.: Abnormal development of intestinal intraepithelial lymphocytes and peripheral natural killer cells in mice lacking the IL-2 receptor beta chain. JExp Med 185: 499-505, 1997 Takei, F., Brennan, J., and Mager, D. L.: The Ly-49 family: genes, proteins and recognition of class I MHC. Immunol Rev 155: 61-11, 1997 Talmadge, J. E., Meyers, K. M., Prieur, D. J., and Starkey, J. R.: Role of NK cells in tumour growth and metastasis in beige mice. Nature 284: 622-624, 1980 Taniguchi, K., Petersson, M., Hoglund, P., Kiessling, R., Klein, G., and Karre, K.: Interferon gamma induces lung colonization by intravenously inoculated B16 melanoma cells in parallel with enhanced expression of class I major histocompatibility complex antigens. Proc Natl Acad Sci USA 84: 3405-3409, 1987 Toomey, J. A., Salcedo, M., Cotterill, L. A., Millrain, M. M., Chrzanowska-Lightowlers, Z., Lawry, J., Fraser, K., Gays, F., Robinson, J. H., Shrestha, S., Dyson, P. J., and Brooks, C. G.: Stochastic acquisition of Qal receptors during the development of fetal NK cells in vitro accounts in part but not in whole for the ability of these cells to distinguish between class I-sufficient and class I-deficient targets. J Immunol 163: 3176- 3184,1999 Toomey, J. A., Shrestha, S., de la Rue, S. A., Gays, F., Robinson, J. H., Chrzanowska- Lightowlers, Z. M., and Brooks, C. G.: MHC class I expression protects target cells from lysis by Ly49-deficient fetal NK cells. Eur J Immunol 28: 47-56, 1998 Torkar, M., Norgate, Z., Colonna, M., Trowsdale, J., and Wilson, M. J.: Isotypic variation of novel immunoglobulin-like transcript/killer cell inhibitory receptor loci in the leukocyte receptor complex. Eur J Immunol 28: 3959-3967, 1998 Trinchieri, G.: Biology of natural killer cells. Adv Immunol 47: 187-376, 1989 Trowsdale, J.: Genomic structure and function in the MHC. Trends Genet 9: 117-122, 1993 Trowsdale, J.: Molecular genetics of HLA class I and class II regions. In M. J. Browning and A. J. McMichael (eds.): HLA and MHC: genes, molecules and function, pp. 23-38, BIOS Scientific Publishers Ltd., Oxford, 1996 142 Uhrberg, M., Valiante, N. M., Shum, B. P., Shilling, H. G., Lienert-Weidenbach, K., Corliss, B., Tyan, D., Lanier, L. L., and Parham, P.: Human diversity in killer cell inhibitory receptor genes. Immunity 7: 753-763, 1997 Vales-Gomez, M., Reyburn, H., and Strominger, J.: Molecular analyses of the interactions between human NK receptors and their HLA ligands. Hum Immunol 61: 28- 38, 2000 Valiante, N. M., Lienert, K., Shilling, H. G., Smits, B. J., and Parham, P.: Killer cell receptors: keeping pace with MHC class I evolution. Immunol Rev 155: 155-164, 1997a Valiante, N. M., Uhrberg, M., Shilling, H. G., Lienert-Weidenbach, K., Arnett, K. L., D'Andrea, A., Phillips, J. H., Lanier, L. L., and Parham, P.: Functionally and structurally distinct NK cell receptor repertoires in the peripheral blood of two human donors. Immunity 7: 739-751, 1997b Van Beneden, K., De Creus, A., Debacker, V., De Boever, J., Plum, J., and Leclercq, G.: Murine fetal natural killer cells are functionally and structurally distinct from adult natural killer cells. JLeukoc Biol 66: 625-633, 1999 Vance, R. E., Jamieson, A. M., and Raulet, D. H.: Recognition of the class lb molecule Qa-l(b) by putative activating receptors CD94/NKG2C and CD94/NKG2E on mouse natural killer cells. JExp Med 190: 1801-1812. Vance, R. E., Kraft, J. R., Airman, J. D., Jensen, P. E., and Raulet, D. H.: Mouse CD94/NKG2A is a natural killer cell receptor for the nonclassical major histocompatibility complex (MHC) class I molecule Qa-lb. JExp Med 188: 1841-1848, 1998 Vance, R. E., Tanamachi, D. M., Hanke, T., and Raulet, D. H.: Cloning of a mouse homolog of CD94 extends the family of C-type lectins on murine natural killer cells. Eur J Immunol 27: 3236-3241, 1997 Vitale, M., Bottino, C, Sivori, S., Sanseverino, L., Castriconi, R., Marcenaro, E., Augugliaro, R., Moretta, L., and Moretta, A.: NKp44, a novel triggering surface molecule specifically expressed by activated natural killer cells, is involved in non-major histocompatibility complex-restricted tumor cell lysis. JExp Med 187: 2065-2072, 1998 Wagtmann, N., Biassoni, R., Cantoni, C, Verdiani, S., Malnati, M. S., Vitale, M., Bottino, C, Moretta, L., Moretta, A., and Long, E. O.: Molecular clones of the p58 NK cell receptor reveal immunoglobulin-related molecules with diversity in both the extra- and intracellular domains. Immunity 2: 439-449, 1995 Wagtmann, N., Rojo, S., Eichler, E., Mohrenweiser, H., and Long, E. O.: A new human gene complex encoding the killer cell inhibitory receptors and related monocyte/macrophage receptors. Curr Biol 7: 615-618, 1997 143 Wahle, E. and Ruegsegger, U.: 3'-End processing of pre-mRNA in eukaryotes. FEMS Microbiol Rev 23: 277-295, 1999 Wang, L. L., Mehta, I. K., LeBlanc, P. A., and Yokoyama, W. M.: Mouse natural killer cells express gp49Bl, a structural homologue of human killer inhibitory receptors. J Immunol 158: 13-17, 1997 Weis, W. I., Taylor, M. E., and Drickamer, K.: The C-type lectin superfamily in the immune system. Immunol Rev 163: 19-34, 1998 Welsh, R. M., Brubaker, J. O., Vargas-Cortes, M., and O'Donnell, C. L.: Natural killer (NK) cell response to virus infections in mice with severe combined immunodeficiency. The stimulation of NK cells and the NK cell-dependent control of virus infections occur independently of T and B cell function. JExp Med 173: 1053-1063, 1991 Welsh, R. M., Dundon, P. L., Eynon, E. E., Brubaker, J. O., Koo, G. C, and O'Donnell, C. L.: Demonstration of the antiviral role of natural killer cells in vivo with a natural killer cell-specific monoclonal antibody (NK 1.1). Natlmmun Cell Growth Regul 9: 112- 120, 1990 Wende, H., Colonna, M., Ziegler, A., and Volz, A.: Organization of the leukocyte receptor cluster (LRC) on human chromosome 19ql3.4. Mamm Genome 10: 154-160, 1999 Westgaard, I. H., Berg, S. F., Orstavlk, S., Fossum, S., and Dissen, E.: Identification of a human member of the Ly-49 multigene family. Eur J Immunol 28: 1-8, 1998 Williams, N. S., Klem, J., Puzanov, I. J., Sivakumar, P. V., Bennett, M., and Kumar, V.: Differentiation of NK1.1+, Ly49+ NK cells from flt3+ multipotent marrow progenitor cells. J Immunol 163: 2648-2656, 1999 Williams, N. S., Klem, J., Puzanov, I. J., Sivakumar, P. V., Schatzle, J. D., Bennett, M., and Kumar, V.: Natural killer cell differentiation: insights from knockout and transgenic mouse models and in vitro systems. Immunol Rev 165: 47-61, 1998 Williams, N. S., Kubota, A., Bennett, M., Kumar, V., and Takei, F.: Clonal analysis of NK cell development from bone marrow progenitors in vitro: orderly acquisition of receptor gene expression. Eur J Immunol 30: 2074-2082, 2000 Williams, N. S., Moore, T. A., Schatzle, J. D., Puzanov, I. J., Sivakumar, P. V., Zlotnik, A., Bennett, M., and Kumar, V.: Generation of lytic natural killer 1.1+, Ly-49- cells from multipotential murine bone marrow progenitors in a stroma-free culture: definition of cytokine requirements and developmental intermediates. JExp Med 186: 1609-1614, 1997 Wilson, M. J., Torkar, M., Haude, A., Milne, S., Jones, T., Sheer, D., Beck, S., and Trowsdale, J.: Plasticity in the organization and sequences of human KIR/ILT gene families. Proc Natl Acad Sci USA 97: 4778-4783, 2000 144 Wong, S., Freeman, J. D., Kelleher, C, Mager, D., and Takei, F.: Ly-49 multigene family. New members of a superfamily of type II membrane proteins with lectin-like domains. J Immunol 147: 1417-1423, 1991 Wu, J., Song, Y., Bakker, A. B., Bauer, S., Spies, T., Lanier, L. L., and Phillips, J. H.: An activating immunoreceptor complex formed by NKG2D and DAP 10. Science 285: 730- 732,1999 Ying, H., Nakayama, E., Robinson, W. H., and Parnes, J. R.: Structure of the mouse CD72 (Lyb-2) gene and its alternatively spliced transcripts. J Immunol 154: 2743-2752, 1995 Yokoyama, W. M., Jacobs, L. B., Kanagawa, O., Shevach, E. M., and Cohen, D. I.: A murine T lymphocyte antigen belongs to a supergene family of type II integral membrane proteins. J Immunol 143: 1379-1386, 1989 Yokoyama, W. M., Kehn, P. J., Cohen, D. I., and Shevach, E. M.: Chromosomal location of the Ly-49 (Al, YE 1/48) multigene family. Genetic association with the NK 1.1 antigen. J Immunol 145: 2353-2358, 1990 Yokoyama, W. M., Ryan, J. C, Hunter, J. J., Smith, H. R., Stark, M., and Seaman, W. E.: cDNA cloning of mouse NKR-P1 and genetic linkage with LY-49. Identification of a natural killer cell gene complex on mouse chromosome 6. J Immunol 147: 3229-3236, 1991 Young, J. D. and Cohn, Z. A.: Cellular and humoral mechanisms of cytotoxicity: structural and functional analogies. Adv Immunol 41: 269-332, 1987 Yu, Y. Y., George, T., Dorfman, J. R., Roland, J., Kumar, V., and Bennett, M.: The role of Ly49 A and 5E6 (Ly49C) molecules in hybrid resistance mediated by murine natural killer cells against normal T cell blasts. Immunity 4: 67-76, 1996 Ziegler, S. F., Ramsdell, F., Hjerrild, K. A., Armitage, R. J., Grabstein, K. H., Hennen, K. B., Farrah, T., Fanslow, W. C, Shevach, E. M., and Alderson, M. R.: Molecular characterization of the early activation antigen CD69: a type II membrane glycoprotein related to a family of natural killer cell activation antigens. Eur J Immunol 23: 1643- 1648, 1993 Zingoni, A., Palmieri, G., Morrone, S., Carretero, M., Lopez-Botel, M., Piccoli, M., Frati, L., and Santoni, A.: CD69-triggered ERK activation and functions are negatively regulated by CD94 / NKG2-A inhibitory receptor. Eur J Immunol 30: 644-651, 2000