Studies on a 34Kda Protein of M. Avium Subsp. Paratuberculosis, a Putative Virulence Factor

Studies on a 34kDa protein of M. avium subsp. paratuberculosis, a putative virulence factor

Darragh G. Heaslip

Presented For the Degree of Doctor of Philosophy University of Surrey School of Biological Sciences June 2002 ProQuest Number: 27558651

INFORMATION TO ALL USERS The quality of this reproduction is dependent upon the quality of the copy submitted.

In the unlikely event that the author did not send a com plete manuscript and there are missing pages, these will be noted. Also, if material had to be removed, a note will indicate the deletion. uest

ProQuest 27558651

Published by ProQuest LLO (2019). Copyright of the Dissertation is held by the Author.

ProQuest LLO. 789 East Eisenhower Parkway P.Q. Box 1346 Ann Arbor, Ml 48106- 1346 This thesis is dedicated to my parents, for their love, support and encouragement. Abstract The 34kDa putative serine protease of M.a.paratuberculosis shows conserved features of the HtrA family of bacterial proteases, implicated in the virulence of several intracellular pathogens. However its role in virulence of M.a.paratuberculosis remained to be determined.

To this end the 34kDa putative serine protease ORF was cloned into a mycobacterial shuttle vector under the transcriptional control of the M.tuberculosis hsp60 promoter. The expression and subsequent secretion of the recombinant protein into the extracellular milieu by M.smegmatis mc^l55 was shown. M.smegmatis mc^l55 that expressed the 34kDa putative serine protease demonstrated enhanced intracellular survival in ex-v/vo sheep alveolar macrophages in the 24 hours following macrophage ingestion in comparison to M.smegmatis mc^l55 expressing E-GFP and wild-type M.smegmatis mc^l55. The presence of the protein had no affect on the ability of M.smegmatis mc^l55 to enter macrophages or on the long-term intracellular survival.

The upstream region of the ORF in M.a.paratuberculosis was examined for transcriptional activity and shown to be capable of expressing the 34kDa putative serine protease in M.smegmatis mc^l55. A similar level of increased intracellular survival was noted when the 34kDa putative serine protease was expressed from the putative upstream promoter as observed when the 34kDa putative serine protease was expressed by the hsp60 promoter. A putative IdeR regulatory sequence was identified in the upstream region. However, further characterisation of the upstream region failed to demonstrate a role for IdeR or the cellular concentration of iron in the regulation of the 34kDa putative serine protease.

Homologues of the 34kDa putative serine protease were observed in the genomes of several pathogenic mycobacterial species, including members of the TB complex and M.leprae. Significantly, only weak homology noted in the genome of the non- pathogenic M.smegmatis. Therefore, the possibility exists that the 34kDa putative serine protease represents a conserved feature of mycobacterial pathogenesis. Declaration

The work presented in this thesis was undertaken as part of the Paratuberculosis project at the Moredun Research Institute. I declare that the experimental design, execution and all results generated are my own, unless other wise stated. Where appropriate, all contributions made by others are acknowledged.

Darragh G. Heaslip

11 Acknowledgements Firstly, I wish to thank my MRI supervisors. Dr. Karen Stevenson and Dr. Mike Sharp, for their advice, encouragement and friendship during the course of the PhD and while compiling the manuscript. I would also like to thank my University Supervisor, Prof. Johnjoe McFadden for his advice and critical appraisal of the manuscript.

During my time at MRI, I have been very fortunate to have worked with a great group of dedicated people, to whom I owe a great deal. Special thanks go to Drs. Neil Inglis, Chris Cousins, and Val Hughes, and Miss Pat Dewar for their time and effort in helping me in the lab and for their enduring friendship throughout, not forgetting Miss Christina Summers for her empathy while writing the thesis. Thanks are also due to Mrs Karen Rudge for expert technical assistance in the culturing of M.a.paratuberculosis strains. I am very grateful to Miss Jackie Thomson (the tissue culture goddess) for everything, not least a roof over my head while writing and her patience while instructing me in the finer arts of tissue culturing. I am also grateful to Miss Lucia De Juan and Mr Kevin McLean for reminding me of life outside the lab.

I would like to extend my gratitude to Profs. Gerald Gerlach and Peter Valentin- Wiegand for providing me the opportunity to conduct research in their labs in Hanover and to Dr. Manfred Rhode for performing transmission electron microscopic analysis on macrophages.

I would also like to thank Miss Diane Donaldson and Heather Edgar for Library Services, Mr. Brian Easter and Mr. Mathew Gilmour for Photography and Reprographics, Dr. Dave Buxton for help with microscope imaging and Mrs. Jill Sales for statistical support.

Farewell Dinesh, ''Was I sleeping, while the others suffered, am I sleeping now, tomorrow when I wake, or think I do, what shall I say o f today?’’’' (Samuel Beckett)

Finally, I am deeply indebted to Celine, for her love, patience and understanding over the last few years, particularly during the tougher times.

Ill CONTENTS

Abstract i Declaration ü Acknowledgements iü Contents iv Abbreviations, Symbols and Formulae xi

CHAPTER 1. INTRODUCTION 1 1.1 The Genus Mycobacterium 1 1.2 The Mycobacterial Cell Envelope 1 1.3 Mycobacterial Genome Sequencing 2 1.4 The Mycobacterium avium Complex (MAC) 7 1.5 MAC and M.a.paratuberculosis Strain Differentiation 8

1.5.1 DNA-DNA hybridisation 8

1.5.2 rRNA genes 8 1.5.3 Molecular Typing methods 9 1.6 Johne’s Disease 12 1.6.1 Aetiology 12 1.6.2 Infection 12 1.6.3 Pathological features of Johne’s disease 13 1.6.4 Prevalence and economic impact 14 1.6.5 Wildlife and non-ruminant infection 15 1.7 Diagnosis of Johne’s Disease 16 1.7.1 Microscopic examination of M.a.paratuberculosis in faeces 16 1.7.2 Detection in culture 17 1.7.3 Nucleic acid based detection of M.a.paratuberculosis 18 1.7.4 Serological detection of M.a.paratuberculosis infection 21 1.7.5 CMI-based detection of M.a.paratuberculosis infection 22 1.8 Crohn's Disease 22

IV 1.8.1 Crohn’s disease and 23 1.9 Identification of Genes in M.a.paratuberculosis 25 1.10 M.a.paratuberculosis 34kDa Putative Serine Protease 28 1.11 The HtrA Family of Bacterial Serine Protease 33 1.11.1 HtrA structural features 33 1.11.2 HtrA function 34 1.11.3 HtrA and pathogenesis 35 1.12 Proposal 38

CHAPTER 2. GENERAL MATERIAL AND METHODS 39 2.1 Culture of Bacterial Strains 39

2.1.1 E.co/z 39 2.1.2 Mycobacteria 39 a) M.a.paratuberculosis 39 b) M.smegmatis 39 2.2 Nucleic Acid Preparation and Manipulation 39 2.2.1 Preparation of plasmid DNA from E.coli host strains 39 2.2.2 Restriction enzyme digestion of plasmid DNA 40 2.2.3 Agarose Gel Electrophoresis 40 2.2.4 Recovery of DNA fragments from agarose gels 40 2.2.5 Dephosphorylation of plasmid DNA 41 2.2.6 Generating “blunt ended” DNA fragments 41 2.2.7 Ligation of DNA fragments into vector DNA 41 2.2.8 Preparation of vector DNA for electroporation 42 2.3 Introduction of Vector DNA into Bacterial Strains 42 2.3.1 Preparation of Electrocompetent Cells 42 d) M.a.paratuberculosis 43 b) M.smegmatis 43 c) E.coli 43 2.3.2 Introduction of vector DNA by Electroporation 43

2l) M.a.paratuberculosis 43

V b) M.smegmatis 44 c) E.coli 44 2.3.3 Transformation of E.coli JM109 competent cells 45 2.4 Sequencing of DNA 45 2.5 DNA and Protein Database Searching 45 2.6 Preparation of Mycobacterial Cell Lysates 46 2.7 DNA Extraction from Mycobacterial Cells 46 2.8 Protein concentration and SDS-PAGE 47 2.8.1 Determination of Protein Concentrations 47 2.8.2 SDS-Polyacrylamide Gel Electrophoresis (SDS-PAGE) 47 2.9 Production of 34kDa putative serine protease Monoclonal Antibody 48 2.9.1 Growth and maintenance of Hybridoma cells lines 48 2.9.2 Purification of IgG fraction from Hybridoma supernatant 49 2.10 Western Transfer and Immunoblotting 49 2.10.1 Western blotting 49 2.10.2 Ponceau S staining of nitrocellulose-bound proteins 49 2.10.3 Immunoblotting 50 2.11 PCR protocols 51 2.11.1 Detection of IS900 in M.a.paratuberculosis 51 2.11.2 Presence of plasmid DNA; aph (Kanamycin) PCR 51

CHAPTER 3. GENETIC MANIPULATION OF M.smegmatis mc^l55 AND M.a.paratuberculosis 52 3.1 Introduction 52 3.2 Materials and Methods 56 3.2.1 Amplification of the 34kDa putative serine protease ORF from 56 genomic DNA 3.2.2 Plasmid Sequencing primers 57 3.2.3 Visualisation of GFP expression 57 3.3 Results 58 3.3.1 Initial characterisation of plasmid DNA 58

VI 3.3.2 Generation of vectors to express GFP in mycobacteria 58 3.3.3 Sequencing of plasmid DNA 59 3.3.4 Plasmid Construction 65 a) Transcriptional fusion vectors 65 b) Promoter-less reporter vectors 69 c) E-GFP reporter vectors 69 3.3.5 Expression of GFP and E-GFP in M.smegmatis mc^l55 71 3.3.6 Cloning the 34kDa putative serine protease ORF and expression of the protein in M.smegmatis mc^l55 71 a) Cloning the 34kDa putative serine protease into a mycobacterial shuttle plasmid 71 b) Expression of the 34kDa putative serine protease in M.smegmatis mc^l55 74 3.3.7 Transformation of M.a.paratuberculosis 78 3.4 Discussion 82

CHAPTER 4. INFLUENCE OF EXPRESSION OF THE M.a.paratuberculosis 34kDa PUTATIVE SERINE PROTEASE ON THE INTRACELLULAR SURVIVAL OF M.smegmatis mc^l55 4.1 Introduction 86 4.2 Materials and Methods 89 4.2.1 Harvesting of OA macrophages from adult animals 89 4.2.2 Preparation of OA macrophages for infection with mycobacteria 89 4.2.3 Preparation of mycobacterial inoculum for OA macrophage infection 90 a) M.smegmatis 90 b) M.a.paratuberculosis 90 4.2.4 Mycobacterial infection of OA macrophages 90 4.2.5 Maintenance of J774A.1 macrophage-like cell line 91 4.2.6 Preparation of mycobacterial inoculum for J774A.1 macrophage-like cell line infection 92 a) M.smegmatis mc^ 155 92

Vll h) M.a.paratuberculosis 92 4.2.7 BacLight’^^ LIVE/DEAD® determination of mycobacterial viability 92 4.2.8 Mycobacterial infection of J774A.1 macrophage-like cell line 93 4.2.9 Preparation of infected J774A. 1 macrophages for Immuno- 93 fluorescence microscopy 4.2.10 Preparation of infected J774A. 1 macrophage for Immuno-electron 94 microscopy (Immuno-EM) 4.2.11 ProteinChip® detection of the 34kDa putative serine protease 95 a) ProteinChip® array analysis of biological samples 95

b) ProteinChip® antibody capture analysis of biological samples 95 4.2.12 Statistical analysis 96 4.3 Results 97 4.3.1 Ex-vzvo OA macrophage survival assay 97 4.3.2 Optimisation of Qx-vivo OA macrophage survival assay 99 4.3.3 Survival of M.smegmatis pMRI34 in Qx-vivo OA macrophages 106 4.3.4 Survival of M.smegmatis pMRlus34 in ex-v/vo OA macrophages 112 4.3.5 Demonstration of the presence of the 34kDa putative serine protease in infected OA macrophages 114 a) Immuno-Ruorescence microscopy and Immuno-EM detection 114 b) ProteinChip® analysis of biological samples 119 4.4 Discussion 123

CHAPTER 5. IDENTIFICATION AND CHARACTERISATION OF PUTATIVE PROMOTER ELEMENTS IN THE UPSTREAM REGION OF THE M.a.paratuberculosis 34kDa PUTATIVE SERINE PROTEASE ORE 131 5.1 Introduction 131 5.2 Materials and Methods 137 5.2.1 Amplification by PCR of the upstream region of the 34kDa putative serine protease from M.a.paratuberculosis genomic DNA 137 a) Using HotStar Taq DNA polymerase 137 b) Using ACCUZYME DNA polyermase 137

vm 5.2.2 Amplification of the 34kDa putative serine protease ORF and the upstream region from M.aparatuberculosis genomic DNA 138 5.2.3 Measuring P-gal activity using the X-gal substrate 138 5.2.4 Induction of p-gal expression from a mycobacterial promoter 139 a) By Iron starvation 139 5.2.5 Measuring p-gal activity using the ONPG substrate 139 5.3 Results 141 5.3.1 Identification of the upstream region of the 34kDa putative serine protease ORF in M.avium and M.a.paratuberculosis 141 5.3.2 In silico identification of promoter elements in the upstream region of the 34kDa putative serine protease 141 5.3.3 Promoter identification in the upstream region of the p40 gene of lS 9 0 ff M. avium 143 5.3.4 Cloning the 34kDa putative serine protease ORF and upstream region into a mycobacterial shuttle vector 145 a) PCR amplification of the entire 34kDa putative serine protease ORF and upstream region 145 b) Cloning of the 34kDa putative serine protease ORF and upstream region into pUS972 147 5.3.5 Expression of the 34kDa putative serine protease from the endogenous promoter in M.smegmatis mc^ 155 153 5.3.6 Investigation of the transcriptional activity of the 34kDa putative serine protease promotQY 155 5.3.7 Regulation of the 34kDa putative serine protease promoter by IdeR 158 a) Generation of 34kDa putative serine protease promoter-p-gal fusion vectors 158 b) Introduction of pSm34pl and pSm34pII into M.smegmatis strains 159 c) Expression of p-gal from 34kDa putative serine protease promoter 159 5.4 Discussion 164

IX CHAPTER 6. GENERAL DISCUSSION 169 6.1 The 34kDa putative Serine Protease And Pathogenesis 170 6.2 HtrA-like Proteins In Mycobacteria 171 6.3 Future Work 178

Literature Cited 180 APPENDIX 1. Laboratory Suppliers ccxii

APPENDIX 2. Bacterial Strains and Vectors ccxv APPENDIX 3. Laboratory Media ccxix APPENDIX 4. Amino acid and Nucleotide Sequences ccxxii Publications Abbreviations, Symbols and Formulae a ...... alpha aa...... amino acid A ...... ampere AGID...... agarose gel immunodiffusion AIDS...... acquired immune deficiency syndrome Amp ...... ampicillin ATP...... adenosine triphosphate ~ ...... approximately P...... Beta BCG...... Bacillus Calmette-Guerin P-gal...... beta-galactosidase bp ...... base pairs BSA...... bovine serum albumin CaCl]...... calcium chloride CFP...... cellular filtrate protein CAT...... chloramphenicol acetyl transferase cfu...... colony forming units CFT...... complement fixation test CôHgOv...... citric acid cm...... Centimetres CMI...... cell mediated immunity CMN group ...... Corynebacterium, Mycobacterium and Nocardia group DAB...... Diaminobenzidine DM SO...... dimethyl sulphoxide DMEM...... Dulbecco’s modified Eagle medium DNA...... deoxyribonucleic acid dN TP:-...... deoxynucleotide triphosphate dATP...... deoxyadenosine triphosphate dCTP...... deoxycytosine triphosphate dGTP...... deoxyguanosine triphosphate dTTP...... deoxythymidine triphosphate DP...... Dipyridyl DTH...... delayed type hypersensitivity DTT...... dithiothreitol DW ...... distilled water ds...... double stranded E.coli...... Escherichia coli E-GFP...... enhanced green fluorescent protein ELISA...... enzyme-linked immunosorbent assay FBS...... foetal bovine serum FIGE...... field inversion gel electrophoresis Y...... gamma g...... Gram g ...... gravitational force G+C...... guanosine + cytosine content GFP...... green fluorescent protein GPL...... Glycopeptidolipid

XI GTP...... guanosine triphosphate HBSS...... Hanks balanced salt solution HCl...... hydrochloric acid HEPES...... (N-[hydroxyethyl]piperazine-N'-[ethanesulphonic acid]) HETB...... high efficiency transformation buffer HtrA...... high temperature requirement A His...... histidine

H2O2 ...... hydrogen peroxide HPLC...... high performance liquid chromatography hr ...... hour(s) HR...... homologous recombination HRP...... horseradish peroxidase H 2SO4 ...... sulphuric acid hsp ...... heat shock protein Ig...... immunoglobulin IFN-y...... interferon gamma IPTG...... isopropyl P-D-thiogalactopyranoside IS...... insertion sequence kb ...... kilobase pairs

KC2H3O2 ...... potassium acetate KCl...... potassium chloride

KH2PO4 ...... potassium dihydrogen orthophosphate kDa...... kilodaltons kg...... kilogram kV...... kilovolts X...... lambda

X g tll...... bacteriophage lambda gtl 1 L...... litre LAM...... lipoarabinomannan Ltd...... limited (company) LMP...... low melting point M ...... molar M...... Mycobacterium mA ...... milliampere mAb ...... monoclonal antibody MAC...... Mycobacterium avium complex M b ...... Megabase pairs m g...... milligram ( 1 0 '^ gram) MgCri...... magnesium chloride MgS0 4 ...... magnesium sulphate MHC...... major histocompatibility complex MIC...... minimum inhibitory concentration min ...... minute(s) ml...... millilitre ( 1 0 '^ litre) mM...... millimolar ( 10'^ molar) MCI...... multiplicity of infection MR...... molar ratio MRI...... Moredun Research Institute

XII pMRI ...... plasmid (MRI Series-Moredun Research Institute) M.wt...... molecular weight MCS...... multiple cloning site NCBI...... National Centre for Bioinformatics NaCl...... sodium chloride NazCO]...... sodium carbonate NazEDTA...... ethlenediaminetetraacetic acid disodium salt NaHCO]...... sodium bicarbonate

Na2HP0 4 ...... disodium hydrogen orthophosphate NaH2P 0 4 ...... sodium dihydrogen orthophosphate NaOH...... sodium hydroxide NCTC...... National Collection of Type Cultures ng ...... nano gram ( 1 0 '^ gram) NH4CI...... ammonium chloride Q ...... Ohm OA...... ovine alveolar OD...... optical density ONPG...... o-nitrophenyl-p-D-galactopyranoside ORF...... open reading frame ori...... origin of replication PE...... glycine-alanine rich protein PPE...... glycine-asparagine rich protein PAGE...... polyacrylamide gel electrophoresis PBMC...... peripheral blood mononuclear cells PBS...... phosphate buffered saline PCR...... polymerase chain reaction PDIM...... phthiocerol dimycocerosate PFGE...... pulsed-field gel electrophoresis pGEM-T ...... PCR cloning vector PGL...... phenolic glycolipids PIM...... phosphotidylinositol manoside pmol ...... picomole ( 1 0 *^^ moles) PMSF...... phenylmethylsulphonyl fluoride PPD ...... purified protein derivative RAPD...... random amplified polymorphic DNA RBS...... ribosome binding site RE...... restriction endonuclease REA...... restriction enzyme analysis RFLP...... restriction fragment length polymorphism RNA:-...... ribonucleic acid mRNA...... messenger ribonucleic acid rRNA...... ribosomal ribonucleic acid tRNA...... transfer ribonucleic acid rpm ...... revolutions per minute RPMI...... Rosewell Park Memorial Institute rrn...... ribosomal RNA operon sec...... second(s) SDS...... sodium dodecyl sulphate

Xlll a ...... sigma ss...... single stranded SOD...... super oxide dismutase TB-complex ...... tuberculosis complex TEM...... Transmission electron microscopy Tm...... melting temperature TN F-a...... Tumour necrosis factor alpha pF ...... microfarrads (10'^ farrads pg ...... micro gram (10'^ gram) p i ...... Microlitre ( 10'^ litre) pM ...... micromolar ( 10'^ molar) pUS ...... plasmid (pUS Series-University of Surrey) V ...... volt Vv...... volume to volume W ...... watt '^/v...... weight to volume '^/wt...... weight to weight X-gal...... 5-bromo-4-chloro-3-indoly-p-D-galactopyranoside

XIV CHAPTER 1

INTRODUCTION

1.1 The Genus Mycobacterium Mycobacteria belong to the genus Mycobacterium, which is the sole genus in the family Mycobacteriaceae, in the order Actinomycelates. The order Actinomycelates comprises the genera Corynebacterium, Mycobacterium, Nocardia (the CMN group) and Rhodococcus, which are distinguishable on the basis of their ability to synthesise mycolic acids (Barksdale and Kim, 1977). The genus includes photochromogens, scotochromogens and non-chromogens. All members are aerobic or microaerophillic, non-motile and non-spore forming. Mycobacteria posses a complex cell wall that is rich in lipids and glycolipids, conferring characteristic acid and alcohol fastness upon the bacillus. The phylogeny of the genus has been determined largely on the basis of 16S rRNA sequences and has been subdivided into fast- or slow- growing species (Springer et ah, 1996). The majority of the members of the genus are saprophytic. The slow growing mycobacteria have remarkably long generation times (1-14 days) and include a wide variety of organisms of medical and veterinary importance, including the human pathogens M.tuberculosis and M.leprae responsible for tuberculosis and leprosy, respectively. The Mycobacterium tuberculosis complex comprises M.tuberculosis together with Mycobacterium africanum, Mycobacterium bovis, Mycobacterium canetti and Mycobacterium microti with exceptionally little sequence variation observed (Sreevatsan et al, 1997; Musser et al, 2000; Musser, 2001). The M.avium complex, another group of closely related slow growing mycobacterial species, includes both veterinary and opportunistic human pathogens (see sections 1.4 and 1.5).

1.2 The Mycobacterial Cell Envelope The mycobacterial cell envelope comprises the cytoplasmic membrane and the cell wall complex. Electron micrograph studies of ultra thin sections of embedded mycobacterial cells demonstrated that the cytoplasmic membrane is asymmetrical with the outer electron dense layer appearing thicker than the inner layer (Paul and Beveridge, 1992; Paul and Beveridge, 1993). The increased thickness has been associated with the preferential association of carbohydrates and phosphatidylinositol mannosides (PIMs, unique to Actinomycetes), with the outer leaflet (Brennan and Nikaido, 1995).

The mycobacterial cell wall is a physically resilient, chemically complex structure of exceptionally low permeability which confers characteristic acid and alcohol fastness upon the cell, as well as resistance to many commonly used antibiotics and chemical disinfectants (Jarlier and Nikaido, 1994). The generally accepted model of the mycobacterial cell wall is one of an asymmetric lipid bilayer (Nikaido et al, 1993; Brennan and Nikaido, 1995). In this model, the inner leaflet comprises peptidoglycan linked to arabinogalactan polysaccharides, esterified at their distal ends with high molecular weight mycolic acids. These long chain mycolic acids (Cgo-Cgo) are arranged perpendicular to the cell surface in a tightly packed inner leaflet array.

The outer leaflet comprises a layer of loosely associated solvent-extractable lipid compounds such as PIMs, including lipoarabinomannan (LAM). LAM has been reported to play a significant role in the immunopathogenesis of M.tuberculosis, M.leprae (Barnes et al, 1992a) (Chatteqee et al, 1992; Barnes et al, 1992b)and M.a.paratuberculosis (Sugden et al, 1987; Sugden et al, 1989; McNab et al, 1991). Several classes of free lipids and glycolipids including phenolic glycolipids (PGLs) and glycopeptidolipids (GPLs) are associated with the outer cell wall. The GPLs form a group of immunogenic cell surface antigens, which have been used to type isolates of M.avium, M.intracellulare, and M.scrofulaceum on the basis of serotypic identity (Inglis and McFadden, 1999). Other cell wall components include phthiocerol dimycocerosates (PDIMs), glycerophospholipids and cell wall associated proteins such as the M.leprae bacterioferritin MMP II (Pessolani et al, 1994) and porin proteins (Draper, 1998) embedded in the lipid matrix.

1.3 Mycobacterial Genome Sequencing In recent years, there have been considerable advances in the application of molecular genetic tools to the study of mycobacterial virulence and pathogenicity, with the development of plasmid and phage vectors, transposons, reporter molecule expression, and strategies for the inactivation and mutagenesis of mycobacterial genes (reviewed in the introduction to Chapter 3). The publishing of the M.tuberculosis H37Rv genome sequence and the continuing genome sequencing projects of other mycobacteria represents a significant step in the potential to dissect the biology of this important genus. This has proved pivotal in the development of new techniques to unravel the transcriptome and proteome of pathogenic mycobacteria as well as being the foundation of functional and comparative genomic studies of the genus (Behr et ah, 1999; Jungblut et al, 1999; Brosch et al, 2000a; Brosch et al, 2000b; Mattow et al, 2001). The completed genomes of other members of the TB complex, M.bovis, M.bovis BCG, M.avium, M.a.paratuberculosis and M.smegmatis will be of critical importance in our growing understanding of the mechanism of pathogenesis of mycobacteria and in highlighting important differences between pathogenic strains (Table 1.1).

The first mycobacterial genome to be completed was that of the standard M.tuberculosis lab strain, M.tuberculosis H37Rv (Cole et al, 1998). The complete M.tuberculosis H37Rv comprises 4,411,529 bp and contains approximately 4,000 protein-encoding genes and 50 genes coding for stable RNA. Of the predicted open reading firames 40% have an attributed function, predominantly associated with core metabolism. Limited functional information or sequence similarity has been ascribed to a further 44% of the genes with the rest of the genes of unknown function and may be unique to mycobacteria. Approximately 51% of the genes of M.tuberculosis have arisen fi*om gene duplication events, with a subsequent high degree of sequence conservation observed, leading to extensive functional redundancy. M.tuberculosis H37Rv is rich in IS elements with 56 copies firom eight different IS families (Gordon et al, 1999a; Gordon et al, 1999b). One of the most remarkable features of the M.tuberculosis genome was the discovery that ~9% of the genome encodes two new families of glycine-rich proteins, the PE (novel glycine-alanine-rich) and PPE (novel glycine-asparagine-rich) proteins (Cole et al, 1998). Functional information about these proteins is still very limited and it has been suggested that they could play a role in antigenic variation (Ramakrishnan et al, 2000; Brennan et al, 2001; Delogu and Brennan, 2001; Banu et al, 2002). Another striking feature of the M.tuberculosis H37Rv genome is the abundance of genes coding for enzymes involved in fatty acid metabolism, more than 250 in M.tuberculosis compared to 50 in Eschericha coli, an observation that is consistent with the complexity of the lipid content of the mycobacterial cell envelope. M.tuberculosis also has the potential to produce over 100 enzymes involved in p-oxidation of fatty acids.

In contrast to the M.tuberculosis H37Rv genome, the M.leprae genome is smaller in size comprising 3,268,203 bp with a lower average G + C content of 57.8% (Cole et al, 2001). Only 49.5% of the genome contains protein-coding genes, compared to 91% in M.tuberculosis H37Rv, a further 27% containing recognisable pseudogenes with the remaining 23.5% of the genome apparently non-coding. The genome contains 1,604 potentially active genes, of which 1,439 are shared with M.tuberculosis H37Rv with 165 containing no M.tuberculosis orthologue. The size of the genome compared to the mean genome size of mycobacteria, calculated to be -4.4 Mb, indicates that considerable downsizing has occurred and as such the M.leprae bacillus has been described as the minimal genome required for pathogenic mycobacteria. Comparative proteome analysis has demonstrated that M.leprae contains only 391 detectable soluble protein species in comparison to the -1,800 detectable protein species of M.tuberculosis (Jungblut et al, 1999; Brosch et al, 2000b). The overall reduction in gene number compared to M.tuberculosis H37Rv leads to a limited repertoire of metabolic pathways, particularly those involved in catabolism and NADH utilisation (Eiglmeier et al, 2001). Similarly, the M.leprae genome does not contain the mbt operon, encoding the non-ribosomal peptide synthases involved in the biosynthesis of the salicyl-capped peptide-polyketide scaffold of mycobactins (Morrison, 1995; Cole et al, 2001). Mycobactins represent the principle iron scavenging mechanism of mycobacteria in the host cell (Wheeler and Ratledge, 1988; Barclay and Ratledge, 1988; De Voss et al, 2000; Gomes et al, 2001), the absence of the enzymes for mycobactin synthesis suggests that M.leprae may use other mechanisms to acquire iron in the intracellular environment of the host cell (Morrison, 1995).

Several other mycobacterial genomes have now been either completely sequenced or are due to be completed soon (Table 1.1). The genomes include other members of the M.tuberculosis complex, members of the MAC complex and M.smegmatis, a saprophytic strain that has been used extensively in developing mycobacterial gene expression techniques. Genome comparisons of these genomes may expand our understanding of pathogenicity, virulence and host specificity, and evolutionary aspects of the genus may be further elucidated. Preliminary information has revealed that the genome of M.smegmatis is similar in size (7-8 Mb) to that of the related actinomycete Streptomyces coelicolor (Brosch et ah, 2001) (http://www.sanger.ac.uk/Projects/S_coelicolor/). This result, coupled to results from the analysis of the 16S rRNA genes suggests that slow growing mycobacteria represent the most recently evolved branch of the genus. If correct, then the possibility exists that loss of genes, rather than horizontal transfer of genetic material, may be an important factor in the evolution of the slow growing pathogenic mycobacteria. The relative uniformity of the G + C content in the M.tuberculosis H37Rv gene has been postulated as confirmatory evidence that little horizontal transfer of genetic material has occurred in M.tuberculosis (Brosch et al, 2001).

Members of the MAC complex, like the members of the M.tuberculosis complex demonstrate a high level of sequence conservation with strains difficult to differentiate (see section 1.4). The sequencing of the genomes of two distinct strains of the MAC complex, M.avium (ISPOi negative) and M.a.paratuberculosis (Table 1,1), and the subsequent genomic comparisons may allow a more complete picture of the differences in terms of host specificity and virulence between the two closely related species to be determined. Also, it may afford the opportunity for the identification of species-specific genomic regions that would form the basis of new detection techniques to distinguish between the two strains. A recent preliminary report on the comparison of both genomes revealed the presence of 21 ORFs apparently unique to the genome of M.a.paratuberculosis (Bannantine et al, 2002). Such differences are based on a comparison of approximately half the completed genome of M.a.paratuberculosis, raising the possibility that more genomic differences exist between the genomes of these two closely related species. Mycobacterial Species Database Mycobacterium smegmatis, http://www.tigr.org/tdb/mdb/mdbinprogress.html/ Mycobacterium avium

Mycobacterium avium http ://www.cbc.umn.edu/ResearchProj ects/AGAC/ subspecies paratuberculosis Mptb/Mptbhome.html/

Mycobacterium ulcerans, Mycobacterium microti, http://www.pasteur.fr/recherche/unites/Lgmb/ Mycobacterium bovis BCG

Mycobacterium tuberculosis http://genolist.pasteur.fr/TubercuList/ H37Rv **

Mycobacterium tuberculosis http ://www.tigr.org/tigr- CDC1551** scripts/CMR2/genomePage3.spl/database=gmt/

Mycobacterium tuberculosis http://www.tigr.org/cgi-bin/BlastSearch/blast.cgi/ strain 210

Mycobacterium bovis http ://www. sanger. ac.uk/Proj ects/Mbovis/

Mycobacterium leprae ** http://genolist.pasteur.fr/Leproma/

Table 1.1 Mycobacterial Genome Sequencing Projects. **Indicates a completed genome. Adapted from Brosch et al, 2001. 1.4 Tht Mycobacterium avium Complex (MAC) The MAC comprises a large group of closely related mycobacteria including M.intracellulare, M.avium subspecies avium (M.a.avium), M.avium subspecies silvaticum (M.a.silvaticum), M.avium subspecies paratuberculosis {M.a.paratuberculosis) and M.lepraemurium (Thorel et ah, 1990). M.lepraemurium is the causative agent of murine leprosy (Rojas-Espinosa and Lovik, 2001) and M.a.silvaticum (originally called the wood pigeon bacillus), containing the specific insertion sequences ISPP7 and ISPP2, has been reported to produce a disease resembling paratuberculosis in calves and deer (Matthews et al, 1982; Collins et al, 1983). M.a.avium consist of primarily saprophytic strains, which are widely distributed in the environment and also in apparently healthy animals, birds and humans. However, a number of M.avium strains are opportunistic pathogens of animals and humans, capable of causing infection and disease in debilitated hosts. M.avium strains have gained increased importance in recent times due to the observed high level of disseminated infection seen in patients with acquired immune deficiency syndrome (AIDS) (Hampson et al, 1989; McFadden et al, 1992).

M.a.paratuberculosis is the causative agent of paratuberculosis or Johne’s disease, a chronic enteric disease of animals, principally affecting ruminants (Cocito et al, 1994). One of the primary distinguishing features of M.a.paratuberculosis is the extremely slow growth in culture, generally 16 weeks on primary culture, although longer incubation periods have been observed for ovine isolates and those from Crohn’s Disease isolates. A second subspecies-specific characteristic is the growth- dependency on mycobactin, an iron chelating cell wall component produced by most other mycobacteria. The identification and characterisation of a subspecies-specific insertion sequence 1S900 has been used extensively to differentiate M.a.paratuberculosis from M.a.avium and M.a.silvaticum (Green et al, 1989; Pavlik et al, 1995; Moreira et al, 1999; Cousins et al, 2000; Bull et al, 2000a; Stevenson et al, 2002). The 1.45kb element was considered unique to M.a.paratuberculosis, with approx. 15-20 copies present in the M.a.paratuberculosis genome (Green et al, 1989). The element itself is unusual in lacking inverted repeats or flanking direct repeats, showing no target site duplication but still requiring a homologous target site sequence for integration. M.a.paratuberculosis has been shown to possess a very broad host range with cattle and sheep isolates of M.a.paratuberculosis reported as well as pigmented strains isolated from multibacillary cases of ovine paratuberculosis (see section 1.5) (Cocito et al, 1994). Such cases have characteristically yellow or orange intestinal regions presumably caused by the presence of large numbers of pigmented organisms present (Clarke and Little, 1996). Strains isolated from sheep and goats have been observed to be more difficult to culture (Juste et al, 1991). More recently M.a.paratuberculosis has been found in ruminant and non-ruminnat wildlife species (see section 1.6.5).

1.5 MAC and M.a,paratuberculosis Strain Differentiation The development and application of reliable techniques to accurately distinguish between members of the MAC has been an ongoing process for the last number of years (Stevenson and Sharp, 1997). A set of phenotypic properties based on a large number of biochemical tests was shown to be capable of dividing the MAC into three distinct subgroups namely, M.a.avium, M.a.silvaticum and M.a.paratuberculosis (Thorel et al, 1990). However, such schemes are complex, a more common way of differentiating between closely related species is to exploit genomic differences between the various strains.

1.5.1 DNA-DNA hybridisation DNA-DNA hybridisation studies have demonstrated between 72 and 100% homology between the various members of the MAC (Hurley et al, 1989). This figure increased to 95-100% when strains of M.intracellulare were ignored (McFadden et al, 1987a; Hurley et al, 1989). The results of such studies indicated a high level of genetic homogeneity between members of the MAC, rendering many of the strains indistinguishable from each other (McFadden et al, 1990).

1.5.2 rRNA genes Differences in the 16S rRNA gene have been used successfully to determine the phylogenetic relationships of mycobacteria and other bacterial taxa. Unfortunately, each of the rRNA genes (16S, 23 S and 5S) as well as their intergenic spacer regions are highly conserved in the M.avium complex (Stahl and Urhance, 1990; Rogall et al, 1990a; Rogall et al, 1990b; van der Giessen et al, 1994). Indeed, The GenProbe® AccuProbe (GenProbe® Inc., San Diego, California, USA) detection Kit is capable of distinguishing between M. avium and M.intracellulare but is unable to distinguish between M.avium and M.a.paratuberculosis (Thoresen and Saxegaard, 1991). Upon sequence analysis a single base pair difference at position 135 in the variable region of the 16s rRNA coding sequence exists between M.avium and M.a.paratuberculosis (van der Giessen et al, 1992). A similar level of sequence conservation was observed for the 23s rRNA gene, with only 9 mismatches observed between M.avium and M.a.paratuberculosis and in the intergenic region 1, where only 2 mismatches are observed (van der Giessen et al, 1994).

1.5.3 Molecular typing methods Molecular typing techniques have been used to study the diversity and strain differentiation within the M.avium complex. Restriction fragment length polymorphism (RFLP) and field inversion gel electrophoresis have been shown to discriminate M.a.paratuberculosis from other M.avium species, with only limited differences observed between M.a.paratuberculosis isolates (Whipple et al, 1987; Picken et al, 1988; Levy-Frebault et al, 1989; Chiodini, 1989a). The ability of RFLP to distinguish between M.a.paratuberculosis strains was enhanced by hybridising the endonuclease generated genomic DNA fragments with DNA probes, resulting in a simplification of the observed banding pattern (McFadden et al, 1987b). One such fragment contained the 1^900 sequence, which was used to successfully discriminate between the two subspecies (McFadden et al, 1987b). Other insertion sequence elements in isolation or in combination have also been used as probes in RFLP analysis to discriminate between the members of the MAC complex including ISP07, IS1245 and IS7377 (Kunze et al, 1992; Collins et al, 1997; Ritacco et al, 1998; Whittington et al, 1998a; Whittington et al, 2000; Garriga et al, 2000).

An \S)900 based probe bas been used to distinguish more than 20 different M.a.paratuberculosis RFLP types (Pavlik et al, 1995; Pavlik et al, 1999). The probe was based on a short sub-species specific region located in the 5’ region of the element. Earlier studies had used ISPOO-RFLP to divide M.a.paratuberculosis strains into three major groups, the first group comprised primarily New Zealand cattle isolates although some sheep and goat isolates were also present (Collins et al, 1990), the second group comprised sheep isolates from New Zealand and the Faeroe Islands (de Lisle et al, 1993) and a third group comprising sheep isolates from South Africa (de Lisle et al, 1992), Iceland and Canada (Collins et al, 1990). More recently, IS900-RFLP using the endonuclease PvuJl subdivided 42 M.a.paratuberculosis strains into two major clusters. Cluster I contained slow growing sheep isolates (S-strains) with Cluster II containing Cattle and Goat isolates (C-strains) (Cousins et al, 2000). In New Zealand and Australia, S-strains are predominantly recovered from sheep (Whittington et al, 2000). In Europe, C-strains are predominantly isolated from sheep and also from cattle and non-ruminant animals. As such, although the terms C and S are used in describing M.a.paratuberculosis strains no conclusive evidence of species-specific strains have been thus far been described. In general IS900-RFLP has been able to detect limited heterogeneity among M.a.paratuberculosis strains with a single IS900-RFLP type predominating in many countries.

Probes based on IS1311 have been used to analyse M.a.paratuberculosis isolates, with fewer polymorphisms observed than seen with 1^900 probes (Whittington et al, 1998a). In general however, such techniques are limited by the number of copies of the insertion sequence present in each isolate and the genomic distribution of the insertion sequence. As such the insertion of insertion elements into the M.a.paratuberculosis genome may generate insufficient genomic polymorphism to adequately differentiate strains of M.a.paratuberculosis from each other.

As already stated, there are approximately 15-20 1^900 integration sites in the M.a.paratuberculosis genome, although there appears to be a degree of strain based variability at several sites in terms of the presence of 1^900 at that site or IS900 mediated re-arrangements of the surrounding loci. These features have formed the basis of a multiplex PCR typing technique, reportedly capable of discriminating 10 different types of M.a.paratuberculosis isolates from different host species e.g., cattle, sheep and man (Bull et al, 2000a). Point mutations in IS7577, however, have allowed the development of a PCR based detection assay followed by endonuclease

10 analysis of the resulting PCR product that allows the differentiation of sheep and cattle M.a.paratuberculosis strains (Whittington et al, 1998a). A new M.a.paratuberculosis specific insertion element, ISMav2, has been recently identified (Strommenger et al, 2001). The IS element is present in at least three copies in the M.a.paratuberculosis genome and demonstrates no significant similarity at nucleotide or amino acid level to known mycobacterial IS elements. Initial results suggest that the lSMav2 PCR is capable of discriminating M.a.paratuberculosis fi*om M.avium.

Field inversion gel electrophoresis (FIGE) using the endonuclease Dral was capable of differentiating M.a.paratuberculosis firom M.a.avium and M.a.silvaticum but revealed a high level of genetic homogeneity for M.a.paratuberculosis (Arbeit et al, 1993). Pulsed field gel electrophoresis (PFGE) has been used to demonstrate strain differentiation of M.avium strains from AIDS patients and to compare strains of M.avium derived from animals and humans (Coffin et al, 1992; Picardeau and Vincent, 1996; Inglis and McFadden, 1999). Such whole genome molecular typing techniques may offer greater sensitivity in differentiating M.a.paratuberculosis isolates, as they do not rely on the potential polymorphisms generated by the presence of insertion elements. A recent comprehensive study conducted at the Moredun Research Institute examined 5 pigmented and 88 non-pigmented M.a.paratuberculosis strains using multiplex-PFGE (utilising restriction enzymes Sna BI and Spe I), ISPOO-RFLP (utilising restriction enzymes Bst Eli and Pvu I) and IS7577 polymorphic analysis using PCR (Stevenson et al, 2002). All pigmented isolates demonstrated the same multiplex-PFGE. Similarly, all of the pigmented strains were designated S (sheep) strains by IS7577-PCR analysis. Finally, multiplex PFGE differentiated the panel of mycobacterial strains into two distinct types, type I, comprised the pigmented strains with type II comprising all non-pigmented isolates. The multiplex-PFGE was found to detect greater heterogeneity than the IS900-RFLP, as the PFGE was capable of subdividing an IS900-RFLP type into two multiplex- PFGE types. The most common type was observed in cattle, sheep and even wildlife arguing that there are no species-specific strains in this panel.

11 Randomly amplified polymorphic DNA (RAPD) techniques have been developed for M.tuberculosis and M.avium (Matsiota-Bemard et al, 1997; Kauppinen et al, 2001; Pillai et al, 2001; Ramasoota et al, 2001). Application of this technique to M.a.paratuberculosis isolates allowed the differentiation of M.a.paratuberculosis isolates firom animals and humans, although only limited diversity between the isolates was reported (Scheibl and Gerlach, 1997; Francois et al, 1997).

1.6 Johne’s Disease 1.6.1 Aetiology Paratuberculosis was first described in 1895 by Johne and Frothingham as a chronic enteritis in cattle (Johne and Frothingham, 1895). It was originally thought that the disease was an intestinal form of tuberculosis due to the presence of acid fast bacilli presumed to be the result of M.avium or M.tuberculosis infection. Bang differentiated the disease from tuberculosis in 1906 and the causative organism was isolated in 1911 by Twort and Ingram and named Mycobacterium enteriditis chronicae pseudotuberculosae bovis johne. Since then the disease has become known as paratuberculosis or Johne’s disease and the causative organism has been renamed several times and has recently been reclassified as M.a.paratuberculosis (Thorel et al, 1990).

1.6.2 Infection The primary route of paratuberculosis infection appears to be the faecal/oral route, probably through the ingestion of contaminated faeces, milk or colostrum (Chiodini et al, 1984; Cocito et al, 1994). Viable M.a.paratuberculosis have also been recovered from the reproductive organs of infected animals and intrauterine infection of the foetus has been reported (Clarke, 1997a). However, classic paratuberculosis lesions have not been identified in infected foetuses. There appears to be an age- related resistance to M.a.paratuberculosis infection, with most animals infected at the neo-natal stage with fewer animals infected as adults (Cocito et al, 1994; Clarke, 1997a). Following oral ingestion the organism translocates through the mucosal epithelium, probably via the M-cells of the dome epithelium (Peyers patches) of the ileum and jejunum. The organism is then phagocytosed by sub-epithelial macrophages where the bacilli persist and replicate (Momotani et al, 1988). Clinical

12 symptoms occur in a minority of infected animals after a prolonged incubation period. The progressive disappearance of the Peyers patches after birth, although patches in the jejunum and ileoceacal valve region persist in adult animals, may be sufficient to explain the age-related resistance observed in adult animals (Landsverk et al, 1991).

The protracted period of infection prior to the onset of clinical disease allows faecal shedding of large number of organisms, contaminating pastures. Clinical symptoms in cattle are watery diarrhoea and progressive weight loss, with an absence of diarrhoea noted in some sheep and goat cases (Cocito et al, 1994). The sub-clinical infection is characterised by weight loss and decreased milk production. The appearance of disease associated lesions occur in the jejunal and ileocaecal Peyers patches area, with lesions often persisting for long periods of time. As the infection progress, lesions will spread to wide areas of the intestine, causing the typical granulomatous enteritis.

1.6.3 Pathological features of Johne’s disease The principal pathological changes centre on the intestine and the related lymphatic and lymphoid tissues although in advanced cases, pathology associated with cachexia may be present. Where infection with pigmented strains occurs, the mucosal lining takes on a pathognomonic bright yellow colour, due to the presence of pigmented M.a.paratuberculosis in the lamina propia (Little et al, 1996; Clarke and Little, 1996). There are two type of intestinal pathology seen in Johne’s affected sheep (Cocito et al, 1994; Perez et al, 1996; Perez et al, 1999). Lesions seen in the paucibacillary form (borderline-tuberculoid: 31% of cases) present a marked lymphocytic infiltrate with low numbers of acid-fast bacilli and high activated T-cell counts, showing a high cell mediated immune (CMI) response and a predominance of Th-l-like (IL-2 and IFN-y) cytokines. In the multibacillary form (borderline- lepromatous: 69% of cases), lesions are characterised by the presence of macrophage infiltration containing numerous acid-fast bacilli and few T-cells, with a greater antibody response, no detectable CMI and a predominance of Th-2-like cytokines (IL-4 and IL-10) (Begara-McGorum et al, 1997; Burrells et al, 1998; Begara- McGorum et al, 1998; Burrells et al, 1999). There are immunological parallels

13 between Johne’s disease and another important pathogenic mycobacterial infection, leprosy, affecting humans. Both mycobacterioses are chacarterised by a strong early CMI response, limiting bacterial proliferation and a terminal anergic stage where there is no detectable CMI response but there are elevated serum antibody levels. It is thought that animals that succumb to Johne’s disease have mounted an insufficient or inappropriate response to clear or contain the infection. To this end, the role of a CMI response could be important in determining which type of pathology is observed in affected animals.

1.6.4 Prevalence and economic impact Paratuberculosis is a global disease problem whose prevalence has been reported to be increasing in some countries. In the USA the prevalence was determined to be 1.6% of all cattle and 2.9% of cull cows (Merkal et al, 1987). Prevalence levels as high as between 18% and 30% have been reported among US cattle herds (Chiodini and van Kruiningen, 1986). A seroprevalence of 74% and 40% has been reported for dairy and beef herds respectively in Missouri (Thome and Hardin, 1997). More recently, results fi*om ELISA based serologic testing revealed that 3.4% of cows and 21.6% of dairy herds were infected with M.a.paratuberculosis in the US (Wells and Wagner, 2000), with a herd prevalence of 54% reported in the Michigan area (Johnson-Ifeamlundu and Kaneene, 1999). The prevalence of bovine paratuberculosis has been estimated to be 15% in the UK. In Europe, using absorbed ELISA as the diagnostic tool, the seroprevalence was determined to be 54.7% at the herd level and 2.5% at the individual animal level in the Netherlands (Muskens et al, 2000) and 17.4% level and 1.2% individual animal level in Belgium (Boelaert et al, 2000). Similarly, a prevalence level of 70% has been estimated for Danish dairy herds based on the seriological detection of M.a.paratuberculosis in bulk milk samples (Nielsen et al, 2000). Earlier findings using an ELISA method utilising a M.a.paratuberculosis specific recombinant protein (a362) indicated a seroprevalence of paratuberculosis in the Wallon district of Belgium to be 12% (Vannuffel et al, 1994). A seroprevalence of 6.96% has been reported for farms in Austria (Gasteiner et al, 1999).

14 The estimated costs to farmers of animals sub-clinically infected with M.a.paratuberculosis was estimated to be £209 per infected dairy cow, due to decreased milk production (Benedictus et al, 1987). The cost to the Dairy industry in the US has been estimated to exceed $15 billion annually (Stabel, 1998), with the estimated costs in the New England area alone to be over $15.4 million per year (Chiodini et al, 1984). Indeed, recent work also carried out in the US, has calculated that paratuberculosis costs dairy farmers around $100 per cow in moderately infected areas rising to $200 per cow in heavily infected areas (Ott et al, 1999). The same study estimated that losses due to reduced productivity amounted to between $200 and $250 million dollars. Such loses have been associated primarily with poor milk production and costs associated with replacing stock. Considerably more research is needed in determining the global level of paratuberculosis prevalence before the real cost to the agricultural industry can be determined. However, it is likely that the true cost of the disease is considerably higher than presently accepted estimates.

1.6.5 Wildlife and non-ruminant infection During the clinical stage of disease large scale shedding of the organism in faeces is observed. Environmental contamination is the major factor in the spread of disease not only to other domestic ruminants but also to wild life inhabitants of the pasture. The finding that M.a.paratuberculosis can infect non-domestic animals including rabbits and other wildlife species, poses serious questions in the overall control of the disease, as well as the more general question of the epidemiology of the disease (Greig et al, 1997; Greig et al, 1999; Beard et al, 2001a; Beard et al, 2001b). M.a.paratuberculosis has been isolated from several species of wild animals including both ruminant and non-ruminant species (Jorgensen, 1969; Chiodini and van Kruiningen, 1983; Buergelt et a/., 2000; Beard et al, 2001b). In the Tayside area of Scotland, 67% of wild rabbits surveyed were infected with M.a.paratuberculosis and showed histopathological changes that were consistent with those seen in ruminants (Greig et al, 1997).

Further investigation across a broader area supported these initial findings and confirmed that the Tayside area is indeed a hotspot for M.a.paratuberculosis (Greig

15 et al, 1999). A statistical correlation was seen between a past or current M.a.paratuberculosis problem and infection of rabbits. Upon investigation the strains isolated from rabbits did not appear, based on in vitro growth rates and morphology, to be different from cattle strains. PFGE typing failed to detect any difference between rabbit and cattle strains on the same farm. The possibility therefore remains that the shedding of organisms from infected ruminants, are a source of infection for wildlife species, which may then act as a reservoir of infection for the sub-sequent re-infection of domestic ruminants.

1.7 Diagnosis of Johne’s Disease The diagnostic techniques that can be used to detect the disease are influenced by the stage of the disease and prevalence in the herd. Attempts to detect sub-clinically affected animals are hampered by the long incubation period of the disease characterised by the presence of low numbers of bacilli and little or no immunological response (Cocito et al, 1994;Clarke et al, 1996a). Similarly, the absence of a humoral response at this stage of disease precludes early serological detection of animals infected with M.a.paratuberculosis. In the clinical stage of the disease, circulating serum antibodies are detectable in an ELISA assay and the bacterium is routinely recovered from the faeces of infected animals, although intermittent shedding of the organism has been observed at earlier stages of paratuberculosis. The ability of both techniques to detect M.a.paratuberculosis increases with disease progression. However there exists considerable variation in the responses observed in individual animals, particularly in the pauci-bacillary form of the disease in sheep. Exposure to antigenically similar environmental strains of mycobacteria has also hampered attempts to develop sensitive and specific diagnostic tests for paratuberculosis (Cocito et al, 1994; Valentin-Weigand and Goethe, 1999).

1.7.1 Microscopic examinationof M,a,paratuberculosis in faeces The detection of M.a.paratuberculosis in stained (Ziehl-Neelsen-ZN) faecal smears depends on the number of organisms present and the degree of bacterial clumping that has occurred. The overall sensitivity of the test is considered inadequate because faecal shedding of the organisms may be intermittent with insufficient organisms

16 present. Similarly, the test is not capable of differentiating M.a.paratuberculosis from other environmental mycobacteria that may be passing through the gut following ingestion (Clarke, 1997a).

1.7.2 Detection in culture The ability to culture the organism from the faeces of infected animals is regarded as the gold standard for diagnosis of Johne’s disease, but success does vary. In a comparison of samples taken from multi- or paucibacillary forms of infection in sheep, the success of culturing was seen to correlate with the likelihood that sufficient numbers of M.a.paratuberculosis were been shed from the intestinal lesion (Chiodini et al, 1984). The very slow growth and requirement for exogenous mycobactin, while being important characteristic determinants of M.a.paratuberculosis, prolong diagnosis. Similarly, slow growth of M.a.paratuberculosis necessitates the decontamination of the faecal samples prior to culturing to prevent the growth of faster growing bacterial strains (Whipple et al, 1991). False negatives may occur due to impaired mycobacterial viability as a result of such procedures. Confirmation of M.a.paratuberculosis identity has been achieved by PCR amplification of the M.a.paratuberculosis specific insertion sequence \S900 (Vary a/., 1990).

Other more rapid techniques for the detection of M.a.paratuberculosis in culture have been investigated. One such technique uses the radiometric based BACTEC 460 system. Growth of mycobacteria is measured by metabolic conversion of the ^^C-labelled substrate palmitate to ^"^CO: during growth in liquid medium. The release of ^"^COa can then be measured sensitively in the gas phase above the culture. Using this system it was reported that under the right growth conditions, including the presence of egg yolk and Mycobactin J, M.a.paratuberculosis could be cultured from sheep intestinal tissues and faecal samples (Cousins et al, 1995; Whittington et al, 1998b; Whittington et al, 1999). Confirmation of the presence of M.a.paratuberculosis is still required by the use of down stream methods, such as \S900 PCR. The application of such systems should lead to a decrease in the diagnostic waiting time compared to more traditional culture methods. This is of

17 particular relevance for ovine samples, which are seen as slower growing and harder to culture than bovine samples (Whittington et al, 1999).

1.7.3 Nucleic acid based detection of M.a.paratuberculosis The identification of IS900 in M.a.paratuberculosis and the closely related \^901/\S902 in some M.avium strains, has allowed the differentiation of M.a.paratuberculosis from other members of the MAC but also has provided an important diagnostic tool in the detection of M.a.paratuberculosis in infected animals (Sanna et al., 2000; Garrido et al., 2000). The use oflS900 is an attractive method of detection as it is a rapid test compared to prolonged culturing methods and offered increased specificity. Indeed, IS900 PCR based detection of M.a.paratuberculosis in ovine faeces was found to be more sensitive than culturing (Collins et al, 1993). This may be due in part to the difficulties associated with the culturing of ovine samples. PCR based detection in bovine samples was found to be less sensitive than culturing methods (Collins et al, 1993). In practice a high level of sensitivity is rarely attained due to difficulties in sample preparation. Reduced sensitivity can result fi*om inefficient template-DNA extraction protocols particularly where low numbers of organisms are present in the sample, and the presence of inhibitors of PCR in faecal and tissue samples.

Improved sample preparation techniques have been developed, especially for faecal samples, improving the sensitivity of such techniques. The application of an IS900 PCR assay to blood and other tissue specimens fi*om sheep with clinical paratuberculosis offered an encouraging alternative to the detection of M.a.paratuberculosis in faecal samples (Gwozdz et al, 2000a). More recently, results indicated that such assays lacked the sensitivity and specificity required for detection of subclinically infected cattle (Gasteiner et al, 2000). Techniques have also been developed to demonstrate the presence of M.a.paratuberculosis in formalin-fixed and paraffin embedded tissue samples using \S900 PCR (Sanna et al, 2000).

Recently, Cousins et al have reported the isolation of mycobacterial field isolates in Australia that were 1^900 PCR positive (Cousins et al, 1999). However, upon

18 further examination of the isolated organism using \S900 RFLP, mycobactin dependence and 16s rRNA sequencing the isolated organism more closely resembled M.scrofulaceum. The authors recommended that restriction endonuclease analysis (REA) of IS900 PCR products should be introduced as a routine precaution to prevent the assignation of false positive results. Englund et al identified an IS900 PCR positive strain from cattle that demonstrate microscopic and growth differences (loss of mycobactin dépendance in subsequent culture and recovery of colonies in 4 weeks) to M.a.paratuberculosis (Englund et al., 2002). They report the presence of a single 1^900 like element demonstrating demonstrating 94.4% identity at the nucleotide level to ISPOO. Subsequent analysis, using 16s rRNA sequences revealed that the strain resembled M.cookii. Significantly, they also noted that REA of the resulting PCR product, as recommended by Cousins et al, would have reiterated the assignation of a false M.a.paratuberculosis identity. Collectively, these findings raise fears over the validity of using 1^900 PCR as the sole criteria in determining the presence of M.a.paratuberculosis.

Based on these observations other mycobacterial IS elements have been used to develop diagnostic PCR techniques for the detection of paratuberculosis. One such technique uses REA of IS7577 PCR products (Marsh et al, 1999). IS7577 is present in both M.avium and M.a.paratuberculosis but point mutations exist in the sequences of the element from the different M.avium strains, allowing the differentiation of M.a.paratuberculosis from M.avium by restriction endonuclease analysis using the restriction enzymes Hinfi and Msel. The test was reported to be capable of distinguishing between not only M.a.paratuberculosis and M.avium but also between ovine and bovine isolates of M.a.paratuberculosis.

In addition to IS elements, species-specific genome sequences have provided the bases for the development of diagnostic tests for paratuberculosis. The F57 genomic sequence was shown to be specific for M.a.paratuberculosis encoding a 620bp ORF with a G + C of 59%, demonstrating no significant homology to any other sequence in the EMBL database (Poupart et al, 1993). Labelled RNA transcripts from the F57 fragment were shown to hybridise to genomic DNA from all strains of M.a.paratuberculosis tested but not to the genomes of other mycobacteria included

19 in the study. Coetsier et al developed a duplex PCR based on F57 and a region of up stream sequence of the M.a.paratuberculosis immunodominant 34kDa antigen gene (Coetsier et al, 2000). The upstream region of the p34 in M.tuberculosis complex strains contains a 79bp deletion compared to the region from M.avium complex strains. The authors demonstrated that the duplex PCR is capable of distinguishing between M.a.paratuberculosis and M.avium and also members of the M.tuberculosis complex (specifically M.tuberculosis H37Rv and M.bovis) in a panel of formalin- fixed paraffin embedded tissue specimens from cattle.

A second M.a.paratuberculosis species-specific genomic sequence has been identified, characterised and applied to a diagnostic test to discriminate M.a.paratuberculosis from other mycobacterial species (Coetsier et al, 2000). The 423bp sequence encodes a heat shock protein (hsp)-like protein, designated hspXfvas recently been demonstrated to be expressed in bovine and murine macrophages infected with M.a.paratuberculosis (Bannantine and Stabel, 2000). Initial results reported that a 30bp oligonucleotide hspX specific probe in conjunction with a second oligonucleotide probe derived from the conserved mycobacterial recA gene was capable of detecting mycobacterial genomic DNA and discriminating M.a.paratuberculosis from other mycobacteria and even other subspecies of the M.avium complex (Coetsier et al, 2000).

More recently, a PCR panel assay using primers for the hspX gene {M.a.paratuberculosis specific), the 16s rRNA gene {M.avium complex specific), ISP07 {M.a.avium specific), \S1245 {M.avium complex specific) and ISPOO {M.a.paratuberculosis specific) has been reported (Ellingson et al., 2000). The application of this technique to mycobacterial lysates from 120 strains in 2 independent laboratories, resulted in 100% and 99.2% detection and differentiation of M.a.paratuberculosis from M.avium and other mycobacterial species in Lab 1 and Lab 2 (blind test) respectively. The ability to demonstrate similar results in two independent laboratories is encouraging, as any standardised detection system must demonstrate reproducibility.

20 1.7.4 Serological detection of M,a.paratuberculosis infection Several different tests for the serological detection of paratuberculosis have been reported including the complement fixation test (CFT), agarose gel immuno diffusion (AGED) and enzyme-linked immunosorbent assay (ELISA) (Cocito et al, 1994). All are affected by an overall lack of sensitivity and an inability to detect early stages of the disease or paucibacillary forms of the disease in sheep where antibody levels are low or absent (Clarke et al., 1996b).

The preferred test for herd analysis is ELISA, based on its sensitivity in comparison to other serological tests, ease of use and rapid diagnostic determination of M.a.paratuberculosis infection status. However, difficulties in specificity have been reported, particularly as a result of the use of crude or partially purified preparation of bacterial extracts such as LAM PPD (Dargatz et al, 2001). Such preparations contain antigenic reagents that are common to most mycobacteria, resulting in the detection of false positives (Nielsen et al, 2001). The specificity of such tests has been increased by absorption of test sera with lysates from environmental mycobacteria, such as M.phlei, eliminating cross-reactive mycobacterial antibodies (Milner et al, 1990).

Refinements of ELISA techniques have centred on using M.a.paratuberculosis specific recombinant antigens to increase the specificity of the tests. A clone isolated from a bacteriophage Igtl 1 expression library was shown to encode a peptide (a362) thought to carry subspecies specific B-cell epitopes corresponding to a 34kDa antigen of M.a.paratuberculosis (de Kesel et al, 1993). A peptide from the carboxyl terminus of a362 was used to develop an ELISA based detection system that was reportedly capable of discriminating M.a.paratuberculosis from strains of the M.avium complex (Vannuffel et al, 1994). More recently, IgGl- and IgG2- subisotype specific ELISA protocols have been developed based on the M.a.paratuberculosis derived antigens Hsp70 and Hsp65, LAM and Johnin PPD (Koets et al, 2001). The study compared the antibody responses of vaccinated animals, asymptomatic animals shedding bacteria and non-shedding animals and animals exhibiting clinical symptoms. They report that there is no uniform association with increased antibody responses during the progression of the disease

21 to clinical stage of bovine paratuberculosis. Indeed, elevated IgGl and IgG2 concentrations were only detected in asymptomatic shedding animals. These results challenge the standard assumptions that humoral immunity is only seen at later stages of the disease and may have important ramifications on the design of future serological-based detection techniques.

1.7.5 CMI-based detection of M.a.paratuberculosis infection Classically, the early stages of M.a.paratuberculosis infection are characterised by a strong CMI response with a gradual decrease in cell-mediated immunity during the progression of paratuberculosis and a concomitant increase in humoral responses (Cocito et al, 1994). Techniques based on measuring cell-mediated immunity offer distinct advantages in detecting infected animals at the subclinical stage of the disease. Cell mediated immune responses to M.a.paratuberculosis infection have been measured in vivo using the intradermal skin test and in vitro using a gamma- interferon ELISA assay and a migration inhibitory test. In the intradermal skin test, the diameter of the DTH response is measured following inoculation with M.avium purified protein derivative (PPD) or Johnin PPD (Gilot and Cocito, 1993). An increase in thickness of 2mm is regarded as a positive reaction. Such tests cannot discriminate between diseased animals and animals that have been vaccinated, and may also detect animals infected with other mycobacterial strains. Techniques have been developed to measure IFN-y levels from heparinised blood of infected animals stimulated with PPD using an ELISA method (Bilhnan-Jacobe et al, 1992; Lauzi et al, 2000; Gwozdz et al, 2000b; Stabel and Whitlock, 2001; Whipple et al, 2001). As already mentioned, the crude nature of the both avian and Johnin PPD used as the basis of such tests and containing potentially cross reactive antigens results in an overall lack of specificity and the occurrence of false positives.

1.8 Crohn’s Disease Crohn’s disease is a non-specific chronic inflammatory disease of humans most commonly affecting the distal ileum and colon but may occur in any part of the gastrointestinal tract fi*om the mouth to the anus and perianal area. The most common clinical features of the disease are chronic diarrhoea associated with abdominal pain, fever, anorexia, weight loss and a right lower quadrant mass or

22 fullness. Prolonged constipation has also been noted and may lead to intestinal obstruction, necessitating surgical intervention to remove the obstructed ileum. The exact aetiology of the disease remains unknown. Numerous infectious agents, viruses and immunological factors have all been implicated as potential causes of the disease (Thompson, 1994; Sartor, 1997; van Kruiningen et al, 2000; Okabe, 2001). The results from several familial studies have also implicated inheritable factors as predisposing individuals to the development of Crohn’s Disease, with regions on chromosome 12, 14 and 16 implicated in the pathogenesis of both Crohn’s disease and ulcerative colitis (Hugot et al, 1996; Cavanaugh et al, 1998; Brant et al, 1998; Ma et al, 1999; Frankish, 2001). The pathogenesis of the disease therefore may involve an interaction of genetic and environmental factors with the precise mechanism responsible for initiating chronic intestinal inflammation remaining unclear.

1.8.1 Crohn’s disease and M.a.paratuberculosis Despite uncertainties surrounding the precise aetiology of the disease, Crohn’s disease does exhibit some clinical and pathological similarities to the pauci-bacillary form of paratuberculosis in animals (Chiodini, 1989b; Thompson, 1994; McFadden and Fidler, 1996; Hermon-Taylor et al, 2000). Several studies have reported culturing M.a.paratuberculosis from the inflamed intestine of Crohn’s patients but only in up to 5% of infected individuals (McFadden et al, 1987c; Chiodini, 1989b). Other mycobacteria have also been isolated from Crohn’s patients including, members of the MAC, M.kansasii, M.cheloni, and M.fortuitum (Chiodini, 1989b; McFadden and Fidler, 1996). Many of these studies reported the isolation of spheroplast forms, some of which appeared to be mycobacteria in subsequent studies. M.a.paratuberculosis has been detected in pathological samples from patients with Crohn’s disease by 1^900 PCR and also at a lower level, in healthy control individuals (Moss et al, 1992; Wall et al, 1993; Dell'Isola et al, 1994; Rowbotham et al, 1995; Clarkston et al, 1998; Schwartz et al, 2000). One recent study demonstrated the presence of M.a.paratuberculosis in samples of breast milk obtained from two mothers with Crohn’s disease, and not from the breast milk of 5 healthy individuals (Naser et al, 2000a). However, the recent finding of ISPOO-like sequences in other mycobacterial species questions the reliance on IS900 PCR as the

23 pronciple method of M.a.paratuberculosis in Crohn’s disease patients. There are also numerous reports in the literature failing to detect the presence of M.a.paratuberculosis in Crohn’s disease samples by \S900 PCR (Dumonceau et al, 1996; Frank and Cook, 1996; Chiba et al, 1998; van Kruiningen, 1999; Kanazawa et al, 1999).

Serological detection of M.a.paratuberculosis in Crohn’s patients based on crude M.a.paratuberculosis extracts in ELIS As failed to detect any differences in antibody binding between Crohn’s disease patients and control subjects (Thayer, Jr. et al, 1984; Cho et al, 1986; McFadden and Houdayer, 1988; Wahnsley et al, 1996). Similarly, no differences were seen in peripheral blood and mucosal CMI responses to sonicates of M.a.paratuberculosis, heat killed M.a.paratuberculosis, and M.a.paratuberculosis PPD (Seldenrijk et al, 1990; Ibbotson et al, 1992; Walmsley et al, 1996). A recent Japanese study however, reported an increase in IgG binding to a crude protoplasmic extract of M.a.paratuberculosis by Crohn’s disease sera compared with normal controls (Suenaga et al, 1999). Several more recent reports have focussed on antibody recognition of selected peptides of M.a.paratuberculosis. Specific responses have been reported in a proportion of Crohn’s disease patients for several M.a.paratuberculosis proteins, including the 38kDa, 24kDa and 18kDa proteins (Elsaghier et al, 1992), the p35 and p36 antigens (El Zaatari et al, 1999) and the M.a.paratuberculosis-spocific epitope, a362 (El Zaatari et al, 1999; Naser et al, 2000b). However, homologues of these proteins exist in other mycobacterial species, and antibody repsonses were also seen in healthy controls and ulcerative colitis patients.

Clinical improvement in a limited number of Crohn’s patients has been observed in response to treatment with conventional anti-tuberculosis chemotherapy, including various combinations of rifampicin, dapsone, isoniazid, streptomycin and ethambutol (Hulten et al, 2000; Colombel et al, 2001). However, relapse of the disease normally occurs and a complete cure is not achieved. The use of drugs such as rifabutin and macrolide antibiotics (e.g. clarithromycin) demonstrating increased anti-MAC activity have been reported to be more effective in higher numbers of Crohn’s patients in open studies, though relapse still occurs (Gui et al, 1997). A

24 large multi-centre, randomised placebo controlled trial of rifabutin, clarithromycin and clofazimine treatment in Crohn’s disease is currently being conducted in Australia, with results expected in 2003 (Hermon-Taylor and Bull, 2002).

Currently there is insufficient evidence to confirm or deny that M.a.paratuberculosis is the causative agent of at least some cases of Crohn’s disease. The detection of M.a.paratuberculosis in a greater number of Crohn’s disease patients than in controls in several studies suggests that the M.a.paratuberculosis may have a role either as the causative agent, as a secondary invader that exacerbates the disease or as a non- pathogenic coloniser due to the Teaky’ nature of the damaged mucosa. However, other factors may contribute to onset of disease including genetic and other susceptibility factors, W iih M.a.paratuberculosis potentially involved in only a subset of Crohn’s disease cases. More work is required to confirm and elucidate the exact role that M.a.paratuberculosis plays in Crohn’s disease.

1.9 Identification of genes in M.a.paratuberculosis To date the main focus of protein and indeed gene identification in M.a.paratuberculosis has been to develop more specific and sensitive diagnostic tests to aid in the detection of M.a.paratuberculosis in infected animals and to facilitate a greater differentiation of M.a.paratuberculosis fi*om other members of the MAC. To this end a number of M.a.paratuberculosis proteins and genome sequences have been reported, which have been recently reviewed in (Harris and Barletta, 2001 ; Stevenson and Sharp, 1997; Clarke, 1997b). As such this section focuses on several of the better charactised examples and also the more recent findings.

Several studies have used SDS polyacrylamide gel electrophoresis often coupled to Western blotting to initially identify M.a.paratuberculosis proteins. Such analyses have revealed numerous immunoreactive proteins in the 20 to over 90kDa range which all belong to a major M.a.paratuberculosis protein antigen complex, A36, with similar antigens present in other bacteria (de Kesel et al, 1992). The most extensively characterised of these include an epitope on the carboxyl terminus of a 34kDa antigen, which has formed the basis of diagnostic tests (see section 1.4) (de Kesel et al, 1993; Gilot et al., 1993; Cocito et al, 1994). The use of monoclonal

25 antibodies has also been successful in detecting predominately heat shock proteins with significant homologies to stress proteins from several other mycobacterial studies (Stevenson et al, 1991). Crossed Immunoelectrophoresis (CIE) was used to identify three proteins exhibiting antigenic properties, namely the constitutively expressed AhpC (a 45kDa homodimer) and AhpD (19kDa) proteins, and a secreted 14kDa protein (Olsen et al, 2000a; Olsen et al, 2000b; Olsen et al, 2001a; Olsen et al, 2001b). Both AhpC and AhpD were demonstrated to be capable of illiciting a specific IFN-gamma repsonse in goats experimentally infected with M.a.paratuberculosis, with antibodies against AhpC also detected in these animals (Olsen et al, 2000b). The secreted 14kDa antigen was shown to be capable of discriminating M.a.paratuberculosis from M.tuberculosis but not other members of the MAC by western immunoblots (Olsen et al, 2001a).

Other approaches to identify potentially sub-species specific M.a.paratuberculosis genes have centred on the creation of a M.a.paratuberculosis genomic expression library followed by subsequent screening of the library for immunoreactive clones using either monoclonal antibodies or rabbit hyper-immune serum. The approach has led to the identification of mainly heat shock proteins or stress proteins with significant homology to other mycobacterial proteins, such as the 70kDa heat shock protein (Stevenson et al, 1991). The production of mAh and anti-sera involves the infection of a non-host animal with bacterial lystates or heat killed bacteria. This inoculation method however does not accurately reflect the immune response of the host animal to infection. This is reflected in the bias towards detection of stress proteins and the apparent inability to identify unique mycobacterial immunogenic components.

In order to represent better the set of antigens expressed in vivo and to augment the identification of potential immunogenic components the library was re-screened with sera from a naturally infected sheep. Any clones that are then isolated produce a protein that is expressed by the bacteria in vivo and as such may be potentially involved in the ovine immune response to M.a.paratuberculosis. This led to the identification of a 34kDa antigen with homology to the HtrA family of bacterial serine proteases (see section 1.10) (Cameron et al, 1994). A more recent study used

26 sera from rabbits infected with live M.a.paratuberculosis to screen a genomic library identified two proteins: Cspl and a polyketide sythase (Pks7) (Bannantine and Stabel, 2001).

Representative difference analysis (RDA) PCR was successfully used to identify the so-called GS element that is present in both M.a.paratuberculosis and also M.a.silvaticum but absent in M.a.avium (Tizard et al, 1998). The GS element itself is 6.5 Kbp long with a GC content of 9%, markedly lower than most mycobacterial genes that have been identified. Sequence data showed that the element itself has 5 ORF’s with homology to the previously reported ser-2 locus of M.avium encoding functions related to extra-cellular polysaccharide synthesis or modification, namely the production of a dimethylfueopyranosyl rhamnopyranoside unit at the terminus of the glycopeptidolipid (Mills et al, 1994; Bull et al, 2000b).

An extracellular ferric reductase, which may be unique to M.a.paratuberculosis, has recently been characterised (Homuth et al, 1998). The protein was demonstrated to be capable of reducing iron complexed in various forms, such as ferritin the main storage form of iron in host cells. While the exact role of the protein remains unknown, the possibility exists that it might represent an alternative mechanism of iron acquisition, rather than the mycobactin-exochelin system of other mycobacteria (Dussurget and Smith, 1998; De Voss et al, 1999). This may be of particular importance given the apparent lack of mycobactin activity in M.a.paratuberculosis (Thorel, 1984).

Ofher M.a.paratuberculosis gene sequences have been identified, including the hspX gene and F57, which has formed the basis of PCR based diagnostic tests for the presence of M.a.paratuberculosis (see section 1.6.3). Similarly, several insertion elements have been isolated in M.a.paratuberculosis some of which are sub-species specific, and have been extensively used in the differentiation of M.a.paratuberculosis from other members of the MAC and also in the detection of M.a.paratuberculosis in infected animals (see sections 1.4.3 and 1.6.3). More recently a secreted manganese superoxide dismutase (SOD) has been described in

27 M.a.paratuberculosis with possible implications for protection of the bacilli in the intracellular environment of the host macrophage (Liu et al, 2001).

The interaction between host and M.a.paratuberculosis remains poorly understood, with almost nothing known about the bacterial factors that enable the survival of M.a.paratuberculosis within macrophages. The M.a.paratuberculosis taxonomic database (http ://www.ncbi.nlm.nih.gov/htbin-post/T axonomy/wgetorg?id=l 770) currently contains over 160 protein sequences and 143 nucleotide sequences (correct at time of writing), a significant number of which have been submitted directly to the database over the last number of years. This reflects not only the growing application of standardised techniques for gene identification developed for M.tuberculosis to M.a.paratuberculosis but also the slow release of information from the M.a.paratuberculosis genomes and in some cases direct benefits from the identification of pathogenesis associated genes in M.tuberculosis. The completion of the M.a.paratuberculosis genome sequencing project and the subsequent comparative genomics, as well as the application of techniques to examine the transcriptome and proteome of M.a.paratuberculosis, may further help unravel some of the molecular mechanisms underlying M.a.paratuberculosis infection, persistence and virulence in a variety of different species.

1.10 M,a,paratuberculosis 34kDa putative serine protease Screening a A,gtll M.a.paratuberculosis expression library with serum from a naturally infected paratuberculosis sheep led to the identification of two immunogenic clones, S4 and 88, containing fragments of the same gene (Cameron et al, 1994; Cameron, 1996). Initial hopes that the isolated sequence was unique to M.a.paratuberculosis proved pre-mature as the gene was found to be expressed in other members of the MAC. The isolated clone coded for a protein with a predicted molecular mass of 34kDa, showing no homology to the immunodominant 34kDa protein previously identified in M.a.paratuberculosis and M.tuberculosis (Cocito et al, 1994). The 88 clone contained the entire coding sequence of the mature protein and demonstrated homology to trypsin like serine proteases from both prokaryotes and eukaryotes (Fallen and Wren, 1997). An overall similarity was also detected to the HtrA family of serine proteases from a number of bacterial species, such as

28 Escherichia coli. Salmonella typhimurium. Brucella abortus, Bartonella henselae. Yersinia pestis. Yersinia enterocolitica (Baumler et al, 1994; Roop et al, 1994; Wren et al, 1995; Anderson et al, 1996; Williams et al, 2000). HtrA has been implicated in the pathogenesis of several of these pathogenic bacterial species. While the overall homology is low there is a higher degree of homology at three sites that contain amino acids that are highly conserved in the active site of the well characterised E.coli HtrA, namely His, Asp and Ser (Figure 1.1). Other HtrA characteristic domains are also retained in the 34kDa putative serine protease, namely a N-terminal signal peptide directing export of the protein and a C-terminal PDZ protein interaction domain (Figure 1.2 and Section 1.11.1).

29 * * * — CAAB0638 CAA80638 (97) VLTtWHVI (1 2 5 ) WGXDRTQDIA (213) GOSGGB -CAC32191 CAC32191 (90) VLTNNHVI (118) WGYI'RTQI'VA (206) GDSGGP -CAB09453 (90) (118) WGYI'RTQI'VA (206) GDSGGP CÀB09453 VLTNNHl^I .GAA17582 CAA17SS2 (192) ILTNNHVI (228) WGAI'PTSDIA (315) 'IMSGGA IAAK45259 AAK45259 (174) ILTNNHVI (210) WGABPTSDIA (297) ‘3NSGGA -CAB36690 CAB3 6690 (177) ILTtffiTHW (216) WGAI'PTSDIA (303) '3NSGGA AAC45270 (279) IVTNNHVI (312) LVGRI'PKTDLX (399) '3NSGGP .MC4527Ü AAK4S518 (265) IVTNNHVI (298) LVGRBPKTI'LA (3 8 5 ) 'GNSGGP 1MK4S18 AAA52916 (270) IVTNNHVI (303) LVGRI'PKTDLA (390) ■3NSGGP -WW62916 A64113 (115) VLTNNHVI (142) LVGKDEQSDIÀ (224) '3NSGGA ,fl64113 AAC38203 VLTNNHli"! (139) LVGKI'ELSRIA (221) ■3NSGGA (1 1 2 ) 1/WC38203 BAAÜ5608 (126) WTNNHW (153) HVGKI'PRSDIA (234) GNSGGA BM05Ô08 BAA92745 (126) WTNNHW (153) HVGKDPRSBIA (234) iINSGGA S 1 5337 (127) WTNNHW (154) WGKPPRSBIA (235) 'GNSGGA BAA92745 CAA63869 (111) WTNNHW (138) VIGKI'PRTI'IA (219) 'GNSGGA S15337 140 0 6 0 (147) WTNNHW (174) LIGAI'PRTBLA (2 5 5 ) iGNSGGP CftA63069 AAA68943 (11) IVTNNHW (39) LIGKI'PKTIiLA (119) 'GNSGGA — 140060 AAD08063 (79) IVTNNHVI (107) LVGTPSESPLA (1 8 7 ) 'GNSGGA -MA5S943 AAD0æ63 C o n s e n s u s WTNNHVI VG DP SDIA GNSGGA

Figure 1.1 Alignment of the conserved His, Asp and Ser catalytic triad sites in the amino acid sequence of HtrA-like proteins in mycobacteria and other bacterial species. Shown in bold is the sequence of the M.a.paratuberculosis 34kDa putative serine protease (CAA80638). Stars denote the location of His, Asp and Ser residues, respectively. Also shown is a dendogram demonstrating the overall relationship of the various HtrA proteins in terms of sequence identity for the total protein sequence. Diagram generated using the Vector NTI ALIGN X software package. CAA80638 (361aa) 34KDa protein [Mycobacterium avium subsp. paratuberculosis\\ CAC32191 (354aa) probable secreted serine protease [Mycobacterium leprae]’, CAB09453 (355aa) pepA [Mycobacterium tuberculosis H37Rv]; CAA17582 (464aa) hypothetical protein Rv0983 [Mycobacterium tuberculosis H37Rv]; AAK45259 (446aa) putative HtrA [Mycobacterium tuberculosis CDC1551]; CAB36690 (452 aa) putative serine protease [Mycobacterium leprae]’, AAC45270 (542aa) HtrA [Mycobacterium tuberculosis H37Rv]; AAK45518 (528aa) HtrA [Mycobacterium tuberculosis CDC1551]; AAA62916 (533aa) HtrA [Mycobacterium leprae]’, A64113 (466aa) HtrA [Haemophilus influenzae (strain Rd KW20)]; AAC38203 (463aa) HtrA [Haemophilus influenzae]’, BAA05608 (474aa) HtrA [Escherichia co//]; BAA92745 (491 aa) HtrA [Shigella sonnei]’, S I5337 (475aa) HtrA [Salmonella typhimurium]’, CAA63869 (464aa) HtrA [Yersinia enterocolitica]’, 140060 (513aa) HtrA [Brucella abortus]’, AAA68943 (368aa) heat shock protein/serine protease [Campylobacter jejuni]’, AAD08063 (443aa) HtrA [Helicobacter pylori 26695],

30 Trypsin Catalytic Domain

Signal peptide PDZ

His Asp Ser 34kDa putative Serine Protease 361 aa

Figure 1.2 Structural features of the 34kDa putative serine protease protein. Shown is the location of the N-terminal signal peptide, the central catalytic domain with the characteristic triad of His, Asp and Ser residues (Pfam: PF00089 trypsin. Trypsin) and the C-terminal PDZ domain (Pfam: PF00595 PDZ, PDZ domain). Figure generated using Vector NTI suite. Further information on Pfam entries can be accessed at http://www.sanger.ac.uk/Software/Pfam/. See Appendix 4 for protein sequence.

31 The S8 clone contained the entire open reading frame for the 34kDa putative serine protease including the putative Shine-Dalgamo sequence (Cameron et al, 1994). The gene could not be expressed as a soluble fusion protein to p-gal even in the presence of urea and acetonitrile. However it was possible to generate a partial N-terminal fusion that was subsequently used to raise monoclonal antibodies in mice. The gene was eventually expressed as free protein by translational coupling in a pUC18 vector (Cameron, 1996). However, although detection by western immunoblotting was possible, insufficient quantities of the recombinant protein were present for purification by anion exchange chromatography or isoelectric focusing (Cameron, 1996). A second approach utilised a T7 promoter based translational coupling system, which also resulted in an inability to purify the protein from the periplasm of E.coli. It was apparent that the expression of the S8 gene was not detrimental to the host E.coli as the host cells retained the plasmid encoded resistance to ampicillin and the growth curve, as measured by optical density at ODeoo, was normal. The addition of protease inhibitor PMSF to the growth media increased the amount of recombinant protein that could be detected in the periplasm. This suggested that autoproteolysis of the protein may be occurring and that was at least partially responsible for the low levels of protein observed. However it may also be the case that PMSF is blocking a host protease from degrading the 34kDa putative serine protease (Cameron, 1996).

The presence of the N-terminal signal peptide predicted that the 34kDa putative serine protease was exported by M.a.paratuberculosis in vivo. The extracellular fate of the protein was consistent with the antigenic nature of the mature peptide, where the export of the protein in vivo would facilitate the interaction of the protein with the machinery of the host immune response. The secretion of the protein in M.a.paratuberculosis was confirmed in culture by demonstrating the presence of the protein in cell-free supernatants (Cameron et al, 1994; Cameron, 1996). The presence of the protein in the extracellular environment of growing cells was not associated with the lysis of the bacilli, as antibodies against the Hsp65, almost exclusively associated with the cytosol, failed to detect the proteins in the cell-free supernatant. Both the 34kDa putative serine protease and Hsp65 proteins were detected in mycobacterial cell lysates. Expression of the 34kDa putative serine

32 protease including the leader peptide in E.coli resulted in the transportation of the protein into the periplasmic space of E.coli. Therefore, the signal peptide is capable of directing the export of the protein both in M.a.paratuberculosis grown in culture and also into the periplasmic space of E.coli (Cameron, 1996). Further studies were required to determine the potential role that the 34kDa putative serine protease played in the virulence of M.a.paratuberculosis.

1.11 The HtrA family of Bacterial Serine Proteases HtrA, also known as DegP and reportedly identical to the Do protease is a heat shock-induced envelope-associated serine protease that was first described in E.coli (Fallen and Wren, 1997). The HtrA protein appears to be a highly conserved feature of most bacterial species, although not a prerequisite for life as no homologues were found in the genomes of Mycoplasma genitalium and Methanococcus janaschii (Fallen and Wren, 1997). While it is an interesting protein in terms of its regulation and its physiological role what is of particular interest is the finding that several htrA mutants in Gram-negative bacteria are attenuated in animal models suggesting a possible role for the protein in the pathogenesis of several diverse bacterial species (Baumler et al, 1994; Roop et al, 1994; Wren et al, 1995; Anderson et al, 1996; Williams et al, 2000).

1.11.1 HtrA structural features The main structural features of the protein include a central core domain containing the catalytic triad of Histidine, Serine and Aspartate residues (Fallen and Wren, 1997). The consensus sequence for the trypsin-like serine proteases catalytic domain is GDSGGFK, with a central serine residue required for proteolytic activity of the protein at elevated temperatures in E.coli. The N-terminal end of the protein determines its sub-cellular localisation by encoding for a signal peptide that is cleaved during export into the periplasmic space of E.coli. HtrA is a peripheral membrane protein, lying on the periplasmic side of the inner membrane (Lipinska et al, 1990; Skorko-Glonek et al, 1997; Kim et al, 1999) .

The carboxy terminus of the protein is characterised by the presence of one or more FDZ domains (Fallen and Wren, 1997), so-called after the three eukaryotic proteins

33 (post-synaptic density protein, disc large and zo-1 proteins) in which they were initially identified (Ponting, 1997). PDZ domains are thought to mediate protein- protein interactions usually by binding to C-terminal tetrapeptides or other PDZ domains. Indeed, PDZ domains have been implicated in substrate recognition of other bacterial protease, such as the Tsp and ClpX proteases (Levchenko et al, 1997). The E.coli HtrA has been shown to have two PDZ domains in the C-terminus, one of which is postulated to be involved in substrate recognition while the second is though to be involved in determining the oligomeric structure of the protein (Sassoon et al, 1999). Similarly, the PDZ domains of E.coli have been implicated in the in the temperature dependant shift from chaperone to protease activity of the native protein, with proteolytic activity almost exclusively present at elevated temperatures (Spiess et al, 1999). Consistent with this observation, autodegradation of the protein has been observed at 42°C but not at 35°C. However, other bacterial HtrA like proteins appear to posses a single PDZ domain at the carboxy terminus, the implications of which for protein function and hexameric formation remain to be determined (Pallen and Wren, 1997).

1.11.2 HtrA function The well-characterised E.coli HtrA protein shows an ATP-independent proteolytic activity and preferentially cleaves peptide bonds of Val-X or Ile-X, where X can be any amino acid (Pallen and Wren, 1997). The proteolytic activity increases with rising temperature, with peak activity observed at 55°C. A E.coli HtrA null mutant was initially characterised as having two possibly related phenotypes, thermosensitivity and decreased degradation of abnormal periplasmic proteins (Lipinska et al, 1988; Lipinska et al, 1989; Lipinska et al, 1990). Indeed the protein is essential for E.coli survival above 42°C. The protein is capable of stabilising unstable envelope associated proteins but not cytosolic proteins. An E.coli HtrA mutant was also shown to have decreased ability to withstand ferrous ion mediated oxidative damage compared to wild-type strains but was not more sensitive to the oxidative damage mediated by hydrogen peroxide (Skorko-Glonek et al, 1999). There are two paralogues of HtrA in the E.coli genome, HhoA (DegQ) and HhoB (DegS). HhoA has been shown to have protease activity and also contains a signal peptide that is removed in the mature form of the protein (Bass et al, 1996).

34 Recently, DegS has been implicated in the degradation of the anti-sigma factor regulating the cellular concentration of the alternative sigma factor, in E.coli (Alba et al, 2001).

Several bacterial HtrA null mutants, including pathogenic speices, have all been shown to be more sensitive to oxidative damage mediated by hydrogen peroxide than wild-type bacteria (Johnson et al, 1991; Yamamoto et al, 1996; Skorko-Glonek et al, 1999; Lowe et al, 1999; Williams et al, 2000; Jones et al, 2001). Therefore it has been postulated that HtrA participates in the degradation of oxidatively or thermally damaged proteins localised in the cellular envelope, especially those connected with the membrane. Interestingly it has been shown that a Bacillis subtillus HtrA homologue, ykdA, null mutant demonstrated increase resistance to heat and hydrogen peroxide compared to wild type cells (Noone et al, 2000; Noone et al, 2001). This suggests that the mutation stimulated an increase in the expression of a gene or genes that protect cells against both heat and oxidative stress.

1.11.3 HtrA and pathogenesis However of particular interest to these studies is that several htrA homologues mutants in pathogenic bacterial species show attenuation in animal models and also in vitro macrophage models. In Salmonella typhimurium, a HtrA homologue was identified in two independent screens of a transposon mutant library, deficient in their ability to survive in mice or macrophages (Johnson et al, 1991). Subsequent work using a mutant with a defined mutation in the S.typhimurium gene demonstrated that the mutant was highly attenuated in mice (Chatfield et al, 1992). However unlike in E.coli the S.typhimurium mutant is not temperature sensitive, but does show increased sensitivity to hydrogen peroxide. Mutation of the htrA gene in a S.typhi strain already harbouring defined mutations in the aroA and aroC genes resulted in a decreased ability to invade epithelial cells in comparison to the mutant parent strain but had no affect on the ability of the strain to survive within a human monocyte cell line or a murine macrophage cell line (Tacket et al, 1997). This suggests that the native protein may be involved in the colonisation of the epithelium and not in the subsequent recruited macrophages. The HtrA mutant strain also showed increased susceptibility to oxidative stress. Furthermore, the htrA mutant

35 strain showed decreased survival after intralumenal infection of SCID mice implanted with non-transformed human intestinal epithelium. This affect was not seen when the animals were infected interperitonealy, again suggesting the mutant strain was defective in invading human epithelial cells.

Brucella abortus HtrA mutants were initially recovered at lower levels than wild type cells from the spleens of infected mice post infection. By Day 60 however the affect was reversed with greater numbers of mutant bacteria recovered from the spleens of infected animals (Elzer et ah, 1996a). The Brucella abortus HtrA null mutant was also reported to demonstrate decreased resistance to killing by cultured macrophages, and the mutant appeared to be attenuated in pregnant goats (Elzer et al, 1996b). A Brucella melitensis HtrA mutant was shown to demonstrate reduced ability to withstand oxidative stress compared to wild-type and transient attenuation in an murine model of infection (Phillips et al, 1995). The same authors also demonstrated that the B.melitensis HtrA mutant also exhibited attenuation in pregnant goats (Phillips et al, 1997). However, more recent work by the same group demonstrated that the mutant used in their earlier studies was a double mutant, HtrA and cylA. The authors generated a bona fide HtrA B.melitensis that did not show attenuation in pregnant goats negating their earlier findings.

A strain of Y.pestis with a defined mutation in a htrA gene was tested for virulence in mice. Mice orally inoculated with the mutant strain were capable of clearing the bacterial infection whereas mice infected with the wild type strain died within 5 days of administration (Williams et al, 2000). A HtrA homologue was also identified independently in Y.enterocolitica although it was initially designated gsrA (Yamamoto et al, 1996; Yamamoto et al, 1997). Yamamoto et al reported that inactivation of the gene resulted in an inability of the bacterium to grow at elevated temperatures and to survive within macrophages following phagocytosis (Yamamoto et al, 1997). Loosmore et al report the cloning and sequence analysis of a HtrA homologue from two strains of non-encapsulated or non-typeable Haemophilus influenzae (NTHI) which are a major cause of otitis media, middle ear infection, in young children and respiratory infections in adults (Loosmore et al, 1998). Immunisation with recombinant HtrA or a mutant analogue (with mutations in either

36 the conserved Histidine or Serine of the active site) resulted in partial protection against live Haemophilus influenzae challenge in both a passive infant rat model of bacteremia and also the chinchilla model of otitis. However, a mutation in the conserved Serine residue failed to demonstrate protection in the chinchilla model of Otitis but was partially protective in the rat model (Cates et al, 2000).

The exact role of HtrA in the virulence of a number of different bacterial species remains unclear. Most researchers have argued that the attenuation of virulence in strains harbouring defined mutants in HtrA is due to impaired resistance to oxidative damage in the intracellular environment of the host cell. Phagocytic cells, including neutrophils, eosinophils and macrophages, are a fundamental part of the host’s immune response. One bactericidal mechanism that is activated in these cells in the presence of target organisms is the release of superoxide radicals produced by a plasma membrane-bound enzyme, NADPH oxidase (Miller and Britigan, 1997). Superoxide can undergo spontaneous or catalysed dismutation to form hydrogen peroxide or it can be converted to highly reactive oxidants such as OK or HOCl by a series of secondary reactions. HtrA may act in vivo to degrade proteins that have been damaged by anti-bacterial oxygen radicals preventing their accumulation to toxic levels (Pallen and Wren, 1997). Interestingly, a human HtrA homologue has been implicated in the degradation of denatured proteins in patients suffering firom rheumatoid arthritis, which has been associated with oxygen radical mediated damage (Hu et al, 1998).

37 1.12 Proposal The 34kDa putative serine protease demonstrates homology to the HtrA family of serine proteases, implicated in the virulence of several important bacterial intracellular pathogens and demonstrates antigenic properties in infected animals. The work presented in the this thesis had as its central aim the further characterisation of the 34kDa putative serine protease of M.a.paratuberculosis, with particular attention to the role that the protein plays in pathogenesis. The subsequent chapters describe the development and application of techniques to elucidate further the biological function of the 34kDa putative serine protease, specifically in terms of its ability to influence the intracellular survival of the saprophytic M.smegmatis mc^l55 strain and also the elucidation of the transcriptional activity and regulation of the gene.

38 CHAPTER 2

GENERAL MATERIALS AND METHODS

2.1 Culture of Bacterial Strains 2.1.1 E.coli E.coli strains (Appendix 2.were maintained in Luria-Bertani (L-B) broth or L-B agar (Sambrook et al 1989) (Appendix 3). L-B broth and L-B agar supplemented with the appropriate antibiotic was used to select E.coli transformed with plasmid DNA.

2.1.2 Mycobacteria a) M,a.paratuberculosis M.a.paratuberculosis strains (Appendix 2.) were routinely propagated in 7H9^ broth and on 7H11+ medium (Appendix 3). 7H11-E media supplemented with the appropriate antibiotic was used to select M.a.paratuberculosis transformed with vector DNA. Cultures were incubated at 37°C for 8-10 weeks. b) M.smegmatis M.smegmatis strains (Appendix 2) were propagated in L-B broth, L-B agar, 7H11-S medium or 7H9^ broth (Appendix 3). Transformed M.smegmatis strains were selected and grown on media supplemented with the appropriate antibiotic. Cultures were incubated at 37°C for 2-3 days, liquid cultures were grown with shaking at 200 rpm at 37°C for 2-3 days.

2.2 Nucleic Acid Preparation and Manipulation 2.2.1 Preparation of plasmid DNA from E.coli host strains Plasmid DNA was extracted from E.coli host cells using the QIAprep^^ Spin Plasmid Kit (Qiagen), in accordance with the manufacturer’s instructions.

39 2.2.2 Restriction enzyme digestion of plasmid DNA All restriction enzymes were obtained from Promega UK, and used with the supplied incubation buffers according to the manufacturer's specifications, unless otherwise stated. Where two restriction enzymes were required in concert to digest target DNA, an appropriate buffer compatible with the optimal efficiency of both enzymes was used.

2.2.3 Agarose Gel Electrophoresis DNA fragments were resolved in horizontal agarose gels as described by Sambrook et al (1989). Gels of 85 x 60 x 6.5mm (mini-gels) and 150 x 125 x 8.0mm (midi-gels) were prepared in “Agarose Gel Electrophoresis Apparatus”, Models H2 and H3 (Amersham Biosciences), respectively. Gels of 0.6%-2.0% (^/y) nucleic acid grade “Ultrapure” agarose (Invitrogen life sciences) supplemented with 0.5 p-g/ml eithidium bromide were prepared and run in 1 x TBE buffer (0.89 M Tris, 0.89 M

Boric acid, 0.025 M Na 2 EDTA, pH correct at 8.3). Gels from which DNA fragments were later recovered, were prepared from nucleic acid grade “Low Melting Point” (LMP) agarose (Invitrogen life sciences) (Section 2.3.4). DNA samples were mixed with 0.1 volume of gel loading buffer (GLB; 50 mM Na 2 EDTA, 0.1% (^/y) bromophenol blue, 25% (^/y) Sucrose or Ficoll 400 prior to electrophoresis. The duration of electrophoretic separation and the precise current densities were adjusted to allow for gel format, agarose concentration and the size of the DNA fragments under analysis. Molecular weight markers used were DNA HyperLadder I or DNA HyperLadder IV (Bioline UK Ltd.) as per the manufacturer’s instructions. Resolved DNA fragments were visualised and photographed using the ImageMaster® YDS (Amersham Biosciences) system incorporating the Fuji film Thermal Imaging System (FTI-500) or visualised using a short wave ultraviolet transilluminator (UVItec Ltd.).

2.2.4 Recovery of DNA fragments from agarose gels Fragments of interest were excised from 0.6-1.0% LMP-agarose under ultraviolet illumination using a clean disposable scalpel. Excess agarose was trimmed away and the block was transferred to a pre-weighed 1.5 ml eppendorf tube. The weight of the

40 block was determined and the DNA recovered using the Qiagen QIAquick® Gel Extraction Kit, as per the manufacturer’s instructions.

2.2.5 Dephosphorylation of plasmid DNA The dephosphorylation of 5’ phosphates from linear plasmid DNA prior to ligation was achieved using Shrimp Alkaline Phosphatase (SAP) (Roche Diagnostics Ltd.) as per the manufacturer’s instructions. Briefly, linear plasmid DNA (50-150 ng) was added to pre-prepared reaction mixtures ( 1 0 pi final volume) comprising (xl) reaction buffer at 0.5 M Tris-HCl, 50 mM MgCb, pH 8.5 (Roche Diagnostics Ltd.) and 1 U SAP. The reaction was incubated at 37°C for 10 min (5’ protruding DNA ends) or 60 min (blunt DNA ends). The reaction was terminated by the inactivation of the SAP by heating for 15 min at 65°C.

2.2.6 Generating “blunt ended” DNA fragments The filling in of 5’-protruding ends with unlabelled dNTP, generating blunt ends suitable for ligation was achieved using DNA polymerase I large (Klenow) fragment (Promega UK) as per the manufacturer’s instructions. Briefly, 50-100 ng of digested DNA containing 5’-overhangs was added to pre-prepared reaction mixtures comprising (x 1) reaction buffer at 50 mM Tris-HCl, pH 7.2, 10 mM MgS 0 4 , 0.1 mM DTT, 40 pM each of dATP, dCTP, dGTP and dTTP, 20 pg/ml acetylated BSA and 1 U of Klenow fragment. The reaction was incubated at room temperature for 10 min. The reaction was terminated by the inactivation of the Klenow fragment by heating for 10 min at 75°C.

2.2.7 Ligation of DNA fragments into vector DNA The insertion of DNA fragments into the desired vectors was achieved using T4 DNA ligase (Roche Diagnostics Ltd.) as per the manufacturer’s instructions. Briefly, insert DNA was added to pre-prepared reaction mixtures (10 pi final volume) comprising (x 1) reaction buffer at 660 mM Tris-HCL, 50 mM MgCb, lOmM dithioerythriol, 10 mM ATP, pH 7.5 (Roche Diagnostics Ltd.), linear pre-digested Vector DNA (50-100 ng) and 3 U T4 DNA ligase (Roche Diagnostics Ltd.). The reaction was incubated at either 4°C (sticky end cloning) or at 16°C (blunt end cloning) overnight. The reaction was terminated by inactivation of the T4 DNA

41 ligase by heating at 65°C for 10 min. The molar ratio (MR) of insert DNA to vector DNA was 3:1, unless otherwise stated. The amount of insert DNA used in each reaction was determined using the formula:

(Amount of Vector DNA in ng) X (Size of Insert DNA in bp) X 3 (MR) (Size of Vector DNA in bp) 1

2.2.8 Preparation of vector DNA for electroporation Plasmid DNA used in electroporation of E.coli and mycobacteria was desalted and concentrated using the Microcon Microconcentrator (Amicon-Millipore) system as per the manufacturer’s recommendations. The concentration of DNA present in each sample was determined using a spectrophotometer at 260nm. The concentration of DNA in each sample was determined using the formula;

Concentration of DNA= OD 2 6 0 x Dilution factor x 50 mg/ml.

In some cases DNA concentration was ascertained by comparison to the known concentration standards of the Hyperladder I or Hyperladder IV (Bioline UK Ltd.), molecular weight standards.

2.3 Introduction of Vector DNA into Bacterial Strains 2.3.1 Preparation of electrocompetent cells a) M.a.paratuberculosis All M.a.paratuberculosis strains (Appendix 2) were grown to a McFarland 6 in 7H9^ broth (Appendix 3), diluted V 2 0 in fresh pre-warmed (37°C) 7H9^ broth and incubated at 37°C until a McFarland of 4.0-4.5 (4-6 weeks). M.a.paratuberculosis cells were harvested by centrifugation at 4,147 x g for 30 min at 4°C, the supernatant discarded and the bacterial pellet washed three times in decreasing volumes of 1 0 % (^/y) glycerol, (15, 10 and 5 ml). Mycobacterial cells were re-suspended in 1 ml 10%

(^/y) sterile glycerol, snap frozen in liquid N 2 and stored at -70°C until required.

42 b) M.smegmatis

M.smegmatis strains (Appendix 2 ) were grown to an ODeoo 0.5-0.6 in 7H9^ (Appendix 3) broth at 37°C with shaking (200 rpm), diluted Vio in fresh pre-warmed (37°C) 7H9^ broth and incubated at 37°C with shaking at (200 rpm) until reaching an ODôoo 0.5-0.6. M.smegmatis cells were harvested by centrifugation at 4,147 x g for 30 min at 4°C, the supernatant discarded and the bacterial pellet washed three times in decreasing volumes of 10% ('^/y) glycerol, (15, 10 and 5 ml). Mycobacterial cells were re-suspended in 1 ml 1 0 % (^/y) sterile glycerol, snap frozen in liquid N 2 and stored at -70°C until required. c) E.coli A fresh overnight culture of E.coli JM109 cells was diluted Vio in fresh pre-warmed (37°C) L-B broth (Appendix 3) and incubated at 37 °C with shaking (200 rpm) until an ODeoo of 0 .8 - 1 .0 . The cells were harvested by centrifugation at 4,147 x g at 4°C, washed twice in 15% glycerol/272 mM Sucrose (2 x 15 ml washes) and re-suspended in 5 ml of 15% glycerol/272 mM Sucrose, dispensed into 500pl aliquots, snap frozen in liquid N 2 and stored at -70°C. DH5a cells were purchased as high efficiency electrocompetent cells from BD Biosciences Clontech UK.

2.3.2 Introduction of vector DNA by electroporation a) M.a.paratuberculosis Method 1 Electroporation of vector DNA into M.a.paratuberculosis strains was carried out in accordance with the protocol of Wards et al 1996. Briefly, 200pl of electrocompetent M.a.paratuberculosis cells (section 2.2.1a) were mixed with 1 pg of desalted vector DNA (section 2.2.8) and equilibrated to 37°C for 10 min, followed by transfer to a 0.2cm cuvette and electroporated at 2.5 kV, 25pF, 1,000Q in a Gene Puiser® apparatus (Bio-Rad Laboratories Ltd.). M.a.paratuberculosis cells were diluted to a final volume of 1 ml in 7H9^ broth (Appendix 3), and incubated without selection at 37°C for 4 hr, followed by selection for positive transformants on 7H1 IE medium (Appendix 3) supplemented with the appropriate antibiotic at 37°C for 12 weeks.

43 Method 2 A second method of electroporation of vector DNA into M.a.paratuberculosis strains was carried out in accordance with the protocol of Dr. Steve Thome, University of Surrey (personal communication). Briefly, 200pl of electrocompetent M.a.paratuberculosis cells (section 2.3.1a) were mixed with 500 ng of desalted Vector DNA (section 2.2.8) and equilibrated to 37°C for 5 min, transferred to a 0.2cm cuvette (Bio-Rad Laboratories Ltd.) and electroporated at 2.5 kV, 25pF, 1,000Q in a Gene Puiser® apparatus (Bio-Rad Laboratories Ltd.). M.a.paratuberculosis cells were diluted to a final volume of 1 ml in 7H9^^ broth (Appendix 3), and incubated without selection at 37°C overnight in a round bottom Cryostat tube, followed by selection for positive transformants on 7H10Su medium (Appendix 3) supplemented with the appropriate antibiotic at 37°C for 12 weeks. b) M.smegmatis Electroporation of vector DNA into M.smegmatis strains was carried out in accordance with the protocol of Parish et al 1998. Briefly, 200pl of electrocompetent M.smegmatis cells (see section 2.3.1b) were mixed with 1 pg of de-salted vector DNA (Section 2.2.8), and incubated on ice for 30 min, transferred to a 0.2cm cuvette (Bio-Rad Laboratories Ltd.) and electroporated at 2.5 kV, 25pF, 1,000Q in a Gene Puiser® apparatus (Bio-Rad Laboratories Ltd.). Mycobacterial cells were diluted to a final volume of 1 ml in 7H9^ broth (Appendix 3) and incubated without antibiotic selection for 2 hr at 37°C, followed by selection for positive transformants on 7H11- S (Appendix 3) medium supplemented with the appropriate antibiotic at 37°C for 4-5 days. c) E.coli Electroporation of vector DNA into E.coli strains was carried out in accordance with the protocol of Parish et al. Briefly, 20 pi of commercial electrocompetent DH5a cells (BD Biosciences Clontech UK) or 200pl of electrocompetent E.coli JM109 (section 2.3.1c) cells were mixed with 1 pg of de-salted plasmid DNA (section 2.2.8), incubated on ice for 1 hr, and transferred to a chilled 0.2cm gap cuvette (Bio- Rad Laboratories Ltd.) and electroporated (2.5 kV, 25pF, 200 Q) in a Gene Puiser®

44 apparatus (Bio-Rad Laboratories Ltd.). E.coli cells then were immediately diluted with chilled SOC (Appendix 3) broth to a final volume of 1 ml, incubated without selection at 37 °C for 1 hr and then plated onto L-B-agar medium (Appendix 3) supplemented with the appropriate antibiotic, and incubated overnight at 37°C.

2.3.3 Transformation of high efficiencyE.coli JM109 competent cells by heat shock High efficiency competent E.coli JM109 cells were purchased from Promega UK, and transformed with vector DNA as per the manufacturer’s instructions. Briefly, 100 pi of chemically competent E.coli JM109 were mixed with 50 ng of vector DNA and incubated on ice for 10 min. The cells were heat shocked for 45-50 sec in a water bath at exactly 42°C, the tubes returned to ice for 2 min and 900 pi of ice-cold SOC medium (Appendix 3) added to each transformation reaction and incubated at 37°C for 1 hr. Positive transformants were selected for on L-B agar medium (Appendix 3) supplemented with the appropriate antibiotic at 37°C and grown overnight.

2.4 Sequencing of Plasmid DNA Cloned DNA fragments were sequenced bi-directionally by the dideoxy chain- termination method (Sanger et al 1977). Sequencing of plasmid DNA was preformed by Oswell DNA Service, MWG-BIOTECH AG sequencing or at the Functional Genomics Unit, MRI, Edinburgh, UK.

2.5 DNA and Protein Database Searching

Database searches were performed using the BLAST (version 2.0) program fi*om the National Centre for Biotechnology Information internet site covering the GenBank,

EMBL, DDBJ and PDB databases, the WU-BLAST (version 2) program from The

Institute for Genomic Research (TIGR) BLAST search engine for unfinished microbial genomes (http://tigrblast.tigr.org/ufing/), the Sanger Centre M. bovis BLAST server

(http://www.sanger.ac.uk), the tuberculist search engine at the Institute Pasteur

(http://genolist.pasteur.fi-/TubercuList), Paris, the leprom a search engine at the Institute Pasteur, Paris (http://genolist.pasteur.fr/Leproma/index.htmD and the

University of Minnesota M.a.paratuberculosis unfinished genome project BLAST server http://www.cbc.umn.edU/ResearchProjects/Ptb/#.

45 2.6 Preparation of Mycobacterial Cell Lysates Mycobacterial cells were harvested from culture by centriftigation at 4,147 x g at 4°C for 15 min and re-suspended in approximately 400 pi of PBS containing PMSF at 1 mM final concentration. The cells were transferred to a screw cap eppendorf containing 1 ml of washed zirconium silica beads (0.1 mm diameter). Cells were disrupted by bead-beating in a RiboLyser (Thermo Hybaid Ltd.). Five bead-beating cycles at speed setting 5 of 45 sec were carried out, cooling on ice after each cycle to avoid overheating and potential dénaturation of the sample. The lysate was recovered from each tube, transferred to a 1.5 ml eppendorf tube and centrifuged at 11,000 x g for 1 min. Finally the lysate was transferred to a sterile 1.5 ml eppendorf and stored at-20°C.

2.7 DNA Extraction from Mycobacterial Cells Mycobacterial cells were resuspended in 200 pi of sterile distilled water and added to a screw capped microfuge tube containing 1 ml of washed zirconium silica beads (0.1 mm). The cells were then beaten on a RiboLyser (Thermo Hybaid Ltd.) at speed setting 5 for 3 cycles of 40 sec, cooling on ice between cycles. The supernatant was carefully removed. 450 pi of GE (5 M guanidine isothyiocyante, 0.1 M EDTA, pH 7.0) and 250 pi of ice-cold 7.5 M ammonium acetate (pH 6.3, unadjusted) were added to the supernatant and the sample was mixed by inversion and then incubated on ice for 20 min. 500 pi of chloroform:octanol (24:1 (%)) was added, mixed by inversion and centrifuged at 11,600 x g for 5 min. The top aqueous layer was retained, a further 0.5ml of chloroform:octanol (24:1 (%)) added, mixed and centrifuged at 11,600 x g for 10 min. An equal volume of ice-cold isopropanol was added to the final aqueous layer, mixed by inversion and centrifuged at 11,600 x g for 10 min. The isopropanol was removed, the pellet washed twice in 70% ethanol and air-dried. Finally the DNA pellet was re-suspended in 150 pi of sterile distilled water and stored at -20°C.

46 2.8 Protein concentration and SDS-PAGE 2.8.1 Determination of Protein Concentrations Soluble protein concentrations were determined using the Bradford Reagent Protein Assay (Sigma-Aldrich) as per the manufacturer’s recommendations. Briefly, standard protein solutions ranging from 1 pg/ml to 20pg/ml BSA were prepared in the same diluent used for the unknown samples. Equal volumes (1ml) of all protein samples, including standard solutions and sample diluent, were added to a 15ml Falcon tube. One ml of Bradford Reagent was added to each tube and mixed. The spectrophotometer was blanked with distilled water, and the absorbance of all samples measured at 565nm. The absorbance of the sample diluent control was subtracted from the OD 5 6 5 readings of the standard solutions and the unknown samples. A standard curve was generated by plotting the OD 5 6 5 readings for the standard solutions against concentration (pg/ml). The protein concentration of the unknown samples was determined by comparison to the standard curve. Samples whose values exceeded the standard range were diluted and re-tested.

2.8.2 SDS-Polyacrylamide Gel Electrophoresis (SDS-PAGE) Polyacrylamide gel electrophoresis of proteins was carried out using the discontinuous buffer system of Laemmli (1970). Briefly, ~15pg of protein samples were denatured by heating to 100°C for 90 s in V 4 volume 4 x Laemmli denaturing buffer (LDB) (0.5 M Tris-HCl pH 6 .8 , 4% C^/y) SDS, 1.2 M 2-P-mercaptoethanol, 40% (^/y) sucrose, 0.1% (f^/y) bromophenol blue). The samples were loaded into the wells of an SDS-PAGE gel and separated as follows. Stacking gels of 3% (^/y) acrylamide, 0.08% (^/y) bis-acrylamide in 1 x Laemmli stacking gel buffer (LSGB)

(0.25 M Tris-HCl pH 6 .8 , 0.1% (^/y) SDS) were layered over resolving gels of 10% (wt/v) acrylamide, 0.26% bis-acrylamide in 1 x Laemmli resolving gel buffer

(LGRB) (1.49 M Tris-HCl pH 8 .8 , 0.1% C/y) SDS). Mini gels (80 x 70 x 0.7mm) were prepared in a Mini Protean™ II Dual Slab Cell (Bio-Rad laboratories) and run at 200 V (constant voltage) for 45-50 min in 1 x Laemmli Electrode buffer (LEB) (0.025 M Tris-Hcl, 0.192 M glycine, 0.1% (^/y) SDS, pH correct at 8.3). Pre-stained protein molecular weight markers spanning size ranges 7.2 - 212.0 kDa [Aprotinin 7.2 kDa, Lysozyme 20.7 kDa, Soybean trypsin inhibitor 28.4 kDa, Carbonic anhydrase, 35.0 kDa, Ovalbumin 51.8 kDa, Bovine serum albumin 83.0 kDa, p-gal

47 122.0 kDa and Myosin 212.0 kDa (Bio-Rad laboratories)] were used, as well as unstained SDS-PAGE standards spanning the size range 14.4 - 97.4 kDa [Lysozyme 14.4 kDa, Trypsin inhibitor 21.5 kDa, Carbonic anhydrase 31.0 kDa, Ovalbumin 45.0 kDa, Serum albumin 66.2 kDa, and Phosphorylase 97.4kDa (Bio-Rad laboratories)].

2,9 Production of 34kDa putative serine protease Monoclonal Antibody 2.9.1 Growth and maintenance of Hybridoma cells lines Hybridoma cell line Mab5.8 (Cameron et al) was recovered from liquid nitrogen storage as follows; 7 ml of RPMI-1640 medium (Invitrogen life sciences) supplemented as follows; 20% (%) heat-inactivated foetal calf serum (Invitrogen life sciences), 2.5 M HEPES (N-[hydroxyethyl]piperazine-N'-[ethanesulphonic acid]), 2 mM glutamine, 100 U/ml penicillin (Invitrogen life sciences), 100 pg/ml streptomycin (Invitrogen life sciences), 20pg/ml ciprofloxacin and 10% (%) OPI, referred to as Hybridoma-RPMI (H-RPMI) was added to approximately 1 ml of thawed cells, mixed gently and centrifuged at 800 rpm for 5 min at room temperature. The cells were re-suspended in 10 ml of H-RPMI and the viability tested by 1% Nigrosine staining followed by viability cell counting in a

Hemocytometer. The cells were diluted (V 2 ) and seeded in 24 well plates, and grown

at 37°C with 5% CO 2 . Cells were removed from the bottom of the each well by

agitation, combined and diluted (V 2) in fresh pre-warmed (37°C) H-RPMI medium, and seeded into a 25 ml tissue culture flask and grown to confluency at 37°C with 5

% CO2 . 95% of the supernatant was carefully removed by pipetting and stored, 30 ml of fresh pre-warmed (37°C) RPMI-1640 medium (Invitrogen life sciences) supplemented as follows; 10% heat-inactivated foetal calf serum (Invitrogen life sciences), 2.5 M HEPES, 2 mM glutamine, 100 U/ml penicillin (Invitrogen life sciences), 100 pg/ml streptomycin (Invitrogen life sciences) and lOpg/ml ciprofloxacin (Invitrogen life sciences) was added to each flask and adherent cells removed by agitation. The culture was split into two fresh 25 ml tissue culture flasks,

and the cells grown to confluency at 37°C with CO 2 . This process was repeated until sufficient supernatant had been generated. The recovered supernatant was

48 centrifuged at 800 rpm for 5 min at room temperature to remove cells and cellular debris. Cell free supernatants were stored at -20°C with the addition of 0.05% Sodium Azide to prevent growth of contaminates.

2.9.2 Purification of IgG fraction from Hybridoma supernatant 34kDa putative serine protease specific monoclonal antibody was purified from hybridoma culture supernatants using a HiTrap Protein A 1 ml affinity column (Amersham Biosciences) as per the manufacturer’s instructions. Briefly, the column was washed with 10 column volumes of binding buffer (20 mM sodium phosphate, pH 7.0) at a flow rate of 1 ml/min using a System Gold HPLC Apparatus (Beckman- Coulter). Filter sterilised Hybridoma cell-free culture supernatant (section 2.9.1) was added to the column using a syringe fitted to a “luer” adapter at a flow rate of 1 ml/min. The column was then washed with 5-10 volumes of binding buffer or until no material appeared in the effluent. The bound IgG fraction was finally eluted with 2-5 column volumes of Elution buffer (0.1 M citric acid, pH3-6). The sample was eluted into 200 pi of 1 M Tris-HCl pH 9.0 per ml of elutant to neutralise the citric acid, preventing degradation of antibody.

2.10 Western Transfer and Immunoblotting 2.10.1 Western Blotting Proteins resolved in mini gels were transferred onto nitrocellulose membranes by electroblotting in Tris/Glycine plot buffer (20 mM Tris, 153 mM glycine, 20% (%) methanol, pH 8.0) in a Mini Trans-Blot® Electrophoretic Transfer Cell (Bio-Rad laboratories) at 100V/250mA (constant voltage) for 1 hr.

2.10.2 Ponceau S staining of nitrocellulose-bound proteins Freshly transferred proteins were stained reversibly by incubating the membrane in Ponceau-S solution (Sigma-Aldrich) for 5 min. Excess stain was removed by rinsing the membrane in distilled water. The positions of the molecular weight markers were noted on each membrane and the membrane processed as described in section 2.10.3.

49 2.10.3 Immunoblotting Membranes were blocked in PBS-Tween solution (1 x PBS, 0.5% (%) Tween 20, 1 mM EDTA, 0.35 M NaCl, pH 7.2) in the absence of extraneous proteins. The blotted proteins were probed by incubation with primary monoclonal antibody for 1 hr at room temperature, followed by three 5 min washes in PBS-Tween. Membranes were then incubated in secondary antibody (HRP-conjugated anti mouse IgG) (Dako Ltd.) diluted V iooo in PBS-Tween for 1 hr at room temperature. After removing excess secondary antibody three 5min washes in PBS-Tween, protein-antibody binding was visualised with the addition of a substrate solution [lOOmM Tris pH7.5, 1 mM diaminobenzidine (DAB) and 60mM H 2 O2 ]. The reaction was stopped by washing the membranes thoroughly in running tap water.

2.11 PCR Protocols 2.11.1 Detection oilS900 in M.a.paratuberculosis Cultured mycobacterial cells were mechanically disrupted by bead beating, as described in section 2.6. Lysates were centrifuged at 13,000 x g, for 5 min and the supernatants transferred to a fresh tube. 5pi of lysate was added to pre-prepared reaction mixtures (50pl final volume) comprising (xl) reaction buffer at 2.5 mM

MgCl2 (Promega UK), 2.5 mM each of dATP, dCTP, dGTP and dTTP, 10 pMol each of the forward (5’-GTT CGG GGC CGT CGC TTA GG-3’ 1S900 positions 22-41) and reverse (5’-CCC ACG TGA CCT CGC CTC CA-3’ ISPOO positions 410-391) primers and 1 U Taq polymerase (Promega UK). PCR conditions consisted of an initial dénaturation of 5 min at 95°C, followed by 40 cycles of 1 min dénaturation at 96°C, 1 min annealing at 55°C and 1 min extension at 72°C. The final cycle included an extension at 72°C for 3 min. Amplification products were analysed by agarose gel electrophoresis, and a single band of 389bp confirmed species identity as M. a.pamtuberculosis .

2.11.2 Presence of plasmid DNA; aph (kanamycin) PCR The presence of plasmid DNA in transformed mycobacterial strains was confirmed by the amplification of the kanamycin resistance gene located on the plasmid. Cultured mycobacterial cells were mechanically disrupted by bead beating, as described in section 2.6. Lysates were centrifuged at 13,000 x g, for 5 min and the

50 supernatants transferred to a fresh tube. 5 pi of lysate was added to pre-prepared reactions mixtures of 50pl (final volume) comprising (xl) reaction buffer at 1.5 mM MgClz (Qiagen), 0.2 mM each of dATP, dCTP, dGTP and dTTP, 2% (% ) Glycerol, 100 pMol Forward (5’-TAT GGA TCC ACT AGT ACT AAA GCC ACG TTG TGT CTC-3’) and Reverse (5’-TGA CTG CAG TGA TCA CGT GCG CTG AGG TCT GCC TCG TGA A-3’) primers, 2.5 U HotStar Taq (Qiagen). HotStar PCR conditions consisted of an initial dénaturation of 15 min at 95°C, followed by 40 cycles of 60 sec dénaturation at 94°C, 60 sec annealing at 55°C and 60 sec extension at 72°C. The final cycle included an extension at 72°C for 3 min. Amplification products were analysed by agarose gel electrophoresis, and a single band of approximately 1 . 1 kb confirmed the presence of plasmid DNA.

51 CHAPTER 3

GENETIC MANIPULATION OF M.smegmatis mc^l55 AND M.a.paratuberculosis

3.1 Introduction The development of transformation techniques, permitting the introduction and expression of genes in pathogenic and non-pathogenic mycobacteria has proved crucial in our growing understanding of this diverse group of important pathogens (Hatfull, 1993). Recombinant DNA was first expressed in mycobacteria using shuttle phasmid vectors (Snapper et al, 1988). Since then, shuttle plasmids have been constructed, capable of replicating in both E.coli and mycobacteria. Several different origins of replication {ori), derived from naturally occurring mycobacterial plasmids, have formed the basis of such vectors. The most extensively used mycobacterial shuttle plasmids utilise an ori derived from the well-characterised M.fortuitum plasmid pALSOOO (Rauzier et al, 1988; Ranes et al, 1990; Labidi et al, 1992; Stolt and Stoker, 1996; Stolt and Stoker, 1997; Stolt et al, 1999). Other mycobacterial plasmids, such as the Mycobacterium scrofulaceum pMSC262 (Qin et al, 1994) plasmid, the M.avium plasmid pLR7 (Crawford and Bates, 1984; Beggs et al, 1995) and the M.fortuitum plasmids pJAZ38 (Gavigan et al, 1997) and pMFl (Bachrach et al, 2 0 0 0 ) have been isolated and used to develop additional mycobacterial-E'.co// shuttle vectors. Other approaches have centred on utilising mycobacteriophages, such as L5, D29 and MS 6 as well as the phage derived Streptomyces plasmid pSAM2 as the basis of integrative vectors, allowing the stable integration of DNA into mycobacterial genomes (Lee et al, 1991; Anes et al, 1992; Pearson et al, 1996; Hatfull, 1996). The isolation of a high transformation efficient mutant of the fast growing saprophytic M.smegmatis strain ATCC607, M.smegmatis mc^l55, has been pivotal in the cloning and expression of numerous mycobacterial genes from diverse pathogenic species (Snapper et al, 1990).

The use of reporter molecules offers great advantages in screening for novel genes with phenotypes that are not readily measured using conventional assays. Such

52 reporter systems have been used to measure the relative activity of mycobacterial promoters controlling the expression of such genes and to elucidate the transcriptional machinery used by mycobacteria both in vitro and in vivo. Several reporter molecules have been demonstrated to be functional in mycobacteria including the firefly luciferase gene (Jacobs, Jr. et al, 1993; Riska and Jacobs, Jr., 1998; Gordon et al, 1998), which has been used to demonstrate the minimum inhibitory concentration (MIC) of numerous antibiotics against M.a.paratuberculosis (Williams et al, 1999). Other reporter molecules have been successfully used in mycobacterial studies including chloramphenicol acetyl transferase (CAT) (Das Gupta et al, 1993), the Pseudomanas xylE gene (Curcic et al, 1994), the Aequorea victoria green fluorescent protein (GFP) (Kremer et al, 1995a; Via et al, 1998), the E.coli lacZ gene (Timm et al, 1994a; Timm et al, 1994b)

The ability to selectively replace genes of interest with inactivated copies allows the potential role in virulence of the particular gene to be determined. Allelic exchange by homologous recombination (HR) has been demonstrated successfully for a number of different mycobacterial species including M.smegmatis, M.bovis BCG, M.tuberculosis, M.intracellulare and M.phlei (Husson et al, 1990; Kalpana et al, 1991; Marklund et al, 1995; Mustafa, 1995; Balasubramanian et al, 1996; Baulard et al, 1996; McFadden, 1996). A number of studies have now applied different methodologies, including the use of secondary selection, such as the B.subtilis sacB gene and the mycobacterial katG and rpsL genes (Sander et al, 1995; Pelicic et al, 1996), for allelic replacement in both pathogenic and non-pathogenic mycobacterial species. The HR frequency in M.smegmatis, M.intracellulare and M.tuberculosis using non-replicating suicide plasmids was reportedly enhanced by the use of single stranded (ss) DNA (alkali denatured double stranded (ds) DNA or single stranded phagemid DNA) or UV irradiated ds DNA (Hinds et al, 1999). Transposon mutagenesis of M.smegmatis mc^l55, M.bovis BCG, M.tuberculosis, M.phlei, M.avium and M.a.paratuberculosis using a variety of mycobacterial transposons including Tn611, Tn5367 and the mini-TnlO has generated mutant libraries (McAdam et al, 1995; Bardarov et al, 1997; Harris et al, 1999; Cavaignac et al, 2000; Machowski et al, 2000). Such libraries then can be screened in vitro or in vivo for genes involved in the virulence of mycobacteria.

53 The majority of molecular genetic work on M.a.paratuberculosis has centred on accurately distinguishing M.a.paratuberculosis from other members of the M.avium complex (MAC) and from M.a.paratuberculosis isolates from different host species, using such techniques as pulse-field gel electrophoresis (PFGE) and restriction fragment length polymorphism (RFLP) (see section 1.4.2). M.a.paratuberculosis has been shown to be amenable to genetic manipulation with successful transformation of the bacillus reported with both shuttle plasmids and phage vectors by electroporation (Foley-Thomas et al, 1995; Williams et al, 1999). Mutant libraries of M.a.paratuberculosis have also been created independently by two groups using the mycobacterial transposon Tn5367 (Harris et al, 1999; Cavaignac et al, 2000). To date however, there have been no reports of successful allelic replacement in M. a.paratuberculosis.

In order to better elucidate the role that the 34kDa putative serine protease plays in the virulence of M.a.paratuberculosis it was intended to clone the gene and express the protein in M.smegmatis mc^l55. Ascertaining the role that the presence of the 34kDa putative serine protease had on the intracellular survival of M.smegmatis mc^l55 would ultimately follow this. In addition, as part of a collaborative project at the University of Surrey routine methodologies were being developed for disruption of M.a.paratuberculosis genes by HR. Initially, four potential virulence genes were targeted for gene knockout, the oxyR and katE genes and those encoding the 34kDa putative serine protease and the bacterioferritin protein. The mutant strains could then be tested in a macrophage survival assay and in animal models to assess the affect of the gene knockout on virulence. The complementation of any mutant phenotype by plasmid based expression of the corresponding endogenous gene would fulfil Koch’s postulates at the molecular level.

An essential prerequisite of the studies presented in this work was the development of techniques, protocols and vectors capable of expressing the 34kDa putative serine protease or any gene of interest in both M.smegmatis mc^l55 and M.a.paratuberculosis. The most commonly used mycobacterial shuttle vectors contain an ori derived from the M.fortuitum plasmid, pAL5000 (designated the “long

54 o rr in these studies, pALSOOO positions 4308 to 1366). A transformation feasibility study at the University of Surrey on the genetic manipulation of M.a.paratuberculosis had suggested that vectors utilising an alternative pALSOOO derived ori (designated the “short ori” in these studies, pALSOOO positions 4308 to 1100) resulted in increased transformation efficiency in M.a.paratuberculosis. The short ori differs fi*om the long ori in that the former contains less pAL5000-derived sequence than the latter. Therefore, in creating a set of vectors capable of expressing genes of interest in mycobacteria, consideration was given to incorporating this short ori. Similarly, it was important to develop adequate controls for these studies. The reporter molecule GFP was used for two reasons. Firstly, it offered the potential to demonstrate expression of recombinant DNA in M.smegmatis mc^l55 and M.a.paratuberculosis. Secondly, it also offered the potential to act as a control marker during animal experiments and in vitro survival determination assays. The work presented in this chapter set out to create the vectors and techniques required to clone the 34kDa putative serine protease and the reporter molecule GFP, or a mutant derivative, and the associated expression of the protein in M.smegmatis mc^l55 and M. a.paratuberculosis.

55 3.2 Materials and Methods 3.2.1 Amplification of the 34kDa putative serine protease ORF from Genomic DNA The entire 34kDa putative serine protease ORF was amplified by PCR from M.aparatuberculosis JD88/107 as follows. M.a.paratuberculosis genomic DNA (125ng) (Section 2.7) was added to pre-prepared reaction mixtures (50pl final volume) comprising (xl) reaction buffer at 1.5mM MgCl: (Qiagen), 0.2mM each of dATP, dCTP, dGTP and dTTP (dNTP mix; Roche Ltd.), 2% C/y) Glycerol, 100 pMol each of the forward and reverse primers (Forward primer: 5’- GGGmCCTCCCGCGACGCAGGAGGGT-3’, nucleotides in bold represent positions -25 to -7 of the 34kDa putative serine protease ORF with nucleotides in italics representing the Bst Eli restriction enzyme recognition sequence; Reverse primer: 5’-GCrCZ4G^TCAGGCCGGCGGCCCCTC-3’, nucleotides in bold represent positions 1068 to 1086 of the 34kDa putative serine protease ORF with nucleotides in italics representing the Xba I restriction enzyme recognition sequence) and 2.5 U HotStar Taq polymerase (Qiagen Ltd.). Hotstart PCR conditions consisted of an initial dénaturation of 15 min at 95°C, followed by 35 cycles of 60 sec dénaturation at 96°C, 60 sec annealing at 65°C and 90 sec extension at 72°C. The

final cycle included an extension at 72°C for 8 min.

56 3.2.2 Plasmid sequencing primers Sequencing of plasmid DNA was conducted as described in section 2.4 using the following primers: Primer Sequence Source Pr(al)-1 ^’ACACCAGCGACAGCCGAGCA3’ pALSOOO Positions 4504-4487 (5’ ORF-1) Pr(al)-2 ^'CCGACAATCCACCGCTGTT 3’ pALSOOO Positions 1056-1074 (3’0RF-2) Pr(M) ^’GCGGCCGCGGTACCAGA^' pMV206/pMV261 Multiple Cloning Site (MCS) Pr(G) 5’AGTTCTTCTCCTTTACTCAf GFP (Accession number: L20345)

coding sequence positions 2 0 - 1 .

3.2.3 Visualisation of GFP expression Visualisation of fluorescent bacteria was achieved by short wave UV irradiation (312nm) of bacterial colonies using a TM 20 transilluminator (GRI). For microscopic examination of individual fluorescent bacteria, single colonies of the bacterial strain were scraped from solid media, transferred to 250pl PBS and homogenised by vortexing. Ten pi of bacterial suspension or liquid culture were placed on a sterile glass slide and dried by heating gently over a Bunsen flame. Sample slides were fixed by submersion in methanol for 10 minutes and analysed using an Olympus BX50 microscope with a wt GFP 605 filter cube (Part No. 39568: Olympus) with an excitation spectra of 395 nm (minor excitation peak at 470nm) and emission spectra of 509nm, or with a E-GFP filter cube with an excitation spectra of 475nm and emission spectra of 509nm.

57 3.3 Results 3.3.1 Initial characterisation of plasmid DNA Several mycobacterial shuttle plasmids and the corresponding vector maps were received from members of the mycobacterial group at the University of Surrey in E.coli host strains, either DH5a or JMllO, as stab cultures (Appendix 2 Plasmid Reference Guide, pUS plasmid series). Initially plasmid DNA was recovered from the E.coli host strain as described in section 2.2.1. All vectors were digested to completion with the restriction enzyme Hind III (see section 2.2.2) and the approximate size determined in comparison to the molecular weight standards. The estimated size agreed with the expected sizes as quoted in the vector maps.

3.3.2 Generation of vectors to express GFP in mycobacteria Initially it was hoped to clone the GFP coding sequence and the upstream promoter region from plasmids pUS1878 {hsp60 promoter), pUS1803 (ISkDa promoter) and p u s 1883 {mpbVO promoter) into a plasmid utilising the short ori, in this case pUS972. The three promoters chosen exhibited a broad range of transcriptional activity, from high constitutive expression for hsp60, increased intracellular expression observed for the ISkDa promoter and low levels of constitutive expression for the mpb70 promoter. If successful, this approach would have facilitated further cloning by replacing the GFP coding sequence with the 34kDa putative serine protease ORF, ultimately leading to expression of the protein in

M.smegmatis mc^l55 2û[\à M.a.paratuberculosis.

Originally, the promoter sequences located in plasmids pUS1878, pUS1803 and pus 1883, were to be removed as Xba l-Bcl I fragments and cloned into the Aba I and Bel I digested pUS972. However, the restriction enzyme Bel I failed to cut pUS1803, pUS1878 and pUS1883 as determined by the presence of multiple undigested bands on a 0.8% agarose gel (see section 2.2.3). The restriction enzyme was demonstrated to be enzymatically active by the digestion of Ipg of A, DNA (Promega UK Ltd.) with 5U of Bel I under the appropriate reaction conditions, resulting in the appearance of distinct bands on a 0.8% agarose gel. Also, Xba I failed to digest p u s 1878 plasmid DNA as determined by the presence of multiple undigested bands on a 0.8% agarose gel. The enzyme was capable of cutting pUS1803 and pUS1883,

58 as determined by the presence of a single band of the required molecular size on a

0 .8 % agarose gel.

An alternative approach was to clone the promoter elements from pUS1803 and pUS1883 upstream of the promoter-less GFP coding sequence present in pUS1870. It was thought that the mycobacterial ori in pUS1870 was the desired short pALSGGO derived ori. Plasmids pUS1883 and pUS18G3 were digested with both Xba I and Hind III under buffering conditions compatible with the optimal activity of both enzymes (see section 2.2.2) and the resulting fragments resolved on a 1% LMP agarose gel. A 389 bp (pUS1883) and a 4G1 bp (pUS18G3) fragment containing the required promoter sequences were recovered from a 1% LMP-agarose gel as described in section 2.2.4. Plasmid pUS187G was similarly digested with both Xba I and Hind III and the linear 4821 bp vector fragment purified from a 1% LMP- agarose gel. Both promoter fragments were ligated into the linear pUS187G vector as described in section 2.2.7 overnight at 4°C. Five pi of each ligation was used to transform electrocompetent E.coli DH5a (see section 2.3.1c and 2.3.2c) and positive transformants selected for by growth on LB-agar media containing 5 Gpg/ml kanamycin with plasmid DNA recovered from positive transformants, section 2.2.1. The presence of the promoter was confirmed by restriction enzyme digestion of the resulting plasmid DNA with Xba I and Hind III. The plasmid vectors were designated pMRIlGl (containing the mpblO promoter) and pMRIlG2 (containing the 18kDa promoter). However, further consultation with the University of Surrey revealed that the mycobacterial ori present in pUS187G was in fact not the short ori but rather the more commonly used long ori present in the plasmids from which the promoter fragments had been excised.

3.3.3 Sequencing plasmid DNA Initial attempts to generate the required plasmids for these studies were hampered and confused by an overall lack of sequence information regarding the particular ori present in each vector as well as the restriction sites available for successful cloning. By sequencing the important constituent parts of the various plasmids it was hoped to generate the required sequence data to facilitate the creation of the required plasmid constructs.

59 In order to determine the exact amount of pALSOOO sequence constituting the ori in plasmids pUS1870, pUS1780 and pUS972 were sequenced using primers Pr(al)-1 and Pr(al)-2 (see section 3.2.2). Dr. Elizabeth Norman had previously demonstrated successful transformation of M.a.paratuberculosis with pUS1780 at the University of Surrey. The resulting sequences were compared to the published sequence of pALSOOO by alignment using the ALIGNX program of the Vector NTI suite (Figures 3.1 and 3.2). Plasmid pUS972 and pUS1780 encompass nucleotide positions 4311 to 1100 of the pALSOOO sequence (short ori) with pUS1870, encompassing positions 4308 to 1366 (long ori) (Figure 3.3).

Plasmids pUS1878 (hsp60 promoter), pUS1803 (jnpbVO promoter) and pUS1883 (18kDa promoter) contained the promoter elements which would be used in further studies to ultimately express the 34kDa putative serine protease. As such all three plasmids were sequenced with primers Pr(al)-1 and Pr(al)-2 and shown to contain the large ori present in pUS1870. The region encompassing the promoter regions in these plasmids was sequenced using primers Pr(M) and Pr(G) (see section 3.2.2). As the region of interest was approximately 400bp for each plasmid, it was possible to generate a Contig of this region, as the generated sequences from both primers were the reverse complement of each other (Figure 3.4). Interestingly, and despite the fact that the restriction site appears inactive the Xba I site appears to be present in plasmid pu s 1878.

60 pUS1780: pALSOOO:4311 agcccaccagctccgtaagttcgggcgctgtgtggctcgtacccgcgcattcaggcggca 4370 MIIIIIIIMMIIIIIIIIMMIMMIIMMIMIIIIII IMIIIIIIIIIM pUSlVSO:166 agcccaccagctccgtaagttcgggcgctgtgtggctcgtacccgagcattcaggcggca 107

4371 gggggtctaacgggtctaaggcggcgtgtacggccgccacagcggctctcagcggcccgg 443 0 IIIIIIIMIIIIIIMIMMIIIMIIIIIIIIMIMIIIIIIIIIIMIMIIIM 106 gggggtctaacgggtctaaggcggcgtgtacggccgccacagcggctctcagcggcccgg 47

4431 aaacgtcctcgaaacgacgcatgtgttcctcctggttggtacag 4474 IIIIIIIMIIIIIIMIMMIIIMIIIIIIIIMIIIIIII 46 aaacgtcctcgaaacgacgcatgtgttcctcctggttggtacag 3 pUS972: pALSOOO: 4311 agcccaccagctccgtaagttcgggcgctgtgtggctcgtacccgcgcattcaggcggca4370 IIMMIIIMIMIIIIIIMIIIIIIMMIIIIIIIIIMM IIIIMMMMM pUS972: 166 agcccaccagctccgtaagttcgggcgctgtgtggctcgtacccgagcattcaggcggca 107

4371 gggggtctaacgggtctaaggcggcgtgtacggccgccacagcggctctcagcggcccgg 4430 IIIIIMMIIIIIMMIIIIIMIIIIIilMIIMIMMIIIIIIIIIIIIIIIII 106 gggggtctaacgggtctaaggcggcgtgtacggccgccacagcggctctcagcggcccgg 47

4431 aaacgtcctcgaaacgacgcatgtgttcctcctggttggtacagg 447S MIIIIIIIMMIIMIMIIIIIMMIIIIIIIIMIIIIII 46 aaacgtcctcgaaacgacgcatgtgttcctcctggttggtacagg 2 pUS1870 pALSOOO: 4308 gtgagcccaccagctccgtaagttcgggcgctgtgtggctcgtacccgcgcattcaggcg4367 MMIIIIIMIIIIIMIIIIIMIIIIIIIIIIMIIIIIIIIIIIIMIIIIIIIM pUS1870:168 gtgagcccaccagctccgtaagttcgggcgctgtgtggctcgtacccgcgcattcaggcg 109

4368 gcagggggtctaacgggtctaaggcggcgtgtacggccgccacagcggctctcagcggcc 4427 IIIIIIIIIMIIIIIIIIIMMIIIIIIIIMMIIIIMIIIIIIIIIIMIIIIM 108 gcagggggtctaacgggtctaaggcggcgtgtacggccgccacagcggctctcagcggcc 49

4428 cggaaacgtcctcgaaacgacgcatgtgttcctcctggttggtacag 4474 IMMIIIIMMIIillllMMMIIIIIIIIIIIMIIIIIIII 48 cggaaacgtcctcgaaacgacgcatgtgttcctcctggttggtacag 2

Figure 3.1 Alignment of the 5’ end of the ori present in vectors pUS1780, pUS972 and pus 1870 with pALSOOO. Plasmid DNA was sequenced with primer Pr(al)-1 (see section 3.2.2) as described in the text and the sequence compared to pALSOOO by BLAST searching. Figure generated from BLAST hit of query sequence and pALSOOO.

61 pUS1780: pALSOOO: 1089 gagcgggtgtcg 1100 MIIIIIIMM pUS1780: 1 gagcgggtgtcg 12 pUS972: pALSOOO: 1083 attggggagcgggtgtcg 1100 MMMMMMMMM pUS972: 4 attggggagcgggtgtcg 21 pUS1870: pALSOOO: 1084 ttggggagcgggtgtcgcgggggttccgtggggggttccgttgcaacgggtcggacaggt 1143 IIIIIMMIIIMMIIIMMIIIIIMMMIIIIIMMIMMMMIMIIIM pUS1870: 1 ttggggagcgggtgtcgcgggggttccgtggggggttccgttgcaacgggtcggacaggt 60

1144 aaaagtcctggtagacgctagttttctggtttgggccatgcctgtctcgttgcgtgtttc 1203 iiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiii 61 aaaagtcctggtagacgctagttttctggtttgggccatgcctgtctcgttgcgtgtttc 120

1204 gttgcgcccgttttgaataccagccagacgagacggggttctacgaa-tcttggtcgata 1262 MIIIIIMMIIIIIIIIIIMMIIIIIIIIMMIIIIIIIIII MMMIIIIM 121 gttgcgcccgttttgaataccagccagacgagacggggttctacgaattcttggtcgata 180

1263 ccaagccatttccgctgaatatcggggagctcaccgccagaatcggtggttgtggtgatg 1322

181 -caagccatttccgctgaatatcggggagctcaccgccagaatcggtggttgtggtgatg 239

1323 tacgtggcgaactccgttgtagtgcctgtggtggcatccgtggc 1366

240 tacgtggcgaactccgttgtagtgcctgtggtggcatccgtggc 283

Figure 3.2 Alignment of the 3’ end of the ori present in vectors pUS1780, pUS972 and pUS1870 with pALSOOO. Plasmid DNA was sequenced with primer Pr(al)-2 (see section 3.2.2) as described in the text and the sequence compared to pALSOOO by BLAST searching. Figure generated from BLAST hit of query sequence and pALSOOO.

62 0RF5 ORF 1 0RF2 ORF 3

Short oh Long ori

Fragment of pALSOOO 3200 bp (molecule 4837 bp)

Figure 3.3 pALSOOO derived origins of replications (ori). Fragment of pALSOOO sequence showing the location of both origins of replication used in these studies, Short ori (pALSOOO positions 4311-1 lOObp) and Long ori (pALSOOO positions 4311- 1366bp). Also shown are ORF 1 and 2, which constitute the minimum requirements for plasmid replication, ORF5 and ORF3. Figure generated using Vector NTI suite, using pALSOOO sequence (Accession number: M23557).

63 B st Eli Bam HI hsp60 Promoter P s tl X ba I Eco RI GFP Kpn I H indW l Myco Origin N ot I Kpn I

pUS1878 Fragment

18kDa Promoter EcoRV B st Eli

E g o RI Myco Origin GFP Kpn I H indW l N ot I Kpn I

pUS1883 Fragment

Bam HI P s tl mpb70 Promoter Myco Origin A%6Zl E g o RI GFP Kpn I H ind III N ot I Kon I

pUS1803 Fragment

Figure 3.4 Vector map of the various promoter elements located in pUS1803, pUS1878 and pUS18083 created by Vector NTI based on sequence information (Appendix 4) generated by sequencing the plasmids as described in the text. Shown is the promoter region in each vector, the location of the down stream GFP coding sequence and the location of the mycobacterial ori. Also shown are the various restriction enzyme recognition sites used for cloning procedures.

64 3.3.4 Plasmid construction The mycobacterial ori present in pUS972 was confirmed as the short mycobacterial ori. As such, pUS972 was selected as the backbone for construction of all future plasmids. a) Transcriptional fusion vectors In order to express any gene in M.smegmatis or M.a.paratuberculosis plasmids were required containing the promoter elements necessary for transcriptional activity. The hsp60 (pus 1878) and 18kDa (pUS1883) promoters were cloned into pUS972 (Figure 3.5 and 3.6). The promoter sequences located in pUS1878 Qisp60 promoter) and pu s 1883 {18kDa promoter) were excised fi*om the vector backbone as Kpn I fragments (460 bp for pUS1878 and 426 bp from pUS1883) and purified from a 1% LMP-agarose gel (see section 2.2.4). Plasmid pUS972 was digested to completion with Kpn I and purified from a 1 % LMP-agarose gel. The linear vector was then treated with Shrimp Alkaline Phosphotase (SAP) (see section 2.2.5) and gel purified as before. The promoter fragments were cloned into the linear pUS972 vector (see section 2.2.7) and 5pi of the ligation reaction used to transform electrocompetent E.coli JM109 cells (section 2.3.1c and 2.3.2c). Positive E.coli transformants were selected by growth on LB-agar media supplemented with 50pg/ml kanamycin. Plasmid DNA was recovered as described in section 2.2.2, and digested with the restriction enzymes Kpn I and Hind III. Kpn I digestion of the recovered plasmid DNA confirmed the presence of both promoter fragments (Figure 3.7).

By using a single restriction site to clone the fragments into pUS972, the orientation of the promoter elements in the plasmid backbone was unknown. To determine the orientation of the cloned promoter fragments, plasmid DNA was digested to completion with the restriction enzyme Hind III. Removal of 6 6 bp from both plasmids confirmed that the promoter was in the correct orientation relative to the down-stream MCS (Figure 3.7). The resultant plasmids with correctly orientated promoter sequences were designated pMRI104 (hsp60 promoter) and pMRI105 {18kDa promoter).

65 EcoRI KpnI Phsp60

BamHI Kan(R) EcoRI H nd I

PUS972 3600 bp P(kan) PUS1878 EcoRI BamHI 5244 bp oriC EcoRI P(kan)

Kan(R)

oriM

EcoRI Sail

Kpn I digestion of both vectors (indicated by arrows)

EcoRI Clal -MCS Bell Hind III SphI P stl Kan(R) Sail Xba I BamHI

P(kan) PMRI104 orlC‘ 4060 bp

P(hsp60)

EcoRI EcoRI Sail

Figure 3.5 Construction of pMRI104. Shown are vector maps of pUS1878, pUS972 and pMRI104. The cloning of the hsp60 promoter into pUS972 was as described in the text. Briefly, the hsp60, P(hsp60), promoter was removed from pUS1878 as a Kpn I fragment and cloned into pUS972 generating plasmid pMRJ104. The orientation of the promoter relative to the downstream MCS was determined by Hind III digestion of pMRI104 DNA (Figure 3.7).

66 EcoRI RBS RBS EcoRI Bst Eli / / Hind III

EcoRV BamHI -MCS Kan(R) P(18K)

PUS972 3600 bp P(kan) BamHI PUS1883 oriC EcoRI 5210 bp P(kan)

oriM Kan(R)

EcoRI Sali

Kpn I digestion of both vectors (indicated by arrows)

EcoRI Clal -MCS Bell Hind III SphI P s tl Sail Kan(R) Xba I BamHI

pMRJiOS P(kan) oriC 4026 bp Hind III

P(18K)

EcoRI EcoRI

S ail

Figure 3.6 Construction of pMRI105. Shown are vector maps of pUS1883, pUS972 and pMRIlOS. The cloning of the 18kDa promoter, P(18kDa), was as described in the text. Briefly, the 18kDa promoter was removed from pUS1883 as a Kpn I fragment and cloned into pUS972 generating plasmid pMRIlOS. The orientation of the promoter relative to the downstream MCS was determined by Hind III digestion of pMRIlOS DNA (Figure 3.7).

67 L 1

10,000 8,000 6,000 5.000 4,780 4.000 3.000 3,600 2,500

2,000 - 1,500-

450 400 -

200 -

Figure 3.7 Agarose gel showing Kpn I digests of plasmids of pUS1878 and pUS972 as well as Kpn I and Hind III digestion of pMRI104 and pMRI105. Lane 1: Kpn I digestion of plasmid pUS1878 results in the removal of the promoter region (460 bp; hsp60 promoter); Lane 2 Kpn I digestion of pUS972 resulting in linearlisation of the vector (3.6 Kb); Lane 3 and Lane 4: Kpn I digestion of pMRI104 (Lane 3) and pMRI105 (Lane 4) resulting in the excision of the cloned promoter region

(pMRI104: hsp60, 460 bp; pMRI105: ISkDa promoter, 426 bp); Lane 5 and Lane 6 :

Hind III digestion of pMRI104 (Lane 5) and pMRI106 (Lane 6 ) resulting in the excision of 6 6 bp from both pMRI104 and pMRI105. See text for more details. L represents the molecular weight markers (Hyperladder I, Bioline Ltd.).

6 8 b) Promoter-less reporter vector In order to generate a promoter less reporter vector, the E-GFP coding sequence was cloned into pUS972. The E-GFP ORF was removed from the plasmid pE-GFP-1 (Appendix 2) as a single 751bp Bam Yil-Xba I fragment and purified from a 1% LMP-agarose gel. Plasmid pUS972 was digested to completion with Bam HI and Xba I, and the resulting 3,576bp vector purified from a 1% LMP-agarose gel. The E- GFP coding sequence fragment was ligated into pUS972 and 5pi of the ligation reaction used to transform electrocompetent E.coli DH5a cells. Positive transformants were selected for by growth on LB-agar medium supplemented with 50pg/ml kanamycin. Plasmid DNA was recovered from positive transformants and restriction enzyme digestion of plasmid DNA with Kpn I confirmed an increase in size for the resultant plasmid consistent with the incorporation of the E-GFP coding sequence. The resultant plasmid construct was designated pMRI103. c) E-GFP reporter vectors In order to create plasmid shuttle vectors capable of expressing the reporter molecule E-GFP in mycobacteria the hsp60 and 18kDa promoter elements were cloned into the promoter-less E-GFP vector, pMRI103 (Figure 3.8). The promoter elements contained within pUS1878 and pUS1883 were excised as a Kpn I fragment and the resultant fragments (460 bp for pUS1878 and 426 bp for pUS1883) were purified from a 1% LMP-agarose gel. pMRI103 DNA was digested to completion with the restriction enzyme Kpn I, purified from a 1% agarose gel and treated with SAP. The resulting linear dephosphorylated vector was purified from a 1% LMP-agarose gel. Both promoter fragments were ligated separately into pMRI103 and 5 pi of each ligation reaction used to transform E.coli JM109 cells. Positive transformants were selected for by growth on LB-agar supplemented with 50pg/ml kanamycin. The orientation of the promoter relative to the downstream E-GFP coding sequence was confirmed by restriction mapping using the restriction enzyme Hind III. The excision of a 744bp fragment from each plasmid by digestion with Hind III confirmed that the promoter was in the correct orientation. E-GFP expression vectors with correctly orientated promoter fragments were designated pMRI107 (hsp60 promoter) and pMRI108 (18kDa promoter).

69 Bst Ell EcoRI Not I Clal RBS ,RBS ^K pnl -MCS— -MCS— Bell BamHI Hind III ■ Pstl Kan(R) SphI EcoRI Pstl Hind III Sail P(kan) GFP Ndel -Xba I orlM PUS1878 EcoRI 5244 bp P stl P(kan) E-GFP Bell

orlM Kan(R)

EcoRI OrIC BamHI Kpn I Sail EcoRI

Kpn I digestion of both vectors (Indicated by Red arrows)

EcoRI

-MCS— Bell Hind III Clal SphI Kan(R) P s tl orIC Sail P(kan) Xba I PMR1107 4000 bp

E-GFP

orIM EcoRI BamH I

P(hsp60) y Kpn I Hind III Sail RBS

RBS EcoRI Kpn I

Figure 3.8 Construction of pMRIlOT. Shown are vector maps of pUS1878, pUSlOB and pMRI107. The cloning of the hsp60, P(hsp60), promoter into pMRIlOB was as described in the text. Briefly, the hsp60 promoter was removed from pUS1878 as a Kpn I fragment and cloned into pMRIlOS generating plasmid pMRI107. The orientation of the promoter relative to the downstream E-GFP sequence was determined by Hind III digestion of pMRIlOB DNA. An identical approach was used to clone the 18kDa promoter into pMRIlOS.

70 3.3.5 Expression of GFP and E-GFP in M,smegmatis mc^l55 The various plasmid vectors created in section 3.3.4 as well as the plasmids received from the University of Surrey capable of expressing GFP (pUS1878, pUS1803 and pus 1883) or E-GFP (pMRI107 and pMRI108) were introduced into electrocompetent M.smegmatis mc^l55 (see section 2.3.1b) by electroporation as described in section 2.3.2b. Positive transformants were selected by growth on 7H11S medium supplemented with 30 pg/ml kanamycin. Positive expression of GFP in M.smegmatis pUS1878, M.smegmatis pUS1883 and M.smegmatis pUS1803 was detected by fluorescent microscopy, using filter cubes specific for GFP detection (see section 3.2.3). Unfortunately, no quantification of the level of GFP expression was possible using this system. Similarly, positive expression of the E-GFP gene was demonstrated in recombinant M.smegmatis mc^l55 strains harbouring plasmids pMRI107 and pMRI108 by fluorescent microscopy using filter cubes for E-GFP detection (Figure 3.9).

3.3.6 Cloning the 34kDa putative serine protease ORF and expression of the protein in M.smegmatis mc^lSS Previous worked carried out at Moredun Research Institute had sequenced the entire 34kDa putative serine protease open reading frame and the corresponding upstream putative Shine Delgamo sequence present in the S 8 clone (see section 1.10). a) Cloning the 34kDa putative serine protease ORF into a mycobacterial shuttle plasmid PCR primers were designed that would allow the PGR amplification of this entire region, with the addition of a 5’ Bst Eli site and a 3’ Xba I site. A double digest of pMRI104 (section 3.3.4a: transcriptional fusion vector hsp60 promoter) using both enzymes was expected to remove both ribosome-binding sites present in the promoter region. By adopting this approach, cloning the 34kDa putative serine protease into pMRI104 was expected to generate a transcriptional fusion to the hsp60 promoter (Figure 3.10). This would allow the determination of the translational activity of the putative RBS located upstream of the 34kDa putative serine protease.

71 A

BB ^BH

Figure 3.9 M.smegmatis pMRI107 (A) and M.smegmatis pMRIlOS (B) expressing E-GFP under the control of the hsp60 {M.smegmatis pMRI107) and 18kDa {M.smegmatis pMRIlOS) promoters. The preparation of cells for visualisation of E- GFP expression was as described in the text. Clumps of fluorescent bacteria are indicated by asterisks and single fluorescent bacteria indicated by arrows.

72 C lal EcoR I MCS B ell Hind III S p h I P s tl Kan(R] S a il Signal sequence Xba I Bst Ell BamH I 34kDa coding sequence

P(kan) Kpn I pGEM-T , pGEM-T PMRI104 oriC-M 4060 bp -RBS -RBS

B st Ell SD pGEM-34 34R

oriM

Kpn I EcoR I EcoR I S a il

EcoRI -MCS“ B ell Hindi C lal S phI Kan(R) P s tl S a il

oriC P(kan) Xba I

PMRI34 5160 bp

oriM

EcoRI

P(hsp60) 34kDa Serine Protease

S ail

BstE II Kpn I EcoRI

Figure 3.10 The cloning of the 34kDa putative serine protease into the E.coli- mycobacterial shuttle vector, pMRI104 was as described in the text. Briefly, the entire 34kDa putative serine protease ORF and 25bp of upstream sequence was initially cloned into pGEM-T (Figure 3.11) and then excised as a single Xba l-Bst Eli fragment and cloned into pMRI104 generating a transcriptional fusion with the hsp60 promoter. The resulting vector was designated pMRI34.

73 The 34kDa putative serine protease open reading frame and 25 bp of sequence upstream from the initiation codon was amplified by PCR from M.a.paratuberculosis genomic DNA (see section 3.2.1). The l,100bp PCR product was purified from a 1% LMP agarose gel and cloned into the pGEM-T vector (Promega UK) as per the manufacturer’s recommendations, generating pGEM-34 (Figure 3.11). The insert fragment was sequenced using the T7 forward and reverse primers located in the pGEM-T vector. Alignment of the generated sequence with the 34kDa putative serine protease database entry demonstrated 100% identity. pGEM-34 plasmid DNA was digested to completion with Xba 1 and Bst Ell and the resulting 1,117 bp fragment was purified from a 1% LMP-agarose gel. pMRI104 plasmid DNA was also digested with both Xba I and Bst Ell and the linear 3,930bp plasmid was purified from a 1% LMP-agarose gel. The Bst E31-Xba 1 34kDa putative serine protease fragment was ligated into pMR1104 and 5 pi of ligation reaction used to transform E.coli JM109 cells. Positive transformants were selected for by growth on LB-agar containing 50pg/ml kanamycin. Plasmid DNA was isolated from positive transformants, and restriction enzyme digestion with Bst Ell and Xba 1 confirmed the presence of the correct l,117bp fragment in the vector (Figure 3.12), the vector was designated pMRI34 (Figures 3.10). Electrocompetent M.smegmatis mc^l55 (see section 2.3.1b) was transformed with pMRI34 by electroporation as described in section 2.3.2b, and positive transformants selected by grov/th on 7H11S medium supplemented with 30pg/ml kanamycin. b) Expression of the 34kDa putative serine proteasein M.smegmatis mc^lSS The expression of the 34kDa putative serine protease from the hsp60 promoter in M.smegmatis mc^lSS was confirmed by western immunoblotting of M.smegmatis pMR134 cell lysates (see section 2.6), probed with a monoclonal antibody raised against the C-terminal end of the 34kDa putative serine protease (see section 2.8 and 2.10). A band of approximately 34kDa was detected in M.smegmatis pMRI34 lysates that co-localised with an identical protein band in the M.a.paratuberculosis lysate confirming expression of the 34kDa putative serine protease in M.smegmatis mc^l55 (Figure 3.13). No such band was detected in the control M.smegmatis mc^l55 lysate.

74 Signal sequence

Bst EII^ 3 4 F Xba I \ 34kDa coding sequence pGEM-T \ » pGEM-T

SD pGEM-34 34R

Figure 3 .1 1 The 34kDa putative serine protease ORF and upstream RBS were cloned into pGEM-T and the insert sequenced as described in the text. Shown are the important features of the cloned 34kDa putative serine protease sequence, the 34kDa putative serine protease ORF complete with the signal peptide and upstream Shine Dalgamo sequence (SD). Also shown are the locations of the restriction enzyme recognition sites used for further cloning {Bst Eli and Xba I). Fragment map was generated from sequence data (Appendix 4) using the Vector NTI suite.

75 1 2 3 4 5 L

10,000 8,000 6,000 5.000 3.930 4.000 3.000 2.500 2.000 1.500 1,117 1,000

-200

Figure 3.12 Agarose gel showing Bst EU and A&a I digestion of plasmids pMRI104, pGEM-34 and pMRI34. Lane 1: digestion of pMRI104 resulting in presence of a 3,930 bp DNA band; Lane 2; digestion of pGEM-34 results in the excision of the cloned 1,117 bp 34kDa putative serine protease ORF, Lane 3, Lane 4 and Lane 5, digestion of pMR134 results in the excision of the cloned 1,117 bp 34kDa putative serine protease ORF from the vector backbone (-3,930 bp). L represents the molecular weight standards (Hyperladder 1, Bioline Ltd.)

76 01 23456789 10 L

- 212,000 - 122,000 - 83,000

-5 1 ,8 0 0 34,000 - 35,600 - 28,400

- 20,000 - 7,200

Figure 3.13 Western blot showing mycobacterial cell lysates probed with anti- 34kDa antigen monoclonal antibody. Lanes 1-9; B.QCovcib\rmi\. M.smegmatis me 155 expressing the 34kDa antigen, lane 0; control M.smegmatis mc^l55. Lane 10; Wild type M.a.paratuberculosis. The lane marked L contains the M.wt markers. Only M.smegmatis pMR134 and M.a.paratuberculosis were positive for the presence of the 34kDa putative serine protease.

77 Earlier work had demonstrated that the signal peptide located at the N-terminus of the protein facilitated the secretion of the protein in M.a.paratuberculosis (see section 1 .1 0 ). In order to demonstrate if the signal peptide was capable of directing the secretion of the recombinant protein in M.smegmatis mc^l55, culture supernatants were tested for the presence of the 34kDa putative serine protease. Cell- free culture supernatants of M.smegmatis mc^l55 and M.smegmatis pMR134 were concentrated down from a initial volume of 2 0 ml to a final volume of 1 ml using Microcon Concentrators (molecular weight cut-off; lOkDa) as per the manufacturer’s instructions. Western immunoblotting of the concentrated supernatants demonstrated the presence of a 34kDa-protein band in the M.smegmatis pMRI34 culture supernatant, with no protein detected in control M.smegmatis mc^l55 supernatant samples (Figure 3.14). No bands were detected when identical blots containing concentrated culture supernatants of M.smegmatis mc^l55 snd M.smegmatis pMRI34 were probed with a monoclonal antibody against the cellular localised mycobacterial Hsp65 antibody, although the protein was detectable in the corresponding cell lysates for the same strains (data not shown).

3.3.7 Transformation of M,a.paratuberculosis plasmid DNA A caveat to the development of expression vectors in M.smegmatis mc^l55, was the development of similar procedures to transform M.a.paratuberculosis. The ability to express genes in M.a.paratuberculosis was important for two reasons, firstly in complementing a null mutant in M.a.paratuberculosis, rescuing any observed phenotype. Secondly, the expression of GFP or a mutant derivative in M.a.paratuberculosis could be used as a convenient marker in future studies of M.a.paratuberculosis infection of cultured macrophages and in animal studies. A panel of six different M.a.paratuberculosis strains was chosen for these studies. The six different strains represented isolates from a broad host range, (cattle, sheep and rabbit) exhibiting different growth rates in culture, with the sheep isolates noted to be slower growing than the cattle isolates. It was hoped that the choice of these strains representative of the spectrum of M.a.paratuberculosis isolates would lead to the identification of a particular strain or strains that were amenable to genetic manipulation.

78 1 2 3 4 5 6

- 97,400

- 66,200

- 45,000

34.000 > -3 1 ,0 0 0

-2 1 ,5 0 0

- 14,400

Figure 3.14 Western blot showing mycobacterial cell lysates and the corresponding concentrated culture supernatants probed with anti-34kDa antigen monoclonal antibody. Lane 1, M.smegmatis mc^l55 lysate; Lane 2: M.smegmatis pMR1104 lysates; Lane 3: M.smegmatis pMRI34 lysate; Lane 4: M.smegmatis mc^l55 culture supernatant; Lane 5: M.smegmatis pMRI104 culture supernatant; Lane 6 : M.smegmatis pMR134 culture supernatant. A unique band at 34kDa is seen in the lysate of M.smegmatis pMR134 and also in the concentrated culture supernatant (indicated by an arrow).

79 Initially the protocol used to transform electrocompetent M.a.paratuberculosis was that of Wards and Collins, 1996 (see section 2.3.2a Method 1). Attempts were made to transform six M.a.paratuberculosis isolates from different host species, demonstrating a wide range of growth rates in culture (Appendix 2). All strains were raised directly from low passage number glycerol stocks and prepared for transformation as described in section 2.3.1a. In order to confirm previous observations regarding the association between the choice of mycobacterial ori and transformation efficiency attempts were made to transform M.a.paratuberculosis strains with plasmids containing GFP and the long ori of replication, (pUS1803, pUS1878, pUS1883 and pUS1780) as described in section 2.3.2a Method 1. Positive transformants were selected for by growth on 7H1 IE medium supplemented with 30 pg/ml kanamycin and incubated at 37°C for up to 16 weeks. Only strains 51/91 and R187 transformed with pUS1780 gave positive colonies after 10 weeks in culture. However, the overall transformation efficiency was extremely low, 10 CFU/pg DNA for 51/91 and 8 CFU/pg DNA for R187. 1^900 PCR confirmed that the resultant transformants were M.a.paratuberculosis (see section 2.11.1) and the presence of plasmid DNA in each strain confirmed by PCR directed against the kanamycin resistance gene (see section 2.11.2). The effect on viability of the electroporation of M.a.paratuberculosis strains was determined by comparison of the growth of each strain before and after electroporation (in the absence of plasmid DNA) in 7H11E media. For each strain, no appreciable difference was detected in the viability of the organisms following control electroporation. Similarly, M.a.paratuberculosis strains electroporated in the absence of plasmid DNA failed to grow on 7H11E media supplemented with 30pg/ml kanamycin. A repeat experiment using the same conditions as described above, failed to generate any transformants for any M.a.paratuberculosis isolates. The inability to transform M.a.paratuberculosis strains 51/91 and R187 in a repeat perhaps underlined the extremely low transformation efficiency observed in the initial experiments.

Following preparation of electrocompetent M.a.paratuberculosis the cells were snap frozen and stored under liquid nitrogen until required. This was necessitated by the different growth rates of the various strains in cultures so that all transformations could be conducted on the same day using the same plasmid DNA and

80 electroporation conditions. The possibility existed that the freezing of the cells before electroporation adversely affected the transformation of these strains. No appreciable adverse affect on the overall viability of each culture was noted. In order to address this, all M.a.paratuberculosis strains were prepared for electroporation as described in section 2.3.1a and immediately transformed with pUS1878, pUS1780 and pUS972 plasmid DNA without freezing of the prepared mycobacterial cells. No positive transformants were observed on selective medium for any strain transformed with plasmid DNA following incubation on selective medium for 16 weeks.

A second transformation method was attempted, following consultation with Dr. Steve Thome at the University of Surrey (see section 2.3.2a Method 2). The possibility remained that the use of the short ori would facilitate the stable introduction of plasmid DNA. M.a.paratuberculosis strains 51/91 and R187 were transformed with 500 ng of pMR1107, pMR1108, pUS1878 and pUS972 plasmid DNA (see section 2.3.2a Method 2). However, no transformant colonies were seen following incubation for 8-10 weeks at 37°C on 7HllSu (Appendix 3) media supplemented with 30 pg/ml kanamycin following transformation with any plasmid DNA.

81 3.4 Discussion The central aim of the work presented in this chapter was to create the shuttle plasmid vectors and transformation protocols necessary to express the 34kDa putative serine protease or a reporter molecule (wildtype GFP or a mutant derivative), in M.smegmatis mc^l55 and M.a.paratuberculosis. Initially an overall lack of sequence information relating to the particular ori present in the various plasmids as well as an inaccurate restriction enzyme map hampered attempts to create the various vectors. As such, several important composite regions of the various plasmids were sequenced. Firstly, it was important to determine the exact amount of pALSOOO sequence present in the mycobacterial ori as a difference in transformation efficiency for M.a.paratuberculosis had been observed using the two origins. Both origins of replication contained the complete sequence of ORFl and 0RF2, which are considered indispensable for plasmid replication in mycobacteria (Stolt and Stoker, 1996). The difference between the two ori was in the region down stream from 0RF2. The long ori of replication contained 260bp more sequence between 0RF2 (719-1078bp) and 0RF3 (1538-2305 bp), than the short ori of replication (Figure 3.3). More recent work has postulated a role for the 0RF5 of pALSOOO in the faster recovery of M.smegmatis mc^lSS, under kanamycin selection (Stolt and Stoker, 1997). However, both the short ori and long ori contain the same amount of 0RF5 sequence and do not contain the full coding sequence (4452-4102) (Figure 3.3). It remains to be determined if the lack of the 3’ 260bp of sequence has any effect on the ability of plasmid DNA to transform M.a.paratuberculosis.

The ultimate choice of the hsp60 promoter to drive expression of the 34kDa putative serine protease in M.smegmatis mc^lSS, instead of the ISkDa or mpblO promoters, for future in vitro virulence assay determination was based on two factors. Firstly, the hsp60 promoter has demonstrated constitutive expression in culture and within macrophages (Dellagostin et al, 1995). Secondly, Foley-Thomas et al have demonstrated that in terms of luciferase activity, the hsp60 promoter demonstrates comparable expression levels in M.smegmatis and M.a.paratuberculosis. The coding sequence was cloned as a transcriptional fusion to the hsp60 promoter and the resultant vector introduced into M.smegmatis mc^l55. The positive expression of the 34kDa putative serine protease in M.smegmatis mc^l55 was confirmed by western

82 immunoblotting of mycobacterial cell lysates. It was also possible to demonstrate that the protein was capable of being secreted by M.smegmatis mc^l55. The native protein has been shown to be secreted by M.a.paratuberculosis and as such any virulence associated function of the mature protein may be related to the secretion and subsequent activity of the protein in the phagosome of infected macrophages.

Published work has demonstrated transformation of M.a.paratuberculosis with plasmids pMV262 and a luciferase expressing derivative of pMV262, pYUBlSO (Foley-Thomas et al, 1995; Williams et al, 1999). pMV262 contains the long pAL5000 derived ori. The authors report that it was possible to transform prototype and clinical isolates of M.a.paratuberculosis with a transformation efficiency between 1.4 to 7.1 x 10^ cfii/pg DNA depending on the strain. The electroporation protocol in these studies used pre-chilled mycobacterial cells (Jacobs, Jr. et al, 1991; Parish and Stoker, 1998), which may have been responsible for the low transformation efficiency. Ward and Collins reported that pre-warming slow growing mycobacterial cells to 37°C improved the transformation efficiency of pathogenic strains, including M.avium (Wards and Collins, 1996). The protocol of Wards and Collins, 1996 was used in these studies, but it was not possible to transform M.a.paratuberculosis strains with plasmids expressing GFP or E-GFP, utilising both origins of replication. While it was possible to transform M.a.paratuberculosis strains 51/91 and R187 with pUS1780 the efficiency of transformation was very low with few colonies recovered on selective medium following incubation. A similar plasmid containing the short ori, pUS972 failed to transform any of the strains tested. Similarly, extending the recovery time post-electroporation and changing the selection media failed to improve the recovery of positive transformants.

There are several potential reasons why it was not possible to transform M.a.paratuberculosis. Indigenous plasmids have been reported in M.avium complex strains, although as yet no published work has demonstrated the presence of naturally occurring plasmids in M.a.paratuberculosis. However, the presence of any such plasmids may decrease the efficiency of, or in some cases possibly prevent, transformation by a mechanism of incompatibility or competition for replication or partition (Crawford and Bates, 1984; Crawford and Bates, 1986; Jucker and

83 Falkinham, III, 1990). Mycobacterial plasmids have been demonstrated to have a restricted and complex mycobacterial host range. Plasmids harbouring pLR7 and pMSC262 based replicons were unable to replicate in M.smegmatis mc^l55, whereas pMSC262 was capable of replication in M.smegmatis J15cs (Beggs et al, 1995). Similarly, a pALSGGO based plasmid failed to transform a M. avium strain harbouring pLR7, whereas a pMSC262 replicon was compatible with the presence of a pALSGGG replicon in M.bovis BCG. Therefore, the possibility exists that the inability to transform M.a.paratuberculosis with plasmid DNA, may reflect an incompatibility between the pALSGGG origin and an endogenous plasmid in the strains used.

Another important consideration is that the complexity and resilience of the M.a.paratuberculosis cell wall constitutes a significant barrier to transformation with exogenous DNA. Similarly, the propensity of M.a.paratuberculosis to aggregate together to form “clumps” both in culture and during the preparation of a electrocompetent M.a.paratuberculosis cell suspension may also render the cells more resilient to transformation. The particular growth stage at which the M.a.paratuberculosis cells are harvested may also affect the transformation efficiency. In these studies, the cells were grown to a high density, to late log phase. However, in the studies of Foley-Thomas et al the cells were grown to a much lower

density (ODeoo ~ G.2 ), early log phase. Actively dividing cells may be more amenable to transformation than those cells harvested at a later growth stage. In the studies of Foley-Thomas et al positive transformants were selected by growth on media containing IG pg/ml kanamycin, significantly lower than the concentration used in these studies. A higher concentration was deemed advantageous to prevent growth of spontaneous kanamycin mutants. The possibility exists that lowering the concentration of kanamycin used for selection of transformants without increasing the appearance of resistant mutants may allow more efficient recovery of M.a.paratuberculosis transformants. Finally, the transient ability to transform two strains of M.a.paratuberculosis with pUS178G but not plasmids expressing OFF or E-GFP may indicate that the expression of the reporter molecule places a strain on the transcriptional machinery of the host mycobacterial cell adversely affecting the viability of that cell.

84 The long incubation time required for confirmation of positive transformants, up to 16 weeks, meant that not all the potential barriers to efficient transformation could be addressed over the course of the work. Further work is required to determine what specific conditions are required to transform M.a.paratuberculosis. The strains used in these studies were low passage number strains, to avoid the possible laboratory adaptation of the strains by repeated passage in culture over many generations. However, the ability to grow the cultures at a faster rate possibly by serial passage, coupled to a comprehensive investigation of the different growth stages may facilitate greater transformation efficiency. Similarly, the ori used in the construction of the plasmid vectors should be re-evaluated to include origins of replication fi*om other plasmids to overcome any potential genetic barriers to transformation.

In conclusion, expression vectors have been constructed utilising the short ori. The 34kDa putative serine protease was cloned as a transcriptional fusion with the hsp60 promoter and the resultant vector, pMRI34, transformed into M.smegmatis mc^l55. It was possible to demonstrate the presence of the recombinant 34kDa putative serine protease in M.smegmatis mc^l55. It was also possible to demonstrate that the 34kDa putative serine protease is capable of being secreted by M.smegmatis mc^l55. The potential effect of expression of the 34kDa putative serine protease on the intracellular survival of M.smegmatis mc^l55 could now be determined.

85 CHAPTER 4

INFLUENCE OF EXPRESSION OF THE M.a.paratuberculosis 34kDa PUTATIVE SERINE PROTEASE ON THE INTRACELLULAR SURVIVAL OF M.smegmatis mc^lSS

4.1 Introduction Pathogenic mycobacteria persist in the host by residing in macrophages. Although both virulent and avirulent mycobacteria are internalised by macrophages and monocytes, only pathogenic mycobacteria survive and replicate intracellularly. Mycobacteria enter macrophages primarily by conventional receptor-mediated phagocytic pathways, predominantly mediated via type 3 complement receptors (Schlesinger and Horwitz, 1991). However the plasma membrane steroid cholesterol has also been shown to be required for efficient uptake (Gatfield and Pieters, 2000).

Pathogenic Mycobacterium species alter the normal maturation processes of the phagosomes following internalisation by macrophages (Barker et al, 1997) (Clemens and Horwitz, 1995; Clemens and Horwitz, 1996; Clemens, 1996; Deretic et al, 1997). Phagosomes containing live pathogenic mycobacteria exhibit reduced acidification, retaining an internal vacuolar pH of 6.2-63 (Clemens, 1996), an observation that has been linked to the exclusion or rapid removal of the vacuolar proton-ATPase from the mycobacterial containing phagosome (Sturgill-Koszycki et al, 1994). This multi-component enzyme complex is primarily responsible for acidification of intracellular compartments, including phagosomes (Sturgill-Koszycki et al, 1994). This in turn results in altered vacuolar maturation such that phagosome- lysosome fiision is blocked with phagosomes containing live bacilli retaining markers of early endosomes as well as many plasma membrane proteins (Sturgill- Koszycki et al, 1996; Clemens and Horwitz, 1996; Guerin and de Chastellier, 2000). A different situation is found upon internalisation by host macrophages that have been exposed to activating cytokines such as interferon-y, in this case the macrophage overcomes the block in maturation and delivers the bacterium to an acidic, lysosome-like vacuole (Via et al, 1998). The phagosomes of activated

86 macrophages have a lower oxygen tension than those of imstimulated phagocytes. Other implicated mechanisms in intracellular mycobacterial survival include resistance to killing by reactive oxygen and nitrogen intermediates (ROI and RNI) produced by the host cell (Fazal, 1997; Rojas et al, 1998; Flynn and Chan, 2001; Piddington et al, 2001) and modification of the lipid composition of the mycobacterial cell membrane, thereby altering its capacity to interact with immune or inflammatory cells (Fratti et al, 2001).

Following M.a.paratuberculosis entry into the mucosa of the host’s gut, via the illeal dome M cells, the microbe is taken up by sub-epithelial macrophages in which the bacillus persists and multiplies (Clarke, 1997). As such internalisation and survival of M.a.paratuberculosis in host macrophages is a vital initial component in the establishment of disease in agreement with the other pathogenic Mycobacterium spp. Recently Kuehnel et al has characterised the intracellular survival of M.a.paratuberculosis in the murine macrophage cell line J774 (Kuehnel et al, 2001). The authors demonstrated that phagosomes containing viable M.a.paratuberculosis fail to acidify retaining a pH of approximately 6.3 and persist in the phagosome as intact single microbes or in groups of multiple microbes for up to 15 days. This is in contrast to other pathogenic mycobacteria, which are thought to reside in large vacuoles containing several mycobacteria early in the infection and in small vacuoles with single organisms after 2-3 days of infection (Xu et al, 1994; Clemens, 1996). It remains unclear if this observation is significant in M.a.paratuberculosis survival and persistence in macrophages.

The identification and characterisation of the mycobacterial products that promote intracellular survival remains a priority as they represent potentially interesting targets for novel drugs and vaccines. One method of identifying bacterial genes involved in pathogenesis is to express these genes in a non-pathogenic host species and determine what affect the presence of the gene has on the intracellular survival of the bacterium in host phagocytic cells. Arruda et al identified an M.tuberculosis gene responsible for the increased ability of E.coli to invade HeLa cells (Arruda et al, 1993). More recently several groups have reported the identification of M.leprae, M.tuberculosis and M.avium genes conferring increased survival in macrophages on

87 the saprophytic M.smegmatis (Lagier et al, 1998; Wei et al, 2000; Miller and Shinnick, 2000).

The 34kDa antigen demonstrates homology to the HtrA family of bacterial trypsin like serine proteases (Cameron et al, 1994). Disruption of the htrA gene in numerous pathogenic bacteria, including Yersinia enterocolitica. Salmonella enterica serovar typhiumurium. Brucella abortus and Legionella pneumophila, results in decreased rates of survival for the mutant bacteria in cultured macrophages relative to wild-type bacterial controls (Baumler et al, 1994; Elzer et al, 1996; Yamamoto et al, 1996; Pedersen et al, 2001). The 34kDa antigen may play an analogous role in M.a.paratuberculosis survival in the hostile environment of the host macrophage. In agreement with this hypothesis, the protein is expressed in vivo by M.a.paratuberculosis during the course of infection eliciting a strong antibody response in animals presenting with clinical disease (Cameron et al, 1994). If the 34kDa putative serine protease represents an important virulence determinant of M.a.paratuberculosis then expression in a saprophytic host strain, may alter the survival of the host microbe in macrophages as has been demonstrated for other genes implicated in the survival of pathogenic mycobacterial strains in macrophages. The work presented in this chapter attempted to elucidate what affect the expression of the 34kDa putative serine protease had on the survival of M.smegmatis in ex-vivo ovine alveolar (OA) macrophages. Attempts were also made to demonstrate the presence of the protein in macrophages infected with M.smegmatis mc^l55 expressing the 34kDa putative serine protease.

88 4.2 Materials and Methods 4.2.1 Harvesting of OA macrophages from adult ewes At post mortem the trachea was clamped before removal of the lungs from adult ewes to avoid contamination with blood. The lungs were filled with approximately 1/ of sterile PBS, massaged gently and the lavage fluid recovered by pouring through sterile gauze into a sterile centrifuge bottle. Lavage fluids that showed signs of discoloration with blood were discarded. Cells were harvested by centrifugation at 1,200 X g- for 10 min at room temperature and washed three times in Hank’s basic salt solution (HBSS- l,3mM CaClz, 5.4mM KCl, 0.5mM KH 2 PO4 , 0.8mM MgS 0 4 ,

136.9mM NaCl, 0.34mM Na 2 HP0 4 , 5.6mM D-glucose, 0.03M phenol red) supplemented as follows; 2% (%) FBS, lOU/ml preservative-free heparin (Sigma- Aldrich), 4 pg/ml amphotericin B (Sigma-Aldrich), 100 U/ml penicillin (Invitrogen life sciences), 100 pg/ml Streptomycin (Invitrogen life sciences) and 50 pg/ml gentamicin sulphate (Invitrogen life sciences). Recovered cells were counted using a 1% C^/y) Nigrosine stain, the cell density adjusted to 1 x 10^ macrophage cells/ml and cryopreserved in 1ml vials (Invitrogen life sciences) in a mixture of RPMI containing 50% (%) FBS and 10% (^/y) dimethyl sulphoxide (DMSO) (Sigma- Aldrich).

4.2.2 Preparation of OA-macrophage for infection with mycobacteria OA macrophages were resuscitated from liquid nitrogen storage as follows; 7 ml of pre-warmed (37°C) RPMI-1640 medium (Life Technologies) supplemented as follows; 10% (7v) heat-inactivated foetal calf serum (FCS) (Life Technologies), 2.5M HEPES (N-[2-Hydroxyethyl]piperazine-N’-[2-ethanesulphonic acid]), 2mM glutamine, 8 % (%) sodium bicarbonate and 50pg/ml gentamicin, referred to as OA- macrophage complete-RPMI (complete OA-RPMI) medium was added to 1ml of freshly thawed OA macrophages, the cells harvested by centrifugation at 800 rpm for 5 min at room temperature. The OA macrophages were re-suspended in 15ml of complete OA-RPMI and cell viability determined using a 1 % (^/y) Nigorsine stain. The cell density was adjusted to the required density in complete OA-RPMI medium and seeded in 24 well tissue culture plates. The cells were incubated overnight at

37°C with 5% CO 2 to allow adherence of OA macrophages to the bottom of each well.

89 4.2.3 Preparation of mycobacterial inoculum for OA-macrophage infection a) M.smegmatis For infection of macrophages, a fresh culture of each M.smegmatis (ODeoo 0.4-0.5) strain was diluted Vio in fresh pre-warmed (37°C) 7H9^ broth (Appendix 3) supplemented where appropriate with 30 pg/ml kanamycin and incubated at 37°C with shaking at 200 rpm to an ODeoo of 0.4-0.5 (approx. 1 x 10^ mycobacteria/ml). The culture was diluted in antibiotic-free complete OA-RPMI to yield a final concentration of 1 x 10^ mycobacterial cells/ml. Microscopy confirmed that the cultures contained many single bacteria. The inoculum was serially diluted in PBS, and inoculated onto 7H11-S medium (Appendix 3) supplemented where appropriate with 30 pg/ml kanamycin and incubated at 37°C for 3-4 days to determine the retrospective viable count. b) M.a.paratuberculosis For infection of OA macrophages, M.a.paratuberculosis cells were scraped from the surface of 7H11+ medium (Appendix 3) and transferred to 5 ml of PBS and vortexed to obtain a cell suspension. The mycobacterial cell suspension was left standing at room temperature for 10-15 min, allowing the clumps of bacteria to settle to the bottom of the tube. The upper cell suspension was carefully removed, the McFarland reading was noted using a Densimat and the cells adjusted to a McFarland 2 in PBS. The culture was diluted in antibiotic-free complete OA-RPMI to yield a final concentration of approximately 1 x 10^ mycobacterial cells/ml. Microscopy confirmed that the cultures contained many single bacteria. The inoculum was serially diluted in PBS, and inoculated onto 7 H 1 1 + medium at 37°C for 8-10 weeks to determine the retrospective viable count.

4.2.4 Mycobacterial infection of OA macrophages OA macrophages were seeded in 24 well tissue culture plates as described in section 4.2.2. Following overnight adherence, OA macrophages were washed twice in sterile PBS and antibiotic-free complete medium containing M.a.paratuberculosis (see section 4.2.3-2) or M.smegmatis (see section 4.2.3-1) at a concentration of 1 x 10^ was added to triplicate wells. After incubation for 4 hr (becoming time zero) at 37°C and 5% CO 2 , macrophage cells were washed three times with PBS to remove

90 extracellular particles, and complete OA-RPMI medium (see section 4.2.2) added. At 0, 24, 48 and 72 hr post infection the media was removed, the macrophages were washed twice with sterile PBS and 1 ml of distilled water was added to each well and incubated for 30 min at 37°C. The macrophage cell lysate was recovered, serially diluted in sterile PBS and plated on 7H11-S medium supplemented where appropriate with 30 pg/ml kanamycin for M.smegmatis or 7H11+ medium for M.a.paratuberculosis. Mycobacterial cultures were incubated at 37°C for 2-3 days {M.smegmatis) or 8-10 weeks {M.a.paratuberculosis) and colonies counted. The number of recovered organisms was expressed as CFU/ml of macrophage lysate.

4.2.5 Maintenance of J774A.1 macrophage-like cell line The preparation, infection and immuno-fluorescence staining procedures of both J774A.1 and bovine derived blood mononuclear cells was performed using the protocols and facilities of Prof. Peter Valentin-Wiegand and Prof. Gerald Gerlach at the Institut fur Mikrobiologie und Tierseuchen, Tierarztliche Hochschule, Bischofsholer Damm 15, D30173 Hannover, Germany. Similarly, while the infection and fixing of macrophages for immuno-electron microscopy (hnmuno-EM) was conducted at the above institute the subsequent embedding, sectioning and analysis of infected macrophage cells was performed by Dr. Manfred Rhode at the Beriech Mikrobiologie der Gesellschaft fur Biotechnologische Forshung (GBF), Braunschweig, Germany.

The mouse macrophage cell line J774A.1 (Ralph et al 1975) was maintained in Dulbecco’s modified Eagle medium (DMEM) supplemented as follows: 10% (%) heat-inactivated foetal calf serum, 1% (%) glutamine (Sigma-Aldrich), 100 U/ml penicillin (Sigma-Aldrich), 100 pg/ml streptomycin (Sigma-Aldrich) (referred to as complete J774A.1 medium;) at 37°C and 5% CO 2 . For infection experiments, the cells were maintained in antibiotic-free complete J774A.1 medium for 48 h and grown to confluency or seeded on glass cover-slips and grown to semi-confluency.

91 4.2.6 Preparation of mycobacterial inoculum for J774A.1 macrophage infection a) M.smegmatis For infection of macrophages with M.smegmatis strains, a fresh culture of each M.smegmatis (ODeoo 0.4) strain was diluted Vio in fresh pre-warmed (37°C) media supplemented where appropriate with 30 pg/ml kanamycin and incubated at 37°C with shaking at 200 rpm to an ODeoo of 0.4-0.6. M.smegmatis strains were diluted to an ODgeo of 0 . 1 in antibiotic free complete J774A.1 medium for infection. Microscopy confirmed that the cultures contained many single bacteria. b) M.a.paratuberculosis For infection of macrophages, M.a.paratuberculosis cells were harvested by centrifugation at 1,000 x g and re-suspended in 5ml of antibiotic free complete J774A.1 medium. Homogenisation of the mycobacteria was performed as described by Silver et al 1998. Briefly, bacterial suspensions were vortexed in the presence of glass beads (3mm diameter) for 5 min and centrifuged for 5 min at 50 x g. M.smegmatis strains were diluted to an ODôôo of 0.1 in antibiotic free complete J774A.1 RPMI for infection. Microscopy confirmed that the resulting supernatant contained many single bacteria.

4.2.7 .Sadight™ LIVE/DEAD® determination of mycobacterial viability Viability of mycobacterial cultures was determined using the LIVE/DEAD ^acLight Bacterial viability assay (L7007; Molecular Probes) as per the manufacturer’s instructions. Briefly, 50 pi of the mycobacterial culture suspension to be tested was centrifuged at 11,600 x g for 3 min. The supernatant was discarded and the bacterial cells re-suspended in 100 pi of colour solution [a 1:1 mix of Solution A (1.67 mM SYTO dye and 1.67 mM propidium red in anhydrous DMSO; Molecular Probes) and Solution B (1.67 mM SYTO 9 Dye and 18.3 mM propidium iodide in anhydrous DMSO; Molecular Probes)]. The cells were left at room temperature for 15 min and then centrifuged at 11,600 x g for 3 min. The supernatant was discarded and the bacterial pellet was resuspended in 1 0 0 pi distilled water and re-centrifuged at

11,600 X g for 3 min. The pellet was then resuspended in a final volume of 25pi sterile distilled water. Five pi of labelled mycobacterial suspension was placed on a clean microscope slide, covered with a sterile cover-slip and sealed using nail polish.

92 Samples were examined microscopically using a Leica DML microscope equipped with an N2.1 filter system. For infection of J774A.1 macrophage-like cells, bacterial suspensions from M.a.paratuberculosis contained between 70-80% viable bacteria, those from M.smegmatis contained ~95%.

4.2.8 Mycobacterial infection of J774A.1 macrophage-like cell line For the infection of J774A.1 macrophages with M.smegmatis or M.a.paratuberculosis, J774A.1 macrophages were seeded as described in section 4.2.5. After 48 h in culture, the macrophages were washed twice with sterile PBS and antibiotic-free complete medium containing M.a.paratuberculosis or M.smegmatis

(see section 4.2.6) added and incubated for 2 hr at 37°C and 5% CO 2 . J774A.1 macrophages were washed three times with sterile PBS to remove extracellular particles, and Dulbecco’s modified Eagle medium (DMEM) supplemented as follows: 10% (7v) heat-inactivated FCS, 1% (7v) glutamine and 50 pg/ml gentamicin was added.

4.2.9 Preparation of infected J774A.1 macrophage cells for Immuno fluorescence microscopy For the preparation of infected macrophages for immuno-fluorescence microscopy, J774A.1 macrophages were seeded onto glass cover-slips in 24 well tissue culture plates (Life Technologies) as described in section 4.2.5. The macrophages were infected with M.smegmatis and M.a.paratuberculosis as described in section 4.2.8. At each experimental time point, residual medium was removed by washing with sterile PBS and the macrophages were fixed with a solution of 0.37% (7v) formaldehyde in PBS (100 pl/well) for 5 min at room temperature. The macrophages were washed twice in sterile PBS and permeabilised in 0.1% (Vy) Triton-X 100 in PBS at room temperature for 15 min, followed by a further three washes in PBS. Primary antibody, Hybridoma supernatant (section 2.9.1), was added and incubated at 37°C in a humidified chamber for 45 min followed by three washes in PBS. Secondary antibody, FITC conjugated goat anti-mouse IgG (DAKO Ltd.) diluted V iooo in PBS, was added and incubated at 37°C for 45 min, followed by three washes in PBS. Finally, each cover-slip was mounted upside down in Mowiol on a clean microscope slide and sealed with nail polish. The slides are then stored at 4°C in the

93 dark until analysed. Samples were examined microscopically using a Leica DML microscope equipped with an N2.1 filter system.

4.2.10 Preparation of infected J774A.1 macrophage cells for Immuno-electron microscopy (Immun-EM) For the preparation of infected macrophages for immuno-electron microscopy,

J774A.1 macrophages were seeded in 6 -well tissue culture plates (Life Technologies) as described in section 4.2.5, followed by infection with M.smegmatis and M.a.paratuberculosis as described in section 4.2.8. At each experimental time point residual medium was removed by washing with PBS and macrophage cells were carefully removed from the bottom of each well, using a rubber policeman. The macrophage cell suspension was transferred to a sterile 1.5 ml eppendorf tube, centrifuged at 2,000 x g for 3 min and re-suspended in 500 pi of 10 mM HEPES. The macrophage cells were again harvested by centrifugation at 2,000 x g for 3 min and fixed in a solution containing 3 % (7y) glutaraldehyde and 5 % (7y) formaldehyde in 10 mM HEPES on ice for 1 hr. Macrophage cells were harvested by centrifugation and washed in a solution containing 10 mM HEPES and 10 mM Glycine in PBS. Finally, macrophage cells were re-suspended in 1 ml of a solution containing 10 mM HEPES and 10 mM Glycine in PBS and stored at 4°C prior to preparation for sectioning. Samples were dehydrated with a graded series of ethanol solutions (10, 30, 50, 70, 90, 100%) on ice and infiltrated with the acrylic resin LRWhite (1 part ethanol / 1 part resin over night; 1 part ethanol / 2 parts resin, 8 h; pure resin for 1 day with several changes). Polymerisation of the resin was carried out at 60°C for 24 h. Ultrathin sections were cut with a diamond knife and the sections were collected using formavar coated grids. Grids were placed onto drops of primary antibody (Protein A purified monoclonal antibody; section 2.2.9) and incubated at 4°C overnight. After washing the grids with PBS the bound antibodies were visualised by floating the grids on drops of a Vioo dilution of the stock solution of 10 nM protein A-gold complexes (British Biocell). After several washing steps with PBS containing 1% (^/y) Tween 20, grids were rinsed in water and air-dried. Counter-staining was performed with aqueous uranyl acetate for 5 min. Samples were examined in a Zeiss transmission electron microscope EM910 at an acceleration voltage of 80 kV and at calibrated magnifications.

94 4.2.11 ProteinChip array detection of the 34kDa putative serine protease Ciphergen Biosystems ProteinChip® System comprises a ProteinChip reader, (a laser desorption/ionisation time-of-flight mass spectrometer) and a ProteinChip array to analyse peptides and proteins from complex biological samples. a) ProteinChip® analysis of biological samples The analysis of biological samples for the presence of the 34kDa putative serine protease was achieved using the ProteinChip® system (Ciphergen Biosystems, Inc.) as per the manufacturer’s instructions. Briefly, the pre-activated chip (NPl or SAX2) was placed in a humidity chamber and the chemical surfaces of the 6 spots on each chip pre-equilibrated by the application of 2 pi PBS to each spot. The PBS was carefully removed by pipetting and 1 pi of sample (mycobacterial cell lysate; section 2.6 or infected OA-macrophage lysate; section 4.2.4) was added to each spot, and incubated for 1 h in the humidity chamber at room temperature or at 4°C overnight. Residual spot activity was blocked by the addition of 3 pi of 1 M ethanolamine in PBS, pH 8.0 and incubated for 30 min at room temperature in the humidity chamber. Unbound protein was removed by washing the chip in 7 ml PBS supplemented with 0.5% (^/y) Triton X-100 with gentle shaking at room temperature for 15 min. This was followed by 3 washes in PBS at room temperature with gentle shaking for 5 min and one wash in 15 ml distilled water (HPLC-grade; Amicon-Millipore) and the ProteinChip® allowed to air dry. Finally, 0.5 pi saturated Sinapinic Acid Energy Absorbing Matrix (EAM) (Ciphergen Biosystems, Inc., P/N 4003-1001) (final concentration 25 mg/ml in 99.8% Acetonitrile, 1.0% TEA), referred to as EAM solution was added to each spot and allowed to air dry, a further 0.5 pi of EAM was added and similarly allowed to air dry. The chip was analysed in a ProteinChip® Reader (series PBS II; Ciphergen Biosystems, Inc.), with the data collection parameters of the spot protocol adjusted for the molecular weight of the target antigen. b) ProteinChip® antibody-capture analysis of biological samples The immunological detection of the antigen of interest from crude samples derived from in vitro or in vivo experimental models, was achieved using the ProteinChip®

95 Antibody Capture Kit (Part Number K100-0005: Ciphergen Biosystems Inc.) as per the manufacturer’s instructions. Briefly, 2 pi of each antibody preparation (0.2 mg/ml Bovine IgG in PBS; Spot A, 0.2 mg/ml goat anti-human TNF-a polyclonal antibody in PBS; Spot B, Hybridoma supernatant (see section 2.9.1): Spots C-E, and Protein A purified Anti-34kDa putative serine protease monoclonal antibody (see section 2.9.2): Spots F-H) were added to the PG20 array (PG20 ProteinChip® Array are PS20 protein chip arrays coupled to Protein G; Ciphergen Biosystems, Inc.), transferred to a humidity chamber and incubated for 1 h at room temperature, or overnight at 4°C. The antibody preparation was carefully removed by pipetting from each spot and the array was washed once in 15 ml of a solution containing 0.5% Triton X-100 in PBS (referred to as Wash Buffer) for 10 min at room temperature, followed by 2 X 5 min washes in PBS. Antibodies were cross-linked to the array for 30 min at room temperature in a humidity chamber in a solution containing 0.5 mg/ ml Bis(sulfosuccinimidyl) (BS3) in PBS, followed by deactivation of the cross linking reagent in 0.5 M Ethanolamine in PBS, pH 8.0. The chip array was washed once in Wash Buffer for 10 min at room temperature, followed by 2 x 5 min washes in PBS with gentle agitation. Diluted TNF-a (100 fM) in PBS was added to spots A and B, 2 pi of protein sample of interest (mycobacterial cell lysates: section 2.6 or infected OA-macrophage lysate: section 4.2.4) was added to the remaining spots and incubated in a humidity chamber for 1 h at room temperature or overnight at 4°C. The array was washed once in Wash Buffer for 10 min with agitation at room temperature, followed by two 5 min washes in PBS with agitation. The chip was then rinsed three times in 1 mM HEPES and allowed to air-dry for 10 min. Finally, 0.5 pi of EAM solution was added to each spot on the array and allowed to air dry, a further 0.5 pi of EAM was added and similarly allowed to air dry. The chip was then analysed in a ProteinChip® reader, with the data collection parameters of the spot protocol adjusted for the molecular weight of the target antigen.

4.2.12 Statistical analysis All data generated from the OA-macrophage experiments was analysed by ANOVA, regression analysis and Students T-test, performed using the MINITAB"^^ Statistical Software package Release 13.1.

96 4.3 Results 4.3.1 Ex-v/v

Initially, Qx-vivo OA macrophages were seeded in 24 well tissue culture well plates at a concentration of 10^ macrophages/well (see section 4.2,2). The macrophages were infected with M.smegmatis mc^l55 control untransformed cells and M.smegmatis mc^l55 harbouring the plasmid pMRI34 {M.smegmatis pMRI34 see section 3.3.6) using a multiplicity of infection (MOI) of 1:1 (section 4.2.3 and section 4.2.4).

The calculated colony forming (CPU) units recovered at each time point decreased appreciably over the course of the experiment for each group, demonstrating that the

Q X -vivo OA macrophages were capable of killing substantial numbers of ingested mycobacteria over 48 hours in culture (Figure 4.1). The mean bacterial counts recovered at 24 hours post infection appeared greater for M.smegmatis pMRI34 than for the wild type control, although this was not statistically significant. Suggesting that the presence of the 34kDa putative serine protease in M.smegmatis mc^l55, while not completely preventing bacterial killing by the host macrophage did enhance bacterial survival over the first 24 hours of infection compared to untransformed control M.smegmatis mc^l55 (Figure 4.1). The increase in survival of M.smegmatis mc^l55 based on the expression of the 34kDa putative serine protease also was evident in a repeat experiment. However while these results were encouraging they were confounded by high levels of variation seen in both experiments between triplicate wells for each of the two strains of M.smegmatis. Similarly, the low numbers of organisms recovered at 48 hours post infection prevented any firm conclusions being made regarding the long-term affect of the 34kDa putative serine protease on M.smegmatis survival.

97 9000 □ pMRI34 8000

7000 □ Control

6000

5000

4000

3000

2000

1000

0 24 48 Time (hours)

Figure 4.1 Initial experiment comparing the survival of M.smegmatis pMRI34 (Blue) versus M.smegmatis mc^l55 (Wine) control cells in OA macrophages (derived from Animal A, 643G). Macrophages were seeded at a cell density of 10^ cells/well and infected with either M.smegmatis pMR134 or M.smegmatis mc^l 55 using a MOI of 1:1 (section 4.2.4). Mean values for triplicate wells are presented plus and minus the standard deviation.

98 4.3.2 Optimisation of the ex-v/vo OA macrophage survival assay While the exact source of the variation was not known, several constituent components of the system were systematically investigated as potential sources of variation. Originally, 10^ macrophages were added to each well and allowed to adhere overnight, non-adherent cells were removed by washing as described in section 4.2.2. Following overnight incubation the ovine macrophages appeared as a densely packed monolayer. By 24 hours post infection a substantial proportion of the macrophages in each well were no longer viable, characterised by the loss of the adherent phenotype and the presence of cellular debris in the culture media, with a greater loss of cells observed at 48 hours. OA macrophage loss also was seen for the control uninfected macrophages suggesting that the observed macrophage death was not a result of cytotoxicity due to the presence of ingested M.smegmatis but may have been a function of the OA macrophage cell density prior to infection.

In an attempt to address the question of macrophage cell density affecting the long term viability of the macrophage cells in culture, the seeding density was lowered to 10^ macrophages per well and the macrophages allowed to adhere overnight (section 4.2.3). Immediately prior to infection the adherent macrophage population for each well presented as a sub-confluent monolayer of macrophage cells with less crowding observed by microscopic examination of cultures. OA macrophage where then infected with M.smegmatis pMRI34 and M.smegmatis mc^l55 control cells with an MOI of 1:1 (section 4.2.4). At each experimental time point, the macrophage cultures were microscopically examined using a light microscope, no significant loss of macrophage viability was observed for experimental or control macrophage cultures. The recovered CFU counts for each well retained a level of variation but this variation was substantially lower than observed previously (Figure 4.2). No significant difference was observed at time 0 between the M.smegmatis pMRI34 and control cells (p-value = 0.463). At 24 hours post infection, a statistically significant increase in the number of recovered M.smegmatis pMRI34 compared to M.smegmatis controls is observed (p-value = 0.0124: Figure 4.2), supporting the earlier results (section 4.3.1) that the presence of the 34kDa putative serine protease increases the survival of M.smegmatis over the first 24 hours of infection. The number of recovered organisms at 48 hours, where no M.smegmatis control cells

99 1600

□ pMRI34 1400

□ Control 1200

1000

P fa 800 u

600

400

200 — Î— T 0 24 48 Time (hours)

Figure 4.2 Comparison of M.smegmatis pMRI34 (Blue) and M.smegmatis me 155 (Wine) survival in sheep ovine macrophages. OA macrophages derived from animal 643G (Animal A) were seeded at a cell density of 10^ macrophages/well and infected with either M.smegmatis pMRI34 or M.smegmatis mc^l55 using a MOI of 1:1 (section 4.2.4). Mean values for triplicate wells are presented plus and minus the standard deviation.

1 0 0 were recovered, prevented any meaningful determination of the longer-term affect of the 34kDa putative serine protease on M.smegmatis.

A MOI of 1:1 in the earlier experiments resulted in low bacterial counts at 24 and particularly 48 hours, due to the high level of bactericide observed over the experimental time course. An increase in the MOI was examined, namely 10:1 and 50:1, over 24 hours of infection to determine if an increase in the MOI resulted in increased bacterial counts at all time points. Infection with an MOI of 50:1 resulted in macrophage cytotoxicity as few adherent cells remained after 24 hours for both M.smegmatis mc^l55 and M.smegmatis pMRI34. Control uninfected macrophages remained viable over the same time period. No significant loss of macrophage viability was observed over the same time course when a MOI of 10 was used. The calculated CFU counts for each strain using a MOI of 10 at 0 and 24 hours post infection demonstrated a similar trend to the results seen with an MOI of 1:1. No statistically significant differences were observed at 0 hours post infection for both a MOI of 10 and 1 between M.smegmatis pMRI34 and M.smegmatis mc^l55. A significant difference in recovered CFU counts was observed between the recombinant M.smegmatis pMRI34 and M.smegmatis mc^l55 strains at 24 hours (p- value = 0.028) using a MOI of 10 (p-value = 0.028) and 1 (p-value = 0.012) (Figure 4.3 and Figure 4.4).

Another important consideration in the optimisation of the OA macrophage survival assay was variation in experimental results dependant on the animal from which the OA macrophages were harvested. In an attempt to address whether or not the source of OA macrophages affected the observed trends, identical experiments comparing different MOI as described above were conducted in OA macrophages derived from a second source (Animal B; 1148G). A MOI of 50:1 resulted in a substantial loss of macrophage cell viability for both M.smegmatis pMRI34 and M.smegmatis mc^l55. Greater numbers of both M.smegmatis pMRI34 and M.smegmatis were recovered from the OA macrophages derived from Animal B at all time points using both a MOI of 1:1 and 10:1 than observed with OA macrophages derived from Animal A (Figure 4.5 and 4.6). This did not appear to affect the overall trend of decreased mortality for M.smegmatis pMRI34, a significant difference in recovered CFU

1 0 1 2200 □ pMRI34 2000

1800 □ Control

1600

1400 p 1200 fa ^ 1000

800

600

400 200 0 0 24

Time (hours)

Figure 4.3 Comparison of M.smegmatis pMRI34 (Blue) and M.smegmatis me 155 (Wine) survival in OA macrophages. OA macrophages derived from animal 643G (Animal A) were seeded at a cell density of 10^ macrophages/well and infected with either M.smegmatis pMRI34 or M.smegmatis mc^l55 using a MOI of 1:1 (section 4.2.4). Mean values for triplicate wells are presented plus and minus the standard deviation.

1 0 2 30000 □ pMRI34

□ Control 25000

20000

P ufa 15000

10000

5000 — ±— T i

24 Time (hours)

Figure 4.4 Comparison of M.smegmatis pMRI34 (Blue) and M.smegmatis me 155 (Wine) survival in OA macrophages. OA macrophages derived from animal 643G (Animal A) were seeded at a cell density of 10^ macrophages/well and infected with either M.smegmatis pMR134 or M.smegmatis mc^l55 using a MOI of 10:1 (section 4.2.4). Mean values for triplicate wells are presented plus and minus the standard deviation.

103 5000

4500 □ pMRI34

4000 □ Control 3500

3000 P k 2500 U 2000

1500

1000

500 0 0 24 Time (hours)

Figure 4.5 Comparison of M.smegmatis pMRI34 (Blue) and M.smegmatis me 155 (Wine) survival in OA macrophages. OA macrophages derived from animal 1148G (Animal B1 were seeded at a cell density of 10^ macrophages/well and infected with either M.smegmatis pMRI34 or M.smegmatis mc^l55 using a MOI of 1:1 (section 4.2.4). Mean values for triplicate wells are presented plus and minus the standard deviation.

104 50000

45000 □ pMRI34

40000 □ Control 35000

30000 P fa 25000 U 20000

15000 — ^— 1 10000 I 5000

0 0 24 Time (hours)

Figure 4.6 Comparison of M.smegmatis pMRI34 (Blue) and M.smegmatis me 155 (Wine) survival in OA macrophages. OA macrophages derived from animal 1148G (Animal B) were seeded at a cell density of 10^ macrophages/well and infected with either M.smegmatis pMRI34 or M.smegmatis mc^l55 using a MOI of 10:1 (section 4.2.4). Mean values for triplicate wells are presented plus and minus the standard deviation.

105 counts was observed between M.smegmatis pMRI34 and wild-type M.smegmatis mc^l55 strains at 24 hours post infection using a MOI of 10 (p-value = 0.007) and 1 (p-value = 0.023). No statistical differences were observed between the two strains at 0 hours post infection.

M.smegmatis pMRI34 recovered from macrophages were grown on 7H11S media supplemented with and without kanamycin with no difference in the calculated CFU observed, suggesting that kanamycin is not required for plasmid stability in vitro. The antibiotic Gentamicin (final concentration 50pg/ml) was included in the post infection media to prevent growth of bacteria prematurely released from macrophages during the course of infection. It remained possible that any increase in survival observed for M.smegmatis pMRI34 was as a result of increased resistance to gentamicin. M.smegmatis pMRI34 and M.smegmatis control cells were grown in complete OA-RPMI culture media supplemented with 50, 5 or 0.5pg/ml gentamicin. In comparison to wild type M.smegmatis, M.smegmatis pMRI34 exhibited no increased resistance to gentamicin at any of the concentrations tested.

4.3.3 Survival of M.smegmatis pMRI34 in ex-vivo OA macrophages Having established a more robust OA macrophage survival assay the effect of the 34kDa putative serine protease on M.smegmatis mc^l55 could be more accurately determined. It was considered that wild-type M.smegmatis mc^l55 was not a sufficiently representative control for M.smegmatis pMRI34. The increased survival for M.smegmatis pMRI34 might be due to the expression of a non-endogenous gene in M.smegmatis, irrespective of what that gene encoded, and would not represent an affect of the presence of the 34kDa putative serine protease. Similarly the electroporation and subsequent antibiotic selection of recombinant M.smegmatis mc^l55 may have altered the microbe sufficiently to account for any observed intracellular increase in survival. Experiments were conducted comparing infection of OA macrophages between wild type M.smegmatis mc^l55, M.smegmatis pMRI34 and M.smegmatis pMRI107. M.smegmatis pMRI107 harbours a similar plasmid to that in M.smegmatis pMRI34, except that pMRI107 expresses a mutant form of the Aequorea victoria GFP protein, namely E-GFP, under the transcriptional and translational control of the hsp60 promoter (Appendix 2 and section 3.3.4c).

106 OA macrophages (10^ macrophages/well) derived from Animal A were infected with untransformed M.smegmatis mc^l55, M.smegmatis pMRI34 and M.smegmatis pMRIlO? with an MOI of 10 (section 4.2.4). The experiment was repeated at total of three times on different days with the results presented as the mean values for the triplicate wells in triplicate experiments. A consistent reduction in the recovered CFU for all strains was observed over the course of infection, particularly at the later time points, with few bacteria recovered for all strains. In order to facilitate a greater comparison between the various strains over time, the calculated CFU, which followed a normal distribution, were normalised using a logarithmic transformation. It can be seen from the interaction plot (Figure 4.7) that the calculated mean counts for M.smegmatis mc^l55 and M.smegmatis pMRI107 are higher at time 0 than M.smegmatis pMRI34 but have become lower by 24 hours and remain so until the end of the experiment. From 24 hours onwards the relationship between the calculated counts (expressed on a logarithmic scale) and time is approximately linear (Figure 4.7). A regression analysis (see section 4.2.12) confirmed that the estimated slope of each linear relationship was similar after 24 hours for both M.smegmatis pMRI34 and M.smegmatis pMR107:

M.smegmatis (pMRI34) = (-0.05995) +/- 0.007091 M.smegmatis (pMRI107) = (-0.05369) +/- 0.006275 (p-value = 0.258764; see section 4.2.12)

In this case the slope of the line represents the rate at which the internalised mycobacteria are being killed over the experimental time period examined, reflected in the magnitude and negativity of the returned value in each case. The rate of mortality was slightly different for M.smegmatis mc^l55, although the low numbers of organisms recovered at 72 hours post infection may have led to an overall skew in the mortality rate for that strain. The main difference in the behaviour of the three strains appeared to be during the first 24 hours post infection (Figure 4.7). The data for the first 24 hours of the infection was re-analysed, in an attempt to determine the exact nature of the observed trend. Regression analysis again was utilised to estimate

107 12

pMRI34 10 pMRllOT Control o> 2

e p fl

âo

24 48 72 Time (hours)

Figure 4.7 Comparison of M.smegmatis pMRI34 (Purple), M.smegmatis pMRI107 (Yellow) and M.smegmatis mc^l55 (Pink) survival in OA macrophages. OA macrophages (10^ cells/well) were infected with M.smegmatis pMR134, M.smegmatis pMRI107 or M.smegmatis mc^l55 as described in section 4.2.4. Surviving bacteria were recovered at 0, 24, 48 and 72 hr post infection. The mean values for triplicate experiments are presented plus and minus the standard deviation.

108 the slope of the linear relationship between the mean counts for the total data set of three experiments (on a logarithmic scale) and time for each group;

Sample Estimated slope Standard error M.smegmatis pMRI34 -0.059 0.0076 M.smegmatis pMRIlO? -0.097 0.0077 M. smegmatis mc^ 155 -0.096 0.0099

A statistically significant difference between M.smegmatis pMRI34 and both M.smegmatis pMRIlO? (p-value = 0.0043) and M.smegmatis mc^l55 (p-value = 0.0013) was seen in the rate of mortality over the first 24 hours of infection. No difference was seen between M.smegmatis mc^l55 and M.smegmatis pMRIlO? (p- value = 0.4604). An approximately 1.6 reduction in the mortality rate was observed for M.smegmatis pMRI34 over both M.smegmatis mc^l55 and M.smegmatis pMRIlO? controls for the first 24 hours post infection.

Analysis of variance (ANOVA) on the total data for the mean counts for three experiments (on a logarithmic scale) revealed a significant level of variation across experiments for each strain. To demonstrate whether or not the observed trend was consistent each experiment was analysed separately. A regression analysis was used to estimate the rate of mortality for each strain in each experiment. The results are presented in Table 4.1 (a) and (b), as can be seen in Table 4 (b) a statistically significant difference in the rate of mortality is maintained between M.smegmatis pMRI34 and both M.smegmatis pMRIlO? and M.smegmatis mc^l55 for each experiment. No significant difference was seen between the control groups in each experiment. Therefore, the experimental variation may be explained as a consequence of different CPU counts for each experiment, with each experiment retaining the observed trend of increased survival for M.smegmatis pMRI34.

109 Strain Experiment number Estimated slopes Standard Error M.smegmatis pMRI34 Experiment 1 -0.047 0.011 M.smegmatis pMRIlO? Experiment 1 -0.095 0.012 M. smegmatis mc^ 155 Experiment 1 -0.082 0.013 M.smegmatis pMRI34 Experiment 2 -0.077 0.013 M.smegmatis pMRIlO? Experiment 2 -0.118 0.014 M. smegmatis mc^ 155 Experiment 2 -0.126 0.021 M.smegmatis pMRI34 Experiment 3 -0.042 0.008 M.smegmatis pMRIlO? Experiment 3 -0.079 0.010 M.smegmatis me? 155 Experiment 3 -0.080 0.008

Table 4.1(a) Rate of mortality for M.smegmatis pMRI34, M.smegmatis mc^l55 and M.smegmatis pMRIlO? over the first 24 hours in OA macrophages. Regression analysis (section 4.2.12) was used to calculate the slope of the linear relationship between recovered CFU (logarithmic scale) and time over the first 24 hours of infection for each strain in each experiment.

1 1 0 Two way statistical comparisons Experiment T-value P-value M.smegmatis A!M.smegmatis mc^l55 Experiment 1 3.003 0.0149 M.smegmatis A!M.smegmatis pMRI107 Experiment 1 2.082 0.0459 M.smegmatisme? 155!M.smegmatis pMRIl07 Experiment 1 0.715 0.2530 M.smegmatis A!M.smegmatis mc^l55 Experiment 2 2.245 0.0373 M.smegmatis A!M.smegmatis pMRI107 Experiment 2 2.025 0.0493 M.smegmatis me? 155!M.smegmatis pMRI107 Experiment 2 0.332 0.3764 M.smegmatis A!M.smegmatis mc^l55 Experiment 3 2.871 0.0174 M.smegmatis A!M.smegmatis pMRI107 Experiment 3 3.378 0.0098 M.smegmatis me?\55!M.smegmatis pMRI107 Experiment 3 0.074 0.4717

Table 4.1(b) Two-way statistical comparison of the difference in mortality rate (slope) over 24 hours between the different strains in three experiments. Regression analysis (section 4.2.12) was used to calculate the slope of the linear relationship between recovered CFU (logarithmic scale) and time over the first 24 hours of infection for each strain in each experiment (Table 4.1b).

I l l The decreased rate of mortality observed for M.smegmatis pMRI34 is reflected further in an observed increase in the percentage surviving bacilli after 24 hours of infection, calculated on the same data as previously analysed. A significant difference in the percentage of bacteria surviving after at 24 hours between M.smegmatis pMRI34 and M.smegmatis mc^l55 (p-value=0.035) and M.smegmatis pMRIlO? (p-value=0.042) was observed, with no difference observed between the two control groups after 24 hours (p-value = 0.11) (Figure 4.8). A greater percentage of M.smegmatis pMRI34 appeared to be surviving at 48 and 72 hours post infection in comparison to controls, although no statistically significant differences were observed between any of the groups at these time points.

4.3.4 Survival of M.smegmatis pMRIus34-I iu ex-v/vo OA macrophages Another important consideration in the interpretation of the results was the use of the promoter driving the expression of the 34kDa putative serine protease in M.smegmatis. The hsp60 promoter has been demonstrated to exhibit high levels of constitutive expression both in culture and in vitro within cultured macrophages (Dellagostin et a/., 1995). There was a possibility that the observed increase in survival may have been the result of over-expression of the gene from the hsp60 promoter on a multi-copy number plasmid and not a property of the expressed protein itself. Chapter 5 describes the identification of a functional promoter in the upstream region of the 34kDa putative serine protease that is capable of expressing the gene from a mycobacterial shuttle plasmid (pMRIus341) in M.smegmatis mc^l55 {M.smegmatis pMRIus341 see section 5.3.4).

In order to test whether or not the choice of promoter used to express the 34kDa putative serine protease in M.smegmatis exerted an important influence on the observed increase in survival for M.smegmatis pMRI34, the survival of M.smegmatis pMRI34 was compared to M.smegmatis pMRIus34 I in OA macrophages. OA macrophages were infected with M.smegmatis pMRI34, M.smegmatis pMRIus34 I and the control strain M.smegmatis pMRI104 (section 3.3.4a) containing an empty plasmid construct as described in section 4.2.1 - 4.2.4. The percentage bacteria surviving at each time point was calculated based on the mean CFU counts for two independent experiments as a function of the total count calculated at time 0.

1 1 2 40

□ M.smegmatis pMRI34 35 □ M.smegmatis

30 □ M.smegmatis pMRI 107

25 s 20

24 48 72 Time (hours)

Figure 4.8 Survival of M.smegmatis pMRI34 (Blue), M.smegmatis mc^l55 (Wine) and M.smegmatis pMRI107 (Yellow) in OA macrophages. OA macrophages (10^ macrophages/well) were infected with M.smegmatis pMRI34, M.smegmatis pMRI107 and M.smegmatis mc^l55 as described in section 4.2.4. Percent survival at a given time was calculated by dividing the number of CFU recovered at that time by the number of CFU recovered at time zero and multiplying by 100. Error bars represent the standard error of the means for three replicate cultures.

113 Concordant with earlier findings, a statistically significant difference in percentage survival at 24 hours was observed between M.smegmatis pMRI34 and M.smegmatis pMRI104 (p-value = 0.012). A similar increase in percentage survival was observed fox M.smegmatis pMRIus34 I o y g x M.smegmatis pMRI104 (p-value = 0.027) (Figure 4.9). However, no difference was observed between M.smegmatis pMRI34 and M.smegmatis pMRIus34 I (p-value = 0.22) at 24 hours. At 48 and 72 hours post infection, no significant difference in the percentage-survival for any of the strains is observed (Figure 4.9). Therefore the increase in survival observed in for M.smegmatis pMRI34 in section 4.3.3 appears to be independent of the promoter used to drive expression as a similar increase in intracellular survival is seen for M.smegmatis pMRIus34 I, expressing the 34kDa putative serine protease from the endogenous upstream promoter.

4.3.5 Demonstration of the presence of the 34kDa putative serine protease in infected ex-v/vo OA macrophages a) Immuno-fluorescent microscopy and Immuno-Electron microscopy (Immuno-EM) The results of the macrophage survival studies suggested that the presence of the 34kDa putative serine protease increased the survival of M.smegmatis in OA macrophages, as such it was important to confirm the presence of the potentially secreted 34kDa putative serine protease in infected macrophages. In an attempt to demonstrate this, immuno-fiuorescence staining was performed on J774A.1 macrophages infected with M.smegmatis pMRI34, M.smegmatis pMRI104 and M.a.paratuberculosis (see section 4.2.5 - 4.2.8), and samples prepared for Immuno fluorescence microscopy as described in section 4.2.9. In two separate experiments fluorescent microscopy revealed no specific staining for the 34kDa putative serine protease above background levels using the hybridoma supernatant (see section 2.2.9) as the primary antibody, in macrophages infected with M.smegmatis pMRI34 at all experimental time points. The relative abundance of the protein in the infected macrophage samples was unknown and as a result any weak specific staining for the 34kDa putative serine protease may have been masked by the high level of

114 30 □ pMRIus34

25 □ pMRI34

□ pMRI104 20 I t 15 s

-H

24 48 72 Time (hours)

Figure 4.9 Survival of M.smegmatis in OA macrophages expressing the 34kDa putative serine protease under the transcriptional control of the hsp60 promoter or a promoter located in the upstream region of the 34kDa putative serine protease in M.a.paratuberculosis compared to M.smegmatis pMRI104 plasmid control. Ovine macrophages were infected with M.smegmatis pMRIus34 I (Blue), M.smegmatis pMRI34 (Wine) and M.smegmatis pMRI104 (Yellow) as described in section 4.2.4. Percentage survival at a given time was calculated by dividing the number of CFU recovered at that time by the number of CFU recovered at time zero and multiplying by 100. Error bars represent the standard error of the mean for two replicate experiments.

115 background staining observed for all samples, including uninfected controls. In an attempt to address this, the MOI was increased to 25:1, resulting in an increased number of ingested mycobacteria (as viewed by microscopic analysis of infected macrophages) and potentially the level of protein available for detection in infected macrophages. However, no specific staining was observed using an increased MOI for macrophages infected with M.smegmatis pMRI34 compared to controls. The level of antibody present in the hybridoma supernatant may have been too weak to detect the protein. Therefore the experiment was repeated and the J774A.1 macrophage samples were probed with the Protein A purified 34kDa putative serine protease specific monoclonal antibody (see section 2.2.9), with again no specific staining observed. Throughout all experiments no 34kDa putative serine protease antibody staining was observed for the J774A.1 macrophages containing M. a.paratuberculosis.

In a final attempt to demonstrate the presence of the 34kDa putative serine protease in situ, immuno-EM analysis was conducted on infected J774A.1 macrophages. J774A.1 macrophages were prepared and infected as described in sections 4.2.5 to 4.2.8, and samples were prepared for Immuno-EM at 0, 24 and 48 hr post infection as described in section 4.2.10. Figure 4.10 and Figure 4.11 show the presence of ingested M.smegmatis pMRI34 at 24 and 48 hr post infection. However, despite the presence of intact M.smegmatis pMRI34 at both time points, immuno-EM analysis using the purified 34kDa putative serine protease specific monoclonal antibody as the primary antibody, failed to demonstrate the presence of the 34kDa putative serine protease in J774A.1 macrophages infected with M.smegmatis pMRI34 or M. a.paratuberculosis.

116 V

Figure 4.10 Intracellular localisation of M.smegmatis pMRI34 in J774 macrophages J774A.1 were infected with M.smegmatis pMRI34 and transmission electron microscope (TEM) pictures taken after 24 hr. Degraded material is indicated by stars, bacteria are indicated by arrows. Bar = 2 pm.

117 Figure 4.11 Intracellular localisation of M.smegmatis pMRI34 in J774 macrophages J774A.1 were infected with M.smegmatis pMRI34 and a TEM picture taken after 48 hr. Degraded material is indicated by stars, bacteria are indicated by arrows. Bar = 2 pm.

118 b) ProteinChip analysis of biological samples Results presented above had failed to demonstrate the presence of the 34kDa putative serine protease in infected macrophages. Ciphergen Biosystems Inc. ProteinChip® technology allows the constitutive protein components of an in vitro or in vivo sample to be determined. Initially, mycobacterial lysates of M.smegmatis pMRI34, M.smegmatis pMRIus34 I and M.smegmatis pMRI104 (see section 2.2.7) were prepared and analysed on a ProteinChip® reader (Ciphergen Biosystems, Inc.) as described in section 4.2.11-1. As can be seen in Figure 4.12, no unique protein was detected at the appropriate molecular weight for M.smegmatis pMRI34 or M.smegmatis pMRIus34 I lysates in comparison to control M.smegmatis pMRI104 lysates. This was in spite of the fact that the 34kDa putative serine protease was detected by western immunoblotting, (see section 2.2.10) in both M.smegmatis pMRI34 and M.smegmatis pMRIus34 I lysate samples. Similar results were observed when macrophage lysates prepared at 0 hours post infection from OA macrophages infected with M.smegmatis pMRI34, M.smegmatis pMRIus34 I or M.smegmatis pMRI104 (see section 4.2.4) were tested for the presence of a specific 34kDa protein signature. The results presented in Figure 4.12 show the data range 20^0 kDa, no unique proteins were detected in M.smegmatis pMRI34 samples over the molecular weight range examined, namely 15-100 kDa.

The possibility existed that the amount of 34kDa putative serine protease present in all these samples was insufficient to allow detection above background protein levels in the samples tested. In order to address this, a ProteinChip® Antibody Capture Kit was used to analyse not only infected macrophage lysates but also mycobacterial lysates for the presence of the 34kDa putative serine protease as described in section 4.2.11. The primary antibody used was both hybridoma supernatant and also the purified 34kDa putative serine protease specific monoclonal antibody. The same set of samples was analysed with each primary antibody, namely OA-macrophage lysates infected with M.smegmatis pMRI34, M.smegmatis pMRIus34-I or M.smegmatis pMRI104 (see section 4.2.4) and mycobacterial lysates prepared from M.smegmatis pMRI34, M.smegmatis pMRIus34-I and M.smegmatis pMRI104, (see section 2.2.4). Upon analysis using the ProteinChip® reader, no unique protein was detected at the appropriate molecular weight for either macrophage lysates infected

119 with M.smegmatis pMRI34 over M.smegmatis pMRI104 samples or mycobacterial lysates derived from the same strains (Figure 4.13).

Finally, macrophage lysates prepared from OA-macrophage infected with M.smegmatis pMRI34, M.smegmatis pMRIus34-I and M.smegmatis pMRI104 (see section 4.2.4) were analysed for the presence of the 34kDa putative serine protease at 0 and 24 hours post infection using Western immunoblotting (see section 2.2.10). No 34kDa putative serine protease specific band was detected in any of the samples at any time points (results not shown). The positive control sample, M.smegmatis pMRI34 lysate, was positive for the presence of the 34kDa putative serine protease on the same blot with M.smegmatis pMRI104 lysate negative. This remained the case even when the approximately 1ml of macrophage lysate was concentrated to lOOpl using a 10,000 molecular weight cut off spin column (Amicon-Millipore) as per the manufacturer’s instructions.

1 2 0 20000 25000 30000 35000 40 000 15 r "

10 22835.2+H M.smegmatis (pMRI104) B ; 5 31756.9+H 27576.1+H 35172.0+H

0 15

22839.0+H M.smegmatis (pMRlus34) 31753.8+H B 5 27590.9+H 35208.5+H

0 15

10 22839.5+H 11 M.smegmatis (pMRI34) B 31746.2+H 5 27581.4+H 35158.3+H

20000 25000 30000 35000 40000

6 34287.0 + H

4 MYO I 2 25975.0+ H 0

20000 25000 30000 35000 40000

Figure 4.12 ProteinChip” analysis of the mycobacterial cell lysates prepared from cultures of M.smegmatis pMRI34, M.smegmatis pMRIus34-I, M.smegmatis pMRI104, as described in section 4.2.11-1. Presented is the range of proteins detected following excitation for the range 20,000 to 40,000 kDa. MYO represents the control protein sample, namely purified myoglobin

121 20000 2 5 0 0 0 30 0 0 0 3 50 00 4 0 0 0 0

0.75

0.5 31457.5+H M.smegmatis (pMRI104) 0.25

0.75

0.5 31192.8+H M.smegmatis (pMRIus34-l) | 0.25

0.75

0.5 M.smegmatis (pMR134) 0.25 31442.9+H

20000 2 5 0 0 0 3 0 0 0 0 3 50 00 4 0 0 0 0

Figure 4.13 ProteinChip® Antibody capture analysis of OA-macrophage lysates, prepared at time 0, infected with M.smegmatis pMRI34, M.smegmatis pMRIus34-l or M.smegmatis pMRI104, as described in section 4.2.11-2. Presented is the range of proteins detected following excitation for the range 20,000 to 40,000 kDa.

1 2 2 4.4 Discussion The primary stage in infection of the host by mycobacteria, including M.a.paratuberculosis, consists of infection, persistence and replication of the microbe in the hostile environment of the host macrophage. To achieve this pathogenic Mycobacterium species have the ability to withstand the bactericidal mechanisms of the host by altering the normal processing of the phagosomes where they reside and replicate. The 34kDa putative serine protease is expressed in vivo by M.a.paratuberculosis and demonstrates homology to the HtrA family of bacterial serine proteases (Cameron et al, 1994). Several intracellular pathogenic bacterial strains harbouring defined mutations in the htrA gene have been shown to exhibit decreased survival in macrophage models (Baumler et al, 1994; Elzer et al, 1996; Yamamoto et al, 1996; Pedersen et al, 2001). As such the work in this chapter attempted to answer the question of what affect expression of the 34kDa putative serine protease would have on the intracellular survival of the M.smegmatis mc^l55 in host macrophages.

To achieve this a reliable and robust macrophage survival assay was required. OA- macrophages were chosen as these cells represented a good in vitro approximation to the environment encountered by M.a.paratuberculosis during the course of natural infection. It was noted that such in vitro systems possibly do not reflect the dynamic process of natural infection where the recruitment and interaction with other cells of the host immune response may alter the environment within the macrophage. It was thought that the use of ex-vivo OA macrophages would represent as accurate a model as possible in determining the intracellular fate of recombinant and wild-type M.smegmatis mc^l55. The macrophages also represent a uniform population, as only terminally differentiated macrophages will be present on the outside of the alveoli, where they can be easily harvested by lavage.

The optimisation of the OA-macrophage assay served to reduce the overall variation observed in the initial experiments both within and between repeat experiments. Several parameters were analysed as potential sources of variation. Firstly, the plating density of the macrophages prior to adherence appeared to have an affect on the number of surviving macrophages at later time points post infection. As cell

123 morbidity also was observed in uninfected macrophage controls, the loss of macrophage viability was attributed to the density of the resulting macrophage monolayer following overnight adherence. While a low level of macrophage death in culture was expected over the course of the infection, such a substantial loss of potentially infected macrophages suggested that the counts taken at later time points were not an accurate reflection of the number of bacteria present after ingestion of the mycobacteria had taken place. A reduction in the plating density of the macrophages appeared to abrogate this affect, resulting in substantially less macrophage morbidity in culture over the experimental time course. A MOI of 10 mycobacteria was adopted as it resulted in higher recovered counts at later time points, in comparison to a MOI of 1. This facilitated a more accurate count of the number of bacteria surviving at later time points post infection. However, the recovered CFU at 72 hours post infection were consistently very low for all mycobacterial strains.

Immediately following infection the number of bacteria recovered from the OA macrophages was consistently lower for M.smegmatis pMRI34 than for M.smegmatis pMRIlO? and M.smegmatis mc^l55. The greater number of bacilli present following ingestion may have led to increased macrophage activation resulting in a corresponding increase in the ability of the macrophage to kill the internalised mycobacteria. Under this hypothesis the decrease in mortality rate observed for M.smegmatis pMRI34 is a result not of expression of the 34kDa putative serine protease in M.smegmatis, but rather an increase in the number of both control M.smegmatis strains being killed over the same time period due to an increase in the activation of the macrophages. However on average the calculated counts for M.smegmatis pMRIlO? are higher than M.smegmatis mc^l55 at 0 hours post infection, with no difference in the mortality rate observed between these groups. Similarly, a closer examination of the individual experiments revealed that a similar level of variation existed between the recovered CFU counts for the control groups at 0 hours post infection. For example, in experiment three the calculated counts for M.smegmatis mc^l55 were similar to those for M.smegmatis pMRI34 (Figure 4.14) at time 0, with higher calculated counts for M.smegmatis pMRIlOT. The rate of mortality was significantly different between M.smegmatis pMRI34 and both

124 M.smegmatis mc^l55 and M.smegmatis pMRIlO? in this experiment, Table 4.1 (a) and (b). No difference in mortality rate was observed for the controls, despite the differences between the calculated CFU counts at time 0. This argues that the observed affect of the presence of the 34kDa antigen is not due to the lower counts observed for M.smegmatis pMRI34 at time 0.

While numerous attempts were made to demonstrate the presence of the 34kDa putative serine protease in M.smegmatis pMRI34 infected macrophages all proved ultimately unsuccessful. The monoclonal antibody used for all these experiments was raised against the C-terminal portion of the protein and as such the specific epitope recognised by the monoclonal antibody may be masked or inaccessible in the native form of the protein. This may explain why no specific staining was seen in the immuno-fiuorescence, immuno-EM experiments, and also in ProteinChip® antibody capture. The failure to detect the native protein in macrophages infected with M.a.paratuberculosis supports the idea that the monoclonal antibody does not detect the protein in its native state. ProteinChip® analysis of mycobacterial lysates and infected OA-macrophage lysates also failed to demonstrate the presence of a specific protein of the appropriate size. The number of different proteins observed at approximately 30-36 kDa in all mycobacterial samples may have “masked” the presence of the 34kDa putative serine protease in those samples expressing the protein. E.coli HtrA has been shown to form a multimeric structure, the possibility therefore existed that in the native state the 34kDa putative serine protease existed in a similar multimeric form. However an examination of the broader molecular weight parameters selected in the ProteinChip® reader, failed to identify any unique protein in samples expressing the 34kDa putative serine protease. The monoclonal antibody remains a reliable indicator of the presence of the protein in western blots conducted under denaturing conditions. However large quantities of protein are required for detection, such as those present in the mycobacterial lysates. The protein was not detected on a blot of a V io o dilution of an M.smegmatis pMRI34 lysate. As the 34kDa putative serine protease undergoes auto-degradation, insufficient amounts of protein may be present in the macrophage lysates to be detected by this method. The use of a polyclonal antibody against the native 34kDa putative serine protease may prove more successful in detecting the protein in macrophages.

125 II

10.5 1

10 i pMRI34 pMRIlO?

S' Control C3 V % 9 ! .a B 8.5 "C

o 8 5 k U 7.5

6.5

24 Time (hours)

Figure 4.14 Comparison of M.smegmatis pMRI34 (Blue), M.smegmatis pMRIlOT (Purple) and M.smegmatis mc^l55 (Yellow) survival in OA macrophages (Experiment No. 3). OA macrophages (10^ macrophages/well) were infected with M.smegmatis pMRI34, M.smegmatis pMRIlO? or M.smegmatis mc^l55 as described in seetions 4.2.4. The mean values for triplicate wells (presented on a logarithmic scale) are presented plus and minus the standard deviation.

126 M.smegmatis pMRI34 demonstrated an approximate 1.6-fold increase in survival in comparison to controls during the first 24 hours of infection. While the macrophages retained the ability to kill the ingested microbe, a significant decrease in the rate of mortality was seen for M.smegmatis pMRI34 over the first 24 hours of infection. The expression of the GFP protein in M.smegmatis mc^l55 had no affect on the ability of the microbe to survive suggesting that the expression of a non-endogenous gene alone does not alter the survival of M.smegmatis mc^l55 in macrophages. Expression of the 34kDa putative serine protease appeared to have no affect on the long-term survival of M.smegmatis mc^l55 as there was no significant difference in the rate of mortality from 24 hours onwards between the different strains. This argues that the protective function of the 34kDa putative serine protease is active during the initial stages following ingestion of M.smegmatis. A similar level of increased survival was also observed when the 34kDa putative serine protease was expressed firom the putative endogenous promoter in M.smegmatis mc^l55, demonstrating that the gene is transcriptionaly active in vitro. However, it remains unknown whether or not the 34kDa putative serine protease promoter undergoes specific up-regulation in the macrophage and whether the identified promoter region is active in M.a.paratuberculosis. The use of the 34kDa putative serine protease promoter does demonstrate that the observed affect on M.smegmatis survival appears to be independent of the promoter used to drive expression.

The proposed function of HtrA-like proteins in several bacterial species is the degradation of mis-folded or damaged proteins following stress conditions, such as heat shock and oxidative stress in E.coli (Lipinska et al, 1990; Fallen and Wren, 1997; Skorko-Glonek et al, 1999) and oxidative stress in S.typhimurium and Y.enterocolitica (Johnson et al, 1991; Williams et al, 2000). While the exact role that HtrA plays in the virulence of pathogenic mycobacteria remains unknown, it is thought that its function is to prevent the aggregation of damaged proteins in the periplasm of the cell caused by the actions of the bactericidal mechanisms of the host macrophage following ingestion of the microbes (Fallen and Wren, 1997). Macrophages have been demonstrated to undergo an oxidative burst following ingestion of mycobacteria (van Furth, 1990; Rastogi, 1990; Eisenstein et al, 1994; Gordon et al, 1995), followed by the acidification of the phagosome (Schaible et al.

127 1998). The possibility therefore exists that the 34kDa putative serine protease confers on M.smegmatis an increased ability to withstand the early bactericidal mechanisms of the host cell, such as protecting the microbe from the affects of reactive oxygen intermediates (ROI) or the acidification of the phagosome. However the results would also suggest that the presence of the gene does not alter the maturation of the phagosome as the presence of the gene has no affect on the survival of M.smegmatis after 24 hours. Other mechanisms of the host cell, such as the phago-lysosome fusion may be responsible for killing the ingested mycobacteria, with the presence of the 34kDa putative serine protease having no affect on this maturation process.

In E.coli there are two HtrA paralogues, one of which DegQ is thought to be housekeeping gene (Bass et al, 1996), with a similar function to DegP (HtrA) itself, responsible for the degradation of abnormal proteins. The other paralogue, DegS, has recently been demonstrated to regulate the activity of the alternative E.coli sigma factor, (Alba et al, 2001). Miller et al demonstrated that expression of a HtrA homologue, annotated as HtrA in the TUBERCULIST web site, failed to increase the survival of M.smegmatis in macrophages (Miller and Shinnick, 2000). In these studies expression of another mycobacterial HtrA homologue the M.a.paratuberculosis 34kDa putative serine protease does increase the survival of M.smegmatis in macrophages. The possibility that the 34kDa putative serine protease is acting as a potential regulator of an alternative sigma factor, possibly regulating stress response genes required for intracellular survival is intriquing and merits further investigation.

Similar studies using M.smegmatis recombinants and/or mutants have implicated numerous M. tuberculosis, M. leprae and M.avium genes in intracellular survival. Wei et al demonstrated that M.smegmatis expressing the M.tuberculosis eis (enhanced intracellular survival) gene of unknown function on a multicopy number plasmid exhibited a 2.4 and 5.3 fold increase in survival over controls M.smegmatis cells at 24 and 48 hours post infection (Wei et al, 2000). The 42kDa Eis protein has been shown to be cell wall associated and is also released into the extracellular media. Miller et al used a co-infection assay to demonstrate enhanced survival for M.smegmatis mc^l55 expressing the M.tuberculosis genes Rv2962c and Rv2958c

128 (probable glucuronsyl transferases), Rv2220 (glutamine synthetase Al, a secreted gene in M.tuberculosis), Rv0365 and Rv2235 (hypothetical proteins of unknown function) (Miller and Shinnick, 2000). Wieles et al demonstrated that expression of the M.leprae thioredoxin-thioredoxin reductase (Tr-Trx) gene enhanced the intracellular survival of M.smegmatis in human mononuclear monocytes (Wieles et al, 1997). By screening insertional mutants of M.smegmatis, Lagier et al isolated 8 mutants with impaired ability to survive in human peripheral blood monocyte- derived macrophages and identified the M.tuberculosis gene corresponding to the mutated M.smegmatis gene for five of them (Lagier et al, 1998). The genes included: Rv3052c (probable nrdl) which is postulated to be involved in deoxynucleotide production under stressed conditions; RvOlOl which is a nonribosomal peptide synthetase that displays a strong homology with a Pseudomonas nonribosomal peptide required for the synthesis of the pyoveridine, a siderophore involved in iron uptake; Rv3420c which displays homology with the S18 ribosomal protein acetyltransferase which behaves as a heat shock protein in Chlamydia trachomatis', and Rv0497 and Rv3604c which are hypothetical conserved membrane proteins of unknown function. Expression of the M.avium pH inducible early secreted mig gene has also been demonstrated to confer an increased resistance to intracellular killing 2 days after infection (Plum et al, 1997).

It has been noted by several of the above authors that the expression of genes derived from pathogenic strains confers only a limited enhancement in survival on M.smegmatis in macrophages (Lagier et al, 1998; Wei et al, 2000; Miller and Shinnick, 2000). This is consistent with the observations presented in this chapter, with a limited enhancement seen for the presence of the 34kDa putative serine protease. Several of the identified genes are either secreted or stress response genes. Again this is consistent with the observations presented here. The initial resistance to killing by macrophages following ingestion represents a subset of the overall pathway leading to mycobacterial persistence and replication in macrophages. Taken collectively the results fi*om these and other studies reaffirm the idea that pathogenic mycobacterial species require numerous different gene products co-ordinately regulated to survive and persist in the changing environment of the host cell. As such single genes would not be expected to greatly increase the virulence of a non-

129 pathogenic mycobacterial strain. However they may offer sufficient protection in M.smegmatis mc^l55 to be measured, as is the case in these and other studies.

The interaction of the host and pathogen is a dynamic process and probably requires numerous mycobacterial gene products to maintain parity with the host bactericidal mechanisms and ultimately survive. A consistent trend of increased survival for M.smegmatis mc^l55 expressing the 34kDa putative serine protease was observed over wild type and recombinant controls during the initial stages post phagocytosis. Further experiments, primarily examining intermediate time points between 0 and 24 hours post infection may facilitate a greater understanding of the precise extent of this survival. Similarly, definitive evidence for a virulence associated role for the 34kDa putative serine protease would only be ascertained by the generation of a knock-out mutant oî M.a.paratuberculosis and the determination of the intracellular survival of the mutant strain compared to wild type.

130 CHAPTER 5

IDENTIFICATION AND CHARACTERISATION OF PUTATIVE PROMOTER ELEMENTS IN THE UPSTREAM REGION OF THE M,a.paratuberculosis 34\iD^ PUTATIVE SERINE PROTEASE ORE

5.1 Introduction Pathogenic mycobacteria such as M.a.paratuberculosis express proteins in vivo that permit the persistence and multiplication of the organism within the host resulting ultimately in the appearance of clinical disease. As such intracellular persistence depends on the co-ordinated regulation of gene expression. The primary level of gene regulation is through the modulation of the transcriptional activity from the promoter of the particular gene in question.

A number of mycobacterial promoters have been identified, of which several have been studied in detail (Sirakova et a l, 1989; Das Gupta et a l, 1993; Curcic et a l, 1994; Timm et a l, 1994a; Dellagostin et a l, 1995; Kremer et a l, 1995b; Mulder et a l, 1997; Bannantine et a l, 1997; DasGupta et a l, 1998; Mulder et a l, 1999; Verma et a l, 1999; Barker et a l, 1999; Juarez et a l, 2001; Mehrotra and Bishai, 2001). These include the promoters for the 16S rRNA genes of M.smegmatis (Ji et a l, 1994), M.tuberculosis (Kempsell et a l, 1992) and M/qprae (Sela and Clark-Curtiss, 1991); the bla gene of M.fortuitum (Timm et a l, 1994b); the ask^ gene of M.smegmatis (Narayanan et a l, 2000); the hsp60 gene of M.bovis BCG (Dellagostin et al, 1995); the ISkDa and 28kDa M.leprae genes (Dellagostin et al, 1995); the cpn60 gene of M.tuberculosis’, the 85A antigen of M.tuberculosis (Kremer et al,

1995b); the P an promoter from the 1^900 element of M.a.paratuberculosis (Gormley et a l, 1997); the three promoters responsible for transcribing the repressor-like gp71 protein of mycobacteriophage L5 (Nesbit et a l, 1995); the M.tuberculosis katG gene (Master et a l, 2001) and the M.marinum G13 promoter (Barker et al, 1999). Other studies have used transcriptional fusions of mycobacterial sequences to different reporter molecules to identify promoter activity and to detect promoters specifically

131 regulated in vivo or as result of environmental stress (Curcic et al, 1994; Gordon et a l, 1994; Barker et a l, 1998; Carroll et a l, 2000).

There are currently too few mycobacterial promoter sequences that have been transcriptionally mapped, available to create a true picture of what constitutes a consensus mycobacterial promoter. There appears to be a high degree of sequence diversity in both the -35 and -10 hexameric sequences with no true homology emerging (Bashyam gf a l, 1996; Mulder et al, 1997; Bashyam and Tyagi, 1998). A number of mycobacterial promoters have been shown to resemble the typical prokaryotic E.coli a^^-like promoter consensus sequences and were demonstrated to be transcriptionally functional in E.coli (Thomas et a l, 1992; Barietta et a l, 1992; Barker et al, 1999). In these cases, mycobacterial promoters demonstrate greater like consensus at the -10 hexamer with more diversity seen in the consensus -35 region, where no strongly conserved consensus emerges. In addition M.a.paratuberculosis promoters have been demonstrated showing greater homology to the a^^-like -35 hexamer with limited consensus homology observed for the -10 hexameric region (Bannantine et al, 1997). Several mycobacterial promoters have also been identified that show limited or weak homology to the E.coli consensus promoter (Das Gupta et al, 1993). It is difficult to create any form of a consensus sequence among the various mycobacterial promoters that have been so far characterised as many belong to specifically regulated genes and thus may not contribute towards the elucidation of constitutive gene expression in mycobacteria. Similarly most in vivo or stress regulated genes do not appear to function in E.coli and show differences in expression levels between mycobacterial species (Gordon et al, 1994; Barker et al, 1998). However as with the consensus sequence itself there appears to be a degree of variability in all these factors.

Mycobacterial promoters lacking homology to the E.coli a^^-like promoter consensus exhibit weak or no expression in E.coli (Das Gupta et al, 1993). As such M.smegmatis offers clear advantages to the use of an E.coli system that is unable to recognise many mycobacterial expression sequences (Jain et a l, 1997; DasGupta et al, 1998). M.smegmatis has been extensively used to study the transcriptional activity of mycobacterial promoters. Several different systems have been used to identify

132 mycobacterial promoters whose expression is up-regulated by environmental stimuli such as those encountered inside phagocytic host cells. These include chloramphenicol acetyltransferase (CAT)-based vectors (Das Gupta et al, 1993), lacZ vectors (Barietta et al, 1992; Timm et al, 1994a and 1994b) and GFP vector systems (Dhandayuthapani et a l, 1995; Kremer et a l, 1995a; Via et a l, 1998; Barker et al, 1998; Luo et a l, 2000; Cowley and Av-Gay, 2001) coupled to fluorescent activated cell sorting (FACS) with and without the counter selective properties of the B.subtilus SacB protein (Triccas et a l, 1999; Triccas et a l, 2001).

Mycobacterial promoters have been shown to have similar levels of expression in different mycobacterial species, namely between M.bovis BCG, M.tuberculosis and M.smegmatis (Bashyam et al, 1996; Bashyam and Tyagi, 1998). This suggests that the basic transcriptional machinery of these mycobacterial species share determinants of transcriptional specificity in common. The authors do point out that this may only be true for constitutive promoters and may not be true for genes that are specifically regulated. In contrast some mycobacterial promoters exhibit different activities in different mycobacterial host species. This may reflect a general differential requirement for gene products by different mycobacterial species, reflected in the differences in promoter recognition and expression patterns between species.

Sigma factors (g ) combine with the basic RNA polymerase core enzyme to direct transcription, the unique affinity of different sigma factor for the particular promoter consensus sequence is an essential component in many gene regulation systems. The M.tuberculosis genome contains genes encoding 13 putative a factors belonging to the major G^^-like class of sigma factors (Doukhan et a l, 1995; Fernandes et a l, 1999; Michele et a l, 1999; Manganelli et a l, 1999; Hu and Coates, 2001). sigA is presumed to encode the major a factor in mycobacteria, as it was demonstrated to be essential m M.smegmatis (Gomez et a l, 1998). Manganelli et al identified three heat shock responsive sigma factor genes, .yzgB, .y/g-H and fzgE, of which sigB and sigY also respond to detergent stress (Manganelli et al, 1999). sigE and sigR also have been shown to be up-regulated in M.tuberculosis infected macrophages (Jensen-Cain and Quinn, 2001). In M.tuberculosis 10 of the 13 putative sigma factors are considered to be members of the extra cytoplasmic factor (ECF) family of alternative

133 sigma factors, thought to be involved in regulating bacterial interactions with the extracellular environment, adaptation to stress and, in some cases, bacterial virulence (Manganelli et al, 1999). Raman et al demonstrated that SigH regulates the stress- inducible expression of sigE and sigB (Raman et a l, 2001). In a recent paper Manganelli et al identified several genes that are induced in a a^-dependant manner after SDS surface stress (Manganelli et a l, 2001). The genes identified encode proteins belonging to different protein classes, including transcriptional regulators {sigB), enzymes involved in fatty acid degradation and classical heat shock proteins.

Mycobacterial promoters have been identified showing specific regulation in response to environmental stress conditions, regulated by specific proteins other than sigma factors. Oxidative stress response in pathogenic mycobacteria is thought to play an important role in the survival and persistence of mycobacteria at various stages of infection. OxyR is a major positive regulator of the oxidative stress response in many bacteria. OxyR is present in most mycobacterial species and has been shown in M.marinum to regulate the expression of ahpC (an alkyl hydroperoxide reductase homologue) but not that of katG (a catalase peroxidase) in response to hydrogen peroxide (Pagan-Ramos et a l, 1998). In M.smegmatis and M.tuherculosis, katG has been demonstrated to be co-transcribed with and regulated by fu r A, which encodes a repressor similar to the ferric uptake regulatory protein (Fur) in many bacteria (Pym et a l, 2001). Fur acts as an iron-responsive repressor and appears to be a central component in a complex network involving iron metabolism, response to oxidative stress, acid tolerance response, sugar metabolism and toxin synthesis (Pagan-Ramos et al, 1998; Pym et al, 2001; Milano et a l, 2001). A second iron responsive transcriptional regulator has been identified in mycobacterial species. The iron-dependent regulatory protein, IdeR, is a functional homologue of the Corynebacterium diphtheriae DtxR protein (Schmitt et a l, 1995). DtxR is an iron dependant repressor controlling siderophore biosynthesis and transcription of the tox gene (Boyd et a l, 1990; Schmitt and Holmes, 1991a; Schmitt and Holmes, 1991b; Tao et a l, 1994). When activated by Fe^^ DtxR, and IdeR, bind to operator sequences known as “Iron boxes”, repressing transcription of iron regulated genes. An IdeR isogenic mutant strain of M.smegmatis mc^l55 was unable to repress the synthesis of exochelin and mycobactin (Dussurget et a l, 1998). The

134 mutant strain also exhibited greater sensitivity to hydrogen peroxide and had decreased catalase/peroxidase and superoxide dismutase activities (Dussurget et ah, 1996). Further work expanded the exact role that IdeR plays in mycobacterial gene regulation by demonstrating that expression of the exochelin biosynthesis gene fxbA (encoding a putative formyltransferase) is negatively regulated by iron only in the presence of IdeR (Dussurget et a l, 1999). Several such iron boxes have been identified upstream of mycobacterial genes and shown to bind IdeR in the presence of divalent metals in gel retardation experiments (Manabe et a l, 1999). More recently, Gold et al identified “Iron box” homologues in the upstream regions of a further 40 M.tuberculosis ORFs, whose gene products are involved in diverse functions including iron acquisition or storage and amino acid biosynthesis, as well as genes with no known role in iron metabolism or demonstrating no significant homologies to any known proteins in databases (Gold et a l, 2001). The authors demonstrated that 5 of these genes namely: mbtA, mbtB, mbtl (involved in siderophore biosynthesis), rv3402c (demonstrating homology to an aminotransferase, a dehydratase and an enzyme involved in perosamine/O-antigen biosynthesis), and bfd (demonstrating homology to Bfd from E.coli) are IdeR and iron repressed, with mbtB, mbtl and rv3402c being up-regulated in THP-1 macrophages. A sixth ORF, bfrA (a bacterioferritin sub-unit involved in iron storage), is controlled by three promoters, two of which are IdeR and iron repressed, whereas the third promoter is activated by IdeR and high iron conditions. The diversity of products of genes regulated by iron as well as the findings that pathogenic mycobacteria encounter an iron-limited environment during intracellular growth, suggest that the regulation of gene expression by iron may play an important role in the survival of mycobacteria in the host macrophage.

Several mycobacterial genes have been identified that undergo up-regulation in response to environmental stress or during intracellular growth. As such these genes may be required at specific stages during infection to ensure intracellular survival. Results presented in Chapter 4 demonstrated that expression of the 34kDa putative serine protease in M.smegmatis mc^l55 conferred a statistically significant increase in the ability o ïM.smegmatis mc^l55 to survive in ovine alveolar (OA) macrophages over the first 24 hours of infection. It was also known from previous work that the

135 34kDa putative serine protease gene is expressed during a natural infection as indicated by the presence of host antibodies against the 34kDa putative serine protease (Cameron et a l, 1994). It was thought that a more detailed understanding of the transcriptional activity of the 34kDa putative serine protease would provide important information on the role the gene plays in the virulence of M.aparatuberculosis. Therefore, the work presented in this chapter, attempted to identify the promoter responsible for expression of the 34kDa putative serine protease and characterise what environmental stimuli were responsible for gene expression.

136 5.2 Materials and Methods 5.2.1 Amplification of the upstream region of the 34kDa putative serine protease from M.a.paratuberculosis genomic DNA a) Using HotStar Taq DNA polymerase Three hundred and sixteen bp of 34kDa putative serine protease upstream sequence including the start and first 3 codons of the 34kDa putative serine protease ORF was amplified by PCR from M.a.paratuberculosis JD88/107 as follows. M.a.paratuberculosis genomic DNA (125 ng) (section 2.7) was added to pre prepared reaction mixtures (50pi final volume) comprising (x 1 ) reaction buffer at 1.5mM MgClz (Qiagen), 0.2 mM each of dATP, dCTP, dGTP and dTTP (dNTP mix; Roche Ltd.), 2% ('^/y) Glycerol, 100 pMol each of the forward and reverse primers (forward primer: 5’-CGG GGC CTT GCG CGA GGG CG-3% positions -316 to - 303; reverse primer: 5’- GCG ATT TGC TCA TCC GTC ACC CT-3% positions -12 to +12) and 2.5 U HotStar Taq polymerase (Qiagen). HotStar PCR conditions consisted of an initial dénaturation of 15 min at 95°C, followed by 35 cycles of 60 sec dénaturation at 94°C, 60 sec annealing at 60°C and 60 sec extension at 72°C. The final cycle included an extension at 72°C for 8 min. The 316 bp amplification product was excised from a 1% LMP agarose gel (section 2.2,4) and cloned into the pGEM®-T vector (Promega UK) as per the manufacturer’s instructions. Competent E.coli JM109 cells were transformed as described in section 2.3.3. plasmid DNA was recovered from positive transformants as described in section 2 .2 .1 .

b) Using ACCUZYME DNA polymerase Three hundred and sixteen bp of 34kDa putative serine protease upstream sequence including the start and first 3 codons of the 34kDa putative serine protease ORF was re-amplified by PCR from plasmid pGEMusP (5.2.1-1) as follows. pGEMusP plasmid DNA (50ng) was added to pre-prepared reaction mixtures (50pl final volume) comprising (xl) reaction buffer at 2.0 mM MgS 0 4 (Bioline, Ltd.), 0.2mM each of dATP, dCTP, dGTP and dTTP (dNTP mix; Roche Ltd.), 2% C"Vy) Glycerol, 100 pMol each of the forward and reverse primers (forward primer: 5’-CGG GGC CTT GCG CGA GGG CG-3’, positions -316 to -303; reverse primer: 5’- GCG ATT TGC TCA TCC GTC ACC CT-3’, positions -12 to +12; position of primer

137 recognition sites are described in relation to start codon of 34kDa putative serine protease) and 2.5 U ACCUZYME DNA polymerase (Bioline, Ltd.). ACCUZYME PCR conditions consisted of an initial dénaturation of 5 min at 95°C, followed by 35 cycles of 60 sec dénaturation at 94°C, 60 sec annealing at 60°C and 60 sec extension

at 72°C. The final cycle included an extension at 72°C for 8 min.

5.2.2 Amplification of the 34kDa putative serine protease ORF and upstream region from M.a.pamtuberculosis genomic DNA The entire 34kDa putative serine protease ORF and 333 bp of upstream sequence was amplified by PCR from M.a.paratuberculosis JD88/107 as follows. M.a.paratuberculosis genomic DNA (125ng) (section 2.7) was added to pre-prepared reaction mixtures (50pi final volume) comprising (xl) reaction buffer at 1.5mM MgCL (Qiagen), 0.2mM each of dATP, dCTP, dGTP and dTTP (PCR nucleotide mix; Roche, Ltd.), 2% (^/Q Glycerol, 100 pMol each of the forward and reverse primers (forward primer: 5’-GCC GTG TAG ACC ACG TCC GG-3’, positions -333 to -314 upstream of the 34kDa putative serine protease start codon; reverse primer 5’-G C r CTA GAG CTC AGG CCG GCG GCC CCT CCG-3% underlined sequence represents positions 1,110 to 1,091 of the 34kDa putative serine protease ORF, sequence in italics represents m X b a I restriction enzyme recognition site) and 2.5 U HotStar Taq polymerase (Qiagen UK Ltd.). HotStar PCR conditions consisted of an initial dénaturation of 15 min at 95°C, followed by 35 cycles of 60 s dénaturation at 94°C, 60 s annealing at 65°C and 90 s extension at 72°C. The final cycle included an

extension at 72°C for 8 min. The 1,419 bp amplification product was excised from a LMP agarose gel (see section 2.2.4) and cloned into the pGEM®-T vector (Promgea UK Ltd.) as per the manufacturer’s instructions. Competent E.coli JM109 cells were transformed as described in section 2.3.3.

5.2.3 Measuring P-gal expression using the X-gal substrate To demonstrate expression of P-gal in M.smegmatis from a mycobacterial promoter, M.smegmatis strains were inoculated onto L-B agar plates supplemented as follows; 20pg/ml streptomycin and 80pg/ml X-gal substrate. The cultures were then incubated at 37°C until the appearance of colonies, the appearance of blue colonies confirmed expression of p-gal activity in those recombinant strains.

138 5.2.4 Induction of p-gal expression from a mycobacterial promoter a) By iron starvation p-Gal assays were performed as described in (Dussurget et a l, 1999). Briefly, a fresh culture of each M.smegmatis strain was diluted Vio in fresh pre-warmed (37°C) L-B broth supplemented as follows; 1% (^Vy) Tween 80 and 20pg/ml streptomycin, and incubated at 37°C with shaking (200 rpm) until an ODgoo of 0.4-0.6. 10 ml of mycobacterial culture was added to two 50ml falcon tubes. The Iron chelator Dipyridyl (DP) was added to one falcon tube to a final concentration of 200pM, the same volume of water was added to the duplicate culture. The cultures were incubated at 37°C with shaking (200 rpm) for a further 4 hours, the ODeoo noted for each strain, centrifuged at 4,147 x g for 10 min, the supernatant discarded and the mycobacterial cell pellet frozen on dry ice and stored at -70°C until processed.

5.2.5 Measuring P"Gal expression using ONPG substrate The mycobacterial cell pellet prepared as described in 5.2.4 or 5.2.5 was re suspended in SOOpl of Z-buffer (lOOmM Sodium Phosphate and ImM Magnesium Sulphate, pH 7.0) supplemented with ImM P-mercaptoethanol. Mycobacterial lysates were prepared by bead beating as previously described (see section 2.7). The supernatant was removed and transferred to a 1.5ml Eppendorf tube centrifuged at 11,000 X g for 10 min at 4°C. The total protein content of the Lysates was measured using the Bradford Reagent (Sigma-Aldrich Ltd.) with BSA as the standard as per the manufacturer’s recommendations. The lysates were then adjusted, diluting if required, to give roughly equal concentration of proteins in all lysates. 2 0 0 pl of adjusted lysate was added to a 1.5ml Eppendorf tube and equilibrated at 37°C for five min, followed by the addition of 200pl of a 0.4% o-nitrophenyl-p-D- galactopyranoside (ONPG) in Z-buffer substrate solution. The reaction was allowed to proceed until the reaction mixture appeared yellow. The reaction was stopped by the addition of 400pl of STOP solution (IM Na 2C0 ]). The colorimetric change was

139 then measured for each sample in a spectrophotometer set to read at 420nm, using Z- buffer as a blank, p-gal activity in Miller units was calculated by the formula;

( O D 4 2 0 X 1000)/(^ X V X ODôoo) where t is the incubation time in minutes and v is the volume of culture used.

140 5.3 Results 5.3.1 Determination of the upstream region of the 34kDa putative serine protease ORF in M,avium and M.a.paratuberculosis

A BLAST search of the unfinished TIGR M.avium genome sequence project (http://tigrblast.tigr.org/ufmg/) using the entire 34kDa putative serine protease sequence as the query sequence revealed the presence on M. avium cosmid 4 of a 100% identical region. This was expected, given earlier work demonstrating the presence of the 34kDa-putative serine protease sequence in M. avium by Southern blot hybridisation. The sequence of the M. avium cosmid 4 was recovered from the

TIGR database and the location of the 34kDa putative serine protease on the cosmid was determined by alignment using the ALIGN X program of the Vector NTI suite (InforMax Inc.). To confirm that the corresponding upstream sequence was identical in M.aparatuberculosis, the upstream region of the 34kDa putative serine protease was amplified by PCR using primer sequences directed against the upstream region of the gene in M.avium as described in section 5.2.1a. The 316 bp insert fragment in the resulting plasmid, designated pGEM34P was sequenced using the T7 forward and reverse primers whose target sequences are located 5’ (T7 forward primer) and 3’ (T7 Reverse primer) of the cloned insert in pGEM-T. Upon sequence analysis, using the ALIGN X program in the Vector NTI suite, the cloned M.a.paratuberculosis upstream sequence was identical to the M.avium cosmid sequence.

5.3.2 In silica identification of promoter elements in the upstream region of the 34kDa putative serine protease In order to determine whether or not a recognisable promoter element was present in the upstream sequence region of the 34kDa putative serine protease in M.a.paratuberculosis, the sequence was analysed by computer-based homology searching for the presence of a mycobacterial promoter consensus. A broad consensus mycobacterial promoter sequence was compiled by aligning the - 1 0 and - 35 hexameric regions of known mycobacterial promoters (Figure 5.1) using the

ALIGN X program (Vector NTI suite, InforMax Inc.). This generated the consensus sequence MPI. Thomas et al has also proposed a M.a.paratuberculosis promoter consensus sequence based on compiling several promoter sequences identified in

141 -35 - 1 0

M.a.paratuberculosis PAN gCGACA pÀ C A C ^

M.a.paratuberculosis Consensus P g m c g t CGGCCS

M.bovis BCG mpbJO CCSATC CATgAG

M.fortuitum pblaF TTCAAA E a c g c t

M.leprae 16s rRNA TTGAC r ATTAAT

M.leprae 18kDa TTGCAT CTATAT

M. leprae 28kDa [TGiGTCA TACCAT

Mmarinum G13 TTGCTG TAGAAA

M.smegmatis ask CCCACG Z^CGCTG

M.tuberculosis hsp60 TTGCAC T A A G ^

M.tuberculosis 85kDaA ^TGACT CGCCTG

M.tuberculosis cpn60 '^GCT^A CATCAG

M.tuberculosis I6SrRNA jTTGACT ÎTAGACT

E.coli [TTGACA [TATAAT MPI consensus TTGACM

Figure 5.1 Generation of MPI promoter consensus. Alignment of several known mycobacterial promoters to generate consensus -35 and -10 hexameric sequences. The promoters were aligned using the A LIG N X program of the Vector NTI suite. Nucleotides depicted in blue with shading represent identity to the MPI consensus. M.aparatuberculosis PA N (Gormley et al, 1997); M.aparatuherculosis Consensus (Thomas et al, 1992); M.bovis BCG mpbJO (Matsumoto et al, 1995); M.fortuitum pblaF (Timm et al, 1994b); M. leprae 16s rRNA (Sela and Clark-Curtiss, 1991); M.leprae ISkDa, M.leprae 28kDa (Dellagostin et al, 1995); Mmarinum G13 (Barker et al, 1999); M.smegmatis askJ3 (Narayanan et al, 2000); M.tuberculosis hsp60 (Dellagostin et al, 1995); M.tuberculosis 85kDa A (Kremer et al, 1995b); M.tuberculosis cpn60; M.tuberculosis 16S rRNA (Kempsell et al, 1992).

142 their studies of the transcriptional machinery of M.a.paratuberculosis (Thomas et al, 1992). As this differed significantly from the consensus sequence generated above it was included in the computer analysis. Both MPI and the M.a.paratuberculosis promoter consensus sequences were aligned to the M.a.paratuberculosis upstream sequence of the 34kDa putative serine protease. This analysis failed to reveal any significant identity to either promoter consensus.

A mycobacterial promoter prediction program (Triccas et al, 2001) (http://www.centenary.usyd.edu.au/research/promoter.html) was also used to analysis the upstream region of the 34kDa putative serine protease. The search program utilises the consensus sequence of Mulder et al (-35: TTGACG; -10, TATAAT) (Mulder et al, 1999). Using this program it was possible to identify two potential promoter regions in the upstream region (Figure 5.2), sharing a common - 35 sequence with two predicted -10 regions (Figure 5.2). Promoter A demonstrated 58% identity to the target sequence, with promoter B demonstrating 67% identity. Given the low level of identity observed for both potential promotes, experimental evidence was required to demonstrate the presence of a functional promoter element in the sequence upstream of the 34kDa putative serine protease in M.a.paratuberculosis

5.3.3 Promoter identification in the upstream region of the p40 gene of 1S901^ M. avium The upstream region of the p40 gene, previously identified in IS901 positive (ISPOf^) M. avium, was analysed using the same methodology as described in section 5.3.2. The gene encodes a 40kDa protein that is present in IS901^ M. avium but absent from IS901' strains (Burrells et a l, 1995; Inglis et a l, 2001). The gene sequence has been shown to be present in 26 mycobacterial species investigated but the protein product is only detected in 1^901^ M. avium (Inglis et a l, 2001). The promoter consensus sequence generated in section 5.3.2 (MPI) (Figure 5.1) was aligned with p40 upstream sequence from 1S901^ M.avium, TS>901' M.avium, M.a.paratuberculosis, M.bovis, M.leprae, M.smegmatis and M.tuberculosis highlighting a potential promoter element.

143 cggcagcaaa cggcggtaag cctatgagcc ggctgagaac ctggcacaùg ccgtgcatag ctacctgcat tacggttat& fcacacaaaat tgtgccgcca ggatcctcag gccgggacag tttggtgttt accgcgacgc aggagggtga cggATGagca aatcgc

-35 -10 Start matches P r o A a tg c c g — 17(bp)—t a c g g t —7 7(bp)—AT G 7 ProB a tg c c g —23 (bp)—t a ta ta —68(bp)—AT G 8

Figure 5.2 Analysis of the upstream region of the 34kDa putative serine protease using the Mycobacterial Promoter Prediction program. The program identified two potential promoters; promoter A (ProA) and promoter B (ProB). Shown are the location of both putative -10 regions, the putative -35 region and the distance fi'om the end of either putative -10 hexamer to the start codon (ATG) of the 34kDa putative serine protease ORF. The number of matches to the consensus site are shown for each putative promoter.

144 A putative promoter (PI) was located 7 base pairs from the start codon (GTG) of the ORF (Figure 5.3). This region also contained an extended -10 motif (the TGN motif), that has been linked to an increased transcriptional activity of several mycobacterial promoters. The observed distance between the -35 and -10 regions is within the expected range (between 9 and 24 base pairs) seen for mycobacterial promoters. Upon sequence analysis, the first base of the putative -10 hexamer is a T in both M.smegmatis and IS90Ü M.avium, the same position contains a C in all other species (Inglis et al, 2001). However more recent data, involving re-sequencing the upstream region of the gene in M.a.paratuberculosis has confirmed the presence of a T at that position.

5.3.4 Cloning the 34kDa putative serine protease ORF and upstream region into a mycobacterial shuttle vector If a promoter element was located in the upstream region of the 34kDa putative serine protease then the possibility existed that it would be capable of driving expression of the 34kDa putative serine protease in M.smegmatis mc^l55. To demonstrate this, the entire open reading frame and upstream sequence was cloned into an appropriate mycobacterial shuttle vector and introduced into M.smegmatis mc^l55. Expression of the 34kDa putative serine protease from a promoter located upstream of the gene could then be determined using western immunoblotting (see section 2.10) probing with the 34kDa putative serine protease specific monoclonal antibody. a) PCR amplification of the entire 34kDa putative serine protease ORF and upstream region PCR primers were designed that would allow the amplification of the 34kDa putative serine protease ORF and 346 bp of upstream region from M.a.paratuberculosis genomic DNA. The reverse primer contains the recognition site for the Xba I restriction enzyme at its 5’ end, generating a fragment containing a 3’ Xba I site. A 1,419 bp product was amplified by PCR (see section 5.2.2), purified from a 1% LMP agarose gel (see section 2.2.4) and ligated into the pGEM-T vector system as per the

145 -4 0 -3 0 -20 10 -1 +1 +10 M.avium {1S901+) GATTGÂqCCT CGATTCTACA GCCTGCgAGq ÂrjGTGGCGTT GTGACCAGTG M.avium {1S901-) GA^TGACGCT CGATTYCACA GCCTGCcKgC ATGTGGCGTT GTGACCAGTG M. a .pth GA^TGACjCCT CGATTCCACA GCCTACCAGC ATjGTGGCGTT GTGACCAGTG M. tuberculosis TA&TGACCCC CTGTCCGATA GCCTGCCAGC AT|GTGGCGTT GTGGCTAGCG M.bovis TATTGAgCCC CTGTCCGATA GCCTGCCAGA ATGTGGCGTT GTGGCTAGCG M. leprae GA&TGÀTCCC G . GATCGACA ATCTGCCpGQ ATGTGGCGTT GTGACTGCTA M. smegmatis G G C ^ c g c C G . . . CGGAGG CGTGAApAGC ATGTGAAGCC GTGACTGCAC Consensus -10 ...... gAGg ^ ...... Consensus -35 . . (TTGACAl......

Figure 5.3 Alignment of sequences upstream of the p40 gene homologues in 1^901^ M.avium, 1^901' M.avium, M.avium subsp. paratuberculosis {M.a.ptb), M.bovis, M.leprae, M.smegmatis and M. tuberculosis. Numbering (-40 - +10) refers to the IS901^ M.avium sequence. The first lObp of the p40 ORFs are shown underlined beginning +1 at the GTG translational start codon. Consensus -10 and -35 regions mark the position of a putative promoter. A TGN motif immediately precedes the - 10 region in all species except M.avium subsp. paratuberculosis. In the case of M.smegmatis, a single nucleotide (A) separates the TGN motif and the start of the - 10 hexamer. Figure and legend taken from Inglis et al, 2001, with permission.

146 manufacturer’s instructions, with a vectorhnsert ratio of 3:1 (Promega UK). Competent E.coli JM109 cells were transformed with 5ul of the ligation mix on L-B agar medium supplemented with 50pg/ml (see section 2.3.3) and plasmid DNA recovered as described in section 2.2.1. Plasmid DNA was digested to completion with the restriction enzyme Xba I (see section 2.2.2), to confirm the presence of the fragment in the pGEM-T vector. Upon electrophoretic analysis, an increase in size for the plasmid DNA was observed consistent with the incorporation of the insert fragment. Similarly, digestion of plasmid DNA using the restriction enzyme Bam HI resulted in two DNA bands on a 1% agarose gel consistent with the presence of the correct insert. A single Bam HI site is present in the insert fragment, located in the upstream sequence with a single Bam HI recognition site present also on the pGEM- T vector backbone (Promega UK). The cloned insert DNA was finally sequenced using the T7 forward and reverse primers ^hose target sequences are located 5’ (T7 forward primer) and 3’ (T7 Reverse primer) of the cloned insert in pGEM-T. Sequence analysis confirmed that the plasmid contained the correct l,419bp insert (Figure 5.4). The plasmid was designated pGEM-us34. b) Cloning of the 34kDa putative serine protease ORF and upstream region into PÜS972 Cloning the 34kDa putative serine protease and upstream region into pGEM-T allowed the fragment to be excised using restriction sites located in the vector sequence, facilitating further cloning into a mycobacterial shuttle vector. The resultant shuttle vectors could then be introduced into M.smegmatis mc^l55 to determine whether or not the upstream sequence was transcriptionally active. The restriction sites Xba I and Spe I are located on either side of the 34kDa putative serine protease and upstream region as shown in Figure 5.4. No recognition site for either enzyme is present in the 34kDa putative serine protease or the upstream sequence, as determined by sequence analysis using the Vector NTI software package. Plasmid pGEM-us34 was digested with both Xba I and Spe I in buffer conditions suitable for optimal activity of both enzymes. The restriction digest was resolved on a 1% LMP agarose gel and the l,440bp insert fragment purified from the gel as previously described.

147 34kDa antigen coding sequence 34USF PCR Primer pcR Primer

Spe I ^ Bam HI Bam HI Xba I

T Signal Peptide sequence pGEM-T pGEM-T

Figure 5.4 Shown is the location of the entire 34kDa putative serine protease ORF and 346bp of upstream region in pGEM-T vector. The location of the single Xba I and Spe I restriction and both Bam HI enzyme (one is located in the upstream 34kDa putative serine protease region with a second located down stream of the Spe I site in pGEM-T) recognition sites relative to the cloned insert are shown. Also shown is the location of the signal peptide of the 34kDa putative serine protease, and the location of the PCR primers used to generate the fragment (Forward primer 34usF and reverse primer 34Rev: the nucleotide sequences of which are given in section 5.2.2). The Figure was generated by the Vector NTI Suite, using sequence data derived from sequencing pGEMus34 (Appendix 4).

148 The fragment was to be cloned into the mycobacterial shuttle vector pUS972 by blunt end ligation. Both of the restriction sites used to excise the fragment from pGEM-us34 generate 5’-overhangs that had to be removed prior to attempting the ligation reaction. To achieve this, the recovered fragment was treated with the Klenow Fragment of DNA polymerase I (see section 2.2.6) and gel purified from a 1% LMP agarose gel (see section 2.2.4). pUS972 Vector DNA (200ng) was digested to completion with the restriction enzyme Sea I under appropriate buffer conditions (Promega Inc.) generating a linear plasmid with blunt ends. The linear 3.6kb vector was purified from a 1% LMP agarose gel. Linear pUS972 was treated with Shrimp Alkaline Phosphatase (SAP) to remove the 5’-phosphate (see section 2.2.5), preventing re-ligation of the plasmid without the fragment during ligation. The linear de-phosphorylated vector was again purified from 1% LMP agarose.

SAP treated linear vector and blunt ended insert DNA were ligated together with a 3:1 (vector:insert) molar ratio. SAP treated and non-treated pUS972 were used as ligation controls. Competent E.coli JM109 cells were transformed with 5pi of the ligation reactions and positive transformants were selected by growth on solid L-agar media supplemented with 50pg/ml kanamycin. It was noted that the transformation efficiency was low with only 8 colonies present on selective solid media.

Blunt end ligation results in the incorporation of the fragment in two orientations relative to the vector DNA backbone. The approach for confirming the presence and the orientation of the fragment in the plasmid backbone is out-lined in Figure 5.5. Briefly, a single Bam HI recognition site is located in the vector with two sites located in the fragment to be cloned (Figure 5.4). Digestion of plasmid DNA containing the cloned fragment with Bam HI would result in the removal of several fragments from the plasmid DNA of different sizes reflecting the different orientation of the insert relative to the backbone vector.

Digestion of plasmid DNA recovered from each of the 8 positive colonies with Bam HI resulted in a single DNA band on a 1% agarose gel with a molecular size corresponding to the vector alone without any insert being present. Other vector: insert ratios (5:1, 1:1, 1:3) were attempted resulting in the recovery of re-

149 pUS972 ^ 34kDa antigen coding sequence pUS972 w—g h. Bam HI BamHl I pMRIus341

H a nb N BamHl Bam HI BamHl pMRIus34 II

Figure 5.5 The relative orientation of the cloned fragment containing the entire 34kDa putative serine protease ORF (purple arrow) and the upstream region in the pUS972 vector (yellow arrows) can be determined using the Bam HI restriction enzyme. A single Bam HI site is located in the MCS of pUS972 with two recognition sites in the cloned 34kDa putative serine protease ORF and upstream region fragment. Introduction of the 34kDa putative serine protease fragment into the vector through blunt end ligation would result in the insert being in two orientations relative to the vector backbone. In orientation I, digestion of the plasmid DNA by Bam HI results in the removal of 287 bp (product I) from the vector. Digestion of plasmid DNA in orientation II results in the removal of approximately 1,496 Kb (product I la) and 287 bp (product Ilb) of DNA from the plasmid DNA.

150 ligated vector DNA alone. This was in spite of the fact that all the usual controls were noted to be satisfactory; re-ligated Sea I cut pUS972 vector DNA that had not been treated with SAP consistently resulted in the recovery of -100 cfu/50ng DNA; indicating the efficacy of the T4 DNA ligase and the reaction buffer supplied by the manufacturer (Roche Ltd.); E.coli JM109 transformation with uncut circular pUS972 resulted in approximately 5x10^ cfu/50 ng DNA. Treatment of the vector with SAP failed to completely prevent re-ligation of the vector as control ligation reactions successfully transformed E.coli JM109. This was consistently the case even when the concentration of SAP used in the reaction was increased to 2 U of SAP per reaction and the time allowed for completion of the reaction was also increased, to 90 min. The possibility existed that the failure to successfully ligate the insert into the vector backbone was due to the preferential reformation of the vector during the ligation reaction. This may have been due to the apparent inefficiency of the de phosphorylation reaction in removing the 5’-phosphate groups on either end of the linear DNA.

In an attempt to overcome these problems linear vector, digested with Sea I but which was not subsequently treated with SAP, was used in the subsequent ligation reaction. This would be expected to result in the reformation of the vector with a corresponding reformation of the Sea I restriction site. However, the ligation of the insert into the vector would not regenerate the Sea I site as determined by computer based sequence analysis of the expected vector-insert junctions. Digestion of the vector-insert ligation mix with the restriction enzyme Sea I would digest the re ligated vector DNA but not vector DNA containing the insert fragment. The ligation was attempted with non-SAP treated vector DNA and a 1:1 vector:insert ratio. lOpl of the resulting reaction was digested with the Sea I restriction enzyme and 5 pi of this reaction was used to transform chemically competent E.coli JM109 cells (see section 2.3.3. The transformation efficiency remained low with only 12 colonies observed on selective media. Plasmid DNA was recovered (see section 2.2.1) from 10 positive colonies and digested with the Bam HI. Electrophoretic analysis of the resulting digested plasmid DNA revealed the presence of two or three DNA bands on a 1% agarose gel demonstrating successful integration of the insert DNA (Figure 5.6).

151 10,000 8,000

6,000 - 5.000 - ^4,741 4.000 -I 3,600 3.000 - 2.500 -

2.000 -

1.500 - 1,144

1,000 - 800-

287 200

Figure 5.6 Agarose gel showing Bam HI digestion of plasmids pMRIus34I and pMRlus34II, confirming the orientation of the cloned fragment relative to the plasmid backbone, as described in the text. Lane 1 : digestion of pMRIus34I results in the presence of two DNA bands at -4,741bp and -287 bp; Lane 2: digestion of pMRlus34II results in the presence of tliree DNA bands of -3,600, -1,144 and -287 bp. L corresponds to molecular weight markers (Hyperladder I, Bioline Ltd.).

152 As expected, the molecular size of the bands varied according to the orientation of the cloned fragment in the plasmid backbone (Figures 5.5 and 5.6).

The resultant vectors were designated pMRIus34-1 (orientation I, Figure 5.5) and pMRIus34-II (orientation II, Figure 5.5). Both vectors were then introduced by electroporation into electrocompetent mc^l55 cells (see sections 2.3.1b and 2.3.2b) and positive transformants selected on 7H11S plates containing kanamycin at 50 pg/ml resulting in M.smegmatis mc^l55 clones M.smegmatis pMRIus34-I and M.smegmatis pMRIus34-II.

5.3.5 Expression of the 34kDa putative serine protease from the endogenous promoter in M.smegmatis mc^l55 Having successfully cloned the entire 34kDa putative serine protease ORF and the upstream region into a mycobacterial shuttle plasmid and introduced the plasmid into M.smegmatis mc^l55 (section 5.3.4), the potential expression of the 34kDa putative serine protease from the upstream promoter could be ascertained. M.smegmatis mc^l55 strains containing the following plasmids, pUS972, pMRIus34 I, pMRIus34 II and pMRI34 (see Appendix 2) were grown in 7H9^-broth culture supplemented with 50 pg/ml kanamycin to an ODôoo of 0.6 and lysates prepared as described in section 2.6. The cell-free supernatants from all cultures were retained, passed through a 0.45pm filter to remove remaining mycobacteria and concentrated down to a final volume of 1ml in a Microcon spin column (Amicon-Millipore Ltd.) spun for 20 min at 4,000 x g at 4°C. PMSF was added to the final concentrated sample to a final concentration of ImM. Mycobacterial bacterial lysates and concentrated culture supernatants derived from strains M.smegmatis pMRIus34-I, M.smegmatis pMRIus34-II, M.smegmatis pMRI34 and M.smegmatis pUS972 were analysed for the presence of the 34kDa putative serine protease by western immunoblotting as described in section 2.10 with the 34kDa putative serine protease specific monoclonal antibody as probe. A single band of approximately 34kDa was detected in the lysate and supernatant samples of M.smegmatis pMRI34, M.smegmatis pMRIus34-I, and pMRIus34-II, with no band detected in the control M.smegmatis pUS972 lysate (Figure 5.7). The same lysates and culture supernatants were also probed with the Hsp65 monoclonal antibody. As the Hsp65 is retained within intact

153 1 2 3 4 5 6 7 8

- 97,400

- 66,200

- 45,000

34,000> <--34,000 -3 1 ,0 0 0

-2 1 ,5 0 0 - 14,400

Figure 5.7 Western blot showing mycobacterial cell lysates and the corresponding concentrated culture supernatants probed with anti-34kDa antigen monoclonal antibody. Lane 1, M.smegmatis pMRI34 lysate, Lane 2; M.smegmatis pUS972 lysate. Lane 3; M.smegmatis pMRIus34-I lysate. Lane 4; M.smegmatis pMRIus34-II lysate. Lane 5; M.smegmatis pMRI34 culture supernatant. Lane 6; M.smegmatis pUS972 culture supernatant. Lane 7: M.smegmatis pMRIus34-I culture supernatant. Lane 8: M.smegmatis pMRIus34-II culture supernatant. A 34kDa band was detected in all experimental lysates and in the corresponding supernatants but not in the plasmid control lysate or supernatant.

154 mycobacterial cells the absence of a 65kDa band in the culture supernatants would indicated that limited lysis of the bacterial culture has occurred. A 65kDa band was observed in all lysates tested with no protein detected in the corresponding supernatants (Figure 5.8), suggesting that the 34kDa putative serine protease expressed from the putative endogenous promoter is secreted by M.smegmatis pMRIus34-I and M.smegmatis pMRIus34-II and not present in the supernatant as a result of mycobacterial cell lysis during growth. These results suggested that a transcriptionally active promoter capable of expressing the 34kDa putative serine protease in the upstream 346 bp region of the gene. Expression of the 34kDa putative serine protease was seen when the cloned fragment was in both orientations relative to the plasmid backbone.

5.3.6 Investigation of the transcriptional activity of the 34kDa putative serine protease promoter The identification of promoter activity is the first step in the determination of what environmental stimuli control the activity of a gene. Another aim of the upstream sequence analysis was to identify sequences homologous to known regulatory binding sites. An IdeR binding site has been identified previously in the upstream region of the M.tuberculosis Rv0983 gene. Rv0983 is annotated in the TUBERCULIST database (section 2.5) as being demonstrating homology to the HtrA family of serine proteases. As such, the possibility existed that a similar regulatory element was located in the upstream region of the 34kDa putative serine protease. The consensus IdeR recognition site (IdeR box) of Manabe et al (1999) was aligned to the upstream sequence of the 34kDa putative serine protease using the ALIGN X component of the Vector NTI suite. The analysis of the 346 bp of upstream sequence revealed a potential IdeR box approximately 250 bp from the start of the coding sequence (Figure 5.9) demonstrating 58% identity to the IdeR/DtxR consensus sequence, while the sequence differed from that of Rv0983, the level of identity between both and the consensus sequence was the same. Experimental evidence was required to determine if this region was in fact a functional IdeR box, capable of regulating the transcriptional activity of the 34kDa putative serine protease in response to IdeR and the concentration of iron.

155 1 2 3 4 5 6 7 8

97.400 -

66,200 - ^ -65,000

45,000 -

3 1 ,0 0 0 -

2 1 ,5 0 0 - 14.400 -

Figure 5.8 Western blot showing mycobacterial cell lysates and the corresponding concentrated culture supernatants probed with anti-Hsp65 monoclonal antibody. Lane 1, M.smegmatis pMRI34 lysate, Lane 2; M.smegmatis pUS972 lysate. Lane 3; M.smegmatis pMRIus34I lysate. Lane 4; M.smegmatis pMRIus34II lysate. Lane 5; M.smegmatis pMRI34 culture supernatant. Lane 6; M.smegmatis pUS972 culture supernatant. Lane 7: M.smegmatis pMRIus34-I culture supernatant. Lane 8: M.smegmatis pMRIus34-II culture supernatant. A ~65kDa band was detected in all mycobacterial lysates but not in the corresponding culture supernatants.

156 34kDa upstream seq CGGGCTACCG AGGCCCGGCC GAACCTCGCC

Ironhox-Rv0983 ...... AC AGGTGGTGCT CAACCACG. .

Ironbox-adhB GC AGGTGACCGT CAACCGAT. .

iTonhox-narG ...... GA AGGTCAACCA NAACAAGA. .

Ironbox-phoP ...... GA AGGTAACGTT CAACCAAT. .

Ironbox-19kDa ...... GC AGGCCAGTGA NAACCTGT. .

Ironbox consensus ...... GT AGGTTAGGCT .AACCTAT. .

Figure 5.9 Alignment of five IdeR binding sites in M.tuberculosis, a IdeR/DtxR consensus recognition sequence (“Ironbox”) and the upstream region of the 34kDa putative serine protease. M.tuberculosis binding sites and the ironbox consensus sequence were taken from Mananbe et al 1999. All five previously identified IdeR/DtxR binding sites have been shown to bind IdeR in gel shift experiments. Sequence depicted in bold represent conserved sites relative to the IdeR/DtxR consensus sequence (“Ironbox” consensus).

157 5.3.7 Regulation of the 34kDa putative serine protease promoter by IdeR In order to confirm a role for IdeR in the transcriptional regulation of the 34kDa putative serine protease, transcriptional fusions of the upstream putative promoter region and the reporter molecule p-gal were created. The integrative mycobacterial vector, pSml28 (Appendix 2), allows the transcriptional fusion of a cloned putative promoter sequence upstream of a promoter less lacZ gene, followed by integration in single copy in to the attP site of M.smegmatis. The choice of integrative vectors for this particular work was necessary in order to have a single copy of the promoter-p- gal fusion in each strain to accurately determine regulation. M.smegmatis strain SM3 (Appendix 2) is an ideR isogenic mutant strain demonstrating no IdeR activity by western blotting (Dussurget et al, 1996). The SM3 strain has a slower doubling time, typically 6 hours, than the parent M.smegmatis mc^l55 strain (Benjamin Gold personal communication). Recent work carried out by Gold et al have demonstrated that the M.tuberculosis bfd promoter is regulated by IdeR and the cellular concentration of iron in M.smegmatis. Indeed the promoter demonstrated increased activity under iron starved growth conditions and also in the SM3 isogenic mutant strain (Gold et a l, 2001). Therefore, M.smegmatis mc^l55 harbouring an integrated vector, ^8mbfd containing the bfd promoter fused to LacZ (designated strain 8Mbfd) and M.smegmatis SM3 harbouring the same integrated vector construct (designated SMZibfd) were used as a positive control in the following experiments (Appendix 2).

a) Generation of 34kDa putative serine protease promoter-P-gal fusion vectors The upstream sequence of the 34kDa putative serine protease was amplified by PCR from pGEM34P as described in section 5.2.1b. pSml28 vector DNA (Appendix 2) was digested to completion with the restriction enzyme Sea I and purified from LMP agarose (section 2.2.4). The 317 bp PCR fragment was ligated into the linearised pSml28 vector with a insert:vector molar ratio of 1:1 (see section 2.2.7). The blunt end ligation protocol was similar to that used to successfully clone the 34kDa putative serine protease and upstream region into the pUS972 vector (section 5.3.3). The ligation reaction was digested to completion with the Sea I restriction enzyme, digesting re-ligated pSml28 vector but not pSml28 containing the insert. Five pi of digested ligation reaction was then used to transform E.coli JM109 chemically

158 competent cells (see section 2.3.3) with positive transformants selected on L-B agar media supplemented with 20 pg/ml streptomycin.

The resulting plasmid DNA, designated pSm34p, was sequenced in both directions with the same primers used to generate the cloned fragment (see section 5.2.2). The sequence confirmed the orientation of the promoter fragment relative to the downstream lacZ coding sequence. The cloned PCR fragment was present in the plasmid DNA in both orientations as shown in Figure 5.10. pSm34pI contains the fragment in an orientation capable of expressing lacZ, where as pSM34pII contains the fragment in the opposite orientation such that no expression of lacZ is expected (Appendix 2). b) Introduction of pSm34pl and pSm34pII into M.smegmatis strains In order to determine if the putative IdeR box located in the upstream region of the 34kDa putative serine protease was capable of controlling gene expression through IdeR, both pSm34pI and pSm34pII were electroporated into M.smegmatis SM3 and M.smegmatis mc^I55 (section 2.3.1b and 2.3.2b) and positive transformants selected on 7H11S (Appendix 3) medium supplemented with 20pg/ml streptomycin. In the case of recombinant SM3 strains streptomycin resistant transformants were subsequently grown on 7H11S media supplemented with 30 pg/ml kanamycin, to confirm the presence of the inactive IdeR gene. M.smegmatis SM3 transformants harbouring the integrated pSm34pI and pSm34pII vectors were designated ^M 3l34pl and SM3l34pII respectively. Similarly M.smegmatis mc^l55 transformants harbouring integrated vector were designated SM34pI and ^M34pII. pSml28 vector was also electroporated into M.smegmatis mc^l55 and M.smegmatis SM3 generating the control strains SM725 and SM3/725 respectively. c) Expression of p-gal from 34kDa putative serine protease promoter In order to test transcriptional activity of the 34kDa putative serine protease promoter, recombinant M.smegmatis SM3 strains (SM3/2^7, ^M3l34pII, SMZtbfd) and the M.smegmatis mc^l55 strains (SM54/?/, SM34pII, ^Mbfd) were assayed for p- gal activity using the X-gal substrate on solid media (see section 5.2.3). SM3/54p/ was shown to demonstrate positive expression of P-gal, as measured by the

159 34kDa antigen upstream region lacZ

34us-Forward 34us-Reverse

Sam HI Bamm HindlW HindlU

p S m 3 4 p I

Bam HI

p S m 3 4 p II

34us-Reverse 34us-Forward

Figure 5.10 Upstream putative promoter region of the 34kDa putative serine protease was cloned into Sea I site of the integrative pSml28 vector up stream from the promoter-less lacZ gene. The vector is a transcriptional fusion as the lacZ gene has a RBS allowing expression of the protein from the mRNA produced from any cloned promoter. The Figure shows the location of the promoter fragment in the pSml28 vector upstream from start of lacZ ORF. Also shown are the locations of the PCR primers used to generate the fragment for cloning and similarly used to sequence the fragment in the pSml28 vector, the sequences of which can be found in section 5.2.1. The Figure was generated using the Vector NTI suite based on available sequence data (Appendix 4).

160 appearance of blue colonies in the presence of X-gal. Similarly SM ibfd colonies demonstrated positive expression of P-gal under similar growth conditions. However, SM34pI and SMbfd were also positive for P-gal expression in the presence of X-gal. Strains SM3/54/?//, SM34pII, SM128 and SM3/725 were all negative for expression of p-gal under the same conditions. The positive demonstration of p-gal activity for both ^M 34pl and SM3/54p7 was suggestive that the transcriptional activity of the upstream 34kDa putative serine protease promoter was not regulated by the presence of IdeR. However, it was also noted that SMbfd demonstrated p-gal activity, in spite of the presence of functional IdeR in these strains. This was unexpected, as the bfd promoter has been shown to demonstrate repression in the presence of IdeR and iron in the growth media (Gold et al, 2001). The residual activity of the bfd promoter in M.smegmatis mc^l55, grown in the presence of iron, was attributed to the incomplete suppression of promoter activity by IdeR. A similar situation may have existed for the 34kDa putative serine protease promoter, with incomplete repression of the promoter in M.smegmatis mc^l55 under normal growth conditions. The use of a solid media based p-gal precluded an accurate measurement the P-gal activity for each strain as it relies on the appearance of blue colonies alone.

A second more sensitive p-gal assay was employed to demonstrate the potential regulation of the 34kDa putative serine protease promoter. The protocol utilises the ONPG substrate and allows the cells to be grown in liquid cultures, facilitating the manipulation of the growth conditions (section 5.2.4). Mycobacterial cell pellets were prepared for the all strains as described in 5.2.4, each lysate was tested for P-gal activity as described in section 5.2.5. As expected, bfd-lacZ fusions were repressed in the presence of iron in M.smegmatis mc^l55, as the p-gal levels obtained for strain ^M bfd under conditions of low iron were significantly higher than those obtained in iron replete conditions (Table 5.1). Expression of the bfd-lacZ fusion was independent of iron in the ideR mutant strain SM3, where levels were similar to those obtained with bfd-lacZ in M.smegmatis mc^l55 under low iron conditions. The low p-gal activity seen for the bfd-lacZ fusion in S M ^ under high iron conditions and in SMbfd may be sufficient to explain the appearance of positive p-gal colonies on solid media in section 5.2.5.

161 Strain -DP +DP Activation*

S M ^ 14.8 (2.4) 348.2 (26.5) 23.6

SM 3Z^ 306.1 (23.5) 287.2 (7.0) 0.9

SM54p7 11.0 (2.4) 11.6(1.9) 1.1

SM3/34p7 3.2 (0.9) 4.7 (0.9) 1.5

SM128 0.5 (0.1) 1.0 (0.5) 2.0

SM3/72($ 0.9 (0.2) 0.3 (0.1) 0.3

Table 5.1 Shown is the p-gal activity (expressed as Miller Units) of each strain, determined as described in section 5.2.5. The bfd promoter demonstrates increased expression under iron limiting conditions (+DP) and also constitutively high expression in M.smegmatis SM3 irrespective of iron concentration (SM3/7/^ expression +DP/-DP indicates that the strains were grown in the presence or absence of the iron chelator Dipyridyl. * Activation is the ratio of p-gal activity between the same strain grown in the presence or absence of Dipyridyl. For strain nomenclature see text. Standard deviations are shown in parenthesis.

162 The 34kDa putative serine protease-lacZ fusion p-gal expression levels in SM34pI were similar in both high- and low-iron growth conditions (Table 5.1). Similar results were seen for the 34kDa putative serine protease-lacZ fusions in SM3 (Table 5.1). The failure to show induction of the promoter under iron limiting conditions in mc^l55 and similarly the low level of expression found in the IdeR knockout SM3 strain, suggest that the 34kDa putative serine protease promoter is not regulated by IdeR in M.smegmatis. The levels of p-gal observed for the 34kDa putative serine protease-lacZ ÎMsion in mc^l55 and SM3 were comparable, demonstrating constitutive expression in both M.smegmatis strains independent of the presence of IdeR or iron limiting conditions.

163 5.4 Discussion Mycobacterial genes that undergo specific up-regulation within the host cells may be important for the intracellular survival and virulence of the bacterium. As such, determining the specific regulation of a gene offers an insight into whether the gene is constitutively expressed or expressed as a result of exposure to a specific environmental stimuli encountered in the host cell. The work described in this chapter attempted to address two important points in the potential regulation of the 34kDa putative serine protease, the presence of a promoter in the upstream region of the gene in M.a.paratuberculosis and the specific signals regulating the transcriptional activity of the promoter.

The continuing M.avium genome project allowed the identification of the M.a.paratuberculosis 34kDa putative serine protease homologue in M.avium. As expected, given that the MAC comprises a group of closely related organisms exhibiting up to 98% homology at the genomic level the sequence of the 34kDa putative serine protease was identical for both species. The available cosmid sequence data also facilitated the identification of the upstream region of the gene in M.avium. This region was shown to be identical to corresponding region in M.a.paratuberculosis. This suggests that the any transcriptional machinery and regulatory elements located in the upstream region are capable of expressing the gene in both species

Analysis of the upstream region of the 34kDa putative serine protease in M.a.paratuberculosis using a consensus promoter recognition site constructed from several, different mycobacterial promoters (MPI) failed to identify any mycobacterial promoter element. Similarly a search for sequences exhibiting identity to a M.a.paratuberculosis promoter consensus also failed to identify a promoter in the upstream region. A second promoter homology search using the promoter predict program created at the Centenary Institute in Australia located two potential promoter elements in the upstream region of the 34kDa putative serine protease. However, the level of identity observed for between both promoters and the consensus sequence was relatively low. The major difference in the promoter consensus sequences MPI and that used by the promoter predict program, that of

164 Mulder et al (Mulder et al, 1997), appears to reside in the -10 sequence, in particular the central two nucleotides of the hexamer. In MPI these nucleotides are GC where as in Mulder et al the corresponding nucleotides are TA, more closely resembling the E.coli a^^-like promoter consensus. The failure to identify a strong consensus promoter does not preclude the presence of a functional promoter in this region. Several reports have identified mycobacterial promoters that show weak or no homology to previously identified promoters (Bashyam et al, 1996; Jain et al, 1997; DasGupta et al, 1998), including a study demonstrating that a set of identified M.a.paratuberculosis promoters appear more similar to each other than to other mycobacterial promoters (Thomas et al, 1992). Similarly mycobacterial promoters with no recognisable -10 or -35 consensus sequences have been demonstrated to undergo specific up-regulation in response to environmental stress conditions.

Another possible reason for the failure to identify a promoter element was that the consensus sequence used for both the -35 and -10 regions and the methodology of aligning the small -35 and -10 regions to larger fragments may not have been sufficiently robust to detect a promoter element. The upstream region of the conserved mycobacterial p40 gene from several mycobacterial species was analysed for the presence of recognisable promoter elements using the same consensus -10 and -35 consensus hexamers. A promoter was identified in the upstream region located 7bp to the start of the gene. While the putative promoter has not been demonstrated to be transcriptionally active the finding of homologous -35 and -10 consensus sequences in the upstream p40 region demonstrate that it was possible to identify promoter consensus elements using this approach (Inglis et al, 2001).

Finally the lack of a promoter homologue in the upstream region may have also be indicative of the gene being part of an operon, transcribed from a distal promoter. The full annotation of both the M.avium and M.a.paratuberculosis genomes are currently unavailable and therefor the intergenic distance between the 34kDa putative serine protease and the upstream gene was not known. In M.tuberculosis the distance between the 34kDa putative serine protease homologue pepA and the upstream gene Rv0124 is 155 bp, sufficient for the presence of a promoter in that species. The 155 bp demonstrating little homology to the upstream region of the

165 34kDa putative serine protease, which may suggest that, the transcription of pepA in M.tuberculosis is different from the 34kDa putative serine protease in M.a.paratuberculosis. In essence to demonstrate the presence of a promoter in the upstream region, functional experimental evidence was required.

The 346 bp of 34kDa putative serine protease upstream sequence was demonstrated to be capable of expressing the protein in M.smegmatis mc^l55. This region therefore contains all the transcriptional signals necessary to express the gene in M.smegmatis mc^l55. Transcriptional activity was seen when the fragment was in both orientations relative to the plasmid. The backbone plasmid does not contain a transcriptional terminator in the immediate upstream region of the vector MCS used in the cloning procedure. As such the 34kDa putative serine protease detected by western blotting may have been the result of transcriptional read through from the surrounding plasmid DNA. Demonstrating expression of the gene in both orientations argues against transcriptional read through as being the source of the 34kDa putative serine protease.

The relative level of 34kDa putative serine protease protein expressed from its own promoter as detected on western blots was less than that for the hsp60 promoter expressed 34kDa putative serine protease, despite the fact that approximately equal amounts of protein were added to each well. The reason for this may be reflected in the relative activity of the two promoters. Dellagostin et al demonstrated that in terms of p-gal activity the M.leprae 18kDa promoter was weak compared to the hsp60 promoter in culture but that a large increase was seen for the 18kDa promoter in vivo (Dellagostin et al, 1995). The authors also noted high constitutive expression for the hsp60 promoter. The level of transcriptional activity for 34kDa putative serine protease promoter appears to be low under normal growth conditions in comparison to hsp60 promoter expression. This finding raised an interesting question as to promoter regulation, namely is the promoter a constitutively expressed promoter under all conditions or does it exhibit specific up-regulation under stress conditions? Further work would be required to determine the exact transcriptional signals resulting in expression of the 34kDa putative serine protease. Similarly further work would be necessary to confirm that a similar pattern of gene expression

1 6 6 from the 34kDa putative serine protease promoter was also seen in M.a.paratuberculosis.

Few transcriptional regulatory proteins have thus far been well characterised for mycobacteria. One exception is the iron dependant transcriptional repressor IdeR. In the presence of divalent metals, IdeR has been shown to bind to a number of so called “iron box” elements located upstream of several genes in mycobacteria

(Manabe et al, 1999), including Rv0983, annotated in the TUBERCULIST genome database as a M.tuberculosis serine protease homologue and also independently identified by Skeiky et al as MT32B, a major secreted putative serine protease of M.tuberculosis (Skeiky Y A, 1999). The potential regulation of a mycobacterial serine protease by IdeR initiated an analysis of the upstream region of the 34kDa putative serine protease for the presence of an “Iron Box” element. A 65% homologous sequence was identified approximately 250 base pairs from the start of the gene. It was also possible to show the presence of a IdeR homologue in the M.a.paratuberculosis unfinished genome (data not shown). Fusions of the 34kDa putative serine protease upstream promoter region with lacZ failed to demonstrate a role for IdeR in the regulation of the 34kDa putative serine protease. Gold et al, have recently published a comprehensive computer based analysis of the M.tuberculosis genome searching for potential IdeR binding sites (Gold et al, 2001). In their studies they use a cut off point of 5 mismatches between the target site and the consensus sequence. In the case of the IdeR box identified in the upstream region, 8 mismatches were observed. Similarly, the Rv0983 Iron Box homologue was shown to bind IdeR in gel shift experiments only and no experimental determination of transcriptional repression by IdeR was presented. More recent evidence has argued that Rv0983 is potentially part of a regulon of contiguous genes (Rv0981, Rv0982, Rv0983 and Rv0984) up-regulated by following SDS treatment (Manganelli et al, 2001). As such the assignation of a regulatory function to a homologous sequence based solely on gel shift may represent an artefact of that technique and not a true biologically significant interaction, is also thought to regulate the expression of another HtrA homologue in M.tuberculosis, which has been annotated as HtrA in the

TUBERCULIST database (Smith et a l, 1998). In E.coli degP QitrA) and degQ have been shown to be regulated in response to the accumulation of damaged or denatured

167 proteins in the periplasm (Laskowska et a l, 1996). The third HtrA homologue, degS, demonstrates constitutive expression under all conditions (Alba et a l, 2001). The p- gal activity of the transcriptional fusion was constitutively low in M.smegmatis mc^l55 under both low- and high-iron conditions and comparable to the levels seen in Sm3. These results complemented the low level of expression observed for expression of the 34kDa putative serine protease from its own promoter, relative to expression from the hsp60 promoter. The potential therefore exists that the gene is expressed at a constitutively low level under all growth conditions. However, it may also be the case that the promoter undergoes up-regulation in the host cell, similarly only a subset of environmental stimuli have been examined as potential up-regulators of the 34kDa putative serine protease promoter. Further work is required to fully elucidate the exact transcriptional activity both in culture under various stress conditions and in vivo. It must also be noted that the results presented here, relate specifically to the expression of the promoter in M.smegmatis, the possibility exists that the gene may not be regulated in the same way in M.a.paratuberculosis.

In conclusion, the evidence presented in this chapter suggests that a functional mycobacterial promoter is located in the 317 bp of sequence immediately upstream of the 34kDa putative serine protease in M.a.paratuberculosis. The exact mechanism regulating the transcriptional activity remains to be defined. However, and despite the presence of a IdeR box homologue in the upstream region, the promoter is not regulated by IdeR or iron concentration as no increase in expression was observed in iron depleted media or in an isogenic M.smegmatis mutant strain lacking IdeR. The identification of a promoter element suggests that the gene is not part of an operon, whose gene expression is controlled by a remote promoter. However, the exact location of promoter has not heen determined.

1 6 8 CHAPTER 6

GENERAL DISCUSSION

The central aim of the work presented in this thesis was to characterise further the M.a.paratuberculosis 34kDa putative serine protease, with particular focus on the role that the protein plays in the virulence of M.a.paratuberculosis. The 34kDa putative serine protease ORF was cloned into a mycobacterial shuttle vector under the transcriptional control of the hsp60 promoter. The expression and subsequent secretion of the recombinant protein by M.smegmatis mc^l55 was shown. This was of critical importance, as it appeared likely that secretion of the protein into the extracellular milieu may be required for any virulence-associated function. This observation was based on the antigenic properties of the protein in sheep naturally infected with M.a.paratuberculosis. A robust and reproducible intracellular survival assay was developed using OA-macrophages. The choice of OA-macrophages reflected a desire to develop an assay that approximated as closely as possible the type of host cells encountered by M.a.paratuberculosis during the course of natural infection. M.smegmatis mc^l55 expressing the 34kDa putative serine protease demonstrated increased survival in OA-macrophages over the initial 24 hours of infection in comparison to M.smegmatis expressing GFP and wild-type M.smegmatis mc^l55. The presence of the gene did not increase the ability of M.smegmatis to enter macrophages as no significant differences were observed between the experimental and control groups following phagocytosis. The overall increase in survival observed was low with the presence of the protein having no affect on the long-term intracellular survival of M.smegmatis mc^l55.

Transcriptional activity capable of expressing the gene in M.smegmatis mc^l55 was observed in the region immediately upstream of the 34kDa putative serine protease ORF. A similar level of increased intracellular survival was observed when the 34kDa putative serine protease was expressed in M.smegmatis mc^l55 from the endogenous promoter as observed when the 34kDa putative serine protease was expressed from the hsp60 promoter. An examination of the sequence upstream of the

169 34kDa putative serine protease revealed the presence of a putative IdeR regulatory sequence, an IdeR ‘box’. However, further studies failed to confirm a role for IdeR in the regulation of the transcriptional activity of the 34kDa putative serine protease in M.smegmatis mc^l55. Transcriptional start point mapping is required before the exact location of the promoter can be determined in the upstream region. Similarly, the regulatory mechanisms determining the expression of the 34kDa putative serine protease remain to be determined. The transcriptional activity and regulation of the promoter must be confirmed in M.a.paratuberculosis, as differences may exist in promoter recognition and activity between M.a.paratuberculosis and M.smegmatis.

6.1 The 34kDa Putative Serine Protease and Pathogenesis The inability of the 34kDa putative serine protease to prevent bacterial killing over 72 hours suggests that the presence of the protein is unable to prevent the acidification of the phagosome containing ingested mycobacterial and its entry into the late endosomal pathway. The protective function of the 34kDa putative serine protease in M.smegmatis mc^l55 was associated with the initial stages of infection following ingestion by macrophages. Phagocytic cells, including macrophages, are known to produce toxic oxygen metabolites following the ingestion of microorganisms (Krause, 2000). Superoxide can not only cause bacterial damage on its own but also participates in a chemical reaction with hydrogen peroxide and iron (the Fenton mechanism) that can produce an even more toxic hydroxyl radical (Miller and Britigan, 1997). Indeed, the function of HtrA in the pathogenesis of other intracellular pathogens has been postulated to be associated with the degradation of oxidatively damaged proteins in the periplasmic space, preventing their accumulation to toxic levels (Fallen and Wren, 1997). It is tempting to speculate that the presence of the 34kDa putative serine protease affords protection against such oxidative metabolites resulting in the observed increase in survival mM.smegmatis mc^l55.

There are currently two postulated mechanisms by which pathogenic mycobacteria protect themselves from toxic oxygen metabolites. Firstly, pathogenic mycobacteria are thought to enter mononuclear phagocytes via complement receptors and component C3, a mechanism that prevents the activation of an oxidative burst and its associated toxic consequences (Bermudez et a l, 1999; El Etr and Cirillo, 2001).

170 Secondly, pathogenic mycobacteria including M.avium have been shown to export an iron-dependant superoxide dismutase (SOD) that is almost exclusively associated with the cytosol or cell membrane of the non-pathogenic M.smegmatis and M.phlei (Harth and Horwitz, 1999; El Etr and Cirillo, 2001). However, no signal peptide element was observed at the N-terminal region of the protein. M.smegmatis was shown to be capable of exporting the M.avium SOD, suggesting that the nucleotide sequence of the recombinant protein contained all the requirements to direct the export of the protein (Escuyer et a l, 1996). The secretion of SOD by pathogenic strains may afford protection against oxygen metabolites in two ways. Firstly, by neutralising such toxic radicals before they can interact with the mycobacterial cell wall, and secondly, by limiting the availability of iron in the host cell for participation in the Fenton mechanism. The unique structure and composition of the mycobacterial cell envelope has been implicated as an important constitutive component of the virulence of mycobacterial species. Interestingly, a capsule has been observed to surround virulent mycobacteria growing intracellularly (Daffe and Etienne, 1999). The significance of such a structure in pathogenesis remains to be determined. However, it may prove pivotal in controlling the bacterial-host interaction and possibly also retain exported proteins crucial in the survival of the bacillus in the host mononuclear phagocyte.

The secretion of the 34kDa putative serine protease may facilitate the degradation of oxidatively damaged or denatured proteins associated with the mycobacterial outer cell wall or possibly the proposed protective capsule. Such damaged proteins could be inaccessible to degradation by membrane associated or cytosolic proteases. Under this hypothesis the 34kDa putative serine protease is acting to prevent the accumulation of damaged proteins, maintaining the integrity of the cell wall or capsule. The secreted protein would therefore be expected to be associated with the bacillus in the phagosome of the infected phagocytic cell. The immunological detection of the 34kDa putative serine protease in infected macrophages was attempted but was unsuccessful. Further work using polyclonal antibodies against the 34kDa putative serine protease is required to demonstrate the presence of the recombinant protein in infected macrophages and also to indicate the cellular fate of the secreted protein. It remains possible that the 34kDa putative serine protease is not

171 associated with the mycobacterial cell in the phagosome, implying a direct interaction between the protein and components of the host cell. Similarly, further studies of the intracellular survival of M.smegmatis mc^l55 expressing a 34kDa putative serine protease derivative lacking the signal peptide would ascertain if the secretion of the protein were critical in the function of the 34kDa putative serine protease.

Other extracellular proteins exported by M.tuberculosis have been implicated in pathogenesis, including the mycolyl transferases of the Antigen 85 complex, glutamine synthetase, and the macrophage cell entry protein (Andersen et a l, 1992; Arruda et a l, 1993; Harth et a l, 1994; Belisle et a l, 1997). Indeed, M.smegmatis expressing the M.tuberculosis glutamine synthase {glnA) gene exhibited increased survival in THP-1 macrophage-like cell line (Miller and Shinnick, 2000). A recent comparison of pathogenic and non-pathogenic mycobacterial species revealed eight differences in the extracellular location, secreted or surface exposed, of enzymatically active proteins in M.tuberculosis and M.avium that are predominantly associated with the cytosol or located deeper in the cell envelope in the non- pathogenic strains M.smegmatis and M.phlei (Raynaud et a l, 1998). The export of proteins by pathogenic mycobacteria into the extracellular environment therefore represents a significant difference between pathogenic and non-pathogenic mycobacterial species with important implications for host-pathogen interaction.

6.2 HtrA-like Proteins in Mycobacteria There are three HtrA-like genes in the annotated genome of M.tuberculosis H37Rv, namely htrA,pepA and Rv0983, for which limited functional information is available in the literature (Wu et a l, 1997; Skeiky et a l, 1999; Miller and Shinnick, 2000; Manganelli et a l, 2001). M.tuberculosis HtrA has been shown to be located

downstream from and co-transcribed with the alternative sigma factor, (W u et al, 1997). Interestingly, expression of the M.tuberculosis HtrA gene in M.smegmatis did not increase the intracellular survival of the bacillus in mononuclear phagocytes, questioning the role of the protein in the pathogenesis of M.tuberculosis (Miller and Shinnick, 2000). However, this does not preclude the involvement of HtrA in pathogenesis as the protein may function differently in M.tuberculosis.

172 M.tuberculosis HtrA (549 amino acids) homologues were identified in the genomes of M.leprae, M.bovis, M.avium and M.smegmatis (Table 6.1).

Rv0983 (MTB32B) was shown to be present in the CF of M.tuberculosis, although no recognisable signal peptidase cleavage site was found (Skeiky et al, 1999). This suggests that the protein may be surface exposed or is exported via an alternative mechanism as has been proposed for both the M.tuberculosis SOD and glutamine synthase proteins (Harth and Horwitz, 1999). Highly conserved homologues of Rv0983 were found in the genomes o îM.leprae, M.bovis, M.avium m d M.smegmatis (Table 6.2). Recently, Rv0983 has been postulated to be part of a regulon of four genes in M.tuberculosis regulated by in response to SDS-stress (Manganelli et al, 2001). The presence of highly conserved orthologues of both Rv0983 and HtrA in both pathogenic and non-pathogenic mycobacteria and their regulation by a stress associated alternative sigma factor suggests that they represent a conserved feature of the mycobacterial stress response.

M.tuberculosis PepA was also shown to be an important component of the M.tuberculosis CF demonstrating significant homology to M.a.paratuberculosis 34kDa putative serine protease (Table 6.3). The proteins also share several phenotypic similarities including the extracellular location of the protein and associated antigenic properties (Cameron et a l, 1994; Skeiky et al, 1999). Therefore, it appears likely that PepA is the functional homologue of the 34kDa putative serine protease in M.tuberculosis. The 34kDa putative serine protease is highly conserved in the genomes of M.bovis and M.leprae but not in the genome of the non-pathogenic M.smegmatis strain (Table 6.3). Although it should be noted that confirmation of the absence of a conserved 34kDa putative serine protease homologue in the genome of M.smegmatis is required upon completion of the genome sequence. However, given the high level of sequence identity observed and the evidence provided in this thesis the possibility remains that such proteins may represent an important conserved feature of mycobacterial pathogenesis. However, this remains speculative as no role in pathogenesis for either PepA or ML2659 has been reported in the literature.

173 Mycobacterial Identity Probability Source Species (ORF) Score M.avium 74% identity in 1.9e-194 TIGR M.avium genome sequencing (Unassigned**) 506 amino acid project http://tigrblast.tigr.org/ufmg/ overlap

M.leprae 81.8% identity in 0 Pasteur Institute LEPROMA (HtrA) 533 amino acid database http://genolist.pasteur.fr/Leproma/ overlap

M.bovis 87% identity in 2.2e-239 Welcome Sanger Centre M.bovis (Unassigned**) 540 amino acid genome sequencing project http://www.sanger.ac.uk/Projects/ overlap M_bovis/blast_server.shtmI

M.smegmatis 68% identity l.le-176 TIGR M.smegmatis genome (Unassigned**) over 508 amino sequencing project http://tigrblast.tigr.org/ufmg/ acids

Table 6.1 Homologues of the M.tuberculosis HtrA in the genomes of other mycobacterial species. For the unfinished genomes of M.avium, M.bovis and M.smegmatis the entire 542 amino acids of HtrA were used to search the unfinished genome using the TBLASTN facility provided by the corresponding database server. Unassigned**; no genomic annotation available. M.tuberculosis HtrA was also detected in the genomes of M.tuberculosis CDC1551 (annotated as MT0133) and M.tuberculosis 210.

174 Mycobacterial Identity Probability Source Species (ORF) Score M.avium 74% identity in 3.6e-106 TIGR M.avium genome (Unassigned**) 458 amino acid sequencing project http://tigrblast.tigr.org/ufmg/ overlap

M.leprae 74.5% identity e-134 Pasteur Institute LEPROMA (ML0176) in 467 amino database http://genoIist.pasteur.fr/Leproma/ acid overlap

M.bovis 78% identity in 6.7e-179 Welcome Sanger Centre M.bovis (Unassigned**) 464 amino acid genome sequencing project http://www.sanger.ac.uk/Projects/ overlap M_bovis/blast_server.shtml

M.smegmatis 67% identity in 3.5e-147 TIGR M.smegmatis genome (Unassigned**) 458 amino acid sequencing project http://tigrblast.tigr.org/ufmg/ overlap

Table 6.2 Homologues of the M.tuberculosis Rv0983 in the genomes of other mycobacterial species. For the unfinished genomes of M.avium, M.bovis and M.smegmatis the entire 464 amino acids of Rv0983 were used to search the unfinished genome using the TBLASTN facility provided by the corresponding database server. Unassigned** no genomic annotation available. M.tuberculosis Rv0983 was also detected in the genomes of M.tuberculosis CDC1551 genome (annotated as M TlOll) md M.tuberculosis 210.

175 Mycobacterial Identity Probability Source Species Score M.tuberculosis 70.7% identity e-143 Pasteur Institute TUBERCULIST (PepA*) in 362 amino database http://genoIist.pasteur.fr/TubercuLis1 acid overlap

M.leprae 71.4% identity e-145 Pasteur Institute LEPROMA (ML2659) in 364 amino database http://genolist.pasteur.fr/Leproma/ acid overlap

M.bovis 71% identity in 8.9e-119 Welcome Sanger Centre M.bovis (Unassigned**) 316 amino acid genome sequencing project http://www.sanger.ac.uk/Projects/ overlap Mbovis/blastserver.shtml

M.smegmatis 46% identity in 1.5e-66 TIGR M.smegmatis genome (Unassigned**) 309 amino acid sequencing project http://tigrblast.tigr.org/ufmg/ overlap

Table 6.3 Homologues of the 34kDa putative serine protease in the genomes of other mycobacterial species. For the unfinished genomes o f M.bovis and M.smegmatis the entire 361 amino acids of 34kDa putative serine protease were used to search the unfinished genome using the TBLASTN faeility provided by the corresponding database server. Unassigned**; no annotation available. PepA* has also been shown to be present in the genomes of M.tuberculosis strain 210 and M.tuberculosis strain CDC1551 (annotated as MT0133).

176 The sequencing of the attenuated vaccine strain M.bovis BCG Pasteur is ongoing

(http://www.pasteur.fr/recherche/unites/Lgmb/mycogenomics.html), with no BLAST facility available yet to confirm the presence or absence of any mycobacterial HtrA like genes in this species. Numerous genome deletions and tandem duplications have been reported in M.bovis BCG relative to M.tuberculosis H37Rv (Behr et a l, 1999). However, the deleted regions identified do not correspond to the genomic regions encoding htrA, Rv0983 or pepA in the M.tuberculosis H37Rv genome (http://www.pasteur.fr/recherche/unites/Lgmb/Deletion.html).

All three HtrA-like proteins in M.tuberculosis (PepA, Rv0983 and HtrA) demonstrate greater sequence identity to each other than to other HtrA like proteins from other bacterial families. However, they still retain the conserved features of a trypsin like serine protease (see Figure 1.1) and as such they represent an orthologous group of proteins. Each HtrA demonstrates greater homology to the corresponding paralogue in other mycobacterial species. The high level of sequence conservation observed suggests that these proteins fulfil conserved roles in mycobacteria. The presence of homologues of Rv0983 and HtrA in the non- pathogenic M.smegmatis suggest that these genes and the corresponding proteins may be components of a general stress response common to mycobacteria in general. However the apparent lack of a 34kDa putative serine protease homologous gene in M.smegmatis suggests that this particular paralogous group may have a conserved role in pathogenesis possibly associated with increased survival in the intracellular environment of the host cell. Under this hypothesis all three HtrA like proteins in mycobacteria function as serine proteases protecting the bacilli during stress, with the 34kDa putative serine protease and its orthologues affording protection in the intracellular environment.

The sequencing of the attenuated vaccine strain M.bovis BCG Pasteur is ongoing

177 However, the deleted regions identified do not correspond to the genomic regions encoding htrA, Rv0983 or pepA in the M.tuberculosis H37Rv genome (http://www.pastenr.ff/recherche/nnites/Lgmh/Deletion.html).

Mycobacterial pathogenesis is a complicated and dynamic process requiring numerous protein products co-ordinately expressed by the bacillus in response to the changing environment of the host mononuclear phagocyte. The precise mechanisms that permit the bacillus to survive and replicate intracellularly remain to be fully determined. The continuing development of techniques to examine the mycobacterial transcriptome and proteome coupled to the complete genome sequence of the bacillus will greatly enhance our understanding of the underlying molecular mechanisms of mycobacterial pathogenesis. The evidence presented here indicates that the 34kDa putative serine protease may protect M.a.paratuberculosis from oxidative damage in host macrophages, and possibly represents a conserved protective mechanism shared among all pathogenic mycobacteria.

6.3 Future Work The exact function that the 34kDa putative serine protease plays in the virulence of M.a.paratuberculosis remains to be determined. Several observations from the work presented here merit further investigation. The extracellular location of the protein is considered a crucial component in the observed increase in intracellular survival for M.smegmatis expressing the 34kDa putative serine protease. Information regarding the cellular fate of the secreted protein would indicate whether or not the protein is associated with the ingested bacillus, supporting the hypothesis that the 34kDa putative serine protease affords protection against the effects of host oxidative metabolites. Similarly, expressing the 34kDa putative serine protease without the signal peptide in M.smegmatis would also confirm the requirement of the gene in the extracellular milieu for its protective function.

While it appears likely that a promoter is located in the upstream region of the gene in M.a.paratuberculosis, the exact location of such a promoter element and the environmental conditions controlling its transcriptional activity remain to be determined. Characterisation of the presence of a 34kDa putative serine protease

178 homologue in the genomes of other non-pathogenic mycobacteria may help to establish if the presence of a homologous protein is associated exclusively with the pathogenic members of the genus. Finally, of critical importance in confirming a role in M.a.paratuberculosis virulence for the 34kDa putative serine protease is the determination of the phenotypic characterisation of a M.a.paratuberculosis null mutant in OA-macrophages and ultimately in animal models. Techniques allowing the selective replacement of gene sequences with inactivated copies have been developed for mycobacteria. Attempts have already been made to apply such techniques in the generation of null mutants in M.a.paratuberculosis at the University of Surrey. The successful application of reverse genetic techniques to M.a.paratuberculosis remains a priority in determining the role that the 34kDa putative serine protease and possibly other M.a.paratuberculosis gene sequences play in pathogenesis.

179 LITERATURE CITED

Alba,B-M., Zhong,HJ., PelayoJ.C., and Gross,C.A. (2001) degS (hhoB) is an essential Escherichia coli gene whose indispensable function is to provide sigma miWiXy Mol.Microbiol 40: 1323-1333.

Anes,E., Portugal,!., and Moniz-Pereira,J. (1992) Insertion into the Mycobacterium smegmatis genome of the aph gene through lysogenization with the temperate mycobacteriophage Ms6 FEMS Microbiol.Lett. 74: 21-25.

Andersen,A.B., Andersen,P., and Ljungqvist,L. (1992) Structure and function of a 40,000-molecular-weight protein antigen of Mycobacterium tuberculosis Infect.Immun. 60: 2317-2323.

Anderson,B., Jones,D., and Burgess,A. (1996) Cloning, expression and sequence analysis of the Bartonella henselae gene encoding the HtrA stress-response protein GgHgl78: 35-38.

Arbeit,R.D., Slutsky,A., Barber,T.W., Maslow,J.N., Niemczyk,S., Falkinham,J.O., Ill, O'Connor,G.T., and von Reyn,C.F. (1993) Genetic diversity among strains of Mycobacterium avium causing monoclonal and polyclonal bacteremia in patients With ATDS J.Infect.Dis. 167: 1384-1390.

Arruda,S., Bomfim,G., Knights,R., Huima-Byron,T., and Riley,L.W. (1993) Cloning of an M. tuberculosis DNA fragment associated with entry and survival inside cells Science 26\\ \A5A-\A51.

Bachrach,G., Colston,M.J., Bercovier,H., Bar-Nir,D., Anderson,C., and Papavinasasundaram,K.G. (2000) A new single-copy mycobacterial plasmid, pMFl, from Mycobacterium fortuitum which is compatible with the pAL5000 replicon Microbiology 146: 297-303.

Balasubramanian,V., Pavelka,M.S., Jr., Bardarov,S.S., Martin,J., Weisbrod,T.R., McAdam,R.A., Bloom,B.R., and Jacobs,W.R., Jr. (1996) Allelic exchange in Mycobacterium tuberculosis with long linear recombination substrates J.Bacteriol. 178:273-279.

Bannantine,J.P., Barletta,R.G., Thoen,C.O., and Andrews,R.E., Jr. (1997) Identification of Mycobacterium paratuberculosis gene expression signals Microbiology 143: 921-928.

Bannantine,J.P., StabefJ.R. (2000) HspX is present within Mycobacterium paratuberculosis-'mÏQciQd macrophages and is recognized by sera from some infected cattle Vet.Microbiol. 76: 343-358.

Bannantine,J.P., StabefJ.R. (2001) Identification of two Mycobacterium avium subspecies paratuberculosis gene products differentially recognised by sera from rabbits immunised with live mycobacteria but not heat-killed mycobacteria J.Med.Microbiol. 50: 795-804.

180 BannantineJ.P., Baechler,E., Zhang,Q., Li,L., and Kapur,V. (2002) Genome Scale Comparison of Mycobacterium avium subsp. paratuberculosis with Mycobacterium avium subsp. avium Reveals Potential Diagnostic Sequences J. Clin Microbiol 40: 1303-1310.

Banu,S., Honore,N., Saint-Joanis,B., Philpott,D., Prevost,M.C., and Cole,S.T. (2002) Are the PE-PGRS proteins of Mycobacterium tuberculosis variable surface antigens? MolMicrobiol 44: 9-19.

Barclay,R., Ratledge,C. (1988) Mycobactins and exochelins of Mycobacterium tuberculosis, M. bovis, M. africanum and other related species J. Gen.Microbiol 134 : 771-776.

Bardarov,S., Kriakov,J., Carriere,C., Yu,S., Vaamonde,C., McAdam,R.A., Bloom,B.R., Hatfull,G.F., and Jacobs,W.R., Jr. (1997) Conditionally replicating mycobacteriophages : a system for transposon delivery to Mycobacterium tuberculosis Proc.NatlAcad.Sci.U.S.A 94: 10961-10966.

Barker,L.P., George,K.M., Falkow,S., and Small,P.L. (1997) Differential trafficking of live and dead Mycobacterium marinum organisms in macrophages Infect.Immun. 65: 1497-1504.

Barker,L.P., Brooks,D.M., and SmalfP.L. (1998) The identification of Mycobacterium marinum genes differentially expressed in macrophage phagosomes using promoter fusions to green fluorescent M olM icrobiol 29: 1167-1177.

Barker,L.P., Porcella,S.F., Wyatt,R.G., and SmalfP.L. (1999) The Mycobacterium marinum G13 promoter is a strong sigma 70-like promoter that is expressed in Escherichia coli and mycobacteria species FEMS Microbiol.Lett. 175: 79-85.

Barksdale,L., Kim,K.S. (1977) Mycobacterium Bacteriol.Rev. 41: 217-372.

Barletta,R.G., Kim,D.D., Snapper,S.B., Bloom,B.R., and Jacobs,W.R., Jr. (1992) Identification of expression signals of the mycobacteriophages Bxbl, LI and TM4 using the Escherichia-Mycobacterium shuttle plasmids pYUB75 and pYUB76 designed to create translational fusions to the lacZ gene J.Gen.Microbiol. 138: 23-30.

Bames,P.F., Chatterjee,D., Abrams, J. S., Lu,S., Wang,E., Yamamura,M., Brennan,P. J., and Modlin,R.L. (1992a) Cytokine production induced by Mycobacterium tuberculosis lipoarabinomannan. Relationship to chemical structure J.Immunol 149: 541-547.

Barnes,P.F., Chatterjee,D., Brennan,P.J., Rea,T.H., and Modlin,R.L. (1992b) Tumor necrosis factor production in patients with lepvosy Infect.Immun. 60: 1441-1446.

Bashyam,M.D., KaushafD., DasGupta,S.K., and Tyagi,A.K. (1996) A study of mycobacterial transcriptional apparatus: identification of novel features in promoter QlemQuis J.Bacteriol. 178: 4847-4853.

Bashyam,M.D., Tyagi,A.K. (1998) Identification and analysis of "extended -10" promoters from mycohaciena. J.Bacteriol. 180: 2568-2573.

181 Bass,s., Gu,Q., and Christen,A. (1996) Multicopy suppressors of prc mutant Escherichia coli include two HtrA (DegP) protease homologs (HhoAB), DksA, and a truncated RlpAy.Rac/eno/. 178: 1154-1161.

Baulard,A., Kremer,L., and Locht,C. (1996) Efficient homologous recombination in fast-growing and slow-growing mycobacteria J.Rac/eno/. 178: 3091-3098.

Baumler,A.J., Kusters,J.G., Stojiljkovic,!., and Heffron,F. (1994) Salmonella typhimurium loci involved in survival within macrophages Infect.Immun. 62: 1623- 1630.

Beard,P.M., Rhind,S.M., Buxton,D., Daniels,M.J., Henderson,D., Pirie,A., Rudge,K., Greig,A., Hutchings,M.R., Stevenson,K., and Sharp, J.M. (2001a) Natural paratuberculosis infection in rabbits in Scotland J. Comp Pathol. 124: 290-299.

Beard,P.M., Daniels,M.J., Henderson,D., Pirie,A., Rudge,K., Buxton,D., Rhind,S., Greig,A., Hutchings,M.R., McKendrick,!., Stevenson,K., and Sharp,J.M. (2001b) Paratuberculosis infection of nonruminant wildlife in Scotland J. Clin.Microbiol 39: 1517-1521.

Begara-McGorum,I.M., Wildblood,L.A., and Jones,D.G. (1997) Early immune events following experimental infection of lambs with Mycobacterium avium paratuberculosis Biochem.Soc.Trans. 25: 2798.

Begara-McGorum,!., Wildblood,L.A., Clarke,C.J., Connor,K.M., Stevenson,K., Mclnnes,C.J., Sharp,J.M., and Jones,D.G. (1998) Early immunopathological events in experimental ovine paratuberculosis Vet.Immunol.Immunopathol. 63: 265-287.

Beggs,M.L., Crawford,J.T., and Eisenach,K.D. (1995) Isolation and sequencing of the replication region of Mycobacterium avium plasmid pLR7 J.Bacteriol. 177: 4836-4840.

Behr,M.A., Wilson,M.A., GilfW.P., Salamon,H., Schoolnik,G.K., Rane,S., and Small,P.M. (1999) Comparative genomics of BCG vaccines by whole-genome DNA microarray Science 284: 1520-1523.

Belisle,J.T., Vissa,V.D., Sievert,!., Takayama,K., Brennan,P.J., and Besra,G.S. (1997) Role of the major antigen of Mycobacterium tuberculosis in cell wall biogenesis Science 276: 1420-1422.

Benedictus,G., Dijkhuizen,A.A., and Stelwagen,!. (1987) Economic losses due to paratuberculosis in dairy cattle Vet.Rec. 121: 142-146.

Bermudez,L.E., Goodman,!., and Petrofsky,M. (1999) Role of complement receptors in uptake of Mycobacterium avium by macrophages in vivo: evidence from studies using CD18-deficient mice/p/bc/./mmwH. 67: 4912-4916.

Billman-Jacobe,H., Carrigan,M., Cockram,F., Comer,L.A., GilfI.J., HilfJ.F., Jessep,T., Milner,A.R., and Wood,P.R. (1992) A comparison of the interferon gamma assay with the absorbed ELISA for the diagnosis of Johne's disease in cattle Aust.Vet.J. 69: 25-28.

182 Boelaert,F., Walravens,K., Biront,?., Vermeersch,J.P., Berkvens,D., and Godfroid,!. (2000) Prevalence of paratuberculosis (Johne's disease) in the Belgian cattle population Vet.Microbiol. 77: 269-281.

Boyd,J., Oza,M.N., and Murphy,J.R. (1990) Molecular cloning and DNA sequence analysis of a diphtheria tox iron-dependent regulatory element {dtxR) from Corynebacterium CvphfhQxidiQ Proc.NatlAcad.Sci.U.S.A 87: 5968-5972.

Brant,S.R., Fu,Y., Fields,C.T., Baltazar,R., Ravenhill,G., Pickles,M.R., Rohal,P.M., Mann,!., Kirschner,B.S., !abs,E.W., Bayless,T.M., Hanauer,S.B., and Cho,!.H. (1998) American families with Crohn's disease have strong evidence for linkage to chromosome 16 but not chromosome 12 Gastroenterology 115: 1056-1061.

Brennan,M.!., Delogu,G., Chen,Y., Bardarov,S., Kriakov,!., Alavi,M., and !acobs,W.R., Jr. (2001) Evidence that mycobacterial PE PGRS proteins are cell surface constituents that influence interactions with other cqWs Infect.Immun. 69: 7326-7333.

Brennan,?.!., Nikaido,H. (1995) The envelope of mycobacteria Annu.Rev.Biochem. 64: 29-63.

Brosch,R., Gordon,S.V., Pym,A., Eiglmeier,K., Gamier,T., and Cole,S.T. (2000a) Comparative genomics of the mycohaciQrm Int. J.Med.Microbiol. 290: 143-152.

Brosch,R., Gordon,S.V., Eiglmeier,K., Gamier,T., and Cole,S.T. (2000b) Comparative genomics of the leprosy and tubercle bacilli Res.Microbiol. 151: 135- 142.

Brosch,R., Pym,A.S., Gordon,S.V., and Cole,S.T. (2001) The evolution of mycobacterial pathogenicity: clues from comparative genomics Trends Microbiol. 9: 452-458.

Buergelt,C.D., Layton,A.W., Ginn,P.E., Taylor,M., King,!.M., Habecker,P.L., Mauldin,E., Whitlock,R., Rossiter,C., and Collins,M.T. (2000) The pathology of spontaneous paratuberculosis in the North American bison (Bison bison) Vet.Pathol. 37: 428-438.

Bull,T.!., Hermon-Taylor,!., Pavlik,!., I, El Zaatari,?., and Tizard,M. (2000a) Characterization of ISPOO loci in Mycobacterium avium subsp. paratuberculosis and development of multiplex PCR typing Microbiology 146: 3285.

Bull,T.!., Sheridan,!.M., Martin,H., Sumar,N., Tizard,M., and Hermon-Taylor,!. (2000b) Further studies on the GS element. A novel mycobacterial insertion sequence (IS7 672), inserted into an acetylase gene {mpd) in Mycobacterium avium subsp. silvaticum but not in Mycobacterium avium subsp. paratuberculosis Vet.Microbiol 77: 453-463.

Burrells,C., Inglis,N.F., Davies,R.C., and Sharp,!.M. (1995) Detection of specific T cell reactivity in sheep infected with Mycobacterium avium subspecies silvaticum and paratuberculosis using two defined mycobacterial antigens Vet.Immunol.Immunopathol. 45: 311-320.

183 Burrells,C., Clarke,C.J., Colston,A., Kay,J.M., Porter,!., Little,D., and Sharp,J.M. (1998) A study of immunological responses of sheep clinically-affected with paratuberculosis (Johne's disease). The relationship of blood, mesenteric lymph node and intestinal lymphocyte responses to gross and microscopic pathology Vet.ImmunolJmmunopathol. 66: 343-358.

Burrells,C., Clarke,C.J., Colston,A., Kay,J.M., Porter,!., Little,D., and Sharp,!.M. (1999) Interferon-gamma and interleukin-2 release by lymphocytes derived from the blood, mesenteric lymph nodes and intestines of normal sheep and those affected with paratuberculosis (!ohne's disease) Vet.ImmunolJmmunopathol. 68: 139-148.

Cameron, R.M. Characterisation of a Putative Serine Protease expressed in vivo by Mycobacterium avium paratuberculosis. 1996. PhD Thesis, University of Edinburgh.

Cameron,R.M., Stevenson,K., Inglis,N.F,, Klausen,!,, and Sharp,!.M. (1994) Identification and characterization of a putative serine protease expressed in vivo by Mycobacterium avium paratuberculosis Microbiology 140: 1977-1982.

Carroll,!.D., Wallace,R.C., Keane,!., Remold,H.G., and Arbeit,R.D. (2000) Identification of Mycobacterium avium DNA sequences that encode exported proteins by using phoA gene fusions Tuber.Lung Dis. 80: 117-130.

Cates,G.A., Yang,Y.P., Klyushnichenko,V., Oomen,R., and Loosmore,S.M. (2000) Properties of recombinant HtrA: an otitis media vaccine candidate antigen from non- iy\)Qdao\Q Haemophilus influenzae Dev.Biol.(Basel) 103: 201-204.

Cavanaugh,!.A., Callen,D.F., Wilson,S.R., Stanford,P.M., Sraml,M.E., Gorska,M., Crawford,!., Whitmore,S.A., ShlegefC., Foote,S., Kohonen-Corish,M., and Pavli,P. (1998) Analysis of Australian Crohn's disease pedigrees refines the localization for susceptibility to inflammatory bowel disease on chromosome 16 Ann.Hum.Genet. 62:291-298.

Cavaignac,S.M., White,S.!., de Lisle,G.W., and Collins,D.M. (2000) Construction and screening of Mycobacterium paratuberculosis insertional mutant libraries Arch.Microbiol. 173: 229-231.

Chatfield,S.N., Strahan,K., Pickard,D., Charles,I.G., Hormaeche,C.E., and Dougan,G. (1992) Evaluation of Salmonella typhimurium strains harbouring defined mutations in htrA and aroA in the murine salmonellosis model Microb.Pathog. 12: 145-151.

Chatterjee,D., Roberts,A.D., Lowell,K., Brennan,P.!., and Orme,I.M. (1992) Structural basis of capacity of lipoarabinomannan to induce secretion of tumor necrosis ïdiciov Infect.Immun. 60: 1249-1253.

Chiba,M., Fukushima,T., Horie,Y., Iizuka,M., and Masamune,0. (1998) No Mycobacterium paratuberculosis detected in intestinal tissue, including Peyer's patches and lymph follicles, of Crohn's àiSQdiSQ J.Gastroenterol. 33: 482-487.

184 Chiodini,RJ., van Kruiningen,HJ. (1983) Eastern white-tailed deer as a reservoir of ruminant paratuberculosis 182: 168-169.

Chiodini,R.J., van Kruiningen,H.J., and Merkal,R.S. (1984) Ruminant paratuberculosis (Johne's disease): the current status and future prospects Cornell Rgr. 74:218-262.

Chiodini,R.J., van Kruiningen,H.J. (1986) The prevalence of paratuberculosis in culled New England cattle Cornell Vet. 76: 91-104.

Chiodini,R.J. (1989a) The genetic relationship between Mycobacterium paratuberculosis and the M. avium complex Acta Leprol. 1 Suppl 1: 249-251.

Chiodini,R.J. (1989b) Crohn's disease and the mycobacterioses: a review and comparison of two disease entities Clin.Microbiol.Rev. 2: 90-117.

Cho,S.N., Brennan,P.J., Yoshimura,H.H., Korelitz,B.L, and Graham,D.Y. (1986) Mycobacterial aetiology of Crohn's disease: serologic study using common mycobacterial antigens and a species-specific glycolipid antigen from Mycobacterium paratuberculosis Gut 21: 1353-1356.

Clarke,C.J., Patterson,!A., Armstrong,K.E., and Low,J.C. (1996a) Comparison of the absorbed ELISA and agar gel immunodiffusion test with clinicopathological findings in ovine clinical paratuberculosis Vet.Rec. 139: 618-621.

Clarke,C.J., Little,D. (1996) The pathology of ovine paratuberculosis: gross and histological changes in the intestine and other tissues J.Comp Pathol. 114: 419-437.

Clarke,C.J. (1997a) The pathology and pathogenesis of paratuberculosis in ruminants and other J.Comp Pathol. 116: 217-261.

Clarke,C.J. (1997b) Paratuberculosis and molecular biology Vet.J. 153: 245-247.

Clarkston,W.K., Presti,M.E., Petersen,P.F., Zachary,P.E., Jr., Fan,W.X., Leonardi,C.L., Vemava,A.M., Ill, Longo,W.E., and Kreeger,J.M. (1998) Role of Mycobacterium paratuberculosis in Crohn's disease: a prospective, controlled study using polymerase chain reaction Dis. Colon Rectum 41: 195-199.

Clemens,D.L., Horwitz,M.A. (1995) Characterization of the Mycobacterium tuberculosis phagosome and evidence that phagosomal maturation is inhibited J.Exp.Med. 181: 257-270.

Clemens,D.L. (1996) Characterization of the Mycobacterium tuberculosis phagosome Trends Microbiol. 4: 113-118.

Clemens,D.L., Horwitz,M.A. (1996) The Mycobacterium tuberculosis phagosome interacts with early endosomes and is accessible to exogenously administered XmnsÏQu'm J.Exp.Med. 184: 1349-1355.

Cocito,C., Gilot,P., Coene,M., de Kesel,M., Poupart,P., and VannuffefP. (1994) Paratuberculosis Clin.Microbiol.Rev. 7: 328-345.

185 Coetsier,C., Vannuffel,P., Blondeel,N., DenefJ.F., Cocito,C., and GalaJ.L. (2000) Duplex PGR for differential identification of Mycobacterium bovis, M. avium, and M. avium subsp. paratuberculosis in formalin- fixed paraffin- embedded tissues ïrom cdXÛQ J. Clin.Microbiol. 38: 3048-3054.

Coffin,J.W., Condon,C., Compston,C.A., Potter,K.N., Lamontagne,L.R., Shafiq,J., and Kunimoto,D.Y. (1992) Use of restrietion fragment length polymorphisms resolved by pulsed- field gel electrophoresis for subspecies identification of mycobacteria in the Mycobacterium avium complex and for isolation of DNA probes J.Clin.Microbiol. 30: 1829-1836.

Cole,S.T., Brosch,R., ParkhilfJ., Garnier,T., Churcher,C., Harris,D., Gordon,S.V., Eiglmeier,K., Gas,S., Barry,C.E., Ill, Tekaia,F., Badcock,K., Basham,D., Brown,D., Chillingworth,T., Connor,R., Davies,R., Devlin,K., Feltwell,T., Gentles,S., Hamlin,N., Holroyd,S., Homsby,T., Jagels,K., Barrell,B.G., and . (1998) Deciphering the biology of Mycobacterium tuberculosis from the complete genome sequence Nature 393: 537-544.

Cole,S.T., Eiglmeier,K., Parkhill,!., James,K.D., Thomson,N.R., Wheeler,P.R., Honore,N., Gamier,!., Churcher,C., Harris,D., Mungall,K., Basham,D., Brown,D., Chillingworth,T., Connor,R., Davies,R.M., Devlin,K., Duthoy,S., Feltwell,T., Fraser,A., Hamlin,N., Holroyd,S., Hornsby,!., Jagels,K., Lacroix,C., Maclean,J., Moule,S., Murphy,L., 01iver,K., QuaifM.A., Rajandream,M.A., Rutherford,K.M., Rutter,S., Seeger,K., Simon,S., Simmonds,M., Skelton,!., Squares,R., Squares,S., Stevens,K., Taylor,K., Whitehead,S., Woodward,J.R., and Barrell,B.G. (2001) Massive gene decay in the leprosy bacillus Nature 409: 1007-1011.

Collins,D.M., Gabric,D.M., and de Lisle,G.W. (1990) Identification of two groups of Mycobacterium paratuberculosis strains by restriction endonuclease analysis and DNA \\yhnà\z?N\on J.Clin.Microbiol. 28: 1591-1596.

Collins,D.M., Stephens,D.M., and de Lisle,G.W. (1993) Comparison of polymerase chain reaction tests and faecal culture for detecting Mycobacterium paratuberculosis in bovine faeces Vet.Microbiol. 36: 289-299.

Collins,D.M., Cavaignac,S., and de Lisle,G.W. (1997) Use of four DNA insertion sequences to characterize strains of the Mycobacterium avium complex isolated from Mol. Cell Probes 11: 373-380.

Collins,P., Matthews,!.R., McDiarmid,A., and Brown,A. (1983) The pathogenicity of Mycobacterium avium and related mycobacteria for experimental animals J.Med.Microbiol. 16: 27-35.

Colombel,J.F., Cortot,A., and van Kruiningen,H.J. (2001) Antibiotics in Crohn's disease Gut 48: 647.

Cowley,S.C., Av-Gay,Y. (2001) Monitoring promoter activity and protein localization in Mycobacterium spp. using green fluorescent protein Gene 264: 225- 231.

186 Cousins,D.V., Evans,R.J., and Francis,B.R. (1995) Use of BACTEC radiometric culture method and polymerase chain reaction for the rapid screening of faeces and tissues ÏOX Mycobacterium paratuberculosis Aust.Vet.J. 72: 458-462.

Cousins,D.V., Whittington,R., Marsh,!., Masters,A., Evans,R.J., and Kluver,P. (1999) Mycobacteria distenct from Mycobacterium avium subsp. paratuberculosis isolated from the faeces of ruminants possess ISP6)6^-like sequences detectable ISP06) polymerase chain reaction: implications for diagnosis Mol. Cell Probes 13: 431-442.

Cousins,D.V., Williams,S.N., Hope,A., and Eamens,G.J. (2000) DNA fingerprinting of Australian isolates of Mycobacterium avium subsp paratuberculosis using 1S900 BJV? Aust.Vet.J. 78: 184-190.

Crawford,!.T., Bates,!.H. (1984) Restriction endonuclease mapping and cloning o f Mycobacterium plasmid pLR7 Gene 27: 331-333.

Crawford,!.!., Bates,!.H. (1986) Analysis of plasmids in Mycobacterium avium- intracellulare isolates from persons with acquired immunodeficiency syndrome Am.Rev.Respir.Dis. 134: 659-661.

Curcic,R., Dhandayuthapani,S., and Deretic,V. (1994) Gene expression in mycobacteria: transcriptional fusions based on xylE and analysis of the promoter region of the response regulator mtrA from Mycobacterium tuberculosis Mol.Microbiol. 13: 1057-1064.

Daffe,M., Etienne,G. (1999) The capsule of Mycobacterium tuberculosis and its implications for pathogenicity Tuber.Lung Dis. 79: 153-169.

Dargatz,D.A., Byrum,B.A., Barber,L.K., Sweeney,R.W., Whitlock,R.H., Shulaw,W.P., !acobson,R.H., and Stabel,!.R. (2001) Evaluation of a commercial ELISA for diagnosis of paratuberculosis in cattle J.Am.Vet.Med.Assoc. 218: 1163- 1166.

Das Gupta,S.K., Bashyam,M.D., and Tyagi,A.K. (1993) Cloning and assessment of mycobacterial promoters by using a plasmid shuttle vector J.Bacteriol. 175: 5186- 5192.

Das Gupta,S.K., !ain,S., Kaushal,D., and Tyagi,A.K. (1998) Expression systems for study of mycobacterial gene regulation and development of recombinant BCG vâccinQS Biochem.Biophys.Res. Commun. 246: 797-804. de Kesel,M., Gilot,P., Coene,M., and Cocito,C. (1992) Composition and immunological properties of the protein fraction of A36, a major antigen complex of Mycobacterium paratuberculosis Scand.J.Immunol. 36: 201-212. de Kesel,M., Gilot,P., Misonne,M.C., Coene,M., and Cocito,C. (1993) Cloning and expression of portions of the 34-kilodalton-protein gene of Mycobacterium paratuberculosis: its application to serological analysis of Johne's disease J. Clin.Microbiol. 31: 947-954.

187 de Lisle,G.W., Collins,D.M., and Huchzermeyer,H.F. (1992) Characterization of ovine strains of Mycobacterium paratuberculosis by restriction endonuclease analysis and DNA hybridization Onderstepoort J. Vet.Res. 59: 163-165. de Lisle,G.W., Yates,G.F., and Collins,D.M. (1993) Paratuberculosis in farmed deer: case reports and DNA characterization of isolates of Mycobacterium paratuberculosis J. Vet.Diagn.Invest 5: 567-571.

De Voss,J.J., Rutter,K., Schroeder,B.G., and Barry,C.E., Ill (1999) Iron acquisition and metabolism by mycobacteria 181: 4443-4451.

De Voss,J.J., Rutter,K., Schroeder,B.G., Su,H., Zhu,Y., and Barry,C.E., Ill (2000) The salicylate-derived myeobactin siderophores of Mycobacterium tuberculosis are essential for growth in macrophages Proc.Natl.Acad.Sci. U.S.A 97: 1252-1257.

Deirisola,B., Poyart,C., Goulet,0., Mougenot,J.F., Sadoun-Journo,E., Brousse,N., Schmitz,!., Ricour,C., and Berche,P. (1994) Detection of Mycobacterium paratuberculosis by polymerase chain reaction in children with Crohn's disease J.Infect.Dis. 169: 449-451.

Dellagostin,O.A., Esposito,G., Eales,L.J., Dale,J.W., and McFadden,!. (1995) Aetivity of mycobacterial promoters during intracellular and extracellular growth Microbiology \^ \ : 1785-1792.

Delogu,G., Brennan,M.J. (2001) Comparative immune response to PE and PE PGRS antigens of Mycobacterium tuberculosis Infect.Immun. 69: 5606-5611.

Deretic,V., Via,L.E., Fratti,R.A., and Deretic,D. (1997) Mycobacterial phagosome maturation, rah proteins, and intracellular trafficking Electrophoresis 18: 2542-2547.

Dhandayuthapani,S., Via,L.E., Thomas,C.A., Horowitz,P.M., Deretic,D., and Deretic,V. (1995) Green fluorescent protein as a marker for gene expression and cell biology of mycobacterial interactions with macrophages Mol.Microbiol. 17: 901-912.

Doukhan,L., Predich,M., Nair,G., Dussurget,0., Mandic-Mulec,!., Cole,S.T., Smith,D.R., and Smith,! (1995) Genomic organization of the mycobacterial sigma gene cluster Gene 165: 67-70.

Draper,!. (1998) The outer parts of the mycobacterial envelope as permeability hdivnQX^ Front Biosci. 3: D1253-D1261.

Dumonceau,J.M., Van Gossum,A., Adler,M., Fonteyne,P.A., Van Vooren,J.P., Deviere,!., and Portaels,F. (1996) No Mycobacterium paratuberculosis found in Crohn's disease using polymerase chain XQZicXion Dig.Dis.Sci. 41: 421-426.

Dussurget,0., Rodriguez,M., and Smith,! (1996) An ideR mutant of Mycobacterium smegmatis has derepressed siderophore production and an altered oxidative-stress XQ^ionsQ Mol.Microbiol. 22: 535-544.

188 Dussurget,0., Rodriguez,M., and Smith,!. (1998a) Protective role of the Mycobacterium smegmatis IdeR against reactive oxygen species and isoniazid toxicity Tuber.Lung Dis. 79: 99-106.

Dussurget,0., Smith,!. (1998b) Interdependence of mycobacterial iron regulation, oxidative-stress response and isoniazid resistance Trends Microbiol. 6: 354-358.

Dussurget,0., Timm,!., Gomez,M., Gold,B., Yu,S., Sabol,S.Z., Holmes,R.K., !acobs,W.R., !r., and Smith,!. (1999) Transcriptional control of the iron-responsive fxbA gene by the mycobacterial regulator l&oK J.Bacteriol. 181: 3402-3408.

Eiglmeier,K., Parkhill,!., Honore,N., Gamier,T., Tekaia,F., Telenti,A., Klatser,P., !ames,K.D., Thomson,N.R., Wheeler,P.R., Churcher,C., Harris,D., Mungall,K., Barrell,B.G., and Cole,S.T. (2001) The decaying genome of Mycobacterium leprae Lepr.Rev. 72: 387-398.

Eisenstein,T.K., Huang,D., Meissler,!.!., !r., and al Ramadi,B. (1994) Macrophage nitric oxide mediates immunosuppression in infectious inflammation Immunobiology 191:493-502.

El Etr,S.H., Cirillo,!.D. (2001) Entry mechanisms of mycobacteria Front Biosci. 6: D737-D747.

El Zaatari,F.A., Naser,S.A., Hulten,K., Burch,P., and Graham,D.Y. (1999) Characterization of Mycobacterium paratuberculosis p36 antigen and its seroreactivities in Crohn's disease Curr.Microbiol. 39: 115-119.

Ellingson,!.L., Stabel,!.R., Bishai,W.R., Frothingham,R., and Miller,!.M. (2000) Evaluation of the accuracy and reproducibility of a practical PCR panel assay for rapid detection and differentiation of Mycobacterium avium subspecies Mol.Cell Probes 14:153-161.

Elsaghier,A., Prantera,C., Moreno,C., and Ivanyi,!. (1992) Antibodies to Mycobacterium paratuberculosis-s^Qcific protein antigens in Crohn's disease Clin.Exp.Immunol. 90: 503-508.

Elzer,P.H., Phillips,R.W., Robertson,G.T., and Roop,R.M. (1996a) The HtrA stress response protease contributes to resistance of Brucella abortus to killing by murine p hagocytes64: 4838-4841.

Elzer,P.H., Hagius,S.D., Robertson,G.T., Phillips,R.W., Walker,!.V., Fatemi,M.B., Enright,F.M., and Roop,R.M. (1996b) Behaviour of a high-temperature-requirement A (HtrA) deletion mutant of Brucella abortus in goats Res. Vet.Sci. 60: 48-50.

Englund,S., Bolske,G., and !ohansson,K.E. (2002) An lS900-\ike sequence found in a Mycobacterium sp. other than Mycobacterium avium subsp. paratuberculosis. EEMSMicrobiol.Lett. 209: 261-266.

Escuyer,V., Haddad,N., Frehel,C., and Berche,P. (1996) Molecular characterization of a surface-exposed superoxide dismutase of Mycobacterium avium Microb.Pathog. 20:41-55.

189 Fazal,N. (1997) The role of reactive oxygen species (ROS) in the effector mechanisms of human antimycobacterial immunity Biochem.Mol.BiolJnt. 43: 399- 408.

Fernandes,N.D., Wu,Q.L., Kong,D., Puyang,X., Garg,S., and Husson,R.N. (1999) A mycobacterial extracytoplasmic sigma factor involved in survival following heat shock and oxidative stress J.Bacteriol. 181: 4266-4274.

Flynn,J.L., Chan,J. (2001) Immunology of tuberculosis Annu.Rev.Immunol. 19: 93- 129.

Foley-Thomas,E.M., Whipple,D.L., Bermudez,L.E., and Barietta,R.G. (1995) Phage infection, transfection and transformation of Mycobacterium avium complex and Mycobacterium paratuberculosis Microbiology 141: 1173-1181.

Francois,B., Krishnamoorthy,R., and Elion,J. (1997) Comparative study of Mycobacterium paratuberculosis strains isolated from Crohn's disease and Johne's disease using restriction fragment length polymorphism and arbitrarily primed polymerase chain reaction 118: 227-233.

Frank,T.S., Cook,S.M. (1996) Analysis of paraffin sections of Crohn's disease for Mycobacterium paratuberculosis using polymerase chain reaction Mod.Pathol. 9: 32-35.

Frankish,H. (2001) Crohn's gene identified Za/icer 357: 1678.

Fratti,R.A., Backer,J.M., Gruenberg,!., Corvera,S., and Deretic,V. (2001) Role of phosphatidylinositol 3-kinase and Rab5 effectors in phagosomal biogenesis and mycobacterial phagosome maturation arrest J. Ce// Biol. 154: 631-644.

Garrido,J.M., Cortabarria,N., Oguiza,J.A., Aduriz,G., and Juste,R.A. (2000) Use of a PCR method on faecal samples for diagnosis of sheep paratuberculosis Vet.Microbiol. 77: 379-386.

Garriga,X., Cortes,P., Rodriguez,P., March,F., Prats,G., and Coll,P. (2000) Comparison of IS1245 restriction fragment length polymorphism and pulsed-field gel electrophoresis for typing clinical isolates of Mycobacterium avium subsp avium Int. J.Tuberc.Lung Dis. 4 : 463-472.

Gasteiner,!., Awad-Masalmeh,M., and Baumgartner,W. (2000) Mycobacterium avium subsp. paratuberculosis infection in cattle in Austria, diagnosis with culture, PCR and ELISA Vet.Microbiol. 77: 339-349.

Gasteiner,!., Wenzl,H., Fuchs,K., Jark,U., and Baumgartner,W. (1999) Serological cross-sectional study of paratuberculosis in cattle in Austria Zentralbl. Veterinarmed.[B] 46: 457-466.

Gatfield,!., Pieters,!. (2000) Essential role for cholesterol in entry of mycobacteria into macrophages Science 288: 1647-1650.

190 GaviganJ.A., AinsaJ.A., Perez,E., Otal,L, and Martin,C. (1997) Isolation by genetic labeling of a new mycobacterial plasmid, pJAZ38, from Mycobacterium fortuitum J.Bacteriol. 179: 4115-4122.

Gilot,P., Cocito,C. (1993) Comparative analysis of three sensitins used in cutaneous testing for tuberculosis and paratuberculosis in cattle FEMS Microbiol.Lett. 110: 307-311.

Gilot,P., de Kesel,M., Machtelinckx,L., Coene,M., and Cocito,C. (1993) Isolation and sequencing of the gene coding for an antigenic 34- kilodalton protein of Mycobacterium paratuberculosis J.Bacteriol. 175: 4930-4935.

Gold,B., Rodriguez,G.M., Marras,S.A., Pentecost,M., and Smith,! (2001) The Mycobacterium tuberculosis IdeR is a dual functional regulator that controls transcription of genes involved in iron acquisition, iron storage and survival in macrophages Mo/.M/cro/j/o/. 42: 851-865.

Gomez,M., Doukhan,L., Nair,G., and Smith,! (1998) sigA is an essential gene in Mycobacterium smegmatis Mol.Microbiol. 29: 617-628.

Gomes,M.S., Boelaert,J.R., and Appelberg,R. (2001) Role of iron in experimental Mycobacterium avium infection/. C/m. Fz'ro/. 20: 117-122.

Gordon,S., Parish,T., Roberts,!S., and Andrew,P.W. (1994) The application of luciferase as a reporter of environmental regulation of gene expression in mycohdiCiQxidiLett.Appl.Microbiol. 19: 336-340.

Gordon,S., Clarke,S., Greaves,D., and Doyle,A. (1995) Molecular immunobiology of macrophages: recent progress Curr.Opin.Immunol. 7: 24-33.

Gordon,S., Chung,G., and Andrew,P. (1998) The application of bacterial luciferase as a reporter gene in mycobacteria Methods Mol.Biol. 101: 235-243.

Gordon,S.V., Brosch,R., Billault,A., Garnier,T., Eiglmeier,K., and Cole,S.T. (1999a) Identification of variable regions in the genomes of tubercle bacilli using bacterial artificial chromosome arrays Mol.Microbiol. 32: 643-655.

Gordon,S.V., Heym,B., Parkhill,!., Barrell,B., and Cole,S.T. (1999b) New insertion sequences and a novel repeated sequence in the genome of Mycobacterium tuberculosis WIBn Microbiology 145: 881-892.

Gormley,E., SandalfL., Hong,C., Lawton,D., and Murray,A. (1997) Identification and differentiation of mycobacteria using the PAN promoter sequence from Mycobacterium paratuberculosis as a DNA probe FEMS Microbiol.Lett. 147: 63-68.

Green,E.P., Tizard,M.L., Moss,M.T., Thompson,!., W interboume,D. !., McFadden,!.!., and Hermon-Taylor,!. (1989) Sequence and characteristics of ISPOO, an insertion element identified in a human Crohn's disease isolate of Mycobacterium paratuberculosis Nucleic Acids Res. 17: 9063-9073.

191 Greig,A., Stevenson,K., Perez,V., Pirie,A.A., Grant,J.M., and Sharp,J.M. (1997) Paratuberculosis in wild rabbits (Oryctolagus cuniculus) Vet.Rec. 140: 141-143.

Greig,A., Stevenson,K., Henderson,D., Perez,V., Hughes,V., Pavlik,!., Hines,M.E., McKendrick,!., and Sharp,J.M. (1999) Epidemiological study of paratuberculosis in wild rabbits in Scotland J. C/m.Mzcroè/o/. 37: 1746-1751.

Guerin,!., de Chastellier,C. (2000) Disruption of the actin filament network affects delivery of endocytic contents marker to phagosomes with early endosome characteristics: the case of phagosomes with pathogenic mycobacteria Eur.J.Cell B/o/. 79: 735-749.

Gui,G.P., Thomas,P.R., Tizard,M.L., Lake,!., Sanderson,!.D., and Hermon-Taylor,!. (1997) Two-year-outcomes analysis of Crohn's disease treated with rifabutin and macrohdQ aniihiotics J.Antimicrob.Chemother. 39: 393-400.

Gwozdz,!.M., Thompson,K.G., Murray,A., West,D.M., and Manktelow,B.W. (2000a) Use of the polymerase chain reaction assay for the detection of Mycobacterium avium subspecies paratuberculosis in blood and liver biopsies from experimentally infected sheep Aust. Vet.J. 78: 622-624.

Gwozdz,!.M., Thompson,K.G., Murray,A., Reichel,M.P., Manktelow,B.W., and West,D.M. (2000b) Comparison of three serological tests and an interferon-gamma assay for the diagnosis of paratuberculosis in experimentally infected sheep Aust. Vet.J. 78: 779-783.

Hampson,S.!., Portaels,F., Thompson,!., Green,E.P., Moss,M.T., Hermon-Taylor,!., and McFadden,!.!. (1989) DNA probes demonstrate a single highly conserved strain of Mycobacterium avium infecting AIDS patients Lancet 1: 65-68.

Harris,N.B., Feng,Z., Liu,X., Cirillo,S.L., Cirillo,!.D., and Barletta,R.G. (1999) Development of a transposon mutagenesis system for Mycobacterium avium subsp. paratuberculosis FEMS Microbiol.Lett. 175: 21-26.

Harris,N.B., Barletta,R.G. (2001) Mycobacterium avium subsp. paratuberculosis in Veterinary Medicine Clin.Microbiol.Rev. 14: 489-512.

Harth,G., Clemens,D.L., and Horwitz,M.A. (1994) Glutamine synthetase of Mycobacterium tuberculosis', extracellular release and characterization of its enzymatic activity Proc.Natl.Acad.Sci.U.S.A 91: 9342-9346.

Harth,G., Horwitz,M.A. (1999) Export of recombinant Mycobacterium tuberculosis superoxide dismutase is dependent upon both information in the protein and mycobacterial export machinery. A model for studying export of leaderless proteins by pathogenic mycokaciona J.Biol.Chem. 274: 4281-4292.

Hatfull,G.F. (1993) Genetic transformation of mycobacteria Trends Microbiol. 1: 310-314.

Hatfull,G.F. (1996) The molecular genetics of Mycobacterium tuberculosis Curr.Top.Microbiol.Immunol. 215: 29-47.

192 Hermon-Taylor,!., Bull,T.!., Sheridan,!.M., Cheng,!., Stellakis,M.L., and Sumar,N. (2000) Causation of Crohn's disease by Mycobacterium avium subspecies paratuberculosis Can.J.Gastroenterol. 14: 521-539.

Hermon-Taylor,!., Bull,T. (2002) Crohn's disease caused by Mycobacterium avium subspecies paratuberculosis: a public health tragedy whose resolution is long ovQrduQ J.Med.Microbiol. 51: 3-6.

Hinds,!., Mahenthiralingam,E., Kempsell,K.E., Duncan,K., Stokes,R.W., Parish,T., and Stoker,N.G. (1999) Enhanced gene replacement in mycobacteria Microbiology 145: 519-527.

Homuth,M., Valentin-Weigand,P., Rohde,M., and Gerlach,G.F. (1998) Identification and characterization of a novel extracellular ferric reductase from Mycobacterium paratuberculosis Infect.Immun. 66: 710-716.

Hu,S.I., Carozza,M., Klein,M., Nantermet,P., Luk,D., and Crowl,R.M. (1998) Human HtrA, an evolutionarily conserved serine protease identified as a differentially expressed gene product in osteoarthritic cartilage J.Biol.Chem. 273: 34406-34412.

Hu,Y., Coates,A.R. (2001) Increased levels of sig! mRNA in late stationary phase cultures of Mycobacterium tuberculosis detected by DNA array hybridisation FEMS Microbiol.Lett. 202: 59-65.

Hugot,!.P., Laurent-Puig,P., Gower-Rousseau,C., 01son,!.M., Lee,!.C., Beaugerie,L., Naom,I., Dupas,!.L., Van Gossum,A., Orholm,M., Bonaiti-Pellie,C., Weissenbach,!., Mathew,C.G., Lennard-!ones,!.E., Cortot,A., Colombel,!.F., and Thomas,G. (1996) Mapping of a susceptibility locus for Crohn's disease on chromosome 16 Nature 379: 821-823.

Hulten,K., Almashhrawi,A., El Zaatari,F.A., and Graham,D.Y. (2000) Antibacterial therapy for Crohn's disease: a review emphasizing therapy directed against mycobacteria 45: 445-456.

Hurley,S.S., Splitter,G.A., and Welch,R.A. (1989) Deoxyribonucleic acid relatedness of Mycobacterium paratuberculosis to other members of the family Mycobacteriaceae. Int.J.Syst.Bacteriol. 38: 143-146.

Husson,R.N., !ames,B.E., and Young,R.A. (1990) Gene replacement and expression of foreign DNA in myoohaciQna J.Bacteriol. 172: 519-524.

Ibbotson,!.P., Lowes,!.R., Chahal,H., Gaston,!. S., Life,P., Kumararatne,D.S., Sharif,H., Alexander-Williams,!., and Allan,R.N. (1992) Mucosal cell-mediated immunity to mycobacterial, enterobacterial and other microbial antigens in inflammatory bowel disease Clin.Exp.Immunol. 87: 224-230.

Inglis,N., McFadden,!. (1999) Strain typing of the Mycobacterium avium complex J.Infect. 38: 151-156.

193 Inglis,N.F., Stevenson,K., Davies,R.C., Heaslip,D.G., and Sharp,J.M. (2001) Unique expression of a highly conserved mycobacterial gene in 1S901(+) Mycobacterium avium Microbiology 147: 1557-1564.

Jacobs,W.R., Jr., Barletta,R.G., Udani,R., Chan,J., Kalkut,G., Sosne,G., Kieser,T., Sarkis,G.J., Hatfull,G.F., and Bloom,B.R. (1993) Rapid assessment of drug susceptibilities of Mycobacterium tuberculosis by means of luciferase reporter phages Science 260: 819-822.

Jacobs,W.R., Jr., Kalpana,G.V., Cirillo,J.D., Pascopella,L., Snapper,S.B., Udani,R.A., Jones,W., Barletta,R.G., and Bloom,B.R. (1991) Genetic systems for my cobaciQxm Methods Enzy mo I. 204: 537-555.

Jain,S., Kaushal,D., DasGupta,S.K., and Tyagi,A.K. (1997) Construction of shuttle vectors for genetic manipulation and molecular analysis of mycobacteria Gene 190: 37-44.

Jarlier,V., Nikaido,H. (1994) Mycobacterial cell wall: structure and role in natural vQsisiancQ to antibiotics FEMS Microbiol.Lett. 123: 11-18.

Jensen-Cain,D.M., Quinn,F.D. (2001) Differential expression of sigE by Mycobacterium tuberculosis during intracellular growth Microb.Pathog. 30: 271- 278.

Ji,Y.E., Colston,M.J., and Cox,R.A. (1994) The ribosomal RNA (rm) opérons of fast-growing mycobacteria: primary and secondary structures and their relation to rm opérons of pathogenic s\ov/-gxov/Qxs Microbiology 140: 2829-2840.

Johne,H.A., Frothingham,L. (IS95) Disch.Zeitschr.Tiermed.Vergl.Path 21: 438-454.

Johnson-Ifearulundu,Y., Kaneene,J.B. (1999) Distribution and environmental risk factors for paratuberculosis in dairy cattle herds in Michigan Am.J.Vet.Res. 60: 589- 596.

Johnson,K., Charles,!., Dougan,G., Pickard,D., 0'Gaora,P., Costa,G., Ali,T., Miller,!., and Hormaeche,C. (1991) The role of a stress-response protein in Salmonella typhimurium vrnxXoxiCQ Mol.Microbiol. 5: 401-407.

Jones,C.H., Bolken,T.C., Jones,K.F., Zeller,G.O., and Hmby,D.E. (2001) Conserved DegP protease in gram-positive bacteria is essential for thermal and oxidative tolerance and full virulence in Streptococcus pyogenes Infect.Immun. 69: 5538-5545.

Jorgensen,!.B. (1969) Paratuberculosis in pigs. Experimental infection by oral administration of Mycobacterium paratuberculosis Acta Vet.Scand. 10: 275-287.

!uarez,M.D., Torres,A., and Espitia,C. (2001) Characterization of tbo Mycobacterium tuberculosis region containing the mpt83 and mpt70 genes(l) FEMS Microbiol.Lett. 203: 95-102.

!ucker,M.T., Falkinham,!.0., Ill (1990) Epidemiology of infection by nontuberculous mycobacteria IX. Evidence for two DNA homology groups among

194 small plasmids in Mycobacterium avium, Mycobacterium intracellulare, and Mycobacterium scrofulaceum Am.Rev.Respir.Dis. 142: 858-862.

Jungblut,P.R., Schaible,U.E., Mollenkopf,H.J., Zimny-Amdt,U., Raupach,B., MattowJ., Halada,P., Lamer,S., Hagens,K., and Kaufmann,S.H. (1999) Comparative proteome analysis of Mycobacterium tuberculosis and Mycobacterium bovis BCG strains: towards functional genomics of microbial pathogens Mol.Microbiol. 33: 1103-1117.

Juste,R.A., Marco,!.C., Saez,d.O., and Aduriz,!.!. (1991) Comparison of different media for the isolation of small ruminant strains of Mycobacterium paratuberculosis Vet.Microbiol. 28 : 385-390.

Kalpana,G.V., Bloom,B.R., and !acobs,W.R., Jr. (1991) Insertional mutagenesis and illegitimate recombination in mycobacteria Proc.Natl.Acad.Sci. D.S.A 88: 5433-5437.

Kanazawa,K., Haga,Y., Funakoshi,0., Nakajima,H., Munakata,A., and Yoshida,Y. ( 1999) Absence of Mycobacterium paratuberculosis DNA in intestinal tissues from Crohn's disease by nested polymerase chain roaction J. Gastroenterol. 34: 200-206.

Kauppinen,!., Hintikka,E., Iivanainen,E., and Katila,M. (2001) PCR-based typing of Mycobacterium avium isolates in an epidemic among farmed lesser white-fronted geese (Anser erythropus) Vet.Microbiol. 81: 41-50.

Kempsell,K.E., !i,Y.E., Estrada,!C., Colston,M.!., and Cox,R.A. (1992) The nucleotide sequence of the promoter, 16S rRNA and spacer region of the ribosomal RNA operon of Mycobacterium tuberculosis and comparison with Mycobacterium leprae XiXocarsorrKHAJ. Gen.Microbiol. 138: 1717-1727.

Kim,K.!, Park,S.C., Kang,S.H., Cheong,G.W., and Chung,C.H. (1999) Selective degradation of unfolded proteins by the self- compartmentalizing HtrA protease, a periplasmic heat shock protein m Escherichia coli J.Mol.Biol. 294: 1363-1374.

Krause,K.H. (2000) Professional phagocytes: predators and prey of microorganisms Schweiz.Med. Wochenschr. 130: 97-100.

Kremer,!., Baulard,A., Estaquier,!., Poulain-Godeffoy,0., and Locht,C. (1995a) Green fluorescent protein as a new expression marker in mycobacteria Mol.Microbiol. 17: 913-922.

Kremer,L., Baulard,A., Estaquier,!., Content,!., Capron,A., and Locht,C. (1995b) Analysis of the Mycobacterium tuberculosis 85A antigen promoter region J.Bacteriol 177: 642-653.

Koets,A.P., Rutten,V.P., de Boer,M., Bakker,D., Valentin-Weigand,P., and van Eden,W. (2001) Differential changes in heat shock protein-, lipoarabinomannan-, and purified protein derivative-specific immunoglobulin G1 and G2 isotype responses during bovine Mycobacterium avium subsp. paratuberculosis infection Infect.Immun. 69: 1492-1498.

195 Kuehnel,M.P., Goethe,R., Habermann,A., Mueller,E., Rohde,M., Griffiths,G., and Valentin-Weigand,P. (2001) Characterization of the intracellular survival of Mycobacterium avium ssp. paratuberculosis: phagosomal pH and fusogenicity in J774 macrophages compared with other mycobacteria Cell Microbiol. 3: 551-566.

Kunze,Z.M., Portaels,F., and McFadden,J.J. (1992) Biologically distinct subtypes of Mycobacterium avium differ in possession of insertion sequence ISP07 J.Clin.Microbiol. 30: 2366-2372.

Labidi,A., Mardis,E., Roe,B.A., and Wallace,R.J., Jr. (1992) Cloning and DNA sequence of the Mycobacterium fortuitum var fortuitum plasmid pAL5000 Plasmid 27: 130-140.

Lagier,B., Pelicic,V., Lecossier,D., Prod'hom,G., Rauzier,!., Guilhot,C., Gicquel,B., and Hance,A.J. (1998) Identification of genetic loci implicated in the survival of Mycobacterium smegmatis in human mononuclear phagocytes Mol.Microbiol. 29: 465-475.

Landsverk,T., Halleraker,M., Aleksandersen,M., McClure, S., Hein,W., and Nicander,L. (1991) The intestinal habitat for organized lymphoid tissues in ruminants; comparative aspects of structure, function and development Vet.Immunol.Immunopathol. 28: 1-16.

Laskowska,E., Kuczynska-Wisnik,D., Skorko-Glonek,!., and Taylor,A. (1996) Degradation by proteases Lon, Clp and HtrA, of Escherichia coli proteins aggregated in vivo by heat shock; HtrA protease action in vivo and in vitro Mol.Microbiol. 22: 555-571.

Lauzi,S., Pasotto,D., Amadori,M., Archetti,I.L., Poli,G., and Bonizzi,L. (2000) Evaluation of the specificity of the gamma-interferon test in Italian bovine tuberculosis-free herds Vet.J. 160: 17-24.

Lee,M.H., Pascopella,L., Jacobs,W.R., Jr., and Hatfull,G.F. (1991) Site-specific integration of mycobacteriophage L5: integration- proficient vectors for Mycobacterium smegmatis, Mycobacterium tuberculosis, and bacille Calmette- Guoxm Proc.Natl.Acad.Sci.U.S.A 88: 3111-3115.

Levchenko,!, Smith,C.K., Walsh,N.P., Sauer,R.T., and Baker,T.A. (1997) PDZ-like domains mediate binding specificity in the Clp/HsplOO family of chaperones and protease regulatory subunits Ce// 91:939-947.

Levy-Frebault,V.V., Thorel,M.F., Vamerot,A., and Gicquel,B. (1989) DNA polymorphism in Mycobacterium paratuberculosis, "wood pigeon mycobacteria," and related mycobacteria analyzed by field inversion gel electrophoresis J.Clin.Microbiol. 27: 2823-2826.

Lipinska,B., Sharma,S., and Georgopoulos,C. (1988) Sequence analysis and regulation of the htrA gene of Escherichia coli: a sigma 32-independent mechanism of heat-inducible ixamcxvptiOYiNucleic Acids Res. 16: 10053-10067.

196 Lipinska,B., Fayet,0., Baird,L., and Georgopoulos,C. (1989) Identification, characterization, and mapping of the Escherichia coli htrA gene, whose product is essential for bacterial growth only at elevated temperatures J.Bacteriol. 171: 1574- 1584.

Lipinska,B., Zylicz,M., and Georgopoulos,C. (1990) The HtrA (DegP) protein, essential for Escherichia coli survival at high temperatures, is an endopeptidase J.Bacteriol. 172: 1791-1797.

Little,D., Alzuherri,H.M., and Clarke,C.J. (1996) Phenotypic characterisation of intestinal lymphocytes in ovine paratuberculosis by immunohistochemistry Vet.Immunol.Immunopathol. 55: 175-187.

Liu,X., Feng,Z., Harris,N.B., Cirillo,J.D., Bercovier,H., and Barletta,R.G. (2001) Identification of a secreted superoxide dismutase in Mycobacterium avium ssp. paratuberculosis FEMS Microbiol.Lett. 202:233-238.

Loosmore,S.M., Yang,Y.P., Oomen,R., Shortreed,J.M., Coleman,D.C., and Klein,M.H. (1998) The Haemophilus influenzae HtrA protein is a protective antigen Infect.Immun. 66: 899-906.

Lowe,D.C., Savidge,T.C., Pickard,D., Eckmann,L., Kagnoff,M.F., Dougan,G., and Chatfield,S.N. (1999) Characterization of candidate live oral Salmonella typhi vaccine strains harboring defined mutations in aroA, aroC, and htrA Infect.Immun. 67: 700-707.

Luo,Y., Chen,X., Szilvasi,A., and 0'Donnell,M.A. (2000) Co-expression of interleukin-2 and green fluorescent protein reporter in mycobacteria: in vivo application for monitoring antimycobacterial immumXy Mol.Immunol. 37: 527-536.

Ma,Y., Ohmen,J.D., Li,Z., Bentley,L.G., McElree,C., Pressman,S., Targan,S.R., Fischel-Ghodsian,N., Rotter,!.I., and Yang,H. (1999) A genome-wide search identifies potential new susceptibility loci for Crohn's disease Inflamm.Bowel.Dis. 5: 271-278.

Machowski,E.E., McAdam,R.A., Derbyshire,K.M., and Mizrahi,V. (2000) Construction and application of mycobacterial reporter transposons Gene 253: 67-75.

Manabe,Y.C., Saviola,B.J., Sun,L., Murphy, J.R., and Bishai,W.R. (1999) Attenuation of virulence in Mycobacterium tuberculosis expressing a constitutively active iron Proc.Natl.Acad.Sci.U.S.A 96: 12844-12848.

Manganelli,R., Dubnau,E., Tyagi,S., Kramer,F.R., and Smith,! (1999) Differential expression of 10 sigma factor genes in Mycobacterium tuberculosis Mol.Microbiol. 31: 715-724.

Manganelli,R., Voskuil,M.!, Schoolnik,G.K., and Smith,! (2001) The Mycobacterium tuberculosis ECF sigma factor sigmaE: role in global gene expression and survival in macrophages Mol.Microbiol. 41: 423-437.

197 Marsh,!., Whittington,R., and Cousins,D. (1999) PCR-restriction endonuclease analysis for identification and strain typing of Mycobacterium avium subsp. paratuberculosis and Mycobacterium avium subsp. avium based on polymorphisms in IS1311 Mol.Cell Probes 13: 115-126.

Marklund,B.L, Speert,D.P., and Stokes,R.W. (1995) Gene replacement through homologous recombination in Mycobacterium intracellulare J.Bacteriol. 177: 6100- 6105.

Master,S., Zahrt,T.C., Song,!., and Deretic,V. (2001) Mapping of Mycobacterium tuberculosis katG promoters and their differential expression in infected macrofnagQS J.Bacteriol. 183: 4033-4039

Matsiota-Bemard,P., Waser,S., Tassios,P.T., Kyriakopoulos,A., and Legakis,N.!. (1997) Rapid discrimination of Mycobacterium avium strains from AIDS patients by randomly amplified polymorphic DNA analysis J.Clin.Microbiol. 35: 1585-1588.

Matsumoto,S., Matsuo,T., Ohara,N., Hotokezaka,H., Naito,M., Minami,!., and Yamada,T. (1995) Cloning and sequencing of a unique antigen MPT70 from Mycobacterium tuberculosis H37Rv and expression in BCG using E. coli- mycobacteria shuttle vector Scand.J.Immunol. 41: 281-287.

Matthews,P.R., Collins,P., Bunch,K.!., and McDiarmid,A. (1982) The virulence of Mycobacterium avium and related mycobacteria for C57 mice J.Comp Pathol. 92: 387-392.

Mattow,!., !ungblut,P.R., Schaible,U.E., MollenkopfH.!., Lamer,S., Zimny- Amdt,U., Hagens,K., Muller,E.C., and Kaufmann,S.H. (2001) Identification of proteins from Mycobacterium tuberculosis missing in attenuated Mycobacterium bovis BCG strains Electrophoresis 22: 2936-2946.

McAdam,R.A., Weisbrod,T.R., Martin,!., Scuderi,!.D., Brown,A.M., Cirillo,!.D., Bloom,B.R., and !acobs,W.R., !r. (1995) In vivo growth characteristics of leucine and methionine auxotrophic mutants of Mycobacterium bovis BCG generated by transposon mutagenesis63: 1004-1012.

McFadden,!.!., Butcher,P.D., Chiodini,R.!., and Hermon-Taylor,!. (1987a) Determination of genome size and DNA homology between an unclassified Mycobacterium species isolated from patients with Crohn's disease and other mycdbaciQxia J.Gen.Microbiol. 133: 211-214.

McFadden,!.!., Butcher,P.D., Thompson,!., Chiodini,R., and Hermon-Taylor,!. (1987b) The use of DNA probes identifying restriction-fragment-length polymorphisms to examine the Mycobacterium avium complex Mol.Microbiol. 1: 283-291.

McFadden,!.!., Butcher,?.D., Chiodini,R., and Hermon-Taylor,!. (1987c) Crohn's disease-isolated mycobacteria are identical to Mycobacterium paratuberculosis, as determined by DNA probes that distinguish between mycobacterial species J.Clin.Microbiol. 25: 796-801.

198 McFadden,J.J., Houdayer,C. (1988) No evidence for antibodies to mycobacterial A60 antigen in Crohn's disease sera by enzyme-linked immunoabsorbent assay (ELISA) 25: 295-298.

McFadden,J.J., Kunze,Z.M., and Seechum,P. (1990) DNA probes for detection and identification. In Molecular Biologoy of the Mycobacteria. McFadden,J.J. (ed)., pp. 139-172.

McFadden,!.J., Kunze,Z.M., Portaels,F., Labrousse,V., and Rastogi,N. (1992) Epidemiological and genetic markers, virulence factors and intracellular growth of Mycobacterium avium in AIDS Res.Microbiol. 143: 423-30, discussion.

McFadden,!.!., Fidler,H.M. (1996) Mycobacteria as possible causes of sarcoidosis and Crohn's disease Soc.Appl.Bacteriol.Symp.Ser. 25: 47S-52S.

McFadden,!. (1996) Recombination in mycohactena Mol.Microbiol. 21: 205-211.

McNab,W.B., Meek,A.H., Martin,S.W., and Duncan,!.R. (1991) Associations between dairy production indices and lipoarabinomannan enzyme-immunoassay results for paratuberculosis Can.J.Vet.Res. 55: 356-361.

Mehrotra,!., Bishai,W.R. (2001) Regulation of virulence genes in Mycobacterium tuberculosis Int.J.Med.Microbiol. 291: 171-182.

Merkal,R.S., Whipple,D.L., Sacks,!.M., and Snyder,G.R. (1987) Prevalence of Mycobacterium paratuberculosis in ileocecal lymph nodes of cattle culled in the United SiatQS J.Am.Vet.Med.Assoc. 190: 676-680.

Michele,T.M., Ko,C., and Bishai,W.R. (1999) Exposure to antibiotics induces expression of the Mycobacterium tuberculosis sigF gene: implications for chemotherapy against mycobacterial persistors Antimicrob.Agents Chemother. 43: 218-225.

Milano,A., Forti,F., Sala,C., Riccardi,G., and Ghisotti,D. (2001) Transcriptional regulation of furA and katG upon oxidative stress in Mycobacterium smegmatis J.Bacteriol. 183: 6801-6806.

Miller,B.H., Shinnick,T.M. (2000) Evaluation of Mycobacterium tuberculosis genes involved in resistance to killing by human macrophages Infect.Immun. 68: 387-390.

Miller,B.H., Shinnick,T.M. (2001) Identification of two Mycobacterium tuberculosis H37Rv ORFs involved in resistance to killing by human macrophages BMC.Microbiol. 1: 26.

Miller,R.A., Britigan,B.E. (1997) Role of oxidants in microbial pathophysiology Clin.Microbiol.Rev. 10: 1-18.

Mills,!.A., McNeil,M.R., Belisle,!.T., !acobs,W.R., Jr., and Brennan,?.!. (1994) Loci of Mycobacterium avium ser2 gene cluster and their functions J.Bacteriol. 176: 4803-4808.

199 Milner,A.R., Mack,W.N., Coates,K.J., Hill,!., Gill,!., and Sheldrick,P. (1990) The sensitivity and specificity of a modified ELISA for the diagnosis of Johne's disease from a field trial in cattle Vet.Microbiol. 25: 193-198.

Momotani,E., Whipple,D.L., Thiermann,A.B., and Cheville,N.F. (1988) Role of M cells and macrophages in the entrance of Mycobacterium paratuberculosis into domes of ileal Peyer's patches in calves Vet.Pathol. 25: 131-137.

Moreira,A.R., Paolicchi,F., Morsella,C., Zumarraga,M., Cataldi,A., Fabiana,B., Alicia,A., Piet,0., van Soolingen,D., and Isabel,R.M. (1999) Distribution oflSPOO restriction fragment length polymorphism types among animal Mycobacterium avium subsp. paratuberculosis isolates from Argentina and Europe Vet.Microbiol 70: 251-259.

Morrison,N.E. (1995) Mycobacterium leprae iron nutrition: bacterioferritin, myeobactin, exochelin and intracellular growth Int.J.Lepr.Other Mycobact.Dis. 63: 86-91.

Moss,M.T., Sanderson,!.D., Tizard,M.L., Hermon-Taylor,!., El Zaatari,F.A., Markesich,D.C., and Graham,D.Y. (1992) Polymerase chain reaction detection of Mycobacterium paratuberculosis and Mycobacterium avium subsp silvaticum in long term cultures from Crohn's disease and control tissues Gut 33: 1209-1213.

Mulder,M.A., Zappe,H., and Steyn,L.M. (1997) Mycobacterial promoters Tuber.Lung Dis. 78: 211-223.

Mulder,M.A., Zappe,H., and Steyn,L.M. (1999) The Mycobacterium tuberculosis katG promoter region contains a novel upstream activator Microbiology 145: 2507- 2518.

Muskens,!., Barkema,H.W., Russchen,E., van Maanen,K., Schukken,Y.H., and Bakker,D. (2000) Prevalence and regional distribution of paratuberculosis in dairy herds in The Netherlands Vet.Microbiol. 77: 253-261.

Musser,!.M., Amin,A., and Ramaswamy,S. (2000) Negligible genetic diversity of Mycobacterium tuberculosis host immune system protein targets: evidence of limited selective pressure Genetics 155: 7-16.

Musser,!.M. (2001) Single nucleotide polymorphisms in Mycobacterium tuberculosis structural genes Emerg.Infect.Dis. 7: 486-488.

Mustafa,A.S. (1995) Genetic transformation of mycobacteria by homologous recombination 11: 670-673.

Narayanan,S., Selvakumar,S., Aarati,R., Vasan,S.K., and Narayanan,?.R. (2000) Transcriptional analysis of inducible acetamidase gene of Mycobacterium smegmatis FEMS Microbiol.Lett. 192: 263-268.

Naser,S.A., Schwartz,D., and Shafran,!. (2000a) Isolation of Mycobacterium avium subsp paratuberculosis from breast milk of Crohn's disease patients [letter] Am. J.Gastroenterol. 95: 1094-1095.

200 Naser,S.A., Hulten,K., Shafran,!., Graham,D.Y., and El Zaatari,F.A. (2000b) Specific seroreactivity of Crohn's disease patients against p35 and p36 antigens of M. avium paratuberculosis Vet.Microbiol. 77: 497-504.

Nesbit,C.E., Levin,M.E., Donnelly-Wu,M.K., and HatfulfG.F. (1995) Transcriptional regulation of repressor synthesis in mycobacteriophage L5 Mol.Microbiol. 17: 1045-1056.

Nielsen,S.S., Thamsborg,S.M., Houe,H., and Bitsch,V. (2000) Bulk-tank milk ELISA antibodies for estimating the prevalence of paratuberculosis in Danish dairy herds Prev. Vet.Med. 44: 1-7.

Nielsen,S.S., Houe,H., Thamsborg,S.M., and Bitsch,V. (2001) Comparison of two enzyme-linked immunosorbent assays for serologic diagnosis of paratuberculosis (Johne's disease) in cattle using different subspecies strains of Mycobacterium avium J.Vet.Diagn.Invest 13: \64-\66.

Nikaido,H., Kim,S.H., and Rosenberg,E.Y. (1993) Physical organization of lipids in the cell wall of Mycobacterium chelonae Mol.Microbiol. 8: 1025-1030.

Noone,D., Howell,A., and Devine,K.M. (2000) Expression of ykdA, encoding a Bacillus subtilis homologue of HtrA, is heat shock inducible and negatively anXoregvdaXed J.Bacteriol. 182: 1592-1599.

Noone,D., Howell,A., Collery,R., and Devine,K.M. (2001) YkdA and YvtA, HtrA- like serine proteases in Bacillus subtilis, engage in negative autoregulation and reciprocal cross-regulation of ykdA and yvtA gene expression J.Bacteriol. 183: 654- 663.

Okabe,N. (2001) The pathogenesis of Crohn's disease Digestion 63 Suppl 1: 52-59.

Olsen,!., Reitan,L.J., and Wiker,H.G. (2000a) Distinct differences in repertoires of low-molecular-mass secreted antigens of Mycobacterium avium complex and Mycobacterium tuberculosis J.Clin.Microbiol. 38: 4453-4458.

Olsen,!., Reitan,L.J., Holstad,G., and Wiker,H.G. (2000b) Alkyl hydroperoxide reductases C and D are major antigens constitutively expressed by Mycobacterium avium suhs^. paratuberculosis Infect.Immun. 68: 801-808.

Olsen,!., Tryland,M., Wiker,H.G., and Reitan,L.J. (2001a) AhpC, AhpD, and a Secreted 14-Kilodalton Antigen from Mycobacterium avium svdas^. paratuberculosis Distinguish between Paratuberculosis and Bovine Tuberculosis in an Enzyme-Linked Immunosorbent Assay Clin.Diagn.Lab Immunol. 8: 797-801.

Olsen,!., Wiker,H.G., Johnson,E., Langeggen,H., and Reitan,L.J. (2001b) Elevated antibody responses in patients with Crohn's disease against a 14-kDa secreted protein purified from Mycobacterium avium subsp. paratuberculosis Scand.J.Immunol. 53: 198-203.

Ott,S.L., Wells,S.J., and Wagner,B.A. (1999) Herd-level economic losses associated with Johne's disease on US dairy operations Prev. Vet.Med. 40: 179-192.

2 0 1 Pagan-Ramos,E., SongJ., McFalone,M., Mudd,M.H., and Deretic,V. (1998) Oxidative stress response and characterization of the oxyR-ahpC and furA-katG loci m Mycobacterium marinum J.Bacteriol. 180: 4856-4864.

Fallen,M.J., Wren,B.W. (1997) The HtrA family of serine proteases Mol.Microbiol. 26: 209-221.

Parish,T., Stoker,N.G. (1998) Electroporation of mycobacteria Methods Mol.Biol. 101: 129-144.

Paul,T.R., Beveridge,T.J. (1992) Re-evaluation of envelope profiles and cytoplasmic ultrastructure of mycobacteria processed by conventional embedding and ffeeze- substitution protocols J.B(3c/en(9/. 174: 6508-6517.

Paul,T.R., Beveridge,T.J. (1993) Ultrastructure of mycobacterial surfaces by freeze- s\xhsi\ivX\on Zentr albl. Bakteriol. 279: 450-457.

Pavlik,!., Bejckova,L., Pavlas,M., Rozsypalova,Z., and Koskova,S. (1995) Characterization by restriction endonuclease analysis and DNA hybridization using 1^900 of bovine, ovine, caprine and human dependent strains of Mycobacterium paratuberculosis isolated in various localities Vet.Microbiol. 45: 311-318.

Pavlik,!, Horvathova,A., Dvorska,L., Bartl,J., Svastova,P., du,M.R., and Rychlik,! (1999) Standardisation of restriction fragment length polymorphism analysis for Mycobacterium avium subspecies paratuberculosis J.Microbiol.Methods 38: 155- 167.

Pearson,R.E., Jurgensen,S., Sarkis,G.J., Hatfull,G.F., and Jacobs,W.R., Jr. (1996) Construction of D29 shuttle phasmids and luciferase reporter phages for detection of mycobacteria Gene 183: 129-136.

Pedersen,!.!., Radulic,M., Doric,M., and Abu,K.Y. (2001) HtrA homologue of Legionella pneumophila: an indispensable element for intracellular infection of mammalian but not protozoan cells Infect.Immun. 69: 2569-2579.

Pelicic,V., Reyrat,J.M., and Gicquel,B. (1996) Generation of unmarked directed mutations in mycobacteria, using sucrose counter-selectable suicide vectors Mol.Microbiol. 20: 919-925.

Perez,V., Garcia Marin,J.F., and Badiola,J.J. (1996) Description and classification of different types of lesion associated with natural paratuberculosis infection in sheep J.Comp Pathol. 114: 107-122.

Perez,V., Tellechea,J., Corpa,J.M., Gutierrez,M., and Garcia Marin,J.F. (1999) Relation between pathologic findings and cellular immune responses in sheep with naturally acquired paratuberculosis Am.J. Vet.Res. 60: 123-127.

Pessolani,M.C., Smith,D.R., Rivoire,B., McCormick,J., Hefta,S.A., Cole,S.T., and Brennan,P.J. (1994) Purification, characterization, gene sequence, and significance of a bacterioferritin from Mycobacterium leprae J.Exp.Med. 180: 319-327.

202 Phillips,R.W., Elzer,P.H., and Roop,R.M., II (1995) A Brucella melitensis high temperature requirement A (htrA) deletion mutant demonstrates a stress response defective phenotype in vitro and transient attenuation in the BALB/c mouse model Microb.Pathog. 19: 227-284.

Phillips,R.W., Elzer,P.H., Robertson,G.T., Hagius,S.D., Walker,J.V., Fatemi,M.B., Enright,F.M., and Roop,R.M. (1997) A Brucella melitensis high-temperature- requirement A {htrA) deletion mutant is attenuated in goats and protects against dborXion Res. Vet.Sci. 63: 165-167.

Picardeau,M., Vincent,V. (1996) Typing of Mycobacterium avium isolates by PCR J.Clin.Microbiol. 34: 389-392.

Picken,R.N., Tsang,A.Y., and Yang,H.L. (1988) Spéciation of organisms within the Mycobacterium avium-Mycobacterium intracellulare-Mycobacterium scrofulaceum (MAIS) complex based on restriction fragment length polymorphisms Mol.Cell Probes 2: 289-304.

Piddington,D.L., Fang,F.C., Laessig,T., Cooper,A.M., Orme,I.M., and Buchmeier,N.A. (2001) Cu,Zn superoxide dismutase of Mycobacterium tuberculosis contributes to survival in activated macrophages that are generating an oxidative hmsX Infect.Immun. 69: 4980-4987.

Pillai,S.R., Jayarao,B.M., Gummo,J.D., Hue,E.C., Tiwari,D., Stabel,J.R., and Whitlock,R.H. (2001) Identification and sub-typing of Mycobacterium avium subsp. paratuberculosis and Mycobacterium avium subsp. avium by randomly amplified polymorphic DNA Vet.Microbiol. 79: 275-284.

Plum,G., Brenden,M., Clark-Curtiss,J.E., and Pulverer,G. (1997) Cloning, sequencing, and expression of the mig gene of Mycobacterium avium, which codes for a secreted macrophage-induced protein Infect.Immun. 65: 4548-4557.

Ponting,C.P. (1997) Evidence for PDZ domains in bacteria, yeast, and plants Protein Sci. 6: 464-468.

Poupart,P., Coene,M., Van Heuverswyn,H., and Cocito,C. (1993) Preparation of a specific RNA probe for detection of Mycobacterium paratuberculosis and diagnosis of Johne's disease J.Clin.Microbiol. 31: 1601-1605.

Pym,A.S., Domenech,P., Honore,N., Song,J., Deretic,V., and Cole,S.T. (2001) Regulation of catalase-peroxidase (KatG) expression, isoniazid sensitivity and virulence by furA of Mycobacterium tuberculosis Mol.Microbiol. 40: 879-889.

Qin,M., Taniguchi,H., and Mizuguchi,Y. (1994) Analysis of the replication region of a mycobacterial plasmid, pMSC262 J.Bacteriol. 176: 419-425.

Ramakrishnan,!., Federspiel,N.A., and Falkow,S. (2000) Granuloma-specific expression of Mycobacterium virulence proteins from the glycine-rich PE-PGRS family Science 288: 1436-1439.

203 Raman,s., Song,T., Puyang,X., Bardarov,S., Jacobs,W.R., Jr., and Husson,R.N. (2001) The Alternative Sigma Factor SigH Regulates Major Components of Oxidative and Heat Stress Responses in Mycobacterium tuberculosis J.Bacteriol. 183: 6119-6125.

Ramasoota,P., Chansiripomchai,N., Kallenius,G., Hoffner,S.E., and Svenson,S.B. (2001) Comparison of Mycobacterium avium complex (MAC) strains from pigs and humans in Sweden by random amplified polymorphic DNA (RAPD) using standardized reagents Vet.Microbiol. 78: 251-259.

Ranes,M.G., Rauzier,J., Lagranderie,M., Gheorghiu,M., and Gicquel,B. (1990) Functional analysis of pAL5000, a plasmid from Mycobacterium fortuitum: construction of a "mini" mycobacterium-Escherichia coli shuttle vector J.Bacteriol. 172:2793-2797.

Rastogi,N. (1990) Killing intracellular mycobacteria in in vitro macrophage systems: what may be the role of known host microbicidal mechanisms? Res.Microbiol. 141: 217-230.

Rauzier,J., Moniz-Pereira,J., and Gicquel-Sanzey,B. (1988) Complete nucleotide sequence of pAL5000, a plasmid from Mycobacterium fortuitum Gene 71: 315-321.

Raynaud,C., Etienne,G., Peyron,P., Laneelle,M.A., and Daffe,M. (1998) Extracellular enzyme activities potentially involved in the pathogenicity of Mycobacterium tuberculosis Microbiology 144: 577-587.

Riska,P.F., Jacobs,W.R., Jr. (1998) The use of luciferase-reporter phage for antibiotic-susceptibility testing of mycobaciexia Methods Mol.Biol. 101: 431-455.

Ritacco,V., Kremer,K., van der,L.T., Pijnenburg,J.E., de Haas,P.E., and van Soolingen,D. (1998) Use of ISP07 and IS7245 in RFLP typing of Mycobacterium avium complex: relatedness among serovar reference strains, human and animal isolates Int.J. Tuberc.Lung Dis. 2: 242-251.

Rogall,T., Wolters,J., Flohr,T., and Bottger,E.C. (1990a) Towards a phylogeny and definition of species at the molecular level within the genus Mycobacterium Int.J.Syst.Bacteriol. 40: 323-330.

Rogall,T., Flohr,T., and Bottger,E.C. (1990b) Differentiation of Mycobacterium species by direct sequencing of amplified D U h J.Gen.M icrobiol. 136: 1915-1920.

Rojas,M., Barrera,L.F., and Garcia,L.F. (1998) Induction of apoptosis in murine macrophages by Mycobacterium tuberculosis is reactive oxygen intermediates- independent Biochem.Biophys.Res.Commun. 247: 436-442.

Rojas-Espinosa,0., Lovik,M. (2001) Mycobacterium leprae and Mycobacterium lepraemurium infections in domestic and wild animals Rev.Sci. Tech. 20: 219-251.

Roop,R.M., Fletcher,T.W., Sriranganathan,N.M., Boyle,S.M., and Schurig,G.G. (1994) Identification of an immunoreactive Brucella abortus HtrA stress response protein homolog/«/ec/./mmwn. 62: 1000-1007.

204 Rowbotham,D.S., Mapstone,N.P., Trejdosiewicz,L.K., Howdle,P.D., and Quirke,P. (1995) Mycobacterium paratuberculosis DNA not detected in Crohn's disease tissue by fluorescent polymerase chain reaction Gut 37: 660-667.

Sanna,E., Woodall,C.J., Watt,N.J., Clarke,C.J., Pittau,M., Leoni,A., and Nieddu,A.M. (2000) In situ-PCR for the detection of Mycobacterium paratuberculosis DNA in paraffin-embedded tissues Eur.JHistochem. 44: 179-184.

Sander,P., Meier,A., and Bottger,E.C. (1995) rpsL+: a dominant selectable marker for gene replacement in mycohactevia Mol.Microbiol. 16: 991-1000.

Sartor,R.B. (1997) Pathogenesis and immune mechanisms of chronic inflammatory bowel diSQasQS Am.J.Gastroenterol. 92: 5S-11S.

Sassoon,N., Arie,J.P., and Betton,J.M. (1999) PDZ domains determine the native oligomeric structure of the DegP (HtrA) protQasQ Mol.Microbiol. 33: 583-589.

Schaible,U.E., Sturgill-Koszycki,S., Schlesinger,P.H., and Russell,D.G. (1998) Cytokine activation leads to acidification and increases maturation of Mycobacterium nvmw-containing phagosomes in murine macrophages/./wwwno/. 160: 1290-1296.

ScheibfP., Gerlach,G.F. (1997) Differentiation of Mycobacterium paratuberculosis isolates by rDNA- spacer analysis and random amplified polymorphic DNA patterns Vet.Microbiol. 57: 151-158.

Schlesinger,L.S., Horwitz,M.A. (1991) Phagocytosis of Mycobacterium leprae by human monocyte-derived macrophages is mediated by complement receptors CRl (CD35), CR3 (CDl lb/CD 18), and CR4 (CD 11 c/CD 18) and IFN-gamma activation inhibits complement receptor function and phagocytosis of this bacterium J.Immunol. 147: 1983-1994.

Schmitt,M.P., Holmes,R.K. (1991a) Characterization of a defective diphtheria toxin repressor (dtxR) allele and analysis of dtxR transcription in wild-type and mutant strains of Corynebacterium diphtheriae Infect.Immun. 59: 3903-3908.

Schmitt,M.P., Holmes,R.K. (1991b) Iron-dependent regulation of diphtheria toxin and siderophore expression by the cloned Corynebacterium diphtheriae repressor gene dtxR in C. diphtheriae C l sixains Infect.Immun. 59: 1899-1904.

Schmitt,M.P., Predich,M., Doukhan,!., Smith,!, and Holmes,R.K. (1995) Characterization of an iron-dependent regulatory protein (IdeR) of Mycobacterium tuberculosis as a functional homolog of the diphtheria toxin repressor (DtxR) from Corynebacterium dnphihQxiaQ Infect.Immun. 63: 4284-4289.

Schwartz,D., Shafran,!, Romero,C., Piromalli,C., Biggerstaff,J., Naser,N., Chamberlin,W., and Naser,S.A. (2000) Use of short-term culture for identification of Mycobacterium avium subsp. paratuberculosis in tissue from Crohn's disease patients Clin.Microbiol.Infect. 6: 303-307.

Sela,S., Clark-Curtiss,J.E. (1991) Cloning and characterization of the Mycobacterium leprae putative ribosomal RNA promoter in Escherichia coli Gene 98: 123-127.

205 Seldenrijk,C.A., Drexhage,H.A., Meuwissen,S.G., and Meijer,CJ. (1990) T-cellular immune reactions (in macrophage inhibition factor assay) against Mycobacterium paratuberculosis, Mycobacterium kansasii, Mycobacterium tuberculosis, Mycobacterium avium in patients with chronic inflammatory bowel disease Gut 31: 529-535.

Silver,R.F., Li,Q., and Ellner,J.J. (1998) Expression of virulence of Mycobacterium tuberculosis within human monocytes: virulence correlates with intracellular growth and induction of tumor necrosis factor alpha but not with evasion of lymphocyte- dependent monocyte QÏïtcXox fnnciions Infect.Immun. 66: 1190-1199.

Sirakova,T.D., Bardarov,S.S., Kriakov,J.L, and Markov,K.I. (1989) Molecular cloning of mycobacterial promoters in Escherichia coli FEMS Microbiol.Lett. 50: 153-156.

Skeiky,Y.A., Lodes,M.J., Guderian,J.A., Mohamath,R., Bement,T., Alderson,M.R., and Reed,S.G. (1999) Cloning, expression, and immunological evaluation of two putative secreted serine protease antigens of Mycobacterium tuberculosis Infect.Immun. 67: 3998-4007.

Skorko-Glonek,J., Lipinska,B., Krzewski,K., Zolese,G., Bertoli,E., and Tanfani,F. (1997) HtrA heat shoek protease interaets with phospholipid membranes and undergoes conformational changes J.Biol.Chem. 272: 8974-8982.

Skorko-Glonek,J., Zurawa,D., Kuczwara,E., Wozniak,M., Wypych,Z., and Lipinska,B. (1999) The Escherichia coli heat shock protease HtrA participates in defense against oxidative stress Mol. Gen. Genet. 262: 342-350.

Smith,!, Dussurget,0., Rodriguez,G.M., Timm,J., Gomez,M., Dubnau,J., Gold,B., and Manganelli,R. (1998) Extra and intracellular expression of Mycobacterium tuberculosis genes Tuber.Lung Dis. 79: 91-97.

Snapper,S.B., Lugosi,!., Jekkel,A., Melton,R.E., Kieser,T., Bloom,B.R., and Jacobs,W.R., Jr. (1988) Lysogeny and transformation in mycobacteria: stable expression of foreign genes Proc.Natl.Acad.Sci. U.S.A 85: 6987-699!

Snapper,S.B., Melton,R.E., Mustafa,S., Kieser,T., and Jacobs,W.R., Jr. (1990) Isolation and characterization of efficient plasmid transformation mutants of Mycobacterium smegmatis Mol.Microbiol. 4: 191I-I919.

Spiess,C., Beil,A., and Ehrmann,M. (1999) A temperature-dependent switch from chaperone to protease in a widely conserved heat shock protein Cell 97: 339-347.

Springer,B., Stockman,!., Teschner,K., Roberts,G.D., and Bottger,E.C. (1996) Two- laboratory collaborative study on identification of mycobacteria: molecular versus phenotypic mQXhods J.Clin.Microbiol. 34: 296-303.

Sreevatsan,S., Pan,X., Stockbauer,K.E., Connell,N.D., Kreiswirth,B.N., Whittam,T.S., and Musser,J.M. (1997) Restricted structural gene polymorphism in the Mycobacterium tuberculosis complex indicates evolutionarily recent global dissemination Proc.Natl.Acad.Sci. U.S.A 94: 9869-9874.

206 StabelJ.R. (1998) Johne's disease: a hidden threat JiDa/ry 5"cz. 81: 283-288.

Stabel,J.R., Whitlock,R.H. (2001) An evaluation of a modified interferon-gamma assay for the detection of paratuberculosis in dairy herds Vet.Immunol.Immunopathol. 79: 69-81.

Stahl,D.A., Urbance,J.W. (1990) The division between fast- and slow-growing species corresponds to natural relationships among the mycobacteria J.Bacteriol. 172: 116-124.

Stevenson,K., Inglis,N.F., Rae,B., Donachie,W., and Sharp,J.M. (1991) Complete nucleotide sequence of a gene encoding the 70 kd heat shock protein of Mycobacterium paratuberculosis Nucleic Acids Res. 19: 4552.

Stevenson,K., Sharp,J.M. (1997) The contribution of molecular biology to Mycobacterium avium subspecies paratuberculosis research Vet.J. 153: 269-286.

Stevenson,K., Hughes,V.M., De Juan,L., Inglis,N.F., Wright,F., and Sharp,J.M. (2002) Molecular Characterization of Pigmented and Nonpigmented Isolates of Mycobacterium avium snhsp.paratuberculosis J.Clin.Microbiol. 40: 1798-1804.

Stolt,P., Stoker,N.G. (1996) Functional definition of regions necessary for replication and incompatibility in the Mycobacterium fortuitum plasmid pAL5000 Microbiology 142: 2795-2802.

Stolt,P., Stoker,N.G. (1997) Mutational analysis of the regulatory region of the Mycobacterium plasmid pAL5000 Nucleic Acids Res. 25: 3840-3846.

Stolt,P., Zhang,Q., and Ehlers,S. (1999) Identification of promoter elements in mycobacteria: mutational analysis of a highly symmetrie dual promoter directing the expression of replication genes of the Mycobacterium plasmid pAL5000 N ucleic Acids Res. 27: 396-402.

Strommenger,B., Stevenson,K., and Gerlach,G.F. (2001) Isolation and diagnostic potential of lSM av2, a novel insertion sequence-like element from Mycobacterium avium subspQCiQS paratuberculosis FEMS Microbiol.Lett. 196: 31-37.

Sturgill-Koszycki,S., Schlesinger,P.H., Chakraborty,P., Haddix,P.L., Collins,H.L., Fok,A.K., Allen,R.D., Gluck,S.L., Heuser,J., and Russell,D.G. (1994) Lack of acidification in Mycobacterium phagosomes produced by exclusion of the vesicular proton-ATPase Science 263: 678-681.

Sturgill-Koszycki,S., Schaible,U.E., and Russell,D.G. (1996) Mycobacterium- containing phagosomes are accessible to early endosomes and reflect a transitional state in normal phagosome biogenesis EMBOJ. 15: 6960-6968.

Suenaga,K., Yokoyama,Y., Nishimori,L, Sano,S., Morita,M., Okazaki,K., and Onishi,S. (1999) Serum antibodies to Mycobacterium paratuberculosis in patients with Crohn's disQasQ Dig.Dis.Sci. 44: 1202-1207.

207 Sugden,E.A., Samagh,B.S., Bundle,D.R., and Duncan,J.R. (1987) Lipoarabinomannan and lipid-free arabinomannan antigens of Mycobacterium paratuberculosis Infect.Immun. 55: 762-770.

Sugden,E.A., Comer,A.H., Samagh,B.S., Brooks,B.W., Turcotte,C., Nielsen,K.H., Stewart,R.B., and Duncan,J.R. (1989) Serodiagnosis of ovine paratuberculosis, using lipoarabinomannan in an enzyme-linked immunosorbent assay Am.J.Vet.Res. 50: 850-854.

Tao,X., Schiering,N., Zeng,H.Y., Ringe,D., and Murphy,J.R. (1994) Iron, DtxR, and the regulation of diphtheria toxin QxpxQssion Mol.Microbiol. 14: 191-197.

Tacket,C.O., Sztein,M.B., Losonsky,G.A., Wasserman,S.S., Nataro,J.P., Edelman,R., Pickard,D., Dougan,G., Chatfield,S.N., and Levine,M.M. (1997) Safety of live oral Salmonella typhi vaccine strains with deletions in htrA and aroC aroD and immune response in humans Infect.Immun. 65: 452-456.

Thayer,W.R., Jr., Coutu,J.A., Chiodini,R.J., van Kruiningen,H.J., and Merkal,R.S. (1984) Possible role of mycobacteria in inflammatory bowel disease. II. Mycobacterial antibodies in Crohn's diSQasQ Dig.Dis.Sci. 29: 1080-1085.

Thomas,T.J., Andrews,R.E., Jr., and Thoen,C.O. (1992) Molecular cloning and characterization of Mycobacterium paratuberculosis promoters in Escherichia coli Vet.Microbiol. 32: 351-362.

Thompson,D.E. (1994) The role of mycobacteria in Crohn's disease J.Med.Microbiol. 41: 74-94.

Thorel,M.F. (1984) Review of the occurrence of myeobactin dependence among mycobacteria species Ann.Rech. Vet. 15: 405-409.

Thorel,M.F., Krichevsky,M., and Levy-Frebault,V.V. (1990) Numerical taxonomy of mycobactin-dependent mycobacteria, emended description of Mycobacterium avium, and description of Mycobacterium avium subsp. avium subsp. nov., Mycobacterium avium subsp. paratuberculosis subsp. nov., and Mycobacterium avium subsp. silvaticum subsp. x\ov Int.J.Syst.Bacteriol. 40: 254-260.

Thoresen,O.F., Saxegaard,F. (1991) Gen-Probe Rapid Diagnostic System for the Mycobacterium avium complex does not distinguish between Mycobacterium avium and Mycobacterium paratuberculosis J.Clin.Microbiol. 29: 625-626.

Thome,J.G., Hardin,L.E. (1997) Estimated prevalence of paratuberculosis in Missouri, USA cattle Prev. Vet.Med. 31: 51-57.

Timm,J., Lim,E.M., and Gicquel,B. (1994a) Escherichia co//-mycobacteria shuttle vectors for operon and gene fusions to lacZ: the pJEM series J.Bacteriol. 176: 6749- 6753.

Timm,J., Perilli,M.G., Duez,C., Trias,J., Orefici,G., Fattorini,L., Amicosante,G., Oratore,A., Joris,B., Frere,J.M., and . (1994b) Transcription and expression analysis, using lacZ and phoA gene fusions, of Mycobacterium fortuitum beta-lactamase genes

208 cloned from a natural isolate and a high-level beta-lactamase producer Mol.Microbiol. 12: 491-504.

Tizard,M., Bull,T., Millar,D., Doran,T., Martin,H., Sumar,N., Ford,!., and Hermon- Taylor,J. (1998) A low G+C content genetic island in Mycobacterium avium subsp. paratuberculosis and M. avium subsp. silvaticum with homologous genes in Mycobacterium tuberculosis Microbiology 144: 3413-3423.

Triccas,J.A., Berthet,F.X., Pelicic,V., and Gicquel,B. (1999) Use of fluorescence induction and sucrose counterselection to identify Mycobacterium tuberculosis genes expressed within host cells Microbiology 145: 2923-2930.

Triccas,J.A., Britton,W.J., and Gicquel,B. (2001) Isolation of strong expression signals of Mycobacterium tuberculosis Microbiology 147: 1253-1258.

Valentin-Weigand,P., Goethe,R. (1999) Pathogenesis of Mycobacterium avium subspecies paratuberculosis infections in ruminants: still more questions than answers Microbes.Infect. 1: 1121-1127.

van der Giessen,!.W., Eger,A., Haagsma,!., Haring,R.M., Gaastra,W., and van der Zeijst,B.A. (1992) Amplification of 16S rRNA sequences to detect Mycobacterium paratuberculosis J.Med.Microbiol. 36: 255-263.

van der Giessen,J.W., Haring,R.M., and van der Zeijst,B.A. (1994) Comparison of the 23S ribosomal RNA genes and the spacer region between the 16S and 23S rRNA genes of the closely related Mycobacterium avium and Mycobacterium paratuberculosis and the fast-growing Mycobacterium phlei Microbiology 140: 1103-1108.

van Furth,R. (1990) Mycobacteria and macrophage activation Res.Microbiol. 141: 256-261.

van Kruiningen,H.J. (1999) Lack of support for a common etiology in Johne's disease of animals and Crohn's disease in humans Inflamm.Bowel.Dis. 5: 183-191.

van Kruiningen,H.J., Mayo,D.R., Vanopdenbosch,E., Gower-Rousseau,C., Cortot,A., and Colombel,J.F. (2000) Virus serology in familial Crohn disease Scand.J.Gastroenterol. 35: 403-407.

Vannuffel,P., Gilot,P., Limbourg,B., Naerhuyzen,B., Dieterich,C., Coene,M., Machtelinckx,L., and Cocito,C. (1994) Development of species-specific enzyme- linked immunosorbent assay for diagnosis of Johne's disease in cattle J.Clin.Microbiol. 32: 1211-1216.

Vary,P.H., Andersen,P.R., Green,E., Hermon-Taylor,!., and McFadden,J.J. (1990) Use of highly specific DNA probes and the polymerase chain reaction to detect Mycobacterium paratuberculosis in Johne's àisQdiSQ J.Clin.Microbiol. 28: 933-937.

Verma,A., Sampla,A.K., and Tyagi,J.S. (1999) Mycobacterium tuberculosis rm promoters: differential usage and growth rate-dependent control J.Bacteriol. 181: 4326-4333.

209 Via,L.E., Fratti,R.A., McFalone,M., Pagan-Ramos,E., Deretic,D., and Deretic,V. (1998) Effects of cytokines on mycobacterial phagosome maturation J.Cell Sci. I l l : 897-905.

Wall,S., Kunze,Z.M., Saboor,S., Soufleri,!., Seechum,P., Chiodini,R., and McFadden,J.J. (1993) Identification of spheroplast-like agents isolated from tissues of patients with Crohn's disease and control tissues by polymerase chain reaction J.Clin.Microbiol. 31: 1241-1245.

Walmsley,R.S., Ibbotson,J.P., Chahal,H., and Allan,R.N. (1996) Antibodies against Mycobacterium paratuberculosis in Crohn's disease QJM. 89: 217-221.

Wards,B.J., Collins,D.M. (1996) Electroporation at elevated temperatures substantially improves transformation efficiency of slow-growing mycobacteria FEMS Microbiol.Lett. 145: 101-105.

Wei,J., DahfJ.L., Moulder,!.W., Roberts,E.A., 0'Gaora,P., Young,D.B., and Friedman,R.L. (2000) Identification of a Mycobacterium tuberculosis gene that enhances mycobacterial survival in macrophages J.Bacteriol. 182: 377-384.

Wells,S.J., Wagner,B.A. (2000) Herd-level risk factors for infection with Mycobacterium paratuberculosis in US dairies and association between familiarity of the herd manager with the disease or prior diagnosis of the disease in that herd and use of preventive measures J.Xm. Vet.Med. Assoc. 216: 1450-1457.

Wheeler,P.R., Ratledge,C. (1988) Metabolism in Mycobacterium leprae, M. tuberculosis and other pathogenic mycobac{Qn?L Br.Med.Bull. 44: 547-561.

Whipple,D.L., Le Febvre,R.B., Andrews,R.E., Jr., and Thiermann,A.B. (1987) Isolation and analysis of restriction endonuclease digestive patterns of chromosomal DNA from Mycobacterium paratuberculosis and other Mycobacterium species J.Clin.Microbiol. 25: 1511-1515.

Whipple,D.L., Callihan,D.R., and Jamagin,J.L. (1991) Cultivation of Mycobacterium paratuberculosis from bovine fecal specimens and a suggested standardized procedure J. Vet.Diagn.Invest 3: 368-373.

Whipple,D.L., Palmer,M.V., Slaughter,R.E., and Jones,S.L. (2001) Comparison of purified protein derivatives and effect of skin testing on results of a commercial gamma interferon assay for diagnosis of tuberculosis in cattle J. Vet.Diagn.Invest 13: 117-122.

Whittington,R., Marsh,I., Choy,E., and Cousins,D. (1998a) Polymorphisms in IS1311, an insertion sequence common to Mycobacterium avium and M. avium subsp. paratuberculosis, can be used to distinguish between and within these species Mol. Cell Probes 12: 349-358.

Whittington,R.J., Marsh,L, Tumer,M.J., McAllister,S., Choy,E., Eamens,G.J., Marshall,D.J., and Ottaway,S. (1998b) Rapid detection of Mycobacterium paratuberculosis in clinical samples from ruminants and in spiked environmental

2 1 0 samples by modified BACTEC 12B radiometric culture and direct confirmation by ISPOOPCR 36: 701-707.

Whittington,R.J., Marsh,!., McAllister, S., Turner,M.J., Marshall,D.J., and Fraser,C.A. (1999) Evaluation of modified BACTEC 12B radiometric medium and solid media for culture of Mycobacterium avium subsp. paratuberculosis from sheep J.Clin.Microbiol. 37: 1077-1083.

Whittington,R.J., Hope,A.F., Marshall,D.J., Taragel,C.A., and Marsh,!. (2000) Molecular epidemiology of Mycobacterium avium subsp. paratuberculosis: \S900 restriction fragment length polymorphism and 1^1311 polymorphism analyses of isolates from animals and a human in australia J. 38: 3240-3248.

Wieles,B., Ottenhoff,T.H., Steenwijk,T.M., Franken,K.L., de Vries,R.R., and Langermans,J.A. (1997) Increased intracellular survival of Mycobacterium smegmatis containing the Mycobacterium leprae thioredoxin-thioredoxin reductase gQUQ Infect.Immun. 65: 2537-2541.

Williams,K., Oyston,P.C., Dorrell,N., Li,S., Titball,R.W., and Wren,B.W. (2000) Investigation into the role of the serine protease HtrA in Yersinia pestis pathogenesis FEMS Microbiol.Lett. 186:281-286.

Williams,S.L., Harris,N.B., and Barletta,R.G. (1999) Development of a firefly luciferase-based assay for determining antimicrobial susceptibility of Mycobacterium avium subsp. paratuberculosis J.Clin.Microbiol. 37: 304-309.

Wren,B.W., 01sen,A.L., Stabler,R., and Li,S.R. (1995) A PCR-based strategy for the construction of a defined Yersinia enterocolitica 0:8 htrA mutant Contrib.Microbiol.Immunol. 13: 290-293.

Wu,Q.L., Kong,D., Lam,K., and Husson,R.N. (1997) A mycobacterial extracytoplasmic function sigma factor involved in survival following stress y.Racrgno/. 179: 2922-2929.

Xu,S., Cooper,A., Sturgill-Koszycki,S., van Heyningen,T., Chatteijee,D., Orme,I., Allen,P., and Russell,D.G. (1994) Intraeellular trafficking in Mycobacterium tuberculosis and Mycobacterium avmm-infected macrophages J.Immunol. 153: 2568- 2578.

Yamamoto,T., Hanawa,T., Ogata,S., and Kamiya,S. (1996) Identification and characterization of the Yersinia enterocolitica gsrA gene, which protectively responds to intracellular stress induced by macrophage phagocytosis and to extracellular environmental stress Infect.Immun. 64: 2980-2987.

Yamamoto,T., Hanawa,T., Ogata, S., and Kamiya,S. (1997) The Yersinia enterocolitica GsrA stress protein, involved in intracellular survival, is induced by macrophage phagocytosis Infect.Immun. 65: 2190-2196.

2 1 1 APPENDIX 1.

Laboratory Suppliers

Allied Monitor Amersham Biosciences UK Limited P.O. BOX 71 Amersham Place 201 Golden Drive Little Chalfont Fayette Buckinghamshire Missouri 65248 HP7 9NA USA UK

Applied Biosystems Beckman Coulter (UK) Ltd. Lingley House Oakley Court, 120 Birchwood Boulevard Kingsmead Business Park Warrington London Road WA3 7QH High Wycombe UK Buckinghamshire H P ll lJU UK

BD Biosciences UK British Biocell International Ltd 21 In Between Towns Road Golden Gate Cowley, Ty Glas Avenue Oxford Cardiff, 0X 4 3LY CF14 5DX UK UK

Bioline UK Ltd. Bio-Rad Laboratories Ltd., 16 The edge Buisness Centre Bio-Rad House Humber Road, Maylands Avenue London Hemel Hempstead NW2 6EW Hertfordshire UK HP2 7TD UK

Calbiochem Ciphergen Biosystems, Inc. CN Biosciences (UK) Ltd. 6611 Dumbarton Circle Boulevard Industrial Park Fremont, Padge Road CA 94555 Beeston USA Nottingham NG9 2JR UK

CCXll DAKO Ltd. InforMax Inc. Denmark House Europe Headquarters Angel Drove The Magdalen Centre Ely Robert Robinson Ave. Cambridgeshire The Oxford Science Park CB7 4ET Oxford UK 0X4 4GA UK

Intvitrogen Life Sciences Ltd. Mast Laboratories Ltd. Inchinnan Business Park Mast House 3 Fountain Drice Derby Road Paisley Bootle PA4 9RF Merseyside UK L20 1E4 UK

Millipore (U.K.) Limited Minitab Ltd. Units 3&5 The Courtyards Brandon Court, Unit E 1 Hatters Lane Progress Way Watford Coventry WD18 8YH CV3 2TE UK UK

Molecular Probes Europe BV MWG-BIOTECH AG PoortGebouw Anzinger Str. 7 Rijnsburgerweg 10 D-85560 2333 AA Leiden Ebersberg The Netherlands Germany

New England Biolabs (UK) Ltd. Oswell DNA service 73 Knowl Piece Lab 5005 Biological Sciences Building Wilbury Way University of Southampton Hitchin, Bolderwood Hertfordshire Basset Crescent East SG4 OTY Southampton UK S016 7PX UK

CCXlll Promega UK Pierce (Perbio Science UK Ltd). Delta House, Chilworth Century House, High Street Research Centre Tattenhall Southampton Cheshire S016 7NS CH3 9RJ UK UK

QIAGEN UK Ltd. Reference Manager Boundary Court ISI ResearchSoft Gatwick Road 2141 Palomar Airport Road, Crawley Suite 350 West Sussex, Carlsbad, RH10 9AX CA 92009 UK USA

Roche Diagnostics Ltd. Sigma-Aldrich Company Ltd. Bell Lane Fancy Road Lewes Poole East Sussex Dorset BN7 ILG BH12 4QH UK UK

Stratagene Europe Thermo Hybaid Gebouw California Action Court Hogehilweg 15 Ashford Road 1101 CB Ashford, Middlesex Amsterdam TW15 IXB Zuidoost UK The Netherlands

Thermo Life Sciences UVItec Limited Unit 5 The Ringway Centre St. John Innovation Centre Edison Road Cowley Road Basingstoke Cambridge Hampshire CB4 4WS RG21 6YH UK UK

CCXIV APPENDIX 2.

Bacterial Strains and Vectors

Mycobacterium Species/Strain Source/Details M. a.paratuberculosis : F13 SAC Perth, Scotland, UK: bovine isolate JDl SAC Perth, Scotland, UK: bovine isolate F162 SAC Perth, Scotland, UK: ovine isolate 51/91 MRI, ovine isolate R7 SAC Perth, Scotland, UK: leporine isolate R186 SAC Perth, Scotland, UK: leporine isolate JD88/107 SAC Perth, Scotland, UK: cervine isolate

M. a. avium JD88/118 MRI, cervine isolate (type A/I)

M.smegmatis mc^l55* High transformation efficiency mutant of M.smegmatis ATCC607 (Snapper et a l, 1990) SM3 Isogenic IdeR mutant strain of M.smegmatis mc^l55 (Dussurget et a l, 1996)

(* A gift from Dr. John T Belisle, Dept, of Microbiology, Colorado State University, Ft. Collins, CO 80523, USA) (** A gift from Issar Smith, TB Centre, Public Health Research Institute 455 1st Avenue, New York, NY 10016, USA)

ccxv Eschericha coli Strain Genotype DH5a (BD Biosciences Clontech UK) F' ([)80d/flcZAM15 recAl endAl gyrA96 thil hsdRll (rC nik^) 5wpE44 relAl deoK E{lacZYA-argF)\] 169

JM109 (Promega UK) E14'(McrA') recAl endAl gyrA96 thi-l hsdR ll (rk’ mk^) supEAA relAl E{lac- proAB) [F’ traD36 proAB /ac/ZAMlS]

ccxvi PLASMID REFERENCE GUIDE

Plasmid Relevant Characteristic/Use Source/Reference pUS972* Mycobacterial shuttle plasmid, Kan^ Uni. Surrey pUS1780* Mycobacterial shuttle plasmid, Kan^ Uni. Surrey pUS1803* Mycobacterial shuttle plasmid, M .bovis Uni. Surrey mpb70 promoter GFP ORF, Kan^ pUS1870* Mycobacterial shuttle plasmid, GFP Uni. Surrey ORF, Kan^ pUS1878* Mycobacterial shuttle plasmid, Uni. Surrey M.tuberculosis hsp60 promoter, GFP ORF, Kan^ pUS1883* Mycobacterial shuttle plasmid, M .leprae Uni. Surrey

ISkDa Promoter, GFP ORF, Kan^

pGEM-T E.coli plasmid, PGR cloning vector Promega UK. ^Amp^

pGEM34 E.coli plasmid, pGEM-T vector This Thesis

containing 34kDa putative serine (Chapter 3)

protease ORF pGEMus34 E.coli plasmid, pGEM-T vector This Thesis

containing 34kDa putative serine (Chapter 5)

protease ORF and upstream region, Amp'^

pGEM34P E.coli plasmid, pGEM-T vector This Thesis

containing 34kDa putative serine (Chapter 5)

protease promoter, Amp^

pMRI34 Mycobacterial shuttle plasmid, hsp60 This Thesis

promoter, 34kDa putative serine (Chapter 3)

protease ORF, Kan^ pMRIus34 I Mycobacterial shuttle plasmid, 34kDa This Thesis

putative serine protease and upstream (Chapter 5) region, Kan^, Orientation I

ccxvii pMRIus34 II Mycobacterial shuttle plasmid, 34kDa This Thesis

putative serine protease and upstream (Chapter 5) region, Kan^, Orientation II

pSml28** Integrative vector , lacZ ORF, ^Strep^ (Dussurget et a l, 1999)

pSmbfd^^ Integrative vector, lacZ ORF, bfd (Gold et a l, 2001) promoter, Strep^

pSm34P I Integrative vector, lacZ ORF, 34kDa This work

antigen promoter, Strep^ (Chapter 5)

pSm34P II Integrative vector, lacZ CDS, 34kDa This work

antigen promoter (opposite orientation), (Chapter 5) Streps.

(* Kindly provided by members of the Molecular Biology Group, Dept, of Microbiology, University of Surrey, Guildford, Surrey, GU2 5XH, UK.) (** A gift from Dr. Benjamin Gold (Laboratory of Dr. Issar Smith), TB Centre, Public Health Research Institute, 455 1st Avenue, New York, NY 10016, USA.)

1. Kan^: Kanamycin resistance; Tn903 aph gene. 2. Amp^: Ampicillin resistance; p-lactamase coding sequence. 3. Strep'll Streptomycin resistance; Omega cassette harbouring a Streptomycin/Spectinomycin resistance gene.

CCXVlll APPENDIX 3.

Laboratory Media

Luria-Bertani (L-B) broth 1% ('^Vv) Bacto®-Tryptone, 0.5% (^Vy) Bacto®-yeast extract, 10 mM NaCl, pH 7.5. Sterilised at 12HC for 15 min.

L-B agar 1% ('^Vv) Bacto®-tryptone, 0.5% C'^Vy) Bacto®-yeast extract, 10 mM NaCl, pH 7.5, 1.5% Bacto®-agar. Sterilised at 121°C for 15 min.

SOC broth 1% ('^Vy) Bacto®-Tryptone, 0.5% ('^Vy) Bacto®-yeast extract, 10 mM NaCl, 2.5 MM

KCl, 5 MM MgClz.ôHzO, 5 mM MgS0 4 .7 H2 0 , pH 7.0. Sterilised at 121"C for 15 min and supplemented with sterile glucose to 0.36% (% ).

7H11 medium 2.1% ('^/y) 7H11 agar (BD Biosciences UK), 0.5% (%) glycerol, pH 7.0. Sterilised at 12UC for 15 min and supplemented as follows using sterile stock reagents; 10% (%) Middlebrook OADC enrichment (BD Biosciences UK), pH 7.0, Selectatabs, Code MS 24 (Mast Laboratories). Note: each Selecetatab contains the following antibiotics 100,000 U Polymyxin B, 50 mg Carbenicillin, 5 mg Amphotericin B and 5 mg Trimethoprim, one Selectatab was used per 500 ml of media.

7H11+ medium 2.1 % ('%) 7H11 agar (BD Biosciences UK), 2.3 mM L.asparagine, 2.5% (%) glycerol, 2 pg/ml mycobactin J (Allied Monitor), Ph 7.0. Sterilised at 121°C for 15 min and supplemented as follows using sterile stock reagents; 10% (%) Middlebrook OADC enrichment (BD Biosciences UK), 20% (%) heat-inactivated new bom calf semm (Invitrogen life sciences), Selectatabs, Code MS 24 (Mast Laboratories).

ccxix 7H11-E medium 2.1 % ('^Vv) 7H11 agar (Becton Dickinson UK Ltd), 2.3 mM L.asparagine, 2.5% (%) glycerol, 2 pg/ml mycobactin J (Allied Monitor), Ph 7.0. Sterilised at 121°C for 15 min and supplemented as follows using sterile stock reagents; 10% (%) Middlebrook OADC enrichment (Becton Dickinson UK Ltd), pH 7.0, 20% (%) heat-inactivated new bom calf semm (Invitrogen life sciences). (“E” corresponds to post-Elecroporation medium).

7H11-S medium 2.1 % ('% ) 7H11 agar (Becton Dickinson UK Ltd), 0.5% (%) glycerol, pH 7.0. Sterilised at 121°C for 15 min. (“S” corresponds to use of the medium in culturing M.smegmatis strains only)

7H10-SU 1.9% ('^Vv) Middlebrook 7H10 medium (BD Biosciences UK), 1 pg/ml mycobactin J (Allied Monitor), pH 5.9. Sterilised at 121°C for 15 min and supplemented as follows using sterile stock reagents: 5% (7y) Middlebrook OADC (BD Biosciences UK), pH 7.0, 0.6% (Vv) glucose and 0.41% ('^Vy) sodium pymvate. (“Su” corresponds to media used by the University of Surrey in culturing post electroporation M. a.paratuberculosis)

7H9^ broth 0.47% ('^Vy) 7H9 medium (BD Biosciences UK), 1% (7y) Tween 80, 2 pg/ml mycobactin J (Allied Monitor), pH 5.9. Sterilised at 121°C for 15 min and supplemented as follows using sterile stock reagents; 10% ('^/y) Middlebrook ADC (BD Biosciences UK), pH 7.0 and 0.6% (7y) glucose. (“^” corresponds to the use of glucose as opposed to glycerol in the medium)

7H9^^ broth 0.47% ('^Vy) 7H9 medium (BD Biosciences UK), 0.05% (7y) Tween 80, 1 pg/ml mycobactin J (Allied Monitor), pH 5.9. Sterilised at 121°C for 15 min and supplemented as follows using sterile stock reagents: 5% (7y) Middlebrook ADC (BD Biosciences UK), pH 7.0, 0.6% (7y) glucose and 0.41% (^/y) sodium pyruvate.

ccxx corresponds to media used by the University of Surrey in culturing post electroporation M. a.paratuberculosis)

7H9^ broth 0.47% ('^/y) 7H9 medium (BD Biosciences UK), 0.05% (7y) Tween 80, pH 5.9. Sterilised at 12UC for 15 min. (“^” corresponds to use of the broth in culturing M.smegmatis strains only)

7H9^ broth 0.47% ('^Vy) 7H9 broth (BD Biosciences UK), 10% (7y) Tween 80, 2 pg/ml Mycobactin J (Allied Monitor), 2.5% (7y) glycerol, pH 5.9. Sterilised at 121°C for 15 min and supplemented as follows using sterile stock reagents; 10% (7y) Middlebrook ADC (BD Biosciences UK), pH 7.0. (“^” corresponds to the increased Tween content of the medium)

ccxxi APPENDIX 4.

Amino Acid and Nucleotide Sequences

> 34kDa putative serine protease protein sequence (Figure 1.2)

Amino acid positions Feature 1-38 Signal Peptide 86-246 Trypsin Catalyic Domain 102, 133 and 215 His, Asp and Ser respectively 267-344 PDZ Domain

1 MSKSHHHRSV WWSWLVGVLT WGLGLGLGS GVGLAPASAA PSGLALDRFA DRPLAPIDPS AMVGQVGPQV 71 VNIDTKFGYN NAVGAGTGIV IDPNGWLTN NHVISGATEI SAFDVGNGQT YAVDWGYDR TQDIAVLQLR 1 4 1 GAAGLPTATI GGEATVGEPI VALGNVGGQG GTPNAVAGKV VALNQSVSAT DTLTGAQENL GGLIQADAPI 2 1 1 KPGDSGGPMV NSAGQVIGVD TAATDSYKMS GGQGFAIPIG RAMAVANQIR SGAGSNTVHI GPTAFLGLGV 2 81 TDNNGNGARV QRWNTGPAA AAGIAPGDVI TGVDTVPING ATSMTEVLVP HHPGDTIAVH FRSVDGGERT 351 ANITLAEGPP A

CCXXll > DNA sequence of pUS1878 (Figure 3.4) Nucleotide positions Feature 50-372 pAL5000 derived ori 392-773 hsp60 Promoter 842-1092 GFP ORF

1 NGGCAAGAAA NANGTCGCAA AACAGAAACG GCCAAAAGGC CNCAAAAAAC CGACAATCCN CCGNTGTTTT NCCGTTCTTT NTNCAGCGTT TTGTCTTTGC CGGTTTTCCG GNGTTTTTTG GCTGTTAGGN GGCNACAAAA 71 AACNCAATTG GGAACGGGTG TCGCGGGGGT TCCGTGGGGG TTCCGTTGCA ACGGGTCGGA CAAGGTAAAA TTGNGTTAAC CCTTGCCCAC AGCGCCCCCA AGGCACCGCG AAGGCAACGT TGCCCAGCCT GTTCCATTTT 1 4 1 GTCTTGGTAG ACGCTAGTTT TCTGGTTTGG CCCATGCCTG TCTCGTTGCG TGTTTCGTTG CGCCCGTTTT CAGAACCATC TGCGATCAAA AGACCAAACC GGGTACGGAC AGAGCAACGC ACAAAGCAAC GCGGGCAAAA 2 1 1 GAATACCAGC CAGACGAGAC GGGGTTCTAC GAATCTTGGT CGATACCAAG CCATTTCCGC TGAATATCGG CTTATGGTCG GTCTGCTCTG CCCCAAGATG CTTAGAACCA GCTATGGTTC GGTAAAGGCG ACTTATAGCC 2 8 1 GGAGCTCACC GCCAGAATCG GTGGTTGTGG TGATGTACGT GCGAACTCCG TTGTAGTGCC TGTGGTGGCA CCTCGAGTGG CGGTCTTAGC CACCAACACC ACTACATGCA CGCTTGAGGC AACATCACGG ACACCACCGT Not I

Kpn I Xha I

3 5 1 TCCGTGGCGC GGCCGCGGTA CCAGATCTTT AAATCTAGAT CGACCACAAC GACGCGCCCG CTTTGATCGG AGGCACCGCG CCGGCGCCAT GGTCTAGAAA TTTAGATCTA GCTGGTGTTG CTGCGCGGGC GAAACTAGCC 4 2 1 GGACGTCTGC GGCCGACCAT TTACGGGTCT TGTTGTCGTT GGCGGTCATG GGCCGAACAT ACTCACCCGG CCTGCAGACG CCGGCTGGTA AATGCCCAGA ACAACAGCAA CCGCCAGTAC CCGGCTTGTA TGAGTGGGCC 4 9 1 ATCGGAGGGC CGAGGACAAG GTCGAACGAG GGGCATGACC CGGTGCGGGG CTTCTTGCAC TCGGCATAGG TAGCCTCCCG GCTCCTGTTC CAGCTTGCTC CCCGTACTGG GCCACGCCCC GAAGAACGTG AGCCGTATCC 5 6 1 CGAGTGCTAA GAATAACGTT GGCACTCGCA ACCGGTGAGT GCTAGGTCGG GACGGTGAGG CCAGGCCCGT GCTCACGATT CTTATTGCAA CCGTGAGCGT TGGCCACTCA CGATCCAGCC CTGCCACTCC GGTCCGGGCA 6 3 1 CGTCGCAGCG AGTGGCAGCG AGGACAACTT GAGCCGTCCG TCGCGGGCAC TGCGCCCGGC CAGCGTAAGT GCAGCGTCGC TCACCGTCGC TCCTGTTGAA CTCGGCAGGC AGCGCCCGTG ACGCGGGCCG GTCGCATTCA B s t E l i

7 0 1 AGCGGGGTTG CCGTCACCCG GTGACCCCCG TTTCATCCCC GATCCGGAGG AATCACTTCG CAATGGCCAA TCGCCCCAAC GGCAGTGGGC CACTGGGGGC AAAGTAGGGG CTAGGCCTCC TTAGTGAAGC GTTACCGGTT Pst I

Bam HI ECO RI Hind III Kpn :I

7 7 1 GACGTCCATG GATCCAGCTG CAGAATTCGA AAGCTAAAGC TTAGGCGAGG AGCTTGGTAC CGGTAGAAAA CTGCAGGTAC CTAGGTCGAC GTCTTAAGCT TTCGATTTCG AATCCGCTCC TCGAACCATG GCCATCTTTT 8 4 1 AATGAGTAAA GGAGAAGAAC TTTTCACTGG AGTTGTCCCA ATTCTTGTTG AATTAGATGG TGATGTTAAT TTACTCATTT CCTCTTCTTG AAAAGTGACC TCAACAGGGT TAAGAACAAC TTAATCTACC ACTACAATTA 9 1 1 GGGCACAAAT TTTCTGTCAG TGGAGAGGGT GAAGGTGATG CAACATACGG AAAACTTACC CTTAAATTTA CCCGTGTTTA AAAGACAGTC ACCTCTCCCA CTTCCACTAC GTTGTATGCC TTTTGAATGG GAATTTAAAT 9 8 1 TTTGCACTAC TGGAAAACTA CCTGTTCCAT GGCCAACACT TGTCACTACT TTCTCTTATG GTGTCAATGC AAACGTGATG ACCTTTTGAT GGACAAGGTA CCGGTTGTGA ACAGTGATGA AAGAGAATAC CACAGTTACG 1 0 5 1 TTTTCAAGAT ACCCAGATCA TATGAAACGG CATGACTTTT TTNAGAAATG CCNTTCCCNA ANGGNTTTTC AAAAGTTCTA TGGGTCTAGT ATACTTTGCC GTACTGAAAA AANTCTTTAC GGNAAGGGNT TNCCNAAAAG 1 1 2 1 AAGAAAAAAA CCTTTTTTTT AAAAAACAAC GGGGACTTNC AANACCCNNN TGAANTCAAG TTTGAAGGGG TTCTTTTTTT GGAAAAAAAA TTTTTTGTTG CCCCTGAANG TTNTGGGNNN ACTTNAGTTC AAACTTCCCC 1 1 9 1 ATNCCCTTTT TAATAAAATC CN TANGGGAAAA ATTATTTTAG GN

ccxxm > DNA sequence of pUS1883 (Figure 3.4)

Nucleotide positions Feature 69-397 pALSOOO derived ori 442-813 ISkDa Promoter 849-1151 GFP ORF

1 CNTNTGANCC CCGTNAANGA NTCGGCTTTN GGGNCAAGAA AAAGCGTGCG GCCAAACAGA AACGGCCTAA 71 AAGGCCCNCA ANGAAAGCCG ACATCCCNCG GNTGTTCTAA CGCAATGGGG AGCGGGTGTC GCGGGGGGTC 1 4 1 CGTGGGGGGT TCCGTTGCAA CGGGTCGGAC AGGTAAAAGT CCTGGTAGAC GCTAGTTTTC TGGTTTGGGC 2 1 1 CATGCCTGTC TCGTTGCGTG TTTCGTTGCG CCCGTTTTGA ATACCAGCCA GACGAGACGG GGTTCTACGA 2 8 1 ATCTTGGTCG ATACCAAGCC ATTTCCGCTG AATATCGGGG AGCTCACCGC CAGAATCGGT GGTTGTGGTG Not I

Kpn I

3 51 ATGTACGTGG CGAACTCCGT TGTAGTGCCT GTGGTGGCAT CCGTGGCGCG GCCGCGGTAC CAGATCTTTA Xha I

Eco RV

4 21 AATCTAGATA TCCATGGCCA TCCGCAGCGA CGGCACCGGG AACGCCGGAA AGTTCGGCCG CTACCGATGA 4 91 TGTCGTATAC GCTGCGTTGC AGTGCCGACG TACCCGTGCC GGCACTACAA TCGGTCATGA GCAATCTCCT 5 6 1 CAGCTGTTCA GACAGAAAAC TTGTCTATCA CAACTTGCAT CAATATATCG ACCAGTGCTA TATCAAATCT Bst E l i

6 3 1 ATGTAGTCAG GAACAGCTAT ATAGTTATAG TTTGTCACAA CAGATTGGAG TGCGAGGTGA CCACACATGC 7 0 1 TGATGCGTAC TGACCCGTTC CGTGAACTGG ACCGCTTCGC CGAGCAAGTG TTAGGTACGT CTGCCCGCCC Hind III

Eco RI Kpn I

7 7 1 AGCAGTAATG CCCATGGACA CTTGGCGTGA GGGCGAAGAA TTCAAGCTTA GGCGAGGAGC TTGGTACCGG 8 4 1 TAGAAAAAAT GAGTAAAGGA GAAGAACTTT TCACTGGAGT TGTCCCAATT CTTGTTGAAT TAGATGGTGA 9 1 1 TGTTAATGGG CACAAATTTT CTGTCAGTGG AGAGGGTGAA GGTGATGCAA CATACGGAAA ACTTACCCTT 9 8 1 AAATTTATTT GCACTACTGG AAAACTACCT GTTCCATGGC CAACACTTGT CACTACTTTC TCTTATGGTG 1 0 51 TTCAATGCTT TTCAAGATAC CCAGATCATA TGAAACGGCA TGACTTTTTC AAGAGTGCCA TGCCCGAAGG 1 1 2 1 GTATGTACAG GAAAAAACTA TTTTTTTCAA ANACNNCCGG GAACNCCAAN AACCNGCCTG AAANCAAGTT 1 1 9 1 GGAAGGGGAT NCCTTGTTAA TAAAATCNNN TAAAANGGNT TTGGNTTTTA AAAAAAA

CCXXIV > DNA sequence of pUS1803 (Figure 3.4)

Nucleotide positions Feature 69-397 pAL5000 derived ori 442-813 mpbJO Promoter 849-1151 GFP ORF

1 AANAGGTCGG CAANACAAGA ANCGGCTCAA AAGGCCCCCA AGAAACCGCC AATCCCCCGC TGTTCTAACG 71 CAATTGGGAA CGGTGTCCCG GGGGTTCCGT GGGGGGTTCC GTTGCAACGG GTCGGACAGG TAAAAGTCCT 1 4 1 GGTAGACGCT AGTTTTCTGG TTTGGGCCAT GCCTGTCTCG TTGCGTGTTT CGTTGCGCCC GTTTTGAATA 2 1 1 CCAGCCAGAC GAGACGGGGT TCTACGAATC TTGGTCGATA CCAAGCCATT TCCGCTGAAT ATCGGGGAGC 2 8 1 TCACCGCCAG AATCGGTGGT TGTGGTGATG TACGTGGCGA ACTCCGTTGT AGTGCCTGTG GTGGCATCCG No tl

Kpnl Xbal

3 5 1 TGGCGCGGCC GCGGTACCAG ATCTTTAAAT CTAGAGCAGC CAACAGCTTT GCACTGCGCG GCCGGTGGGC 4 2 1 GCTGGACTAT CAGGGTGCCA CGTCCGACGG CAACGACGCC GCTATCAAAT TGAATTACCA CGCCAAAGAC 4 9 1 GTCTACATCG TTGTCGGTGG CACCGGCACC CTCACGGTCG TGAGGGACGG AAAGCCAGCC ACACTACCGA 5G1 TCAGCGGGCC GCCGACCACC CATCAGGTGG TCGCCGGCGA TCGGCTGGCG TCCGAAACAC TTGAGGTGCG 6 3 1 GCCCAGCAAG GGGCTACAGG TTTTTTCCTT CACCTACGGA TGAATATCCA TCCAAGACCC GGACGGCTCC 7 0 1 GAAGAAATCA TGTCGGGGGT AGCGAGACGG CACAAGCCGC CGTCTCCGGC AGCCGAAGGA GTGAACGGCG Ps tl Kpnl

BamRl B co R I Hindlll

7 7 1 GGATCCAGCT GCAGAATTCG AAGCTTGGTA CCGGTAGAAA AAATGAGTAA AGGAGAAGAA CTTTTCACTG 8 4 1 GAGTTGTCCC AATTCTTGTT GAATTAGATG GTGATGTTAA TGGGCACAAA TTTTCTGTCA GTGGAGAGGG 9 1 1 TGAAGGTGAT GCAACATACG GAAAACTTAC CCTTAAATTT ATTTGCACTA CTGGAAAACT ACCTGTTCCA 9 8 1 TGGCCAACAC TTGTCACTAC TTTCTCTTAT GGTGTTCAAT GCTTTTCAAG ATACTCCAGA TCATATGAAA 1 0 5 1 CGGCATGACN TTTTNAAAG

ccxxv > DNA sequence of pGEM34 (Figure 3.11) Nucleotide positions Feature 1 -86 pGEM-T 97-114 34F PGR primer 106-112 RBS 119-1204 34kDaORF 143-265 Signal peptide sequence 1204-1185 34R primer 1208-1263 PGEM-T

GTTGANNTCC GNTTGCATCC AACGCGTTGG GAGCTCTCCA TATGGTCGAC CTGCAGGCGG CCGCACTAGT Bst E l i

71 GATTCGGGAT CCCGCCGTGG GTTACCCCGC GACGCAGGAG GGTGACGGAT GAGCAAATCG CACCACCACC 1 4 1 GCTCGGTCTG GTGGTCATGG TTGGTCGGTG TGCTGACCGT GGTCGGGCTG GGCCTCGGGC TGGGGTCCGG 2 1 1 CGTGGGGCTG GCGCCGGCGT CCGCGGCACC GTCGGGCCTG GCGCTGGACC GGTTCGCCGA TCGCCCCCTG 2 8 1 GCGCCGATCG ACCCGTCGGC CATGGTCGGT CAGGTGGGGC CGCAAGTGGT CAACATCGAC ACCAAGTTCG 3 5 1 GCTACAACAA CGCGGTGGGC GCCGGTACCG GCATCGTGAT CGACCCGAAC GGCGTGGTGC TCACCAACAA 4 2 1 CCACGTCATC TCGGGCGCCA CCGAAATCAG CGCGTTCGAC GTCGGCAACG GGCAGACCTA CGGCGTCGAC 4 9 1 GTGGTCGGCT ATGACCGCAC CCAGGACATC GCCGTGCTGC AGCTGCGCGG CGCGGCCGGC CTGCCCACCG 56 1 CCACCATCGG CGGCGAGGCC ACGGTGGGCG AGCCCATCGT CGCGCTTGGC AACGTCGGCG GCCAGGGCGG 6 3 1 CACCCCCAAC GCGGTGGCCG GCAAGGTCGT CGCGCTCAAC CAGAGCGTCT CGGCGACCGA CACGCTGACC 7 0 1 GGCGCGCAGG AGAACCTCGG CGGCCTGATC CAGGCCGACG CGCCGATCAA GCCGGGCGAC TCCGGTGGCC 77 1 CGATGGTGAA CAGCGCCGGG CAGGTGATCG GCGTGGACAC CGCCGCCACC GACAGCTACA AGATGTCCGG 8 4 1 CGGGCAGGGC TTCGCCATCC CGATCGGCCG CGCCATGGCC GTCGGCAACG AGATCCGCTC CGGCGCCGGC 9 1 1 TCCAACACCG TGCACATCGG GCCCACCGCA TTCCTCGGGC TGGGCGTGAC GGAGAAGAAC GGCAACGGCG 9 8 1 CGCGGGTGCA GCGGGTGGTC AACACCGGCC CGGCCGCGGC CGCGGGCATC GCGCCCGGCG ACGTCATCAC 1 0 5 1 CGGCGTCGAC ACCGTCCCGA TCAACGGGGC GACGTCGATG ACCGAGGTGC TCGTCCCGCA CCACCCCGGT 1 1 2 1 GACACCATCG CGGTGCACTT CCGGTCCGTC GACGGCGGCG AGCGCACCGC GAACATCACC CTGGCGGAGG Xha I

1 1 9 1 GGCCGCCGGC CTGAGCTCTA GAGCAATCCC GCGGCCATGG CGGCCGGGAG CATGCGACGT CGGGNACCGA 1 2 6 1 TCN

CCXXVl > DNA sequence of pGEMus34 (Figure 5.4) Nucleotide positions Feature 1-84 pGEM-T 82-101 34usF PGR primer 201-214 RBS 415-1500 34kDa ORF 439-561 Signal peptide sequence 1500-1481 34R primer 1504-1559 pGEM-T

Spe I

1 GTTGANNTCC GNTTGCATCC AACGCGTTGG GAGCTCTCCA TATGGTCGAC CTGCAGGCGG CCGCACTAGT CAACTNNAGG CNAACGTAGG TTGCGCAACC CTCGAGAGGT ATACCAGCTG GACGTCCGCC GGCGTGATCA 7 1 GATTCGATCC CGCCGTGTAC ACCACGTCCG GGTCGGCGTC ATGGTCCGCG TCGGGGCCTT GCGCGAGGGC CTAAGCTAGG GCGGCACATG TGGTGCAGGC CCAGCCGCAG TACCAGGCGC AGCCCCGGAA CGCGCTCCCG 1 4 1 GAAGACGACC GGCACCAGGT GTGGCTGCCC GCCCGGGGAG ACGGTGGCCA ACCGGGCTAC CGAGGCCCGG CTTCTGCTGG CCGTGGTCCA CACCGACGGG CGGGCCCCTC TGCCACCGGT TGGCCCGATG GCTCCGGGCC 2 1 1 CCGAACCTCG CCCTGGCGTC GAATTCGCCC ACCAGATCAG GGTAGGGCGC GCGGCAGCAA ACGGCGGTAA GGCTTGGAGC GGGACCGCAG CTTAAGCGGG TGGTCTAGTC CCATCCCGCG CGCCGTCGTT TGCCGCCATT 2 81 GCCTATGAGC CGGCTGAGAA CCTGGCACAT GCCGTGCATA GCTACCTGCA TTACGGTTAT ATACACAAAA CGGATACTCG GCCGACTCTT GGACCGTGTA CGGCACGTAT CGATGGACGT AATGCCAATA TATGTGTTTT BamHI

3 51 TTGTGCCGCC AGGATCCTCA GGCCGGGACA GTTTGGTGTT TACCGCGACG CAGGAGGGTG ACGGATGAGC AACACGGCGG TCCTAGGAGT CCGGCCCTGT CAAACCACAA ATGGCGCTGC GTCCTCCCAC TGCCTACTCG 4 21 AAATCGCACC ACCACCGCTC GGTCTGGTGG TCATGGTTGG TCGGTGTGCT GACCGTGGTC GGGCTGGGCC TTTAGCGTGG TGGTGGCGAG CCAGACCACC AGTACCAACC AGCCACACGA CTGGCACCAG CCCGACCCGG 4 9 1 TCGGGCTGGG GTCCGGCGTG GGGCTGGCGC CGGCGTCCGC GGCACCGTCG GGCCTGGCGC TGGACCGGTT AGCCCGACCC CAGGCCGCAC CCCGACCGCG GCCGCAGGCG CCGTGGCAGC CCGGACCGCG ACCTGGCCAA 5 6 1 CGCCGATCGC GGCCTGGCGC CGATCGACCC GTCGGCCATG GTCGGTCAGG TGGGGCCGCA AGTGGTCAAC GCGGCTAGCG GGGGACCGCG GCTAGCTGGG CAGCCGGTAC CAGCCAGTCC ACCCCGGCGT TCACCAGTTG 6 3 1 ATCGACACCA AGTTCGGCTA CAACAACGCG GTGGGCGCCG GTACCGGCAT CGTGATCGAC CCGAACGGCG TAGCTGTGGT TCAAGCCGAT GTTGTTGCGC CACCCGCGGC CATGGCCGTA GCACTAGCTG GGCTTGCCGC 7 0 1 TGGTGCTCAC CAACAACCAC GTCATCTCGG GCGCCACCGA AATCAGCGCG TTCGACGTCG GCAACGGGCA ACCACGAGTG GTTGTTGGTG CAGTAGAGCC CGCGGTGGCT TTAGTCGCGC AAGCTGCAGC CGTTGCCCGT 7 7 1 GACCTACGCC GTCGACGTGG TCGGCTATGA CCGCACCCAG GACATCGCCG TGCTGCAGCT GCGCGGCGCG CTGGATGCGG CAGCTGCACC AGCCGATACT GGCGTGGGTC CTGTAGCGGC ACGACGTCGA CGCGCCGCGC 8 4 1 GCCGGCCTGC CCACCGCCAC CATCGGCGGC GAGGCCACGG TGGGCGAGCC CATCGTCGCG CTTGGCAACG CGGCCGGACG GGTGGCGGTG GTAGCCGCCG CTCCGGTGCC ACCCGCTCGG GTAGCAGCGC GAACCGTTGC 9 1 1 TCGGCGGCCA GGGCGGCACC CCCAACGCGG TGGCCGGCAA GGTCGTCGCG CTCAACCAGA GCGTCTCGGC AGCCGCCGGT CCCGCCGTGG GGGTTGCGCC ACCGGCCGTT CCAGCAGCGC GAGTTGGTCT CGCAGAGCCG 9 8 1 GACCGACACG CTGACCGGCG CGCAGGAGAA CCTCGGCGGC CTGATCCAGG CCGACGCGCC GATCAAGCCG CTGGCTGTGC GACTGGCCGC GCGTCCTCTT GGAGCCGCCG GACTAGGTCC GGCTGCGCGG CTAGTTCGGC 10 5 1 GGCGACTCCG GTGGCCCGAT GGTGAACAGC GCCGGGCAGG TGATCGGCGT GGACACCGCC GCCACCGACA CCGCTGAGGC CACCGGGCTA CCACTTGTCG CGGCCCGTCC ACTAGCCGCA CCTGTGGCGG CGGTGGCTGT 1 1 2 1 GCTACAAGAT GTCCGGCGGG CAGGGCTTCG CCATCCCGAT CGGCCGCGGC ATGGCCGTCG CCAACCAGAT CGATGTTCTA CAGGCCGCCC GTCCCGAAGC GGTAGGGCTA GCCGGCGCGG TACCGGCAGC GGTTGGTCTA 1 1 9 1 CCGCTCCGGC GCCGGCTCCA ACACCGTGCA CATCGGGCCC ACCGCATTCC TCGGGCTGGG CGTGACGGAC GGCGAGGCCG CGGCCGAGGT TGTGGCACGT GTAGCCCGGG TGGCGTAAGG AGCCCGACCC GCACTGCCTG 1 2 6 1 AACAACGGCA ACGGCGCGCG GGTGCAGCGG GTGGTCAACA CCGGCCCGGC CGCGGCCGCG GGCATCGCGC TTGTTGCCGT TGCCGCGCGC CCACGTCGCC CACCAGTTGT GGCCGGGCCG GCGCCGGCGC CCGTAGCGCG 13 31 CCGGCGACGT CATCACCGGC GTCGACACCG TCCCGATCAA CGGGGCGACG TCGATGACCG AGGTGCTCGT GGCCGCTGCA GTAGTGGCCG CAGCTGTGGC AGGGCTAGTT GCCCCGCTGC AGCTACTGGC TCCACGAGCA 14 0 1 CCCGCACCAC CCCGGTGACA CCATCGCGGT GCACTTCCGG TCCGTCGACG GCGGCGAGCG CACCGCGAAC GGGCGTGGTG GGGCCACTGT GGTAGCGCCA CGTGAAGGCC AGGCAGCTGC CGCCGCTCGC GTGGCGCTTG Xbal

14 71 ATCACCCTGG CGGAGGGGCC GCCGGCCTGA GCTCTAGAGC AATCCCGCGG CCATGGCGGC CGGGAGCATG TAGTGGGACC GCCTCCCCGG CGGCCGGACT CGAGATCTCG TTAGGGCGCC GGTACCGCCG GCCCTCGTAC 1 5 4 1 CGACGTCGGG NACCGATCN GCTGCAGCCC NTGGCTAGN

CCXXVll > DNA sequence of pSm34pI (Figure 5.10)

Nucleotide positions Feature 480-796 34kDa antigen upstream region 480-499 34usForward PCR primer 796-744 34us-Reverse PCR primer 925-1269 /acZ

1 TATCCGGGTA AAMGCGGCAA GGGTCGRAAA CAAGGAAGAG CGCACRAGGR AGCTTTCCAA GGGGNAAAAC 71 GCCTGGTATC TTTTATAGTC CTGTCGGGTT TCGCCACCTC TTGAACTTGA GCGTCGATTT TTGTRATGCT 1 4 1 CGTCAAGGGG GGGCGGAGCC TATGRAAAAA CGCCAGCAAC GCGGCCTTTT TACGGTTCCT GGCCTTTTGC 2 1 1 TGGCCTTTTG CTCACATGTT CTTTCCTGCG TTATCCCMTR ATTCTGTGGA TAACYGTATT ACNCGCCTTT 2 8 1 GAGTGAGCAT GATACCGCTC GCCGCAAGCC GAACRACCRA GCGCAACGCG TSCGGCCGCG GTACCAGATC 3 51 TTTGTGRATG ACCTTTTATA GATTATATTA CTAATTAATT GGGGACCCTA GAGGTCCCCT TTTTTATTTT 4 2 1 AAAAATTTTT TCACAAWACG GTTTACAAGC ATAAAGMTAG TGKCCSCGGK AATTCGATTC GGGGCCTTGC 4 91 GCGAGGGCGA AKTTGAMGMC CGGCTTNCNG MMCCAGGTSG GGGCTGCCCG CCCGGGGAGA CGCTGGCCAA 5 6 1 CCGGGCTACC GAGGCCCGGC CGAACCTCGC CCTGGCGTCG AATTCGCCCA CCAGATCAGG GTAGGGCGCG 6 3 1 CGGCAGCAAA CGGCGGTAAG CCTATGAGCC GGCTGAGAAC CTGGCACATG CCGTGCATAG CTACCTGCAT BamHI

7 0 1 TACGGTTATA TACACAAAAT TGTGCCGCCA GGATCCTCAG GCCGGGACAG TTTGGTGTTT ACCRMRACGC BamHI

7 71 RGKAGGGTGA CGGATGAGCA AATCGCAATC ACTAGTGAAT TCGCGGGCAC TGGGCCCGCG GATCCGCATG H i n d i I I

8 4 1 CGGTACCAAG CTTGATCCGA TAACACAGGA ACAGATCTAT GGTTCGTGCA AACAAACGCA ACGAGGCTCT H i n d i I I

9 1 1 ACGAATCGGA AGCTTCGATC CCGTCGTTTT ACAACGTTCG TGACTGGGAA AACCCTGGCG TTACCCAACT 9 8 1 TAATCGCCTT GCAGCACATC CCCCTTTYGC CAGCTGGCCG TAATAGCGAA AGAGGCCCGC ACCGATCGCC 1 0 5 1 CTTYCCAACA AGWTTGCGCA GCCTGAATGG YGAAATGGCG CTTTGCCTGG TTTTCCGGCA ACCAAGAAGC 1 1 2 1 GGTGCCGGGA AAAGCTGGCT TGGAAGGTGC GAATCTTTTC CTGAGGCCCG ATTACCTGTC CGTYGGTCCC 1 1 9 1 CTTCAAACTG GCANGAATGC ACCGGTTACC GATGCGGCCC CATTCTTACA CCCAACGGNG ACCTTATNCC 1 2 6 1 AATTTACCGG

CCXXVlll Microbiology (2001), 147, 1557-1564 Printed in Great Britain

Unique expression of a highly conserved mycobacterial gene In IS901* Mycobacterium avium

Neil F. ingiis, Karen Stevenson, Richard C. Davies, Darragh G. Heaslip and J. Michael Sharp

Author for correspondence: J. Michael Sharp. Tel: + 4 4 131 445 5111. Fax: + 4 4 131 445 6111. e-mail: [email protected]

Division of Bacteriology, Expression of a gene encoding a novel protein antigen of 40 kDa (p40) was Moredun Research Institute, detected in IS907+ strains of Mycobacterium avium, but not in any other International Research Centre, Pentlands Science species or subspecies of Mycobacterium tested, including IS901~ M. avium and Park, Bush Loan, Penicuik, the other members of the M. avium complex. Although Southern hybridization Midlothian EH26 OPZ, UK revealed that the p40 gene is widely distributed within the genus, expression of the antigen could not be detected on Western blots of mycobacterial cell lysates. Nucleotide sequence analysis of the cloned p40 gene, and a database search, revealed high levels of sequence identity with a homologous gene in lS90t“M. avium. M. avium subsp. paratuberculosis, Mycobacterium bovis, Mycobacterium leprae, Mycobacterium smegmatis and Mycobacterium tuberculosis. Further analysis of upstream sequences identified a putative promoter region. The p40 gene is the first example of a gene that is widely distributed within the genus Mycobacterium but expressed only in association with the presence of a genomic insertion element, in this case IS901, in strains of M. avium isolated from birds and domestic livestock.

Keywords : MAC, genomic insertion element, p40 gene, differential expression, gene conservation

INTRODUCTION al. (1995) provided clear evidence for in vivo expression of the 40 kDa protein by demonstrating that sheep, The genus Mycobacterium contains a number of im infected experimentally with IS90H M.avium, de portant pathogens of both medical and veterinary veloped specific T-cell immune responses to the 40 kDa importance. Consequently, there have been extensive protein. No responses to the 40 kDa protein were efforts to identify reagents, particularly antigens, that detected in uninfected animals or in sheep infected with are specific for each of these pathogenic species. How the closely related M.avium subsp. paratuberculosis, ever, such searches generally have been unsuccessful and which is IS900"'' but IS901“. Furthermore, experiments in very few specific proteins have been identified. mice have suggested that IS901 may enhance the Recently, we described a 40 kDa protein in IS90H pathogenicity of M.avium. In experimentally inoculated strains of Mycobacterium avium (isolated from birds mice, IS90H M. avium strains grew more rapidly than and domestic livestock) that is absent in IS901~ strains an 18901“ strain and induced splenomegaly (Kunzeet (Nyange, 1990; Ingiis et al., 1994). This tight link a/., 1991). between expression of the 40 kDa protein and the Because of the apparently absolute association between presence of 1S901 was confirmed in a larger study of M. IS901 and expression of the 40 kDa protein, and because avium complex (MAC) isolates; only M.avium strains of their implication in increased pathogenicity, we that were IS90H expressed the 40 kDa protein (Ahrens initiated a study to characterize the 40 kDa gene and to et al., 1995). determine its distribution and expression in other Experiments in mice and sheep have indicated that this mycobacteria. protein may have an important rolein vivo. Burrells et METHODS

The GenBank accession number for the p40 gene, together with 542 bp Bacterial cultures. All cultures used in this study are listed in upstream sequence, is AF247653. Table 1. M . avium (JD88/118) and M. avium subsp. para-

Table 1. Mycobacterium species used in this study, and results of PCR (presence of IS907), Western immunoblotting (p40 expression) and nucleic acid hybridization (presence of a p40 gene homologue)

Mycobacterium species Identification no. IS901 PCR p40 expression p40 gene homologue

M. aviu m (porcine) NCTC 8551 + + + M. aviu m (bovine) NCTC 8552 4- + + M. aviu m (ovine) NCTC 8553 + + + M. aviu m (avian) NCTC 8559 + + + M. aviu m (avian) NCTC 8562 + + + M. aviu m (cervine)”' JD88/118 + + M. aviu m (human HIV patient) T133 - - + M. aviu m subsp. paratuberculosis JD88/107 + (cervine)”' M. aviu m subsp. paratuberculosis ATCC 19698 -- + M. intracellulare NCTC 10425 —— + M. scrofulaceum NCTC 10803 -- + M. sm eg m a tis NCTC 8159 -- + M. ph lei NCTC 8151 —— + M. tuberculosis H37Rv NCTC 7416 —— + M. tuberculosis H37Ra NCTC 7417 —— + M. b o vis NCTC 10772 —— + M. b o vis BCG NCTC 5692 —— + M. m icro ti NCTC 8710 —— + M. terrae NCTC 10856 —— + M. kansasii NCTC 10268 -- — ■ + M. x en o p i NCTC 10042 -- M. m alm oen se NCTC 11298 — — + M. g o rd o n a e NCTC 10267 - — + M. szu lgai NCTC 10831 - — + M. flavescens NCTC 10271 -- + M. m arin u m NCTC 2275 — — + M. ch elon ae subsp. chelon ae NCTC 946 — — i M. ch elon ae subsp. abscessu s NCTC 10882 —— i M. fo rtu itu m NCTC 10394 - - i M. peregrin u m NCTC 10264 -- + M. haemophilum NCTC 11185 -- + M. leprae NA —— ; +

NA, N ot applicable; i, inconclusive. “'M . avium JD88/118 and M. avium subsp. paratuberculosis JD88/107 were isolated from commercially farmed red deer{Cervus elaphus) by Dr J. F. C. Nyange at the Moredun Research Institute.

tuberculosis (JD88/107) were propagated at 37 °C on was propagated in Middlebrook 7H9 medium supplemented Middlebrook 7H11 agar medium supplemented with 20% with ferric ammonium citrate at 0-25% (w/v). All species (v/v) heat-inactivated newborn-calf serum, 2-5% (v/v) were incubated for 4-6 weeks at 37 °C, with the following glycerol, 2 mM asparagine, Selectatabs (code MS 24; MAST exceptions : Mycobacterium chelonae subsp. chelonae (NCTC Laboratories), 10% (v/v) Middlebrook oleic acid-albumin- 946) and M. chelonae subsp. abscessus (NCTC 10882) were dextrose-catalase (OADC) enrichment medium (Becton grown at 25 °C, M. haemophilum (NCTC 11185) and Dickinson) and 2 pg mycobactin J ml“^ (Allied Monitor) for Mycobacterium marinum (NCTC 2275) were grown at 30 °C, 4-6 weeks and 8-10 weeks, respectively. M.avium (T133) was and Mycobacterium xenopi (NCTC 10042) was grown at subcultured and maintained subsequently on unsupplemented 45 °C. Middlebrook 7H11 agar medium. Cultures were incubated at 37 °C for 6-8 weeks. Disruption of mycobacterial cells. M.avium (JD88/118) cells were harvested and washed three times in fresh PBS (0437 M All other Mycobacterium species were propagated in NaCl, 0-003 M KCl, 0 008 M Na^HPO^, 0 015 M KH^PO^, Middlebrook 7H9 liquid medium, with the exception of pH 6 9). Approximately 1 g washed mycobacterial cells was Mycobacterium bovis (NCTC 10772) and M. bovis BCG resuspended in 10 ml PBS containing PMSF at a final (NCTC 5692), which were grown in Middlebrook 7H9^ concentration of 1 mM. The cell suspension was transferred without glycerol and supplemented with sodium pyruvate at to the upper compartment of a pre-chilled ( —70°C) Eaton 0-4% (w/v). Mycobacterium haemophilum (NCTC 11185) pressure chamber (Eaton, 1962), allowed to freeze for 3-4 min.

1558 Unique expression of p40 in IS90F M. avium and then forced through the aperture at 10000 p.s.i. ( = dATP, dCTP, dGTP and dTTP, 20 pmol each of the forward 69 MPa) in a hydraulic press. After thawing, high-M^ genomic and reverse primers (forward primer: 5'-CTGCCAGCAT- DNA was sheared by 2 x 15 s rounds of sonication at 50 % GTGGCGTTGTG-3', positions —18 to +3; reverse primer, amplitude in a Vibra-cell model VCX 600 sonicator (Sonics & 5'-TCAGAACTGCAGCGCGTCGAACCGC-3', positions Materials), allowing 1 min cooling on ice between each 1023-998) and 1 U HotStar Taq polymerase (Qiagen). Hot- sonication. start PCR conditions consisted of an initial dénaturation step of 15 min at 96 °C, followed by 35 cycles of 90 s dénaturation All other mycobacteria were disrupted by shaking with at 96 °C, 1 min annealing at 65 °C and 90 s extension at 72 °C. zirconium beads (Biospec Products). Approximately 100 mg The final cycle included an extension at 72 °C for 8 min. The washed mycobacterial cells was resuspended in 0 4 ml PBS 1041 bp amplification product was excised from a 0 8 % (w/v) containing PMSF at a final concentration of 1 mM. The cells low-melting-point agarose gel, recovered using AgarAce were transferred to a screw-cap microfuge tube containing (Promega) in accordance with the manufacturer’s instructions 1 ml washed 01 mm zirconium/silica beads. Cells were and then cloned into pGEM-T (Promega) using standard disrupted by bead-beating in a Mini Bead-Beater (BioSpec laboratory procedures (Sambrooket al., 1989). Competent Products) (Challans et al., 1994). Five beating cycles of 1 min Escherichia coli JM109 cells (Promega) were transformed in each were separated by 1 min cooling intervals on ice to avoid accordance with the manufacturer’s instructions. The identi overheating and possible dénaturation of the antigen prep fication of recombinants of interest was achieved by preparing aration. colony arrays of 100 transformants per grid (Buluwelaet al., Protein purification and characterization. Soluble protein 1989) and screening by DNA hybridization, as described concentrations in cell lysates were determined using the Micro below. Small-scale preparations (‘minipreps’) of plasmid DNA BCA Protein Assay Reagent (Pierce-Warriner) in accordance were prepared from E. coli host cells by using the QIAprep with the manufacturer’s recommendations. p40 was purified Spin Plasmid Miniprep Kit (Qiagen) in accordance with the from M . avium (JD88/118) cell lysates by HPLC (Burrellset manufacturer’s recommendations. Cloned DNA fragments al., 1995; Ingiis, 1997). The purity was confirmed by SDS- were sequenced bidirectionally by the dideoxy chain-ter- PAGF, using a discontinuous buffer system (Laemmli, 1970), mination method (Sanger et al., 1977). All nucleotide and by visualization of proteins by silver-staining (Morrisey, sequencing was performed by Oswel DNA Service, 1981). Southampton, UK. To determine the amino-terminal amino acid sequence of Sequence analysis. Database searches were performed using HPLC-purified p40, protein was transferred from an SDS- the BLAST (version 2.0) program from the National Centre PAGF gel onto a PVDF membrane in 50 mM boric acid for Biotechnology Information internet site covering the (pH 8-0), 20% (v/v) methanol, 3 mM 2-yff-mercaptoethanol at GenBank, EMBL, DDBJ and PDB databases, the w u - b l a s t 100 V/1'0 A (constant voltage) for 60 min. Membrane-bound (version 2.0) program from The Institute for Genome Research protein was visualized by staining with Coomassie brilliant (TIGR) BLAST Search Engine for Unfinished Microbial blue and the bands were excised. The amino-terminal amino Genomes, the Sanger Centre M. bovis b l a s t server, and the acid sequence was determined by sequential Fdman degra University of Minnesota microbial genome projectb l a s t dation at the Microchemical Facility, Institute of Animal server. Preliminary sequence data for M.avium were obtained Physiology and Genetics Research, Babraham, Cambridge, from the TIGR website at http ://www.tigr.org. UK. Amplification of the 5' flanking sequence. The upstream Protein expression was investigated by Western transfer and sequence of the IS90U M. avium p40 gene was isolated by a immunoblotting. Electrophoretic transfer of proteins from PCR-based gene-walking technique described by Brittonet al. SDS-PAGE gels to nitrocellulose membranes (Schleicher & (1999). Briefly, initial low-stringency amplification was per Schuell) was carried out in accordance with the method of formed using a random primer (5'-GCTCATAGCTGTGT- Herring 6c Sharp (1984). Mono-specific polyclonal antibodies ATGTTCTG-3') in conjunction with a p40-gene-derived were affinity-purified from rabbit sera as described by Beall & antisense primer (5'-GTGCGCGTGTAGAGGGAATCA-3') Mitchell (1986). complementary to bases 4-341 to +321 relative to the p40 GTG translational start codon. Reaction mixtures contained Confirmation of species identity by PCR. Cultured myco 500 ng IS90U M. avium genomic DNA, ( x 1) reaction buffer bacterial cells were mechanically disrupted by bead-beating. at 15 mM MgCl^ (Promega), L25 mM each of dATP, dCTP, Lysates were centrifuged at 13 000g for 5 min to remove dGTP and dTTP, 20 pmol each of the forward and reverse cell debris, and 5 pi clarified lysate was subjected to PCR primers and 1 \] Taq polymerase (Promega) in 50 gl reaction analysis. The identity of M.avium subsp. paratuberculosis volumes. PCR conditions consisted of an initial dénaturation was confirmed by the detection of IS900 amplified using step of 5 min at 94 °C, followed by 30 cycles of dénaturation primers P90 (5 -GTTCGGGGCCGTCGCTTAGG-3') and at 94 °C for 1 min, annealing at 30 °C for 1 min and extension P91 (5'-CCCACGTGACCTCGCCTCCA-3'), as described by at 72 °C for 3 min. The final cycle included an extension at Sanderson et al. (1992). The identity of M. avium was 72 °C for 7 min. The amplification product of this low- confirmed by the detection ofIS901 amplified using primers stringency PCR was then used as template in a second round P102 (5'-CTGATTGAGATCTGACGC-3') and P103 (5'- of high-stringency amplification, using the same random TTAGCAATCCGGCGCCCT-3'). PCR conditions were as primer as above, and a nested p40-gene-derived antisense described for amplification of IS900, and amplification of a primer (5'-CCAGGCCGCGATAGAACAGAT-3') comple single band of 252 bp confirmed the species identity as IS90U mentary to bases + 295 to + 275 relative to the translational M. avium. start codon. PCR conditions were as described above, except Cloning and sequencing of the p40 gene. The entire p40 ORF that the annealing temperature was increased from 30 °C to was amplified by PCR from M.avium JD 88/118 as follows. 57-9 °C. Second-round amplification products were separated M. avium genomic DNA (125 ng) was added to pre-prepared on a 1% (w/v) agarose gel. Southern-blotted and probed at reaction mixtures (100 pi final volume) comprising ( x 1) high stringency using a fluorescein-labelled (Gene Images; reaction buffer at 1-5 mM MgCl^ (Qiagen), 1 25 mM each of Amersham) p40 gene fragment corresponding to positions

1559 N. F. INGLIS and OTHERS

+ 22 to +295. Hybridizing bands were excised from the gel 26 27 28 29 M and recovered byAgarAce digestion in accordance with the # 1 (M # 9 manufacturer’s recommendations. Preparation of a 528 bp p40-specific DNA probe. M. avium genomic DNA (125 ng) was added to pre-prepared reaction mixtures (100 gl final volume) comprising ( x 1) reaction buffer at 1-5 mM MgCL (Qiagen), T25 mM each of dATP, dCTP, dGTP and dTTP, 20 pmol each of the forward and reverse 78 primers (forward primer, 5'-CAGCGGGTCAAGGCCAAT- MR 68 GTGTTGTA-3% positions 256-281; reverse primer, 5'-CG- GGAGGGGGAATCCGATGGTGTGCC-3', positions 784- 759), and I U HotStar Taq polymerase (Qiagen). Hot-start PGR conditions consisted of an initial dénaturation step of 43 15 mill at 96 °C, followed by 35 cycles of 1 min dénaturation 40 — at 96 °G, I min annealing at 65 °C and 90 s extension at 72 °C, and a final extension step of 8 min at 72 °C. The PCR product was excised from a 0 8 % (w/v) low-melting-point agarose gel, extracted with AgarAce and then labelled as described below. 30 Labelling and Southern hybridization of probe DNA. High- molecular-mass genomic DNA was prepared from heat-killed organisms and digested with restriction endonuclease BamHl in accordance with a protocol described for PFGE (Hughes et al., 2001). Samples were electrophoresed in 1 % (w/v) agarose gels and the DNA transferred to Hybond N + nylon mem brane (Amersham) as described by Sambrooket al. (1989). 17 2 Probe DNA was labelled using the Gene Images random prime 12 3 labelling module (Amersham) in accordance with the manu facturer’s recommendations. Hybridization was performed at 55 °C over 15-16 h. The final probe concentration was 3 ng Fig. 1. Silver-stained SDS-PAGE gel sflowing highly purified p40 resulting from sequential size exclusion, anion exchange and liquid block ml”^ (Amersham). Initial stringency washes hydrophobic interaction HPLC. Labels 26-29 above the lanes (3 X 15 min) were carried out in 1 x SSC/OT % (w/v) SDS at correspond to elution times (min) from the hydrophobic 42 °C. Higher-stringency washes (3 x 15 min) were performed interaction column. Lane M contains standard protein markers in 0 1 X SSC/0 1 % SDS at 55 °C. Hybridized probe DNA was (shown in kDa). Artefactual bands of ~ 55-67 kDa are visible in detected using the Gene Images CDP-Star detection module all lanes and originate from the 2-y5-mercaptoethanol used in (Amersham) in accordance with the manufacturer’s recom the sample denaturing buffer (Tasheva & Dessev, 1983). mendations. Autoradiography was performed using Kodak X- OMAT AR scientific imaging film. Typical exposure times varied between 5 and 15 min at room temperature. M 212 — J- RESULTS 122 — * p40 is expressed only in \S901* M. avium 83 — - Previous studies investigating the expression of p40 in A4, avium complex isolates suggested that the expression 5 1 - of this protein was restricted to IS90F A4, avium (Ingiis et at., 1994; Ahrens et al., 1995). The present study, 35 — -*5- therefore, investigated expression of p40 in a wider 2 8 — range of Mycobacterium species by Western immuno blotting, using mono-specific polyclonal antibodies to p 4 0 . 2 0 — p40 was purified from Eaton-pressed lysates of A4. 7 — ' avium JD88/118 by ammonium sulphate precipitation followed by sequential size exclusion, anion exchange and hydrophobic interaction HPLC. This procedure Fig. 2. Western blot of mycobacterial cell lysates probed with yielded highly purified p40, as visualized on silver- affinity-purified anti-p40 polyclonal antibody. Lanes; 1, IS907+ stained SDS-PAGE gels (Fig. 1). Approximately 500- M. avium (JD88/118); 2, 15907“ M. avium (T133); 3, M. avium 600 pg purified p40 could be obtained from 1 g (wet wt) subsp. paratuberculosis (JD88/107); 4, M. tuberculosis (NCTC 7416); 5, M. leprae. Lane M contains standard protein markers A4, avium cells. Purified p40 was used to raise polyclonal (shown in kDa). antibodies to p40 in rabbits, and mono-specific poly clonal antibodies were affinity-purified from the rabbit antisera. antigen: without exception, only those strains of A4. Thirty-two differentMycobacterium species, subspecies avium isolated from birds or domestic livestock were and strains were screened for expression of the p40 observed to express the p40 antigen (Table 1 and Fig. 2).

1560 Unique expression of p40 in IS90F M. avium

-40 -30 -20 -10 -1 + 1 +10 M.avium {1S901+) GATTGACCCT C6ATTCTACA GCCTGCTAGC ATGTGGCGTT GTGACCAGTG M. avium (IS901-) GATTGACCCT CGATTYCACA GCCTGCCAGC ATGTGGCGTT GTGACCAGTG M.a.ptb GATTGACCCT CGATTCCACA GCCTACCAGC ATGTGGCGTT GTGACCAGTG M. tuberculosis TATTGACCCC CTGTCCGATA GCCTGCCAGC ATGTGGCGTT GTGGCTAGCG M.bovis TATTGACCCC CTGTCCGATA GCCTGCCAGA ATGTGGCGTT GTGGCTAGCG M. leprae GATTGATCCC G .GATCGACA ATCTGCCAGC ATGTGGCGTT GTGACTGCTA M. smegmatis GGCTGCCACC G CGGAGG CGTGAATAGC ATGTGAAGCC GTGACTGCAC Consensus -10 ...... TAGC A T ...... Consensus -35 ..TTGACA ......

Fig. 3. Alignment of sequences upstream of the p40 gene homologues in IS907+ M avium, 15907“ M. avium, M. avium subsp. paratuberculosis {M.a.ptb), M. bovis, M. leprae, M. smegmatis and M. tuberculosis. Numbering (—40 to +10) refers to the 15907+ M. avium sequence. The first 10 bp of the p40 ORFs are shown underlined, beginning with +1 at the GTG translational start codon. Consensus —10 and —35 regions mark the position of a putative promoter. A TGN motif immediately precedes the —10 region in all species exceptM. avium subsp. paratuberculosis. In the case of M. smegmatis, a single nucleotide (A) separates the TGN motif and the start of the —10 hexamer.

Furthermore, in support of our previous observations, at residue 164, where proline, in 15901“ M. avium, is expression of the p40 antigen was detected only in replaced with alanine in IS901''" M. avium (data not IS90F organisms. None of the other species of M yco shown). bacterium, including an IS901~ human isolate of M. avium (strain T133), could be shown to harbour IS901 Characterization of the upstream sequences of the or express p40, and neither IS901 nor p40 was detected p40 gene from IS907'*' M. avium alone in any isolate. To determine whether any features of the genomic p40 gene homologues are present in \S901~ M. sequences immediately upstream of the p40 genes in avium, M. avium subsp. paratuberculosis, M. bovis, IS90U and 15901“ strains of M. avium might be M. leprae, M. tuberculosis and M. smegmatis associated with the differential expression of p40, the upstream region of I590U M. avium strain JD88/118 A search of the currently availableMycobacterium was obtained by a PCR-based gene-walking technique. genome databases with the 20 N-terminal amino acid A total of 814 bp was obtained, comprising 272 bp of the residues of p40 (data not shown) revealed p40 homo 5' end of the p40 gene sequence and 542 bp upstream logues in several Mycobacterium species. Sequence sequence (accession no. AF247653). A b l a s t search of identity (50-100%) was shown with p40 homologues in the TICR unfinished M. avium genome sequence Mycobacterium tuberculosis (65%) (EMBL accession revealed 99% identity with a homologous region on number Z92669), Mycobacterium leprae (70%) (EMBL fragment 187. Further searches of the TICR, CenBank, accession no. Z95398), M. avium and Mycobacterium University of Minnesota and 5anger Centre databases smegmatis (100 and 50%, respectively) (TIGR un identified the corresponding p40 upstream sequences of finished genome sequences), M. avium subsp. para M. avium subsp. paratuberculosis, M. bovis, M. leprae, tuberculosis (95 % ) (University of Minnesota unfinished M. smegmatis and M. tuberculosis. Comparison of the genome sequence) and M. bovis (65 % ) (Sanger Centre p40 upstream regions of both I590U and 15901“ M. unfinished genome sequence). avium revealed two single base pair substitutions at positions —14 and —24, relative to the CTC initiation Cloning and sequencing of the gene encoding p40 in codon, with a possible third substitution at position IS901* M. avium — 25, where Y, in the 15901“ M. avium sequence, denotes either C or T (Fig. 3). N o copy of the 15901 To characterize the p40 gene in IS90U M. avium in more insertion element was observed within the 542 bp detail, the entire p40 ORF was amplified by PCR from upstream region. M. avium JD88/118 genomic DNA, using primer sequences determined from the TICR unfinished M. To identify potential promoters in the upstream regions, avium genome sequence. This human isolate of M. a consensus mycobacterial promoter sequence was avium (strain 104) is IS901“. A product of 1041 bp, compiled (Bashyamet al., 1996; Mulder et al., 1997) by including 18 bp genomic sequence upstream of the aligning the —10 and —35 regions of known myco putative initiation codon (CTC), was amplified and bacterial promoters (data not shown). The resulting sequenced. The complete nucleotide sequence of the p40 — 10 and —35 consensus sequences were aligned with gene, together with 542 bp upstream sequence, is avail the sequences lying upstream of the p40 gene homo able from CenBank (accession no. AF247653). Com logues of I590U M. avium, 15901“ M. avium, M. avium parative alignment of the p40 genes of IS90U and IS901“ subsp. paratuberculosis, M. bovis, M. leprae, M. smeg M. avium revealed only four nucleotide substitutions at matis and M. tuberculosis. 5equence alignments were positions 4-291, 4-321, -F336 and 4-493 (99 6 % ident performed using the a l i g n x program in the Vector NTI ity) (data not shown). Only one of these substitutions Suite (Informax). This analysis highlighted a putative (position 493) translated to an amino acid substitution promoter region (Fig. 3).

1561 N. F. INGLIS and OTHERS

10 11 12 13 M

12 5 Fig. 4. Southern blot of mycobacterial genomic DMAs probed with a 528 bp 11 fragment of the M. avium (strain JD88/118) 8 p40 gene. Lanes; 1, IS907+ M. avium (strain JD88/118); 2, 15907“ M. avium (1133); 3, M. ■5 avium subsp. paratuberculosis (JD88/107); 4 4, M. intracellulare (NCTC 10425); 5, M. H37Rv (7416); 5, 3 tuberculosis M. bovis (10772); 7, M. malmoense (11298); 8, M. haemophilum (11185); 9, M. xenopi (10042); 10, M. fortuitum (10394); 11, M. kansasii (10268); 12, M. marinum (2275); 13, M. leprae. Lane M contains molecular size markers (shown in kb).

p40 gene homologues are widely distributed within bacteria included in this study were propagatedin vitro, th e g e n u s Mycobacterium our observations cannot exclude in vivo expression of p40. Nevertheless, the absence of p40 expression in M. To determine the distribution of the p40 gene within the leprae, together with the observation of specific T-cell gen u s Mycobacterium, Southern blots of genomic DNAs immune responses to the p40 antigen in sheep ex o f 23 Mycobacterium species (Table 1) were probed perimentally infected with IS90H M.avium but not in with a 528 bp fragment of the p40 gene of M. avium sheep infected with M. avium subsp. paratuberculosis (strain JD88/118). Genes homologous to the p40 gene in (Burrells et al., 1995), support the absence of in vivo IS901~^ M . avium were detected in all of the species expression in other mycobacteria and indicate that tested, with eight exceptions (Table 1 and Fig. 4). Seven differences in gene regulation may account for the of these (M. chelonae subsp. chelonae and subsp. unusual expression. abscessus, Mycobacterium fortuitum, Mycobacterium kansasii, M. marinum, Mycobacterium phlei and M y co To ascertain whether species-specific expression of p40 bacterium terrae) were checked by PGR using p40 might be attributable to differences in nucleotide se consensus primers. A p40-specific product was amplified quence at promoter level, the upstream regions of p40 from M . kansasii, M. marinum, M. phlei and M . terrae gene homologues from all seven of the above M y co but not from M. fortuitum, M. chelonae su bsp. chelonae bacterium species were aligned and compared. Pre or subsp. abscessus. T h e M . leprae p40 gene homologue liminary analysis of these upstream sequences revealed is currently available in the EMBL database and was not —10 and —35 hexamers of a putative promoter region. tested by PGR. Notably, IS90H M. avium and M . sm egm atis w ere observed to differ from the other species at the —14 DISCUSSION position, where T replaces C at the first position of the putative —10 region. In addition, TGN motifs, which This study has confirmed earlier reports of the ex have been reported to enhance the transcriptional pression of p40 in IS90T^ M. avium (Inglis et al., activity of some mycobacterial promoters (Bashyam & 1994; Ahrens et al., 1995 ; Inglis, 1997) and has extended Tyagi, 1998), were noted to immediately precede the this observation to show that p40 is not expressed in a —10 hexamer in all cases except M.sm egm atis, in w h ich wide range of mycobacterial species. Despite the absence a single nucleotide (A) separated the TGN motif and the of p40 expression, it was demonstrated clearly that p40 first base of the —10 region. Single base pair mutations gene homologues are widely distributed within the genus in —10 regions or their TGN extensions have been Mycobacterium. The concurrence of IS901 and p40, reported to exert marked effects on the efficiency of gene therefore, represents a unique example of constitutive transcription in mycobacteria and enterobacteria expression of a highly conserved mycobacterial gene in (Bashyam & Tyagi, 1998; Timmet al., 1994; Youderian association with a genomic insertion element. These et al., 1982). However, in the absence of laboratory observations raise fundamental questions as to why the confirmation, no firm conclusions can be drawn from p40 gene homologues apparently are not expressed in currently available data. Further work is under way to other species of Mycobacterium, and also why ex establish whether expression of the p40 gene in IS90H pression of the p40 gene is confined to strains of M. M . avium is the result of only a single base pair avium that harbour the insertion element IS901. substitution in the —10 region of the putative promoter.

Database searches identified complete p40 ORFs in M. Differences in the promoter region, as discussed above, bovis, M. leprae, M. smegmatis, M. tuberculosis and, in do not explain the absolute concordance between particular, IS901“ M. avium and M . avium subsp. expression of p40 and IS901. The insertion sequence paratuberculosis, whose respective p40 gene homo itself does not contain an ORF for a p40 homologue, nor logues share 99 6 and 98 9 % identity with that ofIS901^ does it possess outward-facing promoters that are M . avium . However, because almost all of the myco capable of switching on expression of adjacent genes, as

1562 Unique expression of p40 in 18901^ M . avium described for ISlO/TnlO (Dale, 1995). It seems unlikely, UK) for providing the National Collection of Type Cultures therefore, that IS901 is acting in cis to upregulate p40; (NCTC) reference strains; Dr Johnjoe McFadden (University this is supported by our failure to amplify a product of Surrey, Surrey, UK) for providing M.avium strain T133 ; Dr using primers derived from the 3' end of IS9Ô1 and the 5' Patrick J. Brennan (Colorado State University, Fort Collins, Colorado, USA) for providing M. leprae genomic DNA and end of the p40 gene (unpublished). cell fractions; and Mrs Amanda Pirie (Moredun Research An alternative mechanism that could possibly account Institute, Edinburgh, UK) for expert technical assistance. The for constitutive expression of p40 only in IS90H authors acknowledge that preliminary sequence data for M. M. avium would be if expression of the p40 gene were avium was obtained from TIGR and that sequencing of the M. normally tightly regulated and under the control of a avium genome was accomplished with support from the repressor mechanism in Mycobacterium species that National Institute of Allergy and Infectious Diseases. This work was funded by the Scottish Executive Rural Affairs lack IS901. Such regulatory mechanisms have been Department, the Moredun Foundation for Animal Health and reported for a number of mycobacterial genes Welfare, and the Commission of the European Communities (Dhandayuthapaniet al., 1997; Durbach et al., 1997; (CAMAR contract no. 8001-CT90-0014). D.G.H. is the Dussurget et al., 1996, 1999; Manabe et al., 1999; recipient of a Marie-Curie Fellowship for a PhD from the Movahedzadeh et al., 1997 ; Schmitt et al., 1995 ; Sun et European Commission. al., 1998). If a similar repressor protein is responsible for regulating expression of the p40 gene, constitutive expression of p40 would be a direct consequence of REFERENCES integration of IS901 within either the repressor gene Ahrens, P., Giese, S. B., Klausen, J. & Inglis, N. F. (1995). Two itself or the p40 gene repressor binding site. Such markers, IS901/902 and p40, identified by PCR and by using unregulated expression of p40 could be manifested as a monoclonal antibodies, in Mycobacterium avium strains. ] Clin phenotypic change or altered pathogenicity of IS90H M. Microbiol 33, 1049-1053. avium. It has been demonstrated that IS90H M. avium Bashyam, M. D. & Tyagi, A. K. (1998). Identification and analysis (type A/I) is more virulent than IS901“ M.avium (type of extended —10 promoters from mycobacteria. Bacteriol/ 180, A) in experimentally inoculated BALB/c mice (Kunzeet 2568-2573. al., 1991; Pedrosa et al., 1994). Although the increased Bashyam, M. D., Kaushal, D., Dasgupta, S. K. & Tyagi, A. K. virulence was attributed to the presence of IS901 in M. (1996). A study of the mycobacterial transcriptional apparatus; avium type A /I strains, it is conceivable that unrepressed identification of novel features in promoter elements. J Bacteriol expression of p40 might be involved. Whatever the 178, 4847-^853. nature of the association between IS901 and expression Beall, J. A. & Mitchell, G. P. (1986). Identification of a particular of the p40 gene, it is clear that the presence of multiple antigen from a parasite cDNA library using antibodies affinity copies of IS901 appears to divide M. avium into two purified from selected portions of Western blots. J Immunol distinct subtypes with differing host ranges and patho Methods 86, 217-223. genicity. It should be emphasized, however, that in the Britton, C., Redmond, D. L., Knox, D. P., McKerrow, J. H. & Barry, absence of a clearly defined molecular mechanism, there J. D. (1999). Identification of promoter elements of parasite is currently no firm evidence upon which a direct link nematode genes in transgenic Caenorhabditis elegans. Mol between these differences and the presence of IS901 can Biochem Parasitol 103, 171—181. be based. Nevertheless, it is intriguing that the presence Bull, T. J., Hermon-Taylor, J., Pavlik, I., El-Zaatari, F. & Tizard, M. of the closely related insertion element IS900 in M. (2000). Characterisation of 1S900 loci in Mycobacterium avium avium subsp. paratuberculosis (Green et al., 1989) also subspecies paratuberculosis and development of multiplex PCR supports differences in host range and pathogenicity typing.Microbiology 146, 2185-2197. relative to strains of M. avium that possess neither IS901 Buluwela, L., Forster, A. & Babbitts, T. H. (1989). A rapid nor IS900. With the implications for comparative procedure for colony screening using nylon filters.Nucleic Acids functional genomics in mind, it would clearly be of great Res 17, 452. interest to identify and characterize the genes affected by Burrells, C, Inglis, N. P., Davies, R. C. & Sharp, J. M. (1995). the insertion of IS901 and IS900 in M. avium and M. Detection of specific T-cell reactivity in sheep infected with avium subsp. paratuberculosis, respectively. The charac Mycobacterium avium subspecies silvaticum and para tuberculosis using two defined mycobacterial antigens. Vet terization of most of the IS900 loci in M. avium subsp. Immunol Immunopathol 45, 311-320. paratuberculosis was reported recently (Bull et al., 2000). Furthermore, completion of the ongoing M. Challans, J. A., Stevenson, K., Reid, H. W. & Sharp, J. M. (1994). A avium and M. avium subsp. paratuberculosis genome rapid method for the extraction and amplification of Myco- bacterium paratuberculosis DNA from clinical samples. Vet sequencing projects should facilitate our understanding Record 134, 95-96. of how the acquisition and chromosomal integration of genomic insertion elements might affect the biology of Dale, J. W. (1995). Mobile genetic elements in mycobacteria.Eur Respir } 8, suppl. 20, 633s-648s. these organisms. Dhandayuthapani, S., Mudd, M. & Deretic, V. (1997). Interactions of OxyR with the promoter region of theoxyR and ahpC genes ACKNOWLEDGEMENTS from Mycobacterium leprae and Mycobacterium tuberculosis. J The authors are indebted to the following for their assistance : Bacteriol 179, 2401-2409. Dr Brian Watt, Mr Alan Raynor and Mrs Pauline Claxton Durbach, S. I., Anderson, S. J. & Mizrahi, V. (1997). SOS induction (Scottish Mycobacteria Reference Laboratory, Edinburgh, in mycobacteria, analysis of the DNA-binding activity of a LexA-

1563 N. F. INGLIS and OTHERS

like repressor and its role in DNA damage induction of the recA Morrisey, J. H. (1981). Silver stain for proteins in polyacrylamide gene from Mycobacterium smegmatis. Mol Microbiol 26, gels, a modified procedure with enhanced uniform sensitivity. 643-653. Anal Biochem 117, 307—310. Dussurget, D., Rodrigues, M. & Smith, I. (1996). An IdeR mutant Movahedzadeh, F., Colston, M. J. & Davis, E. O. (1997). Charac of Mycobacterium smegmatis has depressed siderophore pro terisation of Mycobacterium tuberculosisi LexA, recognition of a duction and an altered oxidative-stress response.Mol Microbiol Cheo (Bacillus-type SOS) box.Microbiology 143, 929-936. 22, 535-544. Mulder, M. A., Zappe, H. & Steyn, L. M. (1997). Mycobacterial Dussurget, D., Timm, J., Gomez, M., Gold, B., Yu, S., Sabol, S. Z., promoters. Tuber Lung Dis 78, 211-223. Holmes, R. K., Jacobs, W. R. & Smith, I. (1999). Transcriptional Nyange, J. F. C. (1990).Studies on paratuberculosis in red deer. control of the iron-responsive fxbA gene by the mycobacterial PhD thesis. University of Edinburgh. regulator IdeR. J Bacteriol 181, 3402-3408. Pedrosa, J„ Florldo, M., Kunze, Z. M., Castro, A. G., Portaels, F., Eaton, N. R. (1962). New press for disruption of micro-organisms. McFadden, J., Silva, M. T. & Appelberg, R. (1994). Charac ] Bacteriol 83, 1359-1360. terisation of the virulence of Mycobacterium avium complex Green, E. P., Tizard, M. L. V., Moss, M. T., Thompson, J., (MAC) isolates in mice. Clin Exp Immunol 98, 210-216. Winterbourne, D. J., McFadden, J. & Hermon-Taylor, J. (1989). Sambrook, J., Fritsch, E. F. & Maniatis, T. (1989). Molecular Sequence and characteristics of IS900, an insertion element Cloning: a Laboratory Manual, 2nd edn. Cold Spring Harbor, identified in a human Crohn’s disease isolate of Mycobacterium NY; Cold Spring Harbor Laboratory. paratuberculosis. Nucleic Acids Res 17, 9063-9073. Sanderson, J., Moss, M. T., Tizard, M. L. V. & Hermon-Taylor, J. Herring, A. J. & Sharp, J. M. (1984). Protein blotting, the basic (1992). Mycobacterium paratuberculosis DNA in Crohn’s disease method and its role in viral diagnosis. In Recent Advances in tissue. Gut 33, 890-896. Diagnosis, pp. 115-124. Edited by M. S. McNulty & J. B. Sanger, F., Nicklen, S. & Coulsen, A. R. (1977). DNA sequencing McFerran. The Hague; Martinus Nijhoff. with chain-terminating inhibitors. Proc Natl Acad Sci USA 74, Hughes, V. M., Stevenson, K. & Sharp, J. M. (2001). Improved 5463-5467. preparation of high molecular weight DNA for pulsed-held gel Schmitt, M. P., Predich, M., Doukhan, L., Smith, I. & Holmes, R. K. electrophoresis from mycobacteria. J Microbiol Methods 44, (1995). Characterisation of an iron-dependent regulatory protein 209-215. (IdeR) of Mycobacterium tuberculosis as a functional homologue Inglis, N. F. (1997). Studies on a 40 kDa protein antigen of of the Diphtheria toxin repressor (DtxR) fromCorynebacterium 1S901 /902-positive Mycobacterium avium. PhD thesis. University diphtheriae. Infect Immun 63, 4284-4289. of Edinburgh. Sun, L., van der Spek, J. & Murphy, J. R. (1998). Isolation and Inglis, N. F., Davies, R. C., Stevenson, K., Burrells, C, Porter, J. F., characterisation of iron-dependent positive dominant mutants of Nyange, J. F. C. & Sharp, J. M. (1994). Identification of an the diphtheria toxin repressor DtxR.Proc Natl Acad Sci USA 95, immunogenic 40 kDa protein that may be specific for some strains 14985-14900. of Mycobacterium avium. In Proceedings of the Fourth In Tasheva, B. & Dessev, G. (1983). Artefacts in SDS-polyacrylamide ternational Colloquium on Paratuberculosis, pp. 225-230. Edited gel electrophoresis due to 2-)S-mercaptoethanol. Anal Biochem by R. J. Chiodini, M. T. Collins & E. O. E. Bassey. Providence, 129, 98-102. RI; International Association for Paratuberculosis. Timm, J., Perilli, G., Duez, C. & 9 other authors (1994). Kunze, Z. M., Wall, S., Appleberg, R., Silva, M. T., Portaels, F. & Transcription and expression analysis usinglacZ and phoA gene McFadden, J. (1991). IS901, a new member of a widespread class fusions of Mycobacterium fortuitum ^-lactamase genes cloned of atypical insertion sequences, is associated with pathogenicity from a natural isolate and a high-level jg-lactamase producer.Mol in Mycobacterium avium. Mol Microbiol 5, 2265-2272. Microbiol 12, 491-504. Laemmli, U. K, (1970). Cleavage of structural proteins during the Youderian, P., Bouvier, S. & Susskind, M. M. (1982). Sequence assembly of the head of bacteriophage T4.Nature 227, 680-685. determinants of promoter activity.Cell 30, 843-853. Manabe, V. C, Saviola, B. J., Sun, L, Murphy, j. R. & Bishai, W. R. (1999). Attenuation of virulence in Mycobacterium tuberculosis expressing a constitutively active iron repressor.Proc Natl Acad Received 29 September 2000; revised 2 January 2001 ; accepted Sci USA 96, 12844-12848. 5 February 2001.

1 5 6 4

Reproduced with permission of copyright owner. Further reproduction prohibited without permission.