Pak)-Nck Binding in the Formation of Filopodia and Large Protrusions

ROLE OF P21-ACTIVATED KINASE (PAK)-NCK BINDING IN THE FORMATION OF FILOPODIA AND LARGE PROTRUSIONS

John Gary DeMuth

A Thesis

Submitted to the Graduate College of Bowling Green State University in partial fulfillment of the requirements for the degree of

Master of Science

May 2010

Committee:

Carol A. Heckman, Advisor

Michael E. Geusz

Mikhail A. Zamkov

ABSTRACT

Carol Heckman, Advisor

The p21-activated kinases (PAK) isoforms 1-3 are serine-threonine kinases [1]. One potential binding partner for PAK is the non-catalytic tyrosine kinase adaptor protein, Nck [2]. It had previously been found that large protrusions decreased in rat 1000 W respiratory tract epithelial cells when the Nck-binding portion of PAK 1 (PAK7-24) was introduced into them. The cell line used was an in vitro model of lung cancer. When the corresponding Nck SH3[2] domain was introduced, the same was not observed. It was also found that the Nck-binding segment of

PAK 1, PAK7-24, had no effect upon filopodia, while introduction of the PAK-binding Nck

SH3[2] domain decreased filopodia formation. One possible interpretation for the results was that, for each protein, there was another partner (not Nck or PAK) binding at the same domain.

Another explanation for the observations was that two PAK isoforms were required, one for each type of protrusion [3].

To determine if different PAK isoforms were involved in filopodia and large protrusion formation, the 1-25 N-terminal amino acid sequence of each PAK isoform was introduced. This was preceded in some treatments by introduction of siRNAs against PAK 1-3 isoforms separately to knock down transcript production. Cells were then prepared for viewing by scanning electron microscopy. Micrographs of random cells were taken, their edges traced, and these tracings then scanned and transferred to a computer program that analyzed cell shape.

Differences between sample means were determined by analysis of variance (ANOVA), and

Duncan's multiple range test was employed to evaluate the relationship among samples.

Only PAK 2 was associated with filopodia formation. Specific PAK 2 siRNA inhibited filopodia, while the PAK 21-25 peptide reversed the inhibition of these structures by tumor

iii

promoters. Specific siRNA against PAK 1 and PAK 2 were each found to block large protrusion

formation. However, this only decreased the prevalence of large protrusions to the level of the

sham-treated and untreated control samples, because the respective 1-25 N-terminal sequences had the unexpected effect of enhancing large protrusion formation compared controls. The results supported isoform-specific formation of the protrusions.

ACKNOWLEDGEMENTS

I would like to thank the late Dr. Stan Smith for aiding my entry into the Biological Sciences graduate program at Bowling Green State University. I would like to thank Dr. Marilyn Cayer for her direction in my utilization of various machines of the electron microscopy center, as well as the many cell tracings she graciously completed. I would like to thank Dr. Nancy Boudreau and her various graduate students for their aid in analyzing and interpreting my data. I would like to thank Patrick Richey, Deirdre Dobos, and Santosh Malwade for their efforts in tracing cell micrographs used in my thesis experiment. I would like to thank Drs. Michael Geusz and

Mikhail Zamkov for their roles as members of my thesis committee. And I would especially like to thank Dr. Carol Heckman for her patient, tireless support and intelligent guidance while I was an undergraduate and as a Master’s student in her laboratory. To all, I will be forever grateful, striving to help others as you have me.

TABLE OF CONTENTS

INTRODUCTION……..……..…………………………………………………….. 1

MATERIALS AND METHODS……..…….………………………..……………… 9

RESULTS………………...…………………………………………………………. 15

DISCUSSION………………………………………………………………………. 21

REFERENCES…………………………………………………………………….... 24

APPENDIX…………………………………………………………………………. 43

TABLES

TEXT TABLES

6 Factor #4 values after PAK knockdown and PAK peptide interference…………. 16

7 Factor #7 values after PAK knockdown and PAK peptide interference………….. 19

8 Selected factor 7 values after PAK knockdown and PAK peptide interference….. 20

APPENDIX TABLES

1 Upstream effectors of Rac- or Cdc42-mediated PAK activation …………………. 43

2 Effectors of PAK activation not requiring GTPases Rac or Cdc42………………. 44

3 Effectors of PAK inactivation……………………………………………………... 45

4 Binding partners of Nck's SH2 domain…………………………………………… 46

5 Binding partners of Nck's SH3 domains…………………………………………... 47

vii

FIGURES

1 Schematic diagram indicating features of PAK1 structure…….……………..…... 4

2 Schematic diagram of PAK1 autoregulation and activation by Cdc42………….. 5

3 Modular composition of Nck adaptor proteins…………………………………..... 6

4 Hypothesis of isoform-selective Nck-PAK binding in protrusion formation…….. 7

5 Example of a 1000 W cell as observed by scanning electron microscopy………… 13

INTRODUCTION

Embryonic development, tissue repair, and immune system functioning, as well as the

pathological processes of inflammatory disease and tumor cell invasion, all depend upon cell

migration [4-6]. A cell's migration can be characterized by its speed and directionality, which

are the manifestations of and dependent upon the complex interactions among protrusion

formation, membrane interactions with the substrate, and cytoskeletal dynamics migration [4, 5,

7, 8]. Directed migration can be differentiated by whether it is controlled by intrinsic or external

cues [9]. The former refers to “the propensity of cells to continue migrating in the same

direction without turning”, while the latter refers to the process of chemotaxis [9]. Inducing genetic mutations to PAK and dreadlocks (dock), a Nck homolog, showed the two to be essential in the oriented movement of Drosophila melanogaster photoreceptor axon guidance [10], with dock appearing to target PAK to focal contacts during this process [11]. Examining whether the same relationship of Nck and PAK, with regards to persistent directional movement, exists in rat epithelial respiratory cells is the focus of the current research.

Actin, focal contacts, and cellular protrusions

Actin filaments, along with intermediate filaments and microtubules, comprise the main structural components of the eukaryotic cytoskeleton. Connecting the actin to the extracellular matrix are integrin-mediated structures termed focal contacts [12]. The adaptor protein, paxillin, has a primary role in the formation and dissolution of these focal contacts [13]. It is proposed that, upon its phosphorylation by a kinase downstream of a GTPase, cell division cycle 42

(Cdc42) or Ras-related C3 botulinum toxin substrate 1 (Rac), paxillin is then able to interact with

G-protein coupled receptor kinase interacting proteins, GIT1 and GIT2. GIT1 is bound, through

its Spa2 homology domain, to PAK-interacting exchange factor protein (PIX). Phosphorylation

of paxillin Ser-273 by PAK appears to leave GIT1 binding unaffected while removing the site

where focal adhesion kinase (FAK) binds to paxillin [14]. The turnover of the focal contacts

involves similar mechanisms [15-17].

One type of actin-based cellular protrusion is filopodia, which have identified roles in cellular

motility and guidance, developing adhesions, and transmission of signals related to cellular

motility [18]. By statistical analysis of variables contributing to shape in high resolution images, filopodia have been characterized and thus, identified and distinguished from other protrusion types [19]. Study of the neuronal growth cone revealed that filopodia are organized by an organelle called the focal actin ring, and have focal contacts at their basal, mid, and tip regions; the focal actin ring is believed to attach actin filaments to the basal region, and as a result, engender tension and filopodia emergence [20, 21]. Another type of actin-based cell protrusion

observed in oncogenically transformed cells is the large protrusion. Like filopodia, it can be

identified and distinguished from other types of protrusions via mathematical and statistical

analysis of cell images [22]. Since large protrusion formation requires coordination over a

comparably broader expanse of cytoplasm, the underlying mechanisms and effectors may be

different from those in filopodia formation. It is through the dynamic assembly and disassembly

of the protrusions' focal contacts that a cell is able to move.

The PAK isoforms 1 (alpha), 2 (gamma), and 3 (beta)

The PAK 1-3 isoforms were first identified in a search for binding partners for the GTPases

Rac and Cdc42 [1]. Proteins known as p21s resemble the alpha subunit of heterotrimeric G

proteins. To date, a total of six isoforms of PAK have been identified [23], with homologs of

PAK found in organisms ranging from protozoa to yeast to fruit flies to mammals [24, 25].

While sharing some similar features, PAK 1-3 isoforms can be distinguished from the PAK 4-6 isoforms: the former have an N-terminal inhibitory domain and are able to be activated by

GTPases, while the latter lack a complex N-terminal sequence [26]. In the following, I will be focusing only on PAK 1-3 isoforms.

PAK 1-3 are serine-threonine protein kinases [1]. In mammals, PAK 1 is highly expressed in

the brain, muscles, and spleen. PAK 2 is expressed throughout the body. PAK 3 is highly

expressed in the brain [1, 27]. PAK 1-3 have been found to have a role regulating the eukaryotic cell cytoskeleton [26]. Further characterization of their basic structure and modes of

activation and inactivation will be presented in the following.

As Figure 1 shows for PAK 1, PAK isoforms 1-3 all contain a N-terminal that is a regulatory

domain and a C-terminal that is the catalytic domain. Differences in the number of PXXP SH3- binding motifs distinguish the three isoforms, with isoform 1 (alpha) having five, isoform 2

(gamma) having two, and isoform 3 (beta) having four, respectively [26]. All have one non-

classical SH3 binding motif that interacts with PIX family proteins. PIX belongs to a class of

proteins known as guanine nucleotide exchange factors, which activate a GTPase by exchanging guanine disphosphate (GDP) for guanine triphosphate (GTP) on the GTPase [16].

A binding site for the adaptor protein, Nck, is present in the first PXXP SH3-binding motif

[28, 29]. A binding site for the adaptor protein, growth factor receptor-bound protein 2 (Grb2), is present in the second PXXP SH3-binding motif [30]. There is a binding site for GTPase Rac

and Cdc42 family members called the CRIB (Cdc42 and Rac interactive binding) domain [31,

32]. Also present is a p21-binding domain (PBD) that includes the CRIB and provides binding

affinity for p21s, i.e., GTPases. The PBD overlaps with a dimerization domain as well as an

auto-inhibitory segment (AI) that controls the kinase activity level of PAK [33]. There is a site

for the beta and gamma subunit complex of a given G protein to bind [34, 35]. The white circles

in Figure 1 below represent specific amino acids of PAK 1 targeted for phosphorylation by

different kinases: protein kinase B (Akt) at Ser21, cell division cycle 2 (Cdc2) or cell division

protein kinase 5 (Cdk5) at Thr212, and 3’-phophoinositide-dependent kinase (PDK1) at Thr423.

Finally, region ED denotes a region of unknown function [26].

Figure 1: Schematic diagram indicating features of PAK 1 structure [26]

Reprinted, with permission, from Annual Review of Biochemistry, Vol. 27,  2003 by

Annual Reviews, Incorporated and author, Gary Bokoch.

PAK activation can be initiated by many effectors, but perhaps the best understood way is

that mediated by an activated GTPase. GTPase-mediated activation is directed by Nck binding

on the N-terminal [2]. GTPases known to bind to and aid in the activation of PAK include

family members of Rac and Cdc42 [1, 36-40]. Table 1 details several of the known effectors of

Rac- or Cdc42-mediated PAK activation (see Appendix).

As shown in the left portion of Figure 2, inactive PAK is believed to exist as a homodimer,

with one molecule of PAK having its inhibitory domain in contact with the kinase domain of

another. It is proposed that, as shown in the middle and right portions of Figure 2, upon binding

of a GTPase to the CRIB sequence in the inhibitory domains, the dimer dissociates, resulting in

the kinase domain being unblocked. Subsequent phosphorylation of amino acid residues in the

activation loop is required to fully activate the kinase. This can occur when one kinase domain

phosphorylates the other, or when sphingosine, a GTPase independent activator, is involved, or

the residue is phosphorylated by PDK1 [26, 41-53].

Figure 2: Schematic diagram of PAK 1 autoregulation and activation by Cdc42 [26]

Reprinted, with permission, from Annual Review of Biochemistry, Vol. 27,  2003 by

Annual Reviews, Incorporated and author, Gary Bokoch.

As detailed in Table 2, PAK 1-3 can also be activated without GTPase involvement. Very

few activation mechanisms are known to be isoform-specific. However, PAK 2 has been shown

to become activated after caspases lyse it to form two pieces during apoptosis. It is believed that

this truncation relieves the auto-inhibition state, and that one fragment contains the requisite

domains for kinase activity [54, 55]. Table 3 shows the proteins or compounds able to inactivate

PAK 1-3 (see Appendix).

The adaptor protein, Nck

Through their N-terminal PXXP SH3 motifs, which are mentioned above, activated PAK 1-3

can interact with several adaptor proteins, such as new molecule including SH3 protein (NESH),

Grb2, and Nck [26]. While lacking any intrinsic catalytic activity, these adaptors serve to recruit proteins, like the PAKs, to interact with target proteins located at the plasma membrane, in the cytoplasm, or associated with the actin cytoskeleton [2]. In the following, I will solely focus

upon and present characteristics of Nck. This is for two reasons: first, there has been more work

on the consequences of its interaction with PAK than that of other adaptors with PAK, and there

is clear genetic evidence indicating the interaction is important, as axonal pathfinding depends on

the Nck-PAK interaction.

Nck was first identified by the direction of a monoclonal antibody against a cDNA library of

melanoma antigens [56]. Nck has been subsequently found to have a role in regulating actin

[57]. As shown in Figure 3, Nck is composed of one SH2 domain and three SH3 domains. As also shown in Figure 3, Nck exists as one of two possible isoforms, alpha and beta, which share approximately 68% sequence homology, with the differences in the amino acid sequences being mainly in the linker regions [58].

As detailed in Table 4, Nck preferentially interacts through its SH2 domain with pYDEP motifs of tyrosine-phosphorylated proteins [59, 60]. Table 5 shows the different binding partners that Nck interacts with through its SH3 domains (see Appendix).

Figure 3: Modular composition of Nck adaptor proteins (originally published in BioMedCentral) [58].

The roles of Nck and PAK in filopodia and large protrusion formation

Investigation into Nck-PAK interactions, with regards to the formation of filopodia and large protrusions in rat epithelial respiratory cells, had revealed that large protrusions decreased when the Nck-binding portion of PAK 1 (PAK7-24) was introduced. This agreed with previous findings that deletion of the Nck-binding domain on PAK prevented focal contact maturation at the cell

edge [61]. If Nck were titrated by PAK7-24, then the corresponding Nck1 SH3[2] domain should

titrate endogenous PAK and produce the same result. However, this was not observed.

Explanations for the lack of complementary effects by the two interacting surfaces were sought.

First, there might be more proteins than just PAK that could bind to the Nck1 SH3[2] domain.

This “dilution effect” would gain support from the number of SH3 partners listed in Table 5.

However, the domain was effective in blocking filopodia. Alternatively, more than one essential

target may have been blocked by PAK7-24, a hypothesis referred to as a “synergy effect.” For

example, PAK 3 binds both Nck and paxillin through the same domain, so PAK7-24 may have

prevented PAK 3 binding to paxillin. By binding to two proteins essential for protrusion

formation, PAK7-24 may interrupt development of the focal contact and inhibit large protrusions

more effectively than the complementary Nck domain. A third explanation was that the failure

of Nck1 SH3[2] to block large protrusion formation meant that the Nck isoforms were selective

for specific partners, and different PAK-Nck combinations were employed in forming filopodia and larger protrusions. A Nck1 domain may block certain PAK molecules but fail to saturate all of them, due to a lower affinity for one PAK isoform and/or to dilution effect. Thus, even in the presence of Nck1 SH3[2], a PAK isoform that selectively binds Nck2 may remain available [3].

As shown in Figure 4, binding of this more selective isoform to Nck2 may not be eliminated.

Figure 4: Hypothesis of isoform-selective Nck-PAK binding in protrusion formation.

If one isoform, arbitrarily shown as PAK 1, has greater affinity for Nck2 than for Nck1, the

proline-rich domain of PAK 1 may be incompletely saturated and be available to engage in

large protrusion formation.

PAK7-24 was found to have no effect upon filopodia formation, while Nck1 SH3[2] decreased filopodia formation. This result could be consistent with reliance upon different isoforms being involved in protrusion formation. Another isoform, for example PAK 2, may have been titrated more effectively than PAK 1 by Nck1 SH3[2] domain to halt filopodia formation. However,

PAK7-24 might have been unable to titrate both binding partners, as these may have included both

Nck1 and Nck2. Although it seems that the failure of PAK7-24 to inhibit filopodia formation

rules out a requirement for Nck-PAK binding, this is hard to reconcile with the observed synergy

between KID-Nck in filopodia formation [3].

Thus, to determine which PAK 1-3 isoforms individually or in combination could mediate the

formation of the filopodia and large protrusions, double-knockdowns of PAK 1-3 isoforms were

performed. Knockdown at the transcriptional level was done by introducing siRNAs directed

against each PAK isoform separately. This was followed in some treatments by introduction of

the 1-25 amino acid sequence at the N-terminal end of each PAK isoform. I anticipated that the

results would support or disprove the hypothesis that one isoform of PAK was needed for

filopodia focal contact structure and another for large protrusion focal contact structure. If one

of the protrusion types were specifically blocked in one of the doubly-treated cell samples, this

would support the proposed selectivity.

MATERIALS AND METHODS

Cell culture

The 1000 W cell line was generated from respiratory tract epithelium of a Fisher rat by treatment of a heterotropic tracheal transplant with 7, 12-dimethylbenz(a)anthracene. This line is used because, with periodic testing in syngeneic animals, it proved nontumorigenic when first initiated but became tumorigenic after long-term maintenance in culture. Cells in passages 40-50 were maintained at 37° C in 5% CO2 in air and fed with WIHC, a modified Waymouth’s medium containing 10% fetal bovine serum (FBS) and supplemented with 0.1 µg/mL insulin and

0.1 µg/mL hydrocortisone [62, 63]. Cells were routinely subcultured within three days of becoming confluent. Reagents for cell culture were purchased from Invitrogen (Carlsbad, CA or

Grand Island, NY) unless otherwise specified. For experiments, cells were detached from culture dishes with a trypsin-EDTA solution and subcultured into 35 mm tissue culture dishes at a concentration of 2 x 105/dish in 3:2 WIHC:Waymouth’s medium. The cultures were left overnight to become attached and treated within 48 hours.

Transcriptional knockdown and oligopeptide introduction

In previous studies, the protein domains of interest had been made by recombinant DNA techniques using the pXJ40 vector [64]. To facilitate domain recovery, the DNA sequences had been fused to that of glutathione-S-transferase. The Nck-binding domain was a PAK 1 fragment encoding amino acids 7-24. The Nck1 SH3[2] domain was a 66-amino acid sequence encoded by the human Nck sequence:

GGGGAACGTCTCTATGACCTCAACATGCCCGCTTATGTGAAATTTAACTACATGGCT

GAGAGAGAGGATGAATTATCATTGATAAAGGGGACAAAGGTGATCGTCATGGAGAA

ATGCAGTGATGGGTGGTGGCGTGGTAGCTACAATGGACAAGTTGGATGGTTCCCTTC

AAACTATGTAACTGAAGAAGGTGACAGT

In the current studies, I conducted experiments on the short Nck-binding sequences of the

PAK 1-3 isoforms. Synthetic oligopeptides could be used for such experiments instead of

recombinant proteins. The Nck sequence was longer and so, I did not synthesize peptides of the

complementary Nck PAK-binding domain.

Oligopeptides corresponding to amino acids 1-25 were purchased from Jerini AG (Berlin,

Germany). The sequences were MSNNGLDIQDKPPAPPMRNTSTMIG for PAK 1,

MSDNGELEDKPPAPVRMSSTISFST for PAK 2, and

MSDGLDNEEKPPAPPLRMNSNNRDS for PAK 3. (Letters in bold type indicate amino acids

that were missing from the PAK7-24 sequence previously used in studies with recombinant

proteins.) Aliquots containing 45 µg of each oligopeptide were combined with 100 µL of 10

mM phosphate buffer containing 150 mM NaCl (pH 6.0), and then mixed with Bioporter agent

(Gene Therapy Systems, San Diego, CA). This agent was a cationic lipid formulation composed

of a 2:1 mixture of cationic lipid, TFA-DODAPL, and a neutral lipid, DOPE [65]. The aliquots

were added to cells in 0.55 mL serum-free WIHC, according to the manufacturer’s instructions.

After 5 hours exposure of the cells to Bioporter complex, the medium was supplemented with

0.54 mL WIHC + 20% to restore the serum level to 10%. The cells were then treated with 1-

oleoyl-sn-glycero-3-phosphate (LPA) and phorbol 12-myristate 13-acetete (PMA) at final concentrations of 2 x 10-7 M and 1 x 10-9 M, respectively. Chemicals were purchased from

Sigma-Aldrich (St. Louis, MO). After 10 hours of treatment, cultures were collected by fixation in a solution of 3% glutaraldehyde in 0.1 M phosphate buffer (pH 7.3) in parallel with control cultures that had not been exposed to LPA and PMA.

Replicate cultures of cells were pre-treated with transcriptional knockdown of the PAK

isoforms to reduce the amount of PAK protein prior to the introduction of the N-terminal peptide. Specific siRNAs directed against PAK 1, PAK 2, and PAK 3 were obtained from

Santa-Cruz Biotechnology (Santa Cruz, CA) and mixed with Lipofectamine 2000 and OptiMEM according to the manufacturer’s instructions (Invitrogen, Carlsbad, CA). Cells were serum- starved in WIHC medium without FBS, and then aliquots of 65 pmol siRNA per 35 mm dish were added to the media and left for 8 hours. The media were then supplemented with WIHC containing 20% FBS and left overnight prior to treatment with peptide.

While the trial was repeated to fill in missing data, the second trial was not expected to have a different outcome than the first. The second trial included two types of controls. In procedural controls, cultures were treated to the same manipulation as the experimental samples but only carrier agents such as Lipofectamine and/or Bioporter were introduced (mock controls). The other control was a sham control, where an agent was introduced that was expected to have little effect. Sham controls employed 40 µg/dish Alexa Fluor 594 conjugate (Molecular Probes) during the Bioporter procedure. These samples are designated SHAM BIOPORTER. In another set of controls, sham transcriptional knockdown and peptide introduction procedures were done, using manufacturer-supplied FITC siRNA reagent (Santa Cruz) and manufacturer-supplied bovine serum albumin (Molecular Probes). These samples are designated SHAM BOTH in the tables. During the second trial, supplementation of the media with WIHC containing 20% FBS was inadvertently omitted. The inhibition of filopodia by PMA and LPA was greater in the second experiment than the first, according to a statistical comparison by ANOVA, but there was no difference in large protrusions. In addition to the larger spread of values in the filopodia index, the mean values were below those obtained in the first experiment. The difference

12 attributed to the repetition is indicated in a footnote to Table 6.

Scanning electron microscopy, contour tracing, and computerized morphometry

To prepare the cell cultures for viewing with a scanning electron microscope, samples were fixed in 2.5% glutaraldehye in 0.1 M phosphate buffer (pH 7.2), followed by exposure to OsO4.

The osmium tetroxide-thiocarbohydrazide-osmium tetroxide protocol was used to enhance conductivity of the cells. Samples were dehydrated through a graded series of ethanol solutions, dried in a Samadri-780A critical point drier, and coated with a 2-3 nm thickness of gold- palladium in a Polaron VI-A sputter coater [66]. Single cells were randomly selected, and micrographs were recorded on a video printer. Cell edges were then traced from the micrographs, scanned into an Apple Color OneScanner 600/27, running under One Scanner

Dispatcher, and saved in TIFF format. TIFF files were transferred to anonymous SGI-INDY server “elvis.bgsu.edu” for contour extraction and shape analysis. The software gave dimensioned values for cell area, perimeter, and length of the major axis, as well as the values of

33 dimensionless shape variables [67]. An example of the starting image is shown in Figure 5.

As explained in previous articles on the classification methods, factors were originally derived in a project designed to remove metric redundancy in classification procedures based on primary variables' values [19]. To ensure that the new variables would represent a wide variety of cell phenotypes, a database was created which included primary variable values from non-

Figure 5: Example of a 1000 W cell as observed by scanning electron microscopy.

The computerized shape analysis method provides indexes for #7 features, illustrated by

the two protrusions at bottom and lower left, and #4 features, illustrated at lower right.

tumorigenic and highly malignant cells as well as lines that progressively became tumorigenic over long-term cell culture. The final database contained values of 102 variables for 800 cells.

Principal components were extracted by a SAS procedure. By pattern rotation, 20 factors were obtained with variances that were rendered orthogonal. For experiments, factors for cell edge features, #4 and #7, were assigned values on the basis of primary shape variables as described elsewhere. The shape variable data from each experiment were autoscaled and the factor values were computed by C++ programs in a Sun 400 server [22].

Statistical Analysis

The number of cells sampled in each treatment group was 30-37 cells. For factor #4

(filopodia) and factor #7 (large protrusions) values, the differences between sample means were determined by using a procedure called analysis of variance to calculate the F-value for between-

14 group differences. Although the F-test between two sample means tells whether they are different or not, the likelihood of finding a significant differences rises with the number of such tests conducted. The data were subjected to the Tukey test to determine whether there were any differences. Few differences were detected by this test, however, because it underestimates the significance of differences. This problem was aggravated in the current experiment by the weak effect of tumor promoters, PMA and LPA, which ordinarily enhanced the factor #7 features [22] but had apparently lost efficacy upon storage. Thus, Duncan's multiple range test gave a more accurate estimate of the significance and was used to evaluate differences among the samples.

RESULTS

Effects of transcriptional knockdown and interference with PAK-Nck binding on filopodia formation

In the first experiment, treatments were performed to knock down the three transcripts of

PAK singly and together. Additional treatments were performed to interfere with PAK-Nck binding in an isoform-specific fashion. Again these additional treatments were performed for the

isoforms singly and together. The rationale for these treatments was that if a given isoform was

essential in order to form or maintain filopodia, then transcriptional knockdown of that isoform

would significantly reduce the prevalence of the feature. Knockdown of all isoforms would have

a lesser effect because less of each specific siRNA was used when the three siRNAs were

combined. Finally, an agent designed to prevent PAK-Nck binding would only set up interference with the residual amount of specific isoform activity in each case, and therefore, may or may not show a significant effect. The effect of the PAK N-terminal alone was controlled by introducing these peptides singly and in combination in separate samples in the same experiment.

The data suggest that certain predictions based upon my rationale were satisfied. First, interference with PAK 2 activity by an oversupply of N-terminal peptide was found to be associated with filopodia formation and distinguishable from the same interference of PAK 2 with PMA and LPA (P&L) and the same with transcriptional knockdown of PAK 2 without

P&L. The PAK 2 peptide sample is shown in purple and the other two samples are highlighted in blue and red, respectively (Table 6). Second, PAK 1 transcript knockdown by itself with or without the introduction of the PAK 1 1-25 sequence had no effect compared to control treatments. Moreover, this treatment was found to be indistinguishable from the same

16 knockdown treatment with P&L, suggesting that PAK 1 has no role in filopodia formation or maintenance. Third, all PAK 3 treatment samples were found to be indistinguishable from each other and not showing any effect on filopodia formation. Fourth, all PAK 1 + PAK 3 combined treatment types were found to be indistinguishable from each other, and not essential for filopodia formation. These treatments were done in the second trial, in order to compare the effect of knockdown of all PAK isoforms in the first, and so the data are not shown. In sum,

PAK 2 but neither PAK 1 nor PAK 3 isoform expression is essential to the formation or stability of filopodia in rat respiratory epithelial cells.

Effects of transcriptional knockdown and interference with PAK-Nck binding on large protrusion formation

In the first experiment, treatments were performed to knock down the three transcripts of

PAK singly and together. Additional treatments were performed to interfere with PAK isoforms binding Nck. The rationale for these treatments was like that given above for filopodia.

Table 6: Factor #4 values after PAK knockdown and PAK peptide interference*

Duncan group Mean Combination of agents A 0.432 PAK2 peptide A B 0.390 all PAK isoforms transcript knockdown, peptides + P&L A B 0.348 PAK2 transcript knockdown + peptide A B 0.282 PAK3 transcript knockdown + peptide A B 0.276 all PAK isoforms transcript knockdown + peptides A B 0.270 PAK1 peptide A B C 0.257 PAK1 transcript knockdown + peptide A B C 0.132 mock and sham-treated control-SHAM BIOPORTER† A B C 0.103 sham-transfection control-SHAM TRANSFECTION

A B C 0.0362 PAK1 peptide + P&L A B C 0.0096 untreated control-UNTREATED CONTROL A B C 0.0054 PAK 2 transcript knockdown, peptide + P&L† A B C -0.0306 siRNA sham-treated control-SHAM BOTH† A B C -0.0411 PAK3 peptide + P&L A B C -0.0465 PAK3 transcript knockdown, peptide + P&L A B C -0.0636 PAK3 peptide B C -0.0967 siRNA sham-treated control + P&L-SHAM BOTH† B C -0.101 PAK2 peptide + P&L B C -0.118 PAK1, PAK3 transcript knockdown + peptides† B C -0.151 PAK1, PAK3 transcript knockdown, peptides + P&L† B C -0.174 PAK2 transcript knockdown + peptide† C -0.195 mock and sham-treated control + P&L-SHAM BIOPORTER† C -0.271 PAK1 transcript knockdown, peptide + P&L

*means with the same letter are statistically indistinguishable at the level P = 0.05 †from second trial (see Materials and Methods). The means of control samples in the first and second trials differed by 0.150, so the second set of values were corrected by +0.150

The data shown in Table 7 suggests that certain predictions based upon my rationale were

satisfied. First, providing an oversupply of PAK 1 peptide in the presence of P&L was found to

be associated with large protrusion formation, and distinguishable from the same treatment with

PAK 1 transcript knockdown and from PAK 1 transcript knockdown + P&L, respectively.

These samples are indicated in blue on Table 7. Second, interference by oversupplying PAK 2

peptide in the presence of P&L was found to be associated with large protrusion formation and

distinguishable from the same interference with PAK 2 transcript knockdown in the presence of

P&L and from the same interference with PAK 2 transcript knockdown. These samples are highlighted in red. Third, all PAK 3 treatments were indistinguishable from each other and from

control. Fourth, all of the PAK 1-3 knockdown treatments were found indistinguishable from

each other but differed significantly from samples treated with PAK 1 peptide + P&L and PAK 2

peptide + P&L. These samples are highlighted in purple in the data of Table 7. As the data

showed that PAK 3 knockdown had no effect, the entire effect of the PAK 1-3 knockdown

treatment on large protrusions was attributed to PAK 1 and PAK 2 transcript reduction. Fifth,

PAK 1 + PAK 3 transcript knockdown treatments were found to be indistinguishable from each

other. One of these samples differed statistically from the same treatment with PAK 1 or PAK 3

peptides alone, however. This sample is indicated in blue on Table 7. The data indicate that two

PAK isoforms are associated with large protrusion formation. In sum, they show that knocking

down either PAK 1 or 2 prevents formation of large protrusions in rat respiratory epithelial cells.

Effects of Bioporter agent and the tumor promoters, PMA and LPA, on large protrusion

formation

Some unanticipated results of the above treatments were found in the course of analyzing the

experiments. First, the Bioporter agent itself caused a marginal stimulation of the factor #7

values. This effect can be noted in Table 8, where all of the PAK fragment introduction treatments are ranked at the top of the table. A second unexpected result was that the response of cells to the tumor promoters was not consistent with that previously observed (see Discussion).

There was a slight stimulation of factor #7 values which fell short of being statistically

significant in most cases. When the results from samples treated with PMA and LPA were

broken out into a separate table, however, it could clearly be seen that the knockdown of PAK1

Table 7: Factor #7 values after PAK knockdown and PAK peptide interference*

Duncan group Mean Combination of agents

A 0.905 PAK1 peptide + P&L A B 0.760 PAK2 peptide + P&L A B C 0.623 PAK3 peptide + P&L A B C 0.608 PAK3 peptide A B C 0.533 PAK1 peptide A B C 0.525 PAK3 transcript knockdown, peptide + P&L A B C D 0.303 PAK2 peptide B C D 0.0127 PAK3 transcript knockdown + peptide B C D -0.0141 mock and sham-treated control-SHAM BIOPORTER† B C D -0.0494 PAK2 transcript knockdown + peptide B C D -0.0752 PAK1 transcript knockdown, peptide + P&L C D -0.0846 mock and sham-treated control + P&L-SHAM BIOPORTER† C D -0.172 PAK1 transcript knockdown + peptide C D -0.223 siRNA sham-treated control-SHAM BOTH† C D -0.225 PAK1, PAK3 transcript knockdown, peptides + P&L† C D -0.252 PAK2 transcript knockdown, peptide + P&L C D -0.280 all PAK isoforms transcript knockdown + peptides D -0.355 sham-transfection control-SHAM TRANSFECTION D -0.417 untreated control-UNTREATED CONTROL D -0.438 siRNA sham-treated control + P&L-SHAM BOTH† D -0.451 all PAK isoforms transcript knockdown, peptides + P&L D -0.614 PAK1, PAK3 transcript knockdown + peptides† D -0.633 PAK2 transcript knockdown + peptide

*means with the same letter are indistinguishable at the level P = 0.05. †from second trial (see Materials and Methods)

Table 8: Selected factor 7 values after PAK knockdown and PAK peptide interference*

Duncan group Mean Combination of agents

A 0.905 PAK1 peptide + P&L A B 0.760 PAK2 peptide + P&L A B C 0.623 PAK3 peptide + P&L A B C 0.525 PAK3 transcript knockdown, peptide + P&L B C D -0.0752 PAK1 transcript knockdown, peptide + P&L C D -0.0846 mock and sham-treated control + P&L-SHAM BIOPORTER† C D -0.225 PAK1, PAK3 transcript knockdown, peptides + P&L† C D -0.252 PAK2 transcript knockdown, peptide + P&L D -0.355 sham-transfection control-SHAM TRANSFECTION D -0.417 untreated control-UNTREATED CONTROL D -0.438 siRNA sham-treated control + P&L-SHAM BOTH† D -0.451 all PAK isoforms transcript knockdown, peptides + P&L

*means with the same letter are indistinguishable at the level P = 0.05. †from second trial (see Materials and Methods)

DISCUSSION

Filopodia formation

As detailed in Table 6, only PAK 2 was found to be necessary for filopodia formation. The

transcriptional knockdown of PAK 2 with PAK 2 peptide but without P&L had an inhibitory

effect on the structures compared to the introduction of peptide alone. This is not entirely

surprising, as most cells appear to form filopodia and PAK 2 is found in a markedly wider range

of tissues or organs than PAK 1 or PAK 3, with PAK 3 being found in a very limited number of

bodily locations. The current finding that only one PAK isoform is necessary to form a specific

type of protrusion in a given cell type is also in agreement with a previous finding in a prostate

cancer cell line [68] and in an ovarian cancer cell line [69], respectively. The oversupply of

PAK 2 peptide may have had a small, stimulatory effect as well. Such a peptide would compete for a kinase phosphorylating PAK at phosphorylation sites S2 and/or S22.

Pertinent to filopodia formation is the observed effects of tumor promoters, PMA and LPA.

No effect on filopodia was anticipated, based on previous work [22]. Whereas multiple earlier

experiments showed activation of factor #7 features by the 10-hour time point, the difference

between treated and untreated samples at 10 hours was not statistically significant in the current

experiment. In these earlier experiments, tumor promoters caused a measurable decline in

filopodia that was reversed 10 hours after initiating the treatment. In the current experiment,

however, samples treated with PMA and LPA showed generally reduced factor #4 values

compared to untreated samples. The effect depressed the factor #4 values to zero or below and was comparable that of PAK 2 knockdown. If this effect were due to degradation of PAK 2, then the sample treated with the PMA and LPA would have resembled the sample with PAK 2 siRNA in the analysis of factor #7 values as well. As this was not observed, PMA and LPA were

unlikely to affect PAK 2 content. Instead, PMA and LPA may be acting as inhibitors of PAK 2

and thereby mimic the knockdown of PAK 2. Since PMA and LPA most likely activated protein

kinase C, one hypothetical substrate could be PAK 2 itself, as a protein kinase C has been found

at the tip of filopodia in Xenopus cells [70]. In future work, this could be explored by preventing

the phosphorylation and then determining whether this prevented filopodia from disappearing.

If the interpretation is correct, then PAK 2 may bind to Nck 1 and phosphorylation of PAK 2

may destabilize filopodia. Specifically, the previous observation that introduction of Nck-

binding domain of PAK 1, PAK7-24, had no effect upon filopodia formation suggested that PAK

1-Nck binding was not involved. When Nck1's SH3[2] domain was introduced, filopodia

formation was inhibited. If PAK 2 had a greater affinity for Nck1 than PAK 1, it could have

been titrated by the Nck1 SH3[2]. This would have been expected to show the same effect as

transcriptional knockdown of PAK 2. If the PAK 1 domain had a weaker affinity for Nck1 than

Nck2, it may be possible to explain the interference with filopodia formation by differential

recruitment of isoforms. This would fit with what was observed and rationalize the lack of

complementary interference by the PAK and Nck binding surfaces, only if Nck1 served to recruit

specifically PAK 2. There is additional experimental evidence implicating both Nck and PAK in

filopodia [3]. However, it is necessary to determine the respective binding affinities of PAK and

Nck isoforms in order to test this explanation.

Large protrusion formation

As detailed in Table 7, both PAK 1 and 2 were needed to produce large protrusions. It had been observed previously that introduction of the Nck binding portion of PAK 1, PAK7-24, decreased large protrusion formation. This implies that a Nck isoform or another protein that

23 binds this conserved proline-rich domain is necessary for forming large protrusions. Again, however, differential binding affinities of the PAK and Nck isoforms may account for what was observed. If this explanation were involved, the PAK isoform(s) involved must have an affinity for Nck that is not overcome by the Nck1 SH3[2]. Here, however, the activity of the PAK 2 isoform which is needed for large protrusion formation would blocked by the Nck1 SH3[2] domain. Only if the PAK7-24 is preventing Nck2 isoform from targeting a requisite PAK protein(s) to the focal contact might this explanation be tenable. Although the current results do not seem to support the differential binding affinities hypothesis, further work is needed to rule out the targeting of PAK 1 and PAK 2 to the membrane by different Nck isoforms.

REFERENCES

1. Manser, E, T Leung, H Salihuddin, Z Zhao and L Lim (1994) A brain serine/threonine

protein kinase activated by Cdc42 and Rac1, Nature 367: 40-46.

2. Buday, L, L Wunderlich and P Tamas (2002) The Nck family of adapter proteins:

regulators of actin cytoskeleton, Cell. Signal. 14: 723-731.

3. Heckman, CA, JG DeMuth, D Deters, SR Malwade, ML Cayer, C Monfries and A

Mamais (2009) Relationship of p21-activated kinase (PAK) and filopodia to persistence

and oncogenic transformation, J. Cell. Physiol. 220(3): 576-585.

4. Lauffenburger, DA and AF Horwitz (1996) Cell migration: a physically integrated

molecular process, Cell 359-369.

5. Ridley, AJ, MA Schwartz, K Burridge, RA Firtel, MH Ginsberg, G Borisy, JT Parsons and

AR Horwitz (2003) Cell migration: integrating signals from front to back, Science 302:

1704-1709.

6. Raftopoulou, M and A Hall (2004) Cell migration: Rho GTPases lead the way, Develop.

Biol. 265: 23-32.

7. Pollard, TD and GG Borisy (2003) Cellular motility driven by assembly and disassembly

of actin filaments, Cell 112: 453-465.

8. Sheetz, MP, D Felsenfeld, CG Galbraith and D Choquet (1999) Cell migration as a five-

step cycle, Biochem. Soc. Symp. 65: 233-243.

9. Pankov, R, Y Endo, S Even-Ram, M Araki, K Clark, E Cukierman, K Matsumoto and KM

Yamada (2005) A Rac switch regulates random versus directionally persistent cell

migration, J. Cell Biol. 170: 793-802.

10. Garrity, PA, Y Rao, I Salecker, J McGlade, T Pawson and SL Zipursky (1996) Drosophila

photoreceptor axon guidance and targeting requires the dreadlocks SH2/SH3 adapter

protein, Cell 85: 639-650.

11. Hing, H, J Xiao, N Harden, L Lim and SL Zipursky (1999) Pak functions downstream of

Dock to regulate photoreceptor axon guidance in Drosophila, Cell 97: 853-863.

12. Schoenwaelder, SM and K Burridge (1999) Bidirectional signaling between the

cytoskeleton and integrins, Curr. Op. Cell Biol. 11: 274-286.

13. Brown, MC and CE Turner (2004) Paxillin: adapting to change, Physiol. Rev. 84: 1315-

1339.

14. Zhang, ZM, JA Simmerman, CD Guibao and JJ Zheng (2008) GIT1 paxillin-binding

domain is a four-helix bundle, and It binds to both paxillin LD2 and LD4 motifs, J. Biol.

Chem. 283: 18685-18693.

15. Nayal, A, DJ Webb, CM Brown, EM Schaefer, M Vicente-Manzanares and AR Horwitz

(2006) Paxillin phosphorylation at Ser273 localizes a GIT1–PIX–PAK complex and

regulates adhesion and protrusion dynamics, J. Cell Biol. 173: 587-.

16. Manser, E, T-H Loo, C-G Koh, Z-S Zhao, X-Q Chen, L Tan, I Tan, T Leung and L Lim

(1998) PAK kinases are directly coupled to the PIX family of nucleotide exchange

factors, Mol. Cell 1: 183-192.

17. Zhao, Z-S, E Manser, T-H Loo and L Lim (2000) Coupling of PAK-interacting exchange

factor PIX to GIT1 promotes focal complex disassembly, Mol. Cell. Biol. 20: 6354-6363.

18. Mattila, PK and P Lappalainen (2008) Filopodia: molecular architecture and cellular

functions, Nature Rev. Mol. Cell Biol. 9: 446-454.

19. Heckman, CA and RJ Jamasbi (1999) Describing shape dynamics in transformed rat cells

through latent factors, Exp. Cell Res. 246: 69-82.

20. Steketee, MB and KW Tosney (2002) Three functionally distinct adhesions in filopodia:

Shaft adhesions control lamellar extension, J. Neurosci. 22: 8071-8083.

21. Steketee, M, K Balazovich and KW Tosney (2001) Filopodial initiation and a novel

filament-organizing center, the focal ring, Mol. Biol. Cell 12: 2378-2395.

22. Heckman, CA, JM Urban, M Cayer, Y Li, N Boudreau, J Barnes, HK Plummer, III, C

Hall, R Kozma and L Lim (2004) Novel p21-activated kinase-dependent protrusions

characteristically formed at the edge of transformed cells, Exp. Cell Res. 295: 432-447.

23. Szczepanowska, J (2009) Involvement of Rac/Cdc42/PAK pathway in cytoskeletal

rearrangements, Acta Biochim. Polon. 56: 225-234.

24. Hofmann, C, M Shepelev and J Chernoff (2004) The genetics of PAK, J. Cell Sci. 117:

4343-4354.

25. Mentzel, B and T Raabe (2005) Phylogenetic and structural analysis of the Drosophila

melanogaster p21-activated kinase DmPAK3, Gene 349: 25-33.

26. Bokoch, GM (2003) Biology of the p21-activated kinases, Ann. Rev. Biochem. 72: 743-

781.

27. Teo, M, E Manser and L Lim (1995) Identification and molecular cloning of a

p21cdc42/rac1-activated serine/threonine kinase that is rapidly activated by thrombrin in

platelets, J. Biol. Chem. 270: 26690-26697.

28. Galisteo, ML, J Chernoff, Y-C Su, EY Skolnik and J Schlessinger (1996) The adaptor

protein Nck links receptor tyrosine kinases with the serine-threonine kinase Pak1, J. Biol.

Chem. 271: 20997-21000.

29. Bokoch, GM, Y Wang, BP Bohl, MA Sells, LA Quilliam and UG Knaus (1996)

Interaction of the Nck adapter protein with p21-activated kinase (PAK1), J. Biol. Chem.

271: 25746-25749.

30. Puto, LA, K Pestonjamasp, CC King and GM Bokoch (2003) P21-activated kinase 1

(PAK1) interacts with the Grb2 adapter protein to couple to growth factor signaling, J.

Biol. Chem. 278: 9388-9393.

31. Sells, MA and J Chernoff (1997) Emerging from the Pak: the p21-activated protein kinase

family, Tr. Cell Biol. 7: 162-167.

32. Knaus, UG and GM Bokoch (1998) The p21Rac/Cdc42-activated kinases (PAKs), Int. J.

Biochem. Cell Biol. 30: 857-862.

33. Lei, M, W Lu, W Meng, M-C Parrini, MJ Eck, BJ Mayer and SC Harrison (2000)

Structure of PAK1 in an autoinhibited conformation reveals a multistage activation switch,

Cell 102: 387-397.

34. Leeuw, T, C Wu, JD Schrag, M Whiteway, DY Thomas and E Leberer (1998) Interaction

of a G-protein beta-subunit with a conserved sequence in Ste20/PAK family protein

kinases, Nature 39: 191-195.

35. Wang, J, JA Frost, MH Cobb and EM Ross (1999) Reciprocal signaling between

heterotrimeric G proteins and the p21-stimulated protein kinase, J. Biol. Chem. 274:

31641-31647.

36. Knaus, UG, Y Wang, AM Reilly, D Warnock and JH Jackson (1998) Structural

requirements for PAK activation by Rac GTPases, J. Biol. Chem. 273: 21512-21518.

37. Mira, JP, V Bernard, J Groffen, LC Sanders and UG Knaus (2000) Endogenous,

hyperactive Rac3 controls proliferation of breast cancer cells by a p21-activated kinase-

dependent pathway, PNAS USA 97: 185-189.

38. Aronheim, A, YC Broder, A Cohen, A Fritsch, B Belisle and A Abo (1998) Chp, a

homologue of the GTPase Cdc42Hs, activates the JNK pathway and is implicated in

reorganizing the actin cytoskeleton, Curr. Biol. 8: 1125-1128.

39. Neudauer, CL, G Joberty, N Tatsis and IG Macara (1998) Distinct cellular effects and

interactions of the Rho-family GTPase TC10, Curr. Biol. 8: 1151-1160.

40. Tao, W, D Pennica, L Xu, RF Kalejta and AJ Levine (2001) Wrch-1, a novel member of

the Rho gene family that is regulated by Wnt-1, Genes Develop. 15: 1796-1807.

41. Parrini, MC, M Lei, SC Harrison and BJ Mayer (2002) Pak1 kinase homodimers are

autoinhibited in trans and dissociated upon activation by Cdc42 and Rac1, Mol. Cell 9: 73-

83.

42. Thompson, G, D Owen, PA Chalk and PN Lowe (1998) Delineation of the Cdc42/Rac-

binding domain of p21-activated kinase, Biochemistry 37: 7885-7891.

43. Morreale, A, M Venkatesan, HR Mott, D Owen, D Nietlispach, PN Lowe and ED Laue

(2000) Structure of Cdc42 bound to the GTPase binding domain of PAK, Nature Struct.

Biol. 7: 384-388.

44. Gizachew, D, W Guo, KK Chohan, MJ Sutcliffe and RE Oswald (2000) Structure of the

complex of Cdc42Hs with a peptide derived from p21-activated kinase, Biochemistry 39:

3963-3971.

45. Hoffman, GR and RA Cerione (2000) Flipping the switch: the structural basis for

signaling through the CRIB motif, Cell 102: 403-406.

46. Benner, GE, PB Dennis and RA Masaracchia (1995) Activation of an S6/H4 kinase

(PAK 65) from human placenta by intramolecular and intermolecular

autophosphorylation, J. Biol. Chem. 270: 21121-21128.

47. Zhao, Z-S, E Manser, X-Q Chen, C Chong, T Leung and L Lim (1998) A conserved

negative regulatory region in αPAK: Inhibition of PAK kinases reveals their

morphological roles downstream of Cdc42 and Rac1, Mol. Cell. Biol. 18: 2153-2163.

48. Yu, JS, WJ Chen, MH Ni, WH Chan and SD Yang (1998) Identification of the

regulatory autophosphorylation site of autophosphorylation-dependent protein kinase

(auto-kinase). Evidence that auto-kinase belongs to a member of the p21-activated kinase

family, Biochem. J. 334: 121-131.

49. Gatti, A, Z Huang, PT Tuazon and JA Traugh (1999) Multisite autophosphorylation of

p21-activated protein kinase gamma-PAK as a function of activation, J. Biol. Chem. 274:

8022-8028.

50. Zenke, FT, CC King, lBP Boh and GM Bokoch (1999) Identification of a central

phosphorylation site in p21-activated kinase regulating autoinhibition and kinase activity,

J. Biol. Chem. 274: 32565-32573.

51. Tu, H and M Wigler (1999) Genetic evidence for Pak1 autoinhibition and its release by

Cdc42, Mol. Cell. Biol. 19: 602-611.

52. Chong, C, L Tan, L Lim and E Manser (2001) The mechanism of PAK activation -

autophosphorylation events in both regulatory and kinase domains control activity, J. Biol.

Chem. 276: 17347-17353.

53. Buchwald, G, E Hostinova, MG Rudolph, A Kraemer, A Sickmann, HE Meyer, K

Scheffzek and A Wittinghofer (2001) Conformational switch and role of phosphorylation

in PAK activation, Mol. Cell. Biol. 21: 5179-5189.

54. Rudel, T and GM Bokoch (1997) Membrane and morphological changes in apoptotic cells

regulated by caspase-mediated activation of PAK2, Science 276: 1571-1574.

55. Lee, N, H MacDonald, C Reinhard, R Halenbeck, A Roulston, T Shi and LT Williams

(1997) Activation of hPAK65 by caspase cleavage induces some of the morphological

and biochemical changes of apoptosis, PNAS USA 94: 13642-13647.

56. Lehmann, JM, G Riethmuller and JP Johnson (1990) Nck, a melanoma cDNA encoding a

cytoplasmic protein consisting of the src homology units SH2 and SH3, Nucl. Acids Res.

18: 1048.

57. Li, W, J Fan and DT Woodley (2001) Nck/Dock: an adapter between cell surface

receptors and the actin cytoskeleton, Oncogene 20: 6403-6417.

58. Lettau, M, J Pieper and O Janssen (2009) Nck adapter proteins: functional versatility in T

cells, Cell Commun. Signal. 7: 1.

59. Songyang, Z, SE Shoelson, M Chaudhuri, G Gish, T Pawson, WG Haser, F King, T

Roberts, S Ratnofsky, RJ Lechleider, BG Neel, RB Birge, JE Fajardo, MM Chou, H

Hanafusa, B Schaffhausen and LC Cantley (1993) SH2 domains recognize specific

phosphopeptide sequences, Cell 72: 767-778.

60. Songyang, Z, G Gish, G Mbamalu, T Pawson and LC Cantley (1995) A single point

mutation switches the specificity of group III Src homology (SH) 2 domains to that of

group I SH2 domains, J. Biol. Chem. 270: 26029-26032.

61. Zhao, Z-S, E Manser and L Lim (2000) Interaction between PAK and Nck: a template for

Nck targets and role of PAK autophosphorylation, Mol. Cell. Biol. 20: 3906-3917.

62. Heckman, CA (1985) Cell Shape and Growth Control, in Advances in Cell Culture

(Maramorosch, K, ed.), Vol. 4, pp. 85-156, Academic Press, N. Y.

63. Heckman, CA, AE Campbell and B Wetzel (1987) Characteristic shape and surface

changes in epithelial transformation, Exp. Cell Res. 169: 127-148.

64. Manser, E, H-Y Huang, T-H Loo, X-Q Chen, J-M Dong, T Leung and L Lim (1997)

Expression of constitutively active α-PAK reveals effects of the kinase on actin and focal

complexes, Mol. Cell. Biol. 17: 1129-1143.

65. Zelphati, O, Y Wang, S Kitada, JC Reed, PL Felgner and J Corbeil (2001) Intracellular

delivery of proteins with a new lipid-mediated delivery system, J. Biol. Chem. 276: 35103-

35110.

66. Heckman, C, S Kanagasundaram, M Cayer and J Paige (2007) Preparation of cultured

cells for scanning electron microscope, Nature Protocols Network 4 pp.

http://www.natureprotocols.com/2007/2011/2013/preparation_of_cultured_cells.php.

67. Olson, AC, NM Larson and CA Heckman (1980) Classification of cultured mammalian

cells by shape analysis and pattern recognition, PNAS USA 77: 1516-1520.

68. Bright, MD, AP Garner and AJ Ridley (2009) PAK1 and PAK2 have different roles in

HGF-induced morphological responses, Cell. Signal. 21: 1738-1747.

69. Coniglio, SJ, S Zavarella and MH Symons (2008) Pak1 and Pak2 mediate tumor cell

invasion through distinct signaling mechanisms, Mol. Cell. Biol. 28: 4162-4172.

70. Robles, E, S Woo and TM Gomez (2005) Src-dependent tyrosine phosphorylation at the

tips of growth cone filopodia promotes extension, J. Neurosci. 25: 7669-7681.

71. Dharmawardhane, S, LC Sanders, SS Martin and RH Daniels (1997) Localization of p21-

activated kinase 1 (PAK1) to pinocytic vesicles and cortical actin structures in stimulated

cells, J. Cell Biol. 138: 1-14.

72. Wang, D, J Sai, G Carter, A Sachpatzidis, E Lolis and A Richmond (2002) PAK1 kinase

is required for CXCL1-induced chemotaxis, Biochemistry 41: 7100- 7107.

73. Adam, L, Vadlamudi, R, Kondapaka, SB, Chernoff, J, Mendelsohn, J, Kumar, R., 1998.

Heregulin regulates cytoskeletal reorganization and cell migration through the p21-

activated kinase-1 via phosphatidylinositol-3 kinase. J Biol Chem. 273(43): 28238-28246.

74. Tsakiridis, T, C Taha, S Grinstein and A Klip (1996) Insulin activates a p21-activated

kinase in muscle cells via phosphatidylinositol 3-kinase, J. Biol. Chem. 271: 19664-19667.

75. Zhang, S, J Han, MA Sells, J Chernoff, UG Knaus, RJ Ulevitch and GM Bokoch (1995)

Rho family GTPases regulate p38 mitogen-activated protein kinase through the

downstream mediator Pak1, J. Biol. Chem. 270: 23934-23936.

76. Schurmann, A, AF Mooney, LC Sanders, MA Sells, HG Wang, JC Reed and GM Bokoch

(2000) p21-activated kinase 1 phosphorylates the death agonist bad and protects cells

from apoptosis, Mol. Cell. Biol. 20: 453-461.

77. Huang, R, JP Lian, D Robinson and JA Badwey (1998) Neutrophils stimulated with a

variety of chemoattractants exhibit rapid activation of p21-activated kinases (Paks):

separate signals are required for activation and inactivation of Paks, Mol. Cell. Biol. 18:

7130-7138.

78. Schmitz, U, T Ishida, M Ishida, J Surapisitichat, MI Hasham, S Pelech and BC Berk

(1998) Angiotensin II stimulates p21-activated kinase in vascular smooth muscle cells:

role in activation of JNK, Circ. Res. 82: 1272-1278.

79. Roig, J and JA Traugh (1999) p21-activating protein kinase gamma-PAK is activated

by ionizing radiation and other DNA-damaging agents. Similarities and differences to

alpha-PAK, J. Biol. Chem. 274: 31119-31122.

80. Price, LS, J Leng, MA Schwartz and GM Bokoch (1998) Activation of Rac and Cdc42 by

integrins mediates cell spreading, Mol. Biol. Cell 9: 1863-1871.

81. Suzuki-Inoue, K, Y Yatomi, N Asazuma, M Kainoh, T Tanaka, K Satoh and Y Ozaki

(2001) Rac, a small guanosine triphosphate-binding protein, and p21-activated kinase are

activated during platelet spreading on collagen-coated surfaces: roles of integrin

alpha(2)beta(1), Blood 98: 3708-3716.

82. Churin, Y, E Kardalinou, TF Meyer and M Naumann (2001) Pathogenicity island-

dependent activation of Rho GTPases Rac1 and Cdc42 in Heliobacter pylori infection,

Mol. Microbiol. 40: 815-823.

83. Chen, LM, S Bagrodia, RA Cerione and JE Galan (1999) Requirement of p21-activated

kinase (PAK) for Salmonella typhimurium-induced nuclear responses, J. Exp. Med. 189:

1479-1488.

84. Malcolm, KC, J-C Chambard, D Grall, J Pouyssegur and E Van Obberghen-Schilling

(2000) Independent activation of endogenous p21-activated protein kinase (PAK3) and

JNK by throbmin in CCL39 fibroblasts, J. Cell. Physiol. 185: 235-243.

85. Bagrodia, S, SJ Taylor, KA Jordon, L Van Aelst and RA Cerione (1998) A novel

regulator of p21-activated kinases, J. Biol. Chem. 273: 23633-23636.

86. Daniels, RH, FT Zenke and GM Bokoch (1999) αPix stimulates p21-activated kinase

activity through exchange factor-dependent and -independent mechanisms, J. Biol. Chem.

274: 6047-6050.

87. Feng, Q-Y, JG Albeck, RA Cerione and W-N Yang (2002) Regulation of the Cool/Pix

proteins: key binding partners of the Cdc42/Rac targets, the p21-activated kinases, J. Biol.

Chem. 277: 5644-5650.

88. Tang, Y, H Zhou, A Chen, RN Pittman and J Field (2000) The Akt proto-oncogene links

Ras to Pak and cell survival signals, J. Biol. Chem. 275: 9106-9109.

89. Banerjee, M, D Worth, DM Prowse and M Nikolic (2002) Pak1 phosphorylation on t212

affects microtubules in cells undergoing mitosis, Curr. Biol. 12: 1233-1239.

90. Thiel, DA, MK Reeder, A Pfaff, TR Coleman, MA Sells and J Chernoff (2002) Cell

cycle-regulated phosphorylation of p21-activated kinase 1, Curr. Biol. 12: 1227-1232.

91. Bagheri-Yarmand, R, M Mandal, AH Taludker, RA Wang, RK Vadlamudi, HJ Kung and

R Kumar (2001) Etk/Bmx tyrosine kinase activates Pak1 and regulates tumorigenicity of

breast cancer cells, J. Biol. Chem. 276: 29403-29409.

92. Renkema, GH, K Pulkkinen and K Saksela (2002) Cdc42/Rac1-mediated activation

primes PAK2 for superactivation by tyrosine phosphorylation, Mol. Cell. Biol. 22: 6719-

6725.

93. Lian, JP, L Crossley, Q Zhan, R Huang, P Coffer, A Toker, D Robinson and JA Badwey

(2001) Antagonists of calcium fluxes and calmodulin block activation of the p21-activated

protein kinases in neutrophils, J. Immunol. 166: 2643-2650.

94. Bokoch, GM, AM Reilly, RH Daniels, CC King, A Olivera, S Spiegel and UG Knaus

(1998) A GTPase-independent mechanism of p21-activated kinase activation: Regulation

by sphingosine and other biologically active lipids, J. Biol. Chem. 273: 8137-8144.

95. Feng, QY, D Baird, X Peng, JB Wang, T Ly, JL Guan and RA Cerione (2006) Cool-1

functions as an essential regulatory node for EGF receptor- and Src-mediated cell growth,

Nature Cell Biol. 8: 945-955.

96. Xia, C, W Ma, LJ Stafford, S Marcus, WC Xiong and M Liu (2001) Regulation of the

p21-activated kinase (PAK) by a human G beta-like WD-repeat protein, hPIP1, PNAS

USA 98: 6174-6179.

97. Kissil, JL, EW Wilker, KC Johnson, MS Eckman, MB Yaffe and T Jacks (2003) Merlin,

the product of the Nf2 tumor suppressor gene, is an inhibitor of the p21-activated kinase,

Pak1, Mol. Cell 12: 841-849.

98. Hirokawa, Y, A Tikoo, J Huynh, T Utermark, CO Hanemann, M Giovannini, H Xiao, JR

Testa, J Wood and H Maruta (2004) A clue to the therapy of neurofibromatosis type 2:

NF2/merlin is a PAK1 inhibitor, Cancer J. 10: 20-26.

99. Porchia, LM, M Guerra, YC Wang, Y Zhang, AV Espinosa, M Shinohara, SK Kulp, LS

Kirschner, M Saji, CS Chen and MD Ringel (2007) 2-amino-N-{4-[5-(2-phenanthrenyl)-

3-(trifluoromethyl)-1H-pyrazol-1-yl]-phenyl) acetamide (OSU-03012), a celecoxib

derivative, directly targets p21-activated kinase, Mol. Pharmacol. 72: 1124-1131.

100. Chen, S, X Yin, X Zhu, J Yan, S Ji, C Chen, M Cai, S Zhang, H Zong, Y Hu, Z Yan, Z

Shen and J Gu (2003) The c-terminal kinase domain of the p34 cdc2-related PITSLRE

protein kinase (p110c) associates with p21-activated kinase 1 and inhibits its activity

during anoikis, J. Biol. Chem. 278: 20029-20036.

101. Talukder, AH, Q Meng and R Kumar (2006) CRIPak, a novel endogenous Pak1 inhibitor,

Oncogene 25: 1311-1319.

102. Roig, J, PT Tuazon, PA Zipfel, AM Pendergast and JA Traugh (2000) Functional

interaction between c-Abl and the p21-activated protein kinase gamma-PAK, PNAS USA

97: 14346-14351.

103. Westphal, RS, RL Coffee, Jr, A Marotta, SL Pelech and BE Wadzinski (1999)

Identification of kinase-phosphatase signaling modules composed of p70 S6 kinase-protein

phosphatase 2A (PP2a) and p21-activatated kinase-PP2A, J. Biol. Chem. 274: 687-692.

104. Koh, CG, EJ Tan, E Manser and L Lim (2002) The p21-activated kinase PAK is

negatively regulated by POPX1 and POPX2, a pair of serine/threonine phosphatases of the

PP2C family, Current Biology 12: 317-321.

105. Alahari, SK, PJ Reddig and RL Juliano (2004) The integrin-binding protein Nischarin

regulates cell migration by inhibiting PAK, EMBO J. 23: 2777-2788.

106. Beacon, SW, A Beeser, JA Fukui, UE Rennefahrt, C Myers, J Chernoff and JR Peterson

(2008) An isoform-selective, small-molecule inhibitor targets the autoregulatory

mechanisms of p21-activated kinase, Chemical Biology 15: 322-331.

107. Park, D and SG Rhee (1992) Phosphorylation of Nck in response to a variety of receptors,

phorbol myristate acetate, and cyclic AMP, Mol. Cell. Biol. 12: 5815-5823.

108. Li, W, P Hu, EY Skolnik, A Ullrich and J Schlessinger (1992) The SH2 and SH3 domain-

containing Nck protein is oncogenic and a common target for phosphorylation by different

surface receptors, Mol. Cell. Biol. 12: 5824-5833.

109. Meisenhelder, J and T Hunter (1992) The SH2/SH3 domain-containing protein Nck is

recognized by certain anti-phosholipase C-gamma 1 monoclonal antibodies, and its

phosphorylation on tyrosine is stimulated by platelet-derived growth factor and epidermal

growth factor treatment, Mol. Cell. Biol. 12: 5843-5856.

110. Chou, MM, JE Fajardo and H Hanafusa (1992) The SH2- and SH3-containing Nck

protein transforms mammalian fibroblasts in the absence of elevated phosphotyrosine

levels, Mol. Cell. Biol. 12: 5834-5842.

111. Coutinho, S, T Jahn, M Lewitzky, S Feller, P Hutzler, C Peschel and J Duyster (2000)

Characterization of Grb4, an adapter protein interacting with Bcr-Abl, Blood 96: 618-624.

112. Noguchi, T, T Matozaki, K Inagaki, M Tsuda, K Fukunaga, Y Kitamura, T Kitamura, K

Shii, Y Yamanashi and M Kasuga (1999) Tyrosine phosphorylation of p62(DOK) induced

by cell adhesion and insulin: possible role in cell migration, EMBO J. 18: 1748-1760.

113. Lock, P, F Casagranda and AR Dunn (1999) Independent SH2-binding sites mediate

interaction of Dok-related protein with RasGTPase-activating protein and Nck, J. Biol.

Chem. 274: 22775-22784.

114. Stein, E, U Huynh-Do, AA Lane, DP Cerretti and TO Daniel (1998) Nck recruitment to

Eph receptor, EphB1/ELK, couples ligand activation to c-Jun kinase, J. Biol. Chem. 273:

1303-1308.

115. Ito, N, C Wernstedt, U Engstrom and L Claesson-Welsh (1998) Identification of vascular

endothelial growth factor receptor-1 tyrosine phosphorylation sites and binding of SH2

domain-containing molecules, J. Biol. Chem. 273: 23410-23418.

116. Igarashi, K, T Isohara, T Kato, K Shigeta, T Yamano and I Uno (1998) Tyrosine 1213 of

Flt-1 is a major binding site of Nck and SHP-2, Biochem. Biophys. Res. Commun. 246:

95-99.

117. Kroll, J and J Waltenberger (1997) The vascular endothelial growth factor receptor KDR

activates multiple signal transduction pathways in porcine aortic endothelial cells, J. Biol.

Chem. 272: 32521-32527.

118. Xu, P, AR Jacobs and SI Taylor (1999) Interaction of insulin receptor substrate 3 with

insulin receptor, insulin receptor-related receptor, insulin-like growth factor-1 receptor,

and downstream signaling proteins, J. Biol. Chem. 274: 15262-15270.

119. Kochhar, KS and AP Iyer (1996) Hepatocyte growth factor induces activation of Nck and

phospholipase C-gamma in lung carcinoma cells, Cancer Lett. 104: 163-169.

120. Bocciardi, R, B Mograbi, B Pasini, MG Borrello, MA Pierotti, I Bourget, S Fischer, G

Romeo and B Rossi (1997) The multiple endocrine neoplasia type 2B point mutation

switches the specificity of the Ret tyrosine kinase towards cellular substrates that are

susceptible to interact with Crk and Nck, Oncogene 15: 2257-2265.

121. Frischknecht, F, V Moreau, S Rottger, S Gonfloni, I Reckmann, G Superti-Furga and M

Way (1999) Actin-based motility of vaccinia virus mimics receptor tyrosine kinase

signalling, Nature 401: 926-929.

122. Teo, M, L Tan, L Lim and E Manser (2001) The tyrosine kinase ACK1 associates with

clathrin-coated vesicles through a binding motif shared by arrestin and other adaptors, J.

Biol. Chem. 276: 18392-18398.

123. Ren, R, ZS Ye and D Baltimore (1994) Abl protein-tyrosine kinase selects the Crk adapter

as a substrate using SH3-binding sites, Genes Devel. 8: 783-795.

124. Smith, JM, S Katz and BJ Mayer (1999) Activation of the Abl tyrosine kinase in vivo by

Src homology 3 domains from the Src homology 2/Src homology 3 adaptor Nck, J. Biol.

Chem. 274: 27956-27962.

125. Wunderlich, L, A Goher, A Farago, J Downward and L Buday (1999) Requirement of

multiple SH3 domains of Nck for ligand binding, Cell. Signal. 11: 253-262.

126. Rivero-Lezcano, OM, JH Sameshima, A Marcilla and KC Robbins (1994) Physical

association between Src homology 3 elements and the protein product of the c-cbl

protooncogene, J. Biol. Chem. 269: 17363-17366.

127. Lussier, G and L Larose (1997) A casein kinase I activity is constitutively associated with

Nck, J. Biol. Chem. 272: 2688-2694.

128. Minegishi, M, K Tachibana, T Sato, S Iwata, Y Nojima and C Morimoto (1996) Structure

and function of Cas-L, a 105-kD Crk-associated substrate-related protein that is involved

in beta 1 integrin-mediated signaling in lymphocytes, J. Exp. Med. 184: 1365-1375.

129. Tu, Y, DF Kucik and C Wu (2001) Identification and kinetic analysis of the interaction

between Nck-2 and DOCK180, FEBS Lett. 491: 193-199.

130. Oldenhof, J, R Vickery, M Anafi, J Oak, A Ray, O Schoots, T Pawson, M von Zastrow

and HH Van Tol (1998) SH3 binding domains in the dopamine D4 receptor, Biochemistry

37: 15726-15736.

131. Wunderlich, L, A Farago and L Buday (1999) Characterization of interactions of Nck

with Sos and dynamin, Cell. Signal. 11: 25-29.

132. Choudhurry, GG, F Marra and HE Abboud (1996) Thrombin stimulates association of src

homology domain containing adaptor protein Nck with pp125FAK, Am. J. Physiol. 270:

F295-300.

133. Yamamoto, A, T Suzuki and Y Sakaki (2001) Isolation of hNap1BP which interacts with

human Nap1 (NCKAP1) whose expression is down-regulated in Alzheimer’s disease,

Gene 271: 159-169.

134. Oehrl, W, C Kardinal, S Ruf, K Adermann, J Groffen, GS Feng, J Blenis, TH Tan and SM

Feller (1998) The germinal center kinase (GCK)-related protein kinases HPK1 and KHS

are candidates for highly selective signal transducers of Crk family adapter proteins,

Oncogene 17: 1893-1901.

135. Tu, Y, L Liang, SJ Frank and C Wu (2001) Src homology 3 domain-dependent interaction

of Nck-2 with insulin receptor substrate-1, Biochemical J. 354: 315-322.

136. Chou, MM and H Hanafusa (1995) A novel ligand for SH3 domains: the Nck adaptor

protein binds to a serine/threonine kinase via an SH3 domain, J. Biol. Chem. 270: 7359-

7364.

137. Kitamura, T, Y Kitamura, K Yonezawa, NF Totty, I Gout, K Hara, MD Waterfield, M

Sakaue, W Ogawa and M Kasuga (1996) Molecular cloning of p125Nap1, a protein that

associates with an SH3 domain of Nck, Biochem. Biophys. Res. Commun. 219: 509-514.

138. Matuoka, K, H Miki, K Takahashi and T Takenawa (1997) A novel ligand for an SH3

domain of the adaptor protein Nck bears an SH2 domain and nuclear signaling motifs,

Biochem. Biophys. Res. Commun. 239: 488-492.

139. Su, YC, J Han, S Xu, M Cobb and EY Skolnik (1997) NIK is a new Ste20-related kinase

that binds NCK and MEKK1 and activates the SAPK/JNK cascade via a conserved

regulatory domain, EMBO J. 16: 1279-1290.

140. Rohatgi, R, P Nollau, H-YH Ho, MW Kirschner and BJ Mayer (2001) Nck and

phosphatidylinositol 4,5-bisphosphate synergistically activate actin polymerization

through the N-WASP-Arp2/3 pathway, J. Biol. Chem. 276: 26448-26452.

141. Tu, Y, F Li and C Wu (1998) Nck-2, a novel Src homology2/3-containing adaptor protein

that interacts with the LIM-only protein PINCH and components of growth factor receptor

kinase-signaling pathways, Mol. Biol. Cell 9: 3367-3382.

142. Quilliam, LA, QT Lambert, LA Mickelson-Young, JK Westwick, AB Sparks, BK Kay,

NA Jenkins, DJ Gilbert, NG Copeland and CJ Der (1996) Isolation of a NCK-associated

kinase, PRK2, an SH3-binding protein and potential effector of Rho protein signaling,

J. Biol. Chem. 271: 28772-28776.

143. Sun, W, S Vincent, J Settleman and GL Johnson (2000) MEK kinase 2 binds and activates

protein kinase C-related kinase 2: bifurcation of kinase regulatory pathways at the level of

an MAPK kinase kinase, J. Biol. Chem. 275: 24421-24428.

144. Rebhun, JF, H Chen and LA Quilliam (2000) Identification and characterization of a new

family of guanine nucleotide exchange factors for the ras-related GTPase Ral, J. Biol.

Chem. 275: 13406-13410.

145. Wang, B, JX Zou, B Ek-Rylander and E Ruoslahti (2000) R-Ras contains a proline-rich

site that binds to SH3 domains and is required for integrin activation by R-Ras, J. Biol.

Chem. 275: 5222-5227.

146. Lawe, DC, C Hahn and AJ Wong (1997) The Nck SH2/SH3 adaptor protein is present in

the nucleus and associates with the nuclear protein SAM68, Oncogene 14: 223-231.

147. Lim, CS, ES Park, DJ Kim, YH Song, SH Eom, J-S Chun, JH Kim, J-K Kim, D Park and

WK Song (2001) SPIN90 (SH3 Protein Interacting with Nck, 90 kDa), an adaptor protein

that is developmentally regulated during cardiac myocyte differentiation, J. Biol. Chem.

276: 12871-12878.

148. Hu, Q, D Milfay and LT Williams (1995) Binding of NCK to SOS and activation of ras-

dependent gene expression, Mol. Cell. Biol. 15: 1169-1174.

149. Okada, S and JE Pessin (1996) Interactions between Src homology (SH) 2/SH3 adapter

proteins and the guanylnucleotide exchange factor SOS are differentially regulated by

insulin and epidermal growth factor, J. Biol. Chem. 271: 25533-25538.

150. Fu, CA, M Shen, BC Huang, J Lasaga, DG Payan and Y Luo (1999) TNIK, a novel

member of the germinal center kinase family that activates the c-Jun N-terminal kinase

pathway and regulates the cytoskeleton, J. Biol. Chem. 274: 30729-30737.

151. Ramos-Morales, F, BJ Druker and S Fischer (1994) Vav binds to several SH2/SH3

containing proteins in activated lymphocytes, Oncogene 9: 1917-1923.

152. Rivero-Lezcano, OM, A Marcilla, JH Sameshima and KC Robbins (1995) Wiskott-

Aldrich Syndrome protein physically associates with Nck through Src Homology 3

domains, Mol. Cell. Biol. 15: 5725-5731.

153. Anton, IM, W Lu, BJ Mayer, N Ramesh and RS Geha (1998) The Wiskott-Aldrich

syndrome protein interacting protein (WIP) binds to the adaptor protein Nck, J. Biol.

Chem. 273: 20992-20995.

154. Sudol, M (1994) Yes-associated protein (YAP65) is a proline-rich phosphoprotein that

binds to the SH3 domain of the Yes proto-oncogene product, Oncogene 9: 2145-2152.

APPENDIX

Table 1: Upstream effectors of Rac- or Cdc42-mediated PAK activation

N-formyl-methionyl-leucyl-phenylalanine (fMLP) [71]

CXCL-1 [72]

Heregulin [73]

Insulin [74]

Interleukin 1 [75], 3 [76], or 8 [77]

Angiotensin II [78]

Ionizing radiation [79]

Cytosine β-d-arabinofuranoside (AraC) [79]

cis-platinum (II) diammine dichloride (cisplatin) [79]

Integrin [80, 81]

Heliobacter pylori [82] or Salmonella typhimurium infection

[83]

Epidermal growth factor (EGF) [28]

Thrombin [84]

Table 2: Effectors of PAK activation not requiring GTPases Rac or Cdc42

Alpha PIX/COOL [85-87]

Protein kinase B (Akt) [88]

Cell division protein kinase 5 (Cdk5) [89]

Cell division cycle 2 (Cdc2) kinase [90]

Epithelial and endothelial kinase (Etk/Bmx) [91]

Src family tyrosine kinase [92]

Caspases [54, 55]

Calcium/calmodulin signalling pathway [93]

Sphingosines and some of their derived lipids, gangliosides, and phosphatidic acid

[94]

Protein substrates, e.g., histone 2B and histone [49]

Table 3: Effectors of PAK inactivation

Beta PIX [85, 95]

G beta gamma [35]

PAK 1 interacting proteins, e.g., huntingtin interacting protein (HIP1)

[96]

Merlin [97, 98]

OSU-03012 [99]

PITSLRE p34/cdc2-related protein kinases [100]

Cysteine-rich inhibitor of PAK 1 (CRIPak) [101]

V-abl Abelson murine leukemia viral oncogene homolog 1 (Abl) [102]

Partner of PIX 1 and 2 (POPX 1 and 2) [103, 104]

Nischarin [105]

2,2'-dihydroxy-1,1'-dinapthyldisulfide (IPA-3) [106]

Table 4: Binding partners of Nck's SH2 domain

Epidermal growth factor (EGF) [107-110]

Platelet derived growth factor (PDGF) [107-110]

Bcr/Abl oncogene fusion protein [111]

Downstream of tyrosine kinases 1 and 2 (DOK 1 and 2) [112, 113]

Ephrin type-B receptor 1 (EphB1) [114]

Fms-related tyrosin kinase 1 (Flt-1) [115, 116]

Kinase insert domain receptor (Flk-1) [117]

Insulin receptor substrate 3 (IRS-3) [118]

Mesenchymal-epthelial transition factor/hepatocyte growth factor (met/HGF) [119]

RET protooncogene (RET) [120]

Viral protein A36R [121]

Table 5: Binding partners of Nck's SH3 domains

Activated-by-Cdc42 kinase 1 (ACK 1) [122]

V-abl Abelson murine leukemia viral oncogene homolog 1 (Abl) [123, 124]

Bcr-Abl oncogene fusion protein [111, 125]

E3 ubiquitin protein ligase (Cbl-b) [125, 126]

Casein kinase I [127]

CRK-associated substrate-related protein (Cas-L) [128]

Dedicator of cytokinesis protein (DOCK 180) [129]

Dopamine D4 receptor [130]

Dynamin [131]

Focal adhesion kinase (FAK) [132]

Human Nap1 binding protein (hNap1BP) [133]

Heterogeneous nuclear ribonucleoprotein K (hnRNP-K) [133]

Hematopoietic precursor kinase 1 (HPK1) [134]

Insulin receptor substrate I (IRS-1) [135]

NF kappa B activating kinase (NAK) [136]

Nucleosome assembly protein 1 (Nap1) [137]

Nck associated protein 4 (Nap4) [138]

Nck interacting kinase (NIK) [139]

Neuronal Wiskott-Aldrich syndrome protein (N-WASP) [140]

Particularly interesting new Cys-His proteins (PINCH) [141]

Protein kinase C-related 2 (PRK2) [142, 143]

Proline-glutamic acid-serine-threonine rich protein tyrosine phosphatases (PTP-PEST)

[61]

Ral guanine nucleotide exchange factors (RalGPS 1aA, 1B, and 2) [144]

Related RAS viral oncogene homolog (R-RAS) [145]

Src associated in mitosis of 68 kilodaltons protein (SAM68) [146]

SH3 protein interacting with Nck protein of 90 kilodaltons proteins (SPIN90) [147]

Son of sevenless protein (Sos) [148, 149]

Synaptojanin [61]

TRAF2 and Nck-interacting protein kinase (TNIK) [150]

Protooncogene Vav [151]

Wiskott-Aldrich syndrome protein (WASP) [152]

Wiskott-Aldrich syndrome protein interacting protein (WIP) [153]

Yes associated protein 65 (YAP65) [154]