View metadata, citation and similar papers at core.ac.uk brought to you by CORE
provided by Elsevier - Publisher Connector
Virology 363 (2007) 387–396 www.elsevier.com/locate/yviro
A new DNA binding protein highly conserved in diverse crenarchaeal viruses
Eric T. Larson a,b, Brian J. Eilers a,b, Dirk Reiter a,c, Alice C. Ortmann a,d, ⁎ Mark J. Young a,d,e, C. Martin Lawrence a,b,
a Thermal Biology Institute, Montana State University, Bozeman, MT 59717, USA b Department of Chemistry and Biochemistry, Montana State University, Bozeman, MT 59717, USA c Physiologisch-Chemisches Institut der Universität Tübingen, Hoppe-Seyler-Strasse 4, D-72076 Tübingen, Germany d Department of Plant Sciences and Plant Pathology, Montana State University Bozeman, MT 59717, USA e Department of Microbiology, Montana State University Bozeman, MT 59717, USA Received 22 November 2006; returned to author for revision 26 December 2006; accepted 18 January 2007 Available online 2 March 2007
Abstract
Sulfolobus turreted icosahedral virus (STIV) infects Sulfolobus species found in the hot springs of Yellowstone National Park. Its 37 open reading frames (ORFs) generally lack sequence similarity to other genes. One exception, however, is ORF B116. While its function is unknown, orthologs are found in three additional crenarchaeal viral families. Due to the central importance of this protein family to crenarchaeal viruses, we have undertaken structural and biochemical studies of B116. The structure reveals a previously unobserved fold consisting of a five-stranded beta- sheet flanked on one side by three alpha helices. Two subunits come together to form a homodimer with a 10-stranded mixed beta-sheet, where the topology of the central strands resembles an unclosed beta-barrel. Highly conserved loops rise above the surface of the saddle-shaped protein and suggest an interaction with the major groove of DNA. The predicted B116–DNA interaction is confirmed by electrophoretic mobility shift assays. © 2007 Elsevier Inc. All rights reserved.
Keywords: Sulfolobus turreted icosahedral virus; STIV; Crenarchaea; Crenarchaeal virus; Hyperthermophilic virus; B116; DNA binding protein; Intracellular disulfide
Introduction hyperthermophilic viruses infecting crenarchaeal hosts (Ort- mann et al., 2006; Prangishvili and Garrett, 2005). We now Archaea, the third domain of life, encompass two major know that these viruses exhibit spectacular diversity with phyla, the Euryarchaeota, which includes methanogens and respect to both morphology and genomic sequence. This halophiles, and the Crenarchaeota, which includes many of the diversity is reflected in the subsequent recognition of seven hyperthermophiles. Like the bacterial and eukaryotic branches new viral families [Fuselloviridae (Martin et al., 1984; Palm in the tree of life, the Archaea are host to a multitude of viruses. et al., 1991; Schleper et al., 1992; Stedman et al., 2003; Wie- However, compared to viruses infecting the domains Eukarya denheft et al., 2004), Lipothrixviridae (Arnold et al., 2000a, and Bacteria, studies of viruses infecting the Archaea are still in 2000b; Bettstetter et al., 2003; Haring et al., 2005b; Jane- their infancy. Much remains to be discovered with respect to kovic et al., 1983; Neumann et al., 1989), Rudiviridae the viral life cycles, virus–host relationships, genetics and bio- (Prangishvili et al., 1999; Vestergaard et al., 2005), Globu- chemistry of these viruses. loviridae (Ahn et al., 2006; Haring et al., 2004), Guttaviridae The last few years, however, have seen a dramatic increase in (Arnold et al., 2000a), Ampullaviridae (Haring et al., 2005a) and the study of these viruses. This is particularly true of Bicaudaviridae (Haring et al., 2005c)], with two additional viruses awaiting classification (Rice et al., 2004; Xiang et al., 2005). ⁎ Corresponding author. Department of Chemistry and Biochemistry, Gaines Hall 108, Montana State University, Bozeman, MT 59717, USA. Fax: +1 406 Sulfolobus turreted icosahedral virus (STIV) was the first 994 5407. hyperthermophilic virus to be described with an icosahedral E-mail address: [email protected] (C.M. Lawrence). capsid. STIV infects Sulfolobus species resident in the acidic
0042-6822/$ - see front matter © 2007 Elsevier Inc. All rights reserved. doi:10.1016/j.virol.2007.01.027 388 E.T. Larson et al. / Virology 363 (2007) 387–396 hot springs (pH 2.9–3.9 and 72–92 °C) of Yellowstone National Table 2 a Park (Rice et al., 2004). It encapsidates a circular, dsDNA Model Refinement genome of 17,663 bp containing 37 open reading frames Parameter Value b (ORFs). Similar to other families of crenarchaeal viruses, its Rcryst (%) 20.99 b genomic landscape is quite barren. Most of the 37 hypothetical Rfree (%) 24.05 c proteins lack significant similarity to sequences in the NCBI Real space CC (%) 93 database (National Center for Biotechnology Information), thus Mean B value (overall; Å2) 28.3 Coordinate error (based on maximum likelihood, Å) 0.15 precluding functional assignments. RMSD from ideality: The hypothetical protein encoded by open reading frame Bonds (Å) 0.014 B116 is, however, somewhat unique in this regard. While it Angles (°) 1.35 d does not show sequence similarity to any genes of known Ramachandran Plot : function, it is common to the genomes of three additional Most favored (%) 96.3 Additional allowed (%) 3.7 hyperthermophilic Archaeal viral families, the Rudiviridae, the PDB accession code 2J85 Lipothrixviridae and the Bicaudaviridae. B116 and its viral a Refinement was carried out using Refmac5 (Murshudov, Vagin, and relatives thus constitute one of the most prominent clusters of Dodson, 1997). b orthologous proteins in the crenarachaeal viruses, one that spans Rcryst =Σ||Fo|−Fc||/ΣFo| where Fo and Fc are the observed and calculated four otherwise unrelated viral families (Prangishvili et al., 2006; structure factor amplitudes used in refinement. Rfree is calculated as Rcryst, but Rice et al., 2004). Due to the central importance of this protein using the “test” set of structure factor amplitudes that were withheld from family to the biology of these viruses, we have undertaken refinement (5.1%). c Correlation coefficient (CC) is agreement between the model and 2mF − biochemical and structural studies of STIV B116. Similar o DFc density map. studies of crenarchaeal viral proteins from STIV (Khayat et al., d Calculated using PROCHECK (Laskowski et al., 1993). 2005; Larson et al., 2006; Larson et al., submitted) and Sulfo- lobus spindle-shaped Virus 1 (Kraft et al., 2004a, 2004b) have single-wavelength anomalous diffraction (SAD) using seleno- made specific predictions regarding the functions and roles that methionyl-incorporated protein. Details on data collection and these proteins play in the viral life cycle. model refinement are presented in Tables 1 and 2, respectively.
Results Structure of B116
The B116 construct used in this study codes for the 116 The B116 polypeptide folds to form a five-stranded, amino acids of the native protein plus an additional C-terminal predominantly parallel β-sheet lined on one side by three α- His-tag, for a total of 122 residues with a calculated mass of helices (Fig. 1). The polypeptide traces through β-strand 1 (β1), 14,153 Da. The purified protein elutes from a Superdex 75 size β-strand 2 (β2), α-helix 1 (α1), β-strand 3 (β3), α-helix 2 (α 2), exclusion column as a single peak with an apparent molecular β-strand 4 (β4), α-helix 3 (α 3) and β-strand 5 (β5). This mass of 25–30 kDa, suggesting that it is present as a homodimer results in a β-sheet topology of 3, 1, 4, 5, 2, with strand β5 in solution. B116 crystallizes in space group P212121 with two running antiparallel to the remaining strands. Three of the copies of the protein, a potential homodimer, in the asymmetric connections between these secondary elements appear to be unit. The structure was determined at a resolution of 2.4 Å by structurally important. Extended traverses are required to connect β1toβ2, α2toβ4 and β4toα3. Interestingly, an Table 1 intramolecular disulfide bond, contributed by Cys33 and Cys62, a Data collection is also observed. This covalent link between the α1 and α2 Parameter Result b for data set: helices is likely to enhance the thermostability of the B116 fold Se-Peak (Beeby et al., 2005; Larson et al., submitted). Wavelength (Å) 0.97946 Two copies of the B116 polypeptide are found in the
Space group P212121 asymmetric unit, giving rise to the homodimer suggested by Cell constants (a,b,c; Å) α=β=γ=90° 48.6, 83.3, 89.5 size exclusion chromatography. An important component of Resolution range (Å) 30−2.4 (2.49−2.4) these subunit interactions are the β2 strands, which are found Unique reflections 14,911 (1,466) along the edge of each subunit (Fig. 1). These strands come Average redundancy 2.8 (2.8) c 5.1 (5.3) d together in an antiparallel fashion to unite the 5-stranded beta- I/σ 22 (5) sheet of each subunit into a larger 10-stranded β-sheet. Inte- Completeness (%) 99.9 (100) restingly, the topology of the six central strands (β4, β5 and Rsym e 0.07 (0.26) β2) of this 10-stranded mixed β-sheet resemble that of an a Data were integrated, scaled, and reduced using the HKL-2000 software unclosed antiparallel β-barrel (Fig. 1B). The remaining strands package (Otwinowski and Minor, 1997). and helices flank the unclosed barrel, giving rise to a saddle- b Numbers in parenthesis refer to the highest resolution shell. “ ” c shaped protein. A deep cleft, the seat of the saddle, spans Bijvoet pairs separate for scaling. β –α d Bijvoet pairs merged for scaling. the dimer interface, while the extended 4 3 loop rises e “ ” Rsym =100*ΣhΣi|Ii(h)−
Fig. 1. Structure of B116. (A) Stereo image of the B116 homodimer. One monomer is colored red and the second is in blue. The ribbon diagram depicts the secondary structural elements of B116, which are labeled in ascending order from N- to C-terminus. The polypeptide traces from the N-terminus through β1, β2, α1, β3, α2, β4, α3 and β5 of each subunit. The dimer displays a central 10-stranded β-sheet in which the central six strands adopt a topology resembling an unclosed antiparallel β-barrel. The missing staves result in formation of a deep cleft that spans the dimer interface, giving rise to a saddle-shaped homodimer. Note that Cys33 in helix α1 forms a disulfide bond (yellow) with Cys62 at the end of helix α2. (B) Relative to panel A, the homodimer has been rotated 90° about the depicted horizontal axis. The view is now looking into the deep cleft that spans the dimer interface, the “seat” of the saddle. Labels are as in panel A. 390 E.T. Larson et al. / Virology 363 (2007) 387–396
Fig. 2. Multiple sequence alignment of the B116 family. B116 from STIV was aligned with orthologs from other crenarchaeal viruses and the bacterial homologs using default settings in ClustalX (Thompson et al., 1997, 1994). A few manual adjustments were made around the gaps using the alignment of the viral proteins as a guide. Note the absence of gaps in the sequence of B116 itself. Strictly conserved residues are shaded in black with white lettering; strongly conserved residues are shaded in gray. The relative positions of the secondary structural elements in B116 are indicated above the alignment, where arrows represent β-strands and rounded rectangles represent α-helices. The numbering corresponds to that of B116. B116-like proteins show sequence conservation throughout their primary structure. Note the occurrence of the cysteine pair (bold type) among the viral orthologs from SIRV1, SIRV2 and AFV1, while the remaining sequences lack both cysteines. The Rudiviridae sequences include SIRV1 (NP_666617.1) (Peng et al., 2001), SIRV2 (CAC87312.1) (Peng et al., 2001) and ARV1 (CAI44168.1) (Vestergaard et al., 2005). Lipothrixviridae include AFV1 (YP_003762.1) (Bettstetter et al., 2003) and SIFV (NP_445691.1) (Arnold et al., 2000a, 2000b), while ATV is a member of the Bicaudaviridae (YP_319837.1) (Haring et al., 2005c). The creation of a new viral family for STIV is pending. Surprisingly, homologs are also found in three species of Bacteria; two from the family Clostridiaceae (A. metalliredigenes, ZP_00799325.1 and C. beijerincki, ZP_00907466.1, A. Copeland et al., unpublished), and one from the family Bacillaceae (yddF from B. subtilis, CAB12302.1) (Kunst et al., 1997). The presence of a B116-like protein in unrelated crenarchaeal viruses and select bacteria makes a strong case for horizontal gene transfer (Prangishvili et al., 2006).
(Bicaudaviridae). Interestingly, homologs are also found residues are mapped to the surface of B116, it becomes clear in three species of Bacteria; two from the family Clos- that they form a spatially contiguous surface along the top of the tridiaceae (Alkaliphilus metalliredigenes, accession number saddle. They run along the rim of the central cleft, extending ZP_00799325.1 and Clostridium beijerincki, accession number down along the walls of the cleft and upwards to the horn of the ZP_00907466.1; A. Copeland et al., unpublished) and one from saddle (Fig. 3). the family Bacillaceae (yddF from Bacillus subtilis, accession The calculated isoelectric point (pI) for native B116 is 4.7. number CAB12302.1) (Kunst et al., 1997). To our knowledge, With the exception of the B116-like proteins from ATV and characterization of these viral or bacterial proteins has not been ARV1, most of the other viral proteins show comparable pIs reported. (Fig. 2). Similarly, two of three bacterial proteins show acidic A multiple sequence alignment of these viral and bacterial pIs of approximately 5, while that from B. subtilis is quite basic. proteins is shown in Fig. 2. The alignment shows significant This suggests the presence of a significant amount of negative conservation along the entire linear sequence. However, only charge on most of these proteins. However, for B116, projection seven residues are strictly conserved. The regions of greatest of the calculated electrostatic field onto the protein surface conservation are in the β4–α3 loop and the β3–α2 loop. reveals a significant segregation of the positive and negative Strictly conserved residues are also found in the β1–β2 loop charge. and the α2–β4 loop. Thus, all seven of the strictly conserved For the surfaces surrounding the strictly conserved regions, a residues in the B116-like family are found in surface-exposed mixed pattern of positive and negative potential is observed, loops, and with the exception of the conserved glycine residue with the positive potential (blue) clustered around the rim and in the β3–α2 turn, they are unlikely to be of structural walls of the cleft (Fig. 3C). In contrast, a 180° rotation about the importance. Therefore, the strict conservation of Asn8, His51, horizontal axis reveals a surface with strong negative potential Asn69, Arg70,Arg89 and Glu92 is most likely related to the (red, Fig. 3D). This surface is distant from the conserved function of B116. Importantly, when these strictly conserved residues pictured in Fig. 3A and B. The more neutral and basic E.T. Larson et al. / Virology 363 (2007) 387–396 391
Fig. 3. Surface features in the family of B116-like proteins. (A) The surface of the B116 dimer is shown with strictly conserved residues colored according to residue type. Asn8 and Asn69 are in cyan; Gly50 is gray; His51,Arg70 and Arg89 are in blue; while Glu92 is in red. These strictly conserved residues form a patch of contiguous surface on each of the symmetry-related subunits. Arg89 and Glu92 are within the β4–α3 loop, which forms the horn of the saddle, His51 comes from the β3–α2 loop and Arg70 lies in the α2–β4 loop. The basic residues, colored in blue (His51, Arg70 and Arg89), lie along the lip and sides of the central cleft. (B) The strictly conserved surface features are shown from a different perspective. Relative to panel A, the dimer has been rotated by 90° about the depicted horizontal axis. (C) The electrostatic potential is mapped to the surface of B116 dimer, the perspective is identical to that in panel B. The color ramp on the surface is from −15 kT/e (red, acidic) to 15 kT/e (blue, basic). The surface exhibits a mix of positive and negative potential. The positive potential along the edge of the central cleft is due, in part, to the strictly conserved basic residues. Positive potential is also seen in the upper left and lower right corners of this panel (see Fig. 4). The electrostatic potentials at the surface were calculated with SPOCK (Christopher, 1998), using a probe radius of 1.4 Å, a temperature of 353 K, an ionic strength of 0.15 M, pH equal to 6.0, with protein and dielectric constants of 4 and 80, respectively. The image itself was prepared with PyMOL. (D) Relative to panel C, B116 has been rotated by 180° about the depicted horizontal axis to reveal a preponderance of negative charge on the nonconserved face. (For interpretation of the references to colour in this figure legend, the reader is referred to the web version of this article.) pIs of a few B116-like proteins suggest that the negative significant negative charge. The overall shape of the conserved potential on this surface of B116 is not conserved across the surface and the intervening cleft is also a consideration. This B116-like family of proteins. surface is relatively convoluted. In contrast, protein–protein interactions are more likely to utilize relatively flat surfaces. The DNA recognition spacing between symmetry-related residues in the highly conserved β4–α3 loop is also relevant. In fact, using standard While the B116 surface is quite convoluted, especially in the B-form DNA as a metric, one can see that the separation areas surrounding the conserved surface features, it is devoid of between the loops is roughly equivalent to the spacing of the any obvious pockets that might play a role in recognition of major groove along the DNA axis (Fig. 4A). In addition, the small molecules. Thus, it seems likely that B116 will interact side by side comparison also highlights the apparent comple- with a macromolecule. Given the inherent two-fold symmetry in mentarity between the conserved surface features of B116 and the B116 homodimer, interacting macromolecules should also double-stranded DNA. Thus, an interaction between B116 and possess (pseudo)two-fold symmetry, at least when bound to the double-stranded DNA can be envisioned in which the β3–α3 B116 homodimer. And while the overall pI of the protein is loops insert into adjacent tracks of the DNA major groove, acidic, the strictly conserved basic residues (His51, Arg70 and while the intervening ribose-phosphate backbone is accommo- Arg89) impart a significant positive potential along the lip and dated by the central cleft of B116 with its conserved basic sides of the central cleft. This suggests that the lip and walls of residues. Interestingly, the elevated B factors in regions of the the central cleft might interact with a macromolecule carrying protein that might interact with DNA suggest that they are 392 E.T. Larson et al. / Virology 363 (2007) 387–396
of a specific recognition sequence, most sequence specific DNA binding proteins also show non-specific interactions with DNA at elevated DNA or protein concentrations. Indeed, such non-specific interactions are clearly seen in EMSAs with B116 (Fig. 4B).
Discussion
Efforts are currently underway to identify a sequence specific interaction for B116. Until then, it is difficult to say whether the B116–DNA interaction might serve to regulate gene expression, or is indicative of a role in the modification, synthesis or packaging of nucleic acid, either alone, or in a larger protein– nucleic acid complex. If B116 does show a higher affinity site- specific interaction, the fold represents a unique motif for an operator-specific protein. Alternatively, while the overall folds differ, there are some similarities between B116 and the gene V protein from Ff filamentous phage (PDB IDs 1VQB, 2GVA, 1VHA, etc.), specifically with regard to the overall shape, the patches of basic surface charge and the relative location of the dimer interface (Folkers et al., 1994; Guan et al., 1994; Skinner et al., 1994). While the gene V protein preferentially recognizes single-stranded DNA, it will also bind non-specifically to double-stranded nucleic acids, though with lower affinity than to single-stranded DNA (Mou et al., 2003). These properties confer multiples activities on the gene V protein (Mou et al., 2003). It functions to control viral DNA replication by switching Fig. 4. B116–DNA interactions. (A) Spacing between the β4–α3 loops. The B116 homodimer is depicted in the same orientation as in Fig. 1A; however, the from the synthesis of a double-stranded DNA replicative form to protein is colored to reflect the relative main chain B-factors using a rainbow the synthesis of progeny single-stranded DNA. It also serves to colored gradient with blue indicating low B-factors and red indicating high B- prepackage the progeny single-stranded DNA into a complex factors. The side chains of the strictly conserved residues are also depicted. In that is an intracellular precursor to the virus. However, in addition, a 21-bp fragment of B-form DNA is positioned above B116 as a contrast to the Ff phage, STIV packages double-stranded DNA. metric. The spacing between the two symmetry-related β4–α3 loops is roughly equivalent to the major groove spacing of the DNA. Complementarity between Thus, B116 and the gene V protein are unlikely to serve identical the saddle-shaped surface of B116 and the DNA is apparent. This also extends to functions. Nevertheless, these similarities may indicate a non- complementarity with respect to charge (Fig. 3C). The conserved positive specific DNA interaction for B116. charge flanking the central cleft of B116 may accommodate the ribose- As noted earlier, B116 appears orthologous to proteins phosphate backbone flanking the minor groove in the center of the DNA encoded by six other crenarchaeal viruses, all with double- fragment. Note that the upper right and lower left corners of Fig. 3C also show areas of positive potential that might serve to recognize the ribose-phosphate stranded DNA genomes, representing three additional viral backbone present at the outer edges of the DNA. (B) Non-specific binding to families. Because the similarities between these families are double-stranded DNA. Increasing concentrations of purified B116 were added quite limited with respect to particle morphology and genome to a 45-bp double-stranded DNA fragment. Lane 1 contains a 100-bp DNA sequence, the extent of the conservation of this gene product is ladder. Lane 2 contains the 45-bp DNA fragment in the absence of B116. Lane 3 remarkable, especially when considering the greater mutation contains equimolar ratios of B116 and DNA. Lane 4 demonstrates non-specific binding to DNA when B116 is present in 5-fold excess. Visualization of the rates typically observed in viruses. However, there are some protein with Coomassie stain (not shown) shows comigration of the protein and similarities with respect to all of these viruses. They all inhabit the DNA in lane 4. In contrast, protein alone migrates quite slowly and is found acidic hyperthermophilic environments and infect hosts that near the top of the gel, just under the well. Similar band shifts are seen for oligos belong to the family Sulfolobaceae. The maintenance of the of poly-dA annealed to poly-dT. (For interpretation of the references to colour in observed sequence conservation in these diverse viruses this figure legend, the reader is referred to the web version of this article.) suggests an evolutionary pressure exerted by a feature common to their respective hosts. relatively mobile (Fig. 4A), a feature that is common in DNA To our knowledge, the intracellular pH of Sulfolobus has not binding proteins. been accurately determined. However, because Sulfolobus is an The overall surface features of the B116 homodimer are acidophilic organism, it is possible that the intracellular pH is thus quite suggestive of a protein–DNA interaction. In order to also significantly more acidic than in most organisms. This test this prediction, we looked for interactions between B116 might accentuate the positive potentials and diminish the and double-stranded DNA using an electrophoretic mobility negative potentials depicted in Fig. 3. shift assay (EMSA). While demonstration of a high affinity The intramolecular disulfide bond in B116 is also worthy of protein–DNA interaction requires isolation and/or knowledge comment. B116 is not among the nine proteins identified in the E.T. Larson et al. / Virology 363 (2007) 387–396 393
purified viral particle (Maaty et al., 2006); however, it is optical density at 600 nm (OD600) of 0.8 to 1.5, and protein detected by Western blot in STIV infected Sulfolobus solfatar- expression was then induced by addition of 1 mM isopropyl-β- icus (data not shown). This suggests that B116 is a non- D-thiogalactopyranoside (IPTG). After an additional 4 to 6 h of structural protein expressed in the cytoplasm of the host upon growth, cells were harvested by centrifugation (IEC PR- infection with STIV. Though disulfide bonds are generally rare 7000 M) at 6,000×g for 20 min and pellets were stored at in the intracellular proteins of most prokaryotes (Kadokura et al., −80 °C until needed. 2003), there is strong genomic evidence that suggests disulfide For purification, cell pellets were thawed and resuspended in bonds are commonly employed to stabilize the intracellular lysis buffer (10 mM Tris–HCl, pH 8.0, 400 mM NaCl) at 10 ml/g proteins of S. solfataricus (Beeby et al., 2005) and its associated of wet cell pellet mass. Phenylmethylsulfonyl fluoride (PMSF; viruses (Larson et al., submitted). Thus, the disulfide bond is 0.1 mM) was added to the cell suspension, and cells were lysed likely to enhance the thermostability of the B116 fold. by passage through a microfluidizer (Microfluidics Corporation, Despite the absence of a structural homolog with known Newton, MA) or a Power laboratory press (American Instrument function, a preliminary understanding of the function of B116- Co., Inc., Silver Spring, MD), depending on the volume of the like proteins has emerged. These results will guide future cell suspension. The cell lysate was incubated at 65 °C for biochemical and genetic studies of the B116-like family of 20 min to denature many of the contaminating E. coli proteins proteins and help to decipher their role in a process of central and clarified by centrifugation (Beckman; Avanti J-30I) at importance to the crenarchaeal viruses. As this occurs, the 22,000×g for 20 min. The resulting cleared lysate was applied to structure of B116 will continue to contribute to a more detailed a column containing a 3- to 5-ml bed volume of His-Select nickel understanding of the structure–function relationships inherent affinity gel (Sigma-Aldrich), washed with at least 10 column in this newly discovered protein fold. volumes of wash buffer (lysis buffer plus 5 mM imidazole) and eluted with elution buffer (10 mM Tris–HCl, pH 8.0, 50 mM Materials and methods NaCl, 200 mM imidazole). Fractions containing B116 were pooled and loaded onto a Superdex 75 gel filtration column Cloning (Amersham Biosciences) for further purification and buffer exchange into a minimal buffer (10 mM Tris–HCl, pH 8.0, The B116 open reading frame (ORF) was amplified by nested 50 mM NaCl) for crystallization. Peak fractions were pooled and PCR directly from viral particles purified as previously concentrated using a 10-kDa molecular mass cutoff (Amicon described (Rice et al., 2004). The PCR primers added attB ultracentrifugal filter devices; Millipore) to 6.5 mg/ml. Protein sites to facilitate ligase-free cloning using the Gateway system concentrations were determined by Bradford assay (Bradford, (Invitrogen), a Shine-Dalgarno sequence to facilitate efficient 1976) using “protein assay reagent” (Bio-Rad) and bovine serum translation and a C-terminal His-tag to facilitate protein albumin (BSA) as a standard. Protein yield was typically 8 to purification via nickel-affinity chromatography. The internal 12 mg/g of cell pellet. Molecular weight and purity were forward and reverse primers were 5′-TTCGAAGGAGATA- assessed by 12% sodium dodecyl sulfate–polyacrylamide gel GAACCATGGGTAAGGTATTCCTCA-3′ and 5′-GTGATG- electrophoresis (SDS–PAGE). GTGAT GG TGATG CCACACCTCATAAAATGAG-3′, For expression and purification of selenomethionine-incor- respectively, while the external forward and reverse primers porated B116, pEXP14-B116 was transformed into E. coli were 5′-GGGGACAAGTTTGTACAAA AAAGCAGGCTTC- strain B834(DE3)pLysS (Novagen), a methionine auxotroph. GAAGGAGATA GAACC-3′ and 5′-GGGGACCACTTTGTA- Methionine auxotrophy was confirmed for a single colony, CAAGAAAGCTGGGTCCTAGTGATGGTGATG GTGATG- which was then used to inoculate 5 ml of medium, prepared 3′, respectively. The sequence of the resulting entry clone was essentially as described previously (Thoma et al., 1999), but verified using ABI BigDye terminator cycle sequencing. The supplemented with 1 ng/ml biotin, 50 ng/ml L-(+)-seleno- His-tagged B116 construct was then inserted into destination methionine and 100 μg/ml ampicillin, followed by serial vector pDEST14 (Invitrogen), yielding the expression vector expansion to a 10-L batch culture (New Brunswick; BIOFLO pEXP14-B116, for protein expression in Escherichia coli. 2000) in the same medium. After growth to an OD600 of 0.6 to 0.8, protein expression was induced and the protein purified as Expression, purification and characterization of B116 described above for native protein. Selenium incorporation was monitored by matrix-assisted laser desorption ionization-time of Typically, pEXP14-B116 was transformed into E. coli strain flight (MALDI-TOF) mass spectrometry (MS) with a Bruker BL21-CodonPlus(DE3)-RIL (Stratagene), and a single colony Biflex III in the matrix-cyano-4-hydroxycinnamic acid and was used to inoculate 5 ml of LB medium and grown overnight, found to be essentially 100%. with subsequent serial expansion to a 10-L fermentor (New Brunswick; BIOFLO 2000) batch culture, all at 37 °C. Medium Crystallization of B116 and collection of x-ray diffraction data for batch fermentation was as recommended by the manufac- turer (R&D Laboratory-New Brunswick Scientific, 1996). All Purified B116 was crystallized by hanging drop vapor media contained 100 μg/ml ampicillin. Fermentor batch diffusion at 17 °C. Drops were assembled with 2 μlofB116 cultures were supplemented with filtered air at a flow rate of (6.5 mg/ml in 10 mM Tris–HCl, pH 8.0, 50 mM NaCl) mixed 10 L/min and stirred at 300 to 500 rpm. Cells were grown to an with 2 μl of well solution (0.1 M Tris–HCl [pH 8.0], 1.95 M 394 E.T. Larson et al. / Virology 363 (2007) 387–396
NH4H2PO4). Selenomethionine-incorporated B116 crystals CACTATAGACC CTGCTTCAACA GTGC-3′) were annealed were grown under identical conditions. Single rod-shaped or together by heating at 65 °C for 10 min in 10 mM Tris, pH 8.0, wedge-shaped crystals were isolated, and cryoprotectant was 1 mM EDTA, 10 mM MgCl2 and allowed to cool to room introduced with a quick soak (30 to 300 s) in well solution temperature. Annealed DNA (5 μg) was mixed with B116 in supplemented with 10% glycerol. Crystals were then flash molar ratios (DNA to protein) of 1:0, 1:1 and 1:5, and incubated frozen in liquid nitrogen. at 25 °C for 30 min in 14 mM histidine, 30 mM MES pH 5.5. Single-wavelength anomalous diffraction (SAD) was used to Final DNA concentration was 8.55 μM. Higher concentrations solve the structure. Data were collected to 2.4 Å resolution at of B116 (20-fold excess) result in aggregation and or the Se K-edge on beamline X9-B at the National Synchrotron precipitation of the B116–DNA complex. Samples were Light Source (NSLS) during the RapiData 2004 course at electrophoresed in 1.6% agarose gel containing ethidium Brookhaven National Labs (Table 1). Data were integrated, bromide for 50 min at 115 volts. Running buffer was 14 mM scaled and reduced in space group P212121 (Table 1) using the histidine and 30 mM MES at pH 5.5. DNA was visualized by HKL-2000 software package (Otwinowski and Minor, 1997). UV illumination.
Structure determination and model refinement Acknowledgments
SOLVE (Terwilliger and Berendzen, 1999) was used to We thank a reviewer for noting the similarity between B116 determine the positions of the selenium substructure and to and the gene V protein. This work was supported by grants from calculate initial phases. Eight out of 10 possible Se sites were the National Science Foundation (MCB-0236344; MCB- identified, corresponding to two B116 molecules per asym- 0132156) and the National Aeronautics and Space Administra- metric unit. The SOLVE output was then used in RESOLVE tion (NAG5-8807). We are indebted to the staff at the National (Terwilliger, 2000, 2002) for density modification and initial Synchrotron Light Source beamline X9B, in particular Zbyszek model building. The resulting electron density map was of good Dauter and Peter Zwart, for support during data collection at the quality, allowing the best parts of various models output by RapiData 2004 course. Portions of this research were carried out RESOLVE to be manually assembled into a composite model at the Stanford Synchrotron Radiation Laboratory, a national using O (Jones et al., 1991), followed by refinement with user facility operated by Stanford University on behalf of the U. REFMAC5 (Bailey, 1994; Murshudov et al., 1997). The S. Department of Energy, Office of Basic Energy Sciences. The refinement included the use of TLS (translation/libration/ SSRL Structural Molecular Biology Program is supported by screw) parameters in which each chain of the model was broken the Department of Energy, Office of Biological and Environ- into five TLS groups (1: A2–A40, 2: A41–A75, 3: A76–A86, mental Research and by the National Institutes of Health, 4: A87–A108, 5: A109–A119, 6: B2–B24, 7: B25–B46, 8: National Center for Research Resources, Biomedical Technol- B47–B84, 9: B85–B89, 10: B90–B118) with the assistance of ogy Program, and the National Institute of General Medical the TLS Motion Determination Home (http://skuld.bmsc. Sciences. The Macromolecular Diffraction Laboratory at washington.edu/~tlsmd/)(Painter and Merritt, 2006a, 2006b). Montana State University was supported, in part, by a grant Iterative rounds of model building and refinement with O and from the Murdock Foundation. REFMAC5 resulted in a final model with an Rcryst of 21.0% and an Rfree of 24.0% (Table 2). The final model has good stereochemistry, with all residues in allowed regions of the References Ramachandran plot (Laskowski et al., 1993)(Table 2). The Ahn, D.G., Kim, S.I., Rhee, J.K., Kim, K.P., Pan, J.G., Oh, J.W., 2006. TTSV1, protein quaternary structure server (http://pqs.ebi.ac.uk/) was a new virus-like particle isolated from the hyperthermophilic crenarchaeote used to calculate the surface area at the putative dimer interface. Thermoproteus tenax. Virology 351 (2), 280–290. Structural comparisons were performed using the DALI (http:// Altschul, S.F., Madden, T.L., Schäffer, A.A., Zhang, J., Zhang, Z., Miller, W., www.ebi.ac.uk/dali)(Holm and Sander, 1993) and VAST(http:// Lipman, D.J., 1997. Gapped BLAST and PSI-BLAST: a new generation of – www.ncbi.nlm.nih.gov/Structure/VAST/)(Gibrat et al., 1996) protein database search programs. Nucleic Acids Res. 25, 3389 3402. Arnold, H.P., Ziese, U., Zillig, W., 2000a. SNDV, a novel virus of the extremely servers. Structural figures were generated with PYMOL (http:// thermophilic and acidophilic archaeon Sulfolobus. Virology 272 (2), www.pymol.org)(DeLano, 2002). 409–416. Arnold, H.P., Zillig, W., Ziese, U., Holz, I., Crosby, M., Utterback, T., Atomic coordinates Weidmann, J.F., Kristjanson, J.K., Klenk, H.P., Nelson, K.E., Fraser, C.M., 2000b. A novel Lipothrixvirus, SIFV, of the extremely thermophilic crenarchaeon Sulfolobus. Virology 267 (2), 252–266. Atomic coordinates and structure factors for B116 are on Bailey, S., 1994. The CCP4 suite—Programs for protein crystallography. Acta deposit in the Protein Data Bank (www.pdb.org)under Cryst. D50, 760–763. accession code 2J85. Beeby, M., Connor, B.D., Ryttersgaard, C., Boutz, D.R., Perry, L.J., Yeates, T.O., 2005. The genomics of disulfide bonding and protein stabilization in – Electrophoretic mobility shift assays thermophiles. PLoS Biology 3 (9), 1549 1558. Bettstetter, M., Peng, X., Garrett, R.A., Prangishvili, D., 2003. AFV1, a novel virus infecting hyperthermophilic Archaea of the genus Acidianus. Virology For electrophoretic mobility shift assays, complementary 45 315 (1), 68–79. base oligonucleotides (5′-GAGCGCGCGTAATACGACT- Bradford, M.M., 1976. A rapid and sensitive method for the quantitation of E.T. Larson et al. / Virology 363 (2007) 387–396 395
microgram quantities of protein utilizing the principle of protein-dye G., Krogh, S., Kumano, M., Kurita, K., Lapidus, A., Lardinois, S., Lauber, binding. Anal. Biochem. 72, 248–254 (SPOCK: The Structural Properties J., Lazarevic, V., Lee, S.M., Levine, A., Liu, H., Masuda, S., Mauel, C., Observation and Calculation Kit. http://quorum.tamu.edu/. The PyMOL Medigue, C., Medina, N., Mellado, R.P., Mizuno, M., Moestl, D., Nakai, Molecular Graphics System. http://www.pymol.org.). S., Noback, M., Noone, D., O'Reilly, M., Ogawa, K., Ogiwara, A., Christopher, J.A., 1998. SPOCK: The Structural Properties Observation and Oudega, B., Park, S.H., Parro, V., Pohl, T.M., Portetelle, D., Porwollik, S., Calculation Kit. http://quorum.tamu.edu/. Prescott, A.M., Presecan, E., Pujic, P., Purnelle, B., Rapoport, G., Rey, M., DeLano, W.L., 2002. The PyMOL Molecular Graphics System on World Wide Reynolds, S., Rieger, M., Rivolta, C., Rocha, E., Roche, B., Rose, M., Web. http://www.pymol.org. Sadaie, Y., Sato, T., Scanlan, E., Schleich, S., Schroeter, R., Scoffone, F., Folkers, P.J., Nilges, M., Folmer, R.H., Konings, R.N., Hilbers, C.W., 1994. The Sekiguchi, J., Sekowska, A., Seror, S.J., Serror, P., Shin, B.S., Soldo, B., solution structure of the Tyr41→His mutant of the single-stranded DNA Sorokin, A., Tacconi, E., Takagi, T., Takahashi, H., Takemaru, K., binding protein encoded by gene V of the filamentous bacteriophage M13. Takeuchi, M., Tamakoshi, A., Tanaka, T., Terpstra, P., Tognoni, A., Tosato, J. Mol. Biol. 236 (1), 229–246. V., Uchiyama, S., Vandenbol, M., Vannier, F., Vassarotti, A., Viari, A., Gibrat, J.-F., Madej, T., Bryant, S.H., 1996. Surprising similarities in structure Wambutt, R., Wedler, E., Wedler, H., Weitzenegger, T., Winters, P., Wipat, comparison. Curr. Opin. Struct. Biol. 6 (3), 377–385. A., Yamamoto, H., Yamane, K., Yasumoto, K., Yata, K., Yoshida, K., Guan, Y., Zhang, H., Konings, R.N., Hilbers, C.W., Terwilliger, T.C., Wang, Yoshikawa, H.F., Zumstein, E., Yoshikawa, H., Danchin, A., 1997. The A.H., 1994. Crystal structures of Y41H and Y41F mutants of gene V complete genome sequence of the Gram-positive bacterium Bacillus protein from Ff phage suggest possible protein–protein interactions in the subtilis. Nature 390 (6657), 249–256. GVP–ssDNA complex. Biochemistry 33 (25), 7768–7778. Larson, E.T., Reiter, D., Young, M., Lawrence, C.M., 2006. Structure of A197 Haring, M., Peng, X., Brugger, K., Rachel, R., Stetter, K.O., Garrett, R.A., from Sulfolobus turreted icosahedral virus: a crenarchaeal viral glycosyl- Prangishvili, D., 2004. Morphology and genome organization of the virus transferase exhibiting the GT-A fold. J. Virol. 80 (15), 7636–7644. PSV of the hyperthermophilic Archaeal genera Pyrobaculum and Thermo- Larson, E.T., Reiter, D., Young, M.J., and Lawrence, C.M., submitted for proteus: a novel virus family, the Globuloviridae. Virology 323 (2), publication. A winged-helix protein from Sulfolobus turreted icosahedral 233–242. virus points toward stabilizing disulfide bonds in the intracellular proteins of Haring, M., Rachel, R., Peng, X., Garrett, R.A., Prangishvili, D., 2005a. Viral a hyperthermophilic virus. diversity in hot springs of Pozzuoli, Italy, and characterization of a unique Laskowski, R.A., MacArthur, M.W., Moss, D.S., Thornton, J.M., 1993. Archaeal virus, Acidianus bottle-shaped virus, from a new family, the PROCHECK: a program to check the stereochemical quality of protein Ampullaviridae. J. Virol. 79 (15), 9904–9911. structures. J. Appl. Cryst. 26, 283–291. Haring, M., Vestergaard, G., Brugger, K., Rachel, R., Garrett, R.A., Prangishvili, Maaty, W.S.A., Ortmann, A.C., Dlakic, M., Schulstad, K., Hilmer, J.K., Liepold, D., 2005b. Structure and genome organization of AFV2, a novel Archaeal L., Weidenheft, B., Khayat, R., Douglas, T., Young, M.J., Bothner, B., 2006. Lipothrixvirus with unusual terminal and core structures. J. Bacteriol. 187 Characterization of the Archaeal thermophile Sulfolobus turreted icosahedral (11), 3855–3858. virus validates an evolutionary link among double-stranded DNA viruses Haring, M., Vestergaard, G., Rachel, R., Chen, L., Garrett, R.A., Prangishvili, from all domains of life. J. Virol. 80 (15), 7625–7635. D., 2005c. Virology: independent virus development outside a host. Nature Martin, A., Yeats, S., Janekovic, D., Reiter, W.D., Aicher, W., Zillig, W., 1984. 436 (7054), 1101–1102. SAV 1, a temperate u.v.-inducible DNA virus-like particle from the Holm, L., Sander, C., 1993. Protein structure comparison by alignment of archaebacterium Sulfolobus acidocaldarius isolate B12. EMBO J. 3 (9), distance matrices. J. Mol. Biol. 233 (1), 123–138. 2165–2168. Janekovic, D., Wunderl, S., Holz, I., Zillig, W., Gierl, A., Neumann, H., 1983. Mou, T.C., Shen, M.C., Terwilliger, T.C., Gray, D.M., 2003. Binding and TTV1, TTV2 and TTV3, a family of viruses of the extremely thermophilic, reversible denaturation of double-stranded DNA by Ff gene 5 protein. anaerobic sulfur reducing archaebacterium Thermoproteus tenax. Mol. Gen. Biopolymers 70 (4), 637–648. Genet. 192, 39–45. Murshudov, G.N., Vagin, A.A., Dodson, E.J., 1997. Refinement of macro- Jones, T.A., Zou, J.Y., Cowan, S.W., Kjeldgaard, M., 1991. Improved methods molecular structures by the maximum-likelihood method. Acta Cryst. D53, for building protein models in electron density maps and the location of 240–255. errors in these models. Acta Crystallogr. A 47, 110–119. Neumann, H., Schwass, V., Eckerskorn, C., Zillig, W., 1989. Identification and Kadokura, H., Katzen, F., Beckwith, J., 2003. Protein disulfide bond formation characterization of the genes encoding three structural proteins of the in prokaryotes. Annu. Rev. Biochem. 72, 111–135. Thermoproteus tenax virus TTV1. Mol. Gen. Genet. 217 (1), 105–110. Khayat, R., Tang, L., Larson, E.T., Lawrence, C.M., Young, M., Johnson, J.E., Ortmann, A.C., Wiedenheft, B., Douglas, T., Young, M., 2006. Hot crenarchaeal 2005. Structure of an Archaeal virus capsid protein reveals a common viruses reveal deep evolutionary connections. Nat. Rev. Microbiol. 4 (7), ancestry to eukaryotic and bacterial viruses. PNAS 102 (52), 18944–18949. 520–528. Kraft, P., Kummel, D., Oeckinghaus, A., Gauss, G.H., Wiedenheft, B., Young, Otwinowski, Z., Minor, W., 1997. Processing of X-ray diffraction data collected M., Lawrence, C.M., 2004a. Structure of D-63 from Sulfolobus spindle- in oscillation mode. In: Carter, C., Sweet, R. (Eds.), Macromolecular Shaped Virus 1: surface properties of the dimeric four-helix bundle suggest Crystallography, Part A, vol. 276. Academic Press, pp. 307–326. an adaptor protein function. J. Virol. 78 (14), 7438–7442. Painter, J., Merritt, E.A., 2006a. Optimal description of a protein structure in Kraft, P., Oeckinghaus, A., Kummel, D., Gauss, G.H., Gilmore, J., Wiedenheft, terms of multiple groups undergoing TLS motion. Acta Crystallogr. Sect. D B., Young, M., Lawrence, C.M., 2004b. Crystal structure of F-93 from 62 (4), 439–450. Sulfolobus spindle-shaped virus 1, a winged-helix DNA binding protein. Painter, J., Merritt, E.A., 2006b. TLSMD Web server for the generation of multi- J. Virol. 78 (21), 11544–11550. group TLS models. J. Appl. Crystallogr. 39 (1), 109–111. Kunst, F., Ogasawara, N., Moszer, I., Albertini, A.M., Alloni, G., Azevedo, V., Palm, P., Schleper, C., Grampp, B., Yeats, S., McWilliam, P., Reiter, W.D., Bertero, M.G., Bessieres, P., Bolotin, A., Borchert, S., Borriss, R., Zillig, W., 1991. Complete nucleotide sequence of the virus SSV1 of the Boursier, L., Brans, A., Braun, M., Brignell, S.C., Bron, S., Brouillet, S., archaebacterium Sulfolobus shibatae. Virology 185 (1), 242–250. Bruschi, C.V., Caldwell, B., Capuano, V., Carter, N.M., Choi, S.K., Peng, X., Blum, H., She, Q., Mallok, S., Brugger, K., Garrett, R.A., Zillig, W., Codani, J.J., Connerton, I.F., Cummings, N.J., Daniel, R.A., Denizot, F., Prangishvili, D., 2001. Sequences and replication of genomes of the Devine, K.M., Dusterhoft, A., Ehrlich, S.D., Emmerson, P.T., Entian, K.D., Archaeal Rudiviruses SIRV1 and SIRV2: relationships to the Archaeal Errington, J., Fabret, C., Ferrari, E., Foulger, D., Fritz, C., Fujita, M., Lipothrixvirus SIFV and some eukaryal viruses. Virology 291 (2), Fujita, Y., Fuma, S., Galizzi, A., Galleron, N., Ghim, S.Y., Glaser, P., 226–234. Goffeau, A., Golightly, E.J., Grandi, G., Guiseppi, G., Guy, B.J., Haga, K., Prangishvili, D., Garrett, R.A., 2005. Viruses of hyperthermophilic crenarchaea. Haiech, J., Harwood, C.R., Henaut, A., Hilbert, H., Holsappel, S., Hosono, Trends Microbiol. 13 (11), 535–542. S., Hullo, M.F., Itaya, M., Jones, L., Joris, B., Karamata, D., Kasahara, Y., Prangishvili, D., Arnold, H.P., Gotz, D., Ziese, U., Holz, I., Kristjansson, J.K., Klaerr-Blanchard, M., Klein, C., Kobayashi, Y., Koetter, P., Koningstein, Zillig, W., 1999. A novel virus family, the Rudiviridae: structure, virus–host 396 E.T. Larson et al. / Virology 363 (2007) 387–396
interactions and genome variability of the Sulfolobus viruses SIRV1 and Terwilliger, T.C., 2002. Automated main-chain model-building by SIRV2. Genetics 152 (4), 1387–1396. template-matching and iterative fragment extension. Acta Cryst. D 59, Prangishvili, D., Garrett, R.A., Koonin, E.V., 2006. Evolutionary genomics of 34–44. Archaeal viruses: unique viral genomes in the third domain of life. Virus Terwilliger, T.C., Berendzen, J., 1999. Automated MAD and MIR structure Res. 117 (1), 52–67. solution. Acta Crystallogr. D 55, 849–861. R&D Laboratory—New Brunswick Scientific (1996). Fundamentals of Thoma, R., Obmolova, G., Lang, D.A., Schwander, M., Jenö, P., Sterner, R., Fermentation: Techniques For Benchtop Fermentors Part I—E. coli, Edison, Wilmanns, M., 1999. Efficient expression, purification and crystallisation of NJ. two hyperthermostable enzymes of histidine biosynthesis. FEBS Lett. 454 Rice, G., Tang, L., Stedman, K., Roberto, F., Spuhler, J., Gillitzer, E., Johnson, (1–2), 1–6. J.E., Douglas, T., Young, M., 2004. The structure of a thermophilic Archaeal Thompson, J.D., Higgins, D.G., Gibson, T.J., 1994. CLUSTAL W: improving virus shows a double-stranded DNA viral capsid type that spans all domains the sensitivity of progressive multiple sequence alignment through sequence of life. PNAS 101 (20), 7716–7720. weighting, positions-specific gap penalties and weight matrix choice. Nucl. Schleper, C., Kubo, K., Zillig, W., 1992. The particle SSV1 from the extremely Acids Res. 22, 4673–4680. thermophilic archaeon Sulfolobus is a virus: demonstration of infectivity and Thompson, J.D., Gibson, T.J., Plewniak, F., Jeanmougin, F., Higgins, D.G., of transfection with viral DNA. Proc. Natl. Acad. Sci. U.S.A. 89 (16), 1997. The ClustalX windows interface: flexible strategies for multiple 7645–7649. sequence alignment aided by quality analysis tools. Nucleic Acids Res. 24, Skinner, M.M., Zhang, H., Leschnitzer, D.H., Guan, Y., Bellamy, H., Sweet, 4876–4882. R.M., Gray, C.W., Konings, R.N., Wang, A.H., Terwilliger, T.C., 1994. Vestergaard, G., Haring, M., Peng, X., Rachel, R., Garrett, R.A., Prangishvili, Structure of the gene V protein of bacteriophage f1 determined by D., 2005. A novel rudivirus, ARV1, of the hyperthermophilic Archaeal multiwavelength X-ray diffraction on the selenomethionyl protein. Proc. genus Acidianus. Virology 336 (1), 83–92. Natl. Acad. Sci. U.S.A. 91 (6), 2071–2075. Wiedenheft, B., Stedman, K., Roberto, F., Willits, D., Gleske, A.K., Zoeller, L., Stedman, K.M., She, Q., Phan, H., Arnold, H.P., Holz, I., Garrett, R.A., Zillig, Snyder, J., Douglas, T., Young, M., 2004. Comparative genomic analysis of W., 2003. Relationships between fuselloviruses infecting the extremely hyperthermophilic Archaeal Fuselloviridae viruses. J. Virol. 78 (4), thermophilic archaeon Sulfolobus: SSV1 and SSV2. Res. Microbiol. 154 1954–1961. (4), 295–302. Xiang, X., Chen, L., Huang, X., Luo, Y., She, Q., Huang, L., 2005. Sulfolobus Terwilliger, T.C., 2000. Maximum likelihood density modification. Acta Cryst. tengchongensis spindle-Shaped Virus STSV1: virus–host interactions and D 56, 965–972. genomic features. J. Virol. 79 (14), 8677–8686.